Conflicting relationships of Vipera walser inferred from nuclear genes sequences and mitochondrial DNA

Abstract

The description of Vipera walser from the Northern Italian Alps as a new species (Ghielmi et al., 2016, Journal of Zoological Systematics and Evolutionary Research, 54, 161) was one of the most unexpected surprises of European herpetology in the 21st century. In mitochondrial (mt) DNA, it is closely related to a group of vipers only present in the Caucasus region and Northeastern Anatolia. However, its morphology is similar to the V. berus populations that inhabit nearby mountains in the Swiss-Italian Alps, which raises questions on its relationships and status. We thus sequenced five nuclear (nu) genes to determine the position of V. walser relative to V. berus and to the Caucasian/Northeastern Anatolian vipers in nuDNA. We also reanalyzed five previously sequenced mtDNA fragments. NuDNA markers recovered V. walser as closely related to Italian populations of V. berus and not to the Caucasian/Anatolian species, thus contradicting the mtDNA phylogeny. We checked that each of the five mtDNA fragments independently amplified by Ghielmi et al. (2016, Journal of Zoological Systematics and Evolutionary Research, 54, 161) produced individual gene trees compatible with the concatenated mtDNA phylogeny, thus excluding the hypothesis that NUMTs sequencing generated the mtDNA relationships reported by Ghielmi et al. (2016, Journal of Zoological Systematics and Evolutionary Research, 54, 161). Given the low level of nuclear differentiation between V. walser and the Italian population of V. berus, we argue that ancient admixture between V. berus and the ancestral population of V. walser is the most likely explanation for this case of cyto-nuclear discordance and we discuss the consequences of these results on the systematic status of V. walser.

Full text

J Zool Syst Evol Res. 2021;00:1–14. wileyonlinelibrary.com/journal/jzs
|
1© 2021 Wiley- VCH GmbH.
Received: 14 June 2021
|
Revised: 9 September 2021
|
Accepted: 15 September 2021
DOI: 10.1111/jzs.12543
ORIGINAL ARTICLE
Conflicting relationships of Vipera walser inferred from nuclear
genes sequences and mitochondrial DNA
Paul Doniol- Valcroze1 | Sylvain Ursenbacher2,3 | Konrad Mebert4 | Samuele Ghielmi5 |
Lorenzo Laddaga6 | Patricia Sourrouille1 | Mert Kariş7 | Pierre- André Crochet1
Contri buting autho rs: Sylvain Urs enbacher (s.ursenb acher@uniba s.ch), Konrad Me bert (konrad mebert@gm ail.com), Samue le Ghielmi (sam.ghie lmi@gmail.co m), Lorenzo Lad daga (l.
laddag a@libero.it ), Patricia Sou rrouille (pat ricia.sourrouill e@cefe.cnrs .fr), Mert Kari ş (mert.kar is@hotmail.f r), Pierre- A ndré Crochet (p ierre-andre. crochet@cefe .cnrs.fr)
1CEFE, CNRS, Univ Montpellier, EPHE,
IRD, Montpellier, France
2Department of Environmental Sciences,
Section of Conservation Biology,
University of Basel, Basel, Switzerland
3Info fauna - karch, University of
Neuchâtel, Neuchâtel, Switzerland
4IDECC, Institute of Development,
Ecology, Conservation and Cooperation,
Rome, Italy
5Tropical Biodiversity Section, MUSE -
Museo delle Scienze, Trento, Italy
6Società di Scienze Naturali del Verbano
Cusio Ossola, Museo di Scienze Naturali,
Collegio Mellerio Rosmini, Domodossola,
Italy
7Program of Laboratory Technology,
Department of Chemistry and Chemical
Process Technologies, Acıgöl Vocational
School of Technical Sciences, Nevşehir
Hacı Bek taş Veli University, Nevşehir,
Tur ke y
Correspondence
Paul Doniol- Valcroze, CEFE, CNRS, Univ
Montpellier, EPHE, IRD, Montpellier,
France.
Email: pauldoniol-valcroze@orange.fr
Funding information
Scientific and Technical Research Council
of Turkey (TÜBİTA K), Grant/Award
Number: 111T338 and 114Z946; The
Mohamed bin Zayed Species Conservation
Fund, Grant/Award Number: 13057971
and 150510677; Wilhelm Peters Fund
2013 of the German Herpetological
Society DGHT (Deutsche Gesellschaft für
Herpetologie und Terrarienkunde); annual
funds of the DGHT Zürich, Switzerland
Abstract
The description of Vipera walser from the Northern Italian Alps as a new species
(Ghielmi et al., 2016, Journal of Zoological Systematics and Evolutionary Research, 54,
161) was one of the most unexpected surprises of European herpetology in the 21st
century. In mitochondrial (mt) DNA, it is closely related to a group of vipers only pre-
sent in the Caucasus region and Northeastern Anatolia. However, its morphology is
similar to the V. berus populations that inhabit nearby mountains in the Swiss- Italian
Alps, which raises questions on its relationships and status. We thus sequenced five
nuclear (nu) genes to determine the position of V. walser relative to V. berus and to the
Caucasian/Northeastern Anatolian vipers in nuDNA. We also reanalyzed five previ-
ously sequenced mtDNA fragments. NuDNA markers recovered V. walser as closely
related to Italian populations of V. berus and not to the Caucasian/Anatolian species,
thus contradicting the mtDNA phylogeny. We checked that each of the five mtDNA
fragments independently amplified by Ghielmi et al. (2016, Journal of Zoological
Systematics and Evolutionary Research, 54, 161) produced individual gene trees com-
patible with the concatenated mtDNA phylogeny, thus excluding the hypothesis that
NUMTs sequencing generated the mtDNA relationships reported by Ghielmi et al.
(2016, Journal of Zoological Systematics and Evolutionary Research, 54, 161). Given the
low level of nuclear differentiation between V. walser and the Italian population of V.
berus, we argue that ancient admixture between V. berus and the ancestral population
of V. walser is the most likely explanation for this case of cyto- nuclear discordance and
we discuss the consequences of these results on the systematic status of V. walser.
KEYWORDS
cyto- nuclear conflicts, reptiles, snakes, systematics, vipers
Résumé
La description de Vipera walser comme une nouvelle espèce des Alpes italiennes du
Nord (Ghielmi et al., 2016, Journal of Zoological Systematics and Evolutionary Research,
54, 161) a été l'une des surprises les plus inattendues de l'herpétologie européenne au
21e siècle. Son ADN mitochondrial est étroitement apparenté à celui d’un groupe de
vipères uniquement présent autour du Caucase et de l'Anatolie orientale. Cependant,

2
|
D ONIOL- VALCROZE Et AL.
1 | INTRODUC TION
The description of a new species of viper from the Italian Alps, Vipera
walser Ghielmi et al., 2016, was one of the most unexpected discov-
eries of European herpetology in the 21st century. This small and
isolated population is only known from several valleys of the north-
wes te rn Italian Alps about 60 km wes t from the closest kn own vipe r
populations of the Adder Vipera berus. Vipera walser is morpholog-
ically close to the neighboring populations of Vipera berus, which
belong to a distinct lineage (the Italian clade in Ursenbacher et al.,
2006) for which the name Vipera berus marasso applies (Schmidtler
& Hansbauer, 2020). All the morphological characters investigated
overlap with Vipera berus marasso, even if a higher fragmentation
of cephalic scales results in significant differences between these
two groups in several characters, allowing correct classification of
94% and 88% of females and males, respectively, by a discriminant
analysis based on six meristic variables (Ghielmi et al., 2016). Cranial
osteology suggests one diagnostic feature as well (Seghetti et al.,
2021), but this will need to be confirmed on larger sample sizes as
four specimens of V. walser and five V. berus were examined, three
of which only were from the Italian subspecies. The main argument
to describe this population as a new species was its highly divergent
mtDNA, which is not even sister to the mtDNA of Vipera berus but
groups within a distinct clade of Vipera including the Meadow vi-
pers group (V. ursinii, V. graeca, V. eriwanensis) and the Caucasian and
Anatolian species V. kaznakovi, V. anatolica, V. darevskii, and V. dinniki
(Ghielmi et al., 2016). Two nuclear markers were sequenced as
well by Ghielmi et al. (2016) for a single specimen of four Western
European species of Vipera. One marker revealed strongly divergent
haplotypes between V. berus and V. walser (V. walser being even
closer to V. aspis), but the second identified berus alleles as the clos-
est relative of walser alleles with only one mutation (versus four mu-
tations to V. aspis). However, the berus specimen sequenced for the
two nuclear loci by Ghielmi et al. (2016) comes from France (SU un-
published data), which makes the interpretation of the nuclear data
difficult. While the validity of V. walser was accepted by Freit as et al.
(2020), who gave much weight to mtDNA data, the lack of sufficient
nuclear data supporting the unexpected mtDNA relationships was
one of the main arguments used by Speybroeck et al. (2020) to re-
ject its validity pending further studies.
The unexpected biogeographical scenario suggested by the
mtDNA data and the close morphological resemblance of V. walser
with V. berus raise concern about the reliability of the relationships
suggested by the mtDNA data. The aim of this study was thus to
use independent nuclear markers to test whether the relationships
of the V. walser population inferred from several nuclear loci agree
with the mtDNA gene tree or not. For this purpose, we sequenced
representative samples of most of the European species of Vipera
including the newly described V. walser for five nuclear introns. We
also repeated the mtDNA analyses of Ghielmi et al. (2016), using the
same dataset as these authors did, as they are important to evaluate
the various hypotheses that could explain our results, and provide
sa morphologie est similaire aux populations de V. berus qui vivent dans la même
région des Alpes italiennes, ce qui soulève des questions sur ses relations de parenté
et son statut systématique. Nous avons donc séquencé cinq gènes nucléaires pour
déterminer la position de V. walser par rapport à V. berus et aux vipères du Caucase/
Anatolie orientale pour l'ADN nucléaire. Nous avons également réanalysé les cinq
fragments d'ADN mitochondrial précédemment séquencés. Les marqueurs nucléaires
ont identifié V. w als er comme étroitement apparenté à la population italienne de V.
berus et non aux espèces caucasiennes/anatoliennes orientales, contredisant ainsi la
phylogénie de l'ADN mitochondrial. Nous avons vérifié que chacun des cinq fragments
d'ADN mitochondrial amplifiés indépendamment par Ghielmi et al. (2016, Journal
of Zoological Systematics and Evolutionary Research, 54, 161) ont produit des arbres
de gènes individuels compatibles avec la phylogénie mitochondriale concaténée,
excluant ainsi l'hypothèse selon laquelle le séquençage de NUMTs a généré les
relations mitochondriales identifiées par Ghielmi et al. (2016, Journal of Zoological
Systematics and Evolutionary Research, 54, 161). Compte tenu du faible niveau de
différenciation nucléaire entre V. wals er et la population italienne de V. berus, nous
pensons qu’une introgression ancienne entre V. berus et la population ancestrale de
V. walser est l'explication la plus probable de cette discordance cyto- nucléaire; nous
discutons en conclusion des conséquences de ces résultats sur le statut systématique
de V. wals er.

|
3
DONIOL- VALCROZE Et AL.
single- fragment trees that were not presented in the main text in
Ghielmi et al. (2016, see “Sampling” below). Our main aim was to as-
sess whether nuDNA markers group V. walser wit h the Caucasi an taxa
(as suggested by mtDNA) or with the Italian populations of V. berus
(as suggested by morphology and biogeography). Consequently, we
did not include all taxa of the genus Vipera, but we selected samples
from the Caucasian taxa, from several subspecies of V. berus, and
from a few other European species. The first step was to verify that
every well- supported species of viper formed a distinct cluster with
our nuDNA data. Once this was done, we used these data to assess
the position of V. walser in relation to the species we sequenced.
2 | MATERIALS AND METHODS
2.1 | Sampling
Most tissue samples used for the nuclear genes sequencing origi-
nated from the collection of the “Biogéographie et Écologie des
Vertébrés” team (CNRS & École Pratique des Hautes Études, BE V-
EPHE) housed in the UMR 5175- CEFE in Montpellier, France.
Other samples were obtained from the private collections of SU
and KM while V. walser samples were collected by SG and LL.
Most samples were muscle samples obtained from road- killed
specimens, or tail tips, ventral scales, or buccal swabs obtained
from live specimens. All samples were stored in >95% ethanol
prior to extraction. Our dataset included 35 individuals from
most of the species of the genus Vipera: two samples of V ipera
kaznakovi, four samples of Vipera darevskii, three samples of Vipe ra
eriwanensis, four samples of Vipera ursinii (subspecies ursinii and
rakosiensis), five samples of Vipera aspis (subspecies aspis and
zinnikeri), two samples of Vipera seoanei, 11 samples of Vipera
berus (subspecies bosniensis and berus and five individuals from
the subspecies marasso from the Italian Alps), and five samples
of Vipera walser. The complete list of all samples and their origin
is given in Table 1. Non- invasive tissue sampling does not require
ethical approval in French or Italian institutions. For fieldwork in
Turkey, we received ethical permission (Ege University Animal
Experiments Local Ethics Committee, 2013#050) and special
permission (2018#101792) for field studies from the Republic of
Turkey, Ministry of Agriculture and Forestry, General Directorate
of Nature Conservation and National Parks. No permit was re-
quested for sampling V. berus or V. walser in Italy.
In order to examine potential causes of discordant mtDNA and
nuDNA patterns, we tested for possible artifacts caused by the
sequencing of nuclear mitochondrial insertions (NUMTs) that are
homologous to mtDNA sequences but have diverged after pseudog-
enization following their insertion into the nuclear genome. To do
so, we repeated the analyses of the mitochondrial data from Ghielmi
et al. (2016) independently for each amplified mtDNA fragment (five
in total). If NUMTs are involved, we do not expect the PCR to amplify
selectively the nuclear copies for every primer pair, so concatenated
alignments are a mix of nuclear and mitochondrial copies, which can
result in flawed phylogenetic inference. This can be detected by ex-
amining individual gene trees for every gene fragment amplified (i.e.,
every primer pair): if they all support the same topology as the con-
catenated alignment, NUMTs can be excluded as the source of the
concatenated topology. Mitochondrial data were the same as those
used in Ghielmi et al. (2016).
2.2 | Molecular laboratory procedures
Total genomic DNA was extracted using the Dneasy Blood and
Tissue Kit (QIAGEN, Hilden, Germany) following the manufacturer's
recommended procedures. Negative extraction blanks were made
by processing tubes in exactly the same way as tissue samples and
were used in all PCR reactions to check for the lack of contamina-
tion. Five nuclear gene fragments were amplified for all samples:
recombination- activating gene [RAG1], neurotrophin 3 [NT3], RNA
fingerprint protein 35 [R35], brain- derived neurotrophic factor [BDNF],
and ornithine decarboxylase [OD] (Table 2). These fragments were se-
lected after preliminary screening of seven nuclear genes known to
be useful in squamates phylogeny and sequenced in one specimen
each of Vipera aspis, V. berus, and V. eriwanensis. Two other loci were
not ret ained bec ause the y had ze ro (oocy te maturation factor [CMOS])
or just one (melanocortin 1 receptor [MC1R]) variable site in the three
species alignment. PCR were conducted in 20 μl volumes with 2 μl of
DNA, 10 μl of Taq Polymerase (Sigma- Aldrich), 0.5 μl of each primer
[10 μM], and 7 μl of pure water. Amplifications were done following
the same program for all introns: an initiation of 3 min at 94℃; 40
cycles of 30 s at 94℃, 40 seconds at 60℃, 1 min at 72°; and a final
elongation of 10 min at 72℃. To test the success of the PCR, 3 μl
of the PCR product was migrated on a 1% agarose gel for 30 min-
utes at 100 V and 80 mA. Successfully amplified DNA fragments
were sequenced by Eurofins Genomics (Ebersberg, Germany) using
the same primers as for amplification. Sequences were cleaned with
Codon Code Aligner v. 9.0.1 (CodonCode Corporation) and aligned
visually. Heterozygote positions were identified by eye from the
chromatograms and coded with the IUPAC ambiguity codes; pri-
vate mutations (occurring in one or very few specimens) were also
checked by eye on the chromatograms. All new sequences were de-
posited in GenBank (see Table 1).
2.3 | Phylogenetic analysis
Sequences from the five nuclear introns were phased with DnaSP
v. 6.12.03 (Rozas et al., 2017), using default settings of the PHASE
algorithm (Stephens et al., 2001), with 10,000 iterations and 1000
burn- in iterations. The program TCS v. 1.21 (Clement et al., 2006)
implemented in PopART v.1.7 (Leigh & Bryant, 2015) was used to
infer hapl oty pes net work s using statistical parsim ony, for each ge ne.
Unphased nuclear sequences were concatenated for subse-
quent phylogenetic analyses. The best- fitting substitution model in
terms of both BIC and AICc, T92+Γ, was found using Mega- X (Kumar

4
|
D ONIOL- VALCROZE Et AL.
TAB LE 1 Samples origin and GenBank accession numbers. Latitude (Lat.) and longitude (Log.) are in decimal degrees (WGS84). Precision is the radius of a circle around the given coordinates
that includes the place where the sample was collected
Tax on Locality Latitude Longitude
Precision
(m)
Voucher and/or
tissue number RAG1 NT3 R35 BDNF OD
Vipera kaznakovi E of Kiyicik, Turkey 41.3056 41.2 53 0 10 Vika7 MW248848 MT969159 MW248820 MT912385 MW292429
Vipera kaznakovi Esenkıyı, Turkey 41.4 324 41.458 0 10 Vika17 MW248849 MT969160 MW248821 MT912386 -
Vipera darevskii Oguzyolu, Turkey 41.2486 42.9923 10 Vida9 MW2488 46 MT969157 MW248818 MT912383 MW292427
Vipera darevskii Zekeriyaköy, Turkey 40.9875 42.1367 10 Vida11 MW248 847 MT969158 MW248819 MT912384 MW292428
Vipera darevskii 2 km E. Zekeriya, Turkey 40.9941 42.1655 500 BE V. 8369/T741 MW248845 MT969155 MW248812 MT912381 MW292425
Vipera darevskii 2 km E. Zekeriya, Turkey 40.9941 42.1655 500 BE V. 8855/T742 - MT969156 MW248813 MT912382 MW292426
Vipera eriwanensis 6 km ENE Arpaçay, Turkey 40.8898 43.3530 500 B EV.88 56/ T743 MW248852 MT969163 MW248816 MT912389 MW292432
Vipera eriwanensis 8 km E of Gndevaz, Armenia 39.76 50 45.7105 20 BEV.14134/T10 55 4 MW248850 MT969161 MW248814 MT912387 MW292430
Vipera eriwanensis Kechut, Armenia 39.7950 45.6681 20 BEV.14524/T11130 MW248851 MT969162 MW248815 MT912388 MW292431
Vipera walser Valle Strona, Italy 45.9394 8.2253 2000 2788 MW248836 MT969145 MW248803 MT912371 -
Vipera walser Valle Strona, Italy 45.9447 8 .2276 2000 2791 MW248837 MT969146 MW248804 MT912372 -
Vipera walser Valle Elvo, Italy 45.6046 7.904 4 2000 2792 MW24 8834 T969142 MW248800 MT912368 M W292414
Vipera walser Upper Valle Sesia, Italy 45.7283 7.9346 2000 2794 MW248853 MT969143 MW24 8801 MT912369 MW292415
Vipera walser Valle Mastallone, Italy 45.9324 8.0986 2000 It5 MW248835 MT969144 MW248802 MT912370 MW292416
Vipera berus marasso Forno di Zoldo, Italy 46.3123 12.1571 20 S3 MW248828 MT969136 MW248795 MT912362 MW292410
Vipera berus marasso Passo Monte Croce di Comelico,
Italy
46.6605 12.4230 20 S4 MW248829 MT969137 MW267747 MT912363 MW292411
Vipera berus marasso Val Mora, Italy 46.04 01 9.6207 20 S6 MW248 830 MT969138 MW248796 MT912364 MW292412
Vipera berus marasso Val Mora, Italy 46.0369 9.6227 20 S7 MW248831 MT969139 MW248797 MT912365 MW292413
Vipera berus marasso Val Mora, Italy 46.0388 9.6207 20 S10 MW248827 MT969135 MW248794 MT912361 MW292409
Vipera berus berus 1,5 km E of Valtavaara pass,
Finland
66.2052 2 9. 24 6 8 10 0 BEV.10223/ T2992 MW248822 MT969129 MW24 8788 MT912355 MW292404
Vipera berus berus Topilo, Poland 52.6345 23.6232 750 BEV.7602/ T11978 - MT969132 MW248791 MT912358 -
Vipera berus berus Frasne, France 46.8272 6.1740 20 BE V.11592/
T11980
MW248824 MT969131 MW248790 MT912357 MW2924 06
Vipera berus berus Ågesta, Sweden 59.2102 18.0803 10 T40 23 MW248823 MT969130 MW248789 MT912356 MW292405
Vipera berus bosniensis Vitosha, Bulgaria 42.5940 23.2843 10 T402 7 MW248825 MT969133 MW248792 MT912359 MW292407
Vipera berus bosniensis Carev Do, Montenegro 42.8567 19.7 0 43 1000 T4031 MW248826 MT969134 MW248793 MT912360 MW292408
Vipera seoanei seoanei 400 m N of Chalet Pedro, France 43.0404 - 1 . 0 7 6 1 20 T10370 MW248832 MT969140 MW248798 MT912366 -
Vipera seoanei seoanei Chalets d'Iraty, France 43.0505 - 1 . 0 6 4 7 100 T10371 MW248833 MT969141 MW248799 MT912367 -
Vipera ursinii
rakosiensis
3 km SSE Asinip, Romania 46.1617 23.5499 500 T5383 (ROU 154) MW248841 MT969151 MW248808 MT912377 MW292421
(Continues)

|
5
DONIOL- VALCROZE Et AL.
et al., 2018) with default settings and was used to build maximum-
likelihood (ML) and neighbor- joining (NJ) trees with Mega- X. The
support of the clades was estimated by 1000 bootstrap repeti-
tions. Bayesian inference (BI) was conducted with MrBayes v. 3.2
(Ronquist & Huelsenbeck, 2001) using the GTR +Γ evolution model
(the closest model from T92+Γ among the models implemented in
Mr Bayes, as suggested in Mr. Bayes v. 3.2 manual). We ran the pro-
gram for 3,000,000 generations, a value selected after checking that
the standard deviation of split frequencies was below 0.01, that the
potential scale reduction factor (PSRF) was reasonably close to 1.0
for all parameters and that the effective sample sizes (ESSs) were
above 100 for all parameters, as suggested in Mr. Bayes v. 3.2 man-
ual. Burn- in parameters were kept as default, that is, discarding 25%
of samples as burn- in.
To root the nuclear tree, we searched GenBank for sequences
of the nuclear fragments used here obtained in species from the
sister genera to Vipera (Daboia, Montivipera, and Macrovipera, see
Šmíd & Tolley, 2019). None of the possible outgroups is represented
by more than three of our five nuclear fragments, so we selected
the following species (GenBank accession numbers in parentheses):
Montivipera raddei (NT3: KX695031, RAG1: KX169144, and BDNF:
KX694739) and Daboia russellii (NT3: EU390916, R35: HQ876367,
and BDNF: EU402636). In both ML and BI analyses, the evolution-
ary models used were the same as without outgroups. The length
of the run (number of generations) for the BI analyses was deter-
mined as explained above; in the ML analyses, the support of the
clades was estimated by 100 bootstrap repetitions. In BI trees, we
tried to run the models with and without outgroup constraints and
with and without a relaxed- clock model. Enforcing or not an out-
group constraint did not affect the result (root position). Enforcing a
relaxed- clock model (as opposed to the default model without clock)
in MrBayes affected the position of the root; the non- clock model
was significantly better than the relaxed- clock model (as assessed
by comparing the means of the marginal likelihoods, see MrBayes
manual), so we selected the non- clock model as the BI result for the
root position. In all analyses (ML or BI), the addition of outgroups
lowered the resolution of the trees and the clades supports, prob-
ably because the amount of information in outgroups was always
lower than for the in- group taxa. We thus retained the results of
the phylogenetic analyses with the in- group taxa only (the Vipera
species) and simply indicated on the BI tree in Figure 1 the various
positions of the root inferred by different approaches.
Last, we built a NJ population tree using a pairwise between-
groups net average distance matrix computed with Mega- X (T92 +
G model) to represent the patterns of nuclear divergence between
populations based on nuclear data. Groups were defined as species
or subspecies for polytypic ones. The clade supports were not eval-
uated as there is no commonly available way to evaluate support for
distance- based population trees.
We also retrieve d the five mt D N A gene fragments used in Ghie lmi
et al. (2016) to produce five single- gene trees with the ML method
and 1,000 bootstraps repetitions in Mega- X and the BI method with
MrBayes using 200,000 generations. The best substitution models
Tax on Locality Latitude Longitude
Precision
(m)
Voucher and/or
tissue number RAG1 NT3 R35 BDNF OD
Vipera ursinii ur sinii Pra Mouret, France 44.0863 6 .6551 10 T2410 (GCO 14) MW248842 MT969152 MW248809 MT912378 MW292422
Vipera ursinii ur sinii Mont Ventoux, France 44.1812 5.2641 10 T2595 (VEN 4) MW248843 MT969153 MW248810 MT912379 MW292423
Vipera ursinii ur sinii Montagne de Lure, France 4 4.1207 5.8038 2000 T2622 (LURE 25) MW248844 MT969154 MW24 8811 MT912380 MW292424
Vipera aspis aspis Neuvéglise, France 44.9340 2.9982 20 BEV.14511/
T10075
MW248854 MT969150 MW248807 M T912376 MW292420
Vipera aspis zinnikeri Mignoy, France 44.6943 - 0 . 6 3 3 8 200 BEV.14180/
T10692
MW24883 8 MT969147 MW248 805 MT912373 M W292417
Vipera aspis zinnikeri Trachère, France 42.8090 0.3123 400 BEV.8657/ T11981 MW248839 MT969148 MW248806 MT912374 MW292418
Vipera aspis zinnikeri Merdelou, France 43 .76 41 2.8946 20 BEV.9178/ T754 MW248840 MT969149 MW24 8817 MT912375 MW292419
Note: BEV codes are voucher codes.
T codes are tissue codes.
TAB LE 1 (Continued)

6
|
D ONIOL- VALCROZE Et AL.
TAB LE 2 Sequence and source of the primers used in this study. CMOS and MC1R were not retained due to low levels of variability; see
“Material and Methods” section. We did not manage to amplify BACH1 for this study
Gene Primers Sequence 5’ – 3’ Source
RAG1 (recombination- activating gene 1) R13
R18
TCTGA ATGGA AATTCA AGCTGTT
GATGCTGCCTCGGTCGGCCACCTTT
Groth and Barrowclough
(1999)
NT3 (neurotrophin 3) NT3- F3
NT3- R4
ATATTTC TGGCTTTTCTCTGTGGC
GCGTTTCATAAAAATARRGTTTGACC
modified from Mizsei et al.
(2017 )
R35 (RNA fingerprint protein 35) R 3 5 - F
R 3 5 - R
GACTGTGGAYGAYCTGATCAGTGTGGTGC
GCCAAAATGAGSGAGAARCGCTTCTGAGC
Brandley et al. (2011)
BDNF (brain- derived neurotrophic factor) BD NF_f
BD NF_r
GACCATCCTTTTCCTKACTATGGTTATTTCATACTT
CTATCTTCCCCTTTTAATGGTCAGTGTACAA AC
Townsend et al. (2008)
OD (ornithine decarboxylase) O D - F
O F - R
GACTCCAAAGCAGTTTGTCGTCTCAGTGT
TCTTCAGAGCCAGGGAAGCCACCACCA AT
Friesen et al. (1999)
CMOS (oocy te maturation factor) C08
C09
GCTTGGTGTTC AATAGACTGG
TTTGGGAGCATCCAA AGTCTC
Han et al. (2004)
MC1R (melanocor tin 1 receptor) M C 1 r - F
M C 1 r - R
GGCNGCCATYGTCAAGAACCGGAACC
CTCCGRAAGGCRTAAATGATGGGGTCCAC
Pinho et al. (2010)
BACH1 (BTB and CNC homology 1) BACH1_f1
BACH1_r2
GATTTGAHCCYTTRCTTCAGTTTGC
ACCTCACATTCYTGTTCYCTRGC
Townsend et al. (2008)
FIGURE 1 Unrooted Bayesian inference (BI) phylogenetic tree of our Vipera samples inferred from the concatenation of five nuclear
introns with MrBayes. The numbers at the nodes are the posterior probability values of BI and the bootstrap values of the maximum-
likelihood (ML) inference (for nodes in common). The Caucasian– Meadow vipers samples are in red, V. seoanei in gray, V. aspis in yellow,
V. berus in blue, and the V. walser individuals in green. The dotted arrows indicate the position of the root inferred from our analyses with
outgroups (based on the ML or BI methods) or based on the literature. Each individual is designated by its unique sample codes (see Table 1)
and taxonomic allocation
VIDA9
darevski
VIKA7
kaznakovi
S7
marasso
S6
marasso
1/100
0.91/.
0.91/.
1/97
0.9/.
0.91/.
0.65/.
1/95
0.96/.
1/100
0.99/.
0.91/.
1/74
0.75/.
outgroup BI (0.58/0.89)
outgroup Šmíd & Tolley 2019
outgroup ML (57/24)

|
7
DONIOL- VALCROZE Et AL.
were selected for each gene using default settings in Mega- X and
used for ML and BI analyses (for BI the closest model available in
MrBayes was selected, as explained in the MrBayes manual). The
T92+Γ model was selected for 16S ribosomal RNA [16S ], the T92+I
model was selected for Control Region 1 [CR1], the HKY+Γ model was
selected for Control Region 2 [CR2], and NADH dehydrogenase subunit
4 [ND4] and the TN+Γ model were selected for Cytochrome B [CYTB].
3 | RESULTS
The final dataset (provided as Supporting information) included se-
quences of five nuclear DNA introns for each individual: R AG1 (am-
plicon length approx. 1150 bp, trimmed length 1036 bp, 39 variable
sites), R35 (amplicon length approx. 700 bp, trimmed length 635 bp,
35 variable sites), NT3 (amplicon length approx. 750 bp, trimmed
length 697 bp, 20 variable sites), BDNF (amplicon length approx.
750 bp, trimmed length 670 bp, 5 variable sites), and OD (amplicon
length approx. 600 bp, trimmed length 542 bp, 42 variable sites).
Despite several attempts, we failed to amplify the OD intron for the
two V. seoanei samples (see Table 1).
3.1 | Phylogenetic reconstruction:
nuclear sequences
Phylogenetic trees reconstructed using BI, ML, and NJ methods from
the concatenation of the five nuclear introns without outgroups re-
sulted in concordant topologies (Figure 1; Figures S1 and S2). In all nu-
clear trees, low bootstrap values or posterior probabilities for internal
nodes indicate a lack of support for the relationships between species
based on our five nuclear introns. As expected for the reasons ex-
plained above, the position of the root was always poorly supported
(Figures S3 and S4). Even though the species relationships of the tree
are poorly resolved, the clade made of V. ursinii and the Caucasian
taxa (V. eriwanensis, V. darevskii, V. kaznakovi) to the exclusion of V.
aspis and V. berus receives a high support in BI with a posterior prob-
ability (pp) of 0.91. Surprisingly, V. seoanei is included in the clade
made of V. ursinii and the Caucasian taxa in all three possible rooting
options rather than excluded from it and does not group with V. berus,
although these two taxa have been recovered as sister species by
Alencar et al. (2016), Šmíd and Tolley (2019), and Freitas et al. (2020).
On the contrary, valid species are usually recovered as mono-
phyletic clades with high support: V. aspis (V. a. aspis + V. a. zinni-
keri, pp = 1), V. seoanei (pp = 1), V. eriwanensis (pp = 1), and V. ursinii
(pp = 1). The only exceptions to this pattern are the two Caucasian
species, V. kaznakovi and V. darevskii, which are not recovered as re-
ciprocally monophyletic in any of the BI, ML, or NJ (Figure 1; Figures
S1 and S2) trees, and our single sample of V. ursinii rakosiensis, which
either does not group with V. u. ursinii (BI) or groups with low suppor t
(ML and NJ). All these results are valid under any of the three possi-
ble positions of the root of our nuclear tree (Figure 1).
However, whatever the phylogenetic inference method used
or the root position, V. walser is not recovered as a distinct cluster
but all its samples are mixed with samples of V. berus marasso in a
highly supported clade (BI: pp = 0.96) th at includes al l V. b. marraso
samples except S4. All samples of V. berus (inc. V. b. berus and V. b.
bosniensis), together with the samples of V. walser and V. b. marasso,
form a monophyletic clade in all three methods even though this
clade receives a low support (pp = 0.65, ML bootstrap = 48, NJ
bootstrap = 43). The genetic proximity of V. walser with the Italian
populations of V. berus is also supported by the distance- based
population tree that groups V. walser and V. berus marasso within a
monophyletic V. berus (Figure 2).
3.2 | Nuclear haplotype networks and patterns of
alleles sharing
The nuclear gene alignments revealed various levels of diversity: six
alleles for BDNF, 11 for OD, 19 for NT3, 24 for R35, and 29 for R AG1.
Despite extensive lineage sharing, most valid species are entirely
FIGURE 2 Neighbor- joining population
tree inferred from the concatenation
of five nuclear genes using a pairwise
between- groups net average distance
matrix with MEGA- X
Vipera berus berus
Vipera berus bosniensis
Vipera berus marasso
Vipera walser
Vipera aspis zinnikeri
Vipera aspisaspis
Vipera seoanei
Vipera eriwanensis
Vipera darevskii
Vipera kaznakovi
Vipera ursinii rakosiensis
Vipera ursinii ursini
i

8
|
D ONIOL- VALCROZE Et AL.
separated in the network (no allele sharing) in at least one of the five
markers, such as R AG1 and BDNF for V. aspis and V. berus or R35 and
OD for the western European species versus V. ursinii + Caucasian
taxa (see Figure 3 for all haplotype networks). However, none of the
five amplified markers was, considered individually, able to separate
all the different valid species. Nevertheless, V. walser shares alleles
with V. berus marasso for all five loci (sometimes also with other
clades of V. berus, V. aspis, or V. kaznakovi), and those which are not
shared (private alleles) are without exceptions linked to some V.
berus marasso alleles in the network. The five allele networks recon-
structed from the phased introns are therefore concordant with the
relationships outlined by the species tree reconstructions and group
V. walser with specimens of V. berus marasso.
3.3 | Mitochondrial trees
All of the five single gene trees reconstructed from each indepen-
dently amplified mtDNA gene fragments are congruent with the
concatenated mitochondrial tree of Ghielmi et al. (2016) even if they
generally lack support. Most importantly, none of the gene fragment
groups V. walser with V. berus as a monophyletic clade an d most gene
FIGURE 3 Haplotype networks
of the five sequenced nuclear introns
inferred using TCS v1.21 implemented
in PopART. Colored circles represent
identified haplotypes and the circle area is
proportional to the number of individuals
per haplotype. Black circles stand for
missing haplotypes
R35
NT3
RAG1
OD
BDNF
10 samples
1 sample
berus
bosniensis
italianclade
seoanei
walser
aspis
ursini
darevski
kazn akovi
erivanensi s
ursinii& rakosiensis
bosniensis
marasso
seoanei
walser
aspis& zinnikeri
berus
darevskii
kaznakovi
eriwanensis

|
9
DONIOL- VALCROZE Et AL.
FIGURE 4 Gene- by- gene and concatenated maximum- likelihood phylogenetic trees of the Vipera genus inferred from the five mtDNA
fragments sequenced by Ghielmi et al. (2016) with MEGA- X. The two numbers at the nodes are the bootstrap values of maximum- likelihood
and the posterior probabilities of Bayesian inference. Numbers following the taxon names are the sample codes given in Ghielmi et al. (2016)

10
|
D ONIOL- VALCROZE Et AL.
fragments support a position for V. walser closer to the Caucasian
species than to V. berus (Figure 4).
4 | DISCUSSION
4.1 | Nuclear and mitochondrial data suggest
incongruent relationships for Vipera walser
The nuclear data we generated unambiguously place Vipera wal-
ser inside the genetic diversity of Vipera berus. Both concatenated
trees and nuclear haplotype networks mix V. walser individuals with
the specimens of V. berus marasso and fail to recover two distinct
clusters corresponding to V. walser and V. b. marasso. The pattern
of population- level divergence confirms that these two taxa are
closely related and are grouped with the other V. berus subspecies
that we analyzed. This contrast with the other species included in
our dataset, which are all recovered as well- supported monophyl-
etic clusters and exhibit higher levers of genetic divergence from
the other species (except for V. darevskii and V. kaznakovi, discussed
below). This confirms that there is enough information in our nu-
clear data to separate the taxa that correspond to well- established
and fully valid species, even if our nuclear data are clearly not pow-
erful enough to resolve the evolutionary history of the genus Vipera
(see below). We were not able to amplify the nuclear gene BTB and
CNC Homology 1 [BACH1] that exhibited distinct alleles separated
by 12 substitutions in one sample of V. walser and one sample of
V. berus from France in Ghielmi et al. (2016). However, in our data
set, the markers RAG1 or NT3 showed levels of divergence similar
to BACH1 between the most different alleles of V. b. berus and V.
walser (compare our Figure 2 with Ghielmi et al., 2016). It is thus
unlikely that adding BACH1 to our data set would have affected our
results, as this marker does not seem to behave differently from
the markers we analyzed. In conclusion, we can be confident that
V. walser and V. berus marasso are not recovered as distinct line-
ages based on the nuclear data, and these two taxa have a much
lower genetic divergence than most other pairs of well- supported
Eur opean vip ers in our nuclear markers, as shown by the population
tree (Figure 2).
On the contrary, our results support unambiguously that the
mtDNA of V. walser is not closely related to the mtDNA of V. berus
(Figure 4). Vipera walser shares no mtDNA haplotype with V. berus in
any of the five gene fragments sequenced by Ghielmi et al. (2016),
and it never groups inside the V. berus +V. seoanei clade that is re-
covered in all five single- fragment trees (Figure 4). None of the
single- fragment trees recovers well- supported relationships, which
is not surprising since they are all very short. However, they are all
in agreement with the concatenated mitochondrial tree of Ghielmi
et al. (2016; repeated here, Figure 4) in placing V. walser haplotypes
closer to members of the Caucasian clade than to Vipera berus. The
fact that all five mitochondrial fragments, amplified independently
with five different primer pairs, support the same phylogenetic
placement for V. walser excludes the possibility of artifacts resulting
from the sequencing of NUMTs as it would be extremely unlikely to
amplify preferentially the nuclear copy in V. walser for every primer
pair. We can thus safely exclude NUMTs as explanation for the unex-
pected mtDNA relationships of V. walser. The different relationships
of V. walser in mtDNA and nuDNA are thus both genuine and consti-
tute a striking instance of cyto- nuclear discordance.
4.2 | Nuclear relationships within Vipera
The nuclear data that we have generated are clearly not adequate
to address the phylogeny of the genus Vipera, as evidenced by the
low support for several nodes and the unexpected positions of some
species, including outgroups. Indeed, the position of V. seoanei in the
concatenated nDNA tree seems counterintuitive, as this species has
always been considered as the sister species of V. berus (based on
morphology and mtDNA analyses, Alencar et al., 2016; Freitas et al.,
2020) and not related to Caucasian species. Similarly, the position
of outgroups (hence the rooting of the tree) is always poorly sup-
ported, sometimes in a highly unexpected position (Figure S3), and
always differs from the root position established by the most recent
phylogeny of the Viperidae (Figure 1; Šmíd & Tolley, 2019): the BI
analyses placed the root on the branch between V. eriwanensis and
V. darevskii +V. kaznakovi (Figure S3), while the ML tree placed it be-
tween a clade made of these species +V. seoanei on the one hand
and the rest of the vipers on the other hand (Figure S4), while Šmíd
and Tolley (2019) would place it between V. aspis and all the other
species. The difficulties in placing the root probably stem partly from
missing data (at most three loci out of five were available for out-
groups), but it is nevertheless clear that, at least for Eurasian vipers,
obtaining robust phylogenies from nuclear sequence data would re-
quire a larger number of loci than what we used here.
Despite their lack of resolution, our nuclear data generate some
valuable results that would justify further investigation. While this
is outside the scope of this study, the high divergence between our
single sample of V. u. rakosiensis and V. u. ursinii in nuclear DNA, mir-
rored in the mtDNA of these two taxa (Mizsei et al., 2017; Zinenko
et al., 2016), reinforces the need for more detailed study in this spe-
cies. On the contrary, the lack of reciprocal monophyly between
V. darevskii and V. kaznakovi, together with the high divergence be-
tween some of our V. darevskii samples, could be partly due to a lack
of resolution of our markers but also suggests the effects of admix-
ture. These species appear as prime candidates for further genomic
studies, such as done by Zinenko et al. (2016) or Mizsei et al. (2017)
on other Caucasian taxa. Last, the position of V. seoanei in the nu-
clear dataset is poorly supported, but it never groups with V. berus
under any possible position of the root of the Vipera tree. This calls
for a re- examination of its relationships, which entirely rested on
mtDNA and morphological data before our study.
All the nuDNA loci that we analyzed here in Eurasian vipers have
a weak phylogenetic signal individually. In addition, as shown here
and recently by Freitas et al. (2020) on a much larger dataset, allele
sharing in nuclear loci is widespread between Eurasian viper species,

|
11
DONIOL- VALCROZE Et AL.
even between species that are highly divergent in morpholog y, ecol-
ogy, or mtDNA (as between V. aspis and V. berus in our dataset for
example). Such allele sharing and/or weak phylogenetic signal of
single- locus sequences are not restricted to vipers but are instead
typical of nuclear gene sequences among closely related reptile
species (e.g., Miralles et al., 2020; Vasconcelos et al., 2020) and can
result from a combination of interspecific gene flow and/or incom-
plete lineage sorting (e.g., Pinho et al., 2008). In European vipers,
it would be interesting to test whether lineage sharing is more ex-
tensive between sympatric or parapatric species than between fully
allopatric species, once accounting for divergence time. This would
allow assessing the respective role of incomplete lineage sorting and
hybridization (see for instance Tarroso et al., 2014 or Guiller et al.,
2017) in generating this large amount of allele sharing.
4.3 | Possible causes of cyto- nuclear discordance
Incomplete lineage sorting (ILS) can generate gene trees that do
not agree with the species tree and is thus a well- known cause of
discordance between mitochondrial gene trees and species trees.
However, ILS would seem like an extraordinary explanation in this
case. ILS happens when internodes in a tree are short enough or
effective population sizes are large enough for species divergence
to be initiated before ancestral polymorphism is lost; as a result,
ILS usually affects species that are closely related (Funk & Omland,
2003). It thus seems unlikely that ILS would affect patterns of di-
vergence to the extent seen here. If ILS had caused cyto- nuclear
discordance, V. walser would probably be identified as a divergent
cluster in both mtDNA and nuDNA datasets and would be closer
to V. berus in both datasets, even if its relationships were different
when inferred from mtDNA and nuDNA. However, an unequivocal
rebuttal of the ILS hypothesis would require formal testing, such
as simulation of mtDNA data under a species history based on the
Vipera phylogeny, with a wide range of biologically possible popula-
tion sizes, to see whether such level of discordance and such amount
of genetic divergence of mtDNA lineages within V. berus can be
generated. This would first require a robust assessment of species
relationships in Vipera independently of mtDNA data, which is still
not available.
Consequently, the most credible hypothesis to explain the ob-
served pattern of nuclear and mitochondrial divergence of V. walser
relative to V. berus is introgression. Mitochondrial introgression (here
de fin ed as th e occurre nce of mtDNA lineage s or igi nat i ng from an oth er
species in the genetic background of a given species) is a common
phenomenon in animals, resulting in most extreme cases in mitochon-
drial capture (the fixation of the foreign mtDNA in the receiving pop-
ulation). Introgression is the main cause of cyto- nuclear discordance
(reviewed in Funk & Omland, 20 03 and Toews & Brelsford, 2012), and
mitochondrial introgression has been detected in several European
reptiles and amphibians (see Dufresnes et al., 2018; Renoult et al.,
2009; Wielstra & Arntzen, 2020; Zieliński et al., 2013).
Evolutionary mechanisms leading to mitochondrial introgres-
sion have been reviewed by Petit & Excoffier (2009) and Excoffier
et al. (2009). Spatial expansion in particular can lead to massive
introgression of local genes into the genome of an invading spe-
cies, while male- biased dispersal seems to favor higher introgres-
sion rate of mtDNA compared with nuDNA. These situations can
result in populations where the original mtDNA remains in place
but occurs in a nuclear genetic background that has been mas-
sively swamped by the invading species (as recently proposed
for Iberian hares by Seixas et al., 2018). Studies of sex- biased
dispersal in Viperidae are rare but Clark et al. (2008, Crotalus
horridus), Zwahlen et al. (2021, Vipera aspis) and François et al.
(2021, V. berus) reported male- biased dispersal. Male- biased dis-
persal has also been reported in the Colubrid species Coronella
austriaca (Pernetta et al., 2011) and Thermophis baileyi (Hofmann
et al., 2012) and seems to be the general pattern in Squamates
(reviewed in Ferchaud et al., 2015). It thus seems likely that male-
biased expansion of V. berus marasso into the area inhabited by
V. walser generated the current situation where populations have
retained the original V. walser mtDNA in a nuclear background
heavily admixed with V. berus alleles.
Under this hypothesis, Vipera walser's mitochondrial lineage
would really be the footprint of the existence of a highly diver-
gent lineage of Vipera in the western Alps with no close relative in
Western Europe and sharing common ancestors with the Meadow–
Caucasian group of taxa (as suggested in Ghielmi et al., 2016). More
recently, nuclear introgression from expanding V. berus marasso re-
sulted in extensive allele sharing and loss of divergence for the five
nuclear introns we sequenced, and thus probably for a substantial
part of the nuclear genome. As V. walser and V. berus marasso are cur-
rently not in contact, the genetic exchange should have taken place
during the last glaciation (or before), when both species were proba-
bly at a lower altitude and possibly in contact. We checked a recently
published, extensive review of Viperidae fossil material (table S3 in
Šmíd and Tolley, 2019) and none of the material from Italy can be
attributed to the Meadow– Anatolian– Caucasian viper group, which
would support this scenario (but note that no fossil material of V.
berus from Italy could be found either).
A better understanding of the precise mechanisms that gen-
erated this pattern will require studying more nuclear loci, as a
precise estimation of nuclear admixture is a prerequisite to dis-
tinguish between various possible scenarios. Bonnet et al. (2017)
have shown that massively discordant mitochondrial introgression,
where all or nearly all individuals of a species harbor the mtDNA
of the other species with very little nuclear introgression, is ex-
tremely unlikely without positive selection of the foreign mtDNA
or multiple barriers to introgression in the nuclear genome. The
threshold to define a massive discordance, in case where the
mtDNA is not admixed, is that nuclear admixture is less than 20%
(in our case, less than 20% of nuclear alleles would need to be of V.
walser origin). This seems to be the case for most of the five mark-
ers we have sequenced (only one allele of the locus BDNF is shared

12
|
D ONIOL- VALCROZE Et AL.
between walser and kaznakovi) but is not necessarily true for the
whole nuclear genome.
4.4 | Systematic implications
Our results suggest that the status of Vipera walser needs further
investigation. Its ranking as a valid species or not will depend on
the extent of nuclear admixture from V. berus. Our five nuclear
sequences indicate that a substantial part of its genome is now
shared with Vipera berus marasso, but the number of loci we used
is limited and represents a tiny proportion of the nuclear genome.
If most of the nuclear genome of V. walser is indeed shared with
V. berus marasso, as is likely if our five nuclear markers are rep-
resentative of the rest of the genome, V. walser cannot be recog-
nized as a valid species. Even if its mitochondrial DNA constitutes
the past footprint of an ancient evolutionary history, few species
concept would recommend treating these populations as a distinct
species based on their mitochondrial and weak morphological dif-
ferences only. On the contrary, if substantial parts of the nuclear
genome have resisted introgression from V. berus and large tracks
of V. walser original genome remain, it could be argued that V. wal-
ser constitutes a valid species. In other cases, new species have
been recognized despite massive nuclear introgression as long as a
substantial fraction of the genome resist s introgr ession (e.g., Nater
et al., 2017; Toews et al., 2016). We thus recommend screening
of a larger fraction of the genome of V. walser, for example, with
genomic approaches (RAD sequencing or whole genome sequenc-
ing) to unde rstand its history and de cide on its vali dit y as a sp eci es.
Whatever the outcome of these future studies, these populations
are the remnants and last testimony of a fascinating evolution-
ary history that requires to be preserved. Future investigations
to understand this issue better will only be possible if adequate
strategies are implemented to ensure the persistence of V. walser
populations, which should at least be regarded as constituting an
evolutionary significant unit (Moritz, 1994). Unfortunately, only
a small fraction of the populations is currently included in Italian
protected areas, while most of them fall in areas without specific
protection and are increasingly exposed not only to the effects of
clim ate cha nge, but also to dir ect anthropic pressure s that jeopard-
ize their medium/long- term persistence.
On a more general note, our results illustrate the pitfalls of
mitochondrial- based species delimitations. The risks of single- locus
studies have long been known (e.g., Balloux, 2010; Moore, 1995;
Renoult et al., 2009), and the need to use multiple markers for mo-
lecular taxonomy, phylogeography, and phylogenetic studies is now
consistently advocated (e.g., Dupuis et al., 2012; Jacobs et al., 2018).
However, because of the sm aller number of info rmative sites per nu-
clear sequence compared with mtDNA, combining mtDNA and one
or two nuclear introns in a single tree (as is still often done) usually
result s in the sa me topology as the mtDNA tree alone. A proper mul-
tilocus approach should employ enough nuclear markers to provide
a truly independent topology and should report it (Dool et al., 2016).
Despite these well- known issues with mtDNA- alone approaches,
many recent studies still rely mostly on mtDNA for phylogenetic
or taxonomic analyses because of its easy access and low cost, and
this includes several proposed new species (for recent examples in
European reptiles, see Bassitta et al., 2020; Senczuk et al., 2019).
We concur with Speybroeck et al. (2020) that the status of such can-
didate species whose recognition rests primarily on mtDNA diver-
gence should be evaluated with other lines of evidence before they
are widely accepted.
ACKNOWLEDGEMENTS
We thank Philippe Geniez and Anne- Laure Ferchaud for their
help to access the BEV samples and Dragan Arsovski, François
Bole, Marc Cheylan, Michel Geniez, Philippe Geniez, Ioan Ghira,
Bayram Göcmen, Nasit Igci, Arnaud Lyet, Anil Mehmet Oguz, Jean-
Louis Plazanet, Jean- Luc Poitevin, Gilles Pottier, Bernard Ricau,
Adrien Sprumont, Alexandre Teynié, Frédéric Veyrunes, Alexander
Westerström and Stephan Zamfirescu for their help in collecting
some of the samples used here. KM and MK were supported by
the Scientific and Technical Research Council of Turkey (TÜBİTA
K) under Grant 111T338 and 114Z946, the Mohamed bin Zayed
Species Conservation Fund, project no. 13057971 and 150510677,
and the Wilhelm Peters Fund 2013 of the German Herpetological
Society DGHT (Deutsche Gesellschaft für Herpetologie und
Terrarienkunde).
REFERENCES
Alencar, L. R., Quental, T. B., Grazziotin, F. G., Alfaro, M. L., Venzon, M.,
& Zaher, H. (2016). Diversification in vipers: Phylogenetic relation-
ships, time of divergence and shif ts in speciation rates. Molecular
Phylogenetics and Evolution, 105, 50– 62. ht tps://doi.org/10.1016/j.
ympev.2016.07.029
Balloux, F. (2010). The worm in the fruit of the mitochondrial DNA tree.
Heredity, 104, 419– 420. https://doi.org/10.1038/hdy.2009.122
Bassitta, M., Buades, J. M., Pérez- Cembranos, A., Pérez- Mellado, V., Terrasa,
B., Brown, R. P., Navarro, P., Lluch, J., Ortega, J., Castro, J. A., Picornell,
A., & Ramon, C. (2020). Multilocus and morphological analysis of
south- eastern Iberian Wall lizards (Squamata, Podarcis). Zoologica
Scripta, 49(6), 668– 683. https://doi.org/10.1111/zsc.12450
Bonnet, T., Leblois, R., Rousset, F., & Crochet, P. A. (2017). A reassess-
ment of explanations for discordant introgressions of mitochon-
drial and nuclear genomes. Evolution, 71, 2140– 2158. https://doi.
org /10.1111/evo.13296
Brandley, M. C., Wang, Y., Guo, X., Montes, N., de Oca, A., Feria- Ortiz,
M., Hikida, T., & Ota, H. (2011). Accommodating heterogenous
rates of evolution in molecular divergence dating methods: an
example using intercontinental dispersal of plestiodon (Eumeces)
Lizards. Sytematic Biology, 60, 3– 15. https://doi.org/10.1093/sysbi
o/syq0 45
Clark, R. W., Brown, W. S., Stechert, R., & Zamudio, K. R . (2008). Integrating
individual behaviour and landscape genetics: The population struc-
ture of timber rattlesnake hibernacula. Molecular Ecology, 17(3),
719– 730. https://doi.org/10.1111/j.1365- 294X.2007.03594.x
Clement, M., Snell, Q., Walke, P., Posada, D., & Crandall, K. (2006). TCS:
Estimating gene genealogies. Parallel and Distributed Processing
Sympopsium International, 2, 184.
Dool, S. E., Puechmaille, S. J., Foley, N. M., Allegrini, B., Bastian, A.,
Mutumi, G. L., Maluleke, T. G., Odendaal, L. J., Teelin, E. C., &
Jacob, D. S. (2016). Nuclear introns outperform mitochondrial

|
13
DONIOL- VALCROZE Et AL.
DNA in inter- specific phylogenetic reconstruction: Lessons
from horseshoe bats (Rhinolophidae: Chiroptera). Molecular
Phylogenetics and Evolution, 97, 196– 212. https://doi.org/10.1016/j.
ympev.2016.01.003
Dufresnes, C., Lymberakis, P., Kornilios, P., Savary, R., Perrin, N., & Stöck,
M. (2018). Phylogeography of Aegean green toads (Bufo viridis sub-
group): Continental hybrid swarm vs. insular diversification with
discovery of a new island endemic. BMC Evolutionary Biology, 18 ,
6 7 . h t t p s : / /d o i . o r g / 1 0 . 1 1 8 6 / s 1 2 8 6 2 - 0 1 8 - 1 1 7 9 - 0
Dupuis, J. R., Roe, A. D., & Sperling, F. A. (2012). Multi- locus species
delimitation in closely related animals and fungi: One marker is
not enough. Molecular Ecology, 21(18), 4422– 4436. https://doi.
org /10.1111/j.1365- 294X. 2012. 05642.x
Excoffier, L., Foll, M., & Petit, R. J. (2009). Genetic consequences of range
expansions. Annual Review of Ecolog y, Evolution, and Systematics, 40,
4 8 1 – 5 0 1 .
François, D., Ursenbacher, S., Boissinot, A ., Ysnel, F., & Lourdais, O.
(2021). Isolation- by- distance and male- biased dispersal at a fine
spatial scale: A study of the common European adder (Vipera
berus) in a rural landscape. Conservation Genetics, 1– 1 5 , h t tps://d o i .
o r g / 1 0 . 1 0 0 7 / s 1 0 5 9 2 - 0 2 1 - 0 1 3 6 5 - y
Freitas, I., Ursenbacher, S., Mebert, K., Zinenko, O., Schweiger, S., Wüster,
W., Brito, J. C., Crnobrnja- Isailović, J., Halpern, B., Fahd, S., Santos,
X., Pleguezuelos, J. M., Joger, U., Orlov, N., Mizsei, E., Lourdais, O.,
Zuffi, M. A. L., Strugariu, A., Zamfirescu, S. R., … Martínez- Freiría,
F. (2020). Evaluating taxonomic inflation: Towards evidence- based
species delimitation in Eurasian vipers (Serpentes: Viperinae).
Amphibia- Reptilia, 41, 285– 311. https://doi.org/10.1163/15685
381- bja10007
Friesen, V. L., Congdon, B. C., Kidd, M. G., & Birt, T. P. (1999). Polymerase
chain reaction (PCR) primers for the amplification of five nuclear
introns in vertebrates. Molecular Ecology, 8, 2147– 2149. https ://doi.
o r g / 1 0 . 1 0 4 6 / j . 1 3 6 5 - 2 9 4 x . 1 9 9 9 . 0 0 8 0 2 - 4 . x
Funk, D. F., & Omland, K. E. (2003). Species level paraphyly and poly-
phyly: Frequency, causes, and consequences, with insights from
animal mitochondrial DNA. Annual Review of Ecology Evolution and
Systematics, 34, 397– 423. https://doi.org/10.1146/annur ev.ecols
ys.34.011802.132421
Ghielmi, S., Menegon, M., Mardsen, S. J., Laddaga, L., & Ursenbacher,
S. (2016). A new vertebrate for Europe: The discovery of a
range- restricted relict viper in the western Italian Alps. Journal
of Zoological Systematics and Evolutionar y Research, 54, 161– 176.
https://doi.or g/10.1111/jzs.12138
Groth, J. G., & Barrowclough, G. F. (1999). Basal divergences in birds
and the phylogenetic utility of the nuclear RAG- 1 gene. Molecular
Phylogenetics and Evolution, 12, 115– 123. https://doi.org/10.1006/
mpev.1998.0603
Guiller, G., Lourdais, O., & Ursenbacher, S. (2017). Hybridization between
a Euro- Siberian (Vipera berus) and a Para- Mediterranean viper (V.
aspis) at their contact zone in western France. Journal of Zoology,
302, 138– 147. https://doi.org/10.1111/jzo.12431
Han, D., Zhou, K., & Bauer, A. M. (2004). Phylogenetic relationships
among gekkotan lizards inferred from C- mos nuclear DNA se-
quences and a new classification of the Gekkota. Biological
Journal of the Linnean Society, 83, 353– 368. https://doi.
org /10.1111/j.1095- 8312.2004.0 0393.x
Hofmann, S., Fritzsche, P., Solhøy, T., Dorge, T., & Miehe, G. (2012).
Evidence of sex- biased dispersal in Thermophis baileyi inferred from
microsatellite markers. Herpetologica, 68(4), 514– 522. https://doi.
o r g / 1 0 . 1 6 5 5 / H E R P E T O L O G I C A - D - 1 2 - 0 0 0 1 7
Jacobs, S. J., Kristofferson, C., Uribe- Convers, S., Latvis, M., & Tank, D.
C. (2018). Incongruence in molecular species delimitation schemes:
What to do when adding more data is difficult. Molecular Ecology,
27(10), 2397– 2413. https://doi.org/10.1111/mec.14590
Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K. (2018). MEGA
X: Molecular Evolutionary Genetics Analysis across computing
platforms. Molecular Biology and Evolution, 35, 1547– 1549. https://
doi.org/10.1093/molbe v/msy096
Leigh, J. W., & Bryant, D. (2015). PopART: Full- feature software for hap-
lotype network construction. Methods in Ecology and Evolution, 6,
1110– 1116. https://doi.org/10.1111/2041- 210X .12410
Miralles, A., Geniez, P., Beddek, M., Mendez Aranda, D., Brito, J. C.,
Leblois, R., & Crochet, P.- A. (2020). Morphology and multilocus
phylogeny of the Spiny- footed Lizard ( Acanthodactylus erythrurus)
complex reveal two new mountain species from the Moroccan
Atlas. Zootaxa, 4747, 302– 326. https://doi.org/10.11646/ zoota
xa.4747.2.4
Mizsei, E., Jablonski, D., Roussos, S. A., Dimaki, M., Ioannidis, Y., Nilson,
G., & Nagy, Z. T. (2017). Nuclear markers support the mitochondrial
phylogeny of Vipera ursinii– renardi complex (Squamata: Viperidae)
and species status for the Greek meadow viper. Zootaxa, 4227, 75–
88. https://doi.org/10.11646/ zoota xa.4227.1.4
Moore, W. S. (1995). Inferring phylogenies from mtDNA variation:
Mitochondrial- gene trees versus nuclear- gene trees. Evolution, 49,
718– 726. https://doi.org/10.1111/j.1558- 5646.1995.tb023 08.x
Moritz, C. (1994). Defining ‘evolutionarily significant units’ for conser-
vation. Trends in Ecology and Evolution, 9(10), 373– 375. https://doi.
o r g / 1 0 . 1 0 1 6 / 0 1 6 9 - 5 3 4 7 ( 9 4 ) 9 0 0 5 7 - 4
Nater, A., Mattle- Greminger, M. P., Nurcahyo, A., Nowak, M. G., de
Manuel, M., Desai, T., Groves, C., Pybus, M., Sonay, T. B., Roos, C.,
Lameira, A. R., Wich, S. A., Askew, J., Davila- Ross, M., Fredriksson,
G., de Valles, G., Casals, F., Prado- Martinez, J., Goossens, B., …
Krützen, M. (2017). Morphometric, behavioral, and genomic evi-
dence for a new orangutan species. Current Biology, 27, 3487– 3498.
https://doi.org/10.1016/j.cub.2017.09.047
Petit, R. J., & Excoffier, L. (20 09). Gene flow and species delimita-
tion. Trends in Ecology & Evolution, 24(7), 386– 393. https://doi.
org/10.1016/j.tree.2009.02.011
Pinho, C., Harris, D. J., & Ferrand, N. (2008). Non- equilibrium estimates
of gene flow inferred from nuclear genealogies suggest that Iberian
and North African wall lizards (Podarcis spp.) are an assemblage
of incipient species. BMC Evolutionary Biology, 8, 63. https://doi.
o r g / 1 0 . 1 1 8 6 / 1 4 7 1- 2 1 4 8 - 8 - 6 3
Pinho, C., Rocha, S., Carvalho, B. M., Lopes, S., Mourao, S., Vallinoto,
M., Brunes, O. T., Haddad, C. F. B., Gonçalves, H., Sequeira, F., &
Ferrand, N. (2010). New primers fo r the amplification and sequenc-
ing of nuclear loci in a taxonomically wide set of reptiles and am-
phibians. Conservation Genetics Resources, 2, 181– 185. https://doi.
o r g / 1 0 . 1 0 0 7 / s 1 2 6 8 6 - 0 0 9 - 9 1 2 6 - 4
Renoult, J. P., Geniez, P., Bacquet, P., Benoit, L ., & Crochet, P. A.
(2009). Morphology and nuclear markers reveal extensive
mitochondrial introgressions in the Iberian Wall Lizard spe-
cies complex. Molecular Ecology, 18, 4298– 4315. https://doi.
org /10.1111/j.1365- 294X. 20 09.04 351. x
Ronquist, F., & Huelsenbeck, J. P. (2001). MRBAYES: Bayesian inference
of phylogeny. Bioinformatics, 17, 754– 755.
Rozas, J., Ferrer- Mata, A ., Sánchez- DelBarrio, J. C., Guirao- Rico, S.,
Librado, P., Ramos- Onsins, S. E., & Sánchez- Gracia, A. (2017).
DnaSP 6: DNA Sequence Polymorphism Analysis of Large
Datasets. Molecular Biology and Evolution, 34, 3299– 3302. https://
doi.org/10.1093/molbe v/msx248
Schmidtler, J., & Hansbauer, G. (2020). Die Alpenk reuzot ter (Vipera b erus
marasso), eine neue Unterar t in den Bayerischen Alpen. Zeitschrift
für Feldherpetologie, 27, 136– 148.
Seghetti, S. M., Villa, A., Tschopp, E., Bernardini, F., Laddaga, L., Fanelli,
M., Levi, R., & Delfino, M. (2021). Skull osteology of Vipera walser
(Squamata, Viperidae): Description, variability, ontogeny, and di-
agnostic characters in the frame of the Italian vipers. Journal of
Morphology Online Early, 282, 5– 47. https://doi.org/10.1002/
jmor.21279
Seixas, F. A., Boursot, P., & Melo- Ferreira, J. (2018). The genomic im-
pact of historical hybridization with massive mitochondrial DNA

14
|
D ONIOL- VALCROZE Et AL.
introgression. Genome Biology, 19, 91. https://doi.org/10.1186/
s 1 3 0 5 9 - 0 1 8 - 1 4 7 1 - 8
Senczuk, G., Castiglia, R., & Böhme, W. (2019). Podarcis siculus latastei
(Bedriaga, 1879) of the Western Pontine Islands (Italy) raised to the
species rank, and a brief taxonomic overview of Podarcis lizards. Acta
Herpetologica, 14(2), 71– 80. https://doi.org/10.13128/ a_h- 7744
Šmíd, J., & Tolley, K. A. (2019). Calibrating the tree of vipers under the
fossilized birth- death model. Scientific Reports, 9(1), 1– 10. https://
d o i . o r g / 1 0 . 1 0 3 8 / s 4 1 5 9 8 - 0 1 9 - 4 1 2 9 0 - 2
Speybroeck, J., Beukema, W., Dufresnes, C., Fritz, U., Jablonski, D.,
Lymberakis, P., Martínez- Solano, I., Razzetti, E., Vamberger, M.,
Vences, M., Vörös, J., & Crochet, P.- A. (2020). Species list of the
European herpetofauna - update by the Taxonomic Committee of
the Societas Europaea Herpetologica. Amphibia- Reptilia, 41, 139–
189. https://doi.org/10.1163/15685 381- bja10010
Stephens, M., Smith, N., & Donnelly, P. (2001). A new statistical method for
haplotype reconstruction from population data. American Jou rnal of
Human Genetics, 68, 978– 989. https://doi.org/10.1086/319501
Tarroso, P., Pereira, R. J., Martinez- Freiria, F., Godinho, R., & Brito, J. C.
(2014). Hybridization at an ecotone: Ecological and genetic barriers
between three Iberian vipers. Molecular Ecology, 23, 1108– 1123.
https://doi.or g/10.1111/m ec .12671
Toews, D. P., & Brelsford, A . (2012). The biogeography of mitochondrial
and nuclear discordance in animals. Molecular Ecology, 21, 3907–
3930. https://doi.org/10.1111/j.1365- 294X.2012.05664.x
Toews, D. P., Taylor, S. A., Vallender, R., Brelsford, A., Butcher, B. G.,
Messer, P. W., & Lovette, I. J. (2016). Plumage genes and little else
distinguish the genomes of hybridizing warblers. Current Biology,
26(17), 2313– 2318. https://doi.org/10.1016/j.cub.2016.06.034
Townsend, T. M., Alegre, R. E., Kelley, S. T., Wiens, J. J., & Reeder, T. W.
(2008). Rapid development of multiple nuclear loci for phylogenetic
analysis using genomic resources: An example from squamate rep-
tiles. Molecular Phylogenetics and Evolution, 47, 129– 142. https://
doi.org/10.1016/j.ympev.2008.01.008
Ursenbacher, S., Carlsson, M., Helfer, V., Tegelström, H., & Fumagalli,
L. (2006). Phylogeography and Pleistocene refugia of the
adder (Vipera berus) as inferred from mitochondrial DNA se-
quence data. Molecular Ecology, 15, 3425– 3437. https://doi.
org /10.1111/j.1365- 294X. 20 06.0 3031.x
Vasconcelos, R., Köhler, G., Geniez, P., & Crochet, P.- A . (2020). A new
endemic species of Hemidactylus (Squamata: Gek konidae) from São
Nicolau, Island, Cabo Verde. Zootaxa, 4 878, 501– 522. https://doi.
o r g / 1 0 . 1 1 6 4 6 / z o o t a x a . 4 8 7 8 . 3 . 4
Wielstra, B., & Arntzen, J. W. (2020). Extensive cytonuclear discordance
in a crested newt from the Balkan Peninsula glacial refugium.
Biological Journal of the Linnean Society, 130 (3), 578– 585. https://
doi.org/10.1093/bioli nnean/ blaa062
Zieliński, P., Nadachowska- Brzyska, K., Wielstra, B., Szkotak, R., Covaciu-
Marcov, S. D., Cogălniceanu, D., & Babik, W. (2013). No evidence
for nuclear introgression despite complete mt DNA replacement
in the C arpathian newt (Lissotriton montandoni). Molecular Ecology,
22(7), 18 84– 1903. ht tps://doi.org/10.1111/mec.12225
Zinenko, O., Sovic, M., Joger, U., & Gibbs, H. L. (2016). Hybrid ori-
gin of European Vipers (Vipera magnifica and Vipera orlovi) from
the Caucasus determined using genomic scale DNA markers.
BMC Evolutionary Biology, 16, 76. https://doi.org/10.1186/s1286
2 - 0 1 6 - 0 6 4 7 - 7
Zwahlen, V., Nanni- Geser, S., Kaiser, L., Golay, J., Dubey, S., &
Ursenbacher, S. (2021). Only males care about their environment:
Sex- biased dispersal in the asp viper (Vipera aspis). Biological Journal
of the Linnean Society, 132(1), 104– 115. https://doi.org/10.1093/
bioli nnean/ blaa177
SUPPORTING INFORMATION
Additional supporting information may be found in the online version
of the article at the publisher’s website.
Figure S1. Maximum- likelihood tree based on the concatenation of
the five nuclear genes; the numbers at the nodes are the bootstrap
support (1000 repetitions).
Figure S2. Neighbor- joining tree based on the concatenation of the
five nuclear genes; the numbers at the nodes are the bootstrap sup-
port (1000 repetitions).
Figure S3. Bayesian tree based on the concatenation of the five
nuclear genes with Montivipera raddei and Daboia russelii as out-
groups, the numbers at the nodes are the posterior probabilities.
Figure S4. Maximum- likelihood tree based on the concatenation of
the five nuclear genes with Montivipera raddei and Daboia russelii
as outgroups; the numbers at the nodes are the bootstrap support
(100 repetitions).
Alignment S1. Sequence alignment for NT3 gene.
Alignment S2. Sequence alignment for R35 gene.
Alignment S3. Sequence alignment for RAG1 gene.
Alignment S4. Sequence alignment for BDNF gene.
Alignment S5. Sequence alignment for OD gene.
How to cite this article: Doniol- Valcroze, P., Ursenbacher, S.,
Mebert, K., Ghielmi, S., Laddaga, L., Sourrouille, P., Kariş, M., &
Crochet, P.- A. (2021). Conflicting relationships of Vipera walser
inferred from nuclear genes sequences and mitochondrial
DNA. Journal of Zoological Systematics and Evolutionary
Research, 00, 1– 14. https://doi.org/10.1111/jzs.12543