Content uploaded by Paul N. Span
Author content
All content in this area was uploaded by Paul N. Span on Nov 10, 2015
Content may be subject to copyright.
Tumor and Stem Cell Biology
TRPM7 Is Required for Breast Tumor Cell Metastasis
Jeroen Middelbeek
1
, Arthur J. Kuipers
1
, Linda Henneman
6
, Daan Visser
6
, Ilse Eidhof
1
, Remco van Horssen
2
,
B
e Wieringa
2
, Sander V. Canisius
7
, Wilbert Zwart
9
, Lodewyk F. Wessels
8
, Fred C.G.J. Sweep
3
, Peter Bult
4
,
Paul N. Span
5
, Frank N. van Leeuwen
1
, and Kees Jalink
6
Abstract
TRPM7 encodes a Ca
2þ
-permeable nonselective cation channel with kinase activity. TRPM7 has been
implicated in control of cell adhesion and migration, but whether TRPM7 activity contributes to cancer
progression has not been established. Here we report that high levels of TRPM7 expression independently
predict poor outcome in breast cancer patients and that it is functionally required for metastasis formation in a
mouse xenograft model of human breast cancer. Mechanistic investigation revealed that TRPM7 regulated
myosin II–based cellular tension, thereby modifying focal adhesion number, cell–cell adhesion and polarized cell
movement. Our findings therefore suggest that TRPM7 is part of a mechanosensory complex adopted by cancer
cells to drive metastasis formation. Cancer Res; 72(16); 4250–61. 2012 AACR.
Introduction
Metastasis formation is a complicated multistep process
involving tumor cell dissemination from the primary tumor,
matrix invasion, entry into the circulatory system, extrava-
sation through capillary endothelium, and, finally, the out-
growth of secondary tumors in distant organs. Each of these
events requires extensive and continuous Ca
2þ
-dependent
remodeling of the actomyosin cytoskeleton as well as close
interactions with the surroundings of a cell, mediated by
dynamic adhesive structures, such as focal adhesions and
adherens junctions. These specialized cell adhesion sites
convey mechanical cues across the plasma membrane,
affecting both the physical properties of their surroundings
as well as intracellular cytoskeletal dynamics. As the for-
mation and maturation of focal adhesions and adherens
junctions is dependent on the applied mechanical forces,
these structures are considered to function as mechanosen-
sors that integrate mechanical cues from inside and outside
the cell (1–5). The complex protein–protein interactions
within these adhesion sites significantly contribute to tumor
progression and metastasis formation. Hence, proteins that
regulate adhesion formation or turnover represent interest-
ing therapeutic targets to limit the metastatic potential of
cancer cells (6).
Members of the mammalian transient receptor potential
(TRP) cation channel family are considered key players in
mechanosensory signaling (7–11). TRP channels organize into
large macromolecular complexes linked to the actomyosin
cytoskeleton, which may serve to localize signal transduction
pathways and/or enhance the rate of signal transmission
(7, 12, 13). Tethered to the cytoskeleton, their ion conducting
properties can be modulated by different stimuli, including
mechanical cues, resulting in a variety of cellular responses. In
earlier work, we and others identified TRPM7, a Ca
2þ
-perme-
able nonselective cation channel with kinase activity, as a
regulator of actomyosin contractility, cell adhesion, and direct-
ed cell migration (14–16). However, a role for this bifunctional
channel in cancer progression has not been examined. Here we
show that high TRPM7 expression, at the time of diagnosis,
predicts poor therapy outcome in a large cohort of breast
cancer patients. Moreover, TRPM7 is a critical determinant of
breast cancer cell migration in vitro and metastasis formation
in vivo.
Materials and Methods
TRPM7 protein expression in primary breast cancer
tissue samples detected by immunohistochemistry
Formalin-fixed, paraffin-embedded breast tumor tissue,
derived from the tumor bank of the Department of Laboratory
Medicine of the Radboud University Medical Centre, was
probed for TRPM7 (1:400; Cayman Chemical Company), fol-
lowed by biotin-conjugated donkey anti-mouse IgG and DAB
and counterstained with hematoxylin.
Authors' Affiliations:
1
Laboratory of Pediatric Oncology,
2
Department of
Cell Biology, Nijmegen Centre for Molecular Life Sciences, Departments of
3
Laboratory Medicine,
4
Pathology, and
5
Radiation Oncology, Radboud
University Medical Centre, Nijmegen, The Netherlands; Divisions of
6
Cell
Biology and
7
Molecular Biology,
8
Bioinformatics and Statistics, The Neth-
erlands Cancer Institute, Amsterdam, The Netherlands; and
9
Cancer
Research UK, Cambridge Research Institute, Li Ka Shing Centre, Cam-
bridge, United Kingdom
Note: Supplementary data for this article are available at Cancer Research
Online (http://cancerres.aacrjournals.org/).
J. Middelbeek, A.J. Kuipers, P.N. Span, F.N. van Leeuwen, and K. Jalink
contributed equally to this work.
Corresponding Author: Frank N. van Leeuwen, Laboratory of Pediatric
Oncology, Nijmegen Centre for Molecular Life Sciences, Radboud
University Medical Centre, PO Box 9101, 6500 HB Nijmegen, The
Netherlands. Phone: 31-24-36-66203; Fax: 31-24-36-66352; E-mail:
FN.vanLeeuwen@cukz.umcn.nl
doi: 10.1158/0008-5472.CAN-11-3863
2012 American Association for Cancer Research.
Cancer
Research
Cancer Res; 72(16) August 15, 2012
4250
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
TRPM7 expression measurements in patient samples
Our discovery cohort consisted of 368 early-stage breast
cancer samples, described in a previous study (17). The
validation cohort consisted of 144 patients with unilateral
breast cancer who had undergone resection of their pri-
mary tumor between November 1987 and December 1997
(18). TRPM7 expression levels in tumor samples derived
from the discovery cohort were determined by microarray
analysis using Affymetrix U133B Genechips (Affymetrix).
Raw data are available at the Gene Expression Omnibus
repository database (GEO accession number: GSE6532).
TRPM7 expression levels in the validation cohort were
determined by quantitative PCR reactions on cDNA sam-
ples derived from primary tumors, using power SYBR-green
reagent (Applied Biosystems) in combination with TRPM7-
specific primers (forward: TAGCCTTTAGCCACTGGAC;
reverse: GCATCTTCTCCTAGATTTGC) according to man-
ufacturer's recommendations. TRPM7 gene expression
levels were normalized to the HPRT housekeeping gene
(forward: GGTCCTTTTCACCAGCAAGCT; reverse: TGA-
CACTGGCAAAACAATGCA) and calculated according to
the cycling threshold method (19). Statistical analyses were
carried out using SPSS software (version 16.0; SPSS). Dis-
covery and validation cohorts were dichotomized using
median TRPM7 expression as cut-off. Survival curves were
visualized by Kaplan–Meier plots, using recurrence-free
and distant metastasis-free survival as endpoints and com-
pared using log-rank tests. HRs were estimated by univar-
iate Cox regression analysis. The independent prognostic
value of TRPM7 was assessed by univariate and multivar-
iate Cox regression analysis on combined discovery and
validation cohorts.
Generation and validation of cell lines
Human TRPM7 short hairpin RNAs (shRNA; #1: 5-
GCGCTTTCCTTATCCACTTAA-3; #2: 5-CAGCAGAGCCCGA-
TATTATTT-3) were introduced in MDA-MB-231 [HTB-26,
American Type Culture Collection (ATCC)] and human
TRPM7 shRNA#1 was introduced in MCF7 human breast
cancer cells (HTB-22, ATCC), using the pLKO lentiviral
expression vector according to manufacturer's instructions
(Sigma Aldrich). A nonfunctional shRNA (5-GCTACAAGA-
GAAACCAAATCT-3) was used as negative control. Trans-
duced cells were selected with 1 mg/mL puromycin. For
bioluminescent imaging, control and TRPM7 knockdown
MDA-MB-231 cells were cotransduced with a retroviral
pLZRS luciferase reporter construct and selected with
0.5 mg/mL Zeocin. For rescue of TRPM7 expression levels,
HA-tagged mouse TRPM7, containing one mismatch with
respect to the human-specific shRNA (14), was introduced in
MDA-MB-231 TRPM7 shRNA cells. Transduced cells were
selected with 1 mg/mL G418. TRPM7 mRNA expression
levels were determined by quantitative reverse transcriptase
PCR with the additional use of mouse-specificTRPM7
primers (forward: TAGCCTTTAGCCACTGGACC; reverse:
GCATCTTCTCCTAGATTGGCAG). TRPM7 protein levels
were determined by radioactivelylabelingtheTRPM7kinase
domain as described previously (14).
Cell viability and proliferation measurements
The effect of TRPM7 knockdown on cell viability and pro-
liferation was assessed by MTS assays according to manufac-
turer's instructions (Promega). Cell-cycle distribution of the
different cell lines was determined by fluorescence-activated
cell sorting (FACS) analysis on cells stained with propidium
iodide. Cells were harvested and the cell pellet was incubated
in staining solution (1 mg/mL sodium citrate, 0.1 mg/mL
RNAseA, 20 mg/mL propidium iodide, and 0.1% Triton X-100).
Cells were washed and subjected to FACS analysis. Cell-cycle
distribution was quantified using FlowJo analysis software.
Mouse xenograft experiments
All animal work was carried out in accordance with proto-
cols approved by the Animal Welfare Committee (DEC-NKI-
10.034). Immunodeficient Rag2
/
IL2rg
/
mice were used for
metastasis experiments. MDA-MB-231-Luc control and
TRPM7 knockdown cells were collected and washed with PBS.
Subsequently, 0.2 mL PBS containing 5 10
5
cells was injected
into a tail vein. Tumor growth was monitored by biolumines-
cence imaging from day 7 onwards. Beetle luciferin (Promega)
was dissolved at 15 mg/mL in PBS and stored at 20C.
Animals were anaesthetized with 2% to 3% isoflurane. Lucif-
erin solution was injected intraperitonially (0.01 mL/g body
weight). Light emission was measured 15 minutes later, using a
cooled CCD camera (IVIS; Xenogen), coupled to Living Image
acquisition and analysis software over an integration time of 1
minute. Signal intensity was expressed as flux (photons/sec)
integrated over the lung region. Lung tissue was collected at
day 30 after injection. Tissues were fixed in EAF (ethanol–
acetic acid–formol saline fixative, 40:5:10:45% v/v) and pro-
cessed for histology. Paraffin sections were stained with
hematoxylin and eosin. All microscopic images were acquired
using IP-Lab software (Scanalytics Inc.) in combination with a
monochrome CCD camera (Retiga SRV, 1,392 1,040 pixels)
and a RGB filter (Slikder Module; QImaging) attached to a
motorized microscope (Leica DM6000). Quantification of
tumor size and number was carried out by ImageJ image
analysis software.
Cell migration, elongation, and scatter experiments
Following overnight serum starvation, cells were harvested
and resuspended in Dulbecco's Modified Eagle's Medium
(DMEM) containing 0.1% FBS. Subsequently, 50,000 cells were
applied to a transwell insert with 8-mm pore size (Corning Life
Sciences), which was incubated in DMEM supplemented with
10% FBS. Cells were allowed to migrate for 8 hours at 37C.
Migrated cells were fixed (75% methanol and 25% acetic acid)
and stained (0.25% Coomassie blue, 45% methanol, and 10%
acetic acid in H
2
O). Single cell migration on vitronectin-coated
(500 ng/mL) culture dishes was followed for 24 hours by time-
lapse microscopy and analyzed using ImageJ image analysis
software. Cell elongation was determined based on length and
width ratios, measured after 24 hours. A cell was considered
elongated when the ratio length/width was larger than 2. MCF7
cell scattering on vitronectin-coated (500 ng/mL) culture
dishes was visualized by time-lapse microscopy in DMEM
supplemented with 0.1% FBS. Gap closure assays were carried
TRPM7 Drives Breast Cancer Metastasis
www.aacrjournals.org Cancer Res; 72(16) August 15, 2012 4251
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
out according to manufacturer's recommendations (Applied
Biophysics). In short, 40,000 MCF7 cells were seeded per insert
and cultured overnight. After removal of the insert, cells were
allowed to migrate for 24 hours, and migration was followed by
time-lapse microscopy. Where indicated, cells were incubated
in the presence of different concentrations Y27632 (Sigma-
Aldrich) and GSK429286 (Seleckbio) Rho-kinase inhibitors.
Fluorescent staining of focal adhesions, E-cadherin, and
F-actin
Images were taken with a Leica TCS SP5 confocal (Leica
Microsystems) equipped with a 63water-immersion objec-
tive and LAS-AF acquisition software (Leica Microsystems).
Cells were cultured overnight on vitronectin-coated (500
ng/mL) glass coverslips in DMEM containing 0.1% FBS.
Where indicated, cells were next incubated for 2 hours in
the presence of 5 mmol/L Y27632 Rho-kinase inhibitor
(Sigma-Aldrich). Cells were fixed in 3.7% formaldehyde, per-
meabilized in 0.1% Triton X-100, and stained for pTyr118
paxillin (1:100; Life Technologies), E-cadherin (1:200; BD
Biosciences) and F-actin, using Alexa-568–conjugated Phal-
loidin (1:100; Life Technologies). The average number of focal
adhesions per cell was quantified using an ImageJ analysis
routine (macro). Series of paxillin images (pixel size, 0.11
0.11 mm
2
) were normalized with respect to intensity/con-
trast, background was subtracted and cell boundaries were
detected by manually setting the appropriate threshold. The
original image was subjected to a rolling ball filter of radius
10 pixels, which effectively suppresses staining irregularities
while retaining contrast in the focal adhesions. Further
thresholding and the "Analyze Particles" plugin (settings:
particle size 30–500 pixels; circularity 0.1–1.0) were used to
determine the number of focal adhesions. Photomicrographs
of at least 60 cells were analyzed for each condition.
Detection of pSer19 myosin light chain and focal
adhesion–associated pTyr118 paxillin on Western blot
For detection of pSer19 myosin light chain in control and
TRPM7 shRNA–transduced MDA-MB-231 cells, cells were
lysed in Laemmli buffer supplemented with 1 mmol/L MgCl
2
and 1:200 Benzoase Nuclease (Merck) and left on ice for 30
minutes. Focal adhesion–associated proteins were extracted
from MDA-MB-231 cells, as described previously (20). Proteins
were separated by SDS-PAGE and blotted onto a polyvinyli-
dene difluoride membrane. Blots were incubated with rabbit
polyclonal anti-pTyr118 paxillin antibody (1:750; Life Technol-
ogies) or anti-pSer19 myosin light chain antibody (1:1,000; Life
Technologies) and mouse monoclonal g-tubulin (1:10,000;
Sigma Aldrich) antibodies, followed by horseradish peroxi-
dase–conjugated secondary antibodies (1:5,000; Dako). Pro-
teins were detected using ECL Western blot reagent (GE
Healthcare) and exposing the blots to film.
Statistical analysis
Statistical data are expressed as mean SD or SEM, as
indicated in the text. Statistical differences were tested with 2-
sided, unpaired Student ttests, and Pless than 0.05 was
considered statistically significant.
Results and Discussion
TRPM7 mRNA expression levels in primary tumors are
associated with breast cancer progression and
metastasis formation, independent from standard
clinical parameters
Immunohistochemistry on primary breast cancer tissue
samples showed that TRPM7 protein is expressed by epithelial
cells that align mammary glands and by breast tumor cells.
Perinuclear staining of breast carcinoma cells was observed
with accentuation of the nuclear membrane, with or without
diffuse staining of the cytoplasm (Fig. 1A). We explored the
prognostic value of TRPM7 mRNA levels in breast cancer,
using microarray-based gene expression data from breast can-
cer specimens, obtained by resection of the primary tumor at
diagnosis (discovery cohort; n¼368) (Supplementary Table S1;
ref. 17). After dichotomization based on the median TRPM7
expression level, the TRPM7-high group (n¼184) was found
to exhibit a significantly shorter recurrence-free survival as
compared with the TRPM7-low group (n¼184; HR, 1.42; 95%
CI, 1.01–2.01, P¼0.042; Fig. 1B). Even stronger was the
association of TRPM7 with distant metastasis-free survival
interval (HR, 1.85; 95% CI, 1.22–2.81, P¼0.003; Fig. 1B).
In 3 additional breast cancer cohorts (n¼190, 244, and
n¼216), we did not detect a significant association of
TRPM7 with disease outcome. Discordances between micro-
array-based datasets remain a serious problem, often reflecting
differences in patient populations, probe selection, and mRNA
abundance. We therefore sought for independent validation
by carrying out quantitative real-time PCR (qPCR) experi-
ments in a highly similar, independent breast cancer patient
cohort (validation cohort; n¼144; Supplementary Table S1).
TRPM7 mRNA expression was associated with disease recur-
rence (HR, 1.88; 95% CI, 1.06–3.33, P¼0.029) and occurrence
of distant metastases. Although the HR was similar as in the
discovery cohort, the latter association did not reach statistical
significance (HR, 1.84; 95% CI, 0.91–3.71, P¼0.085), possibly
because of a lower number of events (Fig. 1C).
We next assessed the association between TRPM7 expres-
sion and standard clinical parameters using the combined
discovery and validation cohorts (n¼512). In support of its
association with disease progression, TRPM7 was found
enriched in high-grade primary tumors (P¼0.02; Supplemen-
tary Table S2A). Other prognostic parameters, including tumor
size and ER status, were not associated with TRPM7 expression
levels and TRPM7 expression was similar between breast
cancer subtypes (P¼0.28; Supplementary Table S2B and C).
However, because the dominant prognostic feature in all
microarray studies of ER-positive breast cancer is proliferation,
we cannot exclude that TRPM7 is an indirect indicator of
proliferation in the ER-positive subgroup of tumors.
Univariate Cox regression analysis indicated that histologic
grade, tumor size, and TRPM7 expression levels are strong
predictors of both disease recurrence and the occurrence of
distant metastases (Table 1; P<0.01). Importantly, multivar-
iate analysis revealed that TRPM7 mRNA expression is
an independent prognostic marker for both disease recurrence
(P¼0.02) and occurrence of metastases at distant sites
(P¼0.01; Table 1), after correction for standard clinical
Middelbeek et al.
Cancer Res; 72(16) August 15, 2012 Cancer Research
4252
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
parameters. Whereas future research must address to what
extent TRPM7 levels indeed have prognostic value, our results
indicated a strong and independent association between
TRPM7 expression levels and breast cancer progression.
TRPM7 knockdown interferes with the metastatic
potential, but not proliferation, of invasive, triple-
negative breast cancer cells in vivo
To establish a causal relation between TRPM7 expression
levels and metastasis formation, shRNA-mediated knockdown
was carried out by lentiviral transduction of invasive, triple-
negative MDA-MB-231 breast cancer cells. Knockdown effi-
ciency was about 80%, as determined both by qPCR and by
measuring TRPM7 autophosphorylation using an in vitro
kinase assay (Supplementary Fig. S1A and B). A number of
studies has shown that TRPM7 knockdown can affect cell
viability and proliferation in vitro (21, 22). However, we
observed that MDA-MB-231 TRPM7 shRNA cells proliferated
normally and showed no loss in cell viability (Fig. 2A and
Supplementary Fig. S2A). We next compared in vivo metastasis
formation of MDA-MB-231 control and TRPM7 shRNA cells
that were made to express a luciferase reporter gene. Following
injection of cells in the tail vein of immunodeficient Rag2
/
IL2rg
/
mice, luciferase-based noninvasive bioluminescence
imaging was used to monitor dissemination and growth of
tumor cells in vivo. Consistent with earlier reports describing
Figure 1. TRPM7 is a strong and
independent prognostic marker for
breast cancer progression and
metastasis. A, TRPM7 protein
expression in a breast tumor section
(brown). Nuclei are counterstained
with hematoxylin (blue). Left, scale
bar, 500 mm. Right, scale bar, 100
mm. Indicated are breast tumor cells
and stroma. B, Kaplan–Meier
analysis of recurrence-free survival
(left) and distant metastasis-free
survival (right) according to TRPM7
mRNA expression obtained from
microarray analysis on 368 breast
cancer patients (discovery cohort).
TRPM7-low, n¼184; TRPM7-high,
n¼184. Pvalues are based on Log
rank test. C, Kaplan–Meier analysis
of recurrence-free survival (left) and
distant metastasis-free survival
(right) according to TRPM7 mRNA
expression determined by
quantitative real-time PCR
measurements on 144 breast cancer
patients (validation cohort). TRPM7-
low, n¼72; TRPM7-high, n¼72.
Pvalues are based on Log rank test.
TRPM7 Drives Breast Cancer Metastasis
www.aacrjournals.org Cancer Res; 72(16) August 15, 2012 4253
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
this experimental metastasis model (23), tumor cells were
initially trapped in the lungs, probably because of size restric-
tions of the mouse lung capillaries (Fig. 2B). The progressive
increase of the bioluminescent signal in mice injected with
control cells indicates that these cells effectively developed into
pulmonary metastases (Fig. 2C). At day 30 after injection,
metastatic spread of tumor cells throughout the body was
observed in all of the control mice. One mouse had to be taken
out of the experiment 22 days after injection because of a large
tumor mass in the head of the animal (Fig. 2D). TRPM7
knockdown led to a strong reduction in bioluminescent signal
intensity from day 7 onwards, which remained mostly restrict-
ed to the lungs (Fig. 2C and D). Similar results were obtained
from an independent experiment in which an additional
TRPM7 knockdown cell line, derived using a second shRNA,
was included (Supplementary Fig. S1A and B and Supplemen-
tary Fig. S2B and C). These observations suggested that TRPM7
knockdown impairs the initial establishment of tumors in the
lung and dissemination to other parts of the body. Quantitative
analysis of tumor size in HE-stained lung sections confirmed
that TRPM7 knockdown did not affect proliferation [mean
tumor size, control: 0.045 mm
2
0.0047 (n¼474) vs. TRPM7
shRNA: 0.037 mm
2
0.0054 (n¼131), 3 mice per group, P¼
0.29; Fig 2E and G and Supplementary Fig. S2D]. However,
TRPM7 knockdown significantly reduced the number of lung
tumors per mouse (control: 158.33 11.7 vs. TRPM7 shRNA:
43.67 5.33, 3 mice per group, P<0.001; Fig. 2F and G). Overall,
these experiments showed that a reduction of TRPM7 protein
expression effectively interferes with the metastatic potential
of invasive human breast cancer cells in vivo.
TRPM7 knockdown impairs migratory properties of
invasive, triple-negative breast cancer cells in vitro
To examine how TRPM7 may affect the ability of tumor cells
to spread to distant sites, we studied the consequences of
TRPM7 knockdown on cytoskeletal organization and cell
behavior. Whereas control MDA-MB-231 cells exhibited a
characteristic spindle-shaped (mesenchymal) morphology
with actin-rich protrusions at the leading edge, this elongated
morphology was lost upon TRPM7 knockdown (percentage
elongated control cells: 63.3% 2.8% vs. TRPM7 shRNA: 30.0%
2.5%, n>400, 4 independent experiments, P<0.001; Fig. 3A
and B). Moreover, loss of TRPM7 expression effectively inter-
fered with the ability of these cells to migrate toward a serum
gradient, as determined in a transwell migration assay (control:
100% vs. TRPM7 shRNA: 50.56% 9.15%, 5 exp, P<0.01;
Fig. 3C). By time-lapse microscopy, we observed that TRPM7
knockdown affected cell migration speed, resulting in signif-
icantly shorter migration trajectories (control: 29.7 2.2 mm/h
vs. TRPM7 shRNA: 17.2 1.1 mm/h, n>200, 4 exp, P<0.01;
Fig. 3D and E).
Similar results were obtained with the second TRPM7
knockdown cell line (Supplementary Fig. S1A and B, Sup-
plementary Fig. S3). We additionally reexpressed a mouse
TRPM7 cDNA into the TRPM7 knockdown cells, which
contained one mismatch with respect to the (human
Table 1. TRPM7 is a predictor of breast cancer recurrence and metastasis, independent of standard clinical
parameters
Univariate analysis Multivariate analysis
Factors Categories HR (95% CI) PHR (95% CI) P
A. Recurrence-free survival
Age >50 vs. <50 y 0.74 (0.53–1.03) 0.07 0.82 (0.54–1.24) 0.34
Histologic grade 2 & 3 vs. 1 2.23 (1.37–3.76) <0.01 1.85 (1.10–3.11) 0.02
Lymph node status Positive vs. negative 1.24 (0.93–1.66) 0.15 1.24 (0.79–1.94) 0.34
Tumor size >2 cm vs. <2 cm 1.93 (1.41–2.63) <0.01 1.71 (1.19–2.47) <0.01
Syst. Adj. treatment Yes vs. no 1.02 (0.75–1.37) 0.92 0.85 (0.52–1.41) 0.53
Estrogen receptor Positive vs. negative 0.65 (0.45–0.93) 0.02 0.80 (0.51–1.26) 0.34
TRPM7 High vs. low 1.52 (1.13–2.03) <0.01 1.52 (1.08–2.12) 0.02
B. Distant metastasis free survival
Age >50 vs. <50 y 1.28 (0.80–2.05) 0.30 1.19 (0.68–2.08) 0.54
Histologic grade 2 & 3 vs. 1 2.50 (1.34–4.67) <0.01 2.11 (1.12–4.00) 0.02
Lymph node status Positive vs. negative 1.72 (1.21–2.43) <0.01 1.45 (0.86–2.43) 0.16
Tumor size >2 cm vs. <2 cm 2.03 (1.40–2.96) <0.01 1.70 (1.10–2.64) 0.02
Syst. adj. treatment Yes vs. no 1.39 (0.95–2.04) 0.90 0.86 (0.47–1.57) 0.62
Estrogen receptor Positive vs. negative 0.91 (0.57–1.47) 0.70 0.98 (0.54–1.77) 0.94
TRPM7 High vs. low 1.75 (1.19–2.58) <0.01 1.69 (1.13–2.54) 0.01
NOTE: Univariate and multivariate Cox proportional hazards modeling of factors associated with recurrence-free survival (A) and distant
metastasis-free survival (B) in the combined discovery and validation cohorts (n¼512). TRPM7-low, n¼256; TRPM7-high, n¼256.
Bold numbers, P<0.05, statistically significant.
Abbreviation: CI, confidence interval.
Middelbeek et al.
Cancer Res; 72(16) August 15, 2012 Cancer Research
4254
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
specific) shRNA. We confirmed by qPCR analysis as well as
by in vitro kinase assays that expression of TRPM7 was
restored to about 70% of that in the control cells (Supple-
mentary Fig. S1C and D). Reexpression of TRPM7 was
sufficient to rescue the elongated morphology (percentage
of elongated cells: 56.2% 4.7%, n¼400, 4 exp, P<0.01) and
Figure 2. Reduced TRPM7 expression interferes with the metastatic potential of MDA-MB-231 human breast cancer cells in vivo. A, proliferation and overall
viability of control and TRPM7 knockdown MDA-MB-231 cells, determined by MTS assays. Measurements were carried out at different time points, indicated
on the x-axis. Metabolic activity is expressed as the amount of produced Formazan, determined by photospectrometry and normalized to initial metabolic
activity. Data are presented as mean SEM of 2 independent experiments that were carried out in triplicate. B, representative bioluminescence images of mice
7 days after intravenous injections with MDA-MB-231 control or TRPM7 shRNA cells. C, quantification of bioluminescence in the lung region of mice for up
to 30 days after injection. Data are presented as mean SEM of n¼5 mice in each group. D, bioluminescence images of mice taken 30 days after
injection. Photon fluxes are to the same scale. Dagger in C and D indicates a mouse that had to be euthanized 22 days after injection with control MDA-MB-231
cells, because of a large tumor in the head region. Bioluminescence image in D was taken at day 21. Subsequent quantifications were carried out on the 9
remaining mice. E, quantification of mean lung tumor size in mice injected with MDA-MB-231 control or TRPM7 shRNA cells. Error bars represent
SEM for n¼3 mice in each group. F, quantification of the number of lung tumors per mouse measured in resected lung tissue from mice injected with MDA-
MB-231 control or TRPM7 shRNA cells. Error bars represent SEM for n¼3 in each group. ,P<0.001. For size distribution, see Supplementary Fig. S2B. G,
representative hematoxylin and eosin staining on lung tissue collected 30 days after injection with MDA-MB-231 control or TRPM7 shRNA cells. Prominent
tumors in lung tissue from mice injected with TRPM7 shRNA cells (bottom) are indicated by arrows. Scale bar, 1 mm.
TRPM7 Drives Breast Cancer Metastasis
www.aacrjournals.org Cancer Res; 72(16) August 15, 2012 4255
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
restore the migratory properties of MDA-MB-231 TRPM7
knockdown cells (transwell: 95.3% 1.2%, 2 exp, P<0.05;
single-cell migration: 25.3 1.6 mm/h, n>200, 4 exp, P<
0.01; Fig. 3).
Reduced TRPM7 expression levels confer a contractile
phenotype onto triple-negative breast tumor cells and
induce cell-substrate adhesion assembly
In addition to the functional changes, immunofluorescent
staining of MDA-MB-231 cells revealed the redistribution of
filamentous actin to the cell cortex and a strong increase in
the number of focal adhesions, especially in the periphery of
TRPM7 knockdown MDA-MB-231 cells, relative to mock-
transduced control cells (control: 13.8 0.62, TRPM7
shRNA: 29.9 0.85, n>100, P<0.001; Fig. 4A and B). Focal
adhesions are mechanosensitive adhesion structures whose
assembly and disassembly need to be tightly regulated by a
combination of myosin II–based cellular tension and local
Ca
2þ
signaling events to allow optimal cell migration (24–
29). Increased focal adhesion assembly is generally associ-
ated with high cytoskeletal tension, accompanied by tyro-
sine phosphorylation of focal adhesion components such as
paxillin as well as increased myosin light chain (MLC)
phosphorylation (24). Indeed, the increase in focal adhesions
observed in the TRPM7 knockdown cells was reflected by a
rise in Tyr118-phosphorylated paxillin and Ser19-phosphor-
ylated MLC on a Western blot (Fig. 4C and Supplementary
Fig. S4A). Reexpression of TRPM7 reduced focal adhesion
content (18.2 0.89, n¼45, P<0.001) and reverted paxillin
phosphorylation (Fig. 4).
Figure 3. TRPM7 contributes to the
malignant phenotype of MDA-MB-
231 breast cancer cells in vitro.
A, representative phase-contrast
images of control and TRPM7
shRNA MDA-MB-231 cells. Scale
bar, 50 mm. B, quantification of
elongated MDA-MB-231 cells,
TRPM7 shRNA cells, and TRPM7
shRNA cells made to reexpress a
mouse TRPM7 cDNA (rescued
cells). Elongation is presented as
percentage (SEM; 4 independent
experiments, n>400) of cells that
have a length of more than twice
the width. ,P<0.001;
P, <0.01. C, quantification of
serum-induced transwell migration
by MDA-MB-231 cells, TRPM7
shRNA cells, and the rescued cell
line. Data, normalized to the
number of control MDA-MB-231
cells, are from 5 independent
experiments carried out in
duplicate in which the rescued cell
line was included twice, and
represent mean SEM. Migration
was scored after 8 hours. ,P<
0.01; ,P<0.05. D, representative
trajectories of migrating control (n
¼10) and TRPM7 shRNA (n¼10)
MDA-MB-231 cells followed for 24
hours. E, quantification of single
cell migration speed. Shown is
migration speed (mm/h, mean
SEM) of 4 independent
experiments, each carried out in
duplicate (n>200 per cell line).
,P<0.01.
Middelbeek et al.
Cancer Res; 72(16) August 15, 2012 Cancer Research
4256
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
ER-positive breast cancer cells exhibit reduced cell
migration speed and enforced cell–cell adhesions upon
TRPM7 knockdown
In addition to basal-like tumors, represented by the triple-
negative MDA-MB-231 breast cancer model, a large part of
the patient dataset consisted of ER-positive, luminal type
breast cancer patients. To validate our observations in these
tumors, we knocked down TRPM7 in noninvasive, ER-pos-
itive MCF7 human breast cancer cells (Supplementary Fig.
S1E). This significantly reduced migration of MCF7 cells in
gap-closure assays (control: 11.5 0.5% vs. TRPM7 shRNA:
21.2 1.7% gap remaining after 24 hours, 3 exp, P<0.01; Fig.
5A and B). In these epithelial-like cells, TRPM7 knockdown
predominantly affected cell–cell adhesion rather than cell-
substrate adhesion. Unlike the control shRNA-transduced
cells, the TRPM7 knockdown cells were able to maintain
cell–cell contacts upon serum deprivation, a condition
known to induce scattering of epithelial cells (ref. 30; Fig.
5C). Although increased MLC and paxillin phosphorylation
were not observed in MCF7 TRPM7 shRNA cells (data not
shown), confocal microscopy revealed profound effects on
cytoskeletal organization and cell–cell contacts (Fig. 5D).
Figure 4. Reduced TRPM7
expression increases cytoskeletal
contractility and affects focal
adhesion dynamics of MDA-MB-231
cells. A, immunofluorescence
staining of MDA-MB-231 cells with
pTyr118 paxillin antibodies to reveal
focal adhesions and Alexa-568
phalloidin to visualize the actin
cytoskeleton. Arrows indicate
enrichment of filamentous actin at
the cell cortex. Scale bar, 10 mm. B,
quantification of the number of focal
adhesions per cell carried out by
automated image analyses as
detailed in Material and Methods.
Data are mean SEM (n>100 for
control and TRPM7 knockdown
cells, n¼45 for rescue cell line).
,P<0.001. C, immunoblot of
Triton X-100 insoluble fractions
derived from MDA-MB-231 control,
TRPM7 shRNA, and rescued cells.
Antibodies against pTyr118 paxillin
were used to determine the amount
of tyrosine phosphorylated paxillin as
a measure of cytoskeletal
contractility and focal adhesion
content. Antibodies against g-tubulin
were used to control for loading. For
uncropped immunoblots, see
Supplementary Fig. S5A.
TRPM7 Drives Breast Cancer Metastasis
www.aacrjournals.org Cancer Res; 72(16) August 15, 2012 4257
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
Similar to our observations in MDA-MB-231 cells, TRPM7
knockdown induced the redistribution of filamentous actin
to the cell cortex. Moreover, cell–cell interactions seemed to
be enforced in MCF7 TRPM7 shRNA cells, evident from
increased cell–cell contact area and enrichment of E-cad-
herin at these interfaces. Cadherin-containing cell–cell
adhesions, known as adherens junctions, show functional
and structural similarities to focal adhesions (4). Like focal
adhesions, adherens junctions are highly dynamic multi-
protein complexes that act in close association with the
actomyosin cytoskeleton to translate mechanical signals
into cellular responses. Moreover, their formation and
size are directly associated with myosin II–based cellular
tension (5).
Pharmacologic inhibition of cytoskeletal tension rescues
the TRPM7 knockdown phenotype
Our results indicated that TRPM7 knockdown confers a
contractile phenotype onto breast cancer cells and conse-
quently, impairs their migratory and metastatic properties.
Consistent with this notion, inhibition of myosin II–based
cytoskeletal tension using the Y27632 Rho-kinase inhibitor
(31) was sufficient to revert the phenotype of TRPM7 knock-
down in MDA-MB-231 cells to the characteristic elongated
morphology of control cells (elongated cells: 54.5% 3.0%,
n>100, 2 exp, P<0.05; Fig. 6A), while reducing MLC- and
paxillin phosphorylation, and the number of focal adhesions
back to control levels (15.7 0.26, n>100, P<0.001; Fig. 6B
and C, Supplementary Fig. S4A and B). A similar effect was
Figure 5. TRPM7 knockdown
reduces migratory properties and
increases cell–cell interactions of
MCF7 cells. A, representative
images of gap closure assay at
time points 0, 12, 18, and 24 hours.
Scale bar, 100 mm. B,
quantification of percentage gap
remaining after 12, 18, and 24
hours. Data are from 3 independent
experiments, each carried out in
duplicate and represent mean
SEM. ,P<0.05; ,P<0.01. C,
representative images from MCF7
control and TRPM7 knockdown
cells after 0, 2, and 4 hours of serum
deprivation. Scale bar, 100 mm.
D, immunofluorescence detection
of E-cadherin in MCF7 cells to
reveal adherens junctions and
Alexa-568 phalloidin to visualize
the actin cytoskeleton. Arrows
indicate enrichment of E-cadherin
at cell–cell interfaces. Scale bar,
10 mm.
Middelbeek et al.
Cancer Res; 72(16) August 15, 2012 Cancer Research
4258
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
observed with the structurally unrelated Rho-kinase inhib-
itor GSK429286 (ref. 32; Supplementary Fig. S4A and B).
Strikingly, Rho-kinase inhibition restored serum-induced
transwell migration of TRPM7 knockdown cells [TRPM7
shRNA: 63.9% 7.0% vs. TRPM7 shRNA þY27632
(5 mmol/L): 116.6% 17.9%, 3 exp, P<0.05] without affecting
MDA-MB-231 control cell migration (Fig. 6D and Supple-
mentary Fig. S4C). Likewise, gap-closure speed of MFC7
TRPM7 shRNA cells was rescued by Rho-kinase inhibition
(Fig. 6E and Supplementary Fig. S4D). In contrast to MDA-
MB-231 cells, low concentrations of Rho-kinase inhibitors
already significantly increased gap-closure speed of MCF7
control cells. However, much higher concentrations of these
compounds were required to maximize gap-closure speed of
MCF7 TRPM7 shRNA cells, supporting the notion that
TRPM7 knockdown increases cellular tension.
Although our observations are not in agreement with the
general notion that increases in Rho-ROCK signaling positively
correlate with cell migration and metastasis formation
(6, 33, 34), it is well known that actomyosin contractility,
Figure 6. Inhibition of cytoskeletal
contractility recovers TRPM7
knockdown phenotype in both MDA-
MB-231 and MCF7 cells. A,
quantification of elongated MDA-
MB-231 TRPM7 shRNA cells with or
without pretreatment with 5 mmol/L
Rho-kinase inhibitor Y27632.
Elongation is presented as
percentage (SEM; 2 independent
experiments, n>100) of cells that
have a length of more than twice the
width. ,P<0.05. B, quantification of
focal adhesion content in MDA-MB-
231 TRPM7 shRNA cells with or
without pretreatment for 2 hours with
5mmol/L Rho-kinase inhibitor
Y27632. Data are mean SEM
(n>100 cells per cell line). ,
P<0.001. C, immunofluorescence
staining of MDA-MB-231 cells with
pTyr118 paxillin antibodies to reveal
focal adhesions and Alexa-568
phalloidin to visualize the actin
cytoskeleton. Scale bar, 10 mm. D,
quantification of serum-induced
transwell migration of MDA-MB-231
control and TRPM7 shRNA cells
treated with indicated
concentrations Y27632 Rho-kinase
inhibitor. Data, normalized to the
number of migrated MDA-MB-231
control cells that were untreated, are
from 3 independent experiments
carried out in duplicate and represent
mean SEM. Migration was scored
after 8 hours. ,P<0.05. For data on
GSK429286 treated cells, see
Supplementary Fig. S4C. E,
quantification of percentage gap
remaining by MCF7 control and
TRPM7 shRNA cells, treated with
indicated concentrations Y27632
Rho-kinase inhibitor. Data represent
percentage gap remaining after 18
hours (mean SEM, 3 independent
experiments, each conducted in
duplicate). ,P<0.01; ,
P<0.0001. For data on GSK429286
treated cells, see Supplementary
Fig. S4D.
TRPM7 Drives Breast Cancer Metastasis
www.aacrjournals.org Cancer Res; 72(16) August 15, 2012 4259
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
adhesion dynamics, and the mechanical properties of the
substrate have to be tightly balanced to maximize migration
velocity (26, 27, 35, 36). Hence, overassembly of either focal
adhesions or adherens junctions in the TRPM7 knockdown
cells, both a consequence of increased cytoskeletal tension,
likely interferes with optimal cell migration (Supplementary
Fig. S4E). Altogether, our results indicated that TRPM7 is part
of the mechanosensory machinery that regulates cellular ten-
sion and steers adhesion dynamics to allow cell migration and
metastasis formation.
Conclusions
TRP channels play a prominent role in translating mechan-
ical forces into biochemical signals, although in most cases it
remains to be established whether they are directly activated
by mechanical stimulation. Activation of these proteins not
only leads to changes in local Ca
2þ
concentrations but also
triggers other signaling mechanisms that influence cell behav-
ior and differentiation (37). Mice deficient in TRPM7 show
widespread defects in early embryonic development, pointing
at a nonredundant role for this channel kinase in organ
development (38). Defects in mechanotransduction, especially
those that affect cellular tension, are known to contribute to
disease progression (39, 40). Hence, we propose that TRPM7-
guided cell adhesion and migration are normal attributes of
epithelial and mesenchymal cells, required during organ devel-
opment, but when spuriously activated in cancer cells con-
tribute to metastasis formation.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors' Contributions
Conception and design: J. Middelbeek, A.J. Kuipers, L. Henneman, D. Visser, W.
Zwart, F.N. van Leeuwen, K. Jalink
Development of methodology: J. Middelbeek, A.J. Kuipers, D. Visser, I. Eidhof,
F.N. van Leeuwen, K. Jalink
Acquisition of data (provided animals, acquired and managed patients,
provided facilities, etc.): J. Middelbeek, A.J. Kuipers, L. Henneman, D. Visser, I.
Eidhof, R. van Horssen, F.C.G.J. Sweep, P. Bult, P.N Span, K. Jalink
Analysis and interpretation of data (e.g., statistical analysis, biostatistics,
computational analysis): J. Middelbeek, A.J. Kuipers, L. Henneman, I. Eidhof, R.
van Horssen, S.V. Canisius, L.F. Wessels, P.N Span, F.N. van Leeuwen, K. Jalink
Writing, review, and/or revision of the manuscript: J. Middelbeek, A.J.
Kuipers, L. Henneman, D. Visser, S.V. Canisius, W. Zwart, L.F. Wessels, F.C.G.J.
Sweep, P. Bult, P.N Span, F.N. van Leeuwen, K. Jalink
Administrative, technical, or material support (i.e., reporting or orga-
nizing data, constructing databases): L. Henneman, P.N Span, K. Jalink
Study supervision: B. Wieringa, P.N Span, F.N. van Leeuwen, K. Jalink
Acknowledgments
The authors thank J.J.T.M. Heuvel and W.J.M. Peeters for technical
assistance and members of the Division of Experimental Therapy as well
as their laboratory members for support, critical discussions, and critical
reading of the manuscript.
Grant Support
This work was supported by KWF grants to F.N. van Leeuwen and K. Jalink
(KUN2007-3733 and NKI 2010-4626).
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received November 29, 2011; revised May 24, 2012; accepted June 8, 2012;
published OnlineFirst August 7, 2012.
References
1. Bidwell JP, Pavalko FM. Mechanosomes carry a loaded message.
Science Signaling 2010;3:pe51.
2. Geiger B, Bershadsky A. Exploring the neighborhood: adhesion-cou-
pled cell mechanosensors. Cell 2002;110:139–42.
3. Parsons JT, Horwitz AR, Schwartz MA. Cell adhesion: integrating
cytoskeletal dynamics and cellular tension. Nat Rev 2010;11:633–43.
4. Chen CS, Tan J, Tien J. Mechanotransduction at cell-matrix and cell-
cell contacts. Annu Rev Biomed Eng 2004;6:275–302.
5. Liu Z, Tan JL, Cohen DM, Yang MT, Sniadecki NJ, Ruiz SA, et al.
Mechanical tugging force regulates the size of cell-cell junctions. Proc
Natl Acad Sci U S A 2010;107:9944–9.
6. Paszek MJ, Zahir N, Johnson KR, Lakins JN, Rozenberg GI, Gefen A,
et al. Tensional homeostasis and the malignant phenotype. Cancer
Cell 2005;8:241–54.
7. Clark K, Middelbeek J, van Leeuwen FN. Interplay between TRP
channels and the cytoskeleton in health and disease. Eur J Cell Biol
2008;87:631–40.
8. Lin SY, Corey DP. TRP channels in mechanosensation. Curr Opin
Neurobiol 2005;15:350–7.
9. Orr AW, Helmke BP, Blackman BR, Schwartz MA. Mechanisms of
mechanotransduction. Dev Cell 2006;10:11–20.
10. Numata T, Shimizu T, Okada Y. Direct mechano-stress sensitivity of
TRPM7 channel. Cell Physiol Biochem 2007;19:1–8.
11. Oancea E, Wolfe JT, Clapham DE. Functional TRPM7 channels accu-
mulate at the plasma membrane in response to fluid flow. Circ Res
2006;98:245–53.
12. Clark K, Middelbeek J, Lasonder E, Dulyaninova NG, Morrice NA,
Ryazanov AG, et al. TRPM7 regulates myosin IIA filament stability and
protein localization by heavy chain phosphorylation. J Mol Biol 2008;
378:790–803.
13. GoswamiC,KuhnJ,HeppenstallPA,HuchoT.Importanceofnon-
selective cation channel TRPV4 interaction with cytoskeleton and
their reciprocal regulations in cultured cells. PLoS One 2010;5:
e11654.
14. Clark K, Langeslag M, van Leeuwen B, Ran L, Ryazanov AG, Figdor
CG, et al. TRPM7, a novel regulator of actomyosin contractility and cell
adhesion. EMBO J 2006;25:290–301.
15. Wei C, Wang X, Chen M, Ouyang K, Song LS, Cheng H. Calcium
flickers steer cell migration. Nature 2009;457:901–5.
16. Su LT, Agapito MA, Li M, Simonson WT, Huttenlocher A, Habas R, et al.
TRPM7 regulates cell adhesion by controlling the calcium-dependent
protease calpain. J Biol Chem 2006;281:11260–70.
17. Loi S, Haibe-Kains B, Desmedt C, Lallemand F, Tutt AM, Gillet C, et al.
Definition of clinically distinct molecular subtypes in estrogen recep-
tor-positive breast carcinomas through genomic grade. J Clin Oncol
2007;25:1239–46.
18. Span PN, Waanders E, Manders P, Heuvel JJ, Foekens JA, Watson
MA, et al. Mammaglobin is associated with low-grade, steroid recep-
tor-positive breast tumors from postmenopausal patients, and has
independent prognostic value for relapse-free survival time. J Clin
Oncol 2004;22:691–8.
19. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods 2001;25:402–8.
20. Putnam AJ, Cunningham JJ, Pillemer BB, Mooney DJ. External
mechanical strain regulates membrane targeting of Rho GTPases
by controlling microtubule assembly. Am J Physiol 2003;284:
C627–39.
21. Guilbert A, Gautier M, Dhennin-Duthille I, Haren N, Sevestre H, Ouadid-
Ahidouch H. Evidence that TRPM7 is required for breast cancer cell
proliferation. Am J Physiol 2009;297:C493–502.
22. Jiang J, Li MH, Inoue K, Chu XP, Seeds J, Xiong ZG. Transient receptor
potential melastatin 7-like current in human head and neck carcinoma
cells: role in cell proliferation. Cancer Res 2007;67:10929–38.
Middelbeek et al.
Cancer Res; 72(16) August 15, 2012 Cancer Research
4260
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
23. Yang S, Zhang JJ, Huang XY. Orai1 and STIM1 are critical for
breast tumor cell migration and metastasis. Cancer Cell 2009;15:
124–34.
24. Chrzanowska-Wodnicka M, Burridge K. Rho-stimulated contractility
drives the formation of stress fibers and focal adhesions. J Cell Biol
1996;133:1403–15.
25. Giannone G, Ronde P, Gaire M, Haiech J, Takeda K. Calcium oscilla-
tions trigger focal adhesion disassembly in human U87 astrocytoma
cells. J Biol Chem 2002;277:26364–71.
26. Gupton SL, Waterman-Storer CM. Spatiotemporal feedback between
actomyosin and focal-adhesion systems optimizes rapid cell migra-
tion. Cell 2006;125:1361–74.
27. Barnhart EL, Lee KC, Keren K, Mogilner A, Theriot JA. An adhesion-
dependent switch between mechanisms that determine motile cell
shape. PLoS Biol 2011;9:e1001059.
28. Wolfenson H, Bershadsky A, Henis YI, Geiger B. Actomyosin-gener-
ated tension controls the molecular kinetics of focal adhesions. J Cell
Sci 2011;124:1425–32.
29. Aratyn-Schaus Y, Gardel ML. Transient frictional slip between integrin
and the ECM in focal adhesions under myosin II tension. Curr Biol
2010;20:1145–53.
30. Chen CL, Chan PC, Wang SH, Pan YR, Chen HC. Elevated expression
of protein kinase C delta induces cell scattering upon serum depriva-
tion. J Cell Sci 2010;123:2901–13.
31. Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, Morishita T, et al.
Calcium sensitization of smooth muscle mediated by a Rho-associ-
ated protein kinase in hypertension. Nature 1997;389:990–4.
32. Goodman KB, Cui H, Dowdell SE, Gaitanopoulos DE, Ivy RL, Sehon
CA, et al. Development of dihydropyridone indazole amides as selec-
tive Rho-kinase inhibitors. J Med Chem 2007;50:6–9.
33. Croft DR, Sahai E, Mavria G, Li S, Tsai J, Lee WM, et al. Conditional
ROCK activation in vivo induces tumor cell dissemination and angio-
genesis. Cancer Res 2004;64:8994–9001.
34. Jiang P, Enomoto A, Takahashi M. Cell biology of the movement of
breast cancer cells: intracellular signalling and the actin cytoskeleton.
Cancer Lett 2009;284:122–30.
35. DiMilla PA, Barbee K, Lauffenburger DA. Mathematical model for the
effects of adhesion and mechanics on cell migration speed. Biophys J
1991;60:15–37.
36. DiMilla PA, Stone JA, Quinn JA, Albelda SM, Lauffenburger DA.
Maximal migration of human smooth muscle cells on fibronectin and
type IV collagen occurs at an intermediate attachment strength. J Cell
Biol 1993;122:729–37.
37. Pedersen SF, Nilius B. Transient receptor potential channels in
mechanosensing and cell volume regulation. Methods Enzymol
2007;428:183–207.
38. Jin J, Desai BN, Navarro B, Donovan A, Andrews NC, Clapham DE.
Deletion of Trpm7 disrupts embryonic development and thymopoiesis
without altering Mg2 þhomeostasis. Science 2008;322:756–60.
39. Clark K, Langeslag M, Figdor CG, van Leeuwen FN. Myosin II and
mechanotransduction: a balancing act. Trends Cell Biol 2007;17:
178–86.
40. Jaalouk DE, Lammerding J. Mechanotransduction gone awry. Nat Rev
2009;10:63–73.
TRPM7 Drives Breast Cancer Metastasis
www.aacrjournals.org Cancer Res; 72(16) August 15, 2012 4261
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
2012;72:4250-4261. Published OnlineFirst August 7, 2012.Cancer Res
Jeroen Middelbeek, Arthur J. Kuipers, Linda Henneman, et al.
TRPM7 Is Required for Breast Tumor Cell Metastasis
Updated version
10.1158/0008-5472.CAN-11-3863doi:
Access the most recent version of this article at:
Material
Supplementary
http://cancerres.aacrjournals.org/content/suppl/2012/08/09/0008-5472.CAN-11-3863.DC1.html
Access the most recent supplemental material at:
Cited articles
http://cancerres.aacrjournals.org/content/72/16/4250.full.html#ref-list-1
This article cites 40 articles, 14 of which you can access for free at:
Citing articles
http://cancerres.aacrjournals.org/content/72/16/4250.full.html#related-urls
This article has been cited by 9 HighWire-hosted articles. Access the articles at:
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.org
To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at
Permissions
.permissions@aacr.org
To request permission to re-use all or part of this article, contact the AACR Publications Department at
on November 9, 2015. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Published OnlineFirst August 7, 2012; DOI: 10.1158/0008-5472.CAN-11-3863
