Content uploaded by Peter J Thompson
Author content
All content in this area was uploaded by Peter J Thompson on Oct 23, 2017
Content may be subject to copyright.
Content uploaded by Peter J Thompson
Author content
All content in this area was uploaded by Peter J Thompson on Oct 23, 2017
Content may be subject to copyright.
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Author's personal copy
CECR2 Is Involved in Spermatogenesis and Forms a
Complex with SNF2H in the Testis
Peter J. Thompson, Kacie A. Norton, Farshad H. Niri,
Christine E. Dawe and Heather E. McDermid⁎
Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canada T6G 2E9
Received 14 March 2011;
received in revised form
22 November 2011;
accepted 22 November 2011
Available online
2 December 2011
Edited by J. Karn
Keywords:
CECR2;
SNF2H/SMARCA5 SNF2L/
SMARCA1;
ISWI;
spermatogenesis;
chromatin remodeling
The regulation of nucleosome positioning and composition by ATP-
dependent chromatin remodeling enzymes and their associated binding
partners plays important biological roles in mammals. CECR2 is a
binding partner to the ISWI (imitation switch) ATPase SNF2L/SMARCA1
and is involved in neural tube closure and inner ear development;
however, its functions in adult tissues have not been examined. Here, we
report that CECR2 contributes to spermatogenesis and forms a complex
that includes the other ISWI ATPase SNF2H/SMARCA5 in the testis.
Cecr2 mutant males non-penetrant for neural tube defects sired smaller
litters than wild-type males. Strikingly, while we found that Cecr2
mutants have normal seminiferous epithelium morphology, sperm count,
motility, and morphology, the mutant spermatozoa were compromised in
their ability to fertilize oocytes. Investigation of CECR2/ISWI complexes
in the testis showed that SNF2H interacted with CECR2, and this
interaction was also observed in embryonic stem cells, suggesting that
CECR2 may interact with SNF2H or SNF2L depending on the cell type.
Finally, we found that Cecr2 mutants exhibit misregulation of the
homeobox transcription factor Dlx5 in the testis, suggesting that CECR2
complexes may regulate gene expression during spermatogenesis. Taken
together, our results demonstrate a novel role of CECR2-containing
complexes in spermatogenesis and show that CECR2 interacts predom-
inantly with SNF2H instead of SNF2L in the testis.
© 2011 Elsevier Ltd. All rights reserved.
Introduction
A key mechanism controlling the composition,
dynamics, and positioning of nucleosomes in eukary-
otes is the activity of ATP-dependent chromatin
remodeling complexes.
1
The ISWI (imitation switch)
family of ATPases consists of two homologues in
mammals, SNF2H/SMARCA5 and SNF2L/
SMARCA1, which exhibit ∼80% identity at the
protein level.
2
There are a total of eight known
mammalian ISWI complexes identified in human
and/or mouse cells, in which either SNF2H or SNF2L
is incorporated as the catalytic subunit. SNF2H is in
six of these complexes (ACF, CHRAC, WICH, WCRF,
RSF, and NoRC
3–8
), while SNF2L is in NURF and
CERF.
9,10
In vivo, ISWI complexes have many diverse
functions including replication of pericentric hetero-
chromatin,
11,12
ribosomal RNA gene repression,
13
developmental gene regulation,
9,14
and maintenance
of chromosome structure.
15
Genetic studies in mice
suggest that SNF2H-containing complexes are
*Corresponding author. University of Alberta, G-508
Biological Sciences Building, Edmonton, Alberta, Canada
T6G 2E9. E-mail address: heather.mcdermid@ualberta.ca.
Present address: P. J. Thompson, Department of
Medical Genetics, The University of British Columbia,
Vancouver, British Columbia, Canada V6T 1Z3.
Abbreviations used: Xgal, 5-bromo-4-chloro-3-
indolyl-β,D-galactopyranoside; RT, reverse transcriptase;
qRT-PCR, quantitative RT-PCR; IP, immunoprecipitation.
doi:10.1016/j.jmb.2011.11.041 J. Mol. Biol. (2012) 415, 793–806
Contents lists available at www.sciencedirect.com
Journal of Molecular Biology
journal homepage: http://ees.elsevier.com.jmb
0022-2836/$ - see front matter © 2011 Elsevier Ltd. All rights reserved.
Author's personal copy
essential for early development,
16
while SNF2L-
containing complexes are involved in oogenesis.
17
The SNF2L-containing complex CERF was puri-
fied from human embryonic kidney cells (HEK293)
and includes the bromodomain-containing protein
CECR2.
10
CECR2-containing complexes play im-
portant roles in embryogenesis, since mutations in
Cecr2 causes neural tube and inner ear defects;
10,18,19
however, the role of CECR2 in adult tissues has not
been investigated. In the present study, we investi-
gated the role of CECR2 in the male germ line and
report that CECR2 is involved in spermatogenesis.
In mutant males without neural tube defects, Cecr2
was highly expressed in adult spermatogonia, and
Cecr2 mutant males sired significantly smaller litters
than wild-type females. Loss of Cecr2 in males
resulted in a lower percentage of fertilized oocytes,
although those successfully fertilized appeared to
develop to blastocysts in culture. We also found that
CECR2 interacted with SNF2H, rather than SNF2L,
in the adult testis. We observed a similar interaction
with SNF2H in embryonic stem cells, raising the
possibility that CECR2 incorporates into complexes
with either SNF2H or SNF2L depending on the cell
type. Finally, we found that loss of functional
CECR2 affects expression of the homeobox tran-
scription factor Dlx5 in the testis. Together, our
results indicate that CECR2 contributes to sper-
matogenesis and forms complexes with SNF2H in
the testis.
Results
Mutation of Cecr2 affects litter sizes but does
not cause gross morphological changes to the
seminiferous epithelium or mature spermatozoa
BALB/c Cecr2
Gt45Bic
(Cecr2
Gt
) homozygous mu-
tants develop neural tube defects at 74% pene-
trance.
10
The ∼26% non-penetrant animals are
viable, but we noticed that some mutant males
were unable to sire pups. Two homozygous
mutant studs unable to sire pups were necropsied
and found to have compromised spermatogenesis
with an abnormally low cellular density in the
seminiferous epithelium, reduced spermatozoa per
tubule, and a lower than usual number of active
tubules (data not shown). Furthermore, there was a
notable reduction in the number of spermatozoa in
the epididymis and a large number of degenerate
seminiferous cells and cellular fragments mixed in
with the spermatozoa, suggesting a possible defect
in sperm development and maturation. This led us
to conduct a more comprehensive study of sper-
matogenesis and fertility in Cecr2
Gt
mutant males,
which revealed a more subtle phenotype in most
animals.
To examine whether Cecr2 is expressed in the male
germ line, we profiled the expression of the mutant
reporter protein CECR2
Gt
during testis develop-
ment in homozygous mutant embryos and adults
non-penetrant for neural tube defects. CECR2
Gt
is
the CECR2–β-galactosidase fusion protein product
of Cecr2
Gt
in which the 290 N-terminal amino acids
encoding the DDT domain and AT-hook of CECR2
are spliced to a βgeo cassette, effectively deleting the
bromodomain and C-terminal two-thirds of the
protein (Fig. 1a). 5-Bromo-4-chloro-3-indolyl-β,D-
galactopyranoside (Xgal) staining revealed Cecr2
expression as early as E16.5 in the gonocytes of the
sex cords (Fig. 1b). Expression persisted in the
gonocytes throughout the development of the testes
and remained high in the adult, where staining was
strong in spermatogonia, lower in spermatocytes
and was not present in further differentiated cells
such as the elongate spermatids (Fig. 1b). While
there was no CECR2
Gt
staining in the Leydig cells at
E16.5, staining was evident in Leydig cells of the
adult testis (data not shown). Wild-type males
showed no endogenous staining in the testes
(Fig. 1b). To assess whether the Cecr2
Gt
mutants
exhibited any abnormal phenotypes related to
spermatogenesis and fertility, we determined litter
sizes produced by Cecr2
Gt
homozygous mutants
compared to wild type when each was mated to
wild-type females (Fig. 1c). We found that, on
average, mutants sired significantly smaller litters
(average of 4.5 pups in 22 litters) compared to wild
type (average of 6.5 pups in 70 litters) (Fig. 1c;
p=0.022). The range of litter sizes produced by wild-
type males approximated a normal distribution as
expected. In contrast, five out of the eleven Cecr2
Gt
non-penetrant males tested (45.5%) never produced
a litter greater than four pups, and one male out of
the eleven males tested was unable to sire any pups
during the test period (two females were tested). All
23 wild-type males tested were able to produce
litters greater than four at least once in their
breeding history, and no sterile matings were
observed. The length of time for Cecr2
Gt
mutant
males to successfully mate with a female was
generally within 1–4 days and was comparable to
that of wild-type individuals within our colony.
Mating behavior in the mutants appeared similar to
that of wild-type males (data not shown). Taken
together, these data suggest that CECR2 contributes
to fertility.
We next ascertained whether the sub-fertility
phenotype of Cecr2 mutants could be explained by
abnormal spermatogenesis, such as a defect in either
self-renewal or meiotic differentiation of spermato-
gonia, where CECR2 was strongly expressed
(Fig. 1b). We calculated the spermatid–spermatogo-
nia (SD–SG) ratio in five of the fertility-tested Cecr2
mutants compared to four wild-type males, since
this ratio would indicate defects in spermatogonia
794 CECR2 Is Involved in Spermatogenesis
Author's personal copy
self-renewal as a larger SD–SG ratio compared to
wild type or defects in differentiation as smaller SD–
SG ratio compared to wild type. However, we found
that there was no significant difference in the SD–SG
ratios (Fig. 2a; p= 0.102), and both wild-type and
mutant males had ratios of ∼2, consistent with
normal spermatogonia self-renewal and differentia-
tion. In addition, examination of the seminiferous
epithelium of Cecr2 mutants did not reveal any obvi-
ous abnormalities in cellular morphology compared
Fig. 1. Cecr2
Gt
mutants sire significantly smaller litters than wild-type males. (a) Schematic of wild-type CECR2 protein
compared to the CECR2
Gt
mutant reporter protein. DDT, domain in different transcription factors; AT-hook, AT-rich
sequence binding motif; NLS, nuclear localization signal. (b) Xgal staining pattern of CECR2
Gt
in the male gonad at E16.5
and E19.5, at postnatal day 0 (P0), and in adult (≥6 weeks old). Black arrows indicate CECR2
Gt
staining in gonocytes
(E19.5 and P0) and spermatogonia (adult), respectively. Wild-type tissues (Cecr2
+/+
) were Xgal stained as negative
controls. (c) Histogram displays the average number of pups per litter sired by either BALB/c wild-type males (70 litters)
or Cecr2
Gt
mutant males (22 litters) where both were crossed with wild-type females. Frequency plots show the same data
distributed by frequency of litter size for wild type (upper plot) or Cecr2 mutants (lower plot). Error bars represent SD,
and asterisks indicate p=0.022, two-tailed T-test.
795CECR2 Is Involved in Spermatogenesis
Author's personal copy
to wild type (Fig. 2b). Furthermore, we assessed
whether changes in spermatozoa numbers or motil-
ity could underlie the reduced fertility in Cecr2
mutants. However, spermatozoa collected from the
cauda epididymis of Cecr2 mutants appeared
morphologically normal and motile when compared
to wild-type males (data not shown). From these
data, we conclude that CECR2 contributes to fertility
in a manner that usually does not drastically alter
spermatogonia self-renewal or differentiation. Thus,
the original two infertile males examined were
atypical.
Cecr2 mutant spermatozoa are compromised in
their ability to fertilize oocytes
Since most Cecr2 mutants exhibited reduced
fertility without showing obvious defects in semi-
niferous tubule morphology, ratios of spermatids-
to-spermatogonia, or spermatozoa motility, we
asked whether the reduced fertility could be
explained by defects in oocyte fertilization or
compromised viability of embryos. We focused
our analysis on four mutant males and three
matched wild-type males, none of which were
included in the previous analysis. Fertility testing
of wild-type or mutant males with wild-type
females was performed by scoring embryos this
time rather than live births to determine whether the
reduction in litter size was due to an increase in
resorbed embryos or early death. Analysis con-
firmed that the mutants had a significant reduction
in the average number of live embryos compared to
wild type, which was comparable to our previous
analysis (Fig. 1c). Due to considerable inter-litter size
variation for each male, the litter sizes were pooled
for each genotype and compared by the Wilcoxon
Rank Sum test and found to be significantly
different (p= 0.0011; Table 1). Average litter size for
each male ranged from 6.00 to 6.88 for wild-type
males and from 2.86 to 5.29 for mutants. However,
we observed similar numbers of resorbed or dead
embryos in litters sired by wild-type and Cecr2
mutant males (Table 1). This suggests that increased
embryo death does not account for the decreased
litter sizes in mutant males.
We performed detailed analyses of sperm count,
morphology, and motility of mature sperm from the
cauda epididymis in the three wild-type males and
the three mutant males with the smallest average
litter size (Table 2). We did not observe any
significant differences in total sperm counts, motility
patterns, or morphology of mutant sperm compared
to wild type (Table 2). Therefore, loss of Cecr2 does
not result in visibly abnormal sperm.
Prior to sperm analysis, we used two wild-type
fertility-tested males and two mutant fertility-tested
males to determine whether preimplantation em-
bryos sired by Cecr2 mutants exhibited reduced
survival to the blastocyst stage or whether mutant
sperm exhibited a reduced ability to fertilize
oocytes. Wild-type FVB/N females were induced
to superovulate and then mated with either a wild-
type or a mutant male. The following day, oocytes
Fig. 2. Cecr2
Gt
mutants do not
have significant changes in sperma-
tid–spermatogonia ratios or semi-
niferous epithelium morphology
compared to wild type. (a) Elongat-
ed spermatids and spermatogonia
from four BALB/c wild-type males
and five Cecr2
Gt
mutant males were
counted (blind to genotype), and a
ratio was calculated from images
(n=10) of seminiferous tubule
cross-section images for each male.
Each wild-type and Cecr2 mutant
male had been previously been
housed with at least one female.
Error bars are standard errors of the
mean (p=0.102, two-tailed T-test).
(b) Wild-type and Cecr2
Gtc
mutant
testes were sectioned and stained
with hematoxylin and eosin. Im-
ages show the seminiferous epithe-
lium at 630× magnification. Scale
bars represent 50 μm.
796 CECR2 Is Involved in Spermatogenesis
Author's personal copy
were isolated and cultured in vitro. Freshly isolated
oocytes were first observed under phase-contrast
microscopy to identify the number of zygotes that
had formed as evidenced by maternal and paternal
pronuclei. Zygotes were cultured for an additional
3–4 days, and the number of zygotes that survived
to blastocysts was recorded. While zygotes sired by
wild-type males showed ∼81% average survival to
blastocysts, zygotes sired by Cecr2 mutants had an
average survival of only ∼39% (pb0.0001; Table 3).
More importantly, however, we observed that the
number of fertilized oocytes was significantly
smaller for Cecr2 mutants compared to wild type
(∼40% versus ∼78%, respectively, and p= 0.0031;
Table 3). Furthermore, the survival of fertilized
oocytes to blastocysts was not different between
wild-type and Cecr2 mutant males (∼100% versus
∼81%, respectively; Table 3). These data indicate
that mutation of Cecr2 compromises the ability of
sperm to fertilize oocytes and that reduced fertili-
zation underlies the observed reduction of surviving
blastocysts sired by Cecr2 mutants.
Analysis of the mutant protein CECR2
Gt
reveals
different isoforms in ES cells compared to adult
testis
We next investigated the composition of endoge-
nous CECR2-containing complexes in the germ line.
Since our previous attempts in generating polyclon-
al antibodies to mouse CECR2 were unsuccessful,
we chose to investigate the CECR2
Gt
reporter
protein instead (Fig. 1a). Importantly, CECR2
Gt
retains the DDT domain, which is necessary for
the interaction between ISWI proteins and their
binding partners, as shown for Drosophila ACF1 and
ISWI
20
and human RSF1 and SNF2H.
21
CECR2
Gt
also retains the AT-hook, which typically functions
as an AT-rich DNA-binding domain.
22
Further-
more, although CECR2
GT
lacks the putative nuclear
localization signal of CECR2, immunofluorescence
analysis on the Cecr2
Gt45Bic
heterozygous mouse ES
cell line CT45 showed that it is retained in the nucleus
and co-localizes with mitotic chromosomes.
23
Based
on these observations, we determined that CECR2
Gt
would be a suitable endogenous reporter protein for
investigating CECR2/ISWI complexes in vivo.
We performed Western blot analysis using β-
galactosidase antibodies on nuclear extracts pre-
pared from CT45 ES cells, E13.5 embryos, perinatal
brain, and a panel of adult tissues (Fig. 3a and b).
CECR2
Gt
was specifically detected as a single band
at the expected size of ∼180 kDa in whole embryos
and adult testis (Fig. 3a), but levels were low or
undetectable in perinatal brain, adult brain, liver,
and kidney. In CT45 cells, CECR2
Gt
was present as a
faster migrating band at ∼160 kDa (Fig. 3b). Since
the differences in apparent protein size could be due
to alternative splicing within the first seven exons of
Table 1. Fertility analysis of wild-type and Cecr2 mutant males
Cecr2
+/+
506 Cecr2
+/+
2019 Cecr2
+/+
2020 Cecr2
Gt/Gt
1934 Cecr2
Gt/Gt
2018 Cecr2
Gt/Gt
2056 Cecr2
Gt/Gt
2058
Embryos Resorbed Embryos Resorbed Embryos Resorbed Embryos Resorbed Embryos Resorbed Embryos Resorbed Embryos Resorbed
60100 145021 31 20
63 70 814120 61 12
70 901002330 70 24
70 22 805230 20 30
53 62 526131 12110
81 14 703221110 20
81 71 704250 70100
61 9062
40 71
80
6.50 0.90 6.00 1.29 6.88 0.88 4.67 1.56 2.86 0.43 5.29 0.57 4.43 0.86
Litter sizes were averaged for each genotype to assess statistical significance
Wild type Mutant Significance
Average litter size 6.46 4.31 p=0.0011
Average resorbed 1.02 0.85 Not significant
797CECR2 Is Involved in Spermatogenesis
Author's personal copy
Table 3. Fertilization and blastocyst survival of embryos sired by wild-type and Cecr2 mutant males
Genotype Pronuclei Blastocysts Total oocytes Pronuclei/total (%) Blastocysts/total (%) Blastocysts/pronuclei (%)
Cecr2
+/+
506 7 7 8 87.5 87.5 100.0
2 3 5 40.0 60.0 ∼100.0
7 7 9 77.8 77.8 100.0
13 15 17 76.5 88.2 ∼100.0
—10 17 —58.8 —
—12 14 —85.7 —
—13 23 —56.5 —
—16 16 —100.0 —
—78 —87.5 —
4 4 4 100.0 100.0 100.0
Cecr2
+/+
2020 9 12 21 42.9 57.1 ∼100.0
14 14 14 100.0 100.0 100.0
—13 14 —92.9 —
—12 13 —92.3 —
—916 —56.3 —
6 6 6 100.0 100.0 100.0
Average Cecr2
+/+
10 11 14 78.1
a
81.3
b
100.0
c
Cecr2
Gt/Gt
1934 0 2 18 0.0 11.1 ∼100.0
5 4 9 55.6 44.4 79.9
6 8 13 46.2 61.5 ∼100.0
—620 —30.0 —
—621 —28.6 —
—14 18 —77.8 —
—823 —34.8 —
2 1 5 40.0 20.0 50.0
6 0 10 60.0 0.0 0.0
Cecr2
Gt/Gt
2018 6 10 20 30.0 50.0 ∼100.0
5 5 8 62.5 62.5 100.0
—810 —80.0 —
—11 17 —64.7 —
—11 19 —57.9 —
—10 20 —50.0 —
3 4 10 30.0 40.0 ∼100.0
4 6 10 40.0 60.0 ∼100.0
Average Cecr2
Gt/Gt
4 7 15 40.0
a
38.8
b
81.1
c
c
pN0.05, Mann–Whitney test.
Bold highlights the average values across the rows.
—, pronuclei not scored.
∼approximates 100%, number of blastocysts slightly exceeded pronuclei.
a
pb0.001, Mann–Whitney test.
b
p=0.0031, Mann–Whitney test.
Table 2. Analysis of mature sperm of wild-type and Cecr2 mutant males
Genotype
Cecr2
+/+
506
Cecr2
+/+
2019
Cecr2
+/+
2020
Cecr2
Gt/Gt
1934
Cecr2
Gt/Gt
2018
Cecr2
Gt/Gt
2058
Average
Cecr2
+/+
Average
Cecr2
Gt/Gt
T-test
(p-value)
Sperm count
(×10
6
cells/ml)
7.6 9.5 6.7 6.3 6.0 7.0 7.9 6.4 0.162
SD 0.8 0.6 0.9 1.1 0.4 0.4 1.4 0.5 —
Motility (%)
Moving forward 53.2 47.1 50.2 64.0 37.6 45.4 50.2 49.0 0.891
Moving but
not forward
3.6 7.8 3.6 3.0 6.3 5.4 5.0 4.9 0.956
Tail motion only 39.2 29.9 35.9 24.5 44.9 39.0 35.0 36.1 0.873
Not moving 4.1 15.2 10.3 8.5 11.2 10.2 9.9 10.0 0.977
Morphology (%)
Linear/normal 67.6 76.1 70.8 69.2 75.5 61.3 71.5 68.7 0.587
Angulated
(N90°/hairpin)
21.7 13.7 17.2 20.7 16.5 25.0 17.5 20.7 0.397
Headless 10.7 10.2 12.0 10.1 8.0 13.7 11.0 10.6 0.844
SD=standard deviation.
798 CECR2 Is Involved in Spermatogenesis
Author's personal copy
Cecr2
Gt45Bic
transcripts, we performed reverse tran-
scriptase (RT)-PCR analysis of exons 1–7from
heterozygous adult testis and CT45 cells (Fig. 3c).
In both CT45 cells and testis, exons 1–7 were present
in Cecr2
Gt45Bic
transcripts, suggesting that the
differences in protein size may be due to posttrans-
lational modifications of CECR2
Gt
and, by exten-
sion, CECR2.
CECR2
Gt
forms distinct complexes with SNF2H
in the adult testis and ES cells
Human CECR2 interacts with SNF2L in embryonic
kidney cells;
10
therefore, we determined whether
mouse CECR2 also forms a complex with SNF2L or
whether it interacts with the other ISWI homologue
SNF2H in the testis. We used an immunoaffinity
approach to enrich for CECR2
Gt
-associated proteins
from testis nuclear extracts prepared from Cecr2
Gt45Bic
heterozygotes (Fig. 4a). Nuclear proteins were
first passed over a protein G-Sepharose column,
containing no antibody (mock), and then over a
β-galactosidase antibody column. The columns
were washed with a high salt buffer (containing
0.4 M NaCl) to minimize nonspecific binding,
and elution was performed at low pH. Western
blot analysis of the eluted fractions from each
column showed that the column retained CECR2
Gt
and SNF2H but not SNF2L (Fig. 4a). Consistent
with the idea that CECR2
Gt
interacts with SNF2H
independently of other SNF2H-associated proteins,
the immunoaffinity elutions did not contain detect-
able levels of ACF1 from ACF and CHRAC, WSTF
from WICH, RSF1 from RSF, or TIP5 from NoRC
(Fig. 4a). Similarly, TATA-binding protein was
undetectable in the elutions, consistent with
previous findings showing that ISWI complexes
including CERF do not contain general transcription
factors.
3–7,9,10
These data indicate that CECR2
Gt
interacts with SNF2H rather than SNF2L in the
adult testis and that the CECR2
Gt
/SNF2H
complex is independent of other SNF2H-containing
complexes.
We next assessed the native molecular weight of
the CECR2
Gt
/SNF2H complex by fractionating
heterozygous testis nuclear extracts over a gel-
filtration column equilibrated in a high salt buffer
(Fig. 4b). Western blot analysis of the fractions
showed that CECR2
Gt
eluted with the peak centered
at ∼0.9–1 MDa and was not detectable in the
fractions corresponding to the monomeric size
(∼200 kDa, fractions 42–44), suggesting that almost
all of it was incorporated into this complex (Fig. 4b).
SNF2H partially co-eluted with CECR2
Gt
, and the
peak of SNF2H eluted at a molecular mass of
∼600–700 kDa, consistent with the sizes of other
SNF2H-containing complexes such as ACF,
CHRAC, WICH, and NoRC.
5–8
Immunoprecipita-
tion (IP) of SNF2H from the co-eluting fractions
also precipitated CECR2
Gt
, demonstrating that these
Fig. 3. Analysis of the mutant CECR2
Gt
reporter protein. (a) Western blot of CECR2
Gt
in nuclear extracts (∼40 μg per
lane) prepared from E13.5 wild-type (+/+) and Cecr2
Gt
homozygous mutant embryos and adult testes. Molecular mass
markers (kDa) are shown to the left of the blots. (b) Western blot as in (a) except on nuclear extracts prepared from CT45
ES cells, three E13.5 Cecr2
Gt
heterozygous embryos, and Cecr2
Gt
heterozygous postnatal brain (P0), adult brain, liver,
kidney, and testis. Asterisk indicates a nonspecific band. (c) RT-PCR analysis of exons 1–7inCecr2
Gt45Bic
transcripts from
CT45 ES cells and heterozygous adult testis. Negative controls were performed by omitting RT from the cDNA synthesis
reaction. The amplicon size is 817 bp, and identification of the band as Cecr2 exons 1–7 was confirmed by sequencing.
−RT, no RT negative controls; M, DNA fragment size marker.
799CECR2 Is Involved in Spermatogenesis
Author's personal copy
fractions contain the CECR2
Gt
/SNF2H complex
(Fig. 4b). Treatment of the extract with ethidium
bromide did not alter the incorporation of CECR2
Gt
into this high-molecular-weight complex (Fig. 4c),
suggesting that the complex assembles independent-
ly of DNA. In addition, the high-molecular-weight
Fig. 4 (legend on next page)
800 CECR2 Is Involved in Spermatogenesis
Author's personal copy
CECR2
Gt
-containing complex appeared to be inde-
pendent of wild-type CECR2, since CECR2
Gt
eluted
around the same molecular weight in Cecr2 homo-
zygous mutant testis nuclear extract (Fig. 4d).
Finally, the other SNF2H-containing complexes
appeared unperturbed in the Cecr2 mutant testis
nuclear extracts, as the elution profile of SNF2H was
very similar compared to that of the heterozygous
testis with the peak elution fractions at ∼600–
700 kDa (Fig. 4d).
Finally, we chose to examine whether a similar
CECR2/SNF2H-containing complex is present in ES
cells, since we found that CECR2
Gt
was a different
size in ES cells compared to adult testes and whole
embryos (Fig. 3b). Fractionation of the CT45 ES cell
nuclear extract showed that CECR2
Gt
eluted over a
broad range of sizes from ∼200 to 800 kDa (fractions
36–42), with the peak centered at ∼300–400 kDa in
fraction 40, which was similar to the range of sizes
where SNF2H eluted (Fig. 4e). In contrast to adult
testis, a relatively large amount of CECR2
Gt
was
detected in fractions corresponding to the mono-
meric size at ∼67–200 kDa in fractions 42–46,
suggesting that not all the CECR2
Gt
is incorporated
into complexes in ES cells. IP of SNF2H from the
CECR2
Gt
peak fractions at the size range of ∼300–
400 kDa also pulled down CECR2
Gt
, demonstrating
that these fractions contain the complex (Fig. 4e).
Taken together, these results suggest that CECR2
Gt
forms distinct complexes with SNF2H in both the
adult testis and ES cells.
Mutation of Cecr2 results in reduced expression
of Dlx5
To investigate the cause of the fertilization defect
in Cecr2
Gt
mutant spermatozoa, we hypothesized
that there may be misregulation of genes encoding
factors involved in fertility. To determine a set of
candidate genes to test, we took advantage of our
previously generated microarray data set from E8.5
wild-type and Cecr2
Gt
mutant embryos.
18
Although
these embryos were female and prior to gonad
formation, we reasoned that there may be genes that
Fig. 4. CECR2
Gt
interacts in complexes with SNF2H in adult testes and ES cells. (a) Immunoaffinity enrichment of
CECR2
Gt
and associated proteins from Cecr2
Gt
heterozygous adult testis nuclear extract. Eluted fractions were analyzed
by Western blot to detect the indicated proteins. “Load”represents ∼0.6% of material loaded onto the column.
Approximately 7% of each fraction was loaded in the lanes. (b) Upper: gel-filtration fractionation and Western blot of
CECR2
Gt
and SNF2H in Cecr2
Gt
heterozygous testis nuclear extract. “IN”is ∼1% of material loaded onto the column,
“V
O
”is the void volume, and fraction numbers are indicated above the blot, with pooled fractions shown in boldface. The
CECR2
Gt
peak fraction 32 corresponded to a size of ∼0.9–1 MDa. Lower: IP of SNF2H from the CECR2
Gt
peak fractions
31–33, followed by Western blot. “IgG”is the purified mouse IgG negative control IP. (c) Gel filtration and Western blot of
CECR2
Gt
as in (b) except that ethidium bromide was added to the testis nuclear extract before gel filtration. (d) Gel
filtration and Western blot as in (b) except using Cecr2
Gt
homozygous mutant testis nuclear extract. (e) Upper: gel
filtration and Western blot as in (b) except using CT45 ES cell nuclear extract. The CECR2
Gt
peak fraction 40 corresponded
to a size of ∼300–400 kDa. SNF2H was detected in these fractions as two distinct isoforms, one at ∼135 kDa and the other
at the predicted size of ∼120 kDa (black arrows). Lower: IP of SNF2H from CECR2
Gt
peak fractions 39–41, followed by
Western blot as in (b).
Fig. 5. Cecr2
Gt
mutants exhibit significantly reduced expression of Dlx5. qRT-PCR analysis of the indicated genes using
cDNA derived from total testis RNA. Shown are the average expression fold changes in Cecr2
Gt
mutant males normalized
to wild type (n= 3 males per genotype); error bars are standard errors of the mean. Dlx5 expression is reduced by ∼35%;
asterisk indicates significance (p=0.0249, two-tailed T-test).
801CECR2 Is Involved in Spermatogenesis
Author's personal copy
function in both early development and later in the
gonads that these genes may be regulated by CECR2
at both time points. We considered strong candi-
dates based primarily on their fold changes in
Cecr2
Gt
mutant E8.5 embryos and, secondly, wheth-
er they had known phenotypes affecting spermato-
genesis and/or fertility. These criteria established 12
candidates: Peg3,Dlx5,Asb4,Met,Alx1,Ndn,Amph,
Unc5c,Aspm,Rad23b,Wwtr1, and Igf1r (Fig. 5).
Quantitative RT-PCR (qRT-PCR) analysis showed
that 11 of the candidates exhibited no significant
differences in expression in Cecr2
Gt
mutants com-
pared to wild type. However, we observed a
significant ∼35% reduction in the expression of
Dlx5 in Cecr2 mutants (Fig. 5;p= 0.0249), suggesting
that loss of CECR2 may influence expression of Dlx5
in the germ line.
Discussion
CECR2 contributes to sperm fertility and may
regulate Dlx5 in the testis
CECR2 plays important roles in neurulation and
inner ear development,
10,19
but its functional roles in
adult tissues have not been explored. In the present
study, we found that CECR2 influences the ability of
spermatozoa to fertilize oocytes. The oocytes that are
successfully fertilized by mutant sperm correlate to
formation of blastocysts in culture and presumably
develop into live pups in vivo. Strikingly, while Cecr2
is expressed during the development of the germ cells
in the testis (Fig. 1b), the explanation for the reduced
fertility is not due to gross morphological defects in
the seminiferous epithelium resulting in aberrant
spermatogenesis. Cecr2 mutants did not show obvi-
ous defects of spermatogenesis, such as reduced
spermatid-to-spermatogonia ratios, tubule morphol-
ogy, and counts and motility of mature spermatozoa
(Fig. 2 and Table 2). Since Cecr2 is expressed strongly
in spermatogonia, with reduced levels detected in
spermatocytes and was undetectable in spermatozoa
(Fig. 1b), it is likely that it influences gene expression
and/or chromatin structure in spermatogonia, which
is then transmitted to mature spermatozoa. We
hypothesized that CECR2 may contribute to the
regulation of a panel of candidate genes in the testis,
and we observed a significant reduction of ∼35% in
the expression of Dlx5 in Cecr2 mutant males (Fig. 5).
Dlx5 encodes an essential homeobox transcription
factor involved in craniofacial, nervous system, and
limb development
24
and is also misregulated in
Cecr2
Gt
mutant E8.5 embryos.
18
Interestingly, Dlx5
is expressed in the fetal testis at E12.5 onward and
DLX5 partners with the transcription factor GATA-4
to regulate StAR expression and control testicular
steroidogenesis in Leydig cells.
25
We did not observe
Cecr2 expression in Leydig cells at E16.5 (Fig. 1b), but
Cecr2 is expressed in adult Leydig cells. Although
Dlx5 is known to be expressed in adult testes,
26
the
specific cell type it is expressed in is not known. The
reduced expression of Dlx5 may be an indirect result
of misregulated gene expression during testis devel-
opment in Cecr2 mutants; however, it would be
interesting to determine whether DLX5 has a non-
steroidogenic function in adult germ cells.
One possibility is that Cecr2 mutant sperm may
have a general defect in penetration of the zona
pellucida of oocytes, and therefore, CECR2 may
contribute to the expression of enzymes in the
acrosome reaction or “capacitation”of sperm via
cAMP signaling pathways.
27
In addition to gene
regulation, CECR2 may also contribute to chromatin
structure changes during spermatogenesis, such as
deposition of protamines or testis-specific histone
variants such as histone H1t or H3t. Further
examination of gene expression, DNA methylation,
histone modifications and variants, and protamines
in Cecr2 mutant testes would confirm whether the
biological consequences of the loss of CECR2
involve additional changes to global chromatin
structure. In addition, use of microarray or RNA-
seq to look at expression differences between wild-
type and mutant testes may reveal gene pathways
involved in the fertility defect. The use of a stronger
mutant allele, such as a conditional knockout of
Cecr2 in the germ line rather than a gene trap, would
reveal whether there are more severe fertility defects
caused by the loss of CECR2.
CECR2 forms a complex with SNF2H in the testis
Biochemical analysis of CECR2 in the testis
indicated that the mutant reporter protein CECR2
Gt
,
which lacks the bromodomain and remaining
portion of CECR2, can form complexes with ISWI
proteins, presumably due to the presence of the
DDT domain (Fig. 1a). This result is consistent with
the previous studies showing that the DDT domain
is important in the binding of Drosophila ACF1 to
ISWI
20
and of human RSF1 to SNF2H.
21
Interest-
ingly, despite observing physical interactions be-
tween CECR2
Gt
and SNF2H, we generally do not
observe reduced litter size phenotypes in Cecr2
Gt
heterozygotes (data not shown), suggesting that the
inclusion of this mutant protein into ISWI complexes
does not result in a dominant-negative effect, at least
with respect to fertility. CECR2
Gt
interacted with
SNF2H rather than SNF2L in the adult testis and
also formed a complex with SNF2H in ES cells (Fig.
4). Although these data will require confirmation
with wild-type CECR2 to rule out potential artifacts
of the mutant reporter, preferential binding to
SNF2H over SNF2L has been previously demon-
strated for other ISWI-binding proteins such as
WSTF/BAZ1B and ACF1/BAZ1A.
5,6
Consistent
802 CECR2 Is Involved in Spermatogenesis
Author's personal copy
with SNF2H being the major ISWI binding partner
of CECR2 in the testis, Cecr2 expression patterns are
similar to the expression pattern of Smarca5 (SNF2H)
which is also strongly expressed in spermatogonia
and spermatocytes, whereas in contrast, Smarca1
(SNF2L) expression is dispersed throughout the
seminiferous epithelium and mature spermatids.
2,28
Thus, in tissues undergoing extensive proliferation
such as the epiblast of the expanded blastocyst or the
seminiferous epithelium, CECR2 may interact with
SNF2H, which is associated with proliferating cell
types in the nervous system.
2
In contrast, in cell
types that have undergone differentiation such as
HEK293, CECR2 may interact predominantly with
SNF2L.
10
Together, these observations suggest that
CECR2-containing complexes exhibit cell type spec-
ificity with regard to the ISWI subunit.
CERF purified from HEK293 cells is ∼600 kDa,
likely consisting of a heterotetramer of two CECR2
subunits and two SNF2L subunits.
10
In contrast, the
CECR2
Gt
/SNF2H-containing complex was ∼0.9–
1 MDa in testis (Fig. 4c), suggesting that it may
include other subunits or that it may include more
CECR2 and SNF2H subunits compared to CERF. In
addition, the CECR2
Gt
/SNF2H-containing complex
in ES cells eluted over a broad range of sizes, with a
peak at ∼300–400 kDa, consistent with the size of a
CECR2/SNF2H heterodimer, but also up to
∼700 kDa approximating the size of a heterotetra-
mer (Fig. 4e). Although the difference in inferred
subunit numbers may be due to the inclusion of the
mutant CECR2 reporter protein, it may also be due
to differences in the cell types. In the testis, the
mutant CECR2
Gt
-containing complex appeared to
assemble independently of wild-type CECR2 com-
plexes, and the incorporation of SNF2H into other
ISWI complexes was unperturbed in Cecr2 mutants
(Fig. 4d and e). Whether or not all the of the CECR2
proteins in the germ line function solely in the
context of a SNF2H-containing complex is unclear
and will require further characterization of CECR2-
containing complexes in the testis by mass spec-
trometry. The role of SNF2H in the male germ line
has not been investigated; however, hypomorphic
mutation of Smarca5 was reported to affect epige-
netic repression of the variegating locus Agouti viable
yellow specifically in the male germ line,
28
suggest-
ing that SNF2H may have functional roles in male
germ cells. Thus, it is likely that, at least, some of the
functions of CECR2 in spermatogenesis would be in
the context of a complex with SNF2H.
Conclusion
Here, we report that the ISWI binding partner
CECR2 contributes to male fertility in a manner that
usually does not drastically alter seminiferous
epithelium structure, sperm count, motility, or
morphology but nevertheless causes defects in
oocyte fertilization. This is to our knowledge the
first report on a chromatin remodeling protein with
this particular mutant phenotype. One model in
support of our findings is that the mutant CECR2
Gt
protein can form a complex with SNF2H and
possibly other proteins as would be expected of
wild-type CECR2, and the complex can localize to
the nucleus but is not functional. In Cecr2
Gt
heterozygotes, both types of complexes may be
present, but the mutant CECR2
Gt
complexes do not
interfere with the wild-type ones, resulting in
sufficient levels of functional CECR2. In Cecr2
Gt
mutants, the resulting deficiency in chromatin
remodeling activity and/or targeting may result in
misregulated gene expression and/or deleterious
changes in chromatin structure, which cause fertility
defects in the mature spermatozoa.
Materials and Methods
Cecr2
Gt45Bic
mutation, genotyping, and fertility
analysis
All mice used in this study were housed at the Biological
Sciences Animal Services facility at the University of
Alberta in Edmonton, Canada. The Cecr2
Gt45Bic
gene trap
mutation on BALB/c background (Cecr2
Gt
) was generated
previously and genotyped by multiplex PCR.
10,19
For our
initial fertility testing (see Fig. 1), 11 BALB/c Cecr2
Gt45Bic
mutant males and 23 wild-type males between ages of 10
and 24 weeks were each set up in mating pairs to wild-type
females and left together for 3 months. If no pups were
sired within the normal 3- to 4-week period, a new female
was provided. The number of pups was counted in each
litter, and litter sizes for all wild-type and Cecr2 mutant
males were averaged. For the second fertility analysis
(Tables 1,2, and 3), BALB/c wild-type and Cecr2
Gt45Bic
homozygous mutants males (non-penetrant for exence-
phaly) aged 6 weeks and older were housed with a one or
two wild-type BALB/c females. Females were subsequent-
ly tested for seminal plugs, and pregnancies were timed
such that all plugged females were euthanized and
dissected between E14.5 and E18.5. The numbers of
morphologically normal and undeveloped embryos
(resorbed) were counted in each litter. Males were given
2 days apart from females and then again housed with
wild-type females for another round of mating. All
procedures involving mice were carried out in accordance
with the Animal Care and Use Committee at the University
of Alberta and national guidelines and policies.
Culture of CT45 mouse embryonic stem cells
The CT45 ES cell line was generated in a previous
study
23
and was kindly provided by Dr. W. Bickmore. ES
cells were maintained in an undifferentiated state in
DMEM (Dulbecco's modified Eagle's medium) high-
glucose media containing 15% fetal bovine serum, 2 mM
L-glutamine, 0.1 mM nonessential amino acids, 100 mM β-
803CECR2 Is Involved in Spermatogenesis
Author's personal copy
mercaptoethanol, 100 U/ml penicillin, and 100 mg/ml
streptomycin (all from Invitrogen), with 1000 U/ml
leukemia inhibitory factor (Sigma-Aldrich), and were
cultured on gelatinized plates in a 5% CO
2
atmosphere
at 37 °C.
Histology, Xgal staining of testes, and spermatozoa
analysis
Xgal staining of the Cecr2
Gt45Bic
gene product was
performed as previously described.
10,19
For histology,
testes were dissected, fixed in 4% paraformaldehyde,
sectioned at 5 μm, and mounted on positively charged
slides. Sections were stained with hematoxylin and eosin
and imaged according to previous methods.
19
Spermatid-
to-spermatogonia ratios were determined for four BALB/c
wild-type males and five Cecr2
Gt45Bic
mutant males by
counting spermatids and spermatogonia in 10 sections of
the seminiferous epithelium of each animal (blind to
genotype), and average ratios were recorded. Analyses of
sperm count, motility, and morphology were performed as
previously described.
29
Mature sperms isolated from the
cauda epididymis of wild-type and Cecr2
Gt45Bic
mutant
males were counted by hemocytometer in RPMI media
(Sigma-Aldrich). For analysis of motility and morphology,
sperm was isolated as above and examined on a slide
under a Nikon TMS inverted microscope. Approximately
200 sperms were scored for each male under four
specific categories describing its motility pattern: (1)
moving forward, (2) moving in any direction except
forward, (3) moving but not advancing in any direction,
and (4) nonmotile. Approximately 200 sperms from each
male were scored for their morphology as linear/
normal, angulated (bent at N90° or hairpin shaped), or
headless.
Superovulation and analysis of fertilization and
preimplantation embryos
FVB/N wild-type females were superovulated using
previous methods with minor modifications.
30
Females
were injected with 5 IU pregnant mare serum gonadotro-
pin/Folligon followed by 5 IU human chorionic gonado-
tropin/Chorulon (Sigma-Aldrich/Intervet) approximately
46 h later. One superovulated female was then housed
with a BALB/c wild-type or Cecr2
Gt45Bic
mutant male for
approximately 16 h, and females were plug-tested.
Plugged females were euthanized and dissected, and
ovaries were disrupted to release the oocytes into M2
media (Sigma-Aldrich) containing 0.3 mg/ml hyaluroni-
dase (Sigma-Aldrich) for 1.5 min to digest the cumulus.
Oocytes were then washed in M2 media and viewed by
phase-contrast microscopy using the Axioscope II plus
(Carl Zeiss Canada Ltd.). The number of fertilized oocytes
from each superovulated female was scored by visualizing
the maternal and paternal pronuclei. Oocytes were then
washed twice in M16 media (Sigma-Aldrich) and cultured
in 20 μl of M16 media containing 60 mg/l penicillin and
50 mg/l streptomycin (Invitrogen) in microdrop plates
covered with mineral oil at 37 °C and 5% CO
2
atmosphere.
Development of zygotes was observed each day, and the
number of surviving blastocysts at approximately E3.5-4
was scored.
RT-PCR and qRT-PCR analyses
For RT-PCR, total RNA was extracted from ES cells
and adult testes using the Qiagen RNeasy lipid tissue
mini kit according to the product protocol, and 1 μgof
RNA was used for cDNA synthesis using the Super-
Script III first-strand cDNA synthesis kit from Invitro-
gen according to the manufacturer's instructions. cDNA
synthesis was performed using 2 pmol of βgeo reverse
primer 5′AAATTCAGACGGCAAACGAC 3′. Negative
controls were performed by omitting RT from the cDNA
synthesis reaction. The following primers were used for
PCR amplification of Cecr2 cDNA spanning from exon 1
to exon 7: forward 5′GAGCGAGAGCGAGTGAGC 3′
and reverse 5′CTCGGAAGCTCTCAGTGACC 3′. PCR
was performed with an initial denaturing step of 95 °C
for 2 min, followed by 30 cycles of the following: 95 °C
for 15 s, 55 °C for 30 s, and 68 °C for 1 min; a final
extension was performed at 68 °C for 3 min. Sequencing
of cDNA was performed by Sanger dideoxy sequencing.
qRT-PCR analysis was performed as previously
described.
18
Briefly, 1 μg of total RNA each from testes
isolated from three wild-type and Cecr2
Gt
mutant males
was converted into cDNA using the SuperScript VILO
kit (Invitrogen), and quantitative PCR was performed
using Taq Universal PCR Master Mix (Applied
Biosystems) on the Applied Biosystems StepOne Plus
thermocycler with three technical replicates per sample
for each target. Fold changes were calculated by delta–
delta C
T
method using Elmo2 as an endogenous
control. Primer-probe sequences are available upon
request.
Western blot, immunoaffinity enrichment, and
gel filtration
Nuclear extracts were prepared from ES cells and
mouse tissues according to previous methods.
31,32
Protein
concentration was determined by the DC (detergent
compatible) protein assay (Bio-Rad). For Western blot
analysis, Tris glycine SDS-PAGE was performed followed
by transfer to polyvinylidene fluoride membranes. Mem-
branes were blocked with 5% skim milk in Tris-buffered
saline [25 mM Tris (pH 8.0) and 150 mM NaCl] containing
0.05% Tween-20 and were incubated with primary
antibodies overnight at 4 °C. Antibodies used for Western
blot were as follows: anti-β-galactosidase (Santa Cruz
Biotechnology), anti-SNF2H (Active Motif), anti-TATA-
binding protein (Sigma-Aldrich), anti-SNF2L (gift from
Dr. D. Picketts), anti-ACF1 (gift from Dr. P. Varga-Weisz),
anti-WSTF (gift from Dr. P. Varga-Weisz), anti-RSF1 (gift
from Dr. D. Reinberg), and anti-TIP5 (gift from Dr. I.
Grümmt). Primary antibodies were detected using horse-
radish-peroxidase-conjugated anti-rabbit, anti-mouse, and
anti-goat IgG secondary antibodies (Sigma-Aldrich).
Bands were visualized by ECL plus (GE Healthcare) and
exposure to X-ray film.
For immunoaffinity enrichment of CECR2
Gt
,∼0.5 mg
monoclonal β-galactosidase antibodies (Meridian Life
Science) was cross-linked to 0.5 ml protein G-Sepharose
using previous methods.
33
Nuclear extract from Cecr2
Gt45Bic
heterozygous adult testes or CT45 ES cells (∼4 mg) was
diluted to a final concentration of ∼210 mM NaCl and first
804 CECR2 Is Involved in Spermatogenesis
Author's personal copy
passed over a mock column containing no antibody at
gravity flow, then over the β-galactosidase antibody
column. Bound proteins on each column were washed
extensively with wash buffer [20 mM Hepes (pH 7.9),
400 mM NaCl, 0.1% Triton-X-100, and 10% glycerol] and
stepwise eluted by the addition of 0.2 M glycine (pH 2.5).
Fractions were neutralized by the addition of 1.5 M Tris
(pH 8.8) and were analyzed by Western blot.
Gel-filtration analysis was performed as previously
described.
34
A column of Sephacryl S-400 HR (GE
Healthcare) was equilibrated in 20 mM Hepes (pH 7.9),
420 mM NaCl, 1.5 mM MgCl
2
, 0.2 mM ethylenediamine-
tetraacetic acid, and 10% glycerol and was calibrated
using purified standards blue dextran (∼2 MDa), thyro-
globulin (∼670 kDa), and bovine serum albumin (67 kDa)
(all from Sigma-Aldrich). Nuclear extracts (∼2–3 mg)
were fractionated over the column at a flow rate of ∼0.5–
0.8 ml/min, and 0.5-ml fractions were collected and
either stored at −20 °C or precipitated with trichloroacetic
acid, washed with acetone, and air-dried. Protein pellets
were dissolved in SDS-PAGE loading buffer and ana-
lyzed by Western blot. For analysis of DNA-dependent
interactions during gel filtration, ethidium bromide was
added to the nuclear extract at 50 μg/ml and incubated
for 1 h on ice before fractionation as previously
described.
35
IP was performed from gel-filtration frac-
tions essentially as described previously.
36
The three
peak CECR2
Gt
-containing fractions as judged by Western
blot were pooled, diluted 1:2, and separated into two
volumes, and IP was performed overnight at 4 °C on each
volume in parallel by adding 2 μl of anti-SNF2H (Active
Motif) or 2 μg of mouse IgG (Sigma-Aldrich) in IP buffer
[20 mM Hepes (pH 7.9), 210 mM NaCl, 0.2 mM
ethylenediaminetetraacetic acid, 0.1% Triton-X-100, and
10% glycerol] containing 1 mM phenylmethyl sulfonyl
fluoride. Immunocomplexes were collected by adding
30 μl protein A/G-agarose (Santa Cruz Biotechnology)
and rotating an additional 2 h at 4 °C. Beads were
washed four times with IP buffer, and bound proteins
were eluted by boiling in SDS-PAGE loading buffer.
Acknowledgements
We wish to thank Dr. D. Picketts for SNF2L
antibodies and critical reading of this manuscript.
We would also like to thank N. Fairbridge and Dr.
Michael Dyck for helpful discussions. We thank Dr.
W. A. Bickmore for the CT45 ES cell line, Dr. P.
Varga-Weisz for ACF1 and WSTF antibodies, Dr. D.
Reinberg for RSF1 antibodies, and Dr. I. Grümmt for
TIP5 antibodies. This work was supported by the
Canadian Institutes of Health Research Grant
MOP64361. P.J.T. was supported by a Province of
Alberta Queen Elizabeth II scholarship. K.A.N. was
supported by a summer studentship from Alberta
Innovates Health Solutions. C.E.D. was supported
by a scholarship from the Natural Sciences and
Engineering Research Council of Canada. We
declare no conflicts of interest.
References
1. Ho, L. & Crabtree, G. R. (2010). Chromatin remodel-
ling during development. Nature,463, 474–484.
2. Lazzaro, M. A. & Picketts, D. J. (2001). Cloning and
characterization of the murine Imitation Switch (ISWI)
genes: differential expression patterns suggest distinct
developmental roles for Snf2h and Snf2l. J. Neurochem.
77, 1145–1156.
3. LeRoy, G., Orphanides, G., Lane, W. S. & Reinberg, D.
(1998). Requirement of RSF and FACT for transcrip-
tion of chromatin templates in vitro.Science,282,
1900–1904.
4. LeRoy, G., Loyola, A., Lane, W. S. & Reinberg, D.
(2000). Purification and characterization of a human
factor that assembles and remodels chromatin. J. Biol.
Chem. 275, 14787–14790.
5. Poot, R. A., Dellaire, G., Hulsmann, B. B., Grimaldi,
M. A., Corona, D. F., Becker, P. B. et al. (2000).
HuCHRAC, a human ISWI chromatin remodelling
complex contains hACF1 and two novel histone-fold
proteins. EMBO J. 19, 3377–3387.
6. Bozhenok, L., Wade, P. A. & Varga-Weisz, P. (2002).
WSTF–ISWI chromatin remodeling complex targets
heterochromatic replication foci. EMBO J. 21,
2231–2241.
7. Strohner, R., Nemeth, A., Jansa, P., Hofmann-Rohrer,
U., Santoro, R., Langst, G. & Grummt, I. (2001).
NoRC—a novel member of mammalian ISWI-con-
taining chromatin remodeling machines. EMBO J. 20,
4892–4900.
8. Bochar, D. A., Savard, J., Wang, W., Lafleur, D. W.,
Moore, P., Cote, J. & Shiekhattar, R. (2000). A family of
chromatin remodeling factors related to Williams
syndrome transcription factor. Proc. Natl Acad. Sci.
USA,97, 1038–1043.
9. Barak, O., Lazzaro, M. A., Lane, W. S., Speicher, D. W.,
Picketts, D. J. & Shiekhattar, R. (2003). Isolation of
human NURF: a regulator of Engrailed gene expres-
sion. EMBO J. 22, 6089–6100.
10. Banting, G. S., Barak, O., Ames, T. M., Burnham, A. C.,
Kardel, M. D., Cooch, N. S. et al. (2005). CECR2, a
protein involved in neurulation, forms a novel
chromatin remodeling complex with SNF2L. Hum.
Mol. Genet. 14, 513–524.
11. Collins, N., Poot, R. A., Kukimoto, I., Garcia-Jimenez,
C., Dellaire, G. & Varga-Weisz, P. D. (2002). An
ACF1–ISWI chromatin-remodeling complex is re-
quired for DNA replication through heterochromatin.
Nat. Genet. 32, 627–632.
12. Poot, R. A., Bozhenok, L., van den Berg, D. L.,
Steffensen, S., Ferreira, F., Grimaldi, M. et al. (2004).
The Williams syndrome transcription factor interacts
with PCNA to target chromatin remodelling by ISWI
to replication foci. Nat. Cell Biol. 6, 1236–1244.
13. Zhou, Y., Santoro, R. & Grummt, I. (2002). The
chromatin remodeling complex NoRC targets
HDAC1 to the ribosomal gene promoter and represses
RNA polymerase I transcription. EMBO J. 21,
4632–4640.
14. Landry, J., Sharov, A. A., Piao, Y., Sharova, L. V., Xiao,
H., Southon, E. et al. (2008). Essential role of chromatin
remodeling protein Bptf in early mouse embryos and
embryonic stem cells. PLoS Genet. 4, e1000241.
805CECR2 Is Involved in Spermatogenesis
Author's personal copy
15. Perpelescu, M., Nozaki, N., Obuse, C., Yang, H. & Yoda,
K. (2009). Active establishment of centromeric CENP-A
chromatin by RSF complex. J. Cell Biol. 185,397–407.
16. Stopka, T. & Skoultchi, A. I. (2003). The ISWI ATPase
Snf2h is required for early mouse development. Proc.
Natl Acad. Sci. USA,100, 14097–14102.
17. Lazzaro, M. A., Pepin, D., Pescador, N., Murphy,
B. D., Vanderhyden, B. C. & Picketts, D. J. (2006). The
imitation switch protein SNF2L regulates steroido-
genic acute regulatory protein expression during
terminal differentiation of ovarian granulosa cells.
Mol. Endocrinol. 20, 2406–2417.
18. Fairbridge, N. A., Dawe, C. E., Niri, F. H., Kooistra,
M. K., King-Jones, K. & McDermid, H. E. (2010). Cecr2
mutations causing exencephaly trigger misregulation
of mesenchymal/ectodermal transcription factors.
Birth Defects Res., Clin. Mol. Teratol. 88, 619–625.
19. Dawe, C. E., Kooistra, M. K., Fairbridge, N. A., Pisio,
A. C. & McDermid, H. E. (2011). Role of chromatin
remodeling gene Cecr2 in neurulation and inner ear
development. Dev. Dyn. 240, 372–383.
20. Fyodorov, D. V. & Kadonaga, J. T. (2002). Binding of
Acf1 to DNA involves a WAC motif and is important
for ACF-mediated chromatin assembly. Mol. Cell. Biol.
22, 6344–6353.
21. Sheu, J. J., Choi, J. H., Yildiz, I., Tsai, F. J., Shaul, Y.,
Wang, T. L. & Shih Ie, M. (2008). The roles of human
sucrose nonfermenting protein 2 homologue in the
tumor-promoting functions of Rsf-1. Cancer Res. 68,
4050–4057.
22. Aravind, L. & Landsman, D. (1998). AT-hook motifs
identified in a wide variety of DNA-binding proteins.
Nucleic Acids Res. 26, 4413–4421.
23. Tate, P., Lee, M., Tweedie, S., Skarnes, W. C. &
Bickmore, W. A. (1998). Capturing novel mouse genes
encoding chromosomal and other nuclear proteins.
J. Cell Sci. 111, 2575–2585.
24. Depew, M. J., Liu, J. K., Long, J. E., Presley, R., Meneses,
J. J., Pedersen, R. A. & Rubenstein, J. L. (1999). Dlx5
regulates regional development of the branchial arches
and sensory capsules. Development,126, 3831–3846.
25. Nishida, H., Miyagawa, S., Vieux-Rochas, M., Morini,
M.,Ogino,Y.,Suzuki,K.et al. (2008). Positive
regulation of steroidogenic acute regulatory protein
gene expression through the interaction between Dlx
and GATA-4 for testicular steroidogenesis. Endocri-
nology,149, 2090–2097.
26. Kimura, M. I., Kazuki, Y., Kashiwagi, A., Kai, Y., Abe,
S., Barbieri, O. et al. (2004). Dlx5, the mouse
homologue of the human-imprinted DLX5 gene, is
biallelically expressed in the mouse brain. J. Hum.
Genet. 49, 273–277.
27. Fraser, L. R. (2010). The “switching on”of mammalian
spermatozoa: molecular events involved in promotion
and regulation of capacitation. Mol. Reprod. Dev. 77,
197–208.
28. Chong, S., Vickaryous, N., Ashe, A., Zamudio, N.,
Youngson, N., Hemley, S. et al. (2007). Modifiers of
epigenetic reprogramming show paternal effects in
the mouse. Nat. Genet. 39, 614–622.
29. Netzel-Arnett, S., Bugge, T. H., Hess, R. A., Carnes, K.,
Stringer, B. W., Scarman, A. L. et al. (2009). The
glycosylphosphatidylinositol-anchored serine prote-
ase PRSS21 (testisin) imparts murine epididymal
sperm cell maturation and fertilizing ability. Biol.
Reprod. 81, 921–932.
30. Eggan, K. & Jaenisch, R. (2003). Differentiation of F1
embryonic stem cells into viable male and female mice
by tetraploid embryo complementation. Methods
Enzymol. 365,25–39.
31. Dignam, J. D., Lebovitz, R. M. & Roeder, R. G. (1983).
Accurate transcription initiation by RNA polymerase
II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res. 11, 1475–1489.
32. Cox, B. & Emili, A. (2006). Tissue subcellular
fractionation and protein extraction for use in mass-
spectrometry-based proteomics. Nat. Protoc. 1,
1872–1878.
33. Chalkley, G. E. & Verrijzer, C. P. (2004). Immuno-
depletion and purification strategies to study chro-
matin-remodeling factors in vitro.Methods Enzymol.
377, 421–442.
34. Lewis, P. W., Beall, E. L., Fleischer, T. C., Georlette, D.,
Link, A. J. & Botchan, M. R. (2004). Identification of a
Drosophila Myb-E2F2/RBF transcriptional repressor
complex. Genes Dev. 18, 2929–2940.
35. Hanai, K., Furuhashi, H., Yamamoto, T., Akasaka, K.
& Hirose, S. (2008). RSF governs silent chromatin
formation via histone H2Av replacement. PLoS Genet.
4, e1000011.
36. Cavellan, E., Asp, P., Percipalle, P. & Farrants, A. K.
(2006). The WSTF–SNF2h chromatin remodeling
complex interacts with several nuclear proteins in
transcription. J. Biol. Chem. 281, 16264–16271.
806 CECR2 Is Involved in Spermatogenesis
