Phylogeography of the Sponge Suberites diversicolor in Indonesia: Insights into the Evolution of Marine Lake Populations

Abstract

The existence of multiple independently derived populations in landlocked marine lakes provides an opportunity for fundamental research into the role of isolation in population divergence and speciation in marine taxa. Marine lakes are landlocked water bodies that maintain a marine character through narrow submarine connections to the sea and could be regarded as the marine equivalents of terrestrial islands. The sponge Suberites diversicolor (Porifera: Demospongiae: Suberitidae) is typical of marine lake habitats in the Indo-Australian Archipelago. Four molecular markers (two mitochondrial and two nuclear) were employed to study genetic structure of populations within and between marine lakes in Indonesia and three coastal locations in Indonesia, Singapore and Australia. Within populations of S. diversicolor two strongly divergent lineages (A & B) (COI: p = 0.4% and ITS: p = 7.3%) were found, that may constitute cryptic species. Lineage A only occurred in Kakaban lake (East Kalimantan), while lineage B was present in all sampled populations. Within lineage B, we found low levels of genetic diversity in lakes, though there was spatial genetic population structuring. The Australian population is genetically differentiated from the Indonesian populations. Within Indonesia we did not record an East-West barrier, which has frequently been reported for other marine invertebrates. Kakaban lake is the largest and most isolated marine lake in Indonesia and contains the highest genetic diversity with genetic variants not observed elsewhere. Kakaban lake may be an area where multiple putative refugia populations have come into secondary contact, resulting in high levels of genetic diversity and a high number of endemic species.

Full text

Phylogeography of the Sponge
Suberites diversicolor
in
Indonesia: Insights into the Evolution of Marine Lake
Populations
Leontine E. Becking
1,2
*, Dirk Erpenbeck
3
, Katja T. C. A. Peijnenburg
1,4
, Nicole J. de Voogd
1
1 Naturalis Biodiversity Center, Department Marine Zoology, Leiden, The Netherlands, 2 Institute for Marine Resources and Ecosystem Studies (IMARES), Maritime
Department, Den Helder, The Netherlands, 3 Department of Earth- and Environmental Sciences, Palaeontology & Geobiology & GeoBio-Center, Ludwig-Maximilians-
University, Munich, Germany, 4 Institute for Biodiversity and Ecosystem Dynamics (IBED), University of Amsterdam, Amsterdam, The Netherlands
Abstract
The existence of multiple independently derived populations in landlocked marine lakes provides an opportunity for
fundamental research into the role of isolation in population divergence and speciation in marine taxa. Marine lakes are
landlocked water bodies that maintain a marine character through narrow submarine connections to the sea and could be
regarded as the marine equivalents of terrestrial islands. The sponge Suberites diversicolor (Porifera: Demospongiae:
Suberitidae) is typical of marine lake habitats in the Indo-Australian Archipelago. Four molecular markers (two mitochondrial
and two nuclear) were employed to study genetic structure of populations within and between marine lakes in Indonesia
and three coastal locations in Indonesia, Singapore and Australia. Within populations of S. diversicolor two strongly
divergent lineages (A & B) (COI: p = 0.4% and ITS: p = 7.3%) were found, that may constitute cryptic species. Lineage A only
occurred in Kakaban lake (East Kalimantan), while lineage B was present in all sampled populations. Within lineage B, we
found low levels of genetic diversity in lakes, though there was spatial genetic population structuring. The Australian
population is genetically differentiated from the Indonesian populations. Within Indonesia we did not record an East-West
barrier, which has frequently been reported for other marine invertebrates. Kakaban lake is the largest and most isolated
marine lake in Indonesia and contains the highest genetic diversity with genetic variants not observed elsewhere. Kakaban
lake may be an area where multiple putative refugia populations have come into secondary contact, resulting in high levels
of genetic diversity and a high number of endemic species.
Citation: Becking LE, Erpenbeck D, Peijnenburg KTCA, de Voogd NJ (2013) Phylogeography of the Sponge Suberites diversicolor in Indonesia: Insights into the
Evolution of Marine Lake Populations. PLoS ONE 8(10): e75996. doi:10.1371/journal.pone.0075996
Editor: Roberto Pronzato, University of Genova, Italy, Italy
Received July 16, 2013; Accepted August 9, 2013; Published October 1, 2013
Copyright: ß 2013 Becking et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: L. Becking is supported by the Netherlands Organisation for Scientific Research (NWO) (ALW# 817.01.008; Rubicon# 825.12.007). K. Peijnenburg was
supported by NWO-VENI grant #863.08.024. Fieldwork in Indonesia was made possible through additional financial support of De Beukelaar- van der Hucht
Stichting, World Wildlife Foundation Netherlands-INNO Fund, the Schure-Beijerinck-Popping Fund of the Royal Dutch Academy of Science (KNAW), Conservation
International Ecosystem Based Management program (funded by The David and Lucile Packard Foundation), the Treub-Maatschappij Fund, the Leiden University
Fund (LUF)/Slingelands, Singapore Airlines, the A.M. Buitendijk Fund and the J.J. ter Pelkwijk Fund (Naturalis Biodiversity Center). The funders had no role in study
design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: lisa.becking@naturalis.nl
Introduction
It has long been hypothesized that marine species have large
geographic ranges with large population sizes, and are faced with
weaker barriers to dispersal than terrestrial organisms, thus
resulting in relatively slow rates of speciation (e.g. [1]). The
assumed presence of circum-tropical species has supported this
view. However, recent phylogeographic and population genetic
studies on marine taxa portray a situation of ecologically
heterogeneous environments on small spatial scales with several
morphologically cryptic species instead of cosmopolitan species
(e.g. [2,3,4,5,6,7,8]). These results suggest that there may be many
more barriers to dispersal at small spatial scales than we are able to
observe [1,9,10]. The existence of multiple independently derived
populations in landlocked marine lakes provides an opportunity
for fundamental research into the role of isolation in population
divergence and speciation in marine taxa [11]. Marine lakes are
anchialine systems, which are landlocked water bodies that
maintain a marine character through narrow submarine connec-
tions to the sea (Fig. 1; [12]). The marine lakes share many
characteristics with island systems [13]: they are well-defined
geographically [14,15,16], harbor unique biota with high ende-
mism and/or an abundance of species rare that are elsewhere
[16,17,18,19,20,21], and isolated populations [11,22,23]. The
marine lakes in the Indo-Pacific were formed less than 12,000
years ago [13,24], yet their biodiversity is unique. Consistent with
island biogeography theory [25,26,27] larger lakes harbor more
species than smaller ones and the most isolated lakes contain the
highest number of putative endemics, while the more connected
lakes are dominated by reef species [15,16,19]. The degree of
isolation thus appears to influence the species diversity within the
lakes. In the present study our overall aim was to obtain insight
into the role of isolation on the genetic diversity of marine lake
populations.
Phylogeographic studies of anchialine systems across the world
typically show high levels of genetic differentiation between marine
PLOS ONE | www.plosone.org 1 October 2013 | Volume 8 | Issue 10 | e75996

lake populations, suggesting little to no gene flow at small spatial
scales ranging from 10 to 100 km (Table 1). Furthermore,
molecular markers revealed the presence of highly divergent, but
morphologically cryptic species in a number of taxa such as
cnidarians, crustaceans, fish and mollusks [11,22,23,
28,29,30,31,32]. There are, however, exceptions to this general
pattern, which have been interpreted as resulting from life history
strategies involving greater dispersal capabilities [33] or too limited
sampling [34].
Here we have conducted the first phylogeographic study of
Indonesian marine lake populations. The sponge species Suberites
diversicolor [Porifera: Demospongiae: Suberitidae] is an ideal taxon
to pursue this study as it allows comparison of multiple lakes at
various scales and with varying degrees of connection to the sea
(Fig. 1b). There are few other species that are prevalent in marine
lakes [16]. Suberites diversicolor occurs in most moderately to highly
isolated marine lakes in Indonesia [16], as well as in limited
numbers of small populations in sheltered bays in Singapore,
Indonesia and Australia [35]. This species shows great plasticity in
adapting to harsh environments (low salinity and exposure to air)
yet is absent in coral reefs [16,19,36,37]. Sponges are one of the
most dominant taxa in marine lakes in terms of biomass and
species diversity [16,17]. Recent comprehensive studies of sponge
assemblages of marine lakes, coastal mangroves and coral reefs in
Berau (East Kalimantan, Indonesia; Fig. 2) indicated that these
lakes harbor a significantly different assemblage consisting of a
subset of the fauna of the adjacent sea [21,36]. Particularly the lake
Kakaban harbors almost 33% of species not present in the
surrounding [21]. The specific aims of this study were: 1) to
estimate levels of diversity and divergence of seven marine lake
populations and three coastal populations using two mitochondrial
and two nuclear markers, 2) to study the phylogeography of S.
diversicolor populations in marine lakes across Indonesia, 3) to
investigate possible relationships between genetic diversity and the
level of isolation of the lakes.
Materials and Methods
Permits
Indonesia: to L. Becking East Kalimantan IN 2008&2009:
0094/frp/sm/v/2009 and 1810/FRP/SM/VIII/2008; West Pa-
pua in 2011: 098/SIP/FRP/SM/V/2011.
Singapore: Singapore National Biodiversity Center collection
permit to S.C. Lim,
Australia: Museum and Art Gallery of the Northern Territory
permit to B. Alvarez.
Sampling
Twenty four marine lakes and adjacent coastal habitats in
Indonesia were thoroughly surveyed by snorkeling for the presence
of the sponge Suberites diversicolor. Populations of Suberites diversicolor
were located in seven marine lakes (29% of all surveyed lakes) in
the region of Berau, East Kalimantan province (Kakaban lake,
Haji Buang lake, Tanah Bamban lake) and the regions of
Northern Raja Ampat (Cassiopeia lake, Urani lake, Sauwandarek
lake) and Southern Raja Ampat (Misool Jellyfish lake) in West
Papua province, and in mangroves along the coast of the island of
Maratua in the region of Berau, East Kalimantan province (Fig. 2).
Additional coastal populations were sampled from Johor Straight
in Singapore (collected by S.C. Lim) and the man-made open
Lake Alexander in Darwin, Australia (collected by B. Alvarez),
resulting in a total of seven marine lake populations and three
coastal populations sampled for this study (Fig. 2). The lakes
Kakaban, Tanah Bamban, Haji Buang and Misool house
immense perennial populations of the jellyfish Mastigias papua such
as those that have been extensively documented in five marine
lakes in Palau. For a full description of the sampled marine lakes,
Figure 1. A Suberites diversicolor purple color morph. B Landlocked
marine lakes in Raja Ampat Indonesia.
doi:10.1371/journal.pone.0075996.g001
Table 1. Overview of published genetic variation in populations within anchialine systems.
Anchialine
system Location Taxon Marker(s) Structure
Scale of
differentiation Reference
Lake Palau Mastigias papua mtDNA COI & nDNA ITS each lake private haplotypes 1–50 km [11,59]
Lake Palau Brachidontes sp. mtDNA COI divergent species; each lake private
haplotypes
1–50 km [22]
Lake Palau Sphaeramia orbicularis mtDNA control region lakes reduced diversity private
haplotypes
1–50 km [23]
Pool Hawaii island Holocaridina rubra mtDNA COI each pool private ha plotypes 30–50 km [28]
Pool Hawaii Archipelago Halocaridina rubra mtDNA COI each pool private haplotypes 10–50 km [29]
Pool Maui &Hawaii Halocaridina rubra mtDNA COI each pool private haplotypes 1–100 km [94]
Pool Hawaii Archipelago Metabenaeus lohena mtDNA COI panmixia 25–300 km [33]
Cave Philippines Neritilia cavernicola mtDNA COI panmixia 200 km [34]
Cave Australia Stygiocaris lancifera mtDNA COI 16S divergent species 10–100 km [30]
Cave Spain Metacrangonyx longipes mtDNA COI 16S histone divergent species 20–100 km [32]
Cave Mexico Creaseria morleyi mtDNA COI 16S divergent populations 10–100 km [31]
doi:10.1371/journal.pone.0075996.t001
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 2 October 2013 | Volume 8 | Issue 10 | e75996

Figure 2. A Sample locations of the sponge Suberites diversicolor: top three maps represent distribution and frequencies of haplotypes for partial
Cytochrome Oxidase I (COI) and bottom three maps of genotypes of internal transcribed spacer region (ITS) in Indonesia Singapore and Australia with
insets of Berau (East Kalimantan left) and Raja Ampat (West Papua right) in Indonesia; location codes are explained in Table 2; circles represent marine
lakes and squares are coastal populations; haplo/genotypes are indicated by number code (COI: C1-4 and ITS: T1-9) and color codes as provided in B.
Note that scale differs per map. B Bayesian/maximum likelihood phylogram of 105 COI sequences (right) and 104 ITS sequences (left); each haplo/
genotype indicated by specific color followed by location code and total number of samples in squared brackets. Only posterior probabilities of .90
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 3 October 2013 | Volume 8 | Issue 10 | e75996

see Becking et al. [16]. The number of marine lakes worldwide is
estimated at approximately 200 with clusters of ten or more lakes
occurring in areas with a karstic limestone landscape such as
Croatia, Bermuda, Vietnam, Palau, and Indonesia [20]. The lakes
are formed in natural inland depressions and are subjected to a
tidal regime, which is typically delayed in phase (ranging from 20
minutes to 4 hours) and dampened in amplitude (tide ranging
from 20 cm to 1.5 m) compared to the adjacent sea [16,17]. The
level of obstruction of water exchange, i.e. the degree of isolation,
differs per lake as does the salinity and environmental regimes
within the lakes [14,16]. The relative degree of isolation of each
marine lake is provided in Table 2.
Collections were made randomly along the entire coastline of
each of the lakes and specimens were collected at least 25 m
distance from each other to avoid collecting clone siblings. Our
aim was to collect 20 individuals per location, but in most locations
the resident population size was too small to attain this target (see
Table 2). Hence, sample sizes are small for some locations. The
color and substrate of each specimen was recorded, and a
photograph was taken either in situ or within 2 hours after
collection. After collection, portions of the choanosome were cut
into approximately 125 mm
3
cubes, avoiding the surface to
minimize potential contamination with protists or other sponge
associates, and preserved in 96% ethanol, which was refreshed
after 24 hours. The remainder of the samples were preserved in
70% ethanol and deposited in the Porifera collection of the
Naturalis Biodiversity Center, The Netherlands (RMNH POR.) as
voucher specimens. The investigated specimens are listed in the
Appendix A.
DNA Extraction, Amplification and Sequ encing
Total DNA was extracted from 105 specimens using DNeasy
tissue kit (Qiagen), following the instructions of the manufacturer.
Partitions of four markers were amplified: two mitochondrial
genes, cytochrome oxidase subunit 1 (COI) and subunit 2 (COII),
and two nuclear markers, the nuclear ribosomal operons consisting
of partial 18S rDNA, full-length internal transcribed spacer 1 and
2, 5.8S, and partial 28S rDNA fragments (ITS) and the D3–D5
region of the nuclear ribosomal 28S gene (28S). The nuclear
markers are independent from the mitochondrial markers and
therefore provide extra support in case of congruent results.
The standard DNA-barcoding fragment of COI was amplified
by using a specific forward primer designed for Suberites SUB-COI-
F: GGAATGATCGGGACAGCTTTTAGCATG and a degen-
erated reverse primer from Folmer et al. [38] designed by Meyer
et al. [39]: dgHCO2198: TAA ACT TCA GGG TGA CCA AAR
AAY CA. COII was amplified with the primers from Rua et al.
[40]: CO2F: TTTTTCACGATCAGATTATGTTTA and
CO2R: ATACTCGCACTGAGTTTGAATAGG. ITS amplified
with primers from Wo¨rheide (1998) RA2: GTCCC-
TGCCCTTTGTACACA and ITS2.2: CCTGGTTAGTTTCT-
TTTCCTCCGC. 28S was amplified in a subset of samples with
primers from McCormack and Kelly (2002) RD3A:
GACCCGTCTTGAAACACGA and RD5B2: ACACACTCCT-
TAGCGGA. Amplifications were carried out in 25
ml reaction
volumes containing 5
ml PhireH Reaction Buffer,3 ml dNTPs
(1 mM), 0.625
ml of each primer (10 mM), 0.25 ml PhireH Hotstart-
Taq polymerase DNA (Thermo Scientific, Finnzymes), and 1
mlof
DNA (10–20 ng/
ml). The temperature regime for amplification:
94uC for 30 s; followed by 35 cycles of 94uC for 5 s; 50uC for 5 s;
72uC for 12 s; followed by 72uC for 1 min. PCR products were
purified and sequenced by Macrogen Inc (Korea and The
Netherlands).
Data Analysis
The poriferan origin of the obtained sequences was verified
through BLAST searches against Genbank (http://blast.ncbi.nlm.
nih.gov/Blast.cgi). Sequences were handled in SEQUENCHER
4.10.1 (Gene Codes Corporation) and aligned with CLUSTALW
and MUSCLE as implemented in DAMBE [41] and SEAview v
4.3.0 [42]. Alignment was conducted under default settings and
optimized by eye. Alignments were collapsed to contain only
unique sequence types in DAMBE. Haplo-/genotypes and
nucleotide diversity as well as Tajima’s D neutrality test were
calculated per population with Arlequin v. 3.11 [43].
Phylogeographic analyses were carried out for COI and ITS.
We used ITS outgroup sequences obtained from Genbank from
the family Halichondriidae (Figure 1), as the available sequences
for ITS of other Suberitidae were more distant than those from
Halichondriidae. Several studies have shown that the families
Suberitidae and Halichondriidae are sister groups [44,45,46]. To
be consistent we also used species of the family Halichondriidae for
the outgroup of the COI phylogram. The relatively best-fit DNA
substitution model was selected by the Akaike Information
Criterion deployed in jMODELTEST v. 0.1.1 [47] and this
model (COI: HKY and ITS: GTR +G+I) was used for subsequent
Bayesian and maximum likelihood phylogeny inferences. Phylo-
genetic reconstructions were performed under Bayesian inference
criteria implemented in MrBayes v. 3.1.2. [48]. Each analysis
consisted of two independent runs of four Metropolis-coupled
Markov-chains, sampled at every 1,000
th
generation at the default
temperature (0.2). Analyses were terminated after the chains
converged significantly as indicated by an average standard
deviation of split frequencies ,0.001. Convergence was also
checked in Tracer v. 1.5.0 [49]. For comparison, maximum
likelihood bootstrap analyses were conducted using MEGA v. 5.01
[50] using a heuristic search with 1,000 bootstrap replicates. The
Bayesian and maximum likelihood phylograms were combined
and visualized using TreeGraph 2 [51]. Within group p-distance
(uncorrected), as well as net nucleotide divergence between groups
were calculated in MEGA. A Kruskall-Wallis test was performed
to test whether color or substrate preference significantly differed
between lineages. To test for spatial structuring of samples we
performed an analysis of molecular variance (AMOVA) and
calculated pairwise Wst values between separate populations using
Arlequin 3.5.1.2 [43]. Significance of pairwise Wst values (based on
p-distances) was determined by 10,000 permutations and exact
tests of population differentiation in Arlequin.
Results
Sequence variation (COI, COII, ITS, 28S)
All sequences were submitted to GenBank with accession
numbers KF568951-KF568965 (Table S1). We obtained final
alignments (excluding primers) for the sponge S. diversicolor of
519 bp for COI with four haplotypes (C1-4, 105 individuals,
KF568960 - KF568963), 331 bp for COII with one haplotype
(105 individuals, KF568964), 689 bp of ITS with nine genetic
and maximum likelihood values of .70 are indicated. Color blocks represent the same individuals for both molecular markers (i.e. lineage A (pink)
and B (green) represented by the same individuals with both COI and ITS markers). Species of the family Halichondriidae were used for the outgroup
followed by Genbank accession numbers. Scale bars indicate substitutions/site.
doi:10.1371/journal.pone.0075996.g002
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 4 October 2013 | Volume 8 | Issue 10 | e75996

Table 2. Sample locations of ten Suberites diversicolor populations from marine lakes and coastal locations in Berau (East Kalimantan) and Raja Ampat (West Papua) in Indonesia,
Darwin in Australia, and Singapore.
Code
Location Region Latitude Longitude Connection
density
S.diversicolor
(ind. 50m
2
)
color morphs
S.diversicolor
nCOI nITS nCOII n28S
Size lake
(1000 m
3
)
Lake
KKB Kakaban lake Berau N02u 089 23.50 E118u 309 31.90 most isolated 15-Jan green red 22 21 21 5 4000
HBL Haji Buang lake Berau N02u 129 30.40 E118u 359 40.80 isolated 15–50 green, red, blue,
purple, yellow
20 20 20 2 140
TBB Tanah Bamban lake Berau N02u 139 50.00 E118u 349 50.70 least isolated 0–2 4 4 4 2 120
green, red
RAJ Sauwandarek lake Raja Ampat S0u 359 19.60 E130u 359 48.80 very isolated 0–10 purple, blue green 21 21 21 2 84
CAS Cassiopeia lake Raja Ampat N0u 089 36.60 E130u 049 39.80 least isolated 0–10 green 10 10 10 2 13
URA Urani lake Raja Ampat N0u 069 05.10 E130u 159 05.50 isolated 0–2 green 8 8 8 1 68
MIS Misool Jellfish Lake Raja Ampat S01u 559 E130u 209 isolated 0–2 green 7 7 7 1 12
Coastal
BER Maratua mangrove Berau N02u 129 52.30 E118u 359
34.10 open 0–1 green,yellow 3 3 3 1
DAR Lake Alexander Darwin Australia S12u 259 E130u 509 open 0–1 green 6 6 6 2
SIN Johor Strait Singapore N 01u 26902.340 E104u02954.310 open 0–1 purple, blue, green 4 4 4 2
Per locality relative connection to the adjacent sea is provided and for the marine lake size. In addition the density of the target sponge species Suberites diversicolor color morphs and number of samples per genetic marker (COI,
COII, 28S, ITS) is provided per location.
doi:10.1371/journal.pone.0075996.t002
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 5 October 2013 | Volume 8 | Issue 10 | e75996

variants (T1-9, 104 individuals, KF568951- KF568959) (Table 2,
Table S1). For a subset of 20 specimens we obtained 574 bp for
28S resulting in one genetic variant (KF568965).
Divergent lineages in S. diversicolor
COI and ITS sequences were obtained from the same
specimens and fall apart into two major lineages, termed A and
B (Fig. 2B). These lineages represented reciprocally monophyletic
groups for both markers and were strongly supported by both
Bayesian and maximum likelihood inference methods (Fig. 2B).
Lineage A was represented by haplotype C1 for COI and
genotypes T1-5 for ITS. Lineage B is represented by COI
haplotypes C2-4 and ITS genotypes T6-9 (Fig. 1B). Within lineage
A there was no sequence variation in COI (n = 14), while the
average p-distance within lineage B was 0.25% (n = 91). The net
nucleotide divergence between lineage A & B for COI was 0.38%.
Haplotype C1 (lineage A) differed by two basepairs from C2 (the
dominant haplotype from lineage B) of which one resulted in a
non-synonymous substitution between two unpolar amino acids,
from isoleucine to valine. For ITS the average p-distance within
lineage A was 0.44% (n = 13), while the average p-distance within
lineage B was 0.29% (n = 91). The net nucleotide divergence
between lineages A & B for ITS was 7.26%. Several indels of 1–
3 bp length were observed and were consistent within lineages and
differed between lineages. There were insertions in lineage A with
respect to lineage B from 102–103 bp (either CT or TT), 380–
381 bp (CA), 470–473 bp (GGA or GAA). There were gaps in
lineage A with respect to lineage B from 139, 178–180, 549–
555 bp. No double peaks were observed, and it we therefore
assumed that no intragenomic polymorphisms occur within this
species. The level of intragenomic polymorphisms differs per
species [52]. We consider the risk of analyzing paralogous rDNA
sequence types to be minimal as we see genealogical concordance
across two unlinked loci. We did not detect a significant difference
between lineage A & B in color (p = 0.249) or substrate preference
(p = 0.100) using the independent samples Kruskal-Wallis Test.
Diversity and spatial population structuring (COI & ITS)
Lineage A was only present in Kakaban lake while lineage B
was present in all populations. The geographical distribution of
COI haplotypes is shown in Fig. 2A. Of the four detected
haplotypes in COI, haplotype C1 was restricted to Kakaban lake
(East Kalimantan). Haplotype C3 only occurred in one individual
in Urani lake (West Papua). The Darwin population was
represented by haplotype C4, which was shared with no other
population. Haplotype C2 was the most abundant haplotype,
occurring in all populations except Darwin and was the dominant
haplotype in the populations of Berau mangroves, Singapore,
Sauwandarek lake, Cassopeia lake, Urani Lake, and Misool
Jellyfish lake. Of the nine detected genotypes of ITS, five were
restricted to Kakaban lake (genotypes T1-5), which are all
representatives of lineage A. Genotype T7 (lineage B) was the
most abundant and was shared by all sampled populations except
Haji Buang Lake and Tanah Bamban lake (Kalimantan) and
Darwin (Australia). Darwin was represented by the private
genotypes T8-9. Haji Buang lake and Tanah Bamban lake
harbored a single genotype (T6) that was shared by Kakaban lake
(Kalimantan) and Misool Jellyfish lake (Papua).
Within lineage A in Kakaban lake there was only a single
haplotype of COI while the ITS gene diversity was 0.8242+/-
0.0567, and ITS nucleotide diversity was 0.005656+/- 0.003392.
Within lineage B all populations contained a single COI haplotype
except Urani lake, which had two haplotypes with a haplotype
diversity of 0.3333+/2 0.2152 and nucleotide diversity of
0.000624+/2 0.000822. For ITS, the majority of the populations
contained only a single genotype, except for Kakaban lake,
Darwin and Misool Jellyfish lake. The population in Kakaban lake
had the highest gene and nucleotide diversity in lineage B,
followed by Darwin and Misool Jellyfish lake (Table 3). Tajima’s D
tests of neutrality were carried out per population. The majority of
the populations had a zero value due to the presence of only one
genetic variant. Values of Tajima’s D for ITS were negative, but
not significant (p.0.1) in Misool lake and Darwin (Table 3).
Spatial analysis of genetic structure of lineage B COI and ITS
sequences showed that the Darwin population was strongly (Wst
between 0.53–1) and significantly differentiated from all marine
lakes populations (Table 4 & Table S2). Besides Darwin there was
no significant differentiation in COI between the different
populations (Table S2). The ITS marker was more diverse and
showed more structure among the populations than COI (Fig. 1,
Table 3). The Berau lakes (East Kalimantan), Kakaban and Haji
Buang lakes were all significantly differentiated. The Raja Ampat
lakes (West Papua) were not genetically differentiated from each
Table 3. Genetic diversity indices based on ITS sequences per population of Suberites diversicolor of lineage A and B (location
codes indicated in Table 2); gene diversity (h) nucleotide diversity (p) Tajima’s D neutrality test.
Code Lineage n ITS
h
ITS p ITS Tajima’s D
KKB A 13 0.8242+/20.0567 0.005656+/20.003392 1.3927
KKB B 8 0.5357+/20.1232 0.001578+/20.001318 1.4488
HBL B 20 0 0 0
TBB B 4 0 0 0
RAJ B 21 0 0 0
CAS B 10 0 0 0
URA B 8 0 0 0
MIS B 7 0.2857+/20.1964 0.000842+/20.000879 21.23716
BER B 3 0 0 0
SIN B 4 0 0 0
DAR B 6 0.3333+/20.2152 0.000980+/20.000997 21.13197
The majority of populations had only one haplotype resulting in 0 values for all indices calculated. All Tajima D values are not significant.
doi:10.1371/journal.pone.0075996.t003
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 6 October 2013 | Volume 8 | Issue 10 | e75996

other except Misool, which was differentiated from all Raja Ampat
lakes, yet not from the populations of the lakes Kakaban, Haji
Buang and Tanah Bamban (East Kalimantan). The AMOVA
analyses revealed that significant portions of the total variance
within lineage B can be attributed to differences among the
following three groups 1. Berau coast, Singapore coast, Northern
Raja Ampat lakes (Sauwandarek, Cassopeia, Urani), 2. Berau
lakes (Kakaban, Tanah Bamban, Haji Buang), Southern Raja
Ampat (Misool), 3. Darwin. The among group variation was
84.6% (p,0.001) and the within population variation was 10%
(p,0.001).
Discussion
Divergent lineages in S. diversicolor
Two major lineages were uncovered in the populations of the
sponge S. diversicolor. The congruent patterns of COI and ITS
genetic markers and the degree of divergence between the two
lineages (COI: 0.4% and ITS: 7.3%) are indicative of reproductive
isolation, and thus we suggest that the two lineages (A and B)
constitute different species. We searched for morphological and
ecological characters to distinguish the two lineages, but did not
find any. Genetic divergence can preclude morphological or
ecological distinction. The skeletal structure and spicule lengths do
not differ between lineages and fall within the natural variation of
this species (see also [35]). The color and substrate preference are
variable, but not consistent within a particular lineage. A related
Suberites from Satonda lake (Sumbawa, Indonesia) displays different
colors at different depths as a result of a symbiosis with the
unicellular green algae Chlorella and symbiotic bacteria [53].
Phylogeographic studies in the Indo-Australian-Archipelago have
uncovered numerous lineages in marine taxa that may represent
undescribed cryptic species (e.g. [3,6,54]). Within sponges,
molecular studies have revealed a high prevalence of morpholog-
ically cryptic sponge species (see review in [8,55]).
The divergence between lineage A and B points to a long
isolation in spite of the fact that they are sympatric in Kakaban
lake (East Kalimantan). Within sponges there are several reports of
sympatric cryptic species: Tedania spp. in mangroves [56], Scopalina
lophyropoda [57], Cliona spp. [8], and Hexadella spp. [7]. Differential
reproductive traits and output can promote the co-existence of
sibling species (e.g. [57,58]). This observation of divergent lineages
in one lake is, however, not common in the phylogeographic
studies conducted thus far on populations in the marine lakes in
Palau [11,22,23,59]. The Palauan studies on three distinct taxa
(jellyfish, fish and bivalves) mostly show a pattern of one lineage
occupying one lake [11,22,23,59]. One reason why Kakaban lake
may contain two lineages is the sheer size of the lake – at almost
4km
2
it is tenfold larger than any of the other marine lakes in
Indonesia and the majority of Palau (Table 2; [15,16]). Alterna-
tively, lineage B could be a recent introduction to the lake. Sponge
fragments are known to be transported by waterfowl [60] and
workers from the neighboring island Maratua who stay on
Kakaban for short periods to attend small crops may also act as
possible vectors of Suberites diversicolor from the Maratua lakes or the
mangroves near their village.
Phylogeography
Lineage A is only present in Kakaban lake, while lineage B is
present in all populations. Within lineage B the spatial genetic
structure shows three groups: 1. the three Berau lakes and
southern Raja Ampat lake, 2. Berau coast, Singapore coast and
the three northern Raja Ampat lakes, 3. Darwin, Australia. At
present there is no comprehensive phylogeographic study of
sponges spanning the Indonesian archipelago, yet pronounced
genetic differences in populations of other marine invertebrates
and vertebrates are present between the Java Sea, the Indonesian
Through Flow, and the seas of East Sulawesi [3,5,9,61,62]. The
marine phylogeographic patterns of these studies strongly support
the existence of a barrier in the area between the Sunda and Sahul
shelves, where populations from Kalimantan are genetically
isolated from those in Papua. Our data do not show such a clear
East to West phylogeographic break. The Darwin population of
the present study, though small in sample size, is genetically
differentiated from the other populations. This is consistent with
phylogeographic studies of sponges and other invertebrates that
show a barrier within the Torres Strait (e.g. [63,64]). Dispersal
potential and habitat specialization may determine how lineages
are distributed and how fauna of different geographic regions are
connected (e.g. [9]). Many sponge population genetic and
phylogeographic studies have revealed structured populations
with in some cases evidence of (occasional) long distance dispersal
events [65,66,67,68,69,70]. This pattern is congruent with
philopatric, shortlived larvae that recruit at short distances from
the parental locations [71,72], whilst at the same time the
possibility of sponges to disperse as viable fragments in the currents
or rafting on various floating material [73,74,75]. The reproduc-
tive cycle and larvae of S. diversicolor are unknown, but this species
Table 4. Pairwise Wst values between all populations of lineage B based on ITS sequences of Suberites diversicolor (location codes
indicated in Table 2).
KKB HBL TBB RAJ CAS URA MIS BER SIN
HBL 0.60591*
TBB 0.30435 0
RAJ 0.60591* 1* 1*
CAS 0.4702* 1* 1* 0
URA 0.42857 1* 1* 00
MIS 0.13514 0.16749 20.09804 0.91393* 0.86315* 0.84466*
BER 0.25 1* 1* 0000.76136*
SIN 0.30435 1* 1* 0000.78544* 0
DAR 0.53451* 0.9512* 0.86348* 0.83584* 0.74359* 0.71049* 0.77327* 0.55882 0.60396
Values in bold and with asterisk indicate significant values (p,0.05).
doi:10.1371/journal.pone.0075996.t004
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 7 October 2013 | Volume 8 | Issue 10 | e75996

does produce asexual buds [Becking pers. obs.] which may survive
a considerable amount of time in the plankton or by rafting before
colonizing distant locations as proposed by Wo¨rheide et al. [67] for
Leucetta chagosensis.
For lineage B we found no private haplotypes in any of the
Indonesian marine lakes, and many lakes were identical in
composition. The only other phylogeographic studies on marine
lakes have been in the islands of Palau on the jellyfish Mastigias
papua [11;59], the fish Sphaeramia orbicularis [22], and the mussel
Brachidontes sp. [23] (see Table 1). These studies show extreme
genetic isolation, low genetic diversity, and in the cases of Mastigias
papua and Brachidontes sp. rapid morphological evolution in the
marine lakes [11,22,23,59]. The lack of strong population
structure between many of the Indonesian lakes of the present
study may be caused by recurrent (recent and historic) gene flow
among lakes. Alternatively, it is still possible that all these lakes are
completely isolated, i.e. do not exchange any migrants, but that
the lack of structure may be a result of the markers we used. These
markers may not evolve fast enough for mutations to have
accumulated to show the recent divergence. Of the four molecular
markers used in the present study, ITS evolves the fastest and
provided the highest resolution of spatial genetic structure. The
difference in genetic diversity between COI and ITS is large. In
contrast to most animals the mitochondrial DNA of sponges
evolves slowly and generally slower than nuclear DNA [76,77].
The interspecific variation of COI in sponges can be as low as 0–
0.5% (p-distances) (e.g. [55,78,79]). However, in some sponge taxa
COI can provide low but sufficient genetic variation within species
over relatively short geographic distances [63,69,80].
We found no sequence variation in 28S and COII markers
between any of the populations or between the two lineages of S.
diversicolor. The D3–D5 region of the 28S fragment has been used
to distinguish genera and species of a wide range of demosponge
taxa including halichondrids [81,82], but was also reported too
conserved to discriminate between closely related species in other
sponge taxa [7]. COII was proposed as a polymorphic mitochon-
drial marker for sponge phylogeography by Rua et al. [40]. Rua et
al. [40] indicated that the variation of this marker could be low in
halichondrid species Hymeniacidon heliophila but attributed their
results to the collection of clone-mates. In the present study COII
showed no variation between any of the samples spanning a wide
geographic range. We conclude that COII is not a suitable marker
for intraspecific variation or distinction between closely related
species of the genus Suberites in particular, and probably more
generally for the families Suberitidae and Halichondriidae.
Isolation & genetic diversity
Kakaban lake is the largest and most isolated lake in Indonesia
(see Table 2), and it houses a high proportion of endemic sponge
species [16,21]. In concordance, our study shows that the
population of Suberites diversicolor displayed the highest genetic
diversity with unique genetic variants that were not shared with
two marine lakes at just 6 km distance (Fig. 1). These results
indicate that Kakaban lake is very isolated both in physical and
biological terms. Isolation acts to decrease the rate of immigration
and thus to decrease the genetic diversity and the number of
species expected at equilibrium in an island system [25,26,27,83].
Yet isolation can also enhance species formation, with the
diminished gene flow allowing populations to diverge and
ultimately form new species if they remain isolated [17,27,83].
In Palau the degree of genetic distance between marine lake and
adjacent sea populations was strongly correlated with the degree of
connection from the lake to the sea and not the actual geographic
distance between the populations [11,23]. In the present study, the
molecular markers used were not variable enough to detect a
relationship between moderate levels of isolation and the genetic
diversity of the lakes. For example, the populations in northern
Raja Ampat lakes (West Papua) are not genetically differentiated,
despite the limited physical connections to each other and to the
adjacent sea.
Biogeographic scenario
Kakaban lake was probably filled with sea water less than
12,000 years ago [13,24]. Considering the deep divergence
between lineages A & B in this lake, this divergence likely
occurred well before the formation of Kakaban. Wo¨rheide et al.
[52] estimated an evolutionary rate of 1% per million years for
ITS in a suberitid sponge Prosuberites ‘laughlini’ based on the
formation of Isthmus of Panama. Implementing the 1%
mutational rate would mean that the two lineages diverged
approximately 7 million years ago. Though this is a rough
estimation with great error bars and rates of evolution may be
higher for recently diverged lineages [84], the age is consistent
with recent phylogeographic studies that suggest that many
endemics from the Indo-Australian-Archipelago have origins in
the early Pliocene-Miocene (3–20 million years ago; e.g.
[85,86,87]).
Kakaban lake houses a genetic and species diversity of sponges,
that appears to be absent from the surrounding sea (see also
[21,36]). Each lake is ephemeral, but the marine lakes ecosystem
probably has occurred in various locations during the past glacial-
cycles [24]. The Sunda shelf, which includes Borneo (Kalimantan),
was exposed during the Last Glacial Maximum (LGM) when sea
levels are estimated to have been approximately 110–140 m
lower than modern se a levels [88,89,90]. Multiple larger and
smaller depressions in the shelf have been recorded which
presumably represented palaeo-lakes during the LGM [24] that
could have become brackish marine lakes with the increase in
sea level. Durin g the LGM the Sunda Land regio n was also
dominated by mangro ves [91], a nd the w ater around the Sunda
area would have been brackish due to the multiple river outlets
[90]. These are both environments amenable for S. diversicolor.
Ancient lineages/endemics may h ave ‘hopped’ from lake to lake
or from mangrove to lake, a s the la kes formed and subs equently
disappearedwiththeriseandfallinsealevelduringthePlio-
Pleistocene glacial cycles. Genetic signatures of glacial refugia
are expected to be characterized by high genetic diversity and a
mixture of ancestral and private haplotypes [92,93]. While
Kakaban matches this pattern, the lake could not have been a
refugium during LGM (it was dry), however there may have
been palaeo-lakes in the vicinity that served as such. Kakaban
may be an area where multiple putative refugia populations
have come into secondary contact, resulting in the high genetic
diversity and the high number of endemics. Molecular studies
on co-distributed taxa at larger scales including lakes from
adjacent regions in Palau and Vietnam will enhance our
understanding of the processes behind the unique marine lake
diversity.
Supporting Information
Table S1 List of Suberites diversicolor specimens studied. For each
specimen the following information is provided: lineage to which it
belongs (see Fig. 2) haplotype of Cytochrome Oxidase I (COI)
GenBank Accession Number for the COI haplotype genotype of
internal transcribed spacer region of nuclear ribosomal operons
(ITS) GenBank Accession Number for ITS genotype location of
collection (location codes indicated in Table 2) the color when
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 8 October 2013 | Volume 8 | Issue 10 | e75996

alive substrate it resided on collection number within the Porifera
Collection of the Naturalis Biodiversity Center (RMNH POR).
(XLSX)
Table S2 Pairwise Wst values between all populations of the
sponge Suberites diversicolor lineage B based COI of Suberites
diversicolor (location codes indicated in Table 2). Values in bold
and with asterisk indicate significant values (p,0.05).
(XLSX)
Acknowledgments
M. Ammer and B. Hoek sema we re inv aluable so urces o f information for
the fieldwork. We would also li ke to thank the following people for their
help with logistics of the fieldwork and samples: Suharsono, Y. Tuti, C.
Huffard, M. Erdmann, S. Manugbai, Bahruddin, Estradivari, N.
Santodomingo,E.Dondorp,W.Renema,B.Alvarez,S.-C.Lim,and
the staff of TNC/WWF Berau Office, of Nabucco Island Dive Resort, of
Derawan D ive Resort, of Conservation International Wayag station,
and of The Nature Conservancy Misool station. We are grateful to the
following people who facilitated the laboratory work: G. Wo¨rheide, S.
Menken, H. Breeuwer, B. Voetdijk, P. Kupe rus. We are grateful to the
Indonesian Institute of Sciences (LIPI) and t he Indonesia n State
Ministry of Research and Technology (RISTEK) for providing research
permits in Indonesia. E. Gittenberger, W. Renema, C. Vogler, and two
anonymous reviewers provided valuable comments on th e original
manuscript.
Author Contributions
Conceived and designed the experiments: LEB DE KTCAP NJV.
Performed the experiments: LEB DE. Analyzed the data: LEB DE
KTCAP. Contributed reagents/materials/analysis tools: LEB DE NJV.
Wrote the paper: LEB DE KTCAP NJV.
References
1. Palumbi SR (1994) Genetics divergence reproductive isolation and marine
speciation. Annual Review of Ecology & Systematics 25: 547–72.
2. Knowlton N (2000) Molecular genetic analyses of species boundaries in the sea.
Hydrobiologia 420: 73–90.
3. Barber PH, Palumbi SR, Erdmann MV, Moosa MK (2002) Sharp genetic
breaks among populations of Haptosquilla pulchella (Stomatopoda) indicate limits
to larval transport: Patterns causes and consequences. Molecular Ecolo gy
11:659–674.
4. Peijnenburg KTCA, Breeuwer JAJ, Pierrot-Bults AC, Menken SBJ (2004)
Phylogeography of the planktonic chaetognath Sagitta setosa reveals isolation in
European seas. Evolution 58: 1472–1487.
5. Nuryanto A, Kochzius M (2009) Highly restricted gene flow and deep
evolutionary lineages in the giant clam Tridacna maxima. Coral Reefs 28: 607–
619.
6. Malay MCD, Paulay G (2010) Peripatric speciation drives diversification and
distributional pattern of reef hermit crabs (Decapoda: Diogenidae: Calcinus).
Evolution 64: 634–662.
7. Reveil laud J, Remerie T, van Soest R, Erpenbeck D, Ca´rdenas P, et al. (2010)
Species boundaries and phylogenetic relationships between Atlanto-Mediterra-
nean shallow-water and deep-sea coral associated Hexadella species (Porifera
Ianthellidae). Molecular Phylogenetics and Evolution 56: 104–114.
8. Xavier JR, Rachello-Dolmen P G, Parra-Velandia F, Schoenberg CHL,
Breeuwer JAJ, et al. (2010). Molecular evidence of cryptic speciation in the
‘‘cosmopolitan’’ excavating sponge Cliona celata (Porifera Clionaidae). Molecular
Phylogenetics and Evolution 56: 13–20.
9. Carp enter KE, Barber PH, Crandall ED, Ablan-Lagman CA, Ambariyanto
Mahardika GA, et al. (2011) Comparative phylogeography of the Coral Triangle
and implications for marine management. Journal of Marine Biology: Article ID
396982, doi:10.1155/2011/396982.
10. Peijnenburg KTCA, Goetze E (2013) High evolutionary potential of marine
zooplankton. Ecology and Evolution 3: 2765–2781.
11. Dawson MN, Hamner WM (2005) Rapid evolutionary radiation of marine
zooplankton in peripheral environments. Proceedings of the National Academy
of Sciences 102: 9235–9240.
12. Holthuis LB (1973) Caridean shrimps found in land-locked saltwater pools at
four Indo-West Pacific localities (Sinai Peninsula Funafuti atoll Maui and Hawaii
Islands) with the description of one new genus and four new species. Zoologische
Verhandelingen Leiden 128: 1–48.
13. Dawson MN (2006) Island evolution in marine lakes. JMBA Global Marine
Environment: 26–29.
14. Hamner WM, Hamner PP (1998) Stratified marine lakes of Palau (Western
Caroline islands). Physical Geography 19: 175–220.
15. Colin PL (2009) Marine environments of Palau. Indo-Pacific Press San Diego,
416.
16. Becking LE, Renema W, Santodomingo NK, Hoeksema BW, Tuti Y, et al.
(2011) Recently discovered landlocked basins in Indonesia reveal high habitat
diversity in anchialine systems. Hydrobiologia 677: 89–105.
17. Tomascik T, Mah AJ (1994) The ecology of ‘Halimeda lagoon’’: An anchialine
lagoon of a raised atoll Kakaban isla nd East Kalimantan Indonesia. Tropical
Biodiversity 2:385–399.
18. Tomascik T, Mah AJ, Nontji A, Moosa MK (1997) The Ecology of the
Indonesia Seas. Part II. Periplus Singapore, 752.
19. Azzini F, Calcinai B, Cerrano C, Bavestrello G, Pansini M (2007) Sponges of the
marine karst lakes and of the coast of the islands of Ha Long Bay (North
Vietnam). In: Custodia MR, Lobo-Hajdu G, Hajdu E, Muricy G, Porifera
research: Biodiversity innova tion and sustainability. Rio de Janeiro, 157–164.
20. Dawson MN, Martin LE, Bell LJ, Patris S (2009) Marine lakes. In: Gillespie R,
ClagueDA, Encyclopedia of islands. University of California Press Berkeley,
603–607.
21. Becking LE, Cleary DFR, de Voogd NJ (2013) Sponge species composition
abundance and cover in marine lakes and coastal mangroves of Berau Indonesia.
Marine Ecology Progress Series 481: 105–120.
22. Gotoh RO, Sekimoto H, Chiba SN, Hanzawa N (2009) Peripatric differentiation
among adjacent marine lake and lagoon populations of a coastal fish Sphaeramia
orbicularis (Apogonidae Perciformes Teleostei). Genes & Genetic Systems 84:
287–295.
23. Goto TV, Tamate HB, Hanzawa N (2011) Phylogenetic characteri zation of
three morphs of mussels (Bivalvia My tilidae) inhabiting isola ted marine
environments in Palau islands. Zoological Science (Tokyo) 28: 568–579.
24. Sathiamurthy E, Voris HK (2006) Maps of Holocene sea level transgression and
submerged lakes on the Sunda she lf. The Natural History Journal of
Chulalongkorn University Supplement 2: 1–44.
25. MacArthur RH, Wilson EO (1967) The theory of island biogeography.
Princeton University Press, 203.
26. Whittaker RJ, Fernandez-Palacios JM (2008) Island biogeography. Ecology
Evolution and Conserva tion. 2
nd
Edition Oxford University Press, 416.
27. Rosindell J, Hubbell SP, Etienne RS (2011) The unified neutral theory of
biodiversity and biogeography at age ten. Trends in Ecology & Evolution 26:
340–348.
28. Santos SR (2006) Patterns of genetic connectivity among anchialine habitats: A
case study of the endem ic Hawaiian shrimp Hal ocaridina rubra on the island of
Hawaii. Molecular Ecology 15: 2699–2718.
29. Craft JD, Russ AD, Yamamoto MN, Iwai TY, Hau S, et al. (2008) Islands under
islands: The phylogeography and evolution of Halocaridina rubra Holthuis 1963
(Crustacea: Decapoda: Atyidae) in the Hawaiian archipelago. Limnology and
Oceanography 53: 675–689.
30. Page TJ, Humphreys WF, Hughes JM ( 2008) Shrimps down under:
Evolutionary relationships of subterranean crustaceans from Western Australia
(Decapoda: Atyidae: Stygiocaris). PLoS ONE 3:e16181611–1612.
31. Botello A Alvarez F (2010) Genetic variation in the stygobitic shrimp Creaseria
morleyi (Decapoda: Palaemonidae) evidence of bottlenecks and re-invasions in the
Yucatan peninsula. Biologic al Journal of the Linnean Society 99: 315–325.
32. Bauza`-Ribot MM, Jaume D, Forno´s JJ, Juan C, Pons J (2011) Islands beneath
islands: Phylogeography of a groundwater amphipod crustacean in the Balearic
archipelago. BMC Evolutionary Biology 11: 221.
33. Russ A, Santos SR, Muir C (2010) Genetic population structure of an anchialine
shrimp Metabetaeus lohena (Crustacea: Alpheidae) in the Hawaiian Islands. Revista
de Biologia Tropical 58: 159–170.
34. Kano Y, Kase T (2004) Genetic exchange between anchialine cave populations
by means of larval dispersal: The case of a new gastropod species Neritilia
cavernicola. Zoologica Scripta 33: 423–437.
35. Becking LE, Lim SC (2009) A new Suberites (Demospongiae: Hadromerida:
Suberitidae) from the tropical Indo-West Pacific. Zoologische Mededelingen
(Leiden) 83: 853–862.
36. de Voogd NJ, Becking LE, Cleary DFR (2009) Sponge community composition
in the Derawan islands ne Kalimantan Ind onesia. Marine Ecology Progress
Series 396: 169–180.
37. Lim S-C, de Voogd NJ, Tan K-S (2009) Fouling sponges (Porifera) on navigation
buoys from Singapore waters. Raffles Bulletin of Zoology: 41–58.
38. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for
amplification of mitochondrial cytochrome c oxidase subunit I from diverse
metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–
299.
39. Meyer CP, Geller JB, Paulay G (2005) Fine scale endemism on coral reefs:
Archipelagic differentiation in turbinid gastropods. Evolution 59:113–125.
40. Rua CPJ, Zilberberg C, Sole-Cava AM (2011) New polymorphic mitochondrial
markers for sponge phylogeography. Journal of the Marine Biological
Association UK 91:1015–1022.
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 9 October 2013 | Volume 8 | Issue 10 | e75996

41. Xia X, Xie Z (2001) Dambe: Software package for data analysis in molecular
biology and evolution. Journal of Heredity 92: 371–373.
42. Gouy M, Guindon S, Gascuel O (2010) Seaview version 4: A multiplatform
graphical user interface for sequence alignment and phylogenetic tree building.
Molecular Biology and Evolution 27:221–224.
43. Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: A new series of programs
to perform population genetic s analyses under linux and windows. Molecular
Ecology Resources 10: 564–567.
44. Chombard C Boury-Esnault N Tillier S (1998) Reassessment of homology of
morphological characters in tetractinellid sponges based on molecular data.
Systematic Biology 47: 351–366.
45. Chombard C, Boury-Esnault N (1999) Good congruence between morphology
and molecular phylogeny of Hadromerida or how to bother sponge taxonomists.
Memoirs of Queensland Museum 44: 100.
46. Morrow CC, Picton BE, Erpenbeck D, Boury-Esnault N, Maggs CA, et al.
(2012) Congruence between nuclear and mitochondrial genes in Demospongiae:
A new hypothesis for relationships within the G4 clade (Porifera: Demospon-
giae). Molecular Phylogenetics and Evolution 62: 174–190.
47. Posada D 2008. Jmodeltest: Phylogenetic model averaging. Molecular Biology
and Evolution 25: 1253–1256.
48. Huelsenbeck JP, Ronquist F (2001) Mrbayes: Bayesian inference of phylogenetic
trees. Bioinformatics 17: 754–755.
49. Rambaut A, Drummond AJ (2007) Tracer v1.4 available from http://beast.Bio.
Ed.Ac.Uk/tracer.
50. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al. (2011) Mega5:
Molecular evolutionary genetics analysis using maximum likelihood evolutionary
distance and maximum parsimony methods. Molecular Biology and Evolution
28: 2731–2739.
51. Sto¨ver BC, Mu¨ller KF (2010) TreeGraph 2: Combining and visualizing evidence
from different phylogenetic analyses. BMC Bioinformatics 11: 7.
52. Wo¨rheide G, Nichols SA, Goldberg J (2004) Intragenomic variation of the
rDNA internal transcribed spacers in sponges (phylum Porifera): Implications for
phylogenetic studies. Molecular Phylogenetics and Evolution 33: 816–830.
53. Arp G, Reitner J, Wo¨rheide G, Landmann G (1996) New data on microbial
communities and related sponge fauna from the alkaline Satonda Crater Lake
(Sumbawa Indonesia). In: Reitner J Neuweiler F &GunkelF, : Global and
Regional Controls on Biogenetic Sedimentation. I. Reef Evolution. Research
Reports. - Go¨ttinger Arb. Geol. Pala¨ ont Sonderband 2: 1–7Go¨ttingen.
54. Crandall ED, Jones ME, Munoz MM, Akinronbi B, Erdmann MV, et al. (2008)
Comparative phylogeography of two seastars and their ectosymbionts within the
Coral Triangle. Molecular Ecology 17: 5276–5290.
55. Uriz MJ, Turon X (2012) Sponge ecology in the molecular era. Advances in
Marine Biology 61: 345–410.
56. Wulff JL (2006) Sponge systematics by starfish: Predators distinguish cryptic
sympatric species of Caribbean fire sponges Tedania ignis and Tedania klausi n. sp
(Demospongiae Poecilosclerida). Biological Bulletin 211: 83–94.
57. Blanquer A, Uriz M-J, Agell G (2008) Hidden diversity in sympatric sponges:
Adjusting life-history dynamics to share substrate. Marine Ecology Progress
Series 371: 109–115.
58. Pe´rez-Porro A-R, Gonza´lez J, Uriz MJ (2012) Reproductive traits explain
contrasting ecological features in sponges: The sympatric poecilosclerids
Hemimycale columella and Crella elegans as examples. Hydrobiologia 687: 315–33.
59. Dawson MN (2005) Five new subspecies of Mastigias (Scyphozoa: Rhizosto-
meae:Mastigiidae) from marine lakes Palau Micronesia. Journal of the Marine
Biological Association UK 85: 679–694.
60. Pronzato R, Manconi R (1994) Adaptive strategies of sponges in inland waters.
Bolletino di Zoologia 61: 395–401.
61. Barber PH, Palumbi SR, Erdmann MV (2006) Comparative phylogeography of
three co-distributed stomatopods: Origins and timing of regional lineage
diversification in the coral triangle. Evolution 60: 1825–1839.
62. Timm J, Kochzius M (2008) Geological history and oceanography of the Indo-
Malay archipelago shape the genetic population structure in the false clown
anemonefish (Amphiprion ocellaris). Molecular Ecology 17: 3999–4014.
63. Andreakis N, Luter HM, Webster N (2012) Cryptic speciation and phylogeo-
graphic relationships in the elephant ear sponge Ianthella basta (Porifera
Ianthellidae) from northern Australia. Zoological Journal of the Linnean Society
166: 225–235.
64. Vogler C, Benzie JAH, Tenggardjaja K, Barber PH, Wo¨rheide G (2013)
Phylogeography of the crown-of-thorns starfish: genetic structure within the
Pacific species. Coral Reefs 32: 515–525.
65. Wo¨rheide G, Hooper JNA, Degnan BM (2002) Phylogeography of western
Pacific Leucetta ‘chagosensis’ (Porifera: Calcarea) from ribosomal DNA sequences:
Implications for population history and conservation of the great barrie r reef
world heritage area (Australia). Molecular Ecology 11: 1753–1768.
66. Wo¨rheide G, Sole-Cava AM, Hooper JNA (2005) Biodiversity molecular ecology
and phylogeography of marine sponges: Patterns implications and outlooks.
Integrative and Comparative Biology 45: 377–385.
67. Wo¨rheide G, Epp LS, Macis L (2008) Deep genetic divergences among indo-
pacific populations of the coral reef sponge Leucetta chagosensis (Leucettidae):
Founder effects vicariance or both? BMC Evolutionary Biology 8:24.
68. Lopez-Legentil S, Pawlik JR (2009) Genetic structure of the caribbean giant
barrel sponge Xestospongia muta using the I3-m11 partition of COI. Coral Reefs
28: 157–165.
69. DeBiasse MB, Richards VP, Shivji MS (2010) Genetic assessment of connectivity
in the common reef sponge Callyspongia vaginalis (Demospongiae: Haplosclerida)
reveals high population structure along the Florida reef tract. Coral Reefs 29:
47–55.
70. Xavier JR, van Soest RWM, Breeuwer JA, Martins AMF, Menken SBJ (201 0)
Phylogeography, genetic diversity and structure of the Poecilosclerid sponge
Phorbas fictitius at oceanic islands. Contributions to Zoology 79: 19–129.
71. Mariani S, Uriz MJ, Turon X (2005) The dynamics of sponge larvae
assemblages from northwestern Mediterranean nearshore bottoms. Journal of
Plankton Research 27: 249–262.
72. Mariani S, Uriz M-J, Turon X, Alcoverro T (2006) Dispersal strategies in sponge
larvae: Integrating the life history of larvae and the hydrologic component.
Oecologia 149: 174–184.
73. Wulff JL (1991) Asexual fragmentation genotype success and population-
dynamics of erect branching sponges. Journal of Experimental Marine Biology
and Ecology 149: 227–247.
74. Wulff JL (1995) Effects of a hurricane on survival and orientation of large erect
coral-reef sponges. Coral Reefs 14: 55–61.
75. Maldonado M Uriz M.J 1999. Sexual propagation by sponge fragments. Nature
398: 476–476.
76.ShearerTL,VanOppenMJ,RomanoSL,Wo¨rheide G (2002). Slow
mitochondrial DNA sequence evolution in the Anthozoa (Cnidaria). Molecular
Ecology 11: 2475–2487.
77. Hellberg ME (2006) No variation and low synonymous substi tution rates in coral
mtDNA despite high nuclear variation. BMC Evolutionary Biology 6:24.
78. Wo¨rheide G (2006) Low variation in partial cytochrome oxidase subunit I (COI)
mitochondrial sequences in the coralline demosponge Astrosclera willeyana
across the Indo-Pacific. Marine Biology 148: 907–912.
79. Po¨ppe J, Sutcliffe P, Hooper JNA, Wo¨rheide G, Erpenbeck D (2011) COI
barcoding reveals new clades and radiation patterns of Indo-Pacific sponges of
the family Irciniidae (Demospongiae: Dictyoceratida). PLoS ONE 5(4): e9950.
doi:10.1371/journal.pone.0009950.
80. Duran S, Ru¨tzler K (2006) Ecological speciation in a Caribbean marine sponge.
Molecular Phylogenetics and Evolution 40: 292–297.
81. McCormack GP, Kelly M (2002) New indications of the phylogenetic affinity of
Spongosorites suberitoides Diaz et al 1993 (Porifera Demospongiae) as revealed by
28s ribosomal DNA. Journal Natural History 36: 1009–1021.
82. Erpenbeck D, Breeuwer JAJ, van Soest RWM (2005) Implications from a 28s
rRNA gene fragment for the phylogenetic relationships of halichondrid sponges
(Porifera: Demospongiae). Journal Zoological Systematics and Evolutionary
Research 43: 93–99.
83. Chen X-Y, He F (2009) Speciation and endemism under the model of island
biogeography. Ecology 90: 39–45.
84. Ho SYW, Lanfear R, Bromham L, Phillips MJ, Soubrier J, et al. (2011) Time-
dependent rates of molecular evolution. Molecular Ecology 20: 3087–3101.
85. Renema W, Bellwood DR, Braga JC, Bromfield K, Hall R, et al. (2008)
Hopping hotspots: Global shifts in marine biodiversity. Science 321: 654–657.
86. Bellwood DR, Meyer CP (2009) Searching for heat in a marine biodiversity
hotspot. Journal of Biogeography 36: 569–576.
87. Cowman PF, Bellwood DR (2011) Coral reefs as drivers of cladogenesis:
Expanding coral reefs cryptic extinction events and the development of
biodiversity hotspots. Journal of Evolutionary Biology 24:2543–2562.
88. Geyh MA, Kudrass HR, Streif H (1979) Sea level changes during the late
Pleistocene and Holocene in the strait of Malacca. Nature 278: 441–443.
89. Voris HK (2000) Maps of Pleistocene sea levels in Southeast Asia: Shorelines
river systems and time durations. Journal of Biogeography 27: 1153–1167.
90. Hoeksema B (2007) Delineation of the Indo-Malayan centre of maximum
marine biodiversity: The coral triangle. In: Renema W, Biogeography in time
and place: Distribu tions, barriers and islands. Vol 29. Springer Netherlands,
117–178
91. Morley RJ (2000) Origin and Evolution of Tropical Rain Forests. John Wiley &
Sons Ltd, 378.
92. Hewitt G (2000) The genetic legacy of the quaternary ice ages. Nature 405: 907–
913.
93. Maggs CA, Castilho R, Foltz D, Henzler C, Jolly MT, et al. (2008) Evaluating
signatures of glacial refugia for north Atlantic benthic marine taxa. Ecology 89:
S108–S122.
94. Santos SR, Weese DA (2011) Rocks and Clocks: Linking geologic history and
rates of genetic differentation in anchialine organisms. Hydrobiologia. 677: 54–63.
Phylogeography of Suberites diversicolor
PLOS ONE | www.plosone.org 10 October 2013 | Volume 8 | Issue 10 | e75996