Content uploaded by Nilima Prakash
Author content
All content in this area was uploaded by Nilima Prakash on Oct 12, 2018
Content may be subject to copyright.
A WNT1-regulated developmental gene cascade prevents dopaminergic
neurodegeneration in adult En1
+/−
mice
Jingzhong Zhang
a,1
, Sebastian Götz
a
, Daniela M. Vogt Weisenhorn
a,b,c
, Antonio Simeone
d,e
,
Wolfgang Wurst
a,b,c,f,
⁎, Nilima Prakash
a,b,
⁎
,2
a
Instituteof Developmental Genetics, Helmholtz Zentrum München, Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH), Ingolstädter Landstr. 1, D-85764 Neuherberg, Germany
b
Technische Universität München-Weihenstephan, Lehrstuhl für Entwicklungsgenetik c/o Helmholtz Zentrum München, Ingolstädter Landstr. 1, D-85764 Neuherberg, Germany
c
Deutsches Zentrum für Neurodegenerative Erkrankungen (DZNE) Standort München, Schillerstr. 44, D-80336 München, Germany
d
Institute of Genetics and Biophysics “A. Buzzati-Traverso”, I-80131 Naples, Italy
e
IRCCS Neuromed, I-86077 Pozzilli, IS, Italy
f
Munich Cluster for Systems Neurology (SyNergy), Adolf-Butenandt-Institut, Ludwig-Maximilians-Universität München, Schillerstrasse 44, D-80336 München, Germany
abstractarticle info
Article history:
Received 8 April 2015
Revised 18 May 2015
Accepted 27 May 2015
Available online 3 June 2015
Keywords:
Dopamine neuron
Parkinson's Disease
Neuroprotection
Survival
Lef1
Lmx1a
Fgf20
Dkk3
Pitx3
Bdnf
The protracted and age-dependent degeneration of dopamine (DA)-producing neurons of the Substantia nigra
pars compacta (SNc) and ventral tegmental area (VTA) in the mammalian midbrain is a hallmark of human
Parkinson's Disease (PD) and of certain genetic mouse models of PD, such as mice heterozygous for the
homeodomain transcription factor Engrailed 1 (En1
+/−
mice). Neurotoxin-based animal models of PD, in con-
trast, are characterized by the fastand partly reversibledegeneration of the SNcand VTA DA neurons. The secret-
ed protein WNT1was previously shown to be strongly induced in the neurotoxin-injured adult ventral midbrain
(VM), and to protect the SNc and VTA DA neurons from cell death in this context. We demonstrate here that the
sustained and ectopicexpression of Wnt1 in the SNc and VTA DA neurons of En1
+/Wnt1
mice also protected these
genetically affected En1 heterozygote (En1
+/−
) neurons from their premature degeneration in the adult mouse
VM. We identified a developmental gene cascade that is up-regulated in the adult En1
+/Wnt1
VM, including the
direct WNT1/β-catenin signalingtargets Lef1,Lmx1a,Fgf20 and Dkk3, as well asthe indirect targets Pitx3 (activat-
ed by LMX1A) and Bdnf (activated by PITX3). We also showthat the secreted neurotrophin BDNF and the secret-
ed WNT modulator DKK3, but not the secreted growth factor FGF20, increased the survival of En1 mutant
dopaminergic neurons in vitro. The WNT1-mediated signaling pathway and its downstream targets BDNF and
DKK3 might thus provide a useful means to treat certain genetic and environmental (neurotoxic) forms of
human PD.
© 2015 Elsevier Inc. All rights reserved.
Neurobiology of Disease 82 (2015) 32–45
Abbreviations: BDNF, brain-derived neurotrophic factor; BSA, bovine serum albumin; BS(s), binding site(s); cCASP3, cleaved (activated) caspase 3; ChIP, chromatinimmunoprecipi-
tation; DA, dopamine, dopaminergic; DKK3, Dickkopf homolog 3; DIV, day(s) in vitro; EN1, Engrailed 1; FGF20, fibroblast growth factor 20; FZD1, Frizzled 1; GSK3β, glycogen synthase
kinase 3 beta; HD, homeodomain; IHC/ICC, immunohistochemistry/immunocytochemistry; ISH, in situ hybridization; LEF1,lymphoid enhancer binding factor 1; LMX1A, LIM homeobox
transcription factor 1 alpha; mAbs, monoclonal antibodies; mdDA, mesodiencephalic dopaminergic;MPTP, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine;NSC, neural stem cell;OPC, ol-
igodendrocyte progenitor cell; PCR, polymerase chain reaction; PD, Parkinson's Disease; PITX3, Paired-like homeodomain transcription factor 3; qPCR, quantitative RT-PCR; RT, reverse
transcription; Semi-qPCR, semiquantitative RT-PCR; SNc,substantia nigra pars compacta; SNr, substantia nigra pars reticularis; TCF, T-cell factor; TF, transcription factor; TH, tyrosine hy-
droxylase; VM, ventral midbrain; VTA, ventral tegmental area; WNT1, Wingless-related MMTV integration site 1; 6-OHDA, 6-hydroxydopamine.
⁎Corresponding authors at: Institute of Developmental Genetics, Helmholtz Zentrum München, Deutsches Forschungszentrum für Gesundheit und Umwelt GmbH, and Technische
Universität München-Weihenstephan, Lehrstuhl für Entwicklungsgenetik, IngolstädterLandstr. 1, 85764 Neuherberg, Germany. Fax: +49 89 3187 3099.
E-mail addresses: Jingzhong.Zhang@mdc-berlin.de (J. Zhang), sebastian.goetz@helmholtz-muenchen.de (S. Götz), daniela.vogt@helmholtz-muenchen.de (D.M. Vogt Weisenhorn),
antonio.simeone@igb.cnr.it (A. Simeone), wurst@helmholtz-muenchen.de (W. Wurst), nilima.prakash@hshl.de (N. Prakash).
1
Present address: Max Delbrück Zentrum für Molekulare Medizin, Robert-Rössle-Str.10, D-13125, Berlin, Germany.
2
Present address: Hochschule Hamm-Lippstadt, University of Applied Sciences, Marker Allee 76-78, D-59063, Hamm, Germany.
Available online on ScienceDirect (www.sciencedirect.com).
http://dx.doi.org/10.1016/j.nbd.2015.05.015
0969-9961/© 2015 Elsevier Inc. All rights reserved.
Contents lists available at ScienceDirect
Neurobiology of Disease
journal homepage: www.elsevier.com/locate/ynbdi
Introduction
Human PD and certain genetic animal models, such as mice hetero-
zygous for the homeodomain (HD) transcription factor (TF) Engrailed 1
(En1
+/−
mice), are characterized by the age-dependent and slowly
progressing degeneration of the mesodiencephalic dopamine-
synthesizing (mdDA) neuronal population (Nordstrom et al., 2015;
Sgado et al., 2006; Sonnier et al., 2007; reviewed by Le Pen et al.
(2008);Sulzer and Surmeier (2013)). The systemic or local administra-
tion of certain neurotoxins, such as 6-hydroxydopamine (6-OHDA) or
1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), also causes
a degeneration of mdDA neurons in rodents and primates
including humans (reviewed by Blesa et al. (2012);Bove and Perier
(2012)). However, it remains unclear whether the pathological
mechanism(s) leading to mdDA neurodegeneration in the genetic and
neurotoxin-based animal models of PD is comparable if not identical
(Beal, 2010; Bezard et al., 2013; Meredith and Rademacher, 2011).
Aging is the largest risk factor in PD (Rodriguez et al., 2014),
suggesting that the loss of mdDA neurons in PD and genetic animal
models such as the En1
+/−
mice is initially (at younger ages) alle-
viated by neuroprotective mechanisms. Moreover, mdDA neuron
numbers and striatal innervation as well as DA release show a re-
markable ability to recover after acute or chronic administration of
MPTP or 6-OHDA in young but not aged animals (Blandini and
Armentero, 2012; Bove and Perier, 2012). The secreted glycopro-
tein Wingless-related MMTV integration site 1 (Wnt1)isstrongly
induced in chemokine-activated (reactive) astrocytes of the in-
jured murine VM after acute administration of MPTP, an ability
that declines with the age of the mouse (L'Episcopo et al.,
2011b). Binding of WNT1 to Frizzled 1 (FZD1) WNT-receptors
expressed on the surface of the mdDA neurons activates an intra-
cellular signaling cascade (the “canonical”or WNT/β-catenin sig-
naling pathway) leading to the cytosolic stabilization and nuclear
translocation of β-catenin after inhibition of its constitutive phos-
phorylationbyglycogensynthasekinase3beta(GSK3β)
(L'Episcopo et al., 2011a). In the nucleus, β-catenin binds to TFs
of the Lymphoid enhancer binding factor 1 (LEF1)/T-cell factor
(TCF) family and activates the transcription of WNT target genes
(Hoppler and Kavanagh, 2007; van Amerongen and Nusse, 2009).
Remarkably, inhibition of the WNT1/β-catenin signaling pathway
in the intact adult mouse VM induces a similar mdDA neuron
loss and reactive astrocytosis as observed after acute MPTP admin-
istration (L'Episcopo et al., 2011a). Moreover, activation of WNT/β-
catenin signaling through systemic application of a GSK3βinhibi-
tor in vivo or of WNT1 protein to primary VM cells in vitro pro-
tects the mdDA neurons from all kinds of cytotoxic insults,
including the treatment with 6-OHDA, MPTP or WNT/β-catenin
signaling inhibitors (L'Episcopo et al., 2011a, 2011b). Together,
these data indicate that WNT1 and the WNT1/β-catenin signaling
pathway have an important mdDA neuroprotective function in
the adult and aging brain both under basal (intact) conditions
and after injury. The target genes conveying the neuroprotective
effects of WNT1/β-catenin signaling in these contexts, however,
remain to be identified.
Wnt1 is ectopically expressed under the control of En1 regulatory
sequences in an En1 heterozygote (En1
+/−
)background(En1 knock-
out, Wnt1 knock-in) in the En1
+/Wnt1
mouse (Panhuysen et al.,
2004). Ectopic mdDA neurons are induced in the rostroventral hind-
brain during development of the En1
+/Wnt1
embryos and persist in
this region of the adult En1
+/Wnt1
brain, whereas the SNc and VTA
DA neurons did not appear to be affected in this mouse model
(Prakash et al., 2006). In fact, we show herein that a WNT1-induced
neuroprotective gene cascade promotes the survival of En1 mutant
(En1
+/−
and En1
−/−
) mdDA neurons and rescues them from their
premature cell death in the Wnt1-overexpressing (En1
+/Wnt1
) adult
VM.
Materials and methods
Mice
Heterozygous En1
+/Wnt1
knock-in mice were generated and geno-
typed as described previously (Panhuysen et al., 2004), and kept on a
C57BL/6J genetic background for more than 10 generations. Heterozy-
gous En1
+/LacZ
mice were generated and genotyped as described by
Hanks et al. (1995), and backcrossed to either an inbred (C57BL/6J) or
an outbred (CD-1) genetic background for 4–6ormorethan10genera-
tions, respectively. C57BL/6Jand CD-1 mice were provided by the Trans-
genic Unit, Helmholtz Zentrum München. Adult mice and pregnant
dams were killed by CO
2
asphyxiation. Collection of embryonic stages
was done from timed-pregnant females; noon of the day of vaginal
plug detection was designated as E0.5. This study was carried out in
strict accordance with the recommendations in the EU Directive 2010/
63/EU and the Guide for the Care and Use of Laboratory Animals of
the Federal Republic of Germany (TierSchG). The protocol was ap-
proved by the Institutional Animal Careand Use Committee (Ausschuss
für Tierversuche und Versuchstierhaltung, ATV) of the Helmholtz
Zentrum München. All efforts were made to minimize suffering.
BrdU treatments
Adult (6 months old) wild-type (C57BL/6J) and En1
+/Wnt1
mice
(n = 5/genotype) received a daily intraperitoneal injection of 100 mg
5-bromo-2′-deoxyuridine (BrdU; Sigma/Germany) per kg body weight
on 5 consecutive days. The injected mice were killed and perfused
4 weeks after the last BrdU injection.
Radioactive in situ hybridization (ISH)
Serial paraffin sections (8 μm) were hybridized with radioactive
([α-
35
S]UTP, GE Healthcare/USA) riboprobes as described previously
(Brodski et al., 2003; Fischer et al., 2007). Riboprobes used were
mouse En1 (Davis and Joyner, 1988), Wnt1 (Fischer et al., 2007), Lef1
(bp 553–1553; GenBank Acc. Nr. NM_010703.3), Lmx1a (bp
410–1209; Acc. Nr. NM_033652.5), Fgf20 (bp 315–734; GenBank Acc.
Nr. NM_030610.2), Tcf7l2 (Tcf4) (bp 1355–1878; Acc. Nr. NM_
001142924.1), Nr4a2 (Nurr1)(Brodski et al., 2003), Neurod1 (NeuroD)
(Cau et al., 1997), and Jagged 1 (Jag1)(Mitsiadis et al., 1997). Images
were taken with an Axioplan2 microscope or StemiSV6 stereomicro-
scope using bright- and darkfield optics, AxioCam MRc camera and
Axiovision 4.6 software (Zeiss/Germany), and processed with Adobe
Photoshop CS3 software (Adobe Systems Inc./USA).
Immunohisto-/cytochemistry (IHC/ICC)
Collection of brain tissues and antigen (including BrdU) detection on
free-floating cryosections (40 μm) was described by Zhang et al. (2010),
and ICC on cultured cells was performed as reported previously (Peng
et al., 2007). Polyclonal antisera used were rabbit anti-Tyrosine hydrox-
ylase (TH) (1:2000; Millipore/USA AB152), GFAP (1:1000; DAKO/USA
Z0334), OLIG2 (1:1000; Millipore AB9610), IBA1 (1:1000; WAKO/
Japan 019-19741) and cleaved (activated) Caspase 3 (cCASP3) (1:100;
Cell Signalling Technology 9661), and chicken anti-beta-Galactosidase
(β-GAL) (1:1000; abcam/UK ab9361). Monoclonal antibodies (mAbs)
used were mouse anti-TH (1:2000; Millipore MAB318), NeuN (1:200;
Millipore MAB377), NG2 (1:500; Millipore 05-710), and rat anti-BrdU
(1:400; AbD Serotec/UK OBT0030G). Secondary antibodies were fluo-
rescently labeled (Cy2/3/5 dye; Jackson ImmunoResearch Laborato-
ries/USA). The immunostaining for cCASP3 on tissue sections was
amplified using the Tyramide Signal Amplification kit (PerkinElmer/
USA) according to the manufacturer's instructions. Cells were counter-
stained with 4′,6-diamidino-2-phenylindole (DAPI).Fluorescent images
were taken with an Olympus IX81 confocal laser scanning microscope
33J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
(Olympus/Germany), and processed with Adobe Photoshop CS
software.
Primary VM cell cultures and treatments
Primary VM cell cultures were prepared from E12.5 embryos derived
from En1
+/LacZ
×En1
+/LacZ
intercrosses as described by Pruszak et al.
(2009) with minor modifications. Briefly, VM tissues were trypsinised
for 5 min at 37 °C, and 1.5–2×10
5
cells/well were plated in a 24-well
plate on poly-D-lysine (Sigma)-coatedcoverslips in DMEM/F-12 medium
supplemented with 10% fetal calf serum (FCS), glutamine and penicillin/
streptomycin (Life Technologies). 24 h after plating, cells were incubated
in Neurobasal medium (Invitrogen/Germany) supplemented with
200 μM ascorbic acid (A4401, Sigma), 2% B27 supplement (17504044,
Invitrogen) and 1% penicillin/streptomycin for the remaining culture
time. Concomitant with the change to differentiation medium after
1 day in vitro (DIV), primary VM cells were treated with 1 μg/well bovine
serum albumin (BSA) (control; 1 μg/μl, Sigma), 10 ng/well recombinant
human BDNF protein (450-02, Peprotech; 10 ng/μl in 0.1% BSA),
100 ng/well recombinant human DKK3 protein (1118-DK, R&D Systems;
100 ng/μl in 0.1% BSA) or 10 ng/well recombinant human FGF20 protein
(100-41, Peprotech; 10 ng/μl in 0.1% BSA) for 7 days. Proteins were
added with each medium change every third day. Cells were harvested
for ICC after 7 days (8 DIV) of treatments.
Unbiased stereology and cell countings
For IHC, TH- and BrdU-expressing (TH
+
and BrdU
+
) cells in wt,
En1
+/LacZ
and/or En1
+/Wnt1
brains were evaluated by the optical frac-
tionator method on every eighth serial coronal midbrain section using
Stereo Investigator 5.05.4 software (MBF Bioscience/USA). Apoptotic
mdDA neurons in the En1
+/LacZ
VM were estimated by counting
cCASP3
+
/TH
+
double-positive cells among ≥300 TH
+
neurons/animal
on randomly selected confocal images of the SNc and VTA. For ICC on
primary VM cells, β-GAL
+
,TH
+
, cCASP3
+
and DAPI
+
single-, double-
or triple-labeled cells were counted on one entire coverslip. The
numbers (n) of individual specimens or independent experiments eval-
uated in each case are indicated in the figure legends.
Quantitative (qPCR), semiquantitative (semi-qPCR) and conventional
RT-PCR
Total RNA was isolated from adult mouse VM tissues using the
RNeasy Mini Kit (Qiagen), and 1 μg total RNA was reverse transcribed
using the SuperScript First-Strand Synthesis System (Invitrogen) (semi-
qPCR and RT-PCR) or QuantiTect Reverse Transcription Kit (Qiagen)
(qPCR) according to the manufacturer's instructions. One μl(semi-qPCR
and RT-PCR) or 1.5 μl (qPCR) of a 1:3 diluted cDNA were amplified by
PCR using the intron-spanning primers or TaqMan probes and conditions
listed in Table 1. The qPCR (20 μl reactions in a 96-well plate) was per-
formed using TaqMan Universal PCR Master Mix and the 7500 Fast
Real-Time PCR System (Applied Biosystems) according to the
manufacturer's instructions. For semi-qPCR, 10 μl samples were taken
from the PCR reactions after 28 and 35 cycles, and separated on a 1.5%
agarose gel. Densitometric analysis of the gel pictures was done using
ImageJ software (NIH/USA). For qPCR and semi-qPCR, signals from spe-
cificLef1,Lmx1a,Fgf20,En1,Dkk3,Pitx3 and Bdnf PCR products were nor-
malized against β-Actin (Actb), and relative values were calculated by
setting the normalized value of wt controls as 1. For qPCR, the threshold
cycle(Ct)valuewasrecordedforLef1,Lmx1a,Fgf20,En1 and Actb,andthe
relative Ct value (ΔCt) was calculated for each reaction. Normalized Lef1,
Lmx1a,Fgf20 or En1 mRNA levels in the En1 mutants in relation to the
normalized Lef1,Lmx1a,Fgf20 or En1 mRNA levels in the wt controls
were calculated according to the 2
−ΔΔCt
method (Livak and
Schmittgen, 2001). All assays included negative controls and were done
in triplicates, and samples were from three independent experiments.
Prediction of Lef1/Tcf binding sites (BSs) in the Lmx1a and Fgf20 promoter
regions
A genome-wide scan for conserved orthologous Fgf20 promoters
was done with the Gene2Promoter program in the ElDorado Suite
Table 1
Primer and PCR conditions used for qPCR, ChIP-PCR, semi-qPCR and RT-PCR.
Gene (application) Forward primer (5′→3′)
Reverse primer (5′→3′)
or Taqman probe (assay ID)
Product length (bp) Tm (°C) Cycles
Lef1 (qPCR) (Mm00550265_m1) 84 60 40
Lmx1a (qPCR) (Mm00473947_m1) 70 60 40
Fgf20 (qPCR) (Mm00748347_m1) 143 60 40
En1 (qPCR) (Mm00438709_m1) 90 60 40
Actb (qPCR) (Mm00607939_s1) 115 60 40
Lmx1a (LEF1 ChIP Primer) TCCCCAAGGCGACTCCTTTGC
TGTCCCCAGGTTTCCCATTCC
384
(−462 to −79)
61 35
Fgf20 (LEF1 ChIP P1) TCCTCCCACTCATCTCCG
AGGCCAAAGTCAGTCAGC
226
(−254 to −479)
52 35
Fgf20 (LEF1 ChIP P2) GGGGCAAGGCGTTTCTAC
GGAAAGGGCGTTACCTGA
185
(−569 to −753)
50 35
Fgf20 (LEF1 ChIP P3) TAGGGCACAAAACAAGACGG
AAATAAATTGGCCTGAGGGA
386
(−1129 to −1438)
50 35
Fgf20 (LEF1 ChIP P4) AGTTATCCCGCTATGAGA
AAAGGATGCACCAGGTAG
185
(−1832 to −2069)
47 35
Fgf20 (LEF1 ChIP P5) AGTGCGAAGGCTCACGAAGAC
TCACCTGCTCCTGGAGGTATT
226
(−2221 to −2470)
52 35
Dkk3 (Semi-qPCR) CGTCCTCTGAGGTGAACCTGGC
GTCTCGGGTGCATAGCATCTGC
306 62 35
a
Pitx3 (Semi-qPCR) AGCCCTGCGCTGTCGTTATC
AGCTGCTGGCTGGTGAAGTG
185 60 35
a
Bdnf (semi-qPCR) AGCGTGAATGGGCCCAGGGCA
TGTGACCGTCCCACCGGACA
545 56 35
a
Actb (β-Actin) (semi-qPCR, RT-PCR) AGGGTGTGATGGTGGGAATGG
GATGTCACGCACGATTTCCCTC
515 58 35
a
Wnt1 (RT-PCR) GTGCAAATGGCAATTCCGAAAC
AGAAGTTGGGCGATTTCTCGAAG
620 58 35
a
As indicated in Materials and me thods for semi-quantitative RT-PCR (semi-qPCR).
34 J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
software (Genomatix/Germany). Fgf20 promoter sequences from three
different mammalian species (mouse, rat, human) and the murine
Lmx1a promoter were analyzed with the MatInspector program in the
Genomatix software suite GEMS Launcher to identify Lef1/Tcf BSs. The
promoter regions were defined as ~ 1500 bp (Lmx1a) or ~ 2500 bp
(Fgf20) upstream, including the proximal region, and ~100 bp down-
stream of the TSS.
Chromatin immunoprecipitation (ChIP)-PCR
VM tissues were dissected from adult (2 months old)CD-1 mice, and
ChIP was done using the EZ-ChIPkit (#17-371, Millipore) according to
the manufacturer's instructions. Briefly, sheared genomic DNA frag-
ments after sonification with a Sonopuls Sonicator (Bandelin/
Germany; output setting 60%, 10× 10 s pulses with 10 s incubation on
ice between pulses) were enriched between 200–800 bp. One μgofa
rabbit anti-LEF1 mAb (Cell Signaling Technology 2230) or rabbit IgG
(Jackson ImmunoResearch 78057), respectively, was used for ChIP. Pu-
rified DNA served as template for PCR amplification of an Lmx1a geno-
mic fragment with one primer pair, and of Fgf20 genomic fragments
with the five primer pairs indicated in Table 1. Data are from three inde-
pendent ChIP experiments, and PCR assays were repeated three times
for each experiment.
Western blot
VM tissues were isolated from adult (6 months old) En1
+/LacZ
mice
and their wild-type littermates (wt1) as well as En1
+/Wnt1
mice, and
stored at −80 °C. Frozen tissues were lysed and homogenized in
100 mM Tris–HCl pH 8, 250 mM NaCl, 1 mM EDTA, 5 mM MgCl
2
,1%
NP-40, 10% glycerol, protease and phosphatase inhibitors (complete
Mini and Phosphatase Inhibitor Cocktail Tablets; Roche/Germany) for
30 min on ice. The homogenate was sonicated and cleared by centrifu-
gation at 13,000 gfor 15 min at 4 °C. Total protein concentration was de-
termined with Pierce BCA Protein Assay (Thermo Fisher Scientific/USA),
and 25 μg total protein per sample were separated in 10% Criterion XT
Bis-Tris/NuPAGE Precast gels (Invitrogen) and blotted onto PVDF mem-
branes (BioTrace; Pall Corporation/USA). Blots were blocked in PBS con-
taining 5% non-fat milk and 0.2% Tween-20, and probed with mouse
anti-TH (1:5000; Millipore MAB318) or β-Actin (1:10,000; abcam
AB6276) mAbs. Membranes were developed in ECL substrate and ex-
posed to Hyperfilm ECL (GE Healthcare).
Statistical analyses
All values given are mean ± SD. Statistical significance between
groups was assessed by independent-samples ttests using the SPSS
v.10.0 software (SPSS Inc., Chicago,/USA). A valueof pb0.05 was consid-
ered significant.
Results
Ectopic Wnt1 expression prevents the loss of mdDA neurons in adult
En1
+/−
heterozygous mice
To determine if WNT1 has neuroprotective/pro-survival and/or pro-
neurogenic functions in a genetic mouse model of PD, we made use of
the En1
+/Wnt1
knock-in mouse, in which one En1 allele was replaced
by the Wnt1 cDNA (Panhuysen et al., 2004). These mice are heterozy-
gous at the En1 locus (En1
+/−
), and might thus show a progressive de-
generation of the SNc and VTA DA neurons after birth, as previously
reported for the En1
+/LacZ
(En1
+/−
)mice(Nordstrom et al., 2015;
Sonnier et al., 2007). Using RT-PCR and radioactive ISH, we first con-
firmed previous data showing that Wnt1 transcription is strongly
down-regulated or absent in the adult wild-type mouse brain (Gavin
et al., 1990; L'Episcopo et al., 2011b; Panhuysen et al., 2004). Wnt1
was only very weakly expressed in the olfactory bulbs and relatively
more strongly in the frontal cortex, as assessed by RT-PCR (Fig. S1A).
Wnt1 expression in the frontal cortex appeared to be mostly restricted
to the piriform cortex on in situ hybridized coronal brain sections
from adult wild-type mice ( Figs. S1C,D). Expression of Wnt1 was not de-
tected in all other brain regions analyzed with the two methods (poste-
rior cortex, striatum, hippocampus, VM (tegmentum), dorsal midbrain
(tectum) and cerebellum) (Figs. 1A–B′,S1A–M). By contrast and as pre-
viously reported (Simon et al., 2001), En1 was strongly expressed in the
SNc and VTA (Fig. 1A,A′), in the inferior colliculi and in some other cell
populations of the midbrain tegmentum (Figs. S1F–I) from adult wild-
type mice. Correspondingly, Wnt1 was ectopically expressed under
the control of En1 regulatory sequences in the SNc, VTA, midbrain teg-
mentum and inferior colliculi of adult En1
+/Wnt1
mice (Figs. 1C–D′,
S1J–M and data not shown) (Panhuysen et al., 2004). These data thus
confirmed the ectopic expression of Wnt1 in the En1 heterozygote
(En1
+/−
) SNc and VTA DA neurons of adult En1
+/Wnt1
mice.
We next determined the numbers of SNc and VTA DA neurons ex-
pressing TH, the rate-limiting enzyme in DA synthesis, in the VM of
adult En1
+/LacZ
and En1
+/Wnt1
mice. En1
+/LacZ
mice are born with a nor-
mal number of SNc and VTA DA neurons, but these neurons begin to de-
generate after the fourth postnatal week, reaching a plateau after
6monthsofage(Nordstrom et al., 2015; Sonnier et al., 2007). We there-
fore focused on the latter time-point (6 months old mice) for the stereo-
logical counting. Because both mouse lines were bred to different
genetic backgrounds (outbred CD-1 for the En1
+/LacZ
mice and inbred
C57BL/6 J for the En1
+/Wnt1
mice), we compared the numbers of TH
+
cells for each mouse line to the corresponding littermate controls (wt1
for En1
+/LacZ
mice and wt2 for En1
+/Wnt1
mice). The numbers of TH
+
DA neurons were significantly reduced by 30% and 37.5% in the SNc
and VTA, respectively, of theEn1
+/LacZ
mice compared to their littermate
controls (wt1)(Figs. 1E,F,I), which corresponds largely with previous
data (Nordstrom et al., 2015; Sonnier et al., 2007). Notably, TH
+
cells
in the SNc and VTA of En1
+/LacZ
mice were also significantly decreased
by 33.2% and 50.9%, respectively, relative to the En1
+/Wnt1
mice
(Figs. 1F,H,L). No significant differences in the numbers of TH
+
SNc
and VTA DA neurons were detected between En1
+/Wnt1
mice and their
littermate controls (wt2)(Figs. 1G,H,J) and between both wild-type
control groups (wt1 and wt2)(Figs. 1E,G,K). The levels of TH protein
in the VM of adult En1
+/LacZ
mice were significantly reduced by 58%
and 59%, respectively, relative to their littermate controls (wt1)and
the En1
+/Wnt1
VM, in which the amount of TH protein was restored to
wild-type levels (Figs. 1M,N). Backcrossing of the En1
+/LacZ
mouse line
to the C57BL/6 J (inbred) background did not reveal any difference to
the outbred (CD-1) background, and En1
+/LacZ
mice showed a reduction
of TH protein levels in the two genetic backgrounds (data not shown).
Together, these data confirmed the loss of SNc and VTA DA neurons in
6monthsoldEn1
+/LacZ
mice, and indicated that the ectopic expression
of Wnt1 rescued this phenotype in heterozygote En1
+/Wnt1
mice.
Ectopic Wnt1 expression only increases the proliferation of non-neurogenic
cells in the adult En1
+/Wnt1
VM
The rescued mdDA neuron numbers in the adult En1
+/Wnt1
com-
pared to the En1
+/LacZ
mice might have been due to the regeneration
or a better survival of these neurons in the En1
+/Wnt1
VM. The well-
established function of WNT/β-catenin signaling in promoting neural
stem cell (NSC) proliferation and adult neurogenesis (Inestrosa and
Arenas, 2010), prompted us to investigate whether the ectopic Wnt1 in-
duces an increased proliferation of NSCs that subsequently generate
new SNc and VTA DA neurons in the En1
+/Wnt1
VM. Therefore, we first
determined the numbers of proliferating (BrdU
+
) cells in the VM of
adult (6 months old) En1
+/Wnt1
mice relative to their littermate controls.
Four weeks after receiving the last of 5 consecutive and dailyBrdU injec-
tions (Fig. 2A), the total number of BrdU
+
cells was significantly in-
creased in the Substantia nigra pars reticularis (SNr) and VTA, but not
35J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
in the SNc, of the En1
+/Wnt1
mice (Figs. 2B–D). These data suggested that
the proliferation of NSCs and/or other progenitor cells was increased in
the adult En1
+/Wnt1
VM, most likely due to the ectopic expression of
Wnt1 in this region. We next determined the fate of these BrdU
+
cells
by co-labelling with markers for mature neurons (NeuN, also known
as RNA binding protein fox-1 homolog 3 (RBFOX3)), mdDA neurons
Fig. 1. EctopicWnt1 expression prevents the degeneration of mdDA neurons in adultEn1
+/−
heterozygous mice. (A–D′) Representative brightfield(A–D) and the corresponding darkfield
(A′–D′) views of cresylviolet-stained coronal sections (dorsaltop) from adult wt (C57BL/6 J) ( A–B′)andEn1
+/Wnt1
(C–D′) brains, hybridized with riboprobes for En1 (A,A′,C,C′)andWnt1
(B,B′,D,D′). (E–H) Representative close-up viewsof the SNc and lateral VTA on coronal brain sections (dorsal top)from 6 months old littermatecontrol (wt1,E;wt2,G),En1
+/LacZ
(F) and
En1
+/Wnt1
(H) mice, immunostained for TH (green). (I–L) Quantification of TH
+
cells in the SNc or VTA of 6 months old En1
+/LacZ
(I,L), En1
+/Wnt1
(J,L) and their corresponding littermate
control (wt1 (I,K), wt2 (J,K)) mice. Note that the total number of TH
+
cells in the SNc and VTA did not differ significantly between the two littermate control (wt1 and wt2)groups(K).
(TH
+
cells: wt1 SNc,11,997 ± 1938; wt1 VTA, 13,399 ± 2893; En1
+/LacZ
SNc, 8501 ± 961;En1
+/LacZ
VTA, 8374 ± 592; n = 4/genotype; wt2 SNc, 14,139± 2343; wt2 VTA, 17,658 ± 2012;
n=5;En1
+/Wnt1
SNc, 12,724 ± 1445; En1
+/Wnt1
VTA, 17,068 ± 970; n = 4; ns, not significant in the equal variance t-test). (M,N) Western blot analyses confirmed the reduction of TH
protein content in the VM of adult En1
+/LacZ
mice compared with their littermate controls (wt1), which was rescued in the VM of adult En1
+/Wnt1
mice (ratios (optical density, OD): wt1,
0.45 ± 0.12; En1
+/LacZ
, 0.18 ± 0.05; En1
+/Wnt1
, 0.43 ± 0.13;n = 3/genotype; ns,not significant in the equalvariance t-test).Abbreviations:SNc, substantia nigra parscompacta; VTA, ven-
tral tegmental area. Scale bars: 1.33 mm (D′); 100 μm(H).
36 J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
(TH), astrocytes (glial fibrillary acidic protein (GFAP)), oligodendrocyte
progenitor cells (OPCs) (neural/glial antigen 2 (NG2), also known as
chondroitin sulfate proteoglycan 4 (CSPG4)), immature oligodendro-
cytes (oligodendrocyte transcription factor 2 (OLIG2)), and microglia
(ionized calcium-binding adapter molecule 1 (IBA1), also known as al-
lograft inflammatory factor 1 (AIF1)). The BrdU
+
cells in the VM of
adult wild-type mice only co-labeled with NG2 and OLIG2, but not
with NeuN, TH, GFAP or IBA1 (data not shown), consistent with
previous reports showing that the proliferating cells in the adult rodent
wild-type VM are OPCs (Hermann et al., 2009; Lie et al., 2002). In the
adult En1
+/Wnt1
VM, the BrdU
+
cells were co-labeled for NG2 and
OLIG2 (Figs. 2G, S2A–D) and occasionally for IBA1 (Fig. 2H), but not
for NeuN (Fig. 2E), TH (Fig. S2E–G) or GFAP (Fig. 2F), indicating that
the ectopic Wnt1 expression in the adult VM only increased the prolifer-
ation of OPCs and some microglial cells, but not of NSCs giving rise to
NeuN
+
mature neurons or TH
+
mdDA neurons. Together, these data
Fig. 2. Ectopic Wnt1expression only increases the proliferation of non-neurogenic cells in the adultEn1
+/Wnt1
VM. (A) Schemeof the fate-mappingparadigm used: 6 months oldwild-type
(C57BL/6J, wt)andEn1
+/Wnt1
mice received daily intraperitoneal BrdU injections on five consecutive days (d1–5) and were killed and perfused four weeks after receiving the last BrdU
injection (d33). (B,C) Representative unilateral close-up views of the VM on coronal brain sections (dorsal top) from BrdU-injected adult wild-type(wt) mice, immunostained for TH
(green) and BrdU (red). The TH
+
domains were used to delineate the SNc, SNr and VTA. (D) Quantification of BrdU
+
cells in the SNc,SNr or VTA of BrdU-injected adult wild-type (wt)
and En1
+/Wnt1
mice. (BrdU
+
cells: wt SNc, 201.6 ± 150; wt SNr, 633.6 ± 122; wt VTA, 201.6 ± 104; En1
+/Wnt1
SNc, 471.6 ± 218; En1
+/Wnt1
SNr, 1699.1 ± 370; En1
+/Wnt1
VTA,
466.6 ± 131; n = 5/genotype; ns, not significant in the equal variance t-test). (E–H) Representative high magnification confocal views of the VM on coronal brain sections from BrdU-
injected adult En1
+/Wnt1
mice, co-immunostained for NeuN (green) and BrdU (red) (E), GFAP (green) and BrdU (red) (F), OLIG2 (red) and BrdU (green) (G), and IBA1 (red) and BrdU
(green) (H); cells were counterstained with DAPI (blue). The left and bottom panel depict the corresponding orthogonal views (white lines), the right panels are higher magnifications
of the yellow boxedareas in (E–H), respectively. Abbreviations: SNc, substantia nigra parscompacta; SNr, substantia nigra parsreticularis; VTA,ventral tegmental area.Scale bars: 200 μm
(C); 50 μm and 8.35 μm (G).
37J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
discarded the possibility of an increased de novo generation (regenera-
tion) of SNc and VTA DA neurons in the adult En1
+/Wnt1
VM.
Ectopic Wnt1 expression prevents the apoptotic cell deathof mdDA neurons
in adult En1
+/Wnt1
mice
The previous results suggested that a better protection and/or sur-
vival of the En1 heterozygote (En1
+/−
) SNc and VTA DA neurons
accounted for the normal (wild-type-like) numbers of these neurons
in adult En1
+/Wnt1
mice. We therefore determined the incidence of apo-
ptotic (cCASP3-expressing) DA neurons in the VM of adult (6 months
old) wild-type, En1
+/LacZ
and En1
+/Wnt1
mice. Cells were defined as ap-
optotic if a clear immunofluorescent cCASP3 signal was detected in
the cytoplasm or perinuclear region of the corresponding cell (Fig. 3H
′,H″), but not if such a signal was located outside the cell body or on
the cell membrane (Fig. 3D′). Approx. 1.9% of the TH
+
DA neurons
were also cCASP3
+
in the SNc of En1
+/LacZ
mice (Figs. 3E–H′; n = 4),
in line with a previous report showing cCASP3
+
/TH
+
DA neurons in
the SNc of heterozygote En1
+/−
mice on an En2 null background
(Sgado et al., 2006). These apoptotic DA neurons also displayed a weak-
er expression of TH, shrinking of the cell body and signs of pyknotic nu-
clei (Figs. 3E′–H′). By contrast, apoptotic DA neurons (TH
+
/cCASP3
+
double-positive cells) were not detected in the SNc of adult (6 months
old) wild-type and En1
+/Wnt1
mice (Figs. 3A–D′,I–L′), suggesting that
the enhanced apoptotic death of TH
+
SNc DA neurons in the absence
of one En1 allele is rescued by the ectopic expression of Wnt1 in these
cells. It should be noted that the occurrence of apoptotic (including
TH
−
non-dopaminergic) cells appeared to be generally increased in
the VM of adult (6 months old) En1
+/LacZ
mice (Figs. 3E–H,E″–H″). We
thus concluded that the normal (wild-type-like) numbers of SNc and
Fig. 3. Ectopic Wnt1 expression prevents the apoptotic cell death of mdDA neurons in adult En1
+/Wnt1
mice. (A–L′) Representative high magnification confocal views of the SNc on coronal
brain sections from adult wt (C57BL/6J)(A–D′), En1
+/LacZ
(E–H″)andEn1
+/Wnt1
(I–L′) mice, co-immunostained for TH (green; A,A′,E–E″,I,I′) and cleaved Caspase 3 (cCASP3, red; B,B′,F–F″,J,J′),
and counterstained with DAPI (blue; C,C′,G–G″,K,K′). The rightmost panel depicts the merged images (D,D′,H–H″,L,L′). (A′–D′,E′–H′and I′–L′) are higher magnifications of TH
+
cells in the
yellow boxed areas in (D, H and L), respectively, and (E″–H″) are higher magnifications of an apoptotic TH
−
cell in the white boxed area in (H). Scale bars: 25 μm(B);8.35μm(B′).
38 J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
VTA DA neuronsin adult En1
+/Wnt1
mice were mostlikely due to a better
survival of these neurons in the presence of the ectopic Wnt1.
Ectopic Wnt1 induces the expression of Wnt/β-catenin nuclear effector and
target genes in the adult VM
The better survival of mdDA neurons in the adult En1
+/Wnt1
VM sug-
gested that the ectopic Wnt1 induces a neuroprotective WNT1/β-
catenin signaling cascade in either the En1
+
mdDA neurons themselves
or in adjacent VM cells, which ultimately leads to the transcriptional ac-
tivation of WNT/β-catenin target genes mediating this effect. We there-
fore determined the expression patterns and transcriptional levels of
known WNT/β-catenin nuclear effector and/or target genes in the
adult En1
+/Wnt1
VM. The two members of the LEF1/TCF TF family, LEF1
and TCF7L2 (previously known as TCF4), are expressed in the postnatal
and adult wild-type mouse brain (Coyle-Rink et al., 2002). LIM homeo-
box transcription factor 1 alpha (LMX1A) is a HD TF with important
functions in mdDA neuron development (reviewed by Hegarty et al.
(2013);Veenvliet and Smidt (2014)) that continues to be expressed
in adult mdDA neurons (Zou et al., 2009), and Fibroblast growth factor
20 (FGF20) is a growth factor expressed in adult SNc DA neurons that
has been proposed to promote the survival of these neurons (reviewed
by Itoh and Ohta (2013)). Lef1, as well as Lmx1a andFgf20, are direct tar-
get genes of the WNT/β-catenin pathway (Chamorro et al., 2005; Chung
et al., 2009; Filali et al., 2002). Compared to their wild-type littermates,
the transcription of Lmx1a and Fgf20 was noticeably increased in the
SNc and VTA of adult En1
+/Wnt1
mice as determined from the corre-
sponding ISH signal (Figs. 4C–F′). Although this was less obvious for
Lef1 at low magnification (Figs. 4A–B′), inspection at higher magnifica-
tions showed an approx. twofold increase of the number of Lef1
+
cells in
the adult En1
+/Wnt1
VM compared to the wild-type controls (Figs. 4G,H).
The preferential localization of the Lef1 in situ signal to small and
intensely cresyl-violet stained cells suggested an increased transcription
of Lef1 in glial cells (most likely astrocytes and OPC derivatives)
after paracrine WNT1 signaling in the En1
+/Wnt1
VM (Figs. 4G,H). Quan-
titative PCR (qPCR) analyses indeed revealed a 7.1-, 1.6- and 1.8-fold in-
crease of Lef1,Lmx1aand Fgf20 transcripts, respectively,in the En1
+/Wnt1
VM tissues relative to their wild-type counterparts (Fig. 4I). The expres-
sion of the nuclear WNT/β-catenin effector Tcf7l2 and other genes
implicated in mdDA and/or generic neurogenesis, such as Nr4a2 (also
known as Nurr1)(Decressac et al., 2013; Jankovic et al., 2005) and the
two direct WNT/β-catenin target genes Neurod1 and Jag1 (Estrach
et al., 2006; Guillemot, 2007; Imayoshi and Kageyama, 2014;
Kuwabara et al., 2009), by contrast, was not altered or ectopically
Fig. 4. Ectopic Wnt1 induces the express ion of WNT/β-catenin nuclear effector and target genes in the adult VM. (A–F′) Representativebrightfield (A–F) and corresponding darkfield (A′–F′)
views of cresyl violet-stained coronal sections (dorsal top) from adult (3 months old) wt (C57BL/6 J) (A,A′,C,C′,E,E′)andEn1
+/Wnt1
(B,B′,D,D′,F,F′) brains, hybridized with riboprobes for Lef1
(A–B′), Lmx1a (C–D′)andFgf20 (E–F′). (G,H) Representative close-up views of the VM on cresyl violet-stained coronal brain sections (dorsal top) from wt (G) and En1
+/Wnt1
(H) mice, hy-
bridized with a riboprobe for Lef1. Note that approx. twice as manyLef1
+
cells (red arrows) were detec ted in the En1
+/Wnt1
VM. (I)qPCR analyses revealed a 7.1-, 1.6- and 1.8-fold increase of
Lef1,Lmx1a and Fgf20 expression, respectively, in the VM of adult En1
+/Wnt1
mice. (Fold increase relative to wt (set as 1): Lef1,7.1±1.68;Lmx1a,1.6 ± 0.17; Fgf20, 1.8 ± 0.23; n = 3/genotype;
ns, not significant in the equal variance t-test). (J,K) Representative ChIP-PCR results showingthat LEF1 is bound to the mouse Lmx1a promoter containing a conserved Lef1/Tcf BS (J), and to
the mouse Fgf20 promoter containing several conservedLef1/Tcf BSs(K). Schemes depict the positionsof conservedLe f1/Tcf BSs within the mouse Lmx1a and Fgf20 promoter regions relative
to the transcription start site (TSS, red arrow), and of the ampl ified PCR fragments. H
2
O, negative PCR control; rIgG, negative ChIP control; α-Lef, mAb #2230; input: sheared adult mouse VM
genomic DNA. Abbreviations: MG, medial geniculate body; SC, superior colliculus; SNc, substantia nigra pars compacta; VTA,ventral tegmental area. Scale bars: 667 μm (A); 25 μm(G).
39J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
induced in the mutant VM (Fig. S3A–H′). The latter result corresponded
well with the lack of evidences for a de novo generation of mdDA neu-
rons in the adult En1
+/Wnt1
VM (Fig. 2).
The increased expression of Lef1 in the adult En1
+/Wnt1
VM sug-
gested that this nuclear effector transactivates the WNT/β-catenin tar-
get genes Lmx1a and Fgf20 in the SNc and VTA DA neurons. We
therefore determined whether LEF1 binds to the murine Lmx1a and
Fgf20 promoter regions in the adult mouse VM. One (Lmx1a)orseveral
(Fgf20)conservedLef1/Tcf BSs are predicted in the promoter regions of
these two genes (Figs. 4J,K) (Chamorro et al., 2005; Chung et al., 2009).
ChIP-PCR showed that the conserved Lef1/Tcf BS in the Lmx1a promoter
region, and approx. 6 out of 10 predicted Lef1/Tcf BSs in the Fgf20 pro-
moter region, were bound by LEF1 (Figs. 4J,K), strongly suggesting
that these two genes are direct targets of LEF1-mediated WNT/β-
catenin signaling in the murine VM. These results indicated that ectopic
WNT1/β-catenin signaling in the En1
+/Wnt1
VM, including the SNc and
VTA, leads to the increased transcription of the WNT/β-catenin target
gene and nuclear effector Lef1 in this region. LEF1, in turn, binds to the
promoter regions of at least two direct target genes (Lmx1a and Fgf20)
and together with β-catenin appears to activate their transcription in
the mutant VM. The increased expression of LMX1A and FGF20 might
thus mediate the neuroprotective and/or pro-survival functions of the
ectopic Wnt1 in the En1
+/Wnt1
VM.
Ectopic Wnt1 activates a developmental neuroprotective genetic cascade in
the adult mouse VM
Whereas mdDA neuroprotective effects have already been ascribed
to FGF20 (Murase and McKay, 2006; Ohmachi et al., 2000, 2003), a
requirement of LMX1A for the protection and/or maintenance of adult
mdDA neurons has not been demonstrated so far. LMX1A, however,
binds to and activates the promoter region of Pitx3 (Paired-like
homeodomain transcription factor 3) (Chung et al., 2009;SGetal.,un-
published), an essential HD TF for mdDA and especially SNc DA neuron
development and survival (reviewed by Hegarty et al. (2013)). PITX3, in
turn, activates the mouse Bdnf (Brain-derived neurotrophic factor)
promoter (Peng et al., 2011), a neurotrophic factor with known pro-
differentiation and pro-survival functions for mdDA neurons (reviewed
by Hegarty et al. (2014);Zuccato and Cattaneo (2009)). Another direct
target gene of LEF1-mediated WNT/β-catenin signaling is Dkk3
(Dickkopf homolog 3) (Matthes et al., 2014), a secreted modulator of
this pathway that promotes the differentiation and in vitro survival of
a rostrolateral (SNc) mdDA neuron subset (JZ, SG and NP, unpublished).
Lastly, the En1/2 genes are also potential direct targets of LEF1/TCF-
mediated WNT/β-catenin signaling (Danielian and McMahon, 1996;
McGrew et al., 1999), raising the possibility that En1 expression might
be potentiated by the ectopic Wnt1 in the En1
+/Wnt1
VM. We therefore
hypothesized that the ectopic Wnt1 might activate and/or maintain a
developmental mdDA neuroprotective/pro-survival genetic cascade in
the adult En1
+/Wnt1
VM consisting of the direct and indirect targets
mentioned before. Semi-qPCR and qPCR analyses indeed showed that
the transcript levels of Pitx3,Bdnf and Dkk3 were increased by 1.83-,
1.76- and 1.58-fold, respectively, in the adult En1
+/Wnt1
VM relative
to the wild-type controls (Figs. 5A,B). The En1 mRNA levels in the
En1
+/Wnt1
VM, by contrast, were reduced to approx. 54% of the levels
in the corresponding littermate controls (wt2), as would be expected
from the En1 heterozygote background of these mice (Fig. 5C). Sur-
prisingly, the En1 transcript levels in the En1
+/LacZ
VM were reduced
Fig. 5. Ectopic Wnt1 activates a developmental neuroprotective genetic cascade in the adultmouse VM. (A) RT-PCR analyses of VM tissues isolated from adult (3 months old) wild-type
(C57BL/6J, wt)andEn1
+/Wnt1
mice showed that the transcription of Dkk3,Pitx3 and Bdnf was up-regulated in the En1
+/Wnt1
relative to the wt VM. Amplification of β-Actin (Actb) served
as a loading control; H
2
O: negative PCR control. (B) Semi-qPCR analyses revealed a 1.6- to almost 2-fold increase of Dkk3,Pitx3 and Bdnf transcript levels, respectively, in the VM of adult
En1
+/Wnt1
mice. (Fold increase relative to wt (set as 1): Dkk3,1.58±0.19;Pitx3, 1.83 ± 0.41; Bdnf, 1.76 ± 0.27; n = 3/g enotype). (C) qPCR analyses revealed a decrease of En1 mRNA levels
by approx. 74% to 26% in the VM of adult En1
+/LacZ
mice, and by approx. 46% to 54% in the VM of adult En1
+/Wnt1
mice relative to the corresponding littermate controls (wt1 and wt2,respec-
tively). (Fold expression relative to the corresp onding wt control (set as 1): En1
+/LacZ
, 0.26 ± 0.11; En1
+/Wnt1
, 0.54 ± 0.07; n = 3/genotype; ns, not significant in the equal variance t-test).
40 J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
41J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
to approx. 26% of the levels in the corresponding littermate controls
(wt1)(Fig. 5C), indicating that En1 heterozygosity causes a greater
than expected reduction of En1 gene dosage in the En1
+/LacZ
VM,
which is partly rescued (to the expected ~50%) by the ectopic expres-
sion of Wnt1 in the En1
+/Wnt1
VM. We thus concluded that the ectop-
ic LEF1-mediated WNT1/β-catenin signaling in the adult En1
+/Wnt1
VM sustains a developmental genetic cascade consisting of the direct
target genes Lmx1a,Fgf20,Dkk3 and possibly also En1, and the indi-
rect targets Pitx3 (activated by LMX1A) and Bdnf (activated by
PITX3), which together might promote the protection and survival
of SNc and VTA DA neurons in an unfavorable En1 heterozygote
(En1
+/−
) genetic background.
Soluble BDNF and DKK3 but not FGF20 proteins protect En1 mutant mdDA
neurons from their degeneration in vitro
Because BDNF, FGF20 and DKK3 are proven or potential neurotroph-
ic and/or neuroprotective factors for mdDA neurons, these secreted pro-
teins might safeguard the SNc and VTA DA neurons from their
precocious degeneration in the En1
+/−
mouse model of PD. To test
whether this is indeed the case, we generated primary VM cell cultures
from E12.5 mouse embryos derived from En1
+/LacZ
heterozygote inter-
crosses, and treated these cultures with vehicle (control) or recombi-
nant human BDNF, DKK3 or FGF20 proteins for 7 days (Fig. 6A). The
En1 mutant (heterozygote En1
+/LacZ
and homozygote En1
LacZ/LacZ
)DA
neurons in these cultures were identified by their co-expression of β-
GAL and TH (TH
+
/β-Gal
+
cells; Figs. 6B–U). The total number of TH
+
cells, as well as the proportions of En1 mutant (TH
+
/β-GAL
+
)and
wild-type (TH
+
/β-GAL
−
) DA neurons among these cells, were signifi-
cantly increased after BDNF (Fig. 6V) or DKK3 (Fig. 6W) treatment of
the primary VM cultures relative to the control (BSA-treated) cells. In
the FGF20-treated cultures, however, only the number of wild-type
(TH
+
/β-GAL
−
) DA neurons was significantly increased whereas the
total number of TH
+
cells and the proportion of En1 mutant (TH
+
/β-
GAL
+
) DA neurons among these cells remained unchanged relative to
the controls (Fig. 6X). These results indicated that only BDNF or DKK3,
but not FGF20, augment the differentiation and/or survival of En1 mu-
tant mdDA neurons in vitro.
To determine whether BDNF and DKK3 promoted specifically the
survival of the En1 mutant DA neurons in vitro, we co-stained the pri-
mary VM cells for the apoptotic marker cCASP3 (Figs. 6B–U). The major-
ity of the En1 mutant (TH
+
/β-GAL
+
) cells also showed a clear
cytoplasmic, perinuclear or nuclear staining for cCASP3, indicating that
they were undergoing apoptosis as previously reported (Alberi et al.,
2004). However, we noted that a fraction of these TH
+
/β-GAL
+
/
cCASP3
+
DA neurons still had extended TH
+
neurites and intact nuclei,
suggesting that they were in an early stage of apoptosis (yellow arrow-
heads in Figs. 6B–T). The other fraction of the TH
+
/β-GAL
+
/cCASP3
+
DA
neurons exhibited condensed neurites, rounded cell bodies and
fragmented nuclei, suggesting that they were already in a late stage of
apoptosis (white arrowheads in Figs. 6B–T). Some non-apoptotic wild-
type DA neurons (TH
+
/β-GAL
−
/cCASP3
−
cells; grey arrow in Figs. 6G–
J) and only a very few non-apoptotic En1 mutant DA neurons (TH
+
/β-
GAL
+
/cCASP3
−
cells; orange arrow in Figs. 6L–O) were also detected
in these cultures. Quantification of the TH
+
/β-GAL
+
/cCASP3
+
En1 mu-
tant DA neurons in an already advanced stage of apoptosis revealed
that BDNF or DKK3 treatment significantly decreased the numbers of
these cells relative to the control (BSA-treated) cultures (Fig. 6Y). Alto-
gether, our data thus suggest that the increased autocrine and/or para-
crine secretion of BDNF and DKK3 proteins, in response to the ectopic
activation of a LEF1-mediated WNT1/β-catenin signaling cascade in
the adult En1
+/Wnt1
VM, protects genetically affected (En1 mutant)
mdDA neurons from their premature degeneration and promotes
their survival under these adverse conditions.
Discussion
We show here that the ectopic expression of the secreted Wnt1 li-
gand in En1 heterozygote (En1
+/−
) SNc and VTA DA neurons prevents
the premature apoptotic degeneration of these neurons by activating
and/or maintaining a cell-autonomous and/or non-autonomous intra-
cellular signaling cascade that culminates in the up-regulation of the di-
rect WNT/β-catenin target genes Lef1,Lmx1a,Fgf20 and Dkk3, and the
indirect target genes Pitx3 and Bdnf. The secreted neurotrophic factors
BDNF and DKK3, in turn, appear to convey this neuroprotective effect
to En1
+/−
mdDA neurons downstream of WNT1, whereas the growth
factor FGF20 cannot protect En1 mutant (En1
+/−
and En1
−/−
) mdDA
neurons from degeneration in vitro. Our data therefore suggest that in
the context of a genetic mouse model of PD, a neurodevelopmental
LEF1-mediated WNT1/β-catenin signaling pathway provides a similar
mdDA neuroprotective effect as was previously described for a
neurotoxin-based animal model of PD (L'Episcopo et al., 2011a, 2011b,
2014).
Essential mdDA neuroprotective but not regenerative functions of WNT1-
mediated signaling in genetic and neurotoxin-based mouse models of PD
Despite some ongoing WNT/β-catenin signaling in the adult VM, in-
cluding the SNc and VTA DA neurons (SG and NP, unpublished;
L'Episcopo et al., 2014), and in line with previous reports (Gavin et al.,
1990; L'Episcopo et al., 2011b; Panhuysen et al., 2004), we could not de-
tect any Wnt1 gene expression by conventional RT-PCR and ISH in the
adult wild-type mouse VM. Activation of WNT/β-catenin signal trans-
duction by probably other WNT ligands expressed in the adult mouse
VM (data not shown), however, appears to be necessary to sustain the
prolonged survival of TH
+
mdDA neurons in the intact mouse brain, be-
cause the inhibition of WNT/β-catenin signaling causes a progressive
loss of these neurons in the adult VM (L'Episcopo et al., 2011a). Further-
more, WNT/β-catenin signaling, but in particular the expression of
Wnt1, is strongly up-regulated in the adult mouse VM after acute expo-
sure to the neurotoxin MPTP, anddirectly correlated with the improved
protection and survival of mdDA neurons in this neurotoxin-based ani-
mal model of PD (L'Episcopo et al., 2011b, 2014). We therefore hypoth-
esized that Wnt1 might exert a similar neuroprotective and pro-survival
Fig. 6. Soluble DKK3 and BDNF but not FGF20proteins protect En1 mutant mdDA neurons from degeneration. (A) Experimentalset-up: En1
+/LacZ
mice were intercrossed and VM tissues
(orange) were isolated and pooled from the resulting E12.5 embryos with the 3 possible genotypes (En1
+/+
(wild-types), En1
+/LacZ
(heterozygotes) or En1
LacZ/LacZ
(homozygote mu-
tants)). Primary VM cultures were treated for 7 days with BSA (control), BDNF, DKK3 or FGF20 proteins. Wild-type DA neurons in these cultures were identified by the expression of
TH protein only (red cells), En1 mutant DA neurons were identified by the co-expression of TH and β-GAL (yellow cell s), and non-DA but En1 mutant cells only expressed β-GAL
(green cells). (B–U) Representative confocal overviews of En1
+/LacZ
xEn1
+/LacZ
primary VM cells treated with BSA (B–F), BDNF (G–K), DKK3 (L–P), or FGF20 (Q–U) proteins. Cells
were immunostained for β-GAL (green; B,G,L,Q), TH (red; C,H,M,R) and cleaved Caspase 3 (cCASP3, grey; D,I,N,S), and counterstained with DAPI (blue; E,J,O,T). The rightmost panel
(F,K,P,U)depicts the mergedimages. Yellow arrowheads in (B–T) point at β-Gal
+
/TH
+
/cCASP3
+
En1 mutant (En1
+/−
or En1
−/−
) DA neuronsexhibiting extendedTH
+
neuritesand intact
nuclei;white arrowheads in (B–T) pointat β-Gal
+
/TH
+
/cCASP3
+
En1 mutantDA neurons exhibitingcondensed neurites, rounded cell bodiesand fragmented nuclei;grey arrows in (G–J)
point at β-Gal
−
/TH
+
/cCASP3
−
non-apoptotic, wild-type DA neurons, and orange arrows in (L–O) point at β-Gal
+
/TH
+
/cCASP3
−
non-apoptotic, En1 mutant DA neurons. (V–X)Quanti-
fication of the total number of TH
+
DA neurons and the proportion of TH
+
/β-Gal
+
(En1 mutant) and T H
+
/β-Gal
–
(wild-type) cells among these neurons in BDNF- (V), DKK3- (W) and
FGF20-treated (X) En1
+/LacZ
xEn1
+/LacZ
primary VM cultures. (% TH
+
cells relative to control (set as 100%): +BDNF: total TH
+
, 135.9 ± 18.8; T H
+
/β-Gal
+
, 136.4 ± 19.6; TH
+
/β-Gal
−
,
132.1 ± 15.5; +DKK3: total TH
+
, 146.1 ± 17.7; TH
+
/β-Gal
+
, 145.9 ± 18.7; TH
+
/β-Gal
−
, 152.2 ± 22; +FGF20: total TH
+
, 118.1 ± 12.8; TH
+
/β-Gal
+
, 114.9 ± 15.4; TH
+
/β-Gal
−
,
141 ± 12). (Y) Quantification of β-Gal
+
/TH
+
/cCASP3
+
En1 mutant DA neurons in a late apoptotic stage (white arrowheads in B–T) in control-, BDNF- or DKK3-treated En1
+/LacZ
x
En1
+/LacZ
primary VM cultures. (% β-Gal
+
/TH
+
/cCASP3
+
per DAPI
+
cells: Control, 40.8 ± 1.7; +BDNF, 19 ± 3.3; +DKK3, 21.2 ± 2; n = 3 experiments/condition; ns, not significant
in the equal variance t-test). Scale bar: 50 μm(F).
42 J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
function in the VM of adult En1
+/Wnt1
mice, in which Wnt1 is ectopically
expressed in En1 mutant (En1
+/−
) mdDA neurons that are prone to de-
generation after the fourth postnatal week (Nordstrom et al., 2015;
Sonnier et al., 2007). In fact, the ectopic expression of Wnt1 in the SNc
and VTA of adult En1
+/Wnt1
mice rescued the numbers of TH
+
mdDA
neurons to normal (wild-type) levels by preventing their apoptotic
cell death and increasing their survival. Our own data thus corroborate
the essential role of the WNT/β-catenin signaling pathway and especia l-
ly of the secreted WNT1 ligand in the better protection and survival of
SNc and VTA DA neurons after neurotoxic injury or genetic insults
in vivo.
In contrast to previous data suggesting an increased generation of
neurons/mdDA neurons from adult midbrain NSCs after MPTP lesioning
in situ or after isolation and WNT1 treatment in vitro (L'Episcopo et al.,
2011b, 2014), we did not detect any signs for a de novo generation (re-
generation) of TH
+
mdDA neurons in the VM of adult En1
+/Wnt1
mice.
Our data are in good agreement with previous findings showing no ev-
idence for the generation of new mdDA neurons in the adult VM under
basal conditions or after injury, despite the existence of a proliferating
progenitor population in the adult rodent VM (Frielingsdorf et al.,
2004; Hermann et al., 2009; Lie et al., 2002; Worlitzer et al., 2013).
The ectopic Wnt1 expression in the adult En1
+/Wnt1
VM, however, in-
creased the proliferation of mostly NG2
+
and OLIG2
+
OPCs and only
rarely IBA1
+
microglial cells. The enhanced proliferation of non-
neurogenic VM progenitor cells is also observedin neurotoxin-based ro-
dent models of PD with or without additional stimulation of the WNT/
β-catenin signaling pathway (L'Episcopo et al., 2014; Lie et al., 2002). Al-
together, our data therefore suggest that despite the ectopic Wnt1 ex-
pression, the VM (including the SNc and VTA) microenvironment in
adult En1
+/Wnt1
mice remained non-permissive for the generation of
new neurons/mdDA neurons (Panhuysen et al., 2004; Prakash et al.,
2006). The up-regulation of Wnt1 expression and activation of the
WNT1/β-catenin signaling pathway in the adult VM, however, might
contribute at least in part to the increased proliferation of locally
existing progenitor cells (OPCs and others) in these genetic and
neurotoxin-based rodent models of PD.
Autocrine and/or paracrine LEF1-mediated WNT1/β-catenin signaling acti-
vates a developmental neuroprotective gene cascade in the En1
+/Wnt1
VM
The ectopic expression of Wnt1 in the adult En1
+/Wnt1
VM activated a
gene cascade consisting of the direct WNT/β-catenin targets Lef1,
Lmx1a,Fgf20,Dkk3 and potentially also En1, and the indirect targets
Pitx3 (activated by LMX1A) and Bdnf (activated by PITX3). The majority
of these genes exert important functionsduring mdDA neuron develop-
ment in the mouse embryo, although a function of LEF1 and FGF20 in
this context has not been proven so far (SG and NP, unpublished; Itoh
and Ohta, 2013). LMX1A is necessary and sufficient for the generation
of an mdDA neuronal subset, PITX3 is required for the proper generation
and maintenance (at least in part due to the direct activation of Bdnf ex-
pression in these neurons) of the SNc and a subset of VTA DA neurons,
DKK3 is necessary and sufficient for the correct differentiation of a
rostrolateral mdDA neuron subset and their survival (Y. Fukusumi
et al., submitted), and the EN1/2 HD TFs are required for the mainte-
nance of mdDA neurons in the developing mouse VM (reviewed by
Hegarty et al. (2013);Veenvliet and Smidt (2014)). Therefore, our
data strongly suggest that the sustained expression of Wnt1 under the
control of En1 regulatory sequences in En1
+/−
mdDA neurons main-
tains the activation of these target genes throughout development and
in adulthood, thereby providing a continuous protection and trophic
support to the otherwise genetically afflicted (En1 heterozygous) SNc
and VTA DA neurons.
The up-regulation of Lmx1a and Fgf20 transcription in the En1
+
and
Wnt1
+
SNc and VTA of the En1
+/Wnt1
mice suggested that the activation
of the WNT1/β-catenin signaling pathway and its direct and indirect
target genes (Lmx1a →Pitx3 →Bdnf,Dkk3 and Fgf20) occurred in an
autocrine (cell-autonomous) manner in the mutant SNc and VTA DA
neurons themselves. However, we also noted that the increased tran-
scription of Lef1 in the En1
+/Wnt1
VM was largely due to an increased
number of Lef1-expressing glial cells, most likely astrocytes and/or the
offspring of the increased number of proliferating OPCs in the mutant
VM. The up-regulation of Lef1 expression in glial cells might reflect the
activation of the WNT1/β-catenin signaling cascade and its direct and
indirect target genes (including Lef1) in these cells, and suggests that
the secreted neurotrophins BDNF, DKK3 and FGF20 might also be re-
leased in a paracrine manner from these glial cells to act non-cell-auton-
omously on the surrounding mdDA neurons. Previous research has
indeed postulated a paracrine (non-cell-autonomous) mechanism of
the neuroprotective WNT1 action in cytotoxic models of mdDA neuro-
degeneration, whereby the cytokine-mediated activation of Wnt1
gene expression in reactive astrocytes of the neurotoxin-injured VM
leads to the release of WNT1 from these cells and its binding to FZD1 re-
ceptors expressed on the mdDA neurons (L'Episcopo et al., 2011a,
2011b). The subsequent activation of the WNT1/β-catenin signaling
pathway, including the inhibition of GSK3βand cytosolic stabilization
and nuclear translocation of β-catenin, conveys the neuroprotective ef-
fect of astrocyte-derived WNT1 to the mdDA neurons themselves
(L'Episcopo et al., 2011a, 2011b). The precise mode of action (autocrine
and/or paracrine) of the ectopic Wnt1 in the adult En1
+/Wnt1
VM there-
fore remains to be established.
The WNT1/β-catenin targets BDNF and DKK3 but not FGF20 rescue the de-
generation of En1-deficient mdDA neurons in vitro
In contrast to previous suggestions (Sonnier et al., 2007), we did not
find any difference in TH expression between the En1
+/LacZ
mice
backcrossed to an outbred (CD-1) and those backcrossed to an inbred
(C57BL/6J) genetic background (data not shown). This is consistent
with a previous report that analyzed the developmental mdDA pheno-
type of En1
+/−
and En1
−/−
mice backcrossed to the C57BL/6 J genetic
background (Veenvliet et al., 2013). Therefore, we can largely exclude
a rescue of the En1
+/LacZ
mdDA neurodegenerative phenotype in the
En1
+/Wnt1
mice because of the different genetic backgrounds of the
two mouse strains (CD-1 vs. C57BL/6 J) used herein, as is the case
for the En1
−/−
cerebellar phenotype (Bilovocky et al., 2003). Neverthe-
less, we noted an equally strong or even stronger (37.5% vs. 30%) loss of
TH
+
cells in the VTA compared with the SNc in our CD-1-backcrossed
En1
+/LacZ
mice, which contradicts previous findings of a more subtle
mdDA neurodegeneration in the VTA of Swiss-backcrossed En1
+/LacZ
mice (Sonnier et al., 2007). Apart from a potential effect of the different
outbred genetic backgrounds on the numbers of surviving VTA DA neu-
rons in these mice (Zaborszky andVadasz, 2001), slight variations in the
assignment of the different VM regions to the VTA or SNc and in the ste-
reological counting mode used in the two studies (this report; Sonnier
et al. (2007)) might account for these differences. In fact, Veenvliet
et al. (2013) also reported a strong reduction of mdDA cell density in
the VTA of C57BL/6 J-backcrossed En1-deficient mice. The most surpris-
ing finding of our analyses, however, was the fact that the En1 transcript
levels in the adult En1
+/LacZ
(En1
+/−
) VM were reduced by almost three
quarters (~74%) relative to their wild-type (En1
+/+
) littermates. To our
knowledge, this reduction of the En1 gene dosage below the expected
~50% has not been reported for the heterozygote En1
+/−
mouse mu-
tants analyzed so far (En1
+/LacZ
(Nordstrom et al., 2015; Sonnier et al.,
2007); En1
+/tauLacZ
(Sgado et al., 2006)). The strong reduction of En1
mRNA levels might translate into an equallystrong decrease of EN1 pro-
tein levels in the heterozygous En1
+/−
mutants, and might in fact ex-
plain the relatively strong mdDA phenotype of these mice. The ectopic
expression of Wnt1 in the En1
+/Wnt1
VM rescued the En1 transcript
levels to some extent, but only to the approx. 54% that were expected
from the En1
+/−
heterozygote background of these mice. Although
this might have been sufficient to overcome most of the mdDA deficits
in the En1
+/Wnt1
mouse mutants, we believe that the clearly stronger
43J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
(almost twofold) induction of Bdnf,Dkk3 and Fgf20 expression in the
adult En1
+/Wnt1
VM also contributed to the rescued TH
+
mdDA neuron
numbers and the improved survival of these cells in the presence of a
still reduced (heterozygote) En1 gene dosage. In support of this view,
we found that the treatment of En1 mutant (heterozygote En1
+/LacZ
and homozygote En1
LacZ/LacZ
) primary mdDA neurons with soluble
BDNF and DKK3 proteins enhanced the survival of these cells. BDNF
and DKK3 therefore appear to act downstream of EN1, and their signal-
ing pathways might rescue at least some of the mitochondrial deficits
and defects in axonal maintenance and autophagic protein degradation
that have been reported for the SNc and VTA DA neurons in adult
En1
+/−
mice (Alvarez-Fischer et al., 2011; Nordstrom et al., 2015). The
precise mode of action of these two neurotrophic/neuroprotective fac-
tors in the context of a reduced En1 gene dosage, however, remains to
be investigated. Remarkably, the treatment of primary VM cultures
with soluble FGF20 protein only increased the survival of the wild-
type (En1
+/+
)butnottheEn1 mutant (En1
+/LacZ
and En1
LacZ/LacZ
)
mdDA neurons in these cultures, indicating that despite its neuropro-
tective effect on 6-OHDA-treated primary mdDA neurons (Murase and
McKay, 2006), FGF20-mediated signaling acts upstream of EN1 and/or
cannot rescue the mdDA deficits caused by a reduced En1 gene dosage.
Altogether, our findings therefore suggest that the WNT1/β-catenin tar-
gets BDNF and DKK3 are promising pharmacological agents that might
be used for the prevention and/or treatment of a protracted SNc and
VTA DA neurodegeneration in genetic (En1 mutant) as well as environ-
mental (neurotoxin-based) forms of human PD.
Acknowledgments
We thank A. Folchert and S. Badeke for excellent technical assis-
tance; D. Trümbach for introduction to the Genomatix software, and
F. Giesert for initial help with radioactive ISH.
This work was supported by the Italian Association for Cancer
Research (AIRC) (grant IG2013) to AS; by funds (in part) from the
Helmholtz Portfolio Theme “Supercomputing and Modelling for the
Human Brain”(SMHB); from the Bayerisches Staatsministerium für
Bildung und Kultus, Wissenschaft und Kunst within the Bavarian Re-
search Network “Human Induced Pluripotent Stem Cells”(ForIPS);
and by the “Systems Biology of Stem Cells and Reprogramming”
(SyBoSS) project which has received funding from the European
Union's Seventh Framework Programme for research, technological
development and demonstration under grant agreement no [FP7-
HEALTH-F4-2010-242129] to WW. All responsibilities of this publica-
tion are due to the author(s). The funders had no role in study design,
data collection, analysis and interpretation, preparation of the manu-
script, or decision to publish.
Appendix A. Supplementary data
Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.nbd.2015.05.015.
References
Alberi, L., Sgado, P., Simon, H.H., 2004. Engrailed genes are cell-autonomously required to
prevent apopto sis in mesencephalic dopaminer gic neurons. Development 131,
3229–3236.
Alvarez-Fischer, D., Fuchs, J., Castagner, F., Stettler, O., Massiani-Beaudoin, O., Moya, K.L.,
Bouillot, C., Oertel, W.H., Lombes, A., Faigle, W., Joshi, R.L., Hartmann, A., Prochiantz,
A., 2011. Engrailed protects mouse midbrain dopaminergic neurons against mito-
chondrial complex I insults. Nat. Neurosci. 14, 1260–1266.
Beal, M.F., 2010. Parkinson's disease: a model dilemma. Nature 466, S8–S10.
Bezard, E., Yue, Z., Kirik, D., Spillantini, M.G., 2013. Animal models of Parkinson's disease:
limits and relevance to neuroprotection studies. Mov. Disord. 28, 61–70.
Bilovocky, N.A., Romito-DiGiacomo, R.R., Murcia, C.L., Maricich, S.M., Herrup, K., 2003.
Factors in the genetic background suppress the engrailed-1 cerebellar phenotype.
J. Neurosci. 23, 5105–5112.
Blandini, F., Armentero, M.T., 2012. Animal models of Parkinson's disease. FEBS J. 279,
1156–1166.
Blesa, J., Phani, S., Jackson-Lewis, V., Przedborski, S., 2012. Classicand new animal models
of Parkinson's disease. J. Biomed. Biotechnol. 2012, 845618.
Bove, J., Perier, C., 2012. Neurotoxin-based models of Parkinson's disease. Neuroscience
211, 51–76.
Brodski, C., Wei senhorn, D.M., Signore, M., Sil laber, I., Oesterheld, M., Broc coli, V.,
Acampora, D., Simeone, A., Wurst, W., 2003. Location and size of dopaminergic and
serotonergic cell populations are controlled by the position of the midbrain–hind-
brain organizer. J. Neurosci. 23, 4199–4207.
Cau, E., Gradwohl, G., Fode, C., Guillemot, F., 1997. Mash1 activates a cascadeof bHLH reg-
ulators in olfactory neuron progenitors. Development 124, 1611–1621.
Chamorro, M.N., Schwartz, D.R., Vonica, A., Brivanlou, A.H., Cho, K.R., Varmus, H.E., 2005.
FGF-20 and DKK1 are transcriptional targets of beta-cateninand FGF-20 is implicated
in cancer and development. EMBO J. 24, 73–84.
Chung, S., Leung, A., Ha n, B.S., Chang, M.Y., Moon, J.I., Kim, C.H., Hong, S., Pruszak, J.,
Isacson, O., Kim, K.S., 2009. Wnt1-lmx1a forms a novel autoregulatory loop and con-
trols midbrain do paminergic differentiation synergistical ly with the SHH-Fox A2
pathway. Cell Stem Cell 5, 646–658.
Coyle-Rink, J., Del Valle, L., Sweet, T., Khalili, K., Amini, S., 2002. Developmental expression
of Wnt signaling factors in mouse brain. Cancer Biol. Ther. 1, 640–645.
Danielian, P.S., McMahon, A.P., 1996. Engrailed-1 as a target of the Wnt-1 signalling path-
way in vertebrat e midbr ain development . Nature 383, 332 –334.
Davis, C.A., Joyner, A.L., 1988.Expression patternsof the homeo box-containing genes En-
1 and En-2 and the proto-oncogene int-1 diverge during mouse development. Genes
Dev. 2, 1736–1744.
Decressac, M., Vo lakakis, N., Bjor klund, A., Perlm ann, T., 2013. NURR1 in Parkinson
disease—from pathogenesis to therapeutic potential. Nat. Rev. Neurol. 9, 629–636.
Estrach, S., Ambler, C.A., Lo Celso, C., Hozumi, K., Watt, F.M., 2006. Jagged 1 is a beta-
catenin target gene required for ectopic hairfollicle formation in adult epidermis. De-
velopment 133, 4427–4438.
Filali, M., Cheng, N., Abbott, D., Leontiev, V., Engelhardt, J.F., 2002. Wnt-3A/beta-catenin
signaling induces transcription from the LEF-1 pro moter. J. Biol. Che m. 277,
33398–33410.
Fischer, T., Guimera, J., Wurst, W., Prakash, N., 2007. Distinct but redundant expression of
the Frizzled Wnt receptor genes at signaling centers of the developing mouse brain.
Neuroscience 147, 693–711.
Frielingsdorf, H., Schwarz, K., Brundin,P., Mohapel, P., 2004. No evidencefor new dopami-
nergic neurons in the adult mammalian substantia nigra. Proc. Natl. Acad. Sci. U. S. A.
101, 10177–10182.
Gavin, B.J., McMahon, J.A., McMahon, A.P., 1990. Expression of multiple novel Wnt-1/int-
1-related gene s during fetal and adult mouse dev elopment. Gen es Dev. 4,
2319–2332.
Guillemot, F., 2007. Spatial andtemporal specification of neural fates by transcription fac-
tor codes. Development 134, 3771–3780.
Hanks, M., Wurst, W., Anson-Cartwright, L., Auerbach, A.B., Joyner, A.L., 1995 . Rescue
of the En-1 mutant phenotype by repla cement of En-1 with En-2. Science 269,
679–682.
Hegarty, S.V., Sullivan, A.M., O'Keeffe, G.W., 2013. Midbrain dopaminergic neurons: a re-
view of the molecular circuitry that regulates thei r development. Dev. Biol. 379,
123–138.
Hegarty,S.V., Sullivan, A.M., O'Keeffe,G.W., 2014. Roles for the TGFbeta superfamily in the
development and survival of midbrain dopaminergic neurons. Mol. Neurobiol. 50,
559–573.
Hermann, A., Suess, C., Fauser, M., Kanzler, S., Witt, M., Fabel, K., Schwarz, J., Hoglinger,
G.U., Storch, A. , 2009. Rostro-caudal gradual loss of cellular diversity within the
periventricular regions of the ventricular system. Stem Cells 27, 928–941.
Hoppler, S., Ka vanagh, C.L., 20 07. Wnt signalling: variety at the core. J. Cell Sci. 120,
385–393.
Imayoshi, I., Kageyama, R., 2014. bHLH factors in self-renewal, multipotency, and fate
choice of neural progenitor cells. Neuron 82, 9–23.
Inestrosa, N.C., Arenas, E., 2010. Emerging roles of Wnts in the adult nervous system. Nat.
Rev. Neurosci. 11, 77–86.
Itoh, N., Ohta, H., 2013. Roles of FGF20 in dopaminergic neurons and Parkinson's disease.
Front. Mol. Neurosci. 6, 15.
Jankovic, J., Chen, S.,Le, W.D., 2005. The roleof Nurr1 in the developmentof dopaminergic
neurons and Parkinson's disease. Prog. Neurobiol. 77, 128–138.
Kuwabara, T., Hsieh, J., Muotri, A., Yeo, G., Warashina, M., Lie, D.C., Moore, L., Nakashima,
K., Asashima, M., Gage, F.H., 2009. Wnt-mediated activation of NeuroD1 and retro-
elements during adult neurogenesis. Nat. Neurosci. 12, 1097–1105.
Le Pen, G., Sonnier, L., Hartmann, A., Bizot, J.C., Trovero, F., Krebs, M.O., Prochiantz, A.,
2008. Progressive loss of dopaminergic neurons in the ventral midbrain of adul t
mice heterozygot e for Engrailed1: a new genetic model for Parkinson' s disease?
Parkinsonism Relat. Disord. 14 (Suppl. 2), S107–S111.
L'Episcopo, F., Serapide, M.F., Tirolo, C., Testa, N., Caniglia, S., Morale, M.C., Pluchino, S.,
Marchetti, B., 2011a. A Wnt1 regulated Frizzled-1/beta-Catenin signaling pathway
as a candidate regulatory circuit controlling mesencephalic dopaminergic neuron-
astrocyte crosstalk: Therapeutical relevance for neuron survival and neuroprotection.
Mol. Neurodegener. 6 , 49.
L'Episcopo, F., Tirolo, C., Testa, N., C aniglia, S., Moral e, M.C., Cossetti, C ., D'Adamo, P.,
Zardini, E., Andreoni, L., Ihekwab a, A.E., Serra, P.A ., Franciotta, D. , Martino, G.,
Pluchino, S., Marche tti, B., 201 1b. Reactive astrocytes and Wnt/beta-catenin signaling
link nigrostriatal injury to repair in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine
model of Parkinson's disease. Neurobiol. Dis. 41, 508–527.
L'Episcopo, F., Tirolo, C., Testa, N., Caniglia, S., Morale, M.C., Serapide, M.F., Pluchino, S.,
Marchetti, B., 2014. Wnt/beta-catenin signaling is required to rescue midbrain dopa-
minergicprogenitors and promote neurorepairin ageing mouse model of Parkinson's
disease. Stem Cells 32, 2147–2163.
44 J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
Lie, D.C.,Dziewczapolski,G., Willhoite, A.R.,Kaspar, B.K., Shults, C.W., Gage, F.H., 2002. The
adult substantia nigra containsprogenitor cells withneurogenic potential. J. Neurosci.
22, 6639–6649.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408.
Matthes, M., Preusse,M., Zhang,J., Schechter, J., Mayer, D., Lentes, B., Theis, F., Prakash, N.,
Wurst, W., Trumbach, D., 2014. Mouse IDGenes: a reference database for genetic in-
teractions in the developing mouse brain. Database (Oxford) http://dx.doi.org/10.
1093/database/bau083 (2014 Aug 20; pii: bau083).
McGrew, L.L., Takemaru, K., Bates, R., Moon, R.T., 1999. Direct regulation of the Xenopus
engrailed-2 promoter by the Wnt signaling p athway, and a molecul ar screen for
Wnt-responsive genes, confirm a role for Wnt signaling during neural patterning in
Xenopus. Mech. Dev. 87, 21–32.
Meredith, G.E., Rademacher, D.J., 2011. MPTP mouse models of Parkinson's disease: an
update. J. Parkinsons Dis. 1, 19–33.
Mitsiadis, T.A., Henrique, D.,Thesleff, I., Lendahl, U., 1997.Mouse Serrate-1(Jagged-1): ex-
pressionin the developing tooth is regulated by epithelial–mesenchymalinteractions
and fibroblast growth factor-4. Development 124, 1473–1483.
Murase, S., McKay, R.D., 2006. Aspecific survival response in dopamine neurons at most
risk in Parkinson's disease. J. Neurosci. 26, 9750–9760.
Nordstrom, U., Beauvais, G., Ghosh, A., Pulikkaparambil Sasidharan, B.C., Lundblad, M.,
Fuchs, J., Joshi, R.L., Lipton, J.W., Roholt, A., Medicetty, S., Feinstein, T.N., Steiner, J.A.,
Escobar Galvis, M.L., Prochiantz, A., Brundin, P., 2015. Progressive nigrostriatal termi-
nal dysfunction and degeneration in the engrailed1 heterozygous mouse model of
Parkinson's disease. Neurobiol. Dis. 73, 70–82.
Ohmachi, S., Watanabe, Y., Mikami, T., Kusu, N., Ibi, T., Akaike, A., Itoh, N., 2000. FGF-20, a
novel neurotrop hic factor, pref erentially expressed in the substantia nigra pars
compacta of rat brain. Biochem. Biophys. Res. Commun. 277, 355–360.
Ohmachi, S., Mikami, T., Konishi, M., Miyake, A., Itoh, N., 2003. Preferential neurotrophic
activity of fibroblast growth factor-20 for dopaminergic neurons through fibroblast
growth factor receptor-1c. J. Neurosci. Res. 72, 436–443.
Panhuysen, M., Vogt Weisenhorn, D.M., Blanquet, V., Brodski, C., Heinzmann, U., Beisker,
W., Wurst, W., 2004. Effects of Wnt1 signaling on proliferation in the developing
mid-/hindbrain region. Mol. Cell. Neurosci. 26, 101–111.
Peng, C., Fan, S., Li, X., Fan, X., Ming, M., Sun, Z., Le, W., 2007. Overexpression of Pitx3
upregulates expression of BDNFand GDNF in SH-SY5Y cells and primary ventralmes-
encephalic cultures. FEBS Lett. 581, 1357–1361.
Peng, C., Aron, L., Klein,R., Li, M., Wurst, W., Prakash, N., Le,W., 2011. Pitx3 is a criticalme-
diator of GDNF-induced BDNF expression in nigrostriatal dopaminergic neurons.
J. Neurosci. 31, 12802–12815.
Prakash, N., Brod ski, C., Naserke, T., Puelles, E ., Gogoi, R., Hal l, A., Panhuysen, M.,
Echevarria, D., Sussel, L., Weisenhorn, D.M., Martinez , S., Arenas, E., Simeone, A.,
Wurst, W., 2006. A Wnt1-regulated genetic network controls the identity and fate
of midbrain-dopaminergic progenitors in vivo. Development 133, 89–98.
Pruszak, J., Just, L., Isacson, O., Nikkhah, G., 2009. Isolation and culture of ventral mesen-
cephalic precursor cells and dopaminergic neurons from rodent brains. Curr. Protoc.
Stem Cell Biol. (Chapter 2, Unit 2D 5).
Rodriguez, M., Morales, I., Rodriguez-Sabate, C., Sanchez, A., Castro, R., Brito, J.M., Sabate,
M., 2014. The degeneration and replacement of dopamine cells in Parkinson's dis-
ease: the role of aging. Front. Neuroanat. 8, 80.
Sgado, P., Alberi, L., Gherbassi, D., Galasso, S.L., Ramakers, G.M., Alavian, K.N., Smidt, M.P.,
Dyck, R.H., Simon, H.H., 2006. Slow progressive degeneration of nigral dopaminergic
neurons in postn atal Engrailed muta nt mice. Proc. Na tl. Acad. Sci. U. S. A. 103,
15242–15247.
Simon, H.H., Saueressig, H., Wurst, W., Goulding, M.D., O'Leary, D.D., 2001. Fate of mid-
brain dopaminergic neurons controlled by the engrailed genes. J. Neuros ci. 21,
3126–3134.
Sonnier, L., Le Pen, G., Hartmann, A., Bizot, J.C., Trovero, F., Krebs, M.O., Prochiantz, A.,
2007. Progressive loss of dopaminergic neurons in the ventral midbrain of adul t
mice hetero zygote for Engrailed1. J. Neurosci. 27, 1063–1071.
Sulzer, D., Surmeier, D.J., 2013. Neuronal vulnerability, pathogenesis, and Parkinson's dis-
ease. Mov. Disord. 28, 41–50.
van Amerongen, R., Nusse, R., 2009. Towards an integrated view of Wnt signaling in de-
velopment. Development 136, 3205–3214.
Veenvliet, J.V., Smidt, M.P., 2014. Molecular mechanisms of dopaminergic subset specifi-
cation: fundamental aspects and clinical perspect ives. Cell. Mol. Life Sci. 71,
4703–4727.
Veenvliet, J.V., Dos Santos, M.T., Kouwenhoven, W.M., von Oerthel, L., Lim, J.L., van der
Linden, A.J., Koerkamp, M.J., Holstege, F.C., Smidt, M.P., 2013. Specification of dopami-
nergic subsets involves interplay of En1 and Pitx3. Development 140, 3373–3384.
Worlitzer, M.M., Viel, T., Jacobs, A.H., Schwamborn, J.C., 2013. The majority of newly gen-
erated cells in the adult mouse substantia nigra express low levels of Doublecortin,
but their proliferation is unaffected by 6- OHDA-induced nigral lesion or
Minocycline-mediated inhibi tion of neuroinflammation. Eur. J. Neurosci. 38,
2684–2692.
Zaborszky, L., Vadasz, C., 2001. The midbrain dopaminergic system: anatomy and genetic
variation in dopamine neuron number of inbred mouse strains. Behav. Genet. 31,
47–59.
Zhang, J., Giesert, F., Kloos, K., Vogt Weisenhorn, D.M., Aigner, L., Wurst, W., Couillard-
Despres, S., 2010. A powerful transgenic tool for fatemapping and functionalanalysis
of newly generated neurons. BMC Neurosci. 11, 158.
Zou, H.L., Su, C.J., Shi, M., Zhao, G.Y., Li, Z.Y., Guo, C., Ding, Y.Q., 2009. Expression of the
LIM-homeodomain gene Lmx1a in the postnatal mouse central nervous syste m.
Brain Res. Bull. 78, 306–312.
Zuccato, C., Cattaneo, E., 2009. Brain-derived neurotrophic factor in neurodegenerative
diseases. Nat. Rev. Neurol. 5, 311–322.
45J. Zhang et al. / Neurobiology of Disease 82 (2015) 32–45
