Quantification of minimal residual disease in T-lineage acute lymphoblastic with the TAL-1 deletion using a standardized real-time PCR assay

Abstract

Hematologic relapse remains the greatest obstacle to the cure of children with acute lymphoblastic leukemia (ALL). Recent studies have shown that patients with increased risk of relapse can be identified by measuring residual leukemic cells, called minimal residual disease (MRD), during clinical remission. Current PCR methods, however, for measuring MRD are cumbersome and time-consuming. To improve and simplify MRD assessment, we developed a real-time quantitative PCR (RQ-PCR) assay for detection of leukemic cells that harbor the TAL-1 deletion. We studied serial dilutions of leukemic DNA and found the assay had a sensitivity of detection of one leukemic cell among 100,000 normal cells. We then investigated 23 samples from eight children with ALL in clinical remission. We quantified residual leukemic cells by using the TAL-1 RQ-PCR assay and by using limiting dilution analysis. In 17 samples, both methods detected MRD levels > or =0.001%. The percentages of leukemic cells measured by the two methods correlated well (r2 = 0.926). In the remaining six samples, both methods detected fewer than 0.001% leukemic cells. We conclude the TAL-1 RQ-PCR assay can be used for rapid, sensitive and accurate assessment of MRD in T-lineage ALL with the TAL-1 deletion.

Full text

Leukemia (2001) 15, 166–170
2001 Nature Publishing Group All rights reserved 0887-6924/01 $15.00
www.nature.com/leu
BIO-TECHNICAL METHODS SECTION (BTS)
BTS
Leukemia
Quantification of minimal residual disease in T-lineage acute lymphoblastic leukemia
with the TAL-1 deletion using a standardized real-time PCR assay
X Chen
1
, Q Pan
1
, P Stow
1
, FG Behm
2
, R Goorha
3,4
, C-H Pui
1,2,4
and GAM Neale
1,2,4
Departments of
1
Hematology/Oncology,
2
Pathology, and
3
Virology and Molecular Biology, St Jude Children’s Research Hospital, Memphis,
TN; and
4
University of Tennessee College of Medicine, Memphis, TN, USA
Hematologic relapse remains the greatest obstacle to the cure
of children with acute lymphoblastic leukemia (ALL). Recent
studies have shown that patients with increased risk of relapse
can be identified by measuring residual leukemic cells, called
minimal residual disease (MRD), during clinical remission. Cur-
rent PCR methods, however, for measuring MRD are cumber-
some and time-consuming. To improve and simplify MRD
assessment, we developed a real-time quantitative PCR (RQ-
PCR) assay for detection of leukemic cells that harbor the
TAL-
1
deletion. We studied serial dilutions of leukemic DNA and
found the assay had a sensitivity of detection of one leukemic
cell among 100 000 normal cells. We then investigated 23
samples from eight children with ALL in clinical remission. We
quantified residual leukemic cells by using the
TAL-1
RQ-PCR
assay and by using limiting dilution analysis. In 17 samples,
both methods detected MRD levels ⭓0.001%. The percentages
of leukemic cells measured by the two methods correlated well
(
r
2
ⴝ0.926). In the remaining six samples, both methods
detected fewer than 0.001% leukemic cells. We conclude the
TAL-1
RQ-PCR assay can be used for rapid, sensitive and
accurate assessment of MRD in T-lineage ALL with the
TAL-1
deletion.
Leukemia
(2001) 15, 166–170.
Keywords: real-time PCR quantification; MRD; ALL;
TAL-1
Introduction
With a cure rate of 80% in childhood acute lymphoblastic
leukemia (ALL), great effort has been expended to precisely
define risk assessment so that intensive treatment is given to
children at high risk, whereas less toxic therapy is reserved
for those with excellent prognosis.
1,2
Several recent prospective studies have shown that the level
of leukemic cells during clinical remission, known as minimal
residual disease (MRD), is predictive of patient outcome.
3–5
The consensus from MRD studies is that clinical evaluation of
MRD should improve the overall cure rate of ALL by ident-
ifying the patients with highest risk of relapse thereby allowing
timely therapeutic intervention.
6,7
The most common method for quantifying leukemic cells
in ALL is polymerase chain reaction (PCR) amplification of
leukemia-specific targets.
6,8
Of the various PCR techniques,
limiting dilution analysis
9–11
and comparative hybridization
Correspondence: G Neale, Department of Hematology/Oncology, St
Jude Children’s Research Hospital, 332 N Lauderdale, Memphis TN
38105, USA; Fax: 901 495 3749
Received 31 July 2000; accepted 26 September 2000
methods
12–14
have been used the most. However, these
methods are cumbersome and time-consuming. Therefore,
PCR-based methods must be simplified and improved before
they can be routinely applied in the clinical setting. With that
goal in mind, we investigated the ability of real-time quantitat-
ive PCR (RQ-PCR) to quantify leukemic cells harboring the
TAL-1 deletion.
15
RQ-PCR permits accurate quantification by
measuring PCR products during the exponential phase of the
PCR reaction,
16
and reduces time and labor by eliminating
post-PCR processing. The TAL-1 deletion is present in
approximately 25% of cases of T-lineage ALL, but it is not
found in normal T cells.
15,17,18
Therefore, the TAL-1 deletion
provides a leukemia-specific target for MRD assessment in a
significant number of patients with ALL. We developed a Taq-
Man RQ-PCR assay for detection and quantification of leu-
kemic cells harboring the TAL-1 deletion. We applied this
assay to analyze clinical samples from ALL patients. To assess
the accuracy of our TAL-1 RQ-PCR assay, we compared RQ-
PCR data with those obtained by limiting dilution analysis.
Materials and methods
Cells and cell culture
Bone marrow and peripheral blood samples were obtained
from patients diagnosed with T-lineage ALL. Diagnostic DNA
samples were tested by PCR amplification for SIL
db1
-TAL
db1
and SIL
db1
-TAL
db2
deletions using the primers described.
19
Each case in this report had a SIL
db1
-TAL
db1
deletion. All
samples analyzed by RQ-PCR and limiting dilution were
obtained during clinical remission. Patient samples were
obtained with appropriate consent, and with the approval of
the institutional review board. Normal peripheral blood cells
were obtained from healthy volunteers. Mononuclear cells
were isolated by centrifugation on a density gradient
(Lymphoprep; Life Technologies, Gaithersburg, MD, USA) and
washed three times in phosphate buffered saline. The human
T-lineage ALL cell line CEM-C7 was obtained from Dr Dario
Campana (Department of Hematology/Oncology, St Jude
Children’s Research Hospital). Cells were maintained in
RPMI-1640 culture medium (Life Technologies) containing
10% fetal bovine serum (Hyclone, Logan, UT, USA),
2m
ML
-glutamine and antibiotics, and incubated at 37°Cina
humidified atmosphere containing 5% CO
2
.

Real-time MRD assay using
TAL-1
deletion
X Chen
et al
167
Quantification of leukemic cells by RQ-PCR
DNA samples were prepared by using the QIAamp blood kit
(Qiagen, Valencia, CA, USA). To construct standard curves for
quantification of leukemic cells with the TAL-1 deletion, DNA
from the CEM-C7 cell line was diluted into DNA prepared
from normal peripheral blood mononuclear cells (PBMC).
Each DNA sample was analyzed in triplicate using an ABI
Prism 7700 sequence detection system. PCR reactions con-
tained 600 ng of DNA, 1 ×TaqMan Universal Master Mix
(Perkin Elmer, Foster City, CA, USA), 0.1
␮
M
of TAL-1 TaqMan
probe, and 0.25
␮
M
TAL-1 TaqMan amplification primers
(Table 1) in a total volume of 50
␮
l. The amplification con-
ditions consisted of an initial incubation at 95°C for 10 min,
then 50 cycles consisting of 15 s at 95°C and 60 s at 60°C.
To control for the number of amplifiable genomes in the
assay, we tested each sample in a parallel TaqMan assay to
quantify the number of N-ras copies. PCR reactions contained
200 ng of DNA, 1 ×TaqMan Universal Master Mix (Perkin
Elmer, Foster City, CA, USA), 0.1
␮
M
of N-ras TaqMan probe,
and 0.25
␮
M
N-ras TaqMan amplification primers (Table 1) in
a total volume of 50
␮
l. The amplification conditions con-
sisted of an initial incubation at 95°C for 10 min, then 50
cycles consisting of 15 s at 95°C and 60 s at 60°C. An N-ras
standard curve was constructed by making serial dilutions of
normal PBMC DNA in water. The number of amplifiable gen-
omes in each sample varied by less than two-fold (data not
shown). Consequently, we did not adjust our TAL-1 TaqMan
data.
Quantification of leukemic cells with TAL-1 deletion
by limiting dilution analysis
A two-round PCR assay was used to detect a single copy of
the TAL-1 deletion among 10
5
normal genomes. In the first
round, 600 ng of genomic DNA was amplified for 25 cycles
by using the SIL-db-5⬘primer and the TAL-db1–3⬘primer
(Table 1) in a 50
␮
l reaction. In the second round, the first
round amplification mixture was diluted 1:100, and 1
␮
l was
amplified for 45 cycles by using the same amplification pri-
mers in a 25
␮
l reaction. Amplification mixtures contained 1
Table 1 Sequences of RQ-PCR TaqMan probes and amplification primers
Application Oligonucleotide Oligonucleotide sequence
name
TAL-1
RQ-PCR
TAL-1
probe ctctttcacataccttagctcagatgatacccaa
a
SIL
-bp-5⬘gagctagtgggagaaattaagcagtc
b
TAL
-bp1-3⬘ccgcccacagttctcatga
c
N-ras
RQ-PCR
N-ras
probe tctcatggcactgtactcttcttggtccagct
d
N-ras
-5⬘aacctgtttgttggacatactggata
e
N-ras
-3⬘cgcctgtcctcatgtattggt
e
TAL-1
limiting
SIL
-db-5⬘aaggggagctagtgggagaaa
f
dilution analysis
TAL
-dbl-3⬘agagcctgtcgccaagaa
f
a
The
TAL-1
TaqMan probe spans part of exon 1b and the following intron within the
SIL
locus (accession Y07540). The 5⬘nucleotide is
located 107 bp upstream of the
SIL
-db1 breakpoint. The oligonucleotide was modified with 6-FAM reporter dye at 5⬘-end and TAMRA
quencher dye at 3⬘end.
b
The
SIL
-bp-5⬘primer is located within exon 1b of the
SIL
locus; the 5⬘nucleotide is 177 bp upstream of the
SIL
-db1 breakpoint.
c
The
TAL
-bp1–3⬘primer is located within exon 1b of the
TAL-1
locus (accession S53698); the 5⬘nucleotide is 77 bp downstream of the
TAL
-db1 breakpoint.
d
The
N-ras
TaqMan is located within exon 2 of the N-ras gene (accession L00041). The oligonucleotide was modified with VIC reporter
dye at 5⬘-end and TAMRA quencher dye at 3⬘-end.
e
The
N-ras
primers amplify an 80 bp product within exon 2 of the human N-ras gene.
f
Sequences of these oligonucleotides are from Pongers-Willemse
et al.
19
Leukemia
×PCR buffer (PE Applied Biosystems), 1.5 mmMgCl
2
, 200
␮
M
dNTPs, 0.25
␮
mprimers, and 1 unit of AmpliTaq Gold (PE
Applied Biosystems). The amplification conditions consisted
of an initial incubation at 95°C for 10 min, then cycling
between 94°C for 20 s and 60°C for 40 s, followed by a final
incubation at 72°C for 5 min. PCR products were analyzed
by electrophoresis on a 3% agarose gel. MRD was quantified
by limiting dilution analysis using 10 replicates and Poisson
statistics.
20
The sensitivity of detection was 2 ×10
−6
for every
sample tested.
Results
The TAL-1 deletion, present in approximately 25% of T-lin-
eage cases of ALL, arises via site-specific recombination
between the SIL and TAL-1 loci on chromosome 1p32. There
are three breakpoints tightly clustered within the SIL locus and
six breakpoints distributed within the TAL-1 locus.
21,22
The
two most frequently observed TAL-1 deletions involve the
SIL
db1
breakpoint rearranged to either the TAL
db1
or the TAL
db2
breakpoints (Figure 1a). In approximately 85% of cases, the
SIL
db1
breakpoint is rearranged with the TAL
db1
break-
point.
17,18
Using sequence data from the SIL locus (accession
Y07540) and the TAL-1 locus (accession S53698), we con-
structed amplification primers and a TaqMan probe for detec-
tion of the SIL
db1
-TAL
db1
deletion (Table 1, Figure 1b). We syn-
thesized the TaqMan probe complementary to sequences
within the SIL locus so that a single probe could potentially
be used with deletions arising from both major breakpoints
within the TAL-1 locus. Further, the 5⬘-end of the probe was
oriented toward the TAL-1 locus to minimize non-specific
hydrolysis of the probe that might contribute to background
fluorescence.
We tested the sensitivity of the TAL-1 RQ-PCR assay using
the CEM-C7 cell line which contains the TAL-1 deletion. DNA
from the CEM-C7 cells was diluted in normal PBMC DNA
and analyzed by RQ-PCR. An excellent correlation was found
between the input of leukemic cells and the fluorescence
threshold (Ct) value (Figure 2). In every experiment, with input
DNA spanning five orders of magnitude, the correlation coef-
ficient always exceeded 0.99. At a dilution of 10
−5
, there is

Real-time MRD assay using
TAL-1
deletion
X Chen
et al
168
Leukemia
Figure 1 Schematic design of the TAL-1 RQ-PCR assay. (a) The SIL and TAL-1 loci are separated by approximately 90 kb on chromosome
1. Breakpoints identified
21,22
within the SIL and TAL-1 loci are shown by vertical arrows; the large vertical arrows indicate the most frequently
used breakpoints. The relative positions of the TAL-1 TaqMan probe (horizontal bar) and primers (horizontal arrows) are indicated. (b) The
SIL
db1
-TAL
db1
deletion occurs in approximately 85% of cases with TAL-1 deletion. After deletion of intervening sequences, and insertion of N-
region nucleotides (N), the SIL and TAL-1 loci are juxtaposed. Amplification using the SIL-bp-5⬘and TAL-bp1–3⬘primers generates a PCR
product of approximately 220 bp in size. The TAL-1 TaqMan probe, containing reporter (R) and quencher (Q) dyes, (left panel) was synthesized
complementary to the SIL locus (see Table 1 for details). During amplification (right panel) the TaqMan probe is hydrolyzed, resulting in
increased fluorescence.
Figure 2 Real-time detection of leukemic cells with TAL-1
deletion. Standard curve showing the threshold cycle (Ct) vs the input
of CEM-C7 cells. Each point represents the mean of triplicate PCR
reactions. Three out of four replicates using input DNA equivalent to
a single CEM-C7 cell gave positive results.
an average of one genome per reaction. By using multiple
replicates of the 10
−5
dilution, we found the RQ-PCR assay
could detect a single leukemic genome.
We then used the TAL-1 RQ-PCR assay to investigate MRD
in 23 bone marrow and peripheral blood samples from eight
patients during clinical remission. To determine the accuracy
of the TAL-1 RQ-PCR assay, we also investigated the same
samples by using a limiting dilution assay for the TAL-1
deletion. Of the 23 samples, 17 samples had greater than
0.001% leukemic cells by both methods (Figure 3). A good
correlation (r
2
=0.926) was found between the percentage of
leukemic cells determined by both methods. In the remaining
six samples, both methods detected fewer than 0.001% leu-
kemic cells. Two samples had undetectable leukemic cells by
both methods. In four samples, extremely low levels of MRD
(0.0002–0.0009% leukemic cells) were detected by the limit-
ing dilution method but not by the RQ-PCR assay. This appar-
ent difference in sensitivity could arise from the greater mass
of DNA being interrogated by the limiting dilution assay.
Discussion
We have developed a real-time PCR assay for detection and
quantification of leukemic cells that contain the TAL-1
deletion. This assay, applicable to a significant number of ALL
patients is rapid, sensitive, accurate, and less labor-intensive
than current methods for MRD assessment. This assay will
improve and simplify the assessment of MRD in patients with
T-lineage ALL.
Recent studies have shown the predictive value of MRD
assessment to identify ALL patients with increased risk of
relapse. However, current PCR methods are not optimal for
clinical evaluation of MRD. The most frequently used
methods for MRD assessment are comparative hybridization
and limiting dilution analysis.
6
Comparative hybridization is
time-consuming, taking 2–3 days to complete. Further, data
from these analyses are semi-quantitative. MRD levels are esti-
mated by comparison with standards, and it is difficult to

Real-time MRD assay using
TAL-1
deletion
X Chen
et al
169
Figure 3 Comparison of MRD data obtained by TAL-1 RQ-PCR
and limiting dilution analysis in clinical remission T-ALL samples. Six
samples had ⬍10
−5
leukemic cells by both methods.
establish an endpoint of amplification in which each standard
is still within the logarithmic phase. Limiting dilution analysis
provides quantitative MRD estimates in the absence of stan-
dards. However, the overall process is laborious due to the
multiple replicates analyzed, and the two rounds of PCR
amplification performed. Both methods require post-PCR
handling and analysis.
Competitive PCR is another method used to quantify mol-
ecular targets. Hosler and colleagues
23
recently reported the
use of that approach to quantify leukemic cells with the TAL-
1deletion. The authors synthesized an internal calibration
standard, a known quantity of which was added to PCR reac-
tions. After amplification, the number of leukemic cells was
calculated by comparing the intensity of the PCR products of
the endogenous TAL-1 deletion and the calibrator. This assay
was found to be precise and accurate, but analysis of multiple
dilutions of the unknown samples was often needed to
achieve the highest accuracy.
23
RQ-PCR using TaqMan technology affords significant
advantages over current PCR methods. First, the TaqMan
probe provides the sensitivity and specificity required for
MRD assessment. The probe hybridizes to a known sequence
between the amplification primers. It is cleaved, releasing
fluorescence into the reaction, only when the primers direct
amplification to that target sequence. Second, measurement
of fluorescence in real time during the PCR reaction permits
extrapolation of data back to the exponential phase of the
amplification, thus avoiding problems associated with other
comparative hybridization methods. Third, post-PCR pro-
cessing of samples is eliminated, thereby reducing the overall
time and labor of the assay.
We demonstrated that the TAL-1 RQ-PCR assay has a sensi-
tivity of detection of one leukemic cell among 10
5
normal
cells. This sensitivity is sufficient for discriminating ALL
patients with high and low risk of hematologic relapse.
7
Because data are obtained within hours of sample collection,
RQ-PCR analysis permits timely clinical intervention for
patients with increased risk of relapse. In addition, excellent
Leukemia
concordance was found between MRD estimates determined
by RQ-PCR and by limiting dilution analysis. The agreement
between methods provides confidence in the accuracy of the
TAL-1 RQ-PCR assay.
Other recent reports have confirmed the potential of RQ-
PCR to improve quantification of leukemic cells in ALL.
24–27
Those reports, however, used antigen-receptor gene
rearrangements for quantification of leukemic cells, a strategy
that requires leukemic-specific assays for each patient. An
additional way to simplify MRD assessment is to develop
assays that are applicable to a group of patients. This strategy
has been used to quantify MRD in patients with chronic mye-
logenous leukemia,
28,29
acute myelogenous leukemia
30–32
acute promyelocytic leukemia
33
and lymphoma.
34,35
In ALL,
the TAL-1 deletion is present in approximately 5% of total
patients and therefore our RQ-PCR assay will simplify the
assessment of MRD in those cases.
We have developed an RQ-PCR assay for quantification of
leukemic cells harboring the TAL-1 deletion. This standard
assay, applicable to a significant number of patients with ALL,
provides sensitive, accurate and timely assessment of MRD.
Application of this assay in clinical studies will improve
assessment of MRD in ALL, and should identify patients with
increased risk of relapse.
Acknowledgements
This work was supported in part by the following NIH grants:
R01 CA52259, R01 CA43237 and P30 CA21765; by a Center
of Excellence grant from the State of Tennessee, and by the
American Lebanese Syrian Associated Charities (ALSAC). We
thank Ms Sharon Naron for editorial assistance with the
manuscript.
References
1 Pui CH, Evans WE. Acute lymphoblastic leukemia. N Engl J Med
1998; 339: 605–615.
2 Pui CH. Acute lymphoblastic leukemia in children. Curr Opin
Oncol 2000; 12: 3–12.
3 Coustan-Smith E, Behm FG, Sanchez J, Boyett JM, Hancock ML,
Raimondi SC, Rubnitz JE, Rivera GK, Sandlund JT, Pui CH, Cam-
pana D. Immunological detection of minimal residual disease in
children with acute lymphoblastic leukaemia. Lancet 1998; 351:
550–554.
4 Cave H, van der Werff ten Bosch J, Suciu S, Guidal C, Waterkeyn
C, Otten J, Bakkus M, Thielemans K, Grandchamp B, Vilmer E.
Clinical significance of minimal residual disease in childhood
acute lymphoblastic leukemia. European Organization for
Research and Treatment of Cancer – Childhood Leukemia Cooper-
ative Group. N Engl J Med 1998; 339: 591–598.
5 van Dongen JJ, Seriu T, Panzer-Grumayer ER, Biondi A, Pongers-
Willemse MJ, Corral L, Stolz F, Schrappe M, Masera G, Kamps
WA, Gadner H, van Wering ER, Ludwig WD, Basso G, de Bruijn
MA, Cazzaniga G, Hettinger K, van der Does-van den Berg A, Hop
WC, Riehm H, Bartram CR. Prognostic value of minimal residual
disease in acute lymphoblastic leukaemia in childhood. Lancet
1998; 352: 1731–1738.
6 Foroni L, Harrison CJ, Hoffbrand AV, Potter MN. Investigation of
minimal residual disease in childhood and adult acute lympho-
blastic leukaemia by molecular analysis. Br J Haematol 1999; 105:
7–24.
7 Pui CH, Campana D. New definition of remission in childhood
acute lymphoblastic leukemia. Leukemia 2000; 14: 783–785.
8 Campana D, Pui CH. Detection of minimal residual disease in
acute leukemia: methodologic advances and clinical significance.
Blood 1995; 85: 1416–1434.

Real-time MRD assay using
TAL-1
deletion
X Chen
et al
170
Leukemia
9 Brisco MJ, Condon J, Sykes PJ, Neoh SH, Morley AA. Detection
and quantitation of neoplastic cells in acute lymphoblastic leu-
kaemia, by use of the polymerase chain reaction. Br J Haematol
1991; 79: 211–217.
10 Sykes PJ, Neoh SH, Brisco MJ, Hughes E, Condon J, Morley AA.
Quantitation of targets for PCR by use of limiting dilution. Biotech-
niques 1992; 13: 444–449.
11 Ouspenskaia MV, Johnston DA, Roberts WM, Estrov Z, Zipf TF.
Accurate quantitation of residual B-precursor acute lymphoblastic
leukemia by limiting dilution and a PCR-based detection system:
a description of the method and the principles involved. Leukemia
1995; 9: 321–328.
12 Yokota S, Hansen-Hagge TE, Ludwig WD, Reiter A, Raghavachar
A, Kleihauer E, Bartram CR. Use of polymerase chain reactions to
monitor minimal residual disease in acute lymphoblastic leukemia
patients. Blood 1991; 77: 331–339.
13 Biondi A, Yokota S, Hansen-Hagge TE, Rossi V, Giudici G, Maglia
O, Basso G, Tell C, Masera G, Bartram CR. Minimal residual dis-
ease in childhood acute lymphoblastic leukemia: analysis of
patients in continuous complete remission or with consecutive
relapse. Leukemia 1992; 6: 282–288.
14 Nizet Y, Van Daele S, Lewalle P, Vaerman JL, Philippe M, Ver-
mylen C, Cornu G, Ferrant A, Michaux JL, Martiat P. Long-term
follow-up of residual disease in acute lymphoblastic leukemia
patients in complete remission using clonogeneic IgH probes and
the polymerase chain reaction. Blood 1993; 82: 1618–1625.
15 Brown L, Cheng JT, Chen Q, Siciliano MJ, Crist W, Buchanan G,
Baer R. Site-specific recombination of the tal-1 gene is a common
occurrence in human T cell leukemia. EMBO J 1990; 9: 3343–
3351.
16 Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative
PCR. Genome Res 1996; 6: 986–994.
17 Bash RO, Crist WM, Shuster JJ, Link MP, Amylon M, Pullen J,
Carroll AJ, Buchanan GR, Smith RG, Baer R. Clinical features and
outcome of T-cell acute lymphoblastic leukemia in childhood
with respect to alterations at the TAL1 locus: a Pediatric Oncology
Group study. Blood 1993; 81: 2110–2117.
18 Breit TM, Beishuizen A, Ludwig WD, Mol EJ, Adriaansen HJ, van
Wering ER, van Dongen JJ. tal-1 deletions in T-cell acute lym-
phoblastic leukemia as PCR target for detection of minimal
residual disease. Leukemia 1993; 7: 2004–2011.
19 Pongers-Willemse MJ, Seriu T, Stolz F, d’Aniello E, Gameiro P,
Pisa P, Gonzalez M, Bartram CR, Panzer-Grumayer ER, Biondi A,
San Miguel JF, van Dongen JJ. Primers and protocols for stan-
dardized detection of minimal residual disease in acute lympho-
blastic leukemia using immunoglobulin and T cell receptor gene
rearrangements and TAL1 deletions as PCR targets: report of the
BIOMED-1 CONCERTED ACTION: investigation of minimal
residual disease in acute leukemia. Leukemia 1999; 13: 110–118.
20 Taswell C. Limiting dilution assays for the determination of immu-
nocompetent cell frequencies. I. Data analysis. J Immunol 1981;
126: 1614–1619.
21 Aplan PD, Lombardi DP, Reaman GH, Sather HN, Hammond GD,
Kirsch IR. Involvement of the putative hematopoietic transcription
factor SCL in T-cell acute lymphoblastic leukemia. Blood 1992;
79: 1327–1333.
22 Delabesse E, Bernard M, Landman-Parker J, Davi F, Leboeuf D,
Varet B, Valensi F, Macintyre EA. Simultaneous SIL-TAL1 RT-PCR
detection of all tal(d) deletions and identification of novel tal(d)
variants. Br J Haematol 1997; 99: 901–907.
23 Hosler GA, Bash RO, Bai X, Jain V, Scheuermann RH. Develop-
ment and validation of a quantitative polymerase chain reaction
assay to evaluate minimal residual disease for T-cell acute lym-
phoblastic leukemia and follicular lymphoma. Am J Pathol 1999;
154: 1023–1035.
24 Pongers-Willemse MJ, Verhagen OJ, Tibbe GJ, Wijkhuijs AJ, de
Haas V, Roovers E, van der Schoot CE, van Dongen JJ. Real-time
quantitative PCR for the detection of minimal residual disease in
acute lymphoblastic leukemia using junctional region specific
TaqMan probes. Leukemia 1998; 12: 2006–2014.
25 Eckert C, Landt O, Taube T, Seeger K, Beyermann B, Proba J,
Henze G. Potential of LightCycler technology for quantification of
minimal residual disease in childhood acute lymphoblastic leuke-
mia. Leukemia 2000; 14: 316–323.
26 Donovan JW, Ladetto M, Zou G, Neuberg D, Poor C, Bowers D,
Gribben JG. Immunoglobulin heavy-chain consensus probes for
real-time PCR quantification of residual disease in acute lym-
phoblastic leukemia. Blood 2000; 95: 2651–2658.
27 Kwan E, Norris MD, Zhu L, Ferrara D, Marshall GM, Haber M.
Simultaneous detection and quantification of minimal residual dis-
ease in childhood acute lymphoblastic leukaemia using real-time
polymerase chain reaction. Br J Haematol 2000; 109: 430–434.
28 Mensink E, van de Locht A, Schattenberg A, Linders E, Schaap N,
Geurts van Kessel A, De Witte T. Quantitation of minimal residual
disease in Philadelphia chromosome positive chronic myeloid leu-
kaemia patients using real-time quantitative RT-PCR. Br J Haema-
tol 1998; 102: 768–774.
29 Eder M, Battmer K, Kafert S, Stucki A, Ganser A, Hertenstein B.
Monitoring of BCR-ABL expression using real-time RT-PCR in
CML after bone marrow or peripheral blood stem cell transplan-
tation. Leukemia 1999; 13: 1383–1389.
30 Marcucci G, Livak KJ, Bi W, Strout MP, Bloomfield CD, Caligiuri
MA. Detection of minimal residual disease in patients with
AML1/ETO-associated acute myeloid leukemia using a novel
quantitative reverse transcription polymerase chain reaction assay.
Leukemia 1998; 12: 1482–1489.
31 Sugimoto T, Das H, Imoto S, Murayama T, Gomyo H, Chakraborty
S, Taniguchi R, Isobe T, Nakagawa T, Nishimura R, Koizumi T.
Quantitation of minimal residual disease in t(8;21)-positive acute
myelogenous leukemia patients using real-time quantitative RT-
PCR. Am J Hematol 2000; 64: 101–106.
32 Fujimaki S, Funato T, Harigae H, Imaizumi M, Suzuki H, Kaneko
Y, Miura Y, Sasaki T. A quantitative reverse transcriptase poly-
merase chain reaction method for the detection of leukaemic cells
with t(8;21) in peripheral blood. Eur J Haematol 2000; 64: 252–
258.
33 Cassinat B, Zassadowski F, Balitrand N, Barbey C, Rain JD, Fenaux
P, Degos L, Vidaud M, Chomienne C. Quantitation of minimal
residual disease in acute promyelocytic leukemia patients with
t(15;17) translocation using real-time RT-PCR. Leukemia 2000; 14:
324–328.
34 Luthra R, McBride JA, Cabanillas F, Sarris A. Novel 5⬘exonucle-
ase-based real-time PCR assay for the detection of
t(14;18)(q32;q21) in patients with follicular lymphoma. Am J
Pathol 1998; 153: 63–68.
35 Olsson K, Gerard CJ, Zehnder J, Jones C, Ramanathan R, Reading
C, Hanania EG. Real-time t(11;14) and t(14;18) PCR assays pro-
vide sensitive and quantitative assessments of minimal residual
disease (MRD). Leukemia 1999; 13: 1833–1842.