Content uploaded by Nathan A Ellis
Author content
All content in this area was uploaded by Nathan A Ellis on Aug 10, 2015
Content may be subject to copyright.
Featured Article
BRCA Mutations and Risk of Prostate Cancer in Ashkenazi Jews
Tomas Kirchhoff,
1
Noah D. Kauff,
1
Nandita Mitra,
2
Kedoudja Nafa,
1
Helen Huang,
1
Crystal Palmer,
1
Tony Gulati,
1
Eve Wadsworth,
1
Sheri Donat,
3
Mark E. Robson,
1
Nathan A. Ellis,
1
and Kenneth Offit
1
1
Clinical Genetics Service, Department of Medicine,
2
Department of
Epidemiology and Biostatistics, and
3
Urology Service, Department of
Surgery, Memorial Sloan-Kettering Cancer Center, New York, New
York
Abstract
Purpose: The Breast Cancer Linkage Consortium and
other family-based ascertainments have suggested that male
carriers of BRCA mutations are at increased risk of prostate
cancer. Several series looking at the frequency of BRCA
mutations in unselected patients with prostate cancer have
not confirmed this finding. To clarify this issue, we con-
ducted a large case-control study.
Experimental Design: Blood specimens from 251 un-
selected Ashkenazi men with prostate cancer were screened
for the presence of one of the three common Ashkenazi
founder mutations in BRCA1 and BRCA2. The incidence of
founder mutations was compared with the incidence of foun-
der mutations in 1472 male Ashkenazi volunteers without
prostate cancer using logistic regression analysis after ad-
justing for age.
Results: Thirteen (5.2%) cases had a deleterious muta-
tion in BRCA1 or BRCA2 compared with 28 (1.9%) controls.
After adjusting for age, the presence of a BRCA1 or BRCA2
mutation was associated with the development of prostate
cancer (odds ratio, 3.41; 95% confidence interval, 1.64 –
7.06; P ! 0.001). When results were stratified by gene,
BRCA2 mutation carriers demonstrated an increased risk of
prostate cancer (odds ratio, 4.78; 95% confidence interval,
1.87–12.25; P ! 0.001), whereas the risk in BRCA1 mutation
carriers was not significantly increased.
Conclusions: BRCA2 mutations are more likely to be
found in unselected individuals with prostate cancer than
age-matched controls. These results support the hypothesis
that deleterious mutations in BRCA2 are associated with an
increased risk of prostate cancer.
Introduction
Early reports from the Breast Cancer Linkage Consortium
and other family-based ascertainments suggested that families
with deleterious mutations in BRCA1 and BRCA2 had an in-
creased number of prostate cancers compared with families
without known inherited predisposition (1–5). Biological sup-
port for this association was provided by Gao et al. (6), who
demonstrated loss of heterozygosity at the BRCA1 locus in
hereditary prostate cancer cases. In an attempt to confirm these
findings, several groups have looked at the incidence of delete-
rious BRCA1 and BRCA2 mutations in unselected series of
patients with prostate cancer (7–11). The majority of these series
have been performed in Ashkenazi populations because of the
high frequency of three founder mutations in BRCA1 and
BRCA2 in this group. Most series of unselected patients have
concluded that deleterious BRCA mutations contribute little, if
anything, to the incidence of prostate cancer in the Ashkenazi
population. In the only series of unselected patients suggesting
a weak association of BRCA mutations with prostate cancer risk,
the effect was limited to BRCA1 mutation carriers (11). How-
ever, this finding was not confirmed in two recent family-based
ascertainments limited to BRCA1 mutation carriers (12, 13). To
better elucidate the impact of deleterious BRCA1 and BRCA2
mutations on prostate cancer risk, we conducted a large case-
control study comparing the incidence of deleterious BRCA1
and BRCA2 founder mutations in unselected Ashkenazi prostate
cancer patients and compared this with the frequency of BRCA1
and BRCA2 founder mutations in a well-characterized control
population.
Patients and Methods
DNA was extracted from lymphocytes of blood specimens
from 251 individuals of Ashkenazi Jewish ancestry diagnosed
with adenocarcinoma of the prostate who received care at the
outpatient urology clinic at Memorial Sloan-Kettering Cancer
Center from April 2000 to September 2002. The samples were
unselected for age or family history. Clinical and pathological
records were reviewed to confirm the diagnosis of prostate
cancer in all subjects. Once pathological diagnosis of prostate
cancer was confirmed, the age of diagnosis was recorded, and
all other identifying links were destroyed. The study design and
anonymization method were approved by the Memorial Sloan-
Kettering Cancer Center Institutional Review Board.
DNA from case samples was analyzed for the three com-
mon Ashkenazi founder mutations in BRCA1 and BRCA2
(185delAG and 5182insC in BRCA1 and 6174delT in BRCA2)
as described previously (14). Briefly, DNA was purified using
the QiaAmp Blood DNA midi kit (Qiagen, Valencia, CA). DNA
specimens were then analyzed for the presence of the Ashkenazi
founder mutations using the following oligonucleotide primers
flanking the mutation loci: BRCA1, 185delAG forward (5!-
Received 11/18/03; revised 1/13/04; accepted 1/27/04.
Grant support: Department of Defense Breast Cancer Research Pro-
gram Grant DAMD17-03-1-0375 (N. Kauff), the Koodish Fellowship
Fund, the Danzinger Foundation, the Frankel Foundation, and the So-
ciety of Memorial Sloan-Kettering Cancer Center.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
Note: T. Kirchhoff and N. Kauff contributed equally to this work.
Requests for reprints: Kenneth Offit, Clinical Genetics Service, Me-
morial Sloan-Kettering Cancer Center, 1275 York Avenue, Box 192,
New York, NY 10021. Phone: (212) 434-5150; Fax: (212) 434-5165;
E-mail: offitk@mskcc.org.
2918 Vol. 10, 2918 –2921, May 1, 2004 Clinical Cancer Research
CATTAATGCTATGCAGAAAAT) and 185delAG reverse (5!-
CTTACTAGACATGTCTTTTCTTCCC) and 5382insC forward
(5!-GTCCAAAGCGAGCAAGAGAATCTC) and 5382insC re-
verse (5!-GAATTCGAGACGGGAATCCAA); and BRCA2,
6174delT forward (TACTTGTGGGATTTTTAGCCAAGC) and
6174delT reverse (5!-GTGAGCTGGTCTGAATGTTCGTTA).
PCR products were analyzed by RFLP, using modified sites
(ACRES) for restriction enzymes TaqI(185delAG),DdeI
(538insC), and BstXI [6174delT (15)]. Carriers were recognized by
the comparison of test digest with digests of PCR analyses of
previously verified BRCA1/2 carriers.
We then compared the incidence of founder mutations in
cases with a control group that included 1472 Ashkenazi Jewish
male volunteers without prostate cancer identified as part of the
Washington Ashkenazi Jewish Study who had previously un-
dergone genotyping for the three Ashkenazi founder mutations
(3). The authors of this study kindly provided the primary data
files after excluding cases with a prior diagnosis of prostate
cancer. The odds ratio for prostate cancer in cases compared
with controls was estimated using a logistic regression model,
after adjusting for age by treating it as an additional covariate in
the model (16). For stratified analyses, "
2
tests of association
and Fisher’s exact tests were conducted. Exact confidence in-
tervals were computed for odds ratios. SAS version 8.2 (SAS
Institute Inc., Cary, NC) was used for all analyses.
Results
Genotyping revealed that 13 of 251 cases (5%) were car-
riers of either a BRCA1 or BRCA2 mutation. Among the 13
carriers, 4 carriers had BRCA1 185delAG (1.6%), 1 carrier had
BRCA1 5382insC (0.4%), and 8 carriers had BRCA2 6174delT
(3.1%). Of the 1472 controls, 28 (1.9%) had either a BRCA1 or
BRCA2 mutation: 9 (0.6%) had BRCA1 185delAG mutation; 3
(0.2%) had BRCA1 5382insC mutation; and 16 (1%) had a
BRCA2 6174delT mutation.
Logistic regression analysis demonstrated that, after adjust-
ing for age, the presence of an Ashkenazi founder mutation in
BRCA1 or BRCA2 had a significant association with prostate
cancer risk (odds ratio, 3.41; 95% confidence interval, 1.64 –
7.06; P # 0.001). In the multivariate model, age was also a
significant predictor of prostate cancer risk (P $ 0.001). When
results were stratified by gene, BRCA2 mutations were associ-
ated with an increased risk of prostate cancer (odds ratio, 4.78;
95% confidence interval, 1.87–12.25; P # 0.001). BRCA1 mu-
tation carriers also appeared to have an increased risk of prostate
cancer, but the association was not statistically significant (odds
ratio, 2.20; 95% confidence interval, 0.72– 6.70; P # 0.16;
Table 1).
Discussion
In the Ashkenazi Jewish population, the three founder
mutations in BRCA1 and BRCA2 account for the vast majority
of inherited breast and ovarian cancer families (17, 18). Despite
evidence from several groups (2, 4) that prostate cancer was
overrepresented in hereditary breast cancer families linked to
BRCA2 (Table 2), no series of unselected Ashkenazi Jewish men
with prostate cancer prior to the current series has been able to
confirm this association (Table 3). For BRCA1-linked kindreds,
the prior family-based series have shown either a higher (1),
lower (12), or average (13) risk of prostate cancer (Table 2). In
unselected series examining the impact of BRCA1 mutations on
prostate cancer risk, four series did not demonstrate an associ-
ation (7–10), and one population-based series observed a modest
elevation in prostate cancer risk (95% confidence interval, 1.05–
6.04; Ref. 11; Table 3). In contrast to these results, our study
showed a significantly increased risk of prostate cancer in
BRCA2 but not BRCA1 mutation carriers.
Several studies have suggested that BRCA mutations are
predominately associated with an increased rate of early-onset
prostate cancer (13, 19, 20). When our results were stratified by
age, we were able to confirm that presence of a BRCA mutation
was associated with a significantly increased risk for prostate
after the age of 60 years (odds ratio, 3.71; 95% confidence
interval, 1.25–11.65; P # 0.01), but not for prostate cancer
before the age of 60 years (odds ratio, 3.03; 95% confidence
interval, 0.56 –10.72; P # 0.10). However, this analysis was
limited by the very small number of men in the series (n # 3)
less than 60 years old with prostate cancer and a BRCA muta-
tion.
Whereas our finding of increased BRCA2-associated risk
for prostate cancer is consistent with predictions based on
family-based ascertainments, one of the reasons that our results
may differ from prior unselected series is that these studies were
not powered to discern different risks in BRCA1 versus BRCA2
mutation carriers. Four of these series were limited to fewer than
200 cases. In one large series from Israel, the frequency of
BRCA2 mutations in prostate cancer cases (1.5%) was less than
half the 3.1% frequency seen in our series. This difference may
be due to the inclusion of only incident cases in the Israeli series,
whereas we included both incident and prevalent cases. It is
possible that a survival bias in our series resulted from a BRCA2
mutation-associated survival advantage for patients with pros-
Table 1 Frequency of BRCA1 and BRCA2 mutations in cases and controls
Mutation
Cases (n # 251) Controls (n # 1472)
Age-
adjusted
odds ratio 95% CI
a
PN (%)
Mean age of
mutation carriers
(range) (yrs) N (%)
Mean age of
mutation carriers
(range) (yrs)
BRCA1 5 (2.0%) 68.4 (65–71) 12 (0.8%) 57.1 (33–78) 2.20 0.72–6.70 0.16
BRCA2 8 (3.2%) 64.0 (48–78) 16 (1.1%) 46.5 (29–65) 4.78 1.87–12.25 0.001
BRCA1 or BRCA2 13 (5.2%) 65.7 28 (1.9%) 51.0 3.41 1.64–7.06 0.001
a
CI, confidence interval.
2919Clinical Cancer Research
tate cancer, leading to an over representation of the 6174delT
allele in our largely prevalent cohort. Such an effect, as has been
observed in BRCA-associated ovarian cancer (21–23), requires
confirmation through prospective studies.
Another possible bias in our series could have occurred
because the Washington Ashkenazi study was not population
based but rather was composed of volunteers somewhat en-
riched for familial cancer history. If the frequency of founder
mutations in unaffected individuals in the Washington Ashke-
nazi Study was different than the population frequency in Ash-
kenazi individuals in the greater New York area, this could have
resulted in an over- or underestimation of the impact of BRCA
mutations on prostate cancer risk. We believe this is unlikely
because the founder mutation frequency seen in the Washington
Ashkenazi Study is consistent with other large series of Ashke-
nazi individuals from both the greater New York area and other
regions of the United States (24, 25).
Different methodologies were used for genotyping cases
and controls. This theoretically could have introduced a bias in
favor of a significant finding if the genotyping method for cases
was more sensitive than the method used for controls. We
believe this is unlikely, however, because the restriction site
analysis used to genotype the cases and the allele-specific oli-
gonucleotide assay used to genotype the controls have both been
Table 3 Incidence of founder BRCA1 or BRCA2 mutations in unselected series of Jewish patients with prostate cancer
Authors N Comparison group
Frequency of BRCA mutations
in cases
Association of BRCA mutation
and prostate cancer risk
Lehrer et al., 1998 (7)
a
60 268 Ashkenazi Jewish women
with sporadic breast cancer
0 (0%) BRCA1 No
0 (0%) BRCA2
Nastiuk et al., 1999 (8)
a
83 Reported population incidence 1 (1.2%) BRCA1 No
2 (2.4%) BRCA2
Hubert et al., 1999 (9)
a
87 87 Ashkenazi Jewish men
without prostate cancer
2 (2.3%) BRCA1 No
1 (1.1%) BRCA2
Vazina et al., 2000 (10) 174 Reported population incidence 4 (2.3%) BRCA1 No
1 (0.6%) BRCA2
Giusti et al., 2003 (11) 940 472 Ashkenazi Jewish men
without prostate cancer
16 (1.7%) BRCA1 BRCA1-No
b
14 (1.5%) BRCA2 BRCA2-No
a
Analysis limited to 185delAG mutation in BRCA1 and 6174delT mutation in BRCA2.
b
When control population was combined with 872 controls from the United States, presence of the 185delAG mutation in BRCA1 was associated
with an increased risk of prostate cancer. (odds ratio, 2.52; 95% confidence interval, 1.05– 6.04).
Table 2 Association of prostate cancer with BRCA1 or BRCA2 mutations: family-based ascertainments
Genes/Study Ascertainment Analysis method Relative risk 95% Confidence interval
BRCA1
Ford et al., 1994 (1) 33 families with evidence of
linkage to BRCA1
Prostate cancer incidence
compared with
population-specific rates
3.33 1.78–6.20
Brose et al., 2002 (12) 147 families with a BRCA1
mutation seen in a risk
evaluation clinic
Prostate cancer incidence
compared with
population-specific rates
0.39 0.09–0.68
Thompson et al., 2002 (13) 699 families with a
documented BRCA1
mutation
Prostate cancer incidence
compared with
population-specific rates
1.07 0.75–1.54
BRCA2
BCLC
a
1999 (2)
173 families selected for
linkage analysis with a
demonstrated BRCA2
mutation
Prostate cancer incidence
compared with
population-specific rates
4.65 3.48–6.22
Sigurdsson et al., 1997 (4) 16 families in which a
woman with breast
cancer was
demonstrated to have
the Icelandic founder
mutation 999del5 in
BRCA2
Prostate cancer incidence in
first-degree relatives of
case patients compared
with population-specific
incidence
4.6 1.9–8.8
BRCA1 and BRCA2
Warner et al., 1999 (5) 48 Ashkenazi Jewish breast
cancer patients with a
founder mutation in
BRCA1 or BRCA2
Prostate cancer incidence in
1
st
degree relatives
compared with
incidence in 1
st
degree
relatives of healthy
controls
3.36 1.49–7.56
a
BCLC, Breast Cancer Linkage Consortium.
2920 Frequency of BRCA Mutations in Prostate Cancer
shown in other studies to have a sensitivity for detecting the
Ashkenazi founder mutations comparable with that of sequenc-
ing (22, 26, 27).
These results provide evidence that deleterious mutations
in BRCA2 are associated with an increased risk of prostate
cancer. Current recommendations for male carriers of BRCA
mutations include prostate cancer screening with digital rectal
examination and serum prostate-specific antigen level annually
beginning at age 50 years (28). Whereas there was no signifi-
cantly increased risk for early-onset prostate cancer in this
series, this finding requires confirmation in a larger cohort.
Additional family-based studies may also help clarify the rela-
tive penetrance of BRCA2 mutations for prostate cancer. Addi-
tionally, because a substantial proportion of familial prostate
cancer is not linked to mutations in BRCA1 and BRCA2, the
search for other major prostate cancer predisposition genes will
remain a high priority.
Acknowledgments
We are grateful to the Washington Ashkenazi Study Investigators,
including Drs. Jeffrey P. Struewing, Patricia Hartge, Shalom Wacholder,
Lawrence C. Brody, and Margaret A. Tucker, who kindly provided the raw
data files, including the age- and gender-specific rates needed for the
analyses in this study.
References
1. Ford D, Easton DF, Bishop DT, Narod SA, Goldgar DE. Risks of
cancer in BRCA1-mutation carriers. Breast Cancer Linkage Consor-
tium. Lancet 1994;343:692–5.
2. Breast Cancer Linkage Consortium. Cancer risks in BRCA2 muta-
tion carriers. J Natl Cancer Inst (Bethesda) 1999;91:1310 – 6.
3. Struewing JP, Hartge P, Wacholder S, et al. The risk of cancer
associated with specific mutations of BRCA1 and BRCA2 among
Ashkenazi Jews. N Engl J Med 1997;20:1401– 8.
4. Sigurdsson S, Thorlacius S, Tomasson J, et al. BRCA2 mutation in
Icelandic prostate cancer patients. J Mol Med 1997;75:758 – 61.
5. Warner E, Foulkes W, Goodwin P, et al. Prevalence and penetrance
of BRCA1 and BRCA2 gene mutations in unselected Ashkenazi Jewish
women with breast cancer. J Natl Cancer Inst (Bethesda) 1999;91:
1241–7.
6. Gao X, Zacharek A, Salkowski A, et al. Loss of heterozygosity of the
BRCA1 and other loci on chromosome 17q in human prostate cancer.
Cancer Res 1995;55:1002–5.
7. Lehrer S, Fodor F, Stock RG, et al. Absence of 185delAG mutation
of the BRCA1 gene and 6174delT mutation of the BRCA2 gene in
Ashkenazi Jewish men with prostate cancer. Br J Cancer 1998;78:
771–3.
8. Nastiuk KL, Mansukhani M, Terry MB, et al. Common mutations in
BRCA1 and BRCA2 do not contribute to early prostate cancer in Jewish
men. Prostate 1999;40:172–7.
9. Hubert A, Peretz T, Manor O, et al. The Jewish Ashkenazi founder
mutations in the BRCA1/BRCA2 genes are not found at an increased
frequency in Ashkenazi patients with prostate cancer. Am J Hum Genet
1999;65:921– 4.
10. Vazina A, Baniel J, Yaacobi Y, et al. The rate of the founder Jewish
mutations in BRCA1 and BRCA2 in prostate cancer patients in Israel.
Br J Cancer 2000;83:463– 6.
11. Giusti RM, Rutter JL, Duray PH, et al. A twofold increase in BRCA
mutation related prostate cancer among Ashkenazi Israelis is not asso-
ciated with distinctive histopathology. J Med Genet 2003;40:787–92.
12. Brose MS, Rebbeck TR, Calzone KA, et al. Cancer risk estimates
for BRCA1 mutation carriers identified in a risk evaluation program.
J Natl Cancer Inst (Bethesda) 2002;94:1365–72.
13. Thompson D, Easton DF, Breast Cancer Linkage Consortium. Can-
cer incidence in BRCA1 mutation carriers. J Natl Cancer Inst (Bethesda)
2002;94:1358 – 65.
14. Kirchhoff T, Satagopan JM, Kauff ND, et al. Frequency of BRCA1
and BRCA2 mutations in unselected Ashkenazi Jewish patients with
colorectal cancer. J Natl Cancer Inst (Bethesda) 2004;96:68 –70.
15. Nafa K, Angell J, Bonavita L, et al. Direct detection of common
mutations in the BRCA1 and BRCA2 genes by amplified created
restriction enzyme site (ACRES) [abstract]. Am J Hum Genet 1999;65:
A58.
16. Schlesselman JJ. Case control studies: design, conduct, analysis.
New York: Oxford University Press; 1982.
17. Kauff ND, Perez-Segura P, Robson ME, et al. Incidence of non-
founder BRCA1 and BRCA2 mutations in high risk Ashkenazi breast
and ovarian cancer families. J Med Genet 2002;39:611– 4.
18. Frank TS, Deffenbaugh AM, Reid JE, et al. Clinical characteristics
of individuals with germline mutations in BRCA1 and BRCA2: analysis
of 10,000 individuals. J Clin Oncol 2002;20:1480 –90.
19. Gayther SA, de Foy KA, Harrington P, et al. The frequency of
germ-line mutations in the breast cancer predisposition genes BRCA1
and BRCA2 in familial prostate cancer. The Cancer Research Cam-
paign/British Prostate Group United Kingdom Familial Prostate Cancer
Study Collaborators. Cancer Res 2000;60:4513– 8.
20. Edwards SM, Kote-Jarai Z, Meitz J, et al. Two percent of men with
early-onset prostate cancer harbor germline mutations in the BRCA2
gene. Am J Hum Genet 2003;72:1–12.
21. Rubin SC, Benjamin I, Behbakht K, et al. Clinical and pathological
features of ovarian cancer in women with germ-line mutations of
BRCA1. N Engl J Med 1996;335:1413– 6.
22. Boyd J, Sonoda Y, Federici MG, et al. Clinicopathologic features of
BRCA-linked and sporadic ovarian cancer. J Am Med Assoc 2000;283:
2260 –5.
23. Ben David Y, Chetrit A, Hirsh-Yechezkel G, et al. Effect of BRCA
mutations on the length of survival in epithelial ovarian tumors. J Clin
Oncol 2002;20:463– 6.
24. Roa BB, Boyd AA, Volcik K, Richards CS. Ashkenazi Jewish
population frequencies for common mutations in BRCA1 and BRCA2.
Nat Genet 1996;2:185–7.
25. Oddoux C, Struewing JP, Clayton CM, et al. The carrier frequency
of the BRCA2 6174delT mutation among Ashkenazi Jewish individuals
is approximately 1%. Nat Genet 1996;2:188 –90.
26. Fodor FH, Weston A, Bleiweiss IJ, et al. Frequency and carrier risk
associated with common BRCA1 and BRCA2 mutations in Ashkenazi
Jewish breast cancer patients. Am J Hum Genet 1998;63:45–51.
27. Rhei E, Bogomolniy F, Federici MG, et al. Molecular genetic
characterization of BRCA1- and BRCA2-linked hereditary ovarian can-
cers. Cancer Res 1998;58:3193– 6.
28. Burke W, Daly M, Garber J, et al. Recommendations for follow-up
care of individuals with an inherited predisposition to cancer. II. BRCA1
and BRCA2. Cancer Genetics Studies Consortium. J Am Med Assoc
1997;277:997–1003.
2921Clinical Cancer Research
