Osnat Penn

University of Washington Seattle | UW · Department of Genome Sciences

Neurons are frequently classified into distinct types on the basis of structural, physiological, or genetic attributes. To better constrain the definition of neuronal cell types, we characterized the transcriptomes and intrinsic physiological properties of over 4,200 mouse visual cortical GABAergic interneurons and reconstructed the local morpholog...

Background: Neurodevelopmental disorders (NDDs) such as autism spectrum disorder, intellectual disability, developmental disability, and epilepsy are characterized by abnormal brain development that may affect cognition, learning, behavior, and motor skills. High co-occurrence (comorbidity) of NDDs indicates a shared, underlying biological mechani...

Despite the importance of duplicate genes for evolutionary adaptation, accurate gene annotation is often incomplete, incorrect, or lacking in regions of segmental duplication. We developed an approach combining long-read sequencing and hybridization capture to yield full-length transcript information and confidently distinguish between nearly ident...

[This corrects the article DOI: 10.3389/fmolb.2018.00009.].

The 25 human bitter taste receptors (hT2Rs) recognize thousands of structurally and chemically diverse bitter substances. The binding modes of human bitter taste receptors hT2R10 and hT2R46, which are responsible for strychnine recognition, were previously established using site-directed mutagenesis, functional assays, and molecular modeling. Here...

Neocortex contains a multitude of cell types segregated into layers and functionally distinct regions. To investigate the diversity of cell types across the mouse neocortex, we analyzed 12,714 cells from the primary visual cortex (VISp), and 9,035 cells from the anterior lateral motor cortex (ALM) by deep single-cell RNA-sequencing (scRNA-seq), ide...

Background Gene innovation by duplication is a fundamental evolutionary process but is difficult to study in humans due to the large size, high sequence identity, and mosaic nature of segmental duplication blocks. The human-specific gene hydrocephalus-inducing 2, HYDIN2, was generated by a 364 kbp duplication of 79 internal exons of the large cilia...

Segmental duplications contribute to human evolution, adaptation and genomic instability but are often poorly characterized. We investigate the evolution, genetic variation and coding potential of human-specific segmental duplications (HSDs). We identify 218 HSDs based on analysis of 322 deeply sequenced archaic and contemporary hominid genomes. We...

Genetic differences that specify unique aspects of human evolution have typically been identified by comparative analyses between the genomes of humans and closely related primates, including more recently the genomes of archaic hominins. Not all regions of the genome, however, are equally amenable to such study. Recurrent copy number variation (CN...

Intellectual disability (ID) and autism spectrum disorders (ASD) are genetically heterogeneous, and a significant number of genes have been associated with both conditions. A few mutations in POGZ have been reported in recent exome studies; however, these studies do not provide detailed clinical information. We collected the clinical and molecular...

Ancestral reconstruction is a powerful tool for studying protein evolution as well as for protein design and engineering. However, in many positions alternative predictions with relatively high marginal probabilities exist, and thus the prediction comprises an ensemble of near-ancestor sequences that relate to the historical ancestor. The ancestral...

Despite considerable genetic heterogeneity underlying neurodevelopmental diseases, there is compelling evidence that many disease genes will map to a much smaller number of biological subnetworks. We developed a computational method, termed MAGI (Merging Affected Genes into Integrated-networks), that simultaneously integrates protein-protein intera...

Autism spectrum disorder (ASD) is a heterogeneous disease in which efforts to define subtypes behav-iorally have met with limited success. Hypothesiz-ing that genetically based subtype identification may prove more productive, we resequenced the ASD-associated gene CHD8 in 3,730 children with developmental delay or ASD. We identified a total of 15...

Polyclonal serum consists of vast collections of antibodies, products of differentiated B-cells. The spectrum of antibody specificities is dynamic and varies with age, physiology, and exposure to pathological insults. The complete repertoire of antibody specificities in blood, the IgOme, is therefore an extraordinarily rich source of information-a...

Construction of fth1-dp phage vector using ‘SOEing’ PCR. The fth1 vector was utilized as template (A) for the generation of two independent PCR products; the first (B, red) contained a BglII site at its 5′ end and the adapter A sequence (A - orange) followed by a barcode and a SfiI site at its 3′ end (primers 2201s: GCTAGCCATCAGATCTGCACTG and 9602a...

GV4H3 validation. The fth1-dp phage (indicated) was spotted directly onto a nitrocellulose membrane filter along with a phage containing a DNA insert corresponding to the GV4H3 epitope (AGFAIL). The membrane was subsequently immunoblotted with GV4H3 and positive clone was sequenced to validate the presence of AGFAIL insert and Illumina adaptors A a...

Progressive enrichment of affinity selected peptides. 90% of the peptides in the naïve library are unique (blue) where the 20 top most frequent peptides (red) constitute 0.15%. Each round of consecutive panning leads to a drop of the total fraction of unique peptides accompanied by enrichment of those most highly affinity-selected. (TIF)

Ancestral sequence reconstruction is essential to a variety of evolutionary studies. Here, we present the FastML web server, a user-friendly tool for the reconstruction of ancestral sequences. FastML implements various novel features that differentiate it from existing tools: (i) FastML uses an indel-coding method, in which each gap, possibly spann...

Exon-intron architecture is one of the major features directing the splicing machinery to the short exons that are located within long flanking introns. However, the evolutionary dynamics of exon-intron architecture and its impact on splicing is largely unknown. Using a comparative genomic approach, we analyzed 17 vertebrate genomes and reconstruct...

Drug resistance-associated mutations (DRMs) among HIV-1 treatment-naïve patients have increased in recent years. Their incidence and prevalence in various exposure risk categories (ERCs) were evaluated. Plasma samples of HIV-1 treatment-naïve patients diagnosed between 2001 and 2009 at the Tel Aviv Medical Center were screened for DRMs. Samples obt...

Errors in the inferred multiple sequence alignment may lead to false prediction of positive selection. Recently, methods for detecting unreliable alignment regions were developed and were shown to accurately identify incorrectly aligned regions. While removing unreliable alignment regions is expected to increase the accuracy of positive selection i...

Evaluating the accuracy of multiple sequence alignment (MSA) is critical for virtually every comparative sequence analysis that uses an MSA as input. Here we present the GUIDANCE web-server, a user-friendly, open access tool for the identification of unreliable alignment regions. The web-server accepts as input a set of unaligned sequences. The ser...

Multiple sequence alignment (MSA) is the basis for a wide range of comparative sequence analyses from molecular phylogenetics to 3D structure prediction. Sophisticated algorithms have been developed for sequence alignment, but in practice, many errors can be expected and extensive portions of the MSA are unreliable. Hence, it is imperative to under...

Thymidylate synthases (Thy) are key enzymes in the synthesis of deoxythymidylate, 1 of the 4 building blocks of DNA. As such, they are essential for all DNA-based forms of life and therefore implicated in the hypothesized transition from RNA genomes to DNA genomes. Two evolutionally unrelated Thy enzymes, ThyA and ThyX, are known to catalyze the sa...

Rodentia is the most diverse order of placental mammals, with extant rodent species representing about half of all placental diversity. In spite of many morphological and molecular studies, the family-level relationships among rodents and the location of the rodent root are still debated. Although various datasets have already been analyzed to solv...

Accession number table. List of all specimens and accession numbers for each gene sequenced.

DNA sequence alignment. Concatenated DNA sequence alignment (in Nexus format) used to reconstruct the phylogenetic tree present in figure 1.

Protein sequence alignment. Concatenated protein sequence alignment (in Nexus format) used in the phylogenetic analyses.

Variation of the CI value as a function of the site specific evolutionary rate. Scatterplot visualizing the variation of the CI value as a function of the site specific evolutionary rate.

Tissue samples table. Origin of the tissue samples considered and genes amplified.

Phylogeny reconstructed under the CAT model. Figure of the phylogenetic trees obtained under the Bayesian CAT model.

A hallmark of the human immunodeficiency virus 1 (HIV-1) is its rapid rate of evolution within and among its various subtypes. Two complementary hypotheses are suggested to explain the sequence variability among HIV-1 subtypes. The first suggests that the functional constraints at each site remain the same across all subtypes, and the differences a...

A list of all inferred rate-shifting sites, with information regarding secondary structure and exposed/buried classification. (0.04 MB XLS)

A list of all rate-shifting sites according to subtype, sorted according to acceleration/deceleration. (0.06 MB XLS)

Unlabelled: Identifying the epitope to which an antibody binds is central for many immunological applications such as drug design and vaccine development. The Pepitope server is a web-based tool that aims at predicting discontinuous epitopes based on a set of peptides that were affinity-selected against a monoclonal antibody of interest. The serve...

Mapping the epitope of an antibody is of great interest, since it contributes much to our understanding of the mechanisms of molecular recognition and provides the basis for rational vaccine design. Here we present Mapitope, a computer algorithm for epitope mapping. The algorithm input is a set of affinity isolated peptides obtained by screening ph...