Content uploaded by Nancy Younis
Author content
All content in this area was uploaded by Nancy Younis on May 23, 2022
Content may be subject to copyright.
3109
includes colon cancer and rectal cancer, is the
third most common cancer worldwide after lung
and breast cancers1. CRC arises due to a series of
epigenetic and genetic variations with subsequent
high mortality rate. The etiological and risk in-
uences of CRC development are inconsistently
emulating the multifactorial nature of the disease.
Numerous risk factors are linked to the CRC de-
velopment risk, for instance age (older than 50
years), inammatory bowel diseases2, history of
adenomatous polyps, high-red meat diet, smok-
ing and limited physical activity lifestyle3. At
the molecular level, CRC is very intricate and
necessitates establishing comprehensive patient
stratication models through the identication of
patients who will benet or will not benet from
specic targeted therapy. Thus, understanding the
personalized genetic map of each patient will help
in developing the utmost appropriate management
of his/her case.
Incidence Rate of CRC in Saudi Arabia
Colorectal cancer is the second most common
cancer after breast cancer in Kingdom of Saudi
Arabia (KSA)4. In KSA, CRC incidence is about
half of the incidence in the US, nevertheless the
greatest incidence is at a lower age group (40-
60 years in the KSA vs. 60-80 years in the US)5.
Saudi Cancer Registry stated that CRC is the sec-
ond most common malignancy among Saudis for
all ages (10.3%), the rst cancer in Saudi males
(11. 8 %)6, and the third one among Saudi females4.
Also, between 1994 and 2003 age-standardized
rates for CRC in KSA nearly doubled6. Between
2001 and 2003, whereas the annual percent
change (APC) of CRC incidence among Saudi fe-
males displayed an insignicant rise, Saudi males
showed extremely rising incidence, with an APC
reaching 20.5%. Furthermore, it is anticipated that
AB STR ACT. – Colorectal cancer (CRC) is one of
the leading causes of cancer deaths globally. We
implemented a comprehensive literature review
regarding CRC genetics studies to offer a per-
ception into the genes associated with CRC rec-
ognized in Saudi patients. Denite genetic vari-
ants in ABCB1, ADIPOQ, CTNNB1, SFRP3, LRP6,
CYP19A1, PARP -1, TDG genes exhibited signi-
cant protection against CRC development in Sau-
di population. Whereas, other gene mutations in
ABCB1, ABCC1, CASR, IL -17 F, NOTCH1, NOTCH4,
PRNCR1, TDG, TLR2, TLR4, TLR-9, TSLP, TSL-
PR and TNF- α genes showed irrelevant correla-
tion with CRC risk in Saudi Arabia. On the oth-
er hand, specic mutations in ABCC1, ADIPOQ,
CYP1A1, KIR, IL-17A, MMP2, NOTCH3, PRNCR1,
RETN, TDG, TLR2, BRAF, PARP-1, TLR4, TLR-9,
TNF- α, TSLP and XRCC1 genes demonstrated a
substantial augmented CRC risk development
in Saudi patients. Furthermore, ATR, ATM, BMI1,
CCAT1, Chk1, Chk2, COX-2, FoxM1, FSCN1, Ki67,
MALAT1, miR-29, miR-34a, miR-92, miR-182-5,
PANDAR, PIK3CA, TIGAR over-expression re-
vealed a robust association with CRC in Saudi
Arabia (KSA). Moreover, gene alterations in APC,
EGFR, FBXW7, TP53, PTEN, K-ras genes were
concomitant in CRC. As well as, lower expres-
sion of MLH1, MSH2, MSH6, PMS2, EPCAM and
MUTYH genes were recognized in LS patients
and future CRC Saudi patients. These gene mu-
tations may be used as diagnostic and/or prog-
nostic genetic markers in CRC Saudi patients
and could offer a potential therapeutic target for
CRC management.
Key Words:
Colorectal cancer, Gene, Saudi Arabia, Risk, Over-ex-
pression, Mutation, SNP.
Introduction
Cancer is the second utmost cause of death all
around the world. Colorectal cancer (CRC), which
European Review for Medical and Pharmacological Sciences 2022; 26: 3109-3126
N.S. YOUNIS1, E.S. ALMASOUD1, F. AL KHAWAJAH1, F.J. ALGHAZAL1,
H.M. ALMOFARFESH1, L.H. AL-KHALAF1, M.S. AL OTAIBI1, S.M. ALKHAMIS1,
Z.A. AL NASER1, Z.H. AL MOUSA1, Z.I. ALABDULAZIZ1, M.E. MOHAMED1,2
1Department of Pharmaceutical Sciences, College of Clinical Pharmacy, King Faisal University,
Al-Ahsa, Saudi Arabia
2Department of Pharmacognosy, College of Pharmacy, Zagazig University, Zagazig, Egypt
Corresponding Author: Nancy Safwat Younis, MD;
e-mail: nyounis@kfu.edu.sa; nancysafwet@hotmail.com
Potential genetic biomarker of Saudi Arabian
patients with colorectal cancer
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3110
by the year 2030, the CRC incidence in KSA may
upsurge four-fold7. Almatroudi (2020)8 preformed
a retrospective observational population-based
epidemiological study of CRC established on the
Saudi Cancer Registry information, which includ-
ed all CRC patients January 2006 to December
2016. The results veried that the highest mean
age-standardized incidence rates (ASIRs) of the
CRC were in Riyadh, Makka, and Eastern Prov-
ince regions, whereas the lowest mean ASIRs
were stated Jazan and Najran regions8.
Risk Factors
In KSA, there is no nationwide policy for CRC
screening despite the escalation incidence9. Nota-
bly, most of CRC cases were identied throughout
clinical assessments rather than through screen-
ing programs. Aljumah and Aljebreen (2017)9 rec-
ommended that the developing and applying CRC
screening policy would be cost-effective applica-
tion, which would eventually decline the nancial
burden on government spending, as well as im-
prove the populations’ health status. Saudi Centre
for Evidence-Based Healthcare panel meeting in
2015 agreed on the existence of a lack of nation-
wide incidence data concerning adenomatous
polyps or the age groups in which the CRC inci-
dence surges. Furthermore, there were no nation-
al clinical trials assessing the effectiveness of the
diverse modalities of screening for CRC and their
inuence on mortality10. It is crucial to recognize
the risk factors connected to CRC development.
Al-Zalabani (2020)11 recognized some of the pop-
ulation attributable fractions (PAFs) of CRC Sau-
di cases. The study results displayed that the larg-
est fraction of attributable CRC cases among men
and women was triggered by physical inactivity
(16.13% and 16.45%), followed by extra weight
(obesity: 9.71% and 6.93%; overweight 6.05%
and 1.9%); and smoking (present smoker: 3.04%
and 0.18%; prior smoker: 3.29% and 0.12%)11.
Moreover, harmful actions such as consanguinity
among the Saudi population, which were and still
are detrimental factors for CRC increasing risk
among KSA population. Subsequently, the risks
for transporting genetic variations to the next
generations in KSA are higher than in Europe and
America, where there are less consanguineous
marriages, and the family size is generally small-
er12. Although many advances have been made to
diagnose and treat CRC in KSA, the latest cancer
incidence report from the National Cancer Reg-
istry (NCR) indicated a worrying escalation in
CRC patients. Accordingly, additional studies are
still indispensable to conclude the diverse geno-
type biomarkers that can be used to predict the
Saudi patients who are at risk of developing CRC.
The aim of the existing review is to offer an
understanding into the genes recognized in CRC
Saudi patients. These gene mutations may be used
as diagnostic and/or prognostic genetic markers
in CRC Saudi patients and could offer a potential
therapeutic target for CRC management.
To achieve the current review goal, we accom-
plished a comprehensive state-of-art literature
review regarding the genetics of CRC in KSA.
A literature search was executed using online
available databases like PubMed, ClinVar, Online
Mendelian Inheritance in Man (OMIM), Pheno-
type-Genotype Integrator (PheGenI), DisGeNET
and GWAS Catalog to retrieve all genetic stud-
ies executed on Saudi CRC patients or samples
until December 2021. The search was done using
the following strings: (colorectal), (Saudi), (gene),
(colon), (rectal) and (cancer). All published arti-
cles including Saudi CRC patients were included
in this review.
Genes Associated with Colorectal Cancer
Several genes’ mutations were included in this
review, some of which were associated with in-
creased risk of colorectal cancer, whereas others
genetic mutations, were not associated with the
development of CRC. Additionally, some genetic
mutations showed a protective role against CRC
development in Saudi patients. More than 40
genes mutations were included and for each of
these we tried to explain a little about the gene
associated proteins and their roles in CRC devel-
opment as shown in the Supplementary Table I.
ABC
Adenosine Triphosphate (ATP) binding cas-
sette (ABC) transporters play an indispensable
part in the development of numerous disorders,
including cancers, through drug resistance mech-
anism13.
ABCB1
ABCB1 gene is positioned on chromosome 7 and
encodes a P-glycoprotein (Pgp) which is responsi-
ble for the active efux of drugs from cells14. Al
Qahtani et al15 (2019) studied the genotype dis-
tributions and the allele frequencies of two major
variants in A B CB1 gene, C3435T and T129 C, and
linked them with CRC in Saudi Arabia. They
recognized no signicant association between
ABCB1, 3435C>T and 129T>C polymorphisms
Gene’s polymorphisms in colorectal cancer Saudi patients
3111
with CRC risk. Furthermore, patients with 3435
homozygous (TT) genotypes had lower risk of de-
veloping CRC risks15. The same group of research16
implemented another study on 62 CRC patients
to determine the genotypic distribution and allele
frequency of another two A BCB1 Single nucleotide
polymorphisms (SNPs), T1236C and G2677T, in
Saudi CRC patients. The outcomes displayed no
noteworthy variations in T1236C in CRC patients
than controls. However, G2677T showed a protect-
ing action against CRC progression.
ABCC1
Abdulkhaleq et al17 (2019) conducted a
case-control study on 51 colon cancer patients
to recognize the effect of two SNPs; G128C and
C218T in the ABCC1 gene on CRC development.
The results showed an association between hetero-
zygous (CT) genotype for variant C218T and an
increased risk of colon cancer (3 times over) and
high-grade stages (III and IV). They concluded
that the CT genotype of variant C218T in ABCC1
gene might intensify the risk of developing colon
cancer among Saudi population, suggesting that
this variant can be used as a prognostic marker
for colon cancer. In contrast, the variant G128C
exhibited no association with colon cancer.
ADIPOQ
Adiponectin is an adipose-specic protein,
which has anti-atherogenic, anti-inammatory
and anti-diabetic actions. In order to appraise the
inuence of the adiponectin gene ADIPOQ poly-
morphisms to the risk of colon cancer, Al-Harithy
and Al-Zahrani (2012)18 conducted a case-control
study on 60 colon cancer patients. They examined
the link between two SNPs, rs1501299 (G276T)
and rs2241766 (T45G), in the ADIPOQ gene and
CRC risk. The results showed that carriers of the
heterozygous (GT) genotype of G276T displayed
a higher risk of colon cancer than carriers of (GG)
genotype. By contrast, the G allele in position 45
of the ADIPOQ gene had a lower risk of colon
cancer than carriers of the normal (TT) genotype.
The results suggested that the G276T SNP con-
tributes to the genetic risk of colon cancer, while
the presence of the G allele in position 45 of the
ADIPOQ gene acted as a defensive factor against
colon cancer.
ALK
Anaplastic lymphoma kinase (ALK) is a ty-
rosine kinase that was acknowledged as part of
chromosomal rearrangement as a fusion partner
of nucleophosmin19. Bavi et al20 (2013) identied
the frequency and nature of ALK alterations via re-
cruiting 770 Saudi CRC patients. CRC prognosis
was poor in patients with ALK gene amplication
and gain in copy number as compared to CRC pa-
tients with standard ALK gene copy number. ALK
gene amplication and gain in copy number were
considered as an independent prognostic marker
for poor survival in CRC across all stages20.
APC
The adenomatous polyposis coli (APC) gene
mutation is one of the primary events in CRC.
Ninety-ve tumor samples were retrospectively
recruited in a study accomplished by Almuzzaini
et al21 (2021), and 96% of the samples exhibited at
least one conrmed APC gene pathogenic vari-
ant21. Five novel variants, at the time, out of total
38 variants were detected in the APC gene. These
variants included c.1696G>A (p.V566I) mis-
sense mutation at exon 14, c.1697delT (p.V566X)
frame shift mutation at exon 14, c.2680_2681del-
GTinsTA (p.Val894Ter) stop gain mutation at
exon 16, c.3917delA (p.E1306X), frame shift
mutation at exon 16, and c.4320-4341del AC-
CACCTCCTCAAACAGCTCAA (p. PPPPQ-
TAQ1440-1447X). Additional study investigated
99 CRC cases via targeted sequencing, which led
to the identication of frequent mutations in APC.
APC gene was the second most commonly mu-
tated gene in that cohort, with 36.4% of the cases
examined demonstrating missense, nonsense or
frameshift mutations in the hotspot regions of this
gene. The most common mutation identied was
the p. Arg1450Ter change, resulting in the expres-
sion of truncated APC and thus loss of control on
nuclear β-catenin mediated gene expression and
poorly regulated WNT pathway22.
ATR and ATM
The expression of four telomere-associated
proteins, hTERT, TRF1, TRF2, POT1 were stud-
ied by Aljarbou et al (2018)23. There are six indi-
vidual proteins associated with telomeric DNA,
collectively called shelterin complex. They are
essential in preventing the recognition of the telo-
mere as single or double strand breaks via the in-
hibition of Ataxia telangiectasia mutated (ATM)
and Ataxia telangiectasia and Rad3 related (ATR)
dependent by DNA damage response (DDR)
pathway. The expression of ATR, ATM and Chk1,
Chk2 were signicantly escalated in cancer tis-
sues. Thus, the expression of ATR/Chk1 and ATM/
Chk2 pathways, may serve as a therapeutic re-
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3112
Gene
of interest Mutation occurred and association with CRC development risk Ref.
ABCB1 No signicant association between ABCB1 3435C > T and 129T > C polymorphisms with CRC risk.
Patients with 3435 homozygous (TT) genotype had lower risk of developing CRC risk.
15
No noteworthy variations in T1236C in CRC patients. G2677T showed a protecting against CRC
progression.
16
ABCC1 An association between heterozygous (CT) genotype for variant C218T and increased risk of colon
cancer and high-grade stages (III and IV).
17
ADIPOQ Carriers of the heterozygous (GT) genotype of G276T displayed a higher risk of colon cancer than
(GG) genotype. By cont rast, the G allele of T45G had a lower risk of colon cancer than the normal
(TT) genotype.
18
ALK CRC prognosis was poor in patients with ALK gene amplication and gain in copy number as
compared with CRC patients with standard ALK gene copy number.
20
APC 96% of the samples exhibited at least one conrmed APC gene pathogenic variant. 21
APC gene was the second most commonly mutated gene. Most common mutation identied was the
p. Arg1450Ter change, resulting in the expression of truncated APC.
22
ATR & ATM The expressions of ATR, ATM and Chk1, Chk2 were escalated in cancer tissues. 23
BCAR4 No signicant expression of BCAR4 in CRC samples. 24
BRAF V600E mutation was detected in female patients, deletion of A at c.1758 bp, causing a frameshift and
truncated protein, insertion of A/C at c.1860 bp and an insertion of A, leading to frameshift and stop co-
don. Mutation at c.1780G > A (D594N), and c.1826insT, resulted in frame shift and truncated protein.
BRAF frameshift mutations E586E, Q609L, and M620I lead to truncated defective BRAF proteins.
28
CASR Intron 4 variant (rs3804594) in CASR gene was not correlated to CRC risk. 30
CCAT1&C-
CAT2
The expression level of CCAT1 was augmented in CRC patients.
No noteworthy CCAT2 expression in CRC samples.
24
COX-2 COX-2 over expression in CRC cases and associated with shorter survival. 32
CTNNB1 Genetic variants in CTNNB1 (β-catenin) (rs4135385), SFRP3 (rs7775), and LRP6 (rs2284396) ge-
nes were associated with a defense against CRC development.
GG genotype was associated with lower risk CRC developing relative to AA genotype at rs4135385
of CTNNB1 signifying an association of the rs4135385 in CTNNB1 gene with a reduced CRC risk.
34
CYP1A1 High distribution of CYP1A1wt/*2A genotype in CRC patients, reecting a signicant rise of cancer
risk associated with CYP1A1wt/*2A genotype.
36
CYP2E1 CYP2E1 wt/*6 was not related to CRC risk in Saudi populations. 36
CYP19A1 Three SNPs rs4774585, an A > G transition, rs936308, C > G transversion, and rs4775936 C > T
transition. AA genotype of rs4774585, GG state of rs936308 and TT state of rs4775936 exhibited a
negative association with CRC development in Saudi patients.
38
EGFR Frequent mutations in EGFR were associated with young age of onset and poor disease-specic
survival in CRC.
22
FBXW7 Frequent mutations in FBXW7 were identied 22
FOXM1 FoxM1 protein overexpression was elevated in CRC tissues and was related with poorly differentia-
ted and highly proliferative tumors.
40
FSCN1 FSCN1 intensied in CRC patients and was accompanied by reduced OS and DFS. Furthermore,
high BMI1/FSCN1 patients experienced the worst OS and DFS.
26
GSTM1 Majority of CRC cases harbored the null genotype (GSTM1*0/*0). 43
GSTP1 None of the genotypes of GSTP1 studied were associated with an increased risk of CRC. 44
hBD hBD-1 mutations and mutation 1 of hBD-3 lead to truncated pre-proteins. hBD-3 mutation 2 protein
was greatly destabilized. These outcomes established a signicant reduction of hBDs in cancer tissues.
46
hTERT All CRC samples expressed hTERT; however, there was no difference between tumor and adjacent
mucosa.
23
Table I. Summary of the genes mentioned in this review and mutations occurred in them, as well as their association with CRC
development risk.
Table continued
Gene’s polymorphisms in colorectal cancer Saudi patients
3113
Gene
of interest Mutation occurred and association with CRC development risk Ref
IL-17 Males harboring the A allele of IL-17A G197A SNP exhibited higher risk of developing CRC. No
connection between IL-17F (rs763780) polymorphism and CRC susceptibility.
48
KIR Five activating KIR genes (2DS1, 2DS2, 2DS3, 2DS5, and 3DS1) were signicantly more prevalent
in the CRC patients. The highest risk was associated with the 3DS1 gene, followed by the 2DS1
gene. Additionally, no associations were found between 3DL1 and 2DS4 and CRC, whereas 2DS2
was inversely associated with CRC risk.
50
K-ras
No mutations were identied in codon 61 of exon 3. Exon 4 aberrations harbored p.Ala146Thr (a missense
mutation), p.Ala134Val, p.Arg135Lys, p.Gln150Stop, p.Lys147Lys, p.Gln150Stop, p.Gln150Stop, p.Gly-
138Gly, p.Arg149Gly, p.Gly138Gly, and p.Gly138Gly mutations. Missense K-ras mutations altering the
amino acid sequence of the protein (A134V, R135K, E143K and R149G) were distinguished. Moreover,
two synonymous K-ras mutations (G138G and K147K) and a nonsense truncating mutation (Q150X) were
detected. E143K mutation is predicted to have a damaging effect on the protein. R149G mutation is predi-
cted to be neutral, but molecular modeling showed that this mutation caused changes in the helix and loop
chains near the GTP binding pocket. Q150X mutation introduced a premature stop codon.
5
Most mutations detected were at codon 12 and were associated with metastasis. K-ras mutations were
concomitant with advanced stage of CRC, shorter RFS and OS. Mutations in codons 12/13 of K-ras
exon 2 were associated with reduced benet from EGFR antibody treatment for metastatic CRC.
53
K-ras mutations were in codon 12, most commonly p.G12D, and codon 13.
K-ras mutations were higher in young patients and in the right-sided tumors.
54
Mutations in K-ras were acknowledged in codon 12; G12D, G12V, G12R, G12A, and G12C, in
codon 13 included G13D and G13C, 17, S17R and in codon 31, c.91 G > A.
55
K-ras mutations were associated with poor disease-specic survival in cases with wild-type TP53. 22
LRP6 Decreased risk of developing CRC in CC genotype compared to TT genotype at SNP rs2284396 in
LRP6 gene.
34
MALAT1 The expression levels of MALAT1 were signicantly high in CRC patients. 24
MED12 Three MED12 somatic mutations in CRC patients were found. 57
MEG3 No signicant expression of MEG3 in CRC was detected. 24
miRNAs Signicant rises in miR-29 and miR-92 and their expression levels in CRC, while miR-145 and miR-
195 decreased in CRC tissues.
59
A noteworthy escalation in miR-34a in CRC colon specimens was identied. miR-34a rs2666433
AA and AG genotype carriers were found to be more likely to develop cancer than GG carriers.
60
miR-182-5p gene was amplied in CRC patients. 61
MLH1 Structural loss in the genomic regions of MLH1 (3p23-p14.2), MSH2, MSH6, EPCAM (2p21-p16.3),
PMS2 (7p22.1) and MUTYH (1P34.1-p33) in LS patients. This structural loss resulted in lower
expression of MLH1, MSH2, MSH6, PMS2, EPCAM and MUTYH genes.
12
Positive MLH1 correlation was found in around 27% and that MSI was present in more than 90%
of CRC patients with Lynch syndrome.
64
MMP2 C1306 T mutation was signicantly more common in colon Saudi patients. 65,66
NOTCH1 SNPs rs3124591 in NOTCH1 and rs3820041 in NOTCH4 did not exhibit any association with CRC.
rs1043994 in NOTCH3 displayed a signicant association with CRC in males.
68
PANDAR The expression levels of PANDAR were signicantly enlarged in CRC patients. 24
PARP-1 SNPs in PARP-1 gene, including Met129Thr, Val762Ala, and Lys940Arg, did not show any associa-
tion with CRC risk in Saudi population. Lys933Asn and Lys945Asn showed signicant association
with CRC among Saudis.
69
SNP rs8679 diminished susceptibility to colorectal cancer at heterozygous TC allele and at minor
allele C.
70
PCAT6 No signicant expression of PCAT6 was detected in CRC patients. 24
Table I. (Continued). Summary of the genes mentioned in this review and mutations occurred in them, as well as their asso-
ciation with CRC development risk.
Table continued
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3114
Gene
of interest Mutation occurred and association with CRC development risk Ref.
POLD1 and
POLE
Numerous variants in POLE gene were associated with an increased risk for CRC. Low POLE
protein expression exhibited a substantial link with lymph node involvement and grade III tumors.
Whereas for POLD1, low expression was related with adenocarcinoma histology, larger tumor size
and stage III tumors.
72
PRNCR1 One SNPs, rs1456315, in PRNCR1 gene showed an association with CRC with the homozygous
CC variant allele, among younger age patients (≤ 57) and in female patients. Three other SNPs,
rs1016343 (C > T), rs13252298 (A > G), and rs16901946 (A > G), in PRNCR1 gene did not display
any association with CRC.
74
P35 and PTEN P53 positive expression was established in 25.4% CRC, whereas loss of PTEN expression was re-
cognized in 32.3% CRC patients.
64
RETN SNPs in RETN gene rs1862513 (C-420G) and rs3745367 (G+299A) had increased the risk of colon
cancer. Carriers of the heterozygous (GA) genotype of SNP 299 had a signicantly higher colon
cancer risk than carriers of the wild (GG) genotype.
77
SFRP3 Genetic variant (rs7775) was correlated to considerable protection against CRC progression. Women
having Gly at codon 324 (rs7775) of SFRP3 have 2.5-fold lower risk of developing CRC compared
to those having Arg at this locus.
34
SMAD4 SMAD4 gene was identied and correlated to CRC development. 22
TDG SNP rs4135113 showed a signicant risk association of its genotype AA and of the minor allele A in
CRC Saudi patients. SNP rs1866074 presented a protective association with the GG allele and the
additive (AG+GG) allele in CRC patients. Other four SNPs (rs4135050, rs4135066, rs3751209, and
rs1882018) showed no association with CRC patients in the Saudi population.
79
TIGAR TIGAR expression was found in 68% of the tumor samples with nuclear localization and was signi-
cantly amplied in early stage (stage I and II) and late stage (stage III and IV) of CRC.
81
TLR2 TLR2 rs3804099 and TLR2 rs4696480 SNP were associated with CRC susceptibility, while
TLR2 (rs3804100 C > T) disclosed no association with CRC susceptibility in Saudi patients.
83
TLR4 A clear association between TLR4 rs10759931 polymorphism, the G allele, and susceptibility to CRC
development risk was detected. TLR4 rs2770150 is associated with CRC in women aged over 50 years.
Whereas SNP rs10759932 and rs4986790 appeared not to have any association with colon cancer.
84
TLR6 rs3796508 is a protective factor against CRC in the older male Saudi population. Two other non-sy-
nonymous SNP S249P and V327M were common in a few patients and were predicted as damaging.
85
TLR 9
An association between the rs187084 SNP and CRC risk was found in female patients. T allele exhi-
bited lower frequency in female cancer patients. Additionally, rs352139 and rs352144 SNPs were
found to be correlated with colon cancer development. SNPs rs352144, rs187084 and rs5743839
were not associated with colorectal cancer in males.
87
TNF-α SNPs -308 and -857 were not associated with CRC, while -238 (G/A) genotype was signicantly
concomitant with high risk of CRC. AA genotype of -238 G/A SNP was higher proportion in CRCs.
88
PTEN Loss of PTEN has been reported in CRC. 89
TP53 KRAS or PIK3CA mutations were signicantly associated with poor disease-specic survival in
cases with wild-type TP53.
22
TSLP SNP rs10043985 presented a strong correlation with CRC Saudi patients, whereas rs2289276 SNP
did not show any relation with CRC.
93
UCA1 No signicant expression of UCA1 detected in 63 CRC. 24
VDR No association between the four VDR polymorphisms with CRC risk was found in the overall analy-
sis. ApaI and BsmI loci were associated with CRC in elderly and female patients.
95
ApaI SNP (rs7975232), only the heterozygous (AA) genotype increased the risk of CRC. TaqI SNP
(rs731236) carriers with either the heterozygous (TT) or homozygous (TT) genotype displayed an increased
risk for the disease. Heterozygous (Bb) and homozygous (bb) carriers of the BsmI SNP (rs1544410) had
signicantly lower risk for CRC. FokI SNP (rs2228570) showed no association with CRC risk.
96
XPD and
XRCC1
No signicant difference in XPD Lys751Gln polymorphism in CRC. An association between the GG ge-
notype of XRCC1 polymorphism and the increased risk of CRC was detected . Also, XRCC1 (AG + GG)
polymorphism may be associated with increased clinic pathological parameters of CRC.
98
Table I. (Continued). Summary of the genes mentioned in this review and mutations occurred in them, as well as their asso-
ciation with CRC development risk.
Gene’s polymorphisms in colorectal cancer Saudi patients
3115
sponse biomarker to certain therapies that induce
these DNA damages23.
BCAR4
Siddique et al24 (2019) designed a study to
measure the expression of several oncogenic ln-
cRNAs, including BCAR4. The study revealed
that there was no signicant expression of BCAR4
in CRC blood samples. However, a small number
of subjects limited the statistical power in some
comparisons.
BMI1
BMI1 polycomb gene promotes cancer cell sur-
vival via p53-dependant cell death suppression25.
BMI1 expression was related to cancer progression
and poor clinical outcome. Alajez (2016)26 demon-
strated a signicant escalation of BMI1 i n CRC
Saudi patients. Furthermore, high BM I1 expres-
sion was concomitant with reduced overall surviv-
al (OS) and reduced disease-free survival (DFS).
BRAF
BRAF (B-Raf proto-oncogene, serine/thre-
onine kinase) is a member of the rapidly acceler-
ated brosarcoma (RAF) family. BRAF regulates
the mitogen-activated protein kinase (MAPK)/
extracellular signal-regulated kinase (ERK) sig-
naling pathway, thus affecting cell division, dif-
ferentiation, and secretion27. Rasool et al28 (2021)
recognized numerous BRAF mutations in 14% of
CRC Saudi patients studied. Of these, 5% of these
mutations were in the V600E position, especially
in female patients. The second most common mu-
tation was the deletion of A at c.1758 bp, causing
a frameshift and truncated protein of 589 amino
acids only. Thirdly, heterozygous insertion of
A/C at c.1860 bp and an insertion of A, leading to
frameshift and stop codon after 629aa. Addition-
ally, a mutation in at c.1780G > A (D594N), and
c.1826insT, that resulted in frame shift and trun-
cated protein of 610 amino acids. BRAF frame-
shift mutations E586E, Q609L, and M620I were
detrimental, leading to truncated defective BRAF
proteins. Accordingly, these frameshift mutations
predict the worst clinical prognosis, as well as im-
paired response to therapy.
CASR
CASR (calcium sensing receptor) expression
exhibits a protective role in CRC patients via
several signaling transductions, such as stimulat-
ing cell differentiation, prompting apoptosis and
constraining proliferation29. However, Al-Ghafari
(2019)30 veried that intron 4 variant (rs3804594)
in CASR gene did not correlate with CRC risk.
CCAT1 and CCAT2
Siddique et al24 (2019) showed that the expres-
sion level of CCAT1 was signicantly augmented
in CRC patients, concluding that CCAT1 expres-
sion could be used as possible biomarkers for CRC
prognosis. Alternatively, no noteworthy CCAT2
expression has been found in CRC samples when
related to control24.
COX-2
Numerous inammatory mediators and cyto-
kines are elaborated in the cancer pathogenesis, one
of them belonging to the family of cyclooxygenas-
es31. Albasri et al32 (2018) conducted a retrospective
study including 324 CRC diagnosed cases. They
observed COX-2 over expression in 40% of normal
colonic mucosa, 65% of colorectal adenoma and
84.6% of CRC cases. Furthermore, elevated pa-
tients showing an elevated COX-2 expression were
found to suffer from shorter survival.
CTNNB1 ( β-catenin)
The N-terminus of β-catenin harbors highly
conserved residues, S33, S37, S45, and T41 encod-
ed by exon 3 of the human CTNNB1 gene. Alter-
ation in any of these amino acid residues in CTN-
NB1 gene exon 3 produces a stabilized β-catenin.
Stabilized β-catenin could not be phosphorylated,
causing constitutively active transactivation com-
plexes, with subsequent loss of cell growth con-
trol33. Parine et al34 (2019) studied thirteen SNPs in
8 genes including CT NNB1 (β-catenin) (rs4135385,
rs130 72632), SFRP3 (rs7775), APC (rs454886,
rs459552), LRP6 (rs2075241, rs2284396), DKK4
(r s 3763511) , DKK3 (rs6485350), TCF4 (rs12 255372)
and AXIN2 (rs3923086, rs3923087, rs4791171)
in CRC patients. From the 13 SNPs, only genet-
ic variants in CTN N B1 (β-caten in) (rs4135385),
SFRP3 (rs7775), and LRP6 (rs2284396) genes were
associated with considerable defense against CRC
development. GG genotype was associated with a
lower risk of CRC developing relative to AA gen-
otype at rs4135385 of CTNNB1, translating into an
association of the rs4135385 in CT N N B1 gene with
a reduced CRC risk34.
CYP
CYP1A1
CY P1A1 is important for the conversion of car-
cinogenic polycyclic aromatic hydrocarbons35.
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3116
Saeed et al36 (2013) demonstrated that a high dis-
tribution of CYP1A1wt/*2A genotype in CRC pa-
tients, reecting a signicant rise of cancer risk
associated with CYP1A1wt/*2A genotype.
CYP2E1
CYP2E1 enzyme is responsible for the meta-
bolic oxidation of low molecular weight carcin-
ogens37. A nucleotide replacement (7632T>A) in
intron 6 resulted in the absence of a DraI restric-
tion enzyme site (CYP2E1*6 allele, rs. 6413432).
However, CYP2E1 wt/*6 was not related to CRC
risk in Saudi population36 .
CYP19A1
Al-Mukaynizi et al38 (2017) designed a
case-control study to explore the effect of three
SNPs in the CYP19A1, on CRC risk. Two of
the SNPs, rs4774585, an A > G transition and
rs936308, C > G transversion, are positioned in
the promoter region. The third SNP rs4775936
is situated in the intronic region and is a C > T
transition. AA genotype of rs4774585, GG state
of rs936308 and TT state of rs4775936 exhibited
a negative association with CRC development in
Saudi patients38.
EGFR
A study22 has investigated 99 CRC cases, lead-
ing to the recognition of frequent mutations in
EGFR (11%). EGFR mutations were relatively fre-
quent and signicantly associated with young age
of onset and poor disease-specic survival in CRC.
FBXW7
Dallol et al22 (2016) identied frequent muta-
tions in FBXW7 in 99 CRC cases via targeted
sequencing.
FOX
Forkhead box protein M1 (FoxM1) is a mem-
ber of the FoxM family, which initiates cell cycle
progression and evasion of growth arrest. Con-
sequently, FoxM1 deregulation was found to be
involved in cancer pathogenesis39. FoxM1 protein
overexpression was revealed in 66% of 448 CRC
tissues and was related with poorly differentiated
and highly proliferative tumors. Thus, FOXM1
gene may serve as a valuable molecular biomark-
er, as well as a possible therapeutic target40.
FSCN1
FSCN1, an actin-binding protein, stimulates
cancer cell relocation, invasion and metastasis41.
Alajez (2016)26 distinguished FSCN1 intensica-
tion in CRC patients, which was accompanied by
reduced OS and DFS. Furthermore, high BMI1/
FSCN1 patients experienced the worst OS and
DFS. Therefore, these two genetic markers (BMI1
and FSCN1) in combination may represent su-
perior prognostic markers than either one alone.
Also, BMI1 and FSCN1 may offer potential thera-
peutic chances for CRC.
GST
GSTM1
Glutathione S-transferases (GSTs) are fam-
ily of phase II enzymes vital in carcinogen de-
toxication. One of these GSTs is the GSTM, a
protective enzyme that detoxies several carcin-
ogens. GSTM*0/*0 genotype exhibits deciency
in enzyme activity with subsequent reduced car-
cinogen-detoxication ability42. A study43 imple-
mented using 83 CRC patients, showed that the
majority (83%) of CRC cases harbored the null
genotype (GSTM1*0/*0). The remaining (17%)
cases had either the GSTM1wt/wt or the GSTM-
1wt/*0 genotype. Therefore, among the control
cases, 65% had the null genotype (GSTM1*0/*0)
and 35% had either the GSTM1wt/wt or the GST-
M1wt /*0 genotype43. Another study36 found
GSTM1*0/*0 genotype in only 2% of CRC pa-
tients, suggesting that GSTM1*0/*0 is not a risk
factor in CRC Saudi patients.
GSTP1
In the f t h exon at the codon 105 of Glu t athione
S-transferase pi (GSTP1), A changes to G which
triggers substitution of isoleucine (Ile) with valine
(Val) (Ile105Val), with a subsequent low enzyme
activity. A study44 tried to examine the potential
inuence of G S T P1 (Ilel05Val) polymorphism in
CRC risk in Saudi patients. None of the genotypes
of GSTP1 was associated with an increased risk of
CRC development.
hBD
Human β-defensins (hBDs) belong to a fam-
ily of antimicrobial peptides that constitute an
important part of the innate immune defense.
To date, four hBDs (1-4) have been identied in
human tissues45. Semlali et al46 (2015) designed a
study to analyze the expression and genetic varia-
tions in hBDs (hBD -1, hBD-2, hBD-3 and hBD-4)
and their putative association with CRC in Saudi
population. Numerous mutations, generally in-
sertions, were recognized in different exons (1/2).
Gene’s polymorphisms in colorectal cancer Saudi patients
3117
These mutations contributed to signicant chang-
es in the protein structure of hBDs (i.e., hBD -1,
hBD-3 and hBD-4). hBD-1 mutations and mu-
tation 1 of hBD-3 lead to truncated pre-proteins
with no predicted mature hBD-1 protein synthe-
sis. hBD-3 mutation 2 protein is greatly destabi-
lized because of the absence of a disulde bridge
caused by the substitution of cysteine to leucine
(Cys63Leu). In addition, in the same mutant, ly-
sine to glutamic acid (Lys67→Glu) substitution
introduces a negatively charged, acidic residue
in a positively charged, hydrophobic C-terminal
section. These outcomes established a signicant
reduction of hBDs in cancer tissues related to nor-
mal tissues.
hTERT
The expression of four telomere-associated
proteins, hTERT, TR F1, TRF2, POT1 were stud-
ied by Aljarbou et al23 (2018). All CRC samples
expressed hTERT; however, there was no differ-
ence between tumor and adjacent mucosa. Tis-
sues adjacent to tumors showed detectable hTERT
mRNA levels, while normal tissues do not express
hTERT. Thus, Aljarbou et al23 (2018) ndings can
be attributed to the presence of cancer-associat-
ed genetic modications. Additionally, a positive
correlation between the age of the patients and
hTERT expression was identied23.
IL-17
IL-17 is a major cytokine created by Th17 cells
to prompt inammatory cytokines and chemok-
ines production by neutrophils and macrophages,
thus playing a crucial role in human malignan-
cies47. Al Obeed et al48 (2018) detected that males
harboring the A allele of IL - 17A G197A SNP ex-
hibited higher risk of developing CRC. No con-
nection between I L -17F (rs763780) polymorphism
and CRC susceptibility48 has been found.
KIR
Natural killer (NK) cells play a fundamental
role in the immunity regulation against infect-
ed and malignantly transformed cells through
their killer cell immunoglobulin-like receptors
(KIRs). KIRs interacts with human leukocyte an-
tigen (HLA) molecules49. Al Omar et al50 (2015)
veried ve activating KIR genes (2DS1, 2DS2,
2DS3, 2DS5, and 3DS1), which were signicantly
more prevalent in CRC patients. The highest risk
was associated with the 3DS1 gene, followed by
the 2DS1 gene. Additionally, no association was
found between 3DL1 and 2DS4 and CRC, where-
as 2DS2 was inversely associated with CRC risk.
K-ras
In K-ras gene, the majority of somatic muta-
tions occur at codons 12 and 13 (situated in exon
2). Other less frequent mutations occur in exon 3
(codons 59/61) and exon 4 (codons 117/146)51. Wild
type K-ra s protein resides in the GDP-bound state
on the plasma membrane in inactive cells, where-
as mutated K-ra s is in a continuous stimulation.
Subsequently, mutant K-ras proteins are driving
tumor formation and progression52. Additionally,
activated K-ras is associated with increased ag-
gressiveness of CRC and reduced responsiveness
to targeted therapies27. Numerous studies5,22,53,54
explored K-ras mutations in Saudi Arabia. These
studies5,22,53,54 showed different prevalence of
K-ras gene mutations including 35%, 42.85%,
42% and 56%. It is not clear why there is a wide
range difference in the percentage of K-ras mu-
tations in Saudi Arabia. A study5 was performed
on K-ras mutations in cancerous tissue obtained
from 56 Saudi sporadic CRC patients from the
Eastern Province. K-ras gene mutations were de-
tected in the cancer tissue of 24 out of the cases
studied. Of these, 11 had exon 4 mutations local-
ized between codons 134 and 150, while 13 had
mutations in exon 2, affecting codons 12 and 13.
No mutations were identied in codon 61 of exon
3. The 11 cases with exon 4 aberrations harbored
p. Ala146Thr (a missense mutation), p. Ala134Val,
p. Arg135Lys, p. Gln150Stop, p. Lys147Lys, p.
Gln150Stop, p. Gln150Stop, p. Gly138Gly, p. Ar-
g149Gly, p. Gly138Gly, and p. Gly138Gly muta-
tions. Missense K-ra s mutations which altered
the amino acid sequence of the protein (A134V,
R135K, E143K and R149G) were distinguished.
Moreover, two synonymous K-ras mutations
(G138G and K147K) and, a nonsense truncating
mutation (Q150X) were detected. E143K mutation
is predicted to have a damaging effect on the pro-
tein. R149G mutation is predicted to be neutral,
but molecular modeling showed that this mutation
caused changes in the helix and loop chains near
the GTP binding pocket. Q150X mutation intro-
duced a premature stop codon5.
Another study53, one of the largest studies in-
vestigated K- ras mutations, was accomplished
via examining 300 CRC patients in KSA. Most
mutations detected were at codon 12 (89%) and
were associated with metastasis. The prevalence
of mutated K-ras was 42% in patients and mostly
in stages II-IV, suggesting that K-ras mutations
were concomitant with advanced stage of CRC,
shorter RFS and OS. Additionally, mutations in
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3118
codons 12/13 of K-ra s exon 2 are associated with
reduced benet from EGFR antibody treatment
for metastatic CRC53.
A third study54 investigated and analyzed ret-
rospectively the frequency of K-ras mutation
and its correlation with patients’ characteristics
and clinicopathological features in CRC pa-
tients. K-ras mutations were in codon 12 (75%),
most commonly p. G12D, codon 13 (20%). K-ras
mutations were higher in young patients (≤ 50,
54.5%) and in the right-sided tumors (57.1%). A
fourth study55 collected 80 CRC tumor tissues
and sequenced the K-ra s gene. Mutations in four
different codons (12, 13, 17, and 31) were recog-
nized in 26 patients. Several mutations in K-ras
were acknowledged in codon 12 (61.5% of all
mutations), glycine was substituted by aspartate
(G12D), glycine substituted by valine (G12V),
glycine substituted by arginine (G12R), glycine
substituted by alanine (G12A), and glycine sub-
stituted by cysteine (G12C). The presence of gly-
cine at position 12 seemed to be imperative for
appropriate K-ra s gene functioning and disrup-
tion, or the replacement of this amino acid led to
failure in function efciency. Other mutations in
K-ras recognized in codon 13 included glycine
was replaced by aspartate (G13D) and glycine
substituted by cysteine (G13C). As for codon 17,
mutations in which serine was substituted with
arginine (S17R) were detected. Whereas in co-
don 31, a very rare mutation was identied, c.91
G > A, in which glutamic acid was replaced by
lysine55.
Another study22 has investigated 99 CRC cas-
es, identifying frequent mutations in K- ras (35%)
which were associated with poor disease-specif-
ic survival in cases with wild-type TP53.
LRP6
Parine et al34 (2019) veried a fourfold de-
creased risk of developing CRC in CC genotype,
compared to TT genotype at SNP rs2284396 in
LRP6 gene34.
MALAT1
Siddique et al24 Alsuani (2019) displayed
that the expression levels of metastasis-associat-
ed lung adenocarcinoma transcript 1 (MALAT1)
were signicantly escalated in CRC patients.
MED12
MED12 encodes a member of mediator, a mul-
tiprotein complex involved in the transcriptional
regulation of many genes by mediating the in-
teraction of RNA polymerase with various tran-
scriptional factors56. Siraj et al57 (2018) identied
three MED12 somatic mutations in 27 CRC pa-
tients, which expand the role of MED12 as a tu-
mor suppressor in CRC.
MEG3
Siddique et al24 (2019) revealed no signicant
expression of MEG3 in CRC when compared with
control.
miRNAs
Several classes of non-coding RNAs (ncRNAs),
including microRNAs (miRNAs), exhibit differ-
ential expression in many types of cancer, in-
cluding CRC, and their dysregulation promote
carcinogenesis58. Al-Sheikh et al59 (2016) showed
signicant rises in miR-29 and miR-92 and their
expression levels. Whereas miR-145 and mi R-195
decreased in CRC tissues compared with adjacent
neoplasm-free mucosal tissues59. Another study
performed by Fawzy et al60 (2020) identied note-
worthy escalation in miR-34a in CRC colon spec-
imens, specifying that miR-34a rs2666433 AA
and AG genotype carriers were more likely to
develop cancer than GG carriers60. Additionally,
Al-Sheikh et al61 (2019) demonstrated that miR-
182-5p gene was amplied in CRC patients.
MLH1
Lynch syndrome (LS) is associated with ear-
ly onset of CRC and enhanced risk of many ex-
tra colonic malignancies62. LS is mainly caused
by germline pathogenic mutations in DNA mis-
match repair (MMR) genes, mostly in four of the
genes, MutL Homolog 1 (MLH1), MutS Homolog
2 (MSH2), MutS Homolog 6 (MSH6) and PMS1
Homolog 2 (PMS2)63. Rasool et al12 (2020) detect-
ed structural loss in the genomic regions of MLH1
(3p23-p14.2), MSH2, MSH6, EPCAM (2p21-p16. 3),
PMS2 (7p22.1) and MUTYH (1P34.1-p33) in LS
patients. This structural loss resulted in lower
expression of MLH1, MSH2, MSH6, PMS2, EP-
CAM and MUTYH genes. Moreover, Ahmed
(2 017 )64 detected a positive MLH1 correlation in
around 27% and that MSI was present in more
than 90% of CRC patients with Lynch syndrome.
MMP-2
MMPs overexpression is associated with tumor
invasion, metastasis, and a worse prognosis. Two
studies6 5,66 conrmed that MMP2 C1306 T mu-
tation was signicantly more common in colon
Saudi patients.
Gene’s polymorphisms in colorectal cancer Saudi patients
3119
NOTCH1
The NOTCH gene family consists of four re-
ceptors (NOTCH1, NOTCH2, NOTCH3, and
NOTCH4). Notch signaling plays an important
role in several cellular processes, including pro-
liferation, epithelial cell polarity/adhesion and
apoptosis67. Alanazi et al68 (2021) demonstrated
that SNPs rs3124591 in NOTCH1 and rs3820041
in NOTCH4 did not exhibit any association with
CRC. Although rs1043994 in NOTCH3 was not
associated with CRC in the overall analysis, it
displayed a signicant association with CRC in
males. The GA heterozygote males of this SNP
were two-fold higher risk of CRC development
compared to GG homozygotes.
PANDAR
Siddique et al24 (2019) showed that the expres-
sion levels of the promoter of CDKN1A antisense
DNA damage-activated RNA (PANDAR) were
signicantly enlarged in CRC patients.
PARP-1
Poly (ADP-ribose) polymerase-1 (PAR P -1) has
a crucial role in DNA damage repair and is in-
volved in many cellular processes. Thus, PAR P-1
gene polymorphisms are associated with the risk
of various carcinomas, including colon cancer.
Alshammari et al69 (2014) demonstrated that SNPs
in PA R P-1 gene, including Met129Thr, Val762A-
la, and Lys940Arg, did not show any association
with CRC risk, while Lys933Asn and Lys945Asn
showed signicant association with CRC among
Saudis69. Another study formulated by Alhadheq
et al70 (2016) demonstrated that SNP rs8679 di-
minished the susceptibility to colorectal cancer at
heterozygous TC allele and at minor allele C.
PCAT6
Siddique et al24 (2019) revealed no signicant
expression of PCAT6 in CRC patients.
PIK3CA
PIK3CA mutations were signicantly associ-
ated with poor disease-specic survival in cases
with wild-type TP53 in CRC Saudi patients22.
POLD1 and POLE
POLD1 and POLE encode the catalytic subunit
of the polymerase enzyme complexes Epsilon (ε)
and Delta (δ), which play an imperative part in
DNA replication and repair71. Siraj et al72 (2020)
demonstrated that four variants in POLE gene
were associated to an increased risk of CRC, be-
sides the three POLE variants p. His342Tyr, p.
Gly395Glu, and p. Thr457Met, which were found
in early onset CRC patients. Furthermore, POLD1
variant of c.932G > A: p. Arg311His was estab-
lished in a late onset patient, causing loss of func-
tion of POLD1. Generally, low POLE protein ex-
pression exhibited a substantial link with lymph
node involvement and grade III tumors. Whereas
for POLD1, low expression was related to adeno-
carcinoma histology, larger tumor size and stage
III tumors.
PRNCR1
Prostate cancer non-coding RNA (PRNCR1)
propagates colon cancer from epithelial cells,
causing an increase the tumor size in CRC pa-
tients73. One SNPs, rs1456315, in PRNCR1 gene
revealed an association with CRC with the homo-
zygous CC variant allele. This risk association was
observed among younger age patients (≤ 57) and
in female patients. Three other SNPs rs1016343 (C
> T), rs13252298 (A > G), and rs16901946 (A > G)
in PRNCR1 gene did not display any association
with CRC74.
P35 and PTEN
Mutation of p53 frequently happens in almost
half of all human malignancies and contributes
to tumor progression75 . A retrospective cohort
study64 was performed out over a ve-year period
in which 130 samples were recruited. The study
revealed that a P53 positive expression was found
in 25.4%, whereas loss of PTEN expression was
recognized in 32.3% CRC patients.
RETN
Resistin gene (RETN) codes a peptide hormone
called resistin, which is secreted predominantly
by adipose tissue, in particular from adipocytes
and macrophages76. A study accomplished by Al-
harithy (2014)77 indicated that SNPs in RETN gene
rs1862513 (C-420G) and rs3745367 (G+299A) had
increased the risk of colon cancer. Additionally,
carriers of the heterozygous (GA) genotype of
SNP 299 had a signicantly higher colon cancer
risk than carriers of the wild (GG) genotype.
SFRP3
As already mentioned, Parine et al (2019)34
veried that genetic variants in SFRP3 (rs7775)
gene were correlated with considerable protection
against CRC progression. Women having Gly at
codon 324 (rs7775) of SFR P3 have 2.5-fold lower
risk of developing CRC compared to those having
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3120
Arg at this locus. Thus, SFRP3 gene may serve as
a protective marker in female patients harboring
the minor allele G34.
SMAD4
Frequent mutations in SMAD4 were identied
and correlated with CRC development, as showed
by a study done by Dallol et al22 (2016).
TDG
In addition to its DNA repair function, thymine
DNA glycosylase (TDG) is also involved in oth-
er critical cellular processes78. SNP rs4135113 in
TDG gene showed a signicant risk association
between its genotype AA and the minor allele A
in CRC Saudi patients in general, and in patients
aged more than 57 years. On the other hand, SNP
rs1866074 in TDG gene presented a protective as-
sociation between the GG allele and the additive
(AG+GG) allele in CRC patients. Other four SNPs
(rs4135050, rs4135066, rs3751209, and rs1882018)
in TDG gene showed no association with CRC pa-
tients in the Saudi population79.
TIGAR
The TP53-induced glycolysis and apoptosis
regulator (TIGAR) regulates glycolysis by acting
as fructose bis-phosphatase (FBPase) and modu-
late reactive oxygen species80. Al-Khayal et al81
(2016) revealed that TIGAR expression was found
in 68% of the tumor samples with nuclear local-
ization and was signicantly amplied in early
stages (stage I and II) and late stages (stage III
and IV) of CRC. Thus, TIGAR expression may
be used as a biomarker for CRC recognition and
even as a target for developing therapeutics for
CRC treatment81.
TLRs
Toll-like receptors (TLRs) represent the rst
line of defense against invading pathogens, ini-
tiating inammatory responses; thus, they play a
key role in immune cell regulation, survival, and
proliferation82.
TLR2
A study83 goal was to determine the associa-
tion of TLR2 SNPs (rs3804099, rs3804100, and
rs4696480) and the risk of colon cancer devel-
opment in a Saudi Arabia population83. TLR2
rs3804099 and TLR2 rs4696480 SNP were close-
ly associated with CRC susceptibility. However,
TLR2 (rs3804100 C > T) disclosed no association
with CRC susceptibility in Saudi patients.
TLR4
Semlali et al84 (2016) revealed a clear associ-
ation between TLR4 rs10759931polymorphism,
the G allele, and susceptibility to CRC develop-
ment risk in the Saudi Arabian population. Also,
the TLR4 rs2770150 is associated with CRC in
women aged over 50 years and is linked to the
decreased levels of female sex hormones during
the post-menopausal period. Whereas TLR4 SNPs
rs10759932 and rs4986790 appeared not to have
any association with colon cancer84.
TLR6
Semlali et al85 (2019) illustrated that Val/Met
genotype of rs3796508 of TLR6 gene had a sig-
nicantly higher frequency in the control group
than in the CRC male cases, suggesting that TLR6
rs3796508 is a protective factor against CRC
in the older male Saudi population. Two other
non-synonymous SNPs S249P and V327M were
common in a few patients and were predicted as
being damaging85.
TLR 9
TLR 9 is the only TLR which is administered
systemically and has shown substantial evidence
of anticancer activity in human clinical trials86.
Semlali et al87 (2016) claried a sig nicant associ-
ation between the TLR-9 rs187084 SNP and CRC
risk in female patients. T allele exhibited lower
frequency (2.8 times) in female cancer patients.
Additio nally, TLR-9 rs352139 and rs352144 SNPs
were found to be suggestively correlated with co-
lon cancer development when the tumor was lo-
cated in the rectal area, but not in the colon area
localization. On the other hand, all three TLR-9
SNPs rs352144, rs187084 and rs5743839 were not
associated with colorectal cancer in males.
TNF-α
Hamadien et al88 (2016) veried that T NF- α
SNPs, -308 and -857, were not associated with
CRC. TNF-α -238 (G/A) genotype was signicant-
ly concomitant with high risk of CRC. This is be-
cause AA genotype of -238 G/A SNP was observed
at considerably higher proportion in CRCs.
PTEN
Loss of PTEN has been reported89 in many
types of cancers, including CRC. The overall loss
of PTEN expression (negative) was identied in
32.3% of the CRC patients64. In another study in
KSA, PTEN was inactivated in 66.1% of the 51
CRC cases, and PTENloss was more frequent in
Gene’s polymorphisms in colorectal cancer Saudi patients
3121
CRC90. A third study22 identied PTEN mutations
in 13% of CRC cases.
TP53
Int e r estingly, KRAS or PIK3CA mutations were
signicantly associated with poor disease-specif-
ic survival in cases with wild-type TP5322. Mutant
TP53 may serve as an emerging target for cancer
treatment using small molecule therapeutics that
restores wild-type T P53 function, inducing cell
cycle arrest and apoptosis91.
TSLP
TSLP, IL -7 like cytokine, triggers STAT1,
STAT3, S TAT4, and STAT5, stimulating the prolif-
eration, development, differentiation, migration,
and death of apoptotic cells, depending on the
type of stimuli and cells92. Semlali et al93 (20 21)
established that TSLP rs10043985 presented a
strong correlation with CRC Saudi patients, indi-
cating that this mutation in the promoter region of
TSLP gene might play a detrimental role in CRC.
However, rs2289276 SNP of TSLP gene did not
show any relation with CRC. On the other hand,
IL-7R rs1053496 SNP showed no association with
CRC in female subjects or in CRC patients who
are more than 57 years of age93.
UCA1
Siddique et al24 (2019) revealed no signicant
expression of lncRNA urothelial carcinoma-asso-
ciated 1 (UCA1) in 63 CRC cases when compared
with control.
VDR
More than sixty SNPs of the VDR gene, located
in the promoter region, have been related to can-
cer occurrence and prognosis. ApaI (r s7975232),
TaqI (rs731236), BsmI (rs1544410) and Fok I
(rs10735810) are VDR SNPs that affect VDR gene
expression and mRNA stability94. Alkhayal et
al95 (2016) did not observe any association of the
four VDR polymorphisms with CRC risk in the
overall analysis. However, ApaI and BsmI loci
were associated with CRC in elderly and female
patients, respectively95. In contrast, Al-Ghafari
et al (2020)96 demonstrated that for the ApaI SNP
(rs7975232), only the heterozygous (AA) geno-
type increased the risk of CRC. Moreover, they
showed that TaqI SNP (rs731236) carriers with ei-
ther the heterozygous (TT) or homozygous (TT)
genotype displayed an increased risk for the dis-
ease. In contrast, heterozygous (Bb) and homozy-
gous (bb) carriers of the BsmI SNP (rs1544410)
had signicantly lower risk for CRC. Finally, for
the FokI SNP (rs2228570), there was no associa-
tion with CRC risk. Another study performed by
Al-Ghafari et al96 (2020 found that the VDR SNPs
ApaI and Ta q I upsurge the risk of CRC, whereas
BsmI lessens the risk of CRC in the selected Saudi
population.
XPD and XRCC1
The xeroderma pigmentosium group D (XPD)
protein participates in nucleotide excision repair
(NER), one of DNA repair pathways. X-ray re-
pair cross-complementing group 1 (XRCC1) is
acknowledged to participate in base excision re-
pair (BER)97. Karam et al98 (2016) demonstrat-
ed no signicant difference in XPD Ly s751Gln
polymorphism in CRC. Regarding XRCC1 poly-
morphism, they demonstrated there was an as-
sociation between the GG genotype of XRCC1
polymorphism and the increased risk of CRC.
Moreover, XRCC1 (AG + GG) polymorphism
may be associated with increased clinic patholog-
ical parameters of CRC.
Genetic Variation Irrelevant to CRC
ABCB1 (C3435T, T129C and T1236C), ABCC1
(G128C ), CASR (rs3804594), I L -17F (rs763780),
NOTCH1 (rs3124591), NOTCH4 (rs3820041), PRN-
CR1 (rs1016343, rs13252298, and rs16901946), TDG
SNPs (rs4135050, rs4135066, rs3751209, rs1882018),
TLR2 (rs3804100), TLR4 (rs10759932, rs49867
90), TSLP (rs2289276 ), TSLPR (rs36139698,
rs36177645, rs361334 95), and TNF-α (-308 and
-857) polymorphisms were unrelated to CRC risk
in KSA. Additionally, Met129Thr, Val762Ala, and
Lys940Arg and XPD (Lys751Gln) polymorphisms
in PARP-1 were unconnected to CRC risk in Sau-
di population. Moreover, genotypes CY P2E1*6,
GSTM1*0/*0 were not associated with the CRC
development. Besides, no signicant expressions
of BCAR4, CCAT2, MEG3, PCAT6, UCA1 were
found in CRC samples, nor did any genotypes
of GSTP1 showed association with CRC devel-
opment. Finally, three TLR-9 SNPs (rs352144,
rs187084 and rs5743839) were unrelated to col-
orectal cancer in males, whereas IL-7R rs1053496
SNP showed insignicant association with CRC
in female subjects or in CRC patients who were
more than 57 years of age.
Genetic Variation Protected Against CRC
Genetic variants in ABCB (rs3435, TT gen-
otype, G2677T, female), ADIPOQ (T45G, G al-
lele), CTNNB1 (rs4135385, GG genotype), SFR P3
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3122
(rs7775, GG genotype), LRP6 (rs2284396, CC al-
lele), CY P19A1 (rs4775936, TT allele in females;
rs4774585, AA allele in males; rs936308, GG al-
lele), PA R P -1 (rs8679, TC allele), TDG (rs1866074,
GG allele) genes allied with a signicant protec-
tion against CRC in Saudi population. In addition,
MED12 somatic mutations, 2DS2 in KIR genes,
TLR6 rs3796508 have been found to have a cru-
cial role as protective factors against CRC.
Genetic Variation Strongly Associated
with CRC
ABCC1 (C218T, CT genotype), ADIPOQ (G 276T,
T allele), CY P1A1 (wt/*2A ge notype), KIR (3DS1,
2D S1) , I L-17A (G197A, A allele in males), MMP2
(C1306 T), NOTCH3 (rs1043994, GA genotype,
ma les), PRNCR1 (rs1456315, CC, young age, female),
RETN (rs1862513 and rs3745367), TDG (rs41351130,
AA genotype), TLR2 (rs3804099, rs4696480) poly-
morphisms exhibited a substantial augmented CRC
risk of development in CRC Saudi patients. Addi-
tionally, TLR4 (rs1075993, G allele; rs2770150 wom-
en aged over 50 years), TLR-9 (r s1870 8 4, female),
TNF-α (-238 (G/A) genotype), TSLP (rs10043985)
and X RCC1 (GG genotype) mutations displayed a
signicant amplied CRC development. Further-
more ATR, ATM, BMI1, CCAT1, Chk1, Chk2, COX-
2, FoxM1, FSCN1, Ki67, MALAT1, miR-29, miR-34a,
miR-92, miR-182-5, PANDA R, PIK3CA, TIGAR
over-expression showed a correlation with CRC
Saudi inhabitants. Besides, signicant associations
between BRAF (E586E, Q609L, and M620I) and
PARP-1 (Lys933Asn and Lys945Asn) and CRC risk
have been detected. Moreover, ALK gene amplica-
tion and gain in copy number and gene mutations
in APC, EGFR, FBXW7, TP53, PTEN, K- ras were
concomitant in CRC Saudi population. Structur-
al loss of MLH1 (3p23-p14.2), MSH2, MSH6, EP-
CAM (2 p21- p16.3), PMS2 (7p22.1) and MUTYH
(1P34.1-p33), with subsequent lower expression of
MLH1, MSH2, MSH6, PMS2, EPCAM and MUTYH
genes, were recognized in LS patients and future
CRC patients.
Conclusions
In this review, we performed a comprehensive
literature review concerning CRC genetics to of-
fer an insight into the CRC genes in Saudi Arabia
patients. All these gene mutations may be used
as diagnostic and/or prognostic genetic marker
in CRC Saudi patients and could offer a potential
therapeutic target for CRC management. For each
of these genes, we tried to explain a little about
the gene and its role in cancer development and
clinical phenotype on the Saudi patients and the
mutation occurring in these genes. Several genes’
mutations were included in this review, from
which some genetic variations were either asso-
ciated or strongly related to, nor even protected
against the CRC development.
Acknowledgements
The authors acknowledge College of Clinical Pharma-
cy, University of King Faisal, for the continuous sup-
port and for the available facilities and resources.
Conflicts of Interest
The authors declare no conicts of interest.
Funding Sources
This work was supported through the Annual Fund-
ing track by the Deanship of Scientic Research, Vice
Presidency for Graduate Studies and Scientic Re-
search, King Faisal University, Saudi Arabia (Project
No. AN0 0 0 416 ).
Authors’ Contributions
Conceptualization, N.S.Y, M.E.M and M.E.; method-
ology, A.A.A, G.Y.A, H.A.A, J.A.A, M.A.A M.A.A,
Z.A.A, Z.S.A, and Z.A.A. ; data curation, A.A.A,
G.Y.A, H.A.A, J.A.A.; writing - original draft prepa-
ration, A.A.A, G.Y.A, H.A.A, J.A.A, M.A.A, M.A.A,
Z.A.A, Z.S.A, and Z.A.A.; writing - review and ed-
iting, N.S.Y, M.E.M.; supervision, N.S.Y, M.E.M and
M.E.; project administration, N.S.Y, M.E.M and M.E.;
All authors have read and agreed to the published ver-
sion of the manuscript.
References
1) Haggar FA, Boushey RP. Colorectal cancer epi-
demiology: incidence, mortality, survival, and risk
factors. Clin Colon Rectal Surg 2009; 22: 191-197.
2) Levin B, Lieberman DA, McFarland B, Smith RA,
Brooks D, Andrews KS, Dash C, Giardiello FM,
Glick S, Levin TR, Pickhardt P, Rex DK, Thorson
A, Winawer SJ. Screening and surveillance for
the early detection of colorectal cancer and ade-
nomatous polyps, 2008: a joint guideline from the
American Cancer Society, the US Multi-Society
Task Force on Colorectal Cancer, and the Ameri-
can College of Radiology. CA Cancer J Clin 2008;
58: 130 -160 .
Gene’s polymorphisms in colorectal cancer Saudi patients
3123
3) Johnson CM, Wei C, Ensor JE, Smolenski DJ,
Amos CI, Levin B, Berry DA. Meta-analyses of
colorectal cancer risk factors. Cancer Causes
Control 2013; 24: 1207-1222.
4) Chaudhri E, Fathi W, Hussain F, Hashmi SK. The
Increasing Trends in Cases of the Most Common
Cancers in Saudi Arabia. J Epidemiol Glob Health
2020; 10: 258-262.
5) Al-Kuraya K, Novotny H, Bavi P, Siraj AK, Ud-
din S, Ezzat A, Sanea NA, Al-Dayel F, Al-Ma-
na H, Sheikh SS, Mirlacher M, Tapia C, Simon
R, Sauter G, Terracciano L, Tornillo L. HER2,
TOP2A, CCND1, EGFR and C-MYC oncogene
amplication in colorectal cancer. J Clin Pathol
2007; 60: 768-772.
6) Al-Eid HS, Arteh S. Cancer Incidence Report Sau-
di Arabia 2003. Riyadh: Kingdom of Saudi Arabia
Ministry of Health National Cancer Registry 2003.
7) Ibrahim EM, Zeeneldin AA, El-Khodary TR,
Al-Gahmi AM, Bin Sadiq BM. Past, present and
future of colorectal cancer in the Kingdom of Saudi
Arabia. Saudi J Gastroenterol 2008; 14: 178-182.
8) Almatroudi A. The Incidence Rate of Colorectal
Cancer in Saudi Arabia: An Observational De-
scriptive Epidemiological Analysis. Int J Gen Med
2020; 13: 977-990.
9) Aljumah AA, Aljebreen AM. Policy of screening for
colorectal cancer in Saudi Arabia: A prospective
analysis. Saudi J Gastroenterol 2017; 23: 161-168.
10) Alsanea N, Almadi MA, Abduljabbar AS, Alho-
moud S, Alshaban TA, Alsuhaibani A, Alzahra-
ni A, Batwa F, Hassan AH, Hibbert D, Nooh R,
Alothman M, Rochwerg B, Alhazzani W, Morgan
RL. National Guidelines for Colorectal Cancer
Screening in Saudi Arabia with strength of recom-
mendations and quality of evidence. Ann Saudi
Med 2015; 35: 189-195.
11) Al-Zalabani A. Preventability of Colorectal Cancer
in Saudi Arabia: Fraction of Cases Attributable to
Modiable Risk Factors in 2015-2040. Int J Envi-
ron Res Public Health 2020; 17.
12) Rasool M, Pushparaj PN, Mirza Z, Imran Na-
seer M, Abusamra H, Alquaiti M, Shaabad
M, Sibiany AMS, Gauthaman K, Al-Qahtani
MH, Karim S. Array comparative genomic hy-
bridization based identication of key genetic
alterations at 2p21-p16.3 (MSH2, MSH6, EP-
CAM), 3p23-p14.2 (MLH1), 7p22.1 (PMS2) and
1p34.1-p33 (MUTYH) regions in hereditary non
polyposis colorectal cancer (Lynch syndrome)
in the Kingdom of Saudi Arabia. Saudi J Biol Sci
2020; 27: 157-162.
13) Wilkens S. Structure and mechanism of ABC
transporters. F1000Prime Rep 2015; 7: 14.
14) Mencalha AL, Rodrigues EF, Abdelhay E, Fernan-
dez TS. Accurate monitoring of promoter gene
methylation with high-resolution melting poly-
merase chain reaction using the ABCB1 gene as
a model. Genet Mol Res 2013; 12: 714-722.
15) Al Qahtani AM, Al-Ghafari AB, Al Doghaither HA,
Alzahrani AH, Omar UM, Rahimulddin SA. ABCB1
variants C3435T and T129C are not associated
with colorectal cancer risk. Afr Health Sci 2019;
19: 2476-2483.
16) Al-Ghafari AB, Al Qahtani AM, Alturki SN, Al
Doghaither HA, Elmorsy EM, Tashkandi HM, Abu-
sanad AM, Alkhayyat SS, Omar UM, Zeeneldin
AA. Association between MDR1 polymorphisms
and XELIRI and XELOX chemoresistance in
Saudi patients with colorectal cancer. Oncol Lett
2020; 20: 155.
17) Abdulkhaleq MM, Al-Ghafari AB, Yezerski A, Al
Doghaither HA, Abusanad AM, Omar UM. Novel
association between heterozygous genotype of
single nucleotide polymorphism C218T in drug
transporter ABCC1 gene and increased risk of
colon cancer. Saudi Med J 2019; 40: 224-229.
18) Al-Harithy RN, Al-Zahrani MH. The adiponectin
gene, ADIPOQ, and genetic susceptibility to co-
lon cancer. Oncol Lett 2012; 3: 176-180.
19) Morris SW, Kirstein MN, Valentine MB, Dittmer
KG, Shapiro DN, Saltman DL, Look AT. Fusion of
a kinase gene, ALK, to a nucleolar protein gene,
NPM, in non-Hodgkin’s lymphoma. Science 1994;
26 3: 1281-128 4.
20) Bavi P, Jehan Z, Bu R, Prabhakaran S, Al-Sanea
N, Al-Dayel F, Al-Assiri M, Al-Halouly T, Saira R,
Uddin S, Al-Kuraya KS. ALK gene amplication is
associated with poor prognosis in colorectal car-
cinoma. Br J Cancer 2013; 109: 2735-2743.
21) Almuzzaini B, Alghamdi J, Alomani A, AlGham-
di S, Alsharm AA, Alshieban S, Sayed A, Alhe-
jaily AG, Aljaser FS, Abudawood M, Almajed F,
Samman A, Balwi MAA, Aziz MA. Identication
of Novel Mutations in Colorectal Cancer Patients
Using AmpliSeq Comprehensive Cancer Panel. J
Pers Med 2021; 11.
22) Dallol A, Buhmeida A, Al-Ahwal MS, Al-Maghrabi
J, Bajouh O, Al-Khayyat S, Alam R, Abusanad A,
Turki R, Elaimi A, Alhadrami HA, Abuzenadah M,
Banni H, Al-Qahtani MH, Abuzenadah AM. Clini-
cal signicance of frequent somatic mutations de-
tected by high-throughput targeted sequencing in
archived colorectal cancer samples. J Transl Med
2016; 14: 118.
23) Aljarbou F, Almousa N, Bazzi M, Aldaihan S,
Alanazi M, Alharbi O, Almadi M, Aljebreen AM,
Azzam NA, Arafa M, Aldbass A, Shaik J, Alasirri
S, Warsy A, Alamri A, Parine NR, Alamro G. The
expression of telomere-related proteins and DNA
damage response and their association with telo-
mere length in colorectal cancer in Saudi patients.
PLoS One 2018; 13: e0197154.
24) Siddique H, Al-Ghafari A, Choudhry H, AlTurki
S, Alshaibi H, Al Doghaither H, Alsuani H. Long
Noncoding RNAs as Prognostic Markers for Col-
orectal Cancer in Saudi Patients. Genet Test Mol
Biomarkers 2019; 23: 509-514.
25) Alajez NM, Shi W, Hui AB, Yue S, Ng R, Lo KW,
Bastianutto C, O’Sullivan B, Gullane P, Liu FF. Tar-
geted depletion of BMI1 sensitizes tumor cells to
P53-mediated apoptosis in response to radiation
therapy. Cell Death Differ 2009; 16: 1469-1479.
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3124
26) Alajez NM. Signicance of BMI1 and FSCN1 ex-
pression in colorectal cancer. Saudi J Gastroen-
terol 2016; 22: 288-293.
27) Kudryavtseva AV, Lipatova AV, Zaretsky AR,
Moskalev AA, Fedorova MS, Rasskazova AS,
Shibukhova GA, Snezhkina AV, Kaprin AD, Alek-
seev BY, Dmitriev AA, Krasnov GS. Important
molecular genetic markers of colorectal cancer.
Oncotarget 2016; 7: 53959-53983.
28) Rasool M, Natesan Pushparaj P, Buhmeida A,
Karim S. Mutational spectrum of BRAF gene in
colorectal cancer patients in Saudi Arabia. Saudi J
Biol Sci 2021; 28: 5906-5912.
29) Fedirko V, Bostick RM, Flanders WD, Long Q,
Sidelnikov E, Shaukat A, Daniel CR, Rutherford
RE, Woodard JJ. Effects of vitamin d and cal-
cium on proliferation and differentiation in nor-
mal colon mucosa: a randomized clinical trial.
Cancer Epidemiol Biomarkers Prev 2009; 18:
2933-2941.
30) Al-Ghafari AB. Genetic variants of calcium sens-
ing receptor gene and risk of colorectal cancer: A
case-control study. Pak J Med Sci 2019; 35: 448-453.
31) Sobolewski C, Cerella C, Dicato M, Ghibelli L,
Diederich M. The role of cyclooxygenase-2 in cell
proliferation and cell death in human malignan-
cies. Int J Cell Biol 2010; 2010: 215-158.
32) Albasri AM, Elkablawy MA, Hussainy AS, Yousif
HM, Alhujaily AS. Impact of cyclooxygenase-2
over-expression on the prognosis of colorectal
cancer patients. An experience from Western
Saudi Arabia. Saudi Med J 2018; 39: 773-780.
33) Brembeck FH, Rosário M, Birchmeier W. Balancing
cell adhesion and Wnt signaling, the key role of be-
ta-catenin. Curr Opin Genet Dev 2006; 16: 51-59.
34) Parine NR, Azzam NA, Shaik J, Aljebreen AM, Al-
harbi O, Almadi MA, Alanazi M, Khan Z. Genetic
variants in the WNT signaling pathway are protec-
tively associated with colorectal cancer in a Saudi
population. Saudi J Biol Sci 2019; 26: 286-293.
35) Gelboin HV. Benzo[alpha]pyrene metabolism, ac-
tivation and carcinogenesis: role and regulation
of mixed-function oxidases and related enzymes.
Physiol Rev 1980; 60: 1107-1166.
36) Saeed HM, Alanazi MS, Nounou HA, Salaby MA,
Semlali A, Azzam N, Aljebreen A, Alharby O, Parine
NR, Shaik J, Arafaha M. Cytochrome P450 1A1, 2E1
and GSTM1 gene polymorphisms and susceptibility
to colorectal cancer in the Saudi population. Asian
Pac J Cancer Prev 2013; 14: 3761-3768.
37) Liu Y, Meng XW, Zhou LY, Zhang PY, Sun X,
Zhang P. Genetic polymorphism and mRNA levels
of cytochrome P450IIE1 and glutathione S-trans-
ferase P1 in patients with alcoholic liver disease in
different nationalities. Hepatobiliary Pancreat Dis
Int 2009; 8: 162-16 7.
38) Al-Mukaynizi FB, Alanazi M, Al-Daihan S, Parine
NR, Almadi M, Aljebreen A, Azzam N, Alharbi O,
Arafah M, Warsy A. CYP19A1 gene polymorphism
and colorectal cancer etiology in Saudi popula-
tion: case-control study. Onco Targets Ther 2017;
10: 4559-4567.
39) Myatt SS, Lam EW. The emerging roles of fork-
head box (Fox) proteins in cancer. Nat Rev Can-
cer 2007; 7: 847-859.
40) Uddin S, Ahmed M, Hussain A, Abubaker J, Al-Sa-
nea N, AbdulJabbar A, Ashari LH, Alhomoud S, Al-
Dayel F, Jehan Z, Bavi P, Siraj AK, Al-Kuraya KS.
Genome-wide expression analysis of Middle Eastern
colorectal cancer reveals FOXM1 as a novel target
for cancer therapy. Am J Pathol 2011; 178: 537-547.
41) Li D, Jin L, Alesi GN, Kim YM, Fan J, Seo JH,
Wang D, Tucker M, Gu TL, Lee BH, Taunton J, Ma-
gliocca KR, Chen ZG, Shin DM, Khuri FR, Kang S.
The prometastatic ribosomal S6 kinase 2-cAMP
response element-binding protein (RSK2-CREB)
signaling pathway up-regulates the actin-binding
protein fascin-1 to promote tumor metastasis. J
Biol Chem 2013; 288: 32528-32538.
42) Csejtei A, Tibold A, Varga Z, Koltai K, Ember A,
Orsos Z, Feher G, Horvath OP, Ember I, Kiss I.
GSTM, GSTT and p53 polymorphisms as modi-
ers of clinical outcome in colorectal cancer. Anti-
cancer Res 2008; 28: 1917-1922.
43) Khabaz MN, Nedjadi T, Gari MA, Al-Maghrabi JA,
Atta HM, Bakarman M, Gazzaz ZJ. GSTM1 gene
polymorphism and the risk of colorectal cancer in a
Saudi Arabian population. Genet Mol Res 2016; 15.
44) Khabaz MN, Al-Maghrabi JA, Nedjadi T, Gar MA,
Bakarman M, Gazzaz ZJ, Ibrahim AM. Does Val/
Val genotype of GSTP1 enzyme affects suscepti-
bility to colorectal cancer in Saudi Arabia? Neuro
Endocrinol Lett 2016; 37: 46-52.
45) Valore EV, Park CH, Quayle AJ, Wiles KR, Mc-
Cray PB, Jr., Ganz T. Human beta-defensin-1: an
antimicrobial peptide of urogenital tissues. J Clin
Invest 1998; 101: 1633-1642.
46) Semlali A, Al Amri A, Azzi A, Al Shahrani O, Ara-
fah M, Kohailan M, Aljebreen AM, Alharbi O, Al-
madi MA, Azzam NA, Parine NR, Rouabhia M, Al-
anazi MS. Expression and new exon mutations of
the human Beta defensins and their association
on colon cancer development. PLoS One 2015;
10: e0126868.
47) Harrington LE, Hatton RD, Mangan PR, Turner H,
Murphy TL, Murphy KM, Weaver CT. Interleukin
17-producing CD4+ effector T cells develop via a
lineage distinct from the T helper type 1 and 2
lineages. Nat Immunol 2005; 6: 1123-1132.
48) Al Obeed OA, Vaali-Mohamed MA, Alkhayal KA , Bin
Traiki TA, Zubaidi AM, Arafah M, Harris RA, Khan Z,
Abdulla MH. IL-17 and colorectal cancer risk in the
Middle East: gene polymorphisms and expression.
Cancer Manag Res 2018; 10: 2653-2661.
49) Yawata M, Yawata N, Draghi M, Little AM, Parthe-
niou F, Parham P. Roles for HLA and KIR poly-
morphisms in natural killer cell repertoire selec-
tion and modulation of effector function. J Exp
Med 2006; 203: 633-645.
50) Al Omar SY, Mansour L, Dar JA, Alwasel S, Alkhu-
riji A, Arafah M, Al Obeed O, Christmas S. The
Gene’s polymorphisms in colorectal cancer Saudi patients
3125
Relationship Between Killer Cell Immunoglobu-
lin-Like Receptors and HLA-C Polymorphisms in
Colorectal Cancer in a Saudi Population. Genet
Test Mol Biomarkers 2015; 19: 617-622.
51) Breivik J, Meling GI, Spurkland A, Rognum TO,
Gaudernack G. K-ras mutation in colorectal can-
cer: relations to patient age, sex and tumour loca-
tion. Br J Cancer 1994; 69: 367-371.
52) O’Bryan JP. Pharmacological targeting of RAS:
Recent success with direct inhibitors. Pharmacol
Res 2019; 139: 503-511.
53) Zekri J, Al-Shehri A, Mahrous M, Al-Rehaily S,
Darwish T, Bassi S, El Taani H, Al Zahrani A, El-
samany S, Al-Maghrabi J, Sadiq BB. Mutations in
codons 12 and 13 of K-ras exon 2 in colorectal tu-
mors of Saudi Arabian patients: frequency, clinco-
pathological associations, and clinical outcomes.
Genet Mol Res 2017; 16.
54) Mulla N, Alshareef A, Syed AR, Al-Jahel M. Clini-
co-Pathological Study of K-ras Mutations in Col-
orectal Tumors: A Single-Center Retrospective
Study of 51 Patients in Madinah, Saudi Arabia.
Cureus 2020; 12: e9978.
55) Rasool M, Carracedo A, Sibiany A, Al-Sayes F,
Karim S, Haque A, Natesan Pushparaj P, Asif M,
Achakzai NM. Discovery of a novel and a rare
Kristen rat sarcoma viral oncogene homolog
(KRAS) gene mutation in colorectal cancer pa-
tients. Bioengineered 2021; 12: 5099-5109.
56) Taatjes DJ. The human Mediator complex: a ver-
satile, genome-wide regulator of transcription.
Trends Biochem Sci 2010; 35: 315-322.
57) Siraj AK, Masoodi T, Bu R, Pratheeshkumar P,
Al-Sanea N, Ashari LH, Abduljabbar A, Alho-
moud S, Al-Dayel F, Alkuraya FS, Al-Kuraya KS.
MED12 is recurrently mutated in Middle Eastern
colorectal cancer. Gut 2018; 67: 663 -671.
58) Wu WK, Law PT, Lee CW, Cho CH, Fan D, Wu
K, Yu J, Sung JJ. MicroRNA in colorectal can-
cer: from benchtop to bedside. Carcinogenesis
2011; 32: 247-253.
59) Al-Sheikh YA, Ghneim HK, Softa KI, Al-Jobran
AA, Al-Obeed O, Mohamed MA, Abdulla M,
Aboul-Soud MA. Expression proling of selected
microRNA signatures in plasma and tissues of
Saudi colorectal cancer patients by qPCR. Oncol
Le tt 2016; 11: 1406-1412.
60) Fawzy MS, Ibrahiem AT, AlSel BTA, Alghamdi SA,
Toraih EA. Analysis of microRNA-34a expression
prole and rs2666433 variant in colorectal can-
cer: a pilot study. Sci Rep 2020; 10: 16940.
61) Al-Sheikh YA, Ghneim HK, Alharbi KK, Aboul-
Soud MAM. Screening for differentially-expressed
microRNA biomarkers in Saudi colorectal cancer
patients by small RNA deep sequencing. Int J Mol
Med 2019; 44: 2027-2036.
62) Barrow P, Khan M, Lalloo F, Evans DG, Hill J. Sys-
tematic review of the impact of registration and
screening on colorectal cancer incidence and
mortality in familial adenomatous polyposis and
Lynch syndrome. Br J Surg 2013; 100: 1719-1731.
63) Tutlewska K, Lubinski J, Kurzawski G. Germline
deletions in the EPCAM gene as a cause of Lynch
syndrome - literature review. Hered Cancer Clin
Pract 2013; 11: 9.
64) Ahm ed HG. Association of Colorectal Cancer
Type and P53, Pten and Mlh1 Genes in Northern
Saudi Arabia. Gastroenterology & Hepatology:
Open Access 2017; 7.
65) Shalaby MA, Nounou HA, Ms A, O A, Azzam N,
Saeed HM. Associations between single nucleotide
polymorphisms of COX-2 and MMP-2 genes and
colorectal cancer susceptibility in the Saudi popula-
tion. Asian Pac J Cancer Prev 2014; 15: 4989-4994.
66) Saeed HM, Alanazi MS, Parine NR, Shaik J, Sem-
lali A, Alharbi O, Azzam N, Aljebreen A, Almadi M,
Shalaby MA. Matrix metalloproteinase-2 (-1306
c>t) promoter polymorphism and risk of colorectal
cancer in the Saudi population. Asian Pac J Can-
cer Prev 2013; 14: 6025-6030.
67) Zhang Y, Li B, Ji ZZ, Zheng PS. Notch1 regulates
the growth of human colon cancers. Cancer 2010;
116: 5207-5218.
68) Alanazi IO, Shaik JP, Parine NR, Al Naeem A,
Azzam NA, Almadi MA, Aljebreen AM, Alharbi O,
Alanazi MS, Khan Z. NOTCH Single Nucleotide
Polymorphisms in the Predisposition of Breast
and Colorectal Cancers in Saudi Patients. Pathol
Oncol Res 2021; 27: 616204.
69) Alshammari AH, Shalaby MA, Alanazi MS, Saeed
HM. Novel mutations of the PARP-1 gene associ-
ated with colorectal cancer in the Saudi population.
Asian Pac J Cancer Prev 2014; 15: 3667-3673.
70) Alhadheq AM, Purusottapatnam Shaik J, Alamri
A, Aljebreen AM, Alharbi O, Almadi MA, Alhad-
eq F, Azzam NA, Semlali A, Alanazi M, Bazzi
MD, Reddy Parine N. The Effect of Poly(ADP-ri-
bose) Polymerase-1 Gene 3’Untranslated Region
Polymorphism in Colorectal Cancer Risk among
Saudi Cohort. Dis Markers 2016; 2016: 8289293-
8289293.
71) Pursell ZF, Isoz I, Lundström EB, Johansson E,
Kunkel TA. Yeast DNA polymerase epsilon partic-
ipates in leading-strand DNA replication. Science
20 07; 317: 127-130 .
72) Siraj AK, Bu R, Iqbal K, Parvathareddy SK,
Masoodi T, Siraj N, Al-Rasheed M, Kong Y,
Ahmed SO, Al-Obaisi KAS, Victoria IG, Arshad M,
Al-Dayel F, Abduljabbar A, Ashari LH, Al-Kuraya
KS. POLE and POLD1 germline exonuclease
domain pathogenic variants, a rare event in col-
orectal cancer from the Middle East. Mol Genet
Genomic Med 2020; 8: e1368-e1368.
73) Yang L, Qiu M, Xu Y, Wang J, Zheng Y, Li M, Xu
L, Yin R. Upregulation of long non-coding RNA
PRNCR1 in colorectal cancer promotes cell pro-
liferation and cell cycle progression. Oncol Rep
2016; 35: 318-324.
74) AlMutairi M, Parine NR, Shaik JP, Aldhaian S,
Azzam NA, Aljebreen AM, Alharbi O, Almadi MA,
Al-Balbeesi AO, Alanazi M. Association between
polymorphisms in PRNCR1 and risk of colorectal
N.S. Younis, E.S. AlMasoud, F. Al Khawajah, F.J. Alghazal, H.M. AlMofarfesh, L.H. AL-Khalaf, et al
3126
cancer in the Saudi population. PLoS One 2019;
14: e0220931-e0220931.
75) Chang CJ, Chao CH, Xia W, Yang JY, Xiong Y,
Li CW, Yu WH, Rehman SK, Hsu JL, Lee HH,
Liu M, Chen CT, Yu D, Hung MC. p53 regulates
epithelial-mesenchymal transition and stem cell
properties through modulating miRNAs. Nat Cell
Biol 2011; 13: 317-323.
76) Al-Harithy RN, Al-Ghafari AB. Resistin in human
colon cancer. Increased expression independent-
ly of resistin promoter C-180G genotype. Saudi
Med J 2010; 31: 495-500.
77) Alharithy RN. Polymorphisms in RETN gene and
susceptibility to colon cancer in Saudi patients.
Ann Saudi Med 2014; 34: 334-339.
78) Cortázar D, Kunz C, Saito Y, Steinacher R, Schär
P. The enigmatic thymine DNA glycosylase. DNA
Repair (Amst) 2007; 6: 489-504.
79) Reddy Parine N, Alanazi IO, Shaik JP, Aldhaian
S, Aljebreen AM, Alharbi O, Almadi MA, Azzam
NA, Alanazi M. TDG Gene Polymorphisms and
Their Possible Association with Colorectal Can-
cer: A Case Control Study. J Oncol 2019; 2019:
7091815 -7091815.
80) Jen KY, Cheung VG. Identication of novel p53
target genes in ionizing radiation response. Can-
cer Res 2005; 65: 7666-7673.
81) Al-Khayal K, Abdulla M, Al-Obeed O, Al Kattan
W, Zubaidi A, Vaali-Mohammed M-A, Alsheikh
A, Ahmad R. Identication of the TP53-induced
glycolysis and apoptosis regulator in various
stages of colorectal cancer patients. Oncol Rep
2016; 3 5: 1281-128 6.
82) Gordon S. Pattern recognition receptors: doubling
up for the innate immune response. Cell 2002;
111: 927- 9 30.
83) Semlali A, Parine NR, Al-Numair NS, Almutairi M,
Hawsawi YM, Amri AA, Aljebreen AM, Arafah M,
Almadi MA, Azzam NA, Alharbi O, Alanazi MS.
Potential role of Toll-like receptor 2 expression
and polymorphisms in colon cancer susceptibili-
ty in the Saudi Arabian population. Onco Targets
Ther 2018; 11: 8127-8141.
84) Semlali A, Reddy Parine N, Arafah M, Mansour
L, Azzi A, Al Shahrani O, Al Amri A, Shaik JP,
Aljebreen AM, Alharbi O, Almadi MA, Azzam
NA, Kohailan M, Rouabhia M, Alanazi MS. Ex-
pression and Polymorphism of Toll-Like Recep-
tor 4 and Effect on NF-κB Mediated Inamma-
tion in Colon Cancer Patients. PLoS One 2016;
11: e0146333.
85) Semlal i A, Almutairi M, Pathan AAK , Azzi A, Parine
NR, AlAmri A, Arafah M, Aljebreen AM, Alharbi
O, Almadi MA, Azzam NA, Alanazi M, Rouabhia
M. Toll-like receptor 6 expression, sequence vari-
ants, and their association with colorectal cancer
risk. J Cancer 2019; 10: 2969-2981.
86) O’Neill LA, Bryant CE, Doyle SL. Therapeutic tar-
geting of Toll-like receptors for infectious and in-
ammatory diseases and cancer. Pharmacol Rev
2009; 61: 177-197.
87) Semlali A, Parine NR, Al Amri A, Azzi A, Arafah M,
Kohailan M, Shaik JP, Almadi MA, Aljebreen AM,
Alharbi O, Ali Azzam N, Rouabhia M, Alanazi MS.
Association between TLR-9 polymorphisms and
colon cancer susceptibility in Saudi Arabian female
patients. Onco Targets Ther 2016; 10: 1-11.
88) Hamadien MA, Khan Z, Vaali-Mohammed MA,
Zubaidi A, Al-Khayal K, McKerrow J, Al-Obeed O.
Polymorphisms of tumor necrosis factor alpha in
Middle Eastern population with colorectal cancer.
Tumour Biol 2016; 37: 5529-5537.
89) Jagan IC, Deevi RK, Fatehullah A, Topley R, Eves J,
Stevenson M, Loughrey M, Arthur K, Campbell FC.
PTEN phosphatase-independent maintenance of
glandular morphology in a predictive colorectal can-
cer model system. Neoplasia 2013; 15: 1218-1230.
90) Abubaker J, Bavi P, Al-Harbi S, Ibrahim M, Siraj
AK, Al-Sanea N, Abduljabbar A, Ashari LH, Alho-
moud S, Al-Dayel F, Uddin S, Al-Kuraya KS. Clini-
copathological analysis of colorectal cancers with
PIK3CA mutations in Middle Eastern population.
Oncogene 2008; 27: 3539-3545.
91) Bykov VJ, Wiman KG. Mutant p53 reactivation by
small molecules makes its way to the clinic. FEBS
Lett 2014; 588: 2622-2627.
92) Davey HW, Wilkins RJ, Waxman DJ. STAT5 Signaling
in Sexually Dimorphic Gene Expression and Growth
Patterns. Am J Hum Genet 1999; 65: 959-965.
93) Semlali A, Almutairi MH, Alamri A, Reddy Parine N,
Arafah M, Almadi MA, Aljebreen AM, Alharbi O, Az-
zam NA, Almutairi R, Alanazi M, Rouabhia M. Ex-
pression and Polymorphism of TSLP/TSLP Recep-
tors as Potential Diagnostic Markers of Colorectal
Cancer Progression. Genes (Basel) 2021; 12.
94) Perna L, Hoffmeister M, Schöttker B, Arndt V,
Haug U, Holleczek B, Burwinkel B, Ordóñez-Mena
JM, Brenner H. Vitamin D receptor polymorphism
and colorectal cancer-specic and all-cause mor-
tality. Cancer Epidemiol 2013; 37: 905-907.
95) Alkhayal KA, Awadalia ZH, Vaali-Mohammed
M-A, Al Obeed OA, Al Wesaimer A, Halwani R,
Zubaidi AM, Khan Z, Abdulla MH. Association of
Vitamin D Receptor Gene Polymorphisms with
Colorectal Cancer in a Saudi Arabian Population.
PLoS One 2016; 11: e0155236-e0155236.
96) Al-Ghafari AB, Balamash KS, Al Doghaither HA.
TaqI and ApaI Variants of Vitamin D Receptor Gene
Increase the Risk of Colorectal Cancer in a Saudi
Population. Saudi J Med Med Sci 2020; 8: 188-195.
97) Christmann M, Tomicic MT, Roos WP, Kaina B.
Mechanisms of human DNA repair: an update.
Toxicology 2003; 193: 3-34.
98) Karam RA, Al Jiffry BO, Al Saeed M, Abd El Rah-
man TM, Hatem M, Amer MG. DNA repair genes
polymorphisms and risk of colorectal cancer in
Saudi patients. Arab J Gastroenterol 2016; 17:
117-12 0 .
