Genotypic and Phenotypic Characterization of Clinical Isolates of Staphylococcus Aureus for Biofilm Formation Ability

Full text

Advances in Animal and Veterinary Sciences 2 (4): 233 – 238
http://dx.doi.org/10.14737/journal.aavs/2014/2.4.233.238
Goyal et al (2014). Characterization of
Staph. aureus
and Biofilm Formation
233
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
Research Article
Rashmi Goyal1*, Priscilla Kerketta1, Pavan Kumar1, Mayank Rawat2, Konasagara Nagaleekar Viswas3, Rajesh
Kumar Agarwal3
1Division of Veterinary Public Health, Indian Veterinary Rese arch Institute, Izatnagar, Bareilly 243122, Indi a; 2Division of Biological Standerd ization, Indian
Veterinary Research Institute, Izatnagar, Bareilly 243122, India; 3 Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Izatnagar, Bareilly
243122, India
*Corresponding author: drrashmigoyal@gm ail.com
ARTICLE HISTORY
ABSTRACT
Received:
Revised:
Accepted:
2014–02–18
2014–03–02
2014–03–02
The objective of the study was to characterize Staphylococcus aureus (S. aureus) isolated from
human and animal clinical cases for their biofilm formation ability by genotypic and
phenotypic methods. A total of 130 S. aureus strains isolated from human wound (n = 20),
animal wound (n = 70) and animal mastitis (n = 40) cases were subjected to screening for 3
different biofilm associated genes (bap, icaA and icaD) and for phenotypic assessment for
biofilm formation using Congo red agar, modified Congo red agar and microtitre plate assay.
PCR assays were standardized for the detection of bap, icaA and icaD genes. The results
indicated that icaA gene was present in 51.15% of the isolates and bap gene was present in
8.46% isolates. None of the isolates were positive for icaD gene. Human isolates (65%) had
higher occurrence of icaA gene in comparison to animal isolates (49.09%). Dog wound
isolates had higher occurrence of bap gene. Of the 3 methods used for phenotypic expression
of biofilm by S. aureus isolates modified Congo red agar method showed 86.92% isolates to be
positive, whereas by Congo red agar method only 63.07% S. aureus were found to be biofilm
producer. Microtitre plate assay showed 75.38% S. aureus isolates to be biofilm producers. A
good correlation was observed between genotypic and phenotypic biofilm formation ability
of the isolates. Bap gene contained isolates showed higher biofilm producing ability compare
to icaA gene harbored isolates.
All copyrights reserved to Nexus® academic publishers
Key Words: Staphylococcus
aureus, Biofilm formation, Bap,
icaA and icaD genes
ARTICLE CITATION: Goyal R, Kerketta P, Kumar P, Rawat M, Viswas NK, Agarwal RK (2014). Genotypic and phenotypic
characterization of clinical isolates of Staphylococcus aureus for biofilm formation ability. Adv. Anim. Vet. Sci. 2 (4): 233 – 238.
INTRODUCTION
Staphylococcus aureus is a Gram–positive bacterium and is an
important human and animal pathogen. The S. aureus causes
a wide variety of infections ranging from mild skin
infections, to life–threatening diseases such as bacteremia.
The pathogenesis of S. aureus is attributed to the combined
effect of extracellular factors and toxins, together with the
invasive properties of the strain such as adherence, biofilm
formation, and resistance to phagocytosis. There is general
agreement that biofilms are the basis for persistent or
chronic bacterial infections (Costerton et al., 1999). The
implication of biofilms in chronic infections has triggered an
increasing interest in the organization of genes involved in
biofilm formation (Caizza and O’Toole, 2005; Tormo et al.,
2005). The icaADBC cluster, an operon present in S. aureus
and S. epidermidis, participates in biofilm formation by
encoding proteins involved in the synthesis of a biofilm
matrix polysaccharide (Cucarella et al., 2004). The ica
operon was first identified and studied most extensively in
S. epidermidis and was later shown to be present in S. aureus
(Gotz, 2002). Most S. aureus strains appear to contain the
entire ica operon, although there are reports to the contrary.
IcaA and icaD genes have been reported to play a
significant role in biofilm formation in S. aureus and S.
epidermidis (Gotz, 2002). The ica locus has been detected in
majority of the mastitic S. aureus isolates indicating its
potential role as a virulence factor in the pathogenesis of
mastitis in ruminants (Ciftci et al., 2009, Milanov et al.,
2010). Little information is available regarding genotypic
characterization of S. aureus of animal and human clinical
origin with reference to intercellular adhesion genes and its
association with phenotypic characters of Indian isolates
(Vasudevan et al., 2003, Dhanawade et al., 2010).
More recently, Cucarella et al., (2001) identified a
surface protein (Bap, Biofilm Associated Protein) implicated
in S. aureus biofilm formation. Vautor et al., (2008) has
reported that the bap protein is a member of proteins
playing a role in biofilm formation in many bacteria and they
share common structural features as they have a high
molecular weight and contain a core domain of tandem
Genotypic and Phenotypic Characterization of Clinical Isolates of
Staphylococcus aureus
for Biofilm Formation Ability

Advances in Animal and Veterinary Sciences 2 (4): 233 – 238
http://nexusacademicpublishers.com/journal/4
Goyal et al (2014). Characterization of
Staph. aureus
and Biofilm Formation
234
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
repeats. Bap gene has been identified in a small proportion of
S. a ureus from bovine mastitis (Cucarella et al., 2001). Many
studies have yielded negative results for the presence of bap
gene in human and animal cases (Arciola et al., 2001;
Vasudevan et al., 2003; Vancraeynest et al., 2004; Nitzsche
et al., 2007, Vautor et al., 2008) indicating low prevalence of
this gene. No information is available about Indian S. aureus
isolates.
A number of methods have been developed for
cultivation and quantification of biofilm, such as tube test,
microtiter plate test, radiolabeling, microscopy, Congo red
agar plate test, etc. (Deighton et al., 2001; Mathur et al.,
2006; Agarwal et al., 2011). Nevertheless, the microtiter
plate and Congo red agar method remains among the most
frequently used assays for investigation of biofilm
(Vasudevan et al., 2003; Knobloch et al., 2002).
Therefore, the present study was undertaken to
characterize Staphylococcus aureus isolated from human and
animal clinical cases for their biofilm formation ability by
genotypic and phenotypic methods.
MATERIALS AND METHODS
Bacterial strains
The bacterial stains included in the study are listed in the
table 1. Most of the strains (III) were isolated in an earlier
study in our laboratory in the year 2013. Twenty–nine
bovine mastitis strains isolated in the year 2005 were
procured from the repository of the Division of
Standardization, Indian Veterinary Research Institute,
Izatnagar, India. All the strains were tested for their purity,
morphological and biochemical characteristics and were
maintained by periodical sub culturing in brain heart
infusion (BHI) broth.
Table 1: S. aureus isolates used in the study
Sr.
No.
Source of
isolates
Type of clinical case
No. of
isolates
1.
Cattle
Wound
18
2.
Cattle
Mastitis
40*
3.
Dog
Wound
48
4.
Horse
Wound
1
5.
Goat
Wound
3
6.
Human
Wound
20
Total
130
* 29 of these were isolated in year 2005
Detection of Biofilm Associated Genes by PCR
Primers
Primers used in the study for detection of icaA, icaD and bap
genes are listed in table 2.
PCR Protocol
All the 130 S. aureus isolates were subjected to amplification
of icaA icaD and bap genes. The reaction mix invariably
consisted of 5 µl of bacterial DNA, 2.5 µl of 10x PCR buffer
for Taq polymerase [100 mM Tris HCl, pH 8.3, 500 mM KCl,
15 mM MgCl2, 0.01% gelatin], 1.5 µl of 2.5 mM dNTP, 10
pmol of each forward and reverse primers, and 1 U of Taq
polymerase. The final volume of 25 µl was made up by using
milli Q water. For icaA and bap genes an annealing
temperature of 55ºC was used, whereas for the amplification
of icaD gene annealing was done at 49ºC. The cycling
conditions used were an initial denaturation of 5 min at
94ºC, 35 cycle of 45 sec denaturation at 94ºC, 45 sec
annealing at optimum temperature and 45 sec extension at
72ºC. Appropriate positive and negative controls were
added in each of the PCR run. The PCR products were
confirmed by agarose gel (1%) electrophoresis.
Phenotypic Expression of Biofilm
Biofilm formation ability of all the S. aureus isolates was
studied by microtitre plate method and Congo red binding
assay and modified Congo red assay.
Microtitre Plate Assay
The test was performed using tryptone soy broth containing
1% glucose (TSB + 1% Glucose). The isolates were first
inoculated in the TSB + 1% glucose and incubated for 24 h at
37ºC. From each individual culture, 20 µl of TSB+1% glucose
broth were dispended in the wells of sterile 96–well flat
bottomed microtitre plate (Greiner bio–one) and kept for
incubation at 37ºC for 48 h under aerobic conditions. Each
strain was inoculated into at least 8 wells. The control well
contained only TSB+1% glucose without inoculation. After
incubation of plates, unbound cells were removed by
inversion of microtitre plate, followed by vigorous tapping
on absorbent paper. After that, adhered cells were fixed at
80ºC for 30 min.
Adhered cells on the bottom and side of the wells were
stained by addition of 220 µl of crystal violet (0.5%) for 15
min and excess stain was rinsed off. The stain was removed
by exhausting washing with distilled water. The plates
were then allowed to air dry. After drying, 220 µl of
decolouring solution (ethanol 80% and acetone 20%) was
added to each well for 15 min. The absorption of eluted stain
was measured at 590 nm in ELISA reader. Data obtained
from above experiments was subjected to statistical analysis
as per standard procedure of Snedecor and Cochran (1989).
Sr.
No.
Target gene
Sequence
Product Size
Reference
1.
bap
F: 5–AAAGAGCCACATAAACAACAAGAA–3’
R: 5’–GTAGCCATAGCACGGAACATAG–3’
368 bp
Self designed
2.
icaH–1m
icaH–7c
F: 5’–TATACCTTTCTTCGATGTCG–3’
R: 5’–CTTTCGTTATAACAGGCAAG–3’
550 bp
Cucarella et al. (2004)
3.
icaD
F: 5’–AAACGTAAGAGAGGTGG–3’
R: 5’–GGCAATATGATCAAGATAC–3’
381 bp
Dhanawade et al. (2010)
Congo red Agar Assay
For Congo red assay two different methods were used to
prepare plates. In first, Congo agar plates were prepared by
adding brain heart infusion broth– 52 g, sucrose– 36 g,
Congo red dye– 0.8 g and 2% agar. Modified Congo red agar
was performed as suggested by Mariana et al. (2009).
Table 2: Details of the
primers used in this
study

Advances in Animal and Veterinary Sciences 2 (4): 233 – 238
http://nexusacademicpublishers.com/journal/4
Goyal et al (2014). Characterization of
Staph. aureus
and Biofilm Formation
235
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
Isolates producing weak black, black or very black colonies
were considered as biofilm producer and isolates with red
colonies were considered as non biofilm producers.
RESULTS
Occurrence of Biofilm Forming Genes among S. aureus
Isolates by PCR
The biofilm forming ability of the S. aureus isolates was
assessed by studying occurrence of 3 different biofilm
associated genes viz., icaA, ica D and bap. PCR assay was
standardized for all the 3 genes by empirical variation of
annealing temperature (50º–60ºC), concentration of primers
(10 pmol to 15 pmol), template volume (3µl to 5µl) and the
cycling conditions. PCR under optimized conditions yielded
the desired sized product.
A comparison of occurrence of the 3 biofilm associated
genes among all the S. aureus isolates indicated that icaA gene
was present in 51.15% of isolates, followed by bap 8.46%
genes (Table 3, Figure 1 and 2). None of the isolates were
positive for icaD gene. Human isolates (65%) had more
occurrence of icaA gene in comparison to animal isolates
(49.09%). However, none of the human isolates carried bap
gene. Among different animal isolates, dog wound isolates
had higher occurrence of the bap gene.
Phenotypic Characterization of Biofilm Ability of S.
aureus
Biofilm production ability was assessed by microtitre plate
assay (Table 4). Out of 130 isolates, 2 isolates (1 human, 1
mastitis) produced very strong biofilm, 11 isolates (1 cattle
wound, 2 cattle mastitis, 7 dog, 1 human, 1 mastitis isolates)
produced strong biofilm, 32 isolates (3 cattle wound, 11 dog,
1 human and 17 mastitis isolates) produced moderate
biofilm, 53 isolates (12 cattle wound, 10 cattle mastitis, 17
dog, 1 each of horse and goat, 11 human) produced weak
biofilm. Remaining 32 isolates did not produce any biofilm.
Overall, 75.38% isolates were adjusted as biofilm producers.
Biofilm production ability was also assessed by Congo
red method (Table 5). Out of 130 isolates, 4 isolates (2
human and 2 mastitis isolates) produced very black
colonies, 19 isolates (2 human, 2 cattle wound, 5 mastitis, 2
goat and 8 dog wound isolates) produced black colonies,
and 59 (6 human, 23 dog, 6 cattle wound, 22 cattle mastitis,
1 goat and 1 horse wound) produced weak black colonies.
Remaining 48 isolates produced red colonies, indicating
them to be non biofilm producers.
Table 3: Prevalence of biofilm associated genes in S. aureus isolates.
Sr.
No.
Source of
isolates
Type of
sample
No. of isolates
tested
Positive for bap gene
Positive for icaA
gene
Positive for icaD
gene
A. Animal
1.
Cattle
Wound
18
2 (11.11%)
8 (44.4%)
0
2.
Cattle
Mastitis
40
1 (2.5%)
26 (65%)
0
3.
Dog
Wound
48
8 (16%)
18 (37.5)
0
4.
Horse
Wound
1
0
1 (100%)
0
5.
Goat
Wound
3
0
1 (33%)
0
Sub total (A)
110
11(10%)
54 (49.09%)
0
B. Human
1.
Wound
20
0
13(65%)
0
Grand total (A+B)
130
11(8.46%)
67(51.15%)
0
Figure 1: Results of PCR for bap gene of S. aureus isolates; Lane 1: S. aureus
ASM–23; Lane 2: S. aureus ASW–25; Lane 3: S. aureus ASW–37; Lane 4: S. aureus
ASW–39; Lane 5: S. aureus ASW–43; L ane 6: S. aureus ASW–45; Lane M:
Marker
Figure 2: Results of PCR for icaA gene of S. aureus isolates; Lane M:
Marker; Lane 1: S. aureus IVRI–42; Lane 2: S. aureus ASW–24; Lane 3: S.
aureus IVRI–D7; Lane 4: S. aureus HS–12

Advances in Animal and Veterinary Sciences 2 (4): 233 – 238
http://nexusacademicpublishers.com/journal/4
Goyal et al (2014). Characterization of
Staph. aureus
and Biofilm Formation
236
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
Table 4: Biofilm formation ability of S. aureus isolates by microtitre plate method
Sr.
No.
Source of isolate
No of isolates tested
Non producer
Weak
Moderate
Strong
Very strong
Over all biofilm producer
1.
Cattle wound
18
2
12
3
1
–
16 (88.88%)
2.
Cattle mastitis
40
10
10
17
2
1
30 (75%)
3.
Dog wound
48
13
17
11
7
–
35 (72.91%)
4.
Horse wound
1
–
1
–
–
–
(100%)
5.
Goat wound
3
1
2
–
–
–
2 (66.66%)
6.
Human wound
20
6
11
1
1
1
14 (70%)
Total
130
32
53
32
11
2
98 (75.38%)
Table 5: Biofilm formation ability of S. aureus isolates by Congo red method
Sr. No.
Source of isolates
Type of colonies
Total positive*
Red
Weak black
Black
Very black
1.
Cattle wound
10
6
2
–
8 (44.44%)
2.
Cattle mastitis
11
22
5
2
29 (72.5%)
3.
Dog wound
17
23
8
31 (64.58%)
4.
Horse wound
–
1
–
–
1 (100%)
5.
Goat wound
–
1
2
–
3 (100%)
6.
Human wound
10
6
2
2
10 (50%)
Total
48 (36.92%)
59 (45.38%)
19 (14.61%)
4 (3.07%)
82 (63.07%)
*Aggregate of isolates producing weak black, black and very black colonies
Table 6: Biofilm formation ability of S. aureus isolates by modified Congo red method
Sl. No.
Source of isolates
Type of colonies
Total positive*
Red
Weak black
Black
Very black
1.
Cattle wound
5
10
3
–
13 (72.22%)
2.
Cattle mastitis
6
27
6
1
33 (82.5%)
3.
Dog wound
6
29
11
2
42 (87.50%)
4.
Horse wound
–
1
–
–
1 (100%)
5.
Goat wound
–
1
2
–
3 (100%)
6.
Human wound
–
14
4
2
20 (100%)
Total
17 (13.07%)
82 (63.07%)
26 (20%)
5 (3.84%)
113 (86.92%)
*Aggregate of isolates producing weak black, black and very black colonies
Table 7: Comparison of phenotypic and genotypic biofilm formation ability of S. aureus isolates
Sr.
No.
Pheotypic characteristic
ica A gene
Bap gene
No. of positive
isolates
No. of negative
isolates
No. of positive
isolates
No. of negative
isolates
1.
Phenotypically positive*
(119)
67 (56.30%)
53 (44.53%)
11 (9.24%)
101 (84.87%)
2.
Phenotypically negative (11)
0
11 (100%)
0
11 (100%)
*Positive by any of the 3 methods used
On modified Congo red agar, out of 130 isolates, 5 isolates
produced very black colonies, 26 isolates produced black
colonies, 82 isolates produced weak black colonies and 17
isolates showed red colonies (Table 6).
Comparison of genotypic and phenotypic biofilm
characteristics of the isolates revealed that the all the 11
phenotypically negative isolates were also negative for icaA
and bap genes (Table 7). Of the 119 phenotypically positive
isolates 56.30% isolates demonstrated the presence of icaA
gene, whereas 9.24% isolates were positive for bap gene
DISCUSSION
The S. aureus has been shown to posses the capability to form
biofilm (Costerton et al., 1999; Branda et al., 2005; Heilmann
et al., 1997; Caizza and O’Toole, 2005; Tormo et al., 2005;
Cucarella et al., 2001; Vasudevan et al., 2003, Dhanawade et
al., 2010; Vautor et al., 2008), which help bacteria to adhare
to an inert or living surface (Costerton et al., 1999) and is
able to adhere and form biofilm consequently causing severe
morbidity and infection (Sheagren, 1984; Waldvogel et al.,
1995). The ability to produce biofilm is also the most
important reason for eradication of infection and recurrent
infections of mammary glands in bovine mastitis caused by
S. aureus (Melchior et al., 2006b). Biofilm production enables
adhesion of bacteria to the epithelium of mammary glands.
It also facilitates persistence of micro–organisms in the host
tissue by protecting the bacterial cells against the
mechanisms of the host defense (Melchior et al., 2006a,
2007). Production of biofilm requires the presence of the
intracellular adhesion locus gene cluster icaADBC (Cramton
et al., 1999) and strains harboring the icaADBC cluster are
potential biofilm producers. In addition, biofilm– associated
protein (Bap) is also for the primary attachment and cells’
accumulation (Cucarella et al., 2001; Lasa and Penadés,
2006).
In our study, we examined the ability of biofilm
production in S. aureus by detecting icaA and icaD genes in all

Advances in Animal and Veterinary Sciences 2 (4): 233 – 238
http://nexusacademicpublishers.com/journal/4
Goyal et al (2014). Characterization of
Staph. aureus
and Biofilm Formation
237
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
isolates. We tested a total of 130 isolates for the presence of
icaA and icaD genes. Of the 110 animal isolates 54 (49.09%)
isolates were positive for icaA gene, but no isolate was
positive for icaD gene. The distribution of icaA gene among
different animal isolates was 44.4% (8/18) in cattle wound,
65% (26/40) in cattle mastitis, 37.5% (18/48) in dog wound,
100% (1/1) in horse wound, 33% (1/3) in goat wound. Earlier
workers have reported variation in the occurrence of these
genes. Melchior et al. (2009) found 74 out of 99 strains
isolated from mastitis in Netherlands to be positive. Cifti
and coworkers examined the group of 59 isolates from
mastitis and found only 16 icaA positive stains, 38 strains
harboured the icaD gene and 15 of them contained both
genes (Cifti et al., 2009). Among the group of 102 S. aureus
mastitis isolates from India, only 36 revealed the presence of
both genes (Dhanawade et al., 2010). On the other hand,
several authors showed presence of the ica locus genes in all
S. aureus clinical isolates analyzed in their studies (Fowler et
al., 2001; Rohde et al., 2001; Knobloch et al., 2002; Asthan
and Shamsudin, 2011, Szweda et al., 2012). These variations
could be due to circulations of different clones of S. aureus in
different regions.
In the case of strains isolated from human wound
infection, 13 isolates out of 20 were icaA positive. But none of
the isolates possessed icaD gene. In contrast, 36/46 isolates
from auricular infections in Tunisie were icaA and icaD
positive (Zmantar et al., 2010), while Grinholc and
Coworkers were not able to detect the presence of icaD gene
in case of 27 strains among the tested group of 302 clinical
MRSA isolates, whereas all of them harbored the icaA gene
(Grinholc et al., 2007). Rohde et al. (2007) found that all S.
aureus had the icaA gene. On the other hand, Arciola et al.
(2001) suggested that 60.86% strains of S. aureus had icaA
and icaD. It has been demonstrated that most of the S. aureus
strains contain the entire ica operon (Cramton et al., 1999;
Arciola et al., 2001a).
We also studied the occurrence of bap gene among the
Staph aureus isolates. PCR assay was successfully
standardized employing self–designed primers. Eleven
(8.46%) isolates out of 130 showed the presence of bap gene,
of which 2 were from cattle wound, 1 from cattle mastitis
and 8 from dog wound samples. Bap gene was not present in
any of the goat, horse and human isolates. These results are
in agreement with the previous reports on S. aureus by
Cucarella et al. (2001) who found only 5% isolates positive
for bap gene. Szweda et al. (2012) did not report bap gene in
any of isolates in his study in Poland. Similar, results were
found in S. a ureus isolates of different origin, such as human,
sheep, goat, bovine, pig, poultry, horse and rabbit
(Vancraeynest et al., 2004; Nitzsche et al., 2007; Vautor et al.,
2008; Melchior et al., 2009), Vantor and cowoekers (2008),
hypothesized that the bap gene has not spread among the S.
aureus isolates of animal and human origin and its prevalence
is very low.
Interestingly, in contrast bapA gene has shown to be
high conserved in Salmonella (Lasata et al., 2006; Lassa and
Penades, 2006). But in S. aureus, only some isolates (5%)
from clinical mastitis cases and other clinical cases in animal
and human are reported to carry bap gene (Cucarella et al.,
2001). The low prevalence of bap gene in S. aureus may be
because of either the gene is recently acquired in the
pathogenecity island SaPIbov2, a mobile genetic element or
the horizontal transfer is not easy (Vautor et al., 2008).
Phenotypic expression of biofilm formation was
studied by Congo red agar assay, modified Congo red assay
and microtiter method. In present study, out of 130 strains
of S. aureus isolates from animal and human clinical cases,
63.07% strains were considered biofilm producer by Congo
red agar method. In which, 3.07% isolates produced very
black colonies, 14.61% produced black colonies, 45.38%
produced weak black colonies and remaining 63.07%
produced red colonies. Previous work on biofilm formation
carried out by Krukowski et al. (2008), reported 42%
biofilm producing S. aureus by CRA method. In another
study, 42% isolates were found to be biofilm producer
(Dziekiewicz – Mrugasiewicz et al., 2008). Szweda et al.
(2012) found 57% positive isolates by CRA method.
Modified Congo red method was also used to study the
biofilm production ability of S. aureus (Mariana et al., 2009).
In this study, we found 86.92% isolates to be positive for
biofilm production. Similar findings have been reported by
Atshan et al. (2012).
The microtiter plate method remains among the most
frequently used assays for investigation of biofilm. In this
study, we also optimized microtitre plate method and used
it for testing all the 130 Staph aureus isolates for biofilm
formation ability. Of these 130 isolates, 75.38% were found
to be slime producers by microtitre plate assay. Gundogan
et al. (2006) found that 58 out of 110 S. aureus strains were
slime producers by this method. Furthermore, Vasudevan et
al. (2003) demonstrated that 32 of 35 S. aureus isolates were
slime positive and Zmantar et al. (2010) found that 26 out of
46 strains of S. aureus (56.5%) were slime producers.
However, Atshan et al. (2012) found 100% isolates to be
biofilm producers.
Comparison of genotypic and phenotypic biofilm
characteristics of the isolates revealed that absence of either
of 2 genes studied (icaA and bap) clearly indicated that the S,
aureus isolates were negative for biofilm production.
Occurrence of these 2 genes was variable among the
phenotypically positive S. aureus isolates, indicating that
there are other factors involved in biofilm formation.
However, the bap gene containing isolates showed higher
biofilm producing ability in both, microtitre plate and
Congo red assays (result not shown). We conclude that the
presence of bap gene in S. aureus isolate will definitely
indicate high biofilm production ability.
ACKNOWLEDGEMENTS
Authors are thankful to Director, Indian Veterinary
Research Institute, Izatnagar for providing necessary
facilities for research work.
REFERENCES
Agarwal RK, Singh S, Bhilegaonkar KN, Singh VP (2011). Optim ization of
microtitre plate assay for the testing of biofilm formation ability in
different Salmonella serotypes. Int. Food Res. J. 18: 1493 – 1498.
Arciola CR, Baldassarri L, Montanaro L (2001). Presence of icaA and icaD
genes and slime production in a collection of Staphylococcal strains
from catheter–associated infections. J. Clin. Microbiol. 39: 2151 – 2156.
Atshan SS, Shamsudin MN (20 11). Evaluation of phenotypic and genotypic
detection methods for biofilm–forming meth icillin sensitive and
methicillin–resistant S taphylococcus aureus clinical isolates. Ann .
Microbiol. DOI 10.1007/s13213 – 011 – 0201 – 1.

Advances in Animal and Veterinary Sciences 2 (4): 233 – 238
http://nexusacademicpublishers.com/journal/4
Goyal et al (2014). Characterization of
Staph. aureus
and Biofilm Formation
238
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
Atshan SS, Shamsu din MN, Seka wi Z, Lung,L TT, Hamat RA, Karunanidhi A,
Ali AM, Gh anaznavi–Rad E, Ghasemzadeh–Moghaddam H, Sen J SC,
Nathan JJ, Pei CP (2012) . Prevalence of adhesion and regulation of
biofilm– related genes in different clones of Staphylococcus aureus. J.
Biomed. Biotechnol.doi : 10.1155/2012/976972.
Branda SS, Vik A, Friedman L, Kolter R (2005). Biofilm: the matrix revi sited.
Trends Microbiol. 13: 20 – 26.
Caiazza NC, O’Toole GA (2005). SadB is required f or the transition from
reversible to irreversible attachment during b iofilm formation by
Pseudomonas aeruginosa PA14. J. Bacteriol. 186: 4476 – 44 85.
Ciftci A, Findik A, Onuk EE , Savasan S (2009). Detection of m ethicillin
resistance and slime factor production of Staphylococcus aureus in bovine
mastitis. Brazil . J. Microbiol. 40: 254 – 261.
Costerton JW, Ste wart PS, Greenberg EP (1999). Bacterial biofilms: a
common cause of persistent infections, Science. 2 84 (5418): 1318 – 1322.
Costerton JW, Ste wart PS, Greenberg EP (1999). Bacter ial biofilms: a
common cause of persistent infections. Sci. 284: 1318 – 1322.
Cramton SE, Gerke C, Schne ll NF, Nicholsw W, Göt z F (1999). The
intercellular adhesion (ica) locus is present in Staphylococcus aureus and
is required for biofilm formation. Infect. Imm un. 67: 5427 – 5433.
Cucarella C, Solano C, Valle J, Amorena B, L asa I, Penades JR (2001). Bap, a
Staphylococcus aureus surface protein involved in b iofilm formation. J.
Bacteriol. 183: 2888 – 2896.
Cucarella C, Tormo MA, U´be da C, Trotonda MP, Mon zon M, Peris C,
Amorena B, Lasa I, Penades JR ( 2004). Role of biofilm –associated
protein bap in the pathogenes is of bovine Staphylococcus aureus. Infect.
Immun. 72: 2177 – 2185.
Deighton MA, Capstick J, Dom alewski E, VanNguyen T (2001). Methods for
studying biofilms produced by Staphylococcus epidermidis. Meth.
Enzymol. 336 :177 – 195.
Dhanawade N B, Kalorey DR, Srinivasan R, Barbuddhe SB, Kurkure NV
(2010). Detection of intercellular adhesion genes and biofilm
production in Staphylococcus aureus isolated from bovine subclinical
mastitis. Vet. Res. Commun. 34: 81 – 89.
Dziekiewicz–Mrugasiewicz M, R zewuska M, Stefanska J, Jakub czak A
(2008). Select pathogenic characteristics as well as the genotypic
diversity of Staphylo coccus au reus strains isolated from milk of co ws in
the north–east region of Poland. Medycyna. Wet . 64: 961 – 1072.
Fowler VG, Fey PD, Reller LB, Chamis AL, Corey GR, Rupp ME (2001). The
intercellular adhesion (ica) locus is present in clinic al isolates of
Staphylococcus aureus from b acteremic patients with infected and
uninfected prosthetic joints. Med. Microbiol. Imm unol. 189: 127 – 131.
Gotz F (2002). Staphylococcus and biofilm s. Mol. Microbiol. 43: 1367 – 1378.
Grinholc M, Wegrzyn G, Kurlend a J (2007). Evaluation of b iofilm production
and prevalence of the icaD gene in m ethicillin–resistant and
methicillin–susceptible Staphylococcus aureus strains isolated from
patients with no socomial infections and carriers. FEM S Imm unol.
Med. Microbiol. 50: 375 – 379.
Gundogan N, Citak S, Turan E (2006). Slime production, DNase activity and
antibiotic resistance of Staphylococcus aureus isolated from raw m ilk,
pasteurised milk and ice cream samples. Food Cont. 17: 3 89 – 392.
Heilmann C, Hussain M, Peters G, Got z F (1997). Evidence for autolysin–
mediated primary attachment of Staphylococccus epidermidis to a
polystyrene surface. Mol. Microbial. 24: 1083 – 1091.
Knobloch JK, Horstkotte MA, Rohde H, Mack D (2002). Evaluation of
different detection m ethods of biofilm formation in Staphylococcus
aureus. Med. Microbiol. Immunol. 191: 101 – 106.
Krukowski H, Szym ankiewicz M, L isowski A (200 8). Slime production by
Staphylococcus aureusstrains isolated from cases of bovine mastitis. Polish
J. Microbiol. 57: 253 – 255.
Lasa I, Penades JR (2006). Bap: a family of surface proteins involved in biofilm
formation. Res. Microbiol. 157: 99 – 107.
Latasa C, Solano C, Penades JR, Lasa I (2006). Biofilm– associated proteins.
C. R. Biol. 329: 849 – 857.
Mariana N S, Salm an SA, Neela V, Zamb eri S (2009). Evaluation of modified
Congo red agar for det ection of biofilm produced by clinical isolates of
methicillin resistance Staphylococcus aureus. African J. Microbiol. Res.
3(6): 330 – 338.
Melchior MB, Vaarkamp H, Fink–Gremmels J (2006b). Bio–films: A role in
recurrent mastitis infections. Vet. J. 171: 398 – 40 7.
Melchior MB, Fink–Gremmels J, Gaastra W (2007). Extended antimicrobial
susceptibility assay for Sta phylococcus aureus isolates from b ovine
mastitis growing in biofilm. Vet. Microbiol. 125: 141 – 149.
Melchior MB, Van Osch MHJ, Graat RM, Duijkeren EV, Mevius D J, Nielen
M, Gaastra W, Fink–Gremmels J (2009). Biofilm formation and
genotyping of Staphylococcus aureus bovine mastitis isolates: Evidence for
lack of penicillin–resistance in Agr–type II strains. Vet. Microbiol. 137:
83 – 89.
Milanov D, Lazic S, Vidic B, Petrovic J, Bugarski D, Seguljev Z (2010). Slime
production and b iofilm forming ability by Staphylococcus aureus bovine
mastitis isolates. Acta. Vet–Beorgad. 60: 217 – 226.
Nitzsche S, Zweifel C, Stephan R (2007). Phenotyp ic and genotypic traits of
Staphylococcus aureus strains isolated f rom pig carcasses. Vet. Microbiol.
120: 292 – 299.
Rohde H, Burandt EC , Siemssen N (2007). Polysaccharide intercellular
adhesin or protein factors in biofilm accumulation of Staphylococcus
epidermidis and Staphylococcus aureus isolated from prosthetic hip and
knee joint infections. Biomaterials. 28: 1711 – 17 20.
Rohde H, Knobloch JKM, Horstkotte MA, Mack D (2001). Correlation of
Staphylococcus aureus icaADBC genotype and biofilm expression
phenotype. J. Clin. Microbiol. 39: 4595 – 4596.
Sheagren JN (1984). Staphylococcus aureus. The persistent pathogen (second of
two parts). New engl. J. Med. 310: 1368 – 1373.
Szweda P, Schielmann M, Milewski S, Frankowsk A, Jakubczak A (2012).
Biofilm Producti on and presence of ica and bap genes in Staphylococcus
aureus strains isolated from co ws with m astitis in the Eastern Poland.
Polish J. Microbiol. 61: 65 – 69.
Tormo MA, Knecht E, Götz F, Lasa I, Penadés JR (2005). Bap–dependent
biofilm formation by pathogenic species of Staphylococcus: evidence of
horizontal gene transfer. Vet. Microbiol. 151: 2465 – 2475.
Vancraeynest D, Hermans K, Haesebrouck F (2004). Genotypic and
phenotypic screening of high and low virulence Staphylococcus aureus
isolates from rabbits for biofilm formation and MSCRAMMs. Vet.
Microbiol. 103: 241 – 247.
Vasudevan P, N air MK., Annam alai T, Venk itanarayanan KS ( 2003).
Phenotypic and genotypic characterization of bovine mastitis isolates
of Staphylococcus aureus for biofilm f ormation. Vet. Microbiol. 92: 1 79 –
185.
Vautor E , Abadie G , Pont A, Thiery R (2008). Evaluation of the presence of
the bap g ene in Staphylococcus aureus isolates recovered from human and
animals species. Vet. Microbiol. 127: 407 – 411.
Waldvogel FA (1995). In: princ iples and practices of inf ectious diseases.
Mandell gl, bennett je, dolin r, ed. Wiley. New York. pp 1754 – 1777.
Zmantar T, Kou idhi B, Miladi H, Mah douani K, Bakhrouf A (2010). A
Microtiter plate assay for Staphylococcus aureus biofilm quantification at
various pH levels and hydrogen peroxide supplementation. New
Microbiol. 33: 137 – 145.
Zmantar T, Kou idhi B, Miladi H, Mah douani K, Bakhrouf A (2010). A
Microtiter plate assay for Staphylococcus aureus biofilm quantification at
various pH levels and hydrogen peroxide supplementation. New
Microbiol. 33: 137 – 145.