Content uploaded by Muhammad Atif Muneer
Author content
All content in this area was uploaded by Muhammad Atif Muneer on Nov 08, 2023
Content may be subject to copyright.
KamelA.Abd-Elsalam
HebaI.MohamedEditors
Cereal Diseases:
Nanobiotechnological
Approaches
forDiagnosis and
Management
Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management
and Management
Kamel A. Abd-Elsalam •Heba I. Mohamed
Editors
Cereal Diseases:
Nanobiotechnological
Approaches for Diagnosis
ISBN 978-981-19-3119-2 ISBN 978-981-19-3120-8 (eBook)
https://doi.org/10.1007/978-981-19-3120-8
#The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Singapore
Pte Ltd. 2022
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether
the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of
illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and
transmission or information storage and retrieval, electronic adaptation, computer software, or by
similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this
book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or
the editors give a warranty, expressed or implied, with respect to the material contained herein or for any
errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional
claims in published maps and institutional affiliations.
This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd.
The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721,
Singapore
Editors
Kamel A. Abd-Elsalam
Plant Pathology Research Institute
Agricultural Research Center
Giza, Egypt
Heba I. Mohamed
Biological and Geological Science Department
Ain Shams University
Cairo, Egypt
We’d like to dedicate this book to Prof. Aly A.
Aly, my father in agricultural research, for his
guidance, direction, and pearls of wisdom, but
more importantly, for putting up with my
panic attacks and questions while providing
amazingly timely feedback and
encouragement precisely when needed,
without which it would have been nearly
impossible to produce this piece of work.
Kamel A. Abd-Elsalam and Heba I. Mohamed
3
Contents
Part I Identification and Diagnosis
1 An Introduction to Rice Diseases ........................... 3
Parteek Prasher and Mousmee Sharma
2 Bacterial Disease of Rice ................................. 17
Prasad Sunnapu, Shilpa Valiyaparambil,
Muddukrishnaiah Kotakonda, Dhanapal Yogananthan,
and Natarajan Ashokkumar
3 Viral Diseases of Rice ................................... 31
M. Taqqi Abbas, M. Shafiq, Robina Khaliq, Hibba Arshad,
Rajia Haroon, and M. Saleem Haider
4 Etiology, Epidemiology, and Management of Maize Diseases ..... 5
Talha Javed, Rubab Shabbir, Ayesha Tahir, Sunny Ahmar,
Freddy Mora-Poblete, Maryam Razzaq, Muqmirah,
Zainab Qamar Javed, Muhammad Junaid Zaghum, Sadam Hussain,
Ahmed Mukhtar, and Muhammad Asad Naseer
5 Viral Diseases of Maize .................................. 83
Muhammad Taqqi Abbas, Muhammad Shafiq, Hibba Arshad,
Rajia Haroon, Hamza Maqsood, and Muhammad Saleem Haider
6 Barley Diseases: Introduction, Etiology, Epidemiology,
and Their Management .................................. 97
Heba S. Abbas
Part II Plant Breeding and Diseases Management
7 Identification of a New Susceptibility Gene and Its Role in Plant
Immunity ............................................ 121
Zohaib Asad, Maria Siddique, Muhammad Ashfaq,
and Zulqurnain Khan
viivii
viii Contents
8 Breeding Strategies for Developing Disease-Resistant Wheat:
Present, Past, and Future ................................ 137
Anuj Choudhary, Antul Kumar, Harmanjot Kaur, Vimal Pandey,
Baljinder Singh, and Sahil Mehta
9 Potential Breeding Strategies for Developing Disease-Resistant
Barley: Progress, Challenges, and Applications ................ 163
H. S. Mahesha, Ravi Prakash Saini, Tejveer Singh, A. K. Singh,
and R. Srinivasan
10 Economic and Eco-friendly Alternatives for the Efficient and
Safe Management of Wheat Diseases ........................ 183
Abdulwareth A. Almoneafy, Kaleem U. Kakar, Zarqa Nawaz,
Abdulhafed A. Alameri, and Muhammad A. A. El-Zumair
Part III Genome Editing
11 Resistance Gene Identification, Cloning, and Characterization
in Plants ............................................. 205
Muhammad Abu Bakar Saddique, Saad Zafar, ZulkiflAshraf,
Muhammad Atif Muneer, Babar Farid, and Shehla Shabeer
12 The Role of Genetic, Genomic, and Breeding Approaches
in the Fight Against Fungal Diseases in Wheat ................ 225
Antul Kumar, Anuj Choudhary, Radhika Sharma, Harmanjot Kaur,
Khushboo Singh, Baljinder Singh, and Sahil Mehta
13 Disease Resistance Genes’Identification, Cloning, and
Characterization in Plants ................................ 249
Siddra Ijaz, Imran Ul Haq, Maria Babar, and Bukhtawer Nasir
14 Utilization of Biosensors in the Identification of Bacterial
Diseases in Maize ...................................... 271
Luis Germán López-Valdez, Braulio Edgar Herrera-Cabrera,
Rafael Salgado-Garciglia, Gonzalo Guillermo Lucho-Constantino,
Fabiola Zaragoza Martínez, Jorge Montiel-Montoya,
José Lorenzo Laureano, Luz María Basurto González, César Reyes,
and Hebert Jair Barrales-Cureño
Part IV Nanobiotechnology
15 Nanomaterials for Integrated Crop Disease Management ........ 295
Muhammad Ashar Ayub, Asad Jamil, Muhammad Shabaan,
Wajid Umar, Muhammad Jafir, Hamaad Raza Ahmad,
and Muhammad Zia ur Rehman
Contents ix
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations
as Nano-Fungicides for Sustainable Disease Management in
Cereals .............................................. 315
Hossam S. El-Beltagi, Eslam S. Bendary, Khaled M. A. Ramadan,
and Heba I. Mohamed
17 Applications of Nano-Biotechnological Approaches in Diagnosis
and Protection of Wheat Diseases .......................... 345
Charu Lata, Naresh Kumar, Gurpreet Kaur, Ritu Rani, Preeti Pundir,
and Anirudh Singh Rana
18 Nanomaterials for the Reduction of Mycotoxins in Cereals ....... 371
Mohamed Amine Gacem and Kamel A. Abd-Elsalam
About the Editors
Kamel A. Abd-Elsalam, Ph.D., is currently a Research
Professor at the Plant Pathology Research Institute,
Agricultural Research Center, Giza, Egypt. Dr. Kamel’s
research interests include developing, improving, and
deploying plant biosecurity diagnostic tools; under-
standing and exploiting fungal pathogen genomes,
plant genome editing using CRISPR technique; and
developing eco-friendly hybrid nanomaterials for
controlling toxicogenic fungi, plant diseases, and
nanobiotechnology applications in agroecosystems. He
published 20 books related to nano-biotechnology
applications in agriculture and plant protection, which
were published by the world’s major publishing houses
such as Springer. He has published more than 160
scientific research articles in international and regional
specialized scientific journals with a high impact factor
and has an h-index of 36 and an i-10 index of 95, with
5206+ citations. In 2014, he was awarded the Federation
of Arab Scientific Study Councils Prize for excellent
scientific research in biotechnology (fungal genomics)
(first ranking). In addition, according to Stanford
University’s worldwide database rating in 2021,
Kamel A. Abd-Elsalam has been listed among the top
2% of the world’s most influential scientists by Stanford
University. Dr. Kamel earned his Ph.D. in Molecular
Plant Pathology from Christian Albrechts University of
Kiel (Germany) and Suez Canal University (Egypt), and
in 2008, he was awarded a postdoctoral fellowship from
the same institution. Dr. Kamel was a visiting associate
professor at Mae Fah Luang University in Thailand, the
Institute of Microbiology at TUM in Germany, the
Laboratory of Phytopathology at Wageningen Univer-
sity in the Netherlands, and the Plant Protection
xixi
Department at Sassari University in Italy and Moscow
University in Russia. He was ranked within the top
2% of the most influential scientists in the world in
nanobiotechnology for the year 2020 by Stanford
University.
xii About the Editors
Heba I. Mohamed is a Professor of Plant Physiology,
Faculty of Education, Biological and Geological
Sciences Department, Ain Shams University. Dr. Heba
completed her M.Sc. and Ph.D. in Plant Physiology,
Faculty of Education, Ain Shams University. Dr.
Heba’s research interests include biotic and abiotic
stresses, plant biochemistry, use of eco-friendly
compounds to alleviate plant stress, plant secondary
metabolites, and genetic differences between different
genotypes. She edited five books. She has published 24
book chapters, 5 review articles, more than 88 scientific
research in international peer-reviewed journals, and has
an h-index of 32 in Scopus. Dr. Heba is a reviewer of
international peer-reviewed journals. She also is editor
of the Microbial Biosystems journal. Dr. Heba has
obtained a certificate of recognition in honor of achieve-
ment in international publication that supports Ain
Shams University World. In addition, according to
Stanford University’s worldwide database rating in
2021, Heba I. Mohamed has been listed among the top
2% of the world’s most influential scientists by Stanford
University.
Part I
Identification and Diagnosis
An Introduction to Rice Diseases 1
Parteek Prasher and Mousmee Sharma
Abstract
Rice (Oryza sativa) represents the major food, feeding more than half of the world
population every day. The dependence of such a large population to meet their
daily dietary requirements on this tropical crop causes large-scale production in
different parts of the world. Since the crop thrives comfortably in humid climates,
the areas differing in such environmental conditions require the application of
agrochemicals and require an extensive crop management programme to effi-
ciently manage the diseases that hamper the crop’s growth. The rice diseases,
mainly caused by bacteria, fungi, and viruses, lead to significant damage and loss
in the crop yield. The fungal diseases mainly attack stems, roots, grains, and
foliage. The level of plant damage caused by these diseases depends on the innate
capacity of the crop species to withstand the disease, severe environmental
conditions, soil fertility and composition, the effect of agrochemicals, and the
stage of plant growth. This chapter provides a concise discussion of the various
diseases caused by bacteria, fungi, and viruses that impede rice crop growth.
Keywords
Oryza sativa · Diseases · Crop yield · Foot rot · Blast · Bacterial diseases · Fungal
diseases
P. Prasher (*) · M. Sharma
Department of Chemistry, University of Petroleum and Energy Studies, Energy Acres, Dehradun,
Uttarakhand, India
Department of Chemistry, Uttaranchal University, Dehradun, Uttarakhand, India
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_1
3
1.1 Introduction
4 P. Prasher and M. Sharma
Disease is an abnormal condition of the plant species that deters the optimal
functioning of its cells, tissues, enzymes, and biological and biochemical pathways
(Nazarov et al. 2020). Disease in plants occurs via biotic factors or pathogens such as
nematodes, bacteria, fungi, viruses, and mycoplasma. In addition, the abiotic or
physical factors such as temperature, soil pH, nutrient deficiency, moisture content,
presence of toxic elements in soil, water stress, heavy metal stress, and amount of
light readily influence the plant’s growth and development or the progression of
diseased conditions (Hasan et al. 2020; Pautasso et al. 2012; Elad and Pertot 2014).
The rice diseases cause an approximate 10% loss in annual production, with main
diseases as ‘blast’and ‘helminthosporium’caused by Pyricularia oryzae Cav. and
Cochliobolus miyabeanus, respectively (Asibi et al. 2019), while ‘stem rot’and ‘foot
rot’diseases caused by Leptosphaeria salvinii Catt. and Gibberella fujikuroi,
respectively, deter the production of rice adversely. The incidence of blast epidemic
reportedly claims 60–70% loss in the rice production or even 100% crop loss in the
individual fields (Nalley et al. 2016; Kihoro et al. 2013; Kirtphaiboon et al. 2021).
Blast disease causes severe leaf infection, especially in the post-transplanting stage,
causing total destruction of the foliage. Due to this disease, the half-filled rice
earheads that form tend to break and fall off. The treatment of “foot rot”includes
application of the seedlings with organo-mercurial fungicides (Kongcharoen et al.
2020), whereas the “blast”disease is much more widespread and requires immediate
attention to prevent its spread. The popularisation of the breeding of resistant
varieties of rice seedlings represents another desirable approach to prevent the
outburst of diseases and to obtain a good yield (Laha et al. 2017; Miah et al. 2013;
Dubina et al. 2020). Figure 1.1 illustrates the major diseases in rice. This chapter
deals with a succinct discussion of the various diseases of rice and their causal
pathogens.
1.2 Fungal Diseases in Rice
Nearly 20,000 fungal species reportedly cause plant diseases globally. These fungal
species remain active or dormant on both living and dead tissues of the plants
depending on the conditions favouring their growth and proliferation. Pathogenic
fungi produce spores that, when dispersed by air, water, soil, invertebrates, and
insects, may affect the whole crop. Certain fungi, such as mycorrhizae, provide
significant benefits to plants by forming mutualistic relationships with their roots
(Iqbal et al. 2021). Majority of the fungal species cause plant diseases, including rust,
wily, blight, canker, leaf spot, anthracnose, mildew, and root rot. Fungal diseases
such as rice blast serve as an alarming threat to global food security owing to their
widespread distribution and destruction of the rice crop. Magnaporthe oryzae causes
rice blast disease, which is the most devastating fungal disease, infecting the plant
during all the growth stages and hampering the crop yield by 10–35%. Countering
this pathogen encompasses cultural, biological, and molecular approaches that lead
to the development of tolerant and resistant rice varieties by adopting effective
breeding programs (Hirooka and Ishii 2013;O’Brien 2017; Sabri et al. 2020).
Identification, isolation, and characterisation of several blast-resistant genes resulted
in the emergence of allelic variants via molecular breeding and transgenic
approaches such as miRNA and genome editing (Tabassum et al. 2021).Similarly,
in the management of fungal resistance in rice, breeding techniques such as gene
rotation, pyramiding, and multiline varieties proved highly profitable (Ramalingam
et al. 2020). However, the co-evolution of the pathogens and their variable nature
necessitate consistent research aimed at the advancement of sustainable, resistant
cultivators. Table 1.1 presents the various fungal diseases in rice, their causal
organisms, symptoms, and the affected plant parts.
1 An Introduction to Rice Diseases 5
Fig. 1.1 Various diseases in rice crop that affect its yield
1.3 Bacterial Diseases in Rice
Bacterial blight caused by gram-negative bacteria Xanthomonas oryzae pv. oryzae
and bacterial leaf streak disease caused by the gram-negative bacteria Xanthomonas
oryzae pv. oryzicola represent the deadliest bacterial disease in rice that affect the
overall rice production worldwide (Yugander et al. 2017; Pradhan et al. 2020).
Nevertheless, the rice plant too has adopted innate potency to counter the bacterial
(continued)
6 P. Prasher and M. Sharma
Table 1.1 Symptoms and causal organism for the various fungal diseases in rice
Disease Symptoms
Causing
organism Ref.
Rice
blast
•Above ground parts of rice get effected
•Elliptical or spindle-shaped legions occur on
leaf blade
•Lesions enlarge and coalesce eventually
killing the leaf
•Stem node turns blackish and becomes
fragile
•Brown lesions appear on branches of
panicles and spikelets
Pyricularia
grisea
Greer et al.
(1997)
Sheath
blight
•Ellipsoid or ovoid lesions appear on leaf
sheath
•Lesions coalesce and become bigger thereby
causing leaf death
•Waterline in the low land fields serve as
favourable condition for fungal growth
Rhizoctonia
solani
Li et al.
(2021)
Brown
spot
•Small, circular, brown coloured lesions on
seedlings
•Black discoloration of root occurs
•Fungus causes dark brown to black oval
spots on glumes
•Black discoloration of grain occurs
•Affected seedlings show stunted growth
Bipolaris
oryzae
Shabana
et al. (2008)
Leaf
scald
•Zonate lesions, alternating light tan and dark
brown spots starting from leaf edges
•Enlargement and coalescing of lesions
causes blight of leaf blade
•Scalded appearance of leaf occurs
Microdochium
oryzae
Manandhar
(1999)
Narrow
brown
spot
•Short, linear, and brown lesions on leaf
sheath, pedicels, and glumes
•Net blotch-like pattern appears on leaf sheath
as the cell wall turns dark brown, while
intercellular areas turn tan to yellow
•Diseases mainly appear in the mature stages
of the rice crop
Cercospora
janseana
Simanjuntak
et al. (2020)
Stem rot •Disease symptoms appear in the field after
mild tillering stage
•Small, blackish, irregular lesion appears on
outer leaf sheath near water line
•Fungus penetrates into the inner leaf sheath
and causes partial/entire rotting
•Fungus penetrates and rots the culm
•Infection of the culm causes lodging, chalky
grains, unfilled panicles, and death of the tiller
•Infected stem contains dark greyish
mycelium
•Tiny, black sclerotia embed the diseased leaf
sheath tissue
Sclerotium
oryzae
Ghosh et al.
(2020)
attack. The plant’s immune response consists of dual mechanisms to counter the
bacterial attack. Cell surface-localized pattern recognition receptors play a central
role in the detection of pathogen-associated molecular patterns, including the highly
conservative flagella of bacteria essential for sustaining the life of the pathogen
(Mendes et al. 2018; Yuan et al. 2021a,b; Kim et al. 2020). These microbial
components cause a variety of responses, including reactive oxygen species (ROS)
generation, increased calcium ion concentrations, callose aggregation in the cell
wall, activation of mitogen-activated protein kinases (MAPKs), and production of
antimicrobial components such as phytoalexins (Jeandet 2015). Mainly, the broad-
spectrum resistance shown by plants overcomes the intruding pathogens. It
comprises a defence mechanism chiefly localised within the plant cell based on
polymorphic resistance proteins that identify the specific virulence effectors secreted
by the pathogens within the host cells, thereby prompting effector-triggered immu-
nity (ETI) (Meng et al. 2020; Wang et al. 2016). ETI represents a robust resistance
mechanism associated with cellular senescence at the infection site (Liu et al. 2013;
1 An Introduction to Rice Diseases 7
Table 1.1 (continued)
Disease Symptoms
Causing
organism Ref.
Sheath
rot
•Leaf sheath containing young panicles gets
rotted
•Whitish powdery growth occurs inside
affected sheath
•Panicle fails to emerge as they remain inside
the sheath
•Grains become sterile, shriveled, and
discoloured
•Panicles that fail to emerge become rot
•Florets turn red brown to dark brown
Sarocladium
oryzae
Ayyadurai
et al. (2005)
Bakanae •Hypertrophic effect or abnormal elongation
of plant occurs
•Affected plants produce adventitious roots at
the lower nodes of the culm
•Affected plants contain very few tillers, and
leaves dry quickly
•Diseased tillers die quickly even before
reaching maturity
•Surviving infected plants bear empty
panicles
Fusarium
fujikuroi
Singh et al.
(2019)
False
smut
•Individual grains of the panicle turn into
greenish spore balls with velvety appearance
•Membrane around the spore balls eventually
bursts as the spore grows while being enclosed
in the floral parts
•The outermost layer of the ball contains
mature spores and the remaining fragments of
the mycelium
Ustilaginoidea
virens
Fan et al.
(2020)
Yuan et al. 2021a,b). This hypersensitive response serves as the strongest immune
retort against the invading pathogen. Nonetheless, the approaches to mitigating the
bacterial blight of rice present only trivial effectiveness. Chemical disease control is
generally discouraged due to its environmental and human toxicity (Zhai et al. 2002;
Amoghavarsha et al. 2021). The development of resistance among the pathogenic
bacterial strains further questions the chemical methods of disease control (Ellur
et al. 2016).Breeding of rice varieties with sturdy genes against the bacterial
infection presents a viable option to ensure a healthy crop (Tao et al. 2021; Kumar
et al. 2020a,b). The introduction of these genes to the genomes of commercial rice
strains presents a highly desirable strategy to counter bacterial infection in the
tropical countries that produce huge yields of rice every year (Wang et al. 2020;
Oliva et al. 2019). Table 1.2 presents the various bacterial diseases in rice, their
causal organisms, symptoms, and the affected plant parts.
8 P. Prasher and M. Sharma
Table 1.2 Symptoms and causal organism for the various bacterial diseases in rice
Disease Symptoms
Causing
organism Ref.
Bacterial
blight
•Water-soaked lesions appear at the leaf
margin
•Increase in the size of affected region
•Yellowish border appears between dead and
green areas of the leaf
•Withering of leaves or entire young plant
occurs
•Leaves become pale yellow at later stage of
growth
Xanthomonas
oryzae
He et al.
(2010)
Bacterial
leaf streak
•Water-soaked streaks appear between the
leaf veins
•Later, these become longer and translucent
and become light brown coloured
•Large areas of leaf become dry due to
numerous streaks
Xanthomonas
oryzae
Jiang et al.
(2020)
Foot rot •Infected plants become taller
•Plants become thin, with yellowish green
leaves
•Seedlings dry at an early tillering
•Partially filled grains
Dickeya zeae Pu et al.
(2012)
Grain rot •Wilting and rotting of leaves
•Discoloration of panicle
•Shrivelled leaves
•Lesions on seeds
•Lesions on glumes
Burkholderia
glumae
Zhou et al.
(2016)
Sheath
brown rot
•Appearance of necrotic areas on leaves
•Discolouration of seeds occurs
•Leaves show abnormal colours
•Spikelets of emerging panicles become
discoloured
Pseudomonas
fuscovaginae
Razak
et al.
(2009)
1 An Introduction to Rice Diseases 9
1.4 Virus Diseases in Rice
In India, four virus types primarily affect the rice crop, with tungro being the most
widespread virus disease affecting the rice crop in more than ten Indian states
(Sharma et al. 2017; Nguyen et al. 2021). The virus diseases such as grassy stunt
and strains such as GCV4 are confined to the southern part of the country (Ta et al.
2013; Zhao et al. 2021). Virus diseases like ragged stunt and necrotic mosaic are
among the most damaging to rice production in India (Ghosh 1980; Bhattacharya
et al. 2020). The majority of rice disease-causing viruses thrive in Asian and
American continents, but rice stripe necrosis furovirus, maize streak germivirus,
African cereal streak virus, rice yellow mottle sobemivirus, and rice crinkle disease
persist in Africa and neighbouring countries (Awodero 1991; Liu et al. 2020).
Intensified rice cultivation and the application of high-yield varieties, mechanical
contamination, unregulated use of pesticides, fertilizers, and practise of crop mono-
culture serve as the determining factors for the evolution of virus diseases in rice
(Ichiki et al. 2013; Rybicki 2015; Chen et al. 2020). The japonica rice varieties in the
Americas and the Asian continents show vulnerability to the virus diseases, while the
indica rice varieties show susceptibility to the virus-borne diseases (Cho et al. 2013;
Orasen et al. 2020). Breeding and screening resistant rice varieties, plant quarantine,
integrated pest management strategies, and the development of genetically
engineered resistant rice varieties are all important approaches for effective disease
management in rice (Savary et al. 2012; Chatterjee et al. 2021). Table 1.3 presents
the various virus diseases in rice, their causal organisms, symptoms, and the affected
plant parts.
1.5 Nematode Diseases in Rice
Nematodes predominantly cause a huge economic loss, mainly to two crops, maize
and rice. The nematodes cause significant cellular changes inside the root-knot
nematode-induced feeding sites upon interaction with the rice crop (Kyndt et al.
2014). The transcriptome analyses, exogenous hormone application, and mutant
analyses suggested comprehensive models depicting the interactions of plant hor-
mone pathways, such as jasmonate, in response to the innate defence adopted by rice
against nematodes (Zhou et al. 2020; Gheysen and Mitchum 2019; Wang et al.
2014a,b). The nematodes represent soil-borne pathogens that pose a threatening loss
to rice cultivators due to the emergence of new cultivation practises that include less
water usage for growing the rice crop (Khan and Ahamad 2020). Reportedly, the
nematode pathogens cause an alarming 10–25% loss to the rice crop worldwide
(Kumar et al. 2020a,b). The havoc of pathogenic nematodes is mainly confined to
tropical and subtropical regions with a large variety of species (Porazinska et al.
2012; Reddy 2021). In addition, the lack of proper resources for effective crop
management and control and the ideal conditions for the thriving of nematode
populations serve as determining factors for the nematode diseases in the rice crop
grown in these areas (Prasad et al. 1987; Khan et al. 2021). Table 1.4 presents the
10 P. Prasher and M. Sharma
Table 1.3 Symptoms and causal organism for the various virus diseases in rice
Disease Symptoms Causing organism Ref.
Tungro •Affected areas exhibit stunted growth and
reduced tillering
•Leaves become orange-yellow coloured
and develop rust-coloured spots
•Leaf become discoloured starting from
the tip that extends till the lower part of leaf
blade
•Young leaves display mottled appearance
•Old leaves show rust-coloured specks of
various sizes
•Affected plants show a delayed flowering
•Panicles bear partially filled grains
covered with dark brown specks
•Transmitted by green leafhoppers
Rice tungro
bacilliform virus and
spherical virus
Zarreen
et al.
(2018)
Grassy
stunt
•Plant show severe stunting
•Plants show excessive tillering
•Leaves may be mottled or striped
•Transmitted by brown plant hopper
Rice grassy stunt virus Satoh
et al.
(2013)
Ragged
stunt
•Plant show severe stunting
•Plants show reduced tillering
•Leaves show ragged appearance
•Leaf blades twist to form a spiral
•Vein swelling appear on leaf sheath, leaf
blade, and culm
•Transmitted by brown plant hopper
Rice ragged stunt
virus
Wang
et al.
(2014a,b)
Table 1.4 Symptoms and causal organism for the various nematode diseases in rice
Disease Symptoms
Causing
organism Ref.
Ufra or
stem
nematode
•Affected seedlings and plant show
chlorosis
•Stunted plant growth
•Deformation and twisting of leaves occur
•Exserted panicles, with unfilled grains
Ditylenchus
angustus
Ali and
Ishibashi
(1996)
White tip •Chlorosis of leaf occurs
•Infected leaf dries up and shreds
•Flag leaf becomes twisted
•Panicles do not emerge
•If panicles emerge, they display high
sterility, distorted kernels, and distorted
glumes
Aphelenchoides
besseyi
Ou et al.
(2014)
Root knot •Infected plants display stunted growth and
become yellow
•Infected plants show reduced tillering
•Infected plants show the appearance of
root galls
•Disease mostly occurs in upland, as
compared to the lowland rice
Meloidogyne
graminicola
Tian et al.
(2018)
various virus diseases in rice, their causal organisms, symptoms, and the affected
plant parts.
1 An Introduction to Rice Diseases 11
1.6 Conclusion
Oryza sativa, grown mainly as an annual plant, survives as a perennial crop in
tropical areas. The rice crop in these areas faces vulnerability to a variety of diseases
caused by bacteria, fungus, and nematodes, mainly due to the climatic conditions.
Excessive use of fertilizers and chemicals to increase crop production and yield in
order to feed the world’s population exacerbates the crop’s susceptibility to disease.
The overuse of chemicals increases the incidence of microbial resistance and causes
biomagnification in the higher trophic levels. However, plant breeding techniques,
integrated pest management, biological methods of crop management, genome
culturing, and the cultivation of resistant varieties of rice have contributed towards
the effective management of rice disease. The production of flood-resistant rice,
drought-resistant rice, and salt-tolerant rice also made sure there was enough of the
crop to go around.
Acknowledgement The Department of Chemistry, GNDU is duly acknowledged for this work.
References
Ali MR, Ishibashi N (1996) Growth and propagation of the rice stem nematode, Ditylenchus
angustus, on rice seedlings and fungal mat of Botrytis cinerea. Jpn J Nematol 26:12–22
Amoghavarsha C et al (2021) Chemicals for the management of paddy blast disease. In: Nayaka SC,
Hosahatti R, Prakash G, Satyavathi CT, Sharma R (eds) Blast disease of cereal crops. Fungal
biology. Springer, Cham. https://doi.org/10.1007/978-3-030-60585-8_5
Asibi AE, Chai Q, Coulter JA (2019) Rice blast: a disease with implications for global food
security. Agronomy 9:451
Awodero VA (1991) Rice yellow mottle virus in west Africa. Trop Pest Manag 37:356–362
Ayyadurai N, Kirubakaran SI, Srisha S, Sakthivel N (2005) Biological and molecular variability of
Sarocladium oryzae, the sheath rot pathogen of rice (Oryzae sativa L.). Curr Microbiol 50:319–
323
Bhattacharya S, Mukherjee A, Phadikar S (2020) A deep learning approach for the classification of
rice leaf diseases. In: Bhattacharyya S, Mitra S, Dutta P (eds) Intelligence enabled research.
Advances in intelligent systems and computing, vol 1109. Springer, Singapore. https://doi.org/
10.1007/978-981-15-2021-1_8
Chatterjee S, Gangopadhyay C, Bandopadhyay P, Bhowmick MK, Roy SK, Majumder A, Gathala
MK, Tanwar RK, Singh SP, Birah A, Chattopadhyay C (2021) Input-based assessment on
integrated pest management for transplanted rice (Oryza sativa) in India. Crop Prot 141:105444
Chen J, Zhang D, Nanehkaran YA, Li D (2020) Detection of rice plant diseases based on Depp
transfer learning. J Sci Food Agric 100:3246–3256
Cho WK, Lian S, Kim S-M, Park S-H, Kim K-H (2013) Current insights into research on Rice stripe
virus. Plant Pathol J 29:223–233
Dubina EV, Kostylev PI, Garkusha SV, Ruban MG (2020) Development of blast resistant rice
varieties based on application of DNA technologies. Euphytica 216:162
12 P. Prasher and M. Sharma
Elad Y, Pertot I (2014) Climate change impacts on plant pathogens and plant diseases. J Crop
Improv 28:99–139
Ellur RK, Khanna A, Yadav A, Pathania S, Rajashekara H, Singh VK, Krishnan SG, Bhowmick
PK, Nagarajan M, Vinod KK, Prakash G, Mondal KK, Singh NK, Prabhu KV, Singh AK (2016)
Improvement of basmati rice varieties for resistance to blast and bacterial blight diseases using
marker assisted backcross breeding. Plant Sci 242:330–341
Fan J, Liu J, Gong Z-Y, Xu P-Z, Hu X-H, Wu J-L, Li G-B, Yang J, Wang Y-Q, Zhou Y-F, Li S-C,
Wang L, Chen X-Q, He M, Zhao J-Q, Li Y, Huang Y-Y, Hu D-W, Wu X-J, Li P, Wang W-M
(2020) The false smut pathogen Ustilaginoidea virens requires rice stamens for false smut ball
formation. Environ Microbiol 22:646–659
Gheysen G, Mitchum MG (2019) Phytoparasitic nematode control of plant hormone pathways.
Plant Physiol 179:1212–1226
Ghosh SK (1980) Rice necrosis mosaic. Proc Plant Sci 89:291–299
Ghosh T, Pradhan C, Das AB (2020) Control of stem-rot disease of rice caused by Sclerotium
oryzae catt and its cellular defense mechanism—a review. Physiol Mol Plant Pathol 112:101536
Greer CA, Scardaci SC, Webster RK (1997) First report of rice blast caused by Pyricularia grisea in
California. Plant Dis 81:1094
Hasan RI, Yusuf SM, Alzubaidi L (2020) Review of the state of the art of deep learning for plant
diseases: a broad analysis and discussion. Plan Theory 9:1302
He Y-W, Wu J, Cha J-S, Zhang L-H (2010) Rice bacterial blight pathogen Xanthomonas oryzae
pv. oryzae produces multiple DSF-family signals in regulation of virulence factor production.
BMC Microbiol 10:187
Hirooka T, Ishii H (2013) Chemical control of plant diseases. Australas Plant Pathol 79:390–401
Ichiki TU, Shiba T, Matsukura K, Ueno T, Hirae M, Sasaya T (2013) Detection and diagnosis of
rice-infecting viruses. Front Microbiol 4:289
Iqbal MT, Ahmed IAM, Isik M, Sultana F, Ortas I (2021) Role of mycorrhizae inoculations on
nutrient uptake in rice grown under aerobic and anaerobic water management. J Plant Nutr 44:
550–568
Jeandet P (2015) Phytoalexins: current progress and future progress. Molecules 20:2770–2774
Jiang N, Yan J, Liang Y, Shi Y, He Z, Wu Y, Zeng Q, Liu X, Peng J (2020) Resistance genes and
their interactions with bacterial blight/leaf streak pathogens (Xanthomonas oryzae) in rice
(Oryza sativa L.)—an updated review. Rice 13:3
Khan MR, Ahamad F (2020) Incidence of root-knot nematode (Meloidogyne graminicola) and
resulting crop losses in paddy rice in northern India. Plant Dis 104:186–193
Khan MR, Haque Z, Zaidi AB (2021) Biomanagement of rice root-knot nematode Meloidogyne
graminicola using five indigenous microbial isolates under pot and field trials. J Appl Microbiol
130:424–438
Kihoro J, Bosco NJ, Murage H, Ateka E, Makihara D (2013) Investigating the impact of rice blast
disease on the livelihood of the local farmers in greater Mwea region of Kenya. Springer Plus 2:
308
Kim W, Prokchorchik M, Tian Y, Kim S, Jeon H, Segnzac C (2020) Perception of unrelated
microbe-associated molecular patterns triggers conserved yet variable physiological and tran-
scriptional changes in Brassica rapa ssp. pekinensis. Hortic Res 7:186
Kirtphaiboon S, Humphries U, Khan A, Yusuf A (2021) Model of rice blast disease under tropical
climate conditions. Chaos Soliton Fract 143:110530
Kongcharoen N, Kaewsalong N, Dethoup T (2020) Efficacy of fungicides in controlling rice blast
and dirty panicle diseases in Thailand. Sci Rep 10:16233
Kumar A, Kumar R, Sengupta D, Das SN, Pandey MK, Bohra A, Sharma NK, Sinha P, Hajira AK,
Ghazi IA, Laha GS, Sundaram RM (2020a) Deployment of genetic and genomic tools towards
gaining a better understanding of Rice-Xanthomonas oryzae pv. oryzae interactions for devel-
opment of durable bacterial blight resistance rice. Front. Plant Sci 11:1152
Kumar V, Khan MR, Walia RK (2020b) Crop loss estimations due to plant-parasitic nematodes in
major crops in India. Natl Acad Sci Lett 43:409–412
1 An Introduction to Rice Diseases 13
Kyndt T, Fernandez D, Gheysen G (2014) Plant-parasitic nematode infections in rice: molecular
and cellular insights. Annu Rev Phytopathol 52:135–153
Laha GS et al (2017) Importance and management of rice diseases: a global perspective. In:
Chauhan B, Jabran K, Mahajan G (eds) Rice production worldwide. Springer, Cham
Li D, Li S, Wei S, Sun W (2021) Strategies to manage rice sheath blight: lessons from interactions
between rice and Rhizoctonia solani. Rice 14:21
Liu W, Liu J, Ning Y, Ding B, Wang X, Wang Z, Wang G-L (2013) Recent progress in
understanding PAMP- and effector-triggered immunity against the rice blast fungus
Magnaporthe oryzae. Mol Plant 6:605–620
Liu X, Cai W-J, Yin X, Yang D, Dong T, Feng Y-Q, Wu Y (2020) Two slender and crinkly leaf
dioxygenases play an essential role in rice shoot development. J Exp Bot 71:1387–1401
Manandhar JB (1999) Isolation of Microdochium oryzae and Pinatubo oryzae from rice seeds and
their survival on stored seeds. Eur J Plant Pathol 105:139–145
Mendes GPA, Adjemian S, Branco LM, Zanetti LC, Weinlich R, Bortoluci KR (2018) Pattern
recognition receptors and the host cell death molecular machinery. Front Immunol 10:3389
Meng X, Xiao G, Yanoria MJT, Siazon PM, Padilla J, Opulencia R, Bigirimana J, Habarugira G,
Wu J, Li M, Wang B, Lu G-D, Zhou B (2020) The broad-spectrum rice blast resistance (R) gene
Pita2 encodes a novel R protein unique from Pita. Rice 13:19
Miah G, Rafii MY, Ismail MR, Puteh AB, Rahim HA, Asfaliza R, Latif MA (2013) Blast resistance
in rice: a review of conventional breeding to molecular approaches. Mol Biol Rep 40:2369–
2388
Nalley L, Tsiboe F, Morat AD, Shew A, Thoma G (2016) Economic and environmental impact of
rice blast pathogen (Magnaporthe oryzae) alleviation in the United States. PLoS One 11:
e0167295
Nazarov PA, Baleev DN, Ivanova MI, Sokolova LM, Karakozova MV (2020) Infectious plant
diseases: etiology, current-status, problems and prospects in plant protection. Acta Nat 12:46–
59
Nguyen TH, Wang D, Rahman SU, Bai H, Yao X, Chen D, Tao S (2021) Analysis of codon usage
patterns and influencing factors in rice tungro bacilliform virus. Infect Genet Evol 90:104750
O’Brien PA (2017) Biological control of plant diseases. Australas Plant Pathol 46:293–304
Oliva R, Ji C, Grande GA, Tapia JCH, Quintero AP, Li T, Eom JS, Li C, Nguyen H, Liu B,
Auguy F, Sciallano C, Luu VT, Dossa GS, Cunnac S, Schmidt SM, Loedin HIS, Cruz CV,
Szurek B, Frommer WB, White FF, Yang B (2019) Broad-spectrum resistance to bacterial
blight in rice using genome editing. Nat Biotechnol 37:1344–1350
Orasen G, Greco R, Puja E, Pozzi C, Stile MR (2020) Blast resistant Rgenes pyramiding in
temperate japonica rice. Euphytica 216:40
Ou SQ, Gao J, Peng DL, Qi CY, Zhang JH, Meng Y, Lu BH (2014) First report of Aphelenchoides
besseyi causing white tip disease of rice in Jilian province, China. Plant Dis 98:1165
Pautasso M, Doring TF, Garbelotto M, Pellis L, Jeger MJ (2012) Impacts of climate change on plant
diseases—opinions and trends. Eur J Plant Pathol 133:295–313
Porazinska DL, Giblin-Davis RM, Powers TO, Thomas WK (2012) Nematode spatial and ecologi-
cal patterns from tropical and temperate rainforests. PLoS One 7:e44641
Pradhan SK, Barik SR, Nayak DK, Pradhan A, Pandit E, Nayak P, Das SR, Pathak H (2020)
Genetics, molecular mechanisms and deployment of bacterial blight resistance genes in rice.
Crit Rev Plant Sci 39:360–385
Prasad JS, Panwar MS, Rao YS (1987) Nematode problems of rice in India. Trop Pest Manag 33:
127–136
Pu XM, Zhou JN, Lin BR, Shen HF (2012) First report of bacterial foot rot of rice caused by a
Dickeya Zeae in China. Plant Dis 96:1818
Ramalingam J, Raveendra C, Savitha P, Vidya V, Chaitra TL, Velprabhakaran S, Saraswathi R,
Ramanathan A, Pillai MPA, Arumugachamy S, Vanniarajan C (2020) Gene pyramiding for
achieving enhanced resistance to bacterial blight, blast, and sheath blight diseases in rice. Front
Plant Sci 11:591457
14 P. Prasher and M. Sharma
Razak AA, Zainudin NAIM, Sidiqe SNM, Ismail NA, Izham NM, Mohamad N, Salleh B (2009)
Sheath brown rot disease of rice caused by Pseudomonas fuscovaginae in the Peninsular
Malaysia. J Plant Prot Res 49:244–249
Reddy PP (2021) Nematode diseases of crop plants: an overview. In: Nematode diseases of crops
and their management. Springer, Singapore. https://doi.org/10.1007/978-981-16-3242-6_1
Rybicki EP (2015) A top ten list for economically important plant viruses. Arch Virol 160:17–20
Sabri RS, Rafii MY, Ismail MR, Yusuff O, Chukwu SC, Hasan NA (2020) Assessment of agro-
morphologic performance, genetic parameters and clustering pattern of newly developed blast
resistant rice lines tested in four environments. Agronomy 10:1098
Satoh K, Yoneyama K, Kondoh H, Shimizu T, Sasaya T, Choi IR, Yoneyama K, Omura T, Kikuchi
S (2013) Relationship between gene responses and symptoms induced by Rice grassy stunt
virus. Front Microbiol 4:313
Savary S, Willocquet FHL, Heong KJ (2012) A review of principles for sustainable pest manage-
ment in rice. Crop Prot 32:54–63
Shabana YM, Fattah GMA, Ismail AE, Rashad YM (2008) Control of brown spot pathogen of rice
(Bipolaris oryzae) using some phenolic antioxidants. Braz J Microbiol 39:438–444
Sharma S, Kumar G, Mangrauthia S, Neeraja CN, Krishnaveni D, Dasgupta I (2017) Characteristics
of Tungrovirus occurring in India. In: Mandal B, Rao G, Baranwal V, Jain R (eds) A century of
plant virology in India. Springer, Singapore
Simanjuntak FAS, Safni I, Bakti D (2020) Distribution of narrow brown leaf spot disease of rice
(Cercospora oryzae Miyake) in north Sumatra. IOP Conf Ser Earth Environ Sci 454:012163
Singh R, Kumar P, Laha GS (2019) Present status of bakanae of rice caused by Fusarium fujikuroi
Nirenberg. Ind Phytopathol 72:587–597
Ta HA, Nguyen DP, Causse S, Nguyen TD, Ngo VV, Hebrard E (2013) Molecular diversity of Rice
grassy stunt virus in Vietnam. Virus Genes 46:383–386
Tabassum J, Ahmad S, Hussain B, Mawia AM, Zeb A, Ju L (2021) Applications and potential of
genome-editing systems in rice improvement: current and future perspectives. Agronomy 11:
1359
Tao H, Shi X, He F, Wang D, Xiao N, Fang H, Wang R, Zhang F, Wang M, Li A, Liu X, Wang
G-L, Ning Y (2021) Engineering broad-spectrum disease-resistant rice by editing multiple
susceptibility genes. J Integr Plant Biol 63:1639–1648
Tian Z-L, Maria M, Barsalote EM, Castillo P, Zheng J-W (2018) Morphological and molecular
characterization of the rice root-knot nematode, Meloidogyne graminicola, Golden and
Birchfeild, 1965 occurring in Zhejiang, China. J Integr Agric 17:2724–2733
Wang F, Li D, Wang Z, Dong A, Liu L, Wang B, Chen Q, Liu X (2014a) Transcriptomic analysis of
the rice white tip nematode, Aphelenchoides besseyi (Nematoda: Aphelenchoididae). PLoS One
9:91591
Wang H, Xu D, Pu L, Zhou G (2014b) Southern rice black-streaked dwarf virus alters insect
vectors’host orientation preferences to enhance spread and increase Rice ragged stunt virus
co-infection. Phytopathology 104:196–201
Wang R, Ning Y, Shi X, He F, Zhang C, Fan J, Jiang N, Zhang Y, Zhang T, Hu Y, Bellizzi M,
Wang G-L (2016) Immunity to rice blast disease by suppression of effector-triggered necrosis.
Curr Biol 26:2399–2411
Wang S, Liu W, Lu D, Lu Z, Wang X, Xue J, He X (2020) Distribution of bacterial blight resistance
genes in the main cultivators and application of Xa23 in rice. Front Plant Sci 11:555228
Yuan M, Jiang Z, Bi G, Nomura K, Liu M, Wang Y, Cai B, Zhou J-M, He SY, Xin X-F (2021a)
Pattern-recognition receptors are required for NLR-mediated plant immunity. Nature 592:105–
109
Yuan M, Ngou BPM, Ding P, Xin X-F (2021b) PTI-ETI crosstalk: an integrative view of plant
immunity. Curr Opin Plant Biol 62:102030
Yugander A, Sundaram RM, Ladhalakshmi D, Hajira SK, Prakasam V, Prasad MS, Madhav MS,
Babu VR, Laha GS (2017) Virulence profiling of Xanthomonas oryzae pv. oryzae isolates,
causing bacterial blight of rice in India. Eur J Plant Pathol 149:171–191
1 An Introduction to Rice Diseases 15
Zarreen F, Kumar G, Johnson AMA, Dasgupta I (2018) Small RNA-based interactions between rice
and the viruses which cause the tungro disease. Virology 523:64–73
Zhai W, Wang W, Zhou Y, Li X, Zheng X, Zhang Q, Wang G, Zhu L (2002) Breeding bacterial
blight-resistant hybrid rice with the cloned bacterial blight resistance gene Xa21. Mol Breed 8:
285–293
Zhao S, Wu Y, Wu J (2021) Arms race between rice and viruses: a review of viral and host factors.
Curr Opin Virol 47:38–44
Zhou C, Bo Z, Lin XG, Bin L, Shi H (2016) Research status and prospect of Burkholderia glumae,
the pathogen causing bacterial panicle blight. Ric Sci 23:111–118
Zhou Y, Zhao D, Shuang L, Xiao D, Xuan Y, Duan Y, Chen L, Wang Y, Liu X, Zhu X (2020)
Transcriptome analysis of rice roots in response to root-knot nematode infection. Int J Mol Sci
21:848
17
Bacterial Disease of Rice 2
Prasad Sunnapu, Shilpa Valiyaparambil,
Muddukrishnaiah Kotakonda, Dhanapal Yogananthan,
and Natarajan Ashokkumar
Abstract
Rice bacterial infections are a serious stumbling block to long-term output, and
they are quite important on a worldwide scale, particularly in Asian countries.
The management of these diseases, particularly bacterial diseases, has included
extensive research, including infection and disease development and chemical
therapy. By employing proper disease management approaches, bacterial infec-
tion can be overcome. Farmers are increasingly using chemical management
strategies to prevent output loss. When the disease condition and infection rate
in the infected area are out of control, chemical management is required. The
appropriate use of selective antibiotics and combinations of antibiotics will help
manage bacterial infections and prevent yield loss. Excessive and poor antibiotic
combination selection may disrupt the natural system’s balance, posing a health
risk to humans and animals. Chemicals used for longer periods may cause
disease-causing germs to develop resistance. Natural and chemical management
P. Sunnapu
Department of Pharmaceutical Chemistry, Sri Ramakrishna Institute of Paramedical Science,
College of Pharmacy, Coimbatore, India
S. Valiyaparambil
Department of Pharmaceutics, Karuna College of Pharmacy Iringuttoor, Palakkad, India
M. Kotakonda (*)
Faculty of Technology, Anna University, Chennai, India
D. Yogananthan
Department of Pharmacology, PSG College of Pharmacy, Coimbatore, India
N. Ashokkumar
Department of Biochemistry and Biotechnology, Annamalai University, Annamalai Nagar, Tamil
Nadu, India
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_2
strategies should be used together in a controlled way to achieve eco-friendly
results, so this is what you should do.
18 P. Sunnapu et al.
Keywords
Bacterial leaf blight · Bacterial leaf streak · Bacterial panicle blight · Antibiotics ·
Management
2.1 Introduction
The paddy crop (Oryza sativa) is widely grown in India and Asian countries. Rice is
one of the world’s most significant cereal crops, providing nutrition to the vast
majority of people in Africa, Asia, and Latin America (US Department of Agricul-
ture 2021; Kadu et al. 2015). Rice consumption has increased marginally in recent
crop years when compared to previous crops. India consumed roughly 504.3 million
metric tonnes of rice in the years 2020 and 2021 compared to the worldwide average.
In 2008/2009, 437.18 million metric tonnes of crop were consumed globally. After
China, India is the world’s second-largest rice producer. According to the area, rice
comprises about 23.3% of farmed land. It contributes 43% to food grain output and
46% to cereal production in the United States. Rice refers to a different number of
grain species. There are about 40,000 different varieties of Oryza sativa worldwide,
divided into four broad categories: indica, japonica, aromatic, and glutinous. Increas-
ing rice consumption means expanding rice-growing areas and increasing rice
production, both of which have made rice more vulnerable to disease (Fargette
et al. 2013; Dai et al. 2010).
Droughts, weather fluctuations, floods, and illnesses are among the variables that
affect rice yield. Rice is susceptible to a range of diseases caused by bacteria, viruses,
or fungi; the most devastating are bacterial infections, resulting in yield losses of up
to 50% depending on the rice variety, growth stage, geographic location, and
environmental conditions.
By implementing eco-friendly measures at an early stage, we can decrease or
eliminate the use of carcinogenic and toxic chemicals and reduce or eliminate the
discharge of such chemicals in agricultural land. When the condition has progressed
beyond the point where it is cost-effective, chemicals should be used. It will support
and promote the natural competitors of harmful bacteria in the ecosystem.
Bacterial leaf blight (BLB), bacterial leaf streak (BLS), and bacterial panicle
blight (BPB) are three main bacterial diseases of rice caused by Gram-negative
bacteria of the Xanthomonas oryzae genus: X. oryzae pv. oryzae (Xoo), X. oryzae
pv. oryzicola (Xoc), and Burkholderia. The bacterial leaf blight (BLB) disease can
cause yield losses of up to 50% in favourable situations (Ou S. Rice Infections). In
1884, farmers in the Fukuoka district of Kyushu, Japan, discovered BLB illness
(Tagami and Mizukami 1962) (Tagami and Mizukami 1962). Tagami and
Mizukami, the first cases of bacterial leaf streak (BLS), were discovered in Mali in
2003 and Burkina Faso in 2009 (Wonni I) (Wonni II) (Wonni III). BPB was first
identified as the principal cause of grain rotting and a seedling blight on rice in Japan
in 1967 and was dubbed bacterial grain rot. These illnesses are now considered
emergent diseases that can result in a significant decrease in gross rice yield.
Different species of Pantoea (Doni et al. 2019) and Sphingomonas (Kini et al.
2017) genera reduced the rice gross yield.
2 Bacterial Disease of Rice 19
Table 2.1 Major bacterial diseases which are causing maximum yield loss in the rice crop
Bacterial disease name Pathogenic bacterial species First reported year
Leaf blight Xanthomonas oryzae pv. oryzae 1884
Leaf streak Xanthomonas oryzae pv. oryzicola 2003
Panicle blight Burkholderia glume 1967
Xanthomonas oryzae has been identified as being responsible for bacterial leaf
blight-like symptoms in rice. Pantoea,P. stuartii,P. ananatis, and P. agglomerans
have all been identified as BLB disease-causing pathogens in different nations.
(HB Lee and AD Gonza’lez) Only a few isolates of Sphingomonas species have
been identified as plant pathogens and have been linked to BLB disease symptoms
(Kini et al. 2017).
Extensive research studies are on the Pantoea and Sphingomonas species to
establish the information and documentation of well-known Xanthomonas bacteria.
In rice, the bacterial sheath brown disease is caused by Pseudomonas fuscovaginae
through seed transmission. However, recently other pathogens like Sarocladium
oryzae and Fusarium spp. also showed similar sheath rot symptoms. Based on the
reported evidence in this chapter, we focused on the three bacterial diseases causing
divesting in the yield of rice. Table 2.1 contains the list of major bacterial diseases
and Table 2.2 the other stains of the bacterial species.
2.2 Rice Leaf Blight Disease
2.2.1 Disease Development
Xanthomonas oryzae infects the rice plants by invading through the water pores and
taking advantage of newly formed wounds (Mukoo et al. 1957). The pores for water
percolation in the plant can be found on the edges of the leaf’s upper section. Lesions
usually begin on the upper section of the leaf, at the leaf margins. The water-soaked
lesions became yellowish-white in hue, spreading from the square form’s equal sides
to form elongated circular to uneven lesions. The wavy margins of the leaf blades
were plainly visible on the leaves, which are an indication of the condition. Under
humid conditions, the lesions usually begin on both leaf margins and can even be
seen on newly infected leaf veins. The disease’s progression and the emergence of
symptoms in the rice field are both influenced by the environment. The illness can be
divided into two different phases, the leaf blight phase and kresek phase, which is the
harmful phase of the epidemic (Reddy and Ou 1976;Ou1985) (Fig. 2.1).
20 P. Sunnapu et al.
Table 2.2 List of the various bacterial stains
Species Type of bacteria Strain
X. oryzae pv. oryzae Gram-negative bacterium OS225
OS198
OS86
Z173
JS158-2
CJO13-1
BAI3
ABB27
ABB37
X. oryzae pv. oryzicola Gram-negative bacterium BAI10
BAI119
BLS256
AHB4-75
JSB3-22
YNB10-32
GXB3-14
SCB4-1
CJOC13-1
B. glumae Gram-negative bacterium CU-1
CU-2
CU-3
LMG2196
NCPPB3923
CFBP3831
3252–8
P. ananatis Gram-negative bacterium ARC22
ARC315
ARC593
P. stewartii Gram-negative bacterium ARC903
ARC10
P. agglomerans Gram-negative bacterium ARC982
ARC1000
ARC282
ARC933
2.2.1.1 Leaf Blight Phase
After the tillering stage reaches its maximum peak position, the leaf blight phase of
the rice leaf blight disease becomes more obvious in the tropical and temperate
zones, with the initial symptoms on the leaf blades. Bacterial infection normally
begins in the lower sections of the plant and expansions up to the leaf upperside
portion (Goto 1992; Cha et al. 1982). The upper half or entire portion of the leaf
blade acquires a pale yellow colour before drying up depending on the severity of the
disease (Mizukami and Wakimoto 1969).
2 Bacterial Disease of Rice 21
Fig. 2.1 1. Bacterial light caused by Xanthomonas oryzae pv. oryzae, 2. yellow droplets of bacteria
on the leaf, 3. dried bacteria on the leaf, 4. dried leaf margins (Jiang et al. 2020)
2.2.1.2 Kresek Phase
The word “Kresek”, which means “the sound of dead leaves,”were rubbed together
(Wakimoto 1969). This stage of the disease was originally documented in Indonesia
in the twentieth century in the context of a separate bacterial rice disease (Reitsma
and Schure 1950). The “Kresek”phase of the bacterial leaf blight illness appeared
1–2 weeks after the nursery plants were transplanted into the field. The plant’s leaves
turn grey-green to yellowish in extreme conditions. The disease’s“Kresek”phase
can also emerge in mature plant stages (Goto 1992; Watanabe 1975). Symptoms on
the foliar sections of the plant are similar to those on younger plants during the
Kresek phase, but the rotting of the stem also reaches the upper part of the leaf.
In the roots of the weed “Leersia hexandra”, the bacteria Xanthomonas Oryzae
will be detected. Bacteria infiltrate rice nursery beds during the growing season and
spread across the beds and channels as water is watered to the immature plants. The
pathogen might enter the rice nursery by infected straw or infected seeds in the field
(Mizukami and Wakimoto 1969). The pathogen accumulates on the surface of the
roots and travels towards the crown once it reaches young plants. The bacterium
begins to multiply by consuming the plant compounds released by the roots
(Mizukami 1957,1959,1961) (Mizukami 1957,1959,1961) (Mizukami). Under
moist conditions, the pathogen entered the stomata of coleoptiles and leaf sheath,
where it multiplied in the intercellular spaces of parenchyma. It was also speculated
and reported that the infection could be spread by insects or bugs, such as
Leptocorisa acuta, which was found in the rice crop (Mohiuddin et al. 1976).
2.2.2 Rice Bacterial Leaf Blight Management
Rice leaf blight can be controlled through hygienic conditions, the selection of
resistant seed variants, the application of appropriate pesticides, and the use of
biological control approaches. Cultural management methods such as using healthy
seeds, removing old and diseased straws and stubbles, maintaining an appropriate
water level, using nitrogenous compounds properly, and adopting a proper water
drainage system can aid in pathogen control.
22 P. Sunnapu et al.
2.2.3 Chemical Management
According to the literature and documented evidence, substantial research has been
conducted to establish the efficacy of various pesticides in controlling and managing
bacterial leaf blight in rice and reducing yield loss. Varying combinations of
antibiotics in various strengths have been recommended for disease inhibition by
various workers over the years. Table 2.3 lists some of the medications and
combinations used to treat BLB.
2.3 Bacterial Leaf Streak
2.3.1 Disease Development
Bacterial leaf streak is a seed-borne disease and is mainly infected by the pathogen
Xanthomonas oryzae pv. oryzicola. It can spread or infect through seed and physical
contact of the infected plant to other plants. The presence of moisture content around
the seed as a film facilitates the release of bacteria from the diseased seed and attacks
the inside tissue where it grows further as colonies. The bacterium enters through the
Table 2.3 Antibiotics and combination of antibiotics used in the chemical management of BLB
disease
S. No Antibiotics/combination of antibiotics Reference year
1 Streptomycin sulphate 200 ppm + copper oxychloride (0.25%) Kumar et al. (2009)
2 Streptocycline + copper sulphate were effective at 1000 ppm
concentration
Patel et al. (2009)
3 Amistar at 0.1% Mustafa et al. (2013)
4 Streptomycin + copper oxychloride highly effective under
in vitro condition at 4%
Singh et al. (2015)
5 Azoxystrobin 25 SC Swati et al. (2015)
6 Blitox 0.3% + streptocycline at 250 ppm Ashish et al. (2016)
7 Mancozeb 500 ppm + streptocycline 100 ppm Kamble et al. (2017)
8 Trifloxystrobin 25% + tebuconazole 50% at 50 ppm Bala et al. (2017)
9 Nativo 75 WG at 0.65% Qudsia et al. (2017)
10 Streptomycin at concentration of 0.03% and 0.05% was
effective
Prasad et al. (2018)
11 Carbendazim at 500 ppm concentration Jadhav et al. (2018)
12 Mancozeb at 500 ppm Jadhav et al. (2018)
13 Streptocycline at 250 ppm Jadhav et al. (2018)
openings on the leaf’s surface, stomata, and the wounds on the leaf. Under
favourable warm conditions, the bacteria multiply in parenchyma tissue and starts
spreading from bottom to top of the plant.
2 Bacterial Disease of Rice 23
The obvious signs appear as elongated streaks running down the leaf’s veins. The
disease’s primary symptom is the formation of thin water-soaked transparent veinal
streaks that can range in length from 1 to 10 cm. The veins constrict and restrict the
streaks, which turn yellow or orange-brown. The streaks become rough and dry as
they progress, coalescing to form huge patches that occasionally cover the entire leaf
surface. The infection has been found to spread to the leaf sheath and seed coat in
some instances, although the symptoms are unclear (Ou 1985). The presence of
water or dew on the leaf surface enhances the number of lesions by easily spreading
bacteria over the large surface area. The bacteria overwinter in the soil, other
perennial plants, and some other weed plants (Tillman et al. 1996) (Fig. 2.2).
2.3.2 Management of Bacterial Leaf Streak
The proper application of required fertilisers can manage the BLS. Proper distance
needs to be maintained during plantation to avoid or minimise the physical contact of
the plants. Selection of resistant seed varieties may reduce the intensity of the
infection and the loss of the yield. Before seeding, the seeds are treated with
chemicals and hot water to remove the spores of the bacteria. By practising field
sanitation, removing rattons and straws from the field will minimise the inoculum at
the beginning of the season. Providing a good drainage system for seedbeds,
Fig. 2.2 1. Initial water-
soaked lesions, 2. enlarged
and merged lesions (Shrvan
Kumar et al. 2017)
growing nurseries in isolated upland areas, and avoiding clipping seedlings during
transplantation may reduce the risk of bacterial infection to a large number of plants.
24 P. Sunnapu et al.
2.3.3 Chemical Management
Chemical control techniques for BLS have been studied and reported on in several
research. However, many of them have almost the same characteristics as the
bacterial leaf blight infection.
2.4 Bacterial Panicle Blight Disease
2.4.1 Disease Development
The Gram-negative bacteria Burkholderia glumae causes panicle blight disease
(BPB), also known as rice bacterial grain rot (BGR). Pseudomonas glumae, the
bacteria that causes bacterial panicle blight disease, was discovered in 1967 (Kurita
and Tabei 1967). In 1992, the non-fluorescent bacteria in Pseudomonas were
assigned to the genus Burkholderia. The bacteria’s optimum temperature for growth
is 30 degrees Celsius; however, it may still grow at tropical temperatures (Saddler
1994).
BPB is mostly a seed-borne disease, with inoculums that have persisted in the
soil. The inoculum can survive in the leaf sheath and panicle of adult rice plants, and
it can develop epiphytically from the booting stage (Goto and Ohata 1956; Uematsu
et al. 1976; and Sayler et al. 2006). Physical contact is also a way for it to spread
from one plant to another. Night-time temperatures are higher than humidity climatic
conditions, which encourage bacteria to proliferate rapidly, increasing the risk of
crop loss (Cha et al. 2001) (Cha et al. 2001). Cha et al. found that B. glumae can
cause sterility in spikelets as well as discolouration in growing seeds. The bacteria on
the leaf cause an initial infection, which then spreads to the sheath, infecting the
growing panicle (Tsushima 1991; Tsushima et al. 1996). The bacteria penetrate the
lemma and paleae through the stomata, where they multiply in parenchymatous
intercellular gaps before spreading to the plant’s surrounding healthy tissues (Tabei
et al. 1989). In some situations, bacteria have been found in the parenchyma,
epidermis, and sclerenchyma of glumes (Hikichi 1993). The entire disease cycle
hasn’t been studied yet, but a lot of research is going on to figure it out.
2.4.2 Management of Bacterial Panicle Blight Disease
The primary inoculum in the seeds is destroyed by soaking them in hot water for
10 min at 57 C (Tagami and Mizukami 1962). Appropriate field cleanliness, such as
eliminating old rice straws and alternate, collateral, weed, and volunteer plants, is
critical to avoid or prevent infection. When planting, it’s important to keep enough
spacing between the plants to avoid direct contact. When transplanting, avoid
trimming the seedling’s tip. The contact period of the inoculum can be reduced by
maintaining good irrigation and drainage of water. Disease rate can be minimized by
using resistant types and (IR-20, IRBB21, IR-36, Sasyasree, Govind, Pant Dhan-4,
Pant Dhan-6, and Saket-4) correct nitrogen fertiliser (Fig. 2.3).
2 Bacterial Disease of Rice 25
Fig. 2.3 Panicle blight
caused by bacterial B. glumae
(1. infection in sheath
2. panicles) (Ortega and Rojas
2021)
2.4.3 Chemical Management
Before seeding, the seeds can be soaked overnight in 100 ppm streptomycin solution
(Devadath and Padmanabhan 1970) which can eradicate the primary inoculum from
the seeds. P. fluorescens applied to wet seed treatment at a rate of 10 grammes per
kilogramme of seeds also aids in eradicating the main inoculum. Spraying of neem
oil 60 EC at 3% or NSKE @5% in the field can control the disease spreading to
healthy plants. Some other antibiotics used in BPB disease management are listed in
Table 2.4.
2.4.4 Molecular Diagnosis of Bacterial Disease of Rice Disease
The presence of X. oryzae and B. glumae in infected rice may cause damage the crop;
many studies have listed the three bacteria as quarantined organisms. Both conven-
tional and real-time PCR have been widely used to detect or verify the presence of
X. oryzae and B. glumae in recent decades. These molecular-based methods are
rapid, accurate, and sensitive for detecting pathogens. However, they can detect only
one pathogen each. Several methods have been developed to distinguish highly
similar pathovars of X. oryzae and X. oryzae pv. oryzicola using multiplex or real-
time PCR.
26 P. Sunnapu et al.
Table 2.4 Antibiotics used in the disease management of BPB
S. No Antibiotics Reference year
1 Streptocycline at 100 μg Banerjee et al. (1984)
2 Agrimycin 100 at 100 μg Banerjee et al. (1984)
3 Oxolinic acid at 300 μg Shtienberg et al. (2001)
4 Streptomycin sulphate at 100 μg Shtienberg et al. (2001)
5 Glycoside B at 700 μg Shtienberg et al. (2001)
6 Kasugamycin at 80 μg Shtienberg et al. (2001)
Table 2.5 Primer used for the detection of bacterial disease of rice
Pathogen Primer Sequence Reference
Xanthomonas oryzae
pv. oryzae
Xo3756F CATCGTTAGGACTGCCAGAA Bangratz et al.
(2020)
Xo3756R GTGAGAACCACCGCCATCT
Burkholderia glume toxB-F GCATTTGAAACCGAGATGGT
toxB-Rd TCGCATGCAGATAACCRAAG
2.4.4.1 Sample Collection
Rice-infected bacterial samples were collected from the paddy field and cultured in
selective culture media Luria-Bertani medium for 24 h.
2.4.4.2 Bacterial DNA Isolation
Rice-infected bacterial DNA was extracted with a genomic DNA isolation kit
following the manufacture protocol. Quality of extracted DNA was checked using
NanoPhotometer UV/VIS spectrophotometer. The optical density 260/280 of the
isolated DNA was approximately 1.8 and diluted in double distilled water
(Table 2.5).
The bottleneck for PCR-based diagnostic or detection tools has been the avail-
ability of pathogen-specific primers. Sequence polymorphisms of 16S ITS are often
observed in strains of different species. In previous studies, specific DNA primers
and probes have been designed based from 16S.
2.5 Conclusion
The major challenges for farmers in the production and cultivation of rice are
overcoming natural disasters and various microbial diseases. It’s not possible to
take steps to overcome natural disasters against Mother Nature. But the other
microbial diseases can be overcome by practising the proper disease management
techniques. Nowadays, farmers are adopting chemical management techniques to
reduce the loss of yield. Chemical management needs to adapt when the disease
condition and the rate of infection of the infected area are not under control. The
proper application of selective antibiotics and a combination of antibiotics will
control bacterial diseases and help to reduce the loss of yield. Excessive and poor
antibiotic mixture selection may disturb the standard system’s balance, posing a
hazard to humans and livestock. Further, prolonged usage of chemicals may cause
resistance in the disease-causing bacteria. So, it is advisable to adopt both natural and
chemical management techniques in a controlled and interdependent way to achieve
eco-friendly results. Molecular techniques will help to detect the bacterial disease
caused by the rice pathogen.
2 Bacterial Disease of Rice 27
References
Ashish, Arora A, Gill PPS, Jawandha SK (2016) Effect of agro chemicals on severity of bacterial
blight and fruit quality in pomegranate. Int J Agric Environ Biotechnol 9:1061–1067
Bala A, Rai B, Priya S, Kumar R (2017) In vitro evaluation of various fungicides and plant extracts
against Xanthomonas oryzae pv. oryzae isolated from rice (Oryzae sativa L.). Int J Curr
Microbiol App Sci 6(5):421–427
Banerjee AK, Rai M, Srivastava SS, Singh DV (1984) Suitable dose of streptocycline and
agrimycin-100 for the control of bacterial leaf streak of paddy. Indian Phytopathol (India)
37(4):726–728
Bangratz M, Wonni I, Kini K, Sondo M, Brugidou C, Béna G, Gnacko F, Barro M, Koebnik R,
Silué D, Tollenaere C (2020) Design of a new multiplex PCR assay for rice pathogenic bacteria
detection and its application to infer disease incidence and detect co-infection in rice fields in
Burkina Faso. PLoS One 15:e0232115
Cha KH, Kim YS, Kim H, Lee DK, Kim MS (1982) Effects of application levels of fertilizer on the
susceptibility to bacterial leaf blight, yield and quality of grains in nineteen rice cultivars in
Jeonnam Region. Kor J Plant Proct 21:216–221
Cha KH, Lee YH, Ko SJ, Park SK, Park IJ (2001) Influence of weather condition at heading period
on the development of rice bacterial grain rot caused by Burkholderia glumae. Res Plant Dis 7:
150–154
Dai LY, Liu XL, Xiao YH, Wang GL (2010) Recent advances in cloning and characterization of
disease resistance genes in rice. J Integr Plant Biol 49:112–119
Devadath S, Padmanabhan SY (1970) Approaches to control bacterial blight and streak diseases of
rice in India. Bull Indian Phytopathol Soc 6:5–12
Doni F, Suhaimi NSM, Mohamed Z, Ishak N, Mispan MS (2019) Pantoea: a newly identified
causative agent for leaf blight disease in rice. J Plant Dis Protect 126:491–494
Goto M (1992) Fundamentals of bacterial plant pathology. Academic Press, San Diego, CA, p 342
Goto K, Ohata K (1956) New bacterial diseases of rice (brown stripe and grain rot). Ann
Phytopathol Soc Jpn 21:46–47
Hikichi Y (1993) Relationship between population dynamics of Pseudomonas glumae on rice
plants and disease severity of bacterial grain rot of rice. J Pesticide Sci 18:319–324
Jadhav RR, More AS, Apet KT, Dandnaik BP (2018) In vitro Bioefficacy of Different Antibiotics,
Fungicides and Botanicals against (Xanthomonas axonopodis pv. citri.) causing Bacterial
canker of Kagzi Lime. Int J Curr Microbiol App Sci 6:1693–1699
Jiang N, Yan J, Liang Y, Shi Y, He Z, Wu Y, Zeng Q, Liu X, Peng J (2020) Resistance genes and
their interactions with bacterial blight/leaf streak pathogens (Xanthomonas oryzae) in rice
(Oryza sativa L.)-an updated review. Rice (N Y) 13:1–12
28 P. Sunnapu et al.
Kadu TP, Kale SS, Chavan NR, Agrawal T, Verulkar SB (2015) Pyramiding of three bacterial
blight resistance in Dubraj rice cultivar using marker-assisted selection. Ecoscan VII:07–12
Kamble AK, Sanjay SD, Sujoy S, Indu SS (2017) In vitro efficacy of different chemicals and
Biological agent against Xanthomonas campestris pv. viticola causing Bacterial leaf spot of
Grapes. Int J Agric Sci 9:4427–4430
Kini K, Agnimonhan R, Dossa R, Soglonou B, Gbogbo V, Ouedraogo I, Kpemoua K, Traore M,
Silue D (2017) First report of Sphingomonas sp. causing bacterial leaf blight of rice in Benin,
Burkina Faso, The Gambia, Ivory Coast, Mali, Nigeria, Tanzania and Togo. New Dise Rep 35:
32
Kumar M, Parate RL, Ninawe BN (2009) Effect of botanicals, bioagents and some chemicals
against Xantomonas oryzae pv. oryzae. J Plant Dis Sci 4:60–63
Kurita T, Tabei H (1967) On the causal bacterium of grain rot of rice. Ann Phytopath Soc Jap 33:
111
Mizukami T (1957) On the relationships between Xanthomonas oryzae and the roots of rice
seedlings. Agric Bull Saga Univ 6:87–91
Mizukami T (1959) On the nature and function of exudates produced by Xanthomonas oryzae.
Agric Bull Saga Univ 8:10–14
Mizukami T (1961) Studies on the ecological properties of Xanthomonas oryzae (Uyda at Ishiyama)
Dowson, the causal organism of bacterial leaf blight of rice plant. Agric Bull Saga Univ 13:1–85
Mizukami T, Wakimoto S (1969) Epidemiology and control of bacterial leaf blight of rice. Annu
Rev Phytopathol 7:51–72
Mohiuddin MS, Rao YP, Mohan SK, Verma JP (1976) Role of Leptocorisa Acuta Thun. In: the
spread of bacterial blight of rice. Curr Sci 45:426–427
Mukoo H, Kusaba T, Watanabe M, Tabei H (1957) Several factors related to the occurrence of
bacterial leaf blight disease of rice Proc KantoTosan Pl. Proc Soc 4:7–8
Mustafa A, Yasin SI, Mahmood S, Hannan A, Akhtar M (2013) Field Evaluation of new Fungicide
against rice disease. Pak J Phytopathol 25:141–145
Ortega L, Rojas CM (2021) Bacterial panicle blight and Burkholderia glumae: from pathogen
biology to disease control. Phytopathology 111:772–778
Ou SH (1985) Rice diseases, 2nd edn. Common Wealth Mycological Instt, Kew, pp 61–96
Patel SJ, Chauhan HL, Mehta AN, Gohil NM (2009) Management of bacterial blight of rice with
chemicals, botanicals and antagonists. J Plant Dis Sci 4:208–211
Prasad D, Singh R, Deep S (2018) In-vitro and in-vivo efficacy of antibacterial compounds against
Xanthomonas oryzae pv. oryzae, a cause of bacterial leaf blight of rice. Int J Curr Microbiol App
Sci 7:2960–2969
Qudsia H, Akhter M, Riaz A, Haider Z, Mahmood A (2017) Comparative efficacy of different
chemical treatments for paddy blast, brown leaf spot and bacterial leaf blight diseases in rice
(Oryza sativa L.). Appl Microbiol Open Access 3:138
Reddy CR, Ou SH (1976) Characterization of Xanthomonas oryzae (Uyeda et. Ishiyama) Dowson,
the bacterial blight pathogen of rice. Annl Rev Phytopathol 42:124–130
Reitsma J, Schure PSJ (1950) Kresek, a bacterial blight disease of rice. Res Stat Bogar 117:1–17
Saddler GS (1994) IMI descriptions of fungi and bacteria, Set 122, Nos 1211-1220.
Mycopathologia 128(1):59–60
Sayler RJ, Cartwright RD, Yang Y (2006) Genetic characterization and real-time PCR detection of
Burkholderia glumae, a newly emerging bacterial pathogen of rice in the United States. Plant
Dis 90:603–610
Shtienberg D, Miriam Z, Oppenheim D, Herzog Z, Shulamit M, Shwartz H, Kritzman G (2001)
Efficacy of oxolinic acid and other bactericides in suppression of Erwinia amylovora in pear
orchards in Israel. Phytoparasitica 29:143–154
Singh R, Yadav RS, Javeria S (2015) Management of bacterial leaf blight of Basmati rice caused by
Xanthomonas oryzae pv. oryzae with some available antibiotics and plant products. Int J Innovat
Appl Res 3:1–6
2 Bacterial Disease of Rice 29
Swati, Kumar A, Roy SP, Kumari P (2015) studies on efficacy of different chemicals treatments
against Bacterial leaf blight of rice in Bihar. Int Quart J Life Sci 2:56–61
Tagami Y, Mizukami T (1962) Historical review of the researches on bacterial leaf blight of rice
caused by Xanthomonas oryzae (Uyeda et Ishiyama) Dowson. Special report of the Plant
Disease and Insect Pests Forecasting Service 10. Ministry of Agriculture and Forestry. Japan,
112 p
Tillman BL, Harrison SA, Russin JS, Clark CA (1996) Relationship between bacterial leaf streak
and black chaff symptoms in winter wheat. Crop Sci 36:74–78
Tsushima S (1991) Epidemiology of bacterial grain rots of rice caused by Pseudomonas glumae.
JARQ 30:85–89
Tsushima S, Naito H, Koitabashi M (1996) Population dynamics of Pseudomonas glumae, the
causal agent of bacterial grain rot of rice, on leaf sheaths of rice plants in relation to disease
development in the field. Ann Phyto Soc Japan 62:108–113
Uematsu T, Yoshimura D, Nishiyama K, Ibaraki T, Fuji H (1976) Occurrence of bacterial seedling
rot in nursery flat, caused by grain rot bacterium Pseudomonas glumae. Ann Phytopathol Soc
Jpn 42:310–312
USDA (2021) Rice outlook economic research service. RCS-21E. pp 1–24
Wakimoto S (1969) Bacterial leaf blight of rice and its control. Nogyo Oyobi Engel Agric Hort 32:
1523–1525
Watanabe Y (1975) Ecological studies, kresek phase of bacterial leaf blight of rice. Bull Tokaikinki
Agric Exp Stat 28:50–123
31
Viral Diseases of Rice 3
M. Taqqi Abbas, M. Shafiq, Robina Khaliq, Hibba Arshad,
Rajia Haroon, and M. Saleem Haider
Abstract
Rice, a fundamental means of life for millions, is the second most widely
consumed staple food globally. It is mainly consumed by people living in Latin
America, Asia, and Africa. With the gradual increase in the world’s population, it
has become essential to increase rice cultivation as well. Rice is harvested on
roughly 159 million hectares around the world. Rice is produced in excess of
700 million tons per year, with Asia accounting for nearly all of it. Rice has a
significant impact on the global food security, human nutrition, as well as the
economy. Rice has a vast amount of nutritional value as it provides about 15% of
global human per capita protein and 20% of the per capita energy (International
Rice Research Institute, 2002. Rice Almanac, Third Edition). It can also be used
for medicinal purposes, and its hulls can be used for fuel and in many industrial
processes. Being one of the most cultivated crops worldwide, it is infected by
several fungal, bacterial, and viral diseases. Among other things, rice production
and yield are seriously threatened by viral diseases. In the Asia-Africa area, about
30 distinct rice viruses have been documented. Each year, an estimated 37% of all
rice crops are lost to pests and diseases. Insect vectors such as leafhoppers,
aphids, and whiteflies are commonly agents that transmit these viruses. Pale
and discontinuous yellow stripes, blotches, and dead tissue streaks on the leaves
are typical symptoms of viral infections in rice crops. Some of the management
strategies involve using integrated pest management, screening, and breeding for
varietal resistance, virus-free propagation material, etc.
M. T. Abbas · M. Shafiq(*) · R. Khaliq · H. Arshad · R. Haroon · M. S. Haider
Department of Plant Pathology, Faculty of Agricultural Sciences, University of the Punjab, Lahore,
Pakistan
e-mail: shafiq.iags@pu.edu.pk
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_3
32 M. T. Abbas et al.
Keywords
Viral diseases · PCR · Vector · Yield losses · CRISPR · RNAi
3.1 Introduction
Rice is one of the most widely consumed cereals and cash crops in the world, and it
is grown all over the world (Sangeetha et al. 2020). It is grown in almost all Asian
countries, some of eastern and central Africa and Central and South America
(Mitrofanova et al. 2018). Asia alone consumes about 650 million tons of rice
which accounts for 90% of the global population (Ali et al. 2018). The first viral
disease of rice was recorded in Japan in 1883 (Miloševićet al. 2012). Since then,
viruses have been infecting and causing damages to rice crops in several Asian,
African, and American countries. Over 30 rice viruses have been reported in these
countries through experimental tests and in nature. The last few decades have shown
how greatly can yield, quality, and production of rice be compromised by viral
diseases (Tang et al. 2020). Twenty-five viruses have a direct economic threat to rice
growth and production. These viruses are majorly transmitted by vectors whose host
range is limited to gramineous plants, usually leafhoppers and plant hoppers, that can
migrate over large distance (Sangeetha et al. 2020), while some are seed or soil-
borne (Tang et al. 2020). These viruses as well as their vectors favor hot and humid
climatic conditions. Rice virus disease management techniques include varietal
resistance screening and breeding, chemical treatment, plant quarantine, efficient
cultural practices, integrated pest management, disease management training, and
bioengineered resistance (Sangeetha et al. 2020) and ongoing collaboration with
other laboratories pursuing the same disease-management goal. This chapter
includes some important viral pathogens and diseases of rice crop as well as
describes their taxonomic position and nucleotide sequence, particle morphology,
diseases symptoms and host range, virus transmission, economic significance,
purification, diagnostic techniques, as well as management and control measures
to better understand the viruses and the diseases they cause on rice crop and manage
their disease problem (Table 3.1).
3.2 Black-Streaked Dwarf Virus
Rice black-streaked virus, a member of the Fijivirus genus, mostly affects rice and
maize crops, causing diseases such as maize rough dwarf disease and rice black-
streaked dwarf disease. It usually occurs in East Asian countries and causes major
yield losses (Tang et al. 2020). RBSDV was originally identified in Japan in the early
1950s, where it impacted rice crops. It was later discovered in Korea and China. This
disease is associated with a plant hopper Laodelphax striatellus.
3 Viral Diseases of Rice 33
Table 3.1 Describe the common symptoms, host range, and mode of transmission of viral diseases of rice
Serial
no.
Viral
diseases Host range Symptoms Transmission
1 Black-
streaked
dwarf
virus
RBSDV usually infects hosts that belong to the
Poaceae family including Zea mays,Oryza sativa,
and Triticum aestivum (Tang et al. )2020
Normal symptoms include wrinkled leaves that
are dark green, white tumor-like protrusions
endings, incomplete tassels, upgrowth of
rootlets, and formation of the tiller on the upper
part of the plant (Mohammed et al. )2012
This virus is transferred from one
place to another by an insect vector
Laodelphax striatellus and
sometimes by Unkanodes
sapporona and Unkanodes
albifascia (Manglli et al. )2012
2 Rice
yellow
mottle
virus
Confined to species in the family Poaceae,
predominantly in the tribes Oryzeae (Oryza sativa
L. and Oryza glaberrima Steud.) and
Eragrostideae (Adkins et al. ; Adkins et al.
; Adkins et al. ; Lan and Lu )202020062003
2003
Yellow or orange leaf discoloration, necrosis,
stunted growth, yellow-green streaking, leaf
mottling, reduced tillering, and empty
spikelets. Unsynchronized flowering and
eventually plants’death or discoloration of the
grains (Lan and Lu ; Odongo et al. )20212020
Leaf debris and spikelet
contaminants (Kamenova and
Adkins ; Cagno et al. ),
insect vectors, i.e., beetles (Adkins
et al. ; Himeno et al. ;
Sõmera et al. ; Zeng et al. )
or wounds (Odongo et al. )2021
20162015
20142003
20182004
3 Rice
tungro
disease
Cultivated rice, some wild rice varieties, and other
grassy weeds often found in rice paddies (VIRUS;
Matsuura et al. )2004
Stunted plants (Kumar and Dasgupta ),
yellow to orange discoloration, and interveinal
chlorosis (Lawson et al. ; Goto et al. ;
Brindhadevi et al. ). Mottled young
leaves, rusty spots on older leaves, reduced
tillering (Asjes and Blom-Barnhoorn ;
Matsuura et al. ; Goto et al. ;
Brindhadevi et al. )2021
20152004
2001
2021
20151995
2021 Leafhopper vector transmission
(green leafhopper is considered to be
most efficient) (Bautista et al. ;
Hirayama et al. )2017
1995
4 Rice
dwarf
virus
This virus affects 28 species of 15 genera
including Oryza sativa,H.distichum var. nudum,
H. vulgare,Triticum aestivum,Secale cereale,
Avena sativa,Zea mays saccharata,Setaria
italica,Paspalum thunbergii,Polypogon fugax,
Leersia japonica,Eragrostis ferruginea,Lolium
multiflorum,O. australiensis,O. barthii,
O. brachyantha,O. latifolia,O. nivara,
O. glaberrima, and Beckmann taerucaeformis
(Ara et al. )2012
One of the major symptoms that are found in
the rice crops infected by RDV through which
they can be characterized is stunting of the
crop. (Kumar and Dasgupta ). Other
symptoms include increased tillering, dark-
green discoloration, and white chlorotic spots
on the leaves (Haxim et al. )2017
2021
Rice dwarf virus is transmitted by
Nephotettix cincticeps,
N. nigropictus, and Recilia dorsalis
34 M. T. Abbas et al.
3.2.1 Taxonomic Position and Nucleotide Sequence
RBSDV is a member of the Fijivirus genus and the Reoviridae family. The viral
particle contains a double-layered capsid with a 50-nm core and double-stranded
genomic RNA (Tang et al. 2020). It has ten genomic segments of dsRNAs that are
designated in the order of increasing electrophoretic mobility in the polyacrylamide
gels as S1-S10 (Abdul-Samad and Mat 1995). These segments range in sizes from
4.5 to 1.4 kb. Segments have a low content of GC (32.0–38.3%) and have a
conserved 50–30terminal sequence (Zhang et al. 2016).
3.2.2 Particle Morphology of the Causal Virus
The particle of its casual virus is of an icosahedral shape that ranges in diameter
approximately 70–80 nm (Eyvazi et al. 2021). The infected cells from the insect
vector or the plant host contain two different kinds of particles; large particles range
from 75 to 85 nm in diameter, whereas small particles are 55 nm in diameter (Lin
et al. 2000).
3.2.3 Purification
The diseased samples are extracted in 0.2 M phosphate buffer at a pH of 7.5. 0.01 M
EDTA is also used. It is centrifuged at 20,000 rpm (34,500 g) for 1 h as well as
8000 rpm (5000 g) for 20 min. Phosphate buffer (0.01 M) that contains M EDTA at
the pH of 7.0 (Niu et al. 2014) is used to keep the virus suspended The isolation of
DNA strands of RBSDV along with its PCR amplification can be achieved by using
the FastQuant RT Kit (TIANGEN, Beijing, China) and KOD-Plus-Neo enzyme with
relevant primers (TOYOBO, Osaka, Japan) (Zhang et al. 2019).
3.2.4 Disease Symptoms
The symptoms of the black-streaked dwarf virus vary with the age of the crop.
Normal symptoms include wrinkled leaves that are dark green, white tumor-like
protrusion endings, incomplete tassels, upgrowth of rootlets, and formation of the
tiller on the upper part of the plant (Blystad et al. 2015). Twisted leaf blades appear,
and when the heads are formed, they contain dark-brown blotches (Kainana 1976).
In the Poaceae family, it is responsible for extreme restricted and rigid and darkened
leaves of the crop (Tang et al. 2020) (Fig. 3.1).
3 Viral Diseases of Rice 35
Fig. 3.1 Symptoms of diseases caused by the rice black-streaked dwarf virus (RBSDV) and the
vector Laodelphax striatellus (small brown plant hopper) (a) Rice nursery, (b) Infected twisted
leaves leaves (c) Stem Showing symptoms (d) formation of tiller on the upper part of plant, (e-g)
wrinkled leaves (h) Vector (Cheong et al. 2003)
3.2.5 Diagnostic Techniques
The infection is detected by the use of RT-PCR and confirmed by gel electropho-
resis using the relevant primers (Matsukura et al. 2019). The dot-ELISA process is
simple as well as a rapid method to screen many samples at the same time (Lin
et al. 2000).
3.2.6 Control/Management of the Disease
The management of this disease can be obtained by screening and the development
of varieties as well as the use of insecticides (Kim et al. 1988). If resistant varieties
are not present, integrated pest management is used for inhibiting the viral transmis-
sion by insect vectors (Tang et al. 2020). Different combinations of cultural practices
can also be used. Escaping the peak periods of insect attack by sowing the seeds
early can also prevent the onset of disease. Infection can also be reduced by planting
the crop at the spacing of 30 10 cm (Cheong et al. 2003).
36 M. T. Abbas et al.
3.2.7 Economic Significance
The plant that is infected with RBSDV has fewer panicles and a lower percentage of
ripe grains. Infection can result in losses in yield of up to 60%. RBSDV is also
responsible for a substantial yield loss in maize (Zhao et al. 2018).
3.2.8 Host Range and Transmission
RBSDV usually infects hosts that belong to the Poaceae family including Zea mays,
Oryza sativa, and Triticum aestivum (Tang et al. 2020). Other hosts include oats,
barley, rye and species of Digitaria,Echinochloa,Eragrostis,Glyceria,Lolium,
Agrostis,Alopecurus,Panicum, and Poa in the Gramineae. This virus is transferred
from one place to another by an insect vector Laodelphax striatellus and sometimes
by Unkanodes sapporona and Unkanodes albifascia. For L. striatellus, there’s about
a 30% proportion of active transmitters. This insect breeds on wheat, rice, and
barley. Unkanodes sapporona breeds on wheat, barley, and maize. The only
means of transmission for this virus is through an insect vector; hence the efficiency
in the migration and transmission is essential for the successful development of
disease (Tang et al. 2020).
3.3 Rice Yellow Mottle Virus
Rice Yellow Mottle Virus; Taxonomic position and nucleotide sequence.
3.3.1 Taxonomic Tree
Domain Virus
Kingdom Orthornavirae
Phylum Pisuviricota
Class Pisoniviricetes
Order Sobelivirales
Family Solemoviridae
Genus Sobemovirus
Species Rice yellow mottle virus
3 Viral Diseases of Rice 37
3.3.2 Nucleotide Sequence
RYMV is 4450 nucleotide long and its genomic RNA contains 5 ORFs (Sõmera
et al. 2015). ORF1 (nt 80–553) encodes proteins having 157 amino acids. ORF2
(nt 608–3607) codes a polyprotein containing 999 amino acids. ORF3 is said to
encode a polypeptide containing 127 amino acids and is also enclosed in ORF2.
ORF4 (nt 3447–4166) protrudes the 30terminus of OFR2, encodes a protein of
26 KDa, and is considered as coat protein of RYMV (Odongo et al. 2021).
3.3.3 Economic Significance
RYMV has importance economically (Brunt et al. 1980) and can put the develop-
ment and extension of rice production in a region at a possible risk because it is a key
biotic hurdle to rice cultivation in Africa (Séré et al. 2013; Blystad et al. 2015).
3.3.4 Disease Symptoms
Its symptoms consist of yellow/orange leaf discoloration, necrosis, and stunted
growth during the vegetative state and yellow-green streaking, leaf mottling, reduced
tillering, and empty spikelets. RYMV can also cause unsynchronized flowering and
eventually plant death or discoloration of the grains (Brunt et al. 1980;Lan and Lu
2020; Odongo et al. 2021).
3.3.5 Host Range
It has a confined host range, limiting to Poaceae species, predominantly in the tribes
Oryzeae (Oryza sativa L. and Oryza glaberrima Steud.) and Eragrostideae (Adkins
et al. 2003;Matsui et al. 2005; Adkins et al. 2006; Lan and Lu 2020).
3.3.6 Transmission
RYMV cannot be transmitted through rice seeds, but it can be transmitted through
leaf debris and spikelet contaminants (Kamenova and Adkins 2004; Cagno et al.
2018). It can be transmitted through insect vectors, i.e., beetles (Adkins et al. 2003;
Himeno et al. 2014; Sõmera et al. 2015; Zeng et al. 2016) or wound (Odongo
et al. 2021).
38 M. T. Abbas et al.
3.3.7 Purification
Purification of RYMV is done using new or deep-frozen young rice leaves harvested
14 days after infection. Liquid nitrogen is used to grind the leaves, which are then
homogenized in a 0.1 M phosphate buffer (pH 5.0). It can be further purified by
centrifugation at 3000 g for 2 h through a 10–40% sucrose gradient (Kamenova
and Adkins 2004). The RNA is extracted by using GeneJET Plant RNA Purification
Mini Kit followed by RT-PCR using RYMV CP specific primers. The PCR products
are then sequenced by Sanger sequencing technology (Hébrard et al. 2020).
3.3.8 Diagnostic Techniques
The direct visual evaluation of rice for detection of RYMV is done based on
Standard Evaluation System (SES) (Abou Ghanem-Sabanadzovic et al. 2012).
Serological diagnostic techniques include the precipitation methods and the nitro-
cellulose test. Many variants of DAS-ELISA for detection of RYMV (Nagpal et al.
2005; Jia and Martin et al. 2008; Gautam 2019; Liu et al. 2020; Mabele et al. 2020;
Marwal and Gaur 2020) utilizing a panel of polyclonal and monoclonal antibodies
are used (Fekih-Hassan et al. 2003). Western and Northern immune blotting and
PCR are used for the translation and expression of RYMV (Fekih-Hassan et al. 2003;
Sicard et al. 2018). Electron microscopy (Caldwell and Robb 1962; Mokra et al.
2008) and RT-PCR amplification of the ceruloplasmin (CP gene) (Caldwell and
Robb 1962) can also be used to identify RYMV.
3.3.9 Particle Morphology of the Causal Virus
RYMV is a positive-sense RNA virus with a single strand. Particles are distinctive,
being spherical having a diameter of about 28 3 nm and containing about 77%
protein (Caldwell and Robb 1962).
3.3.10 Geographic Distribution, Epidemiology, and Yield Losses
The first case of RYMV was discovered in Kenya and East Africa in the 1960s
(Caldwell and Robb 1962); after that in many East and West African countries, it has
been reported on occasionally (Mokra et al. 2008; Issaka et al. 2021).
According to the estimations, RYMV can cause rice yield losses between 20%
and 100% (Brunt 1971; Richins and Shepherd 1983; Larsen et al. 2005; Odongo
et al. 2021) with important socio-economic effects for farmers.
3.3.11 Control/Management of the Disease
3.3.11.1 Prevention
3 Viral Diseases of Rice 39
•Resistant and tolerant varieties can be used (Pappu et al. 2005; Nerway et al.
2020; Odongo et al. 2021).
•Direct sowing or nursery areas that haven’t been affected before can also assist
prevent the virus from spreading (Larsen et al. 2005; Katsurayama et al. 2020).
•Regular weeding and clearance of shrubs around fields can help reduce RYMV
by preventing the peak period of the virus’s insect vectors.
•The use of prophylactic control measures or other sanitary techniques can also
help to prevent the spread of RYMV (Harris and Eade 1963).
3.3.11.2 Chemical Control
To directly control or prevent the spread of this virus, no chemical control methods
are available yet. However, in some countries, insecticides are present to manage
insect vectors, thus inhibiting viral transmission (Hirayama et al. 2017).
3.4 Rice Tungro Disease
Tungro was reported to be caused by a combination of two morphologically
unrelated viruses in 1979: the Rice tungro spherical virus (RTSV), an RNA virus,
and the Rice tungro bacilliform virus, a DNA/RNA virus (RTBV) (De Haan et al.
1991; Sether and DeAngelis 1992; Günther et al. 2000).
3.4.1 Taxonomic Position and Nucleotide Sequence
3.4.1.1 Taxonomic Tree
Rice tungro spherical virus (RTSV) Rice tungro bacilliform virus (RTBV)
Domain Virus Virus
Kingdom Pararnavirae Pararnavirae
Phylum Artverviricota Artverviricota
Class Revtraviricetes Revtraviricetes
Order Ortervirales Ortervirales
Family Secoviridae Caulimoviridae
Genus Waikavirus Tungrovirus
Species Rice tungro spherical virus (RTSV) Rice tungro bacilliform virus (RTBV)
3.4.1.2 Nucleotide Sequence
RTBV, like other plant pararetroviruses, is transcribed asymmetrically with full
coding capacity on the negative strand. RTBV has four ORFs, able to encode
proteins of 24, 12, 194, and 46 kDa, respectively (Sether and DeAngelis 1992;
Maloy and Murray 2001). ORF3 encodes a P194 polyprotein which consists of four
40 M. T. Abbas et al.
present domains: the coat protein of the virus (37 kDa), reverse transcriptase,
aspartate protease, and ribonuclease H (Parrella 2003).
Only five RTSV complete genomes are currently accessible in the NCBI database
(Kannan et al. 2020). RTSV assists the transmission of RTBV. The viral RNA has a
515-nucleotide leader sequence and encodes a single major ORF1 at the 50end,
beginning after the leader sequence (Azzam and Chancellor 2002). ORF1 encodes
for a polyprotein that is broken by a protease into three coat proteins (CPs) that are
arranged next to each other (CP1–3) (Sharma et al. 2012; Kannan et al. 2020).
3.4.2 Disease Symptoms
Noticeably stunted plants (Kumar and Dasgupta 2021) yellow to orange discolor-
ation, and interveinal chlorosis on the leaves (Lawson et al. 1995; Goto et al. 2015;
Brindhadevi et al. 2021). At times, young leaves are mottled, while on older leaves,
rusty spots appear. Virus reduced tillering with poor root system. In the initial stage
of infection, there is no formation of panicles, if formed, remain tiny with some,
deformed and chaffy grains (Asjes and Blom-Barnhoorn 2001; Matsuura et al. 2004;
Goto et al. 2015; Brindhadevi et al. 2021) (Fig. 3.2).
Fig. 3.2 Symptoms of rice plant infected with Tungro infected plant (Credits: Knowledge bank)
3 Viral Diseases of Rice 41
3.4.3 Host Range
Tungro mostly infects cultivated rice, but certain wild rice types and other grassy
weeds can also be found in rice fields (VIRUS; Matsuura et al. 2004; Sankarganesh
et al. 2020).
3.4.4 Transmission
Transmission mainly occurs by the leafhopper vector, and the green leafhopper is
considered to be the most effective vector for transmission (Bautista et al. 1995;
Hirayama et al. 2017).
3.4.5 Purification
PCR products are usually purified using QIAquick
®
Purification Kit following the
manufacturer’s instructions (Qiagen, Valencia, CA) (Caguiat et al. 2020).
3.4.6 Diagnostic Techniques
Tungro can be detected by DNA amplification and visualization of the amplified
DNA using electrophoresis. Tungro can be verified using serological methods
when they are accessible (Rosello et al. 1999), such as ELISA, latex agglutination
test, and rapid immunofilter paper assays (RIPA) (Brunt 1968). BLAST can be
used to find local similarity in-between sequences from previous researches
(Waing et al. 2020).
3.4.7 Particle Morphology of the Causal Virus
The bacilliform capsid of the Rice tungro bacilliform virus (RTBV) possesses a
circular double-stranded DNA genome (Hull 1996), while Rice tungro spherical
virus (RTSV) has spherical/isometric capsid with a diameter of 30 nm, single-
stranded RNA genome (Kannan et al. 2020).
3.4.8 Geographic Distribution, Epidemiology, and Yield Losses
Tungro is one of the most destructive and devastating rice diseases in South and
Southeast Asia (Gulati et al. 2016). In extreme cases, in varieties susceptible to
tungro, if infected at an early stage of development, yield loss might be as high as
100% every year (Kannan et al. 2020).
3.4.9 Control/Management of the Disease
After a plant is infected, it is impossible to cure it; hence prevention is the best
measure to manage or control the disease.
3.4.9.1 Cultural Control/ Biological Control
42 M. T. Abbas et al.
•Integrated management of tungro disease, i.e., field sanitation, rouging, or remov-
ing the hosts weed species of the virus as well as the vectors (Jochems 1930).
•Grow disease-tolerant cultivars or host/virus-resistant varieties (Johnson 1936).
•Biocontrol of insect vector by using natural enemies (i.e., ladybugs)
(Bambaradeniya and Edirisinghe 2009).
•A technical culture like varieties inter-cropping and Legowo system (Rumanti
et al. 2016).
•Practice synchronous planting with surrounding farms (Costa 1945).
3.4.9.2 Chemical Control
•The vectors can be controlled in the nursery by the application of carbofuran or
isoprocarb (Thomas and Zaumeyer 1950; Martin et al. 1959; Brindhadevi et al.
2021) (Fig. 3.3).
Fig. 3.3 Structure of Rice yellow mottle virus (RYMV) at different resolutions (Palukaitis et al.
1992): (a) electron micrograph of frozen-hybridized native RYMV (cryoelectron microscopy), (b)
three-dimensional surface-shaded density maps of RYMV derived by cryo-EM (Gorovits et al.
2013), (c) space filling model of RYMV generated from X-ray crystallography data (Ravindra and
Kalaria 2019)
3 Viral Diseases of Rice 43
3.5 Rice Dwarf Virus
Rice dwarf disease is induced by the rice dwarf virus. It infects crops, causing yield
losses in production of rice throughout East Asian countries. It is transmitted by one
of the most common leafhoppers in rice fields and the green rice leafhoppers,
specifically Nephotettix cincticeps and two other species (Nakagawa et al. 2018).
Green rice leaf hoppers that are free of RDV acquire it by feeding on diseased plant-
parts (Xia et al. 2021). Virus multiplies in the insect body and hence is passed on
from one generation to another. The virus induces white flecks on the leaves and
causes dwarfing in graminaceous plants. It cannot be transmitted through the seeds
of the host plant (Costa and Carvalho 1961).
3.5.1 Particle Morphology of the Causal Virus
The capsid of rice dwarf virus is a double shelled icosahedral. It is approximately
70 nm in diameter. This virus has several structural proteins that are called P1, P2,
P3, P4, P5, P6, P7, P8, and P9 (Nakagawa et al. 2018). Its structure is determined by
X-ray crystallography at a 3.5A resolution (Costa and Carvalho 1961). Miura and
Fujii-Kawata were the first ones to analyze the genomic structure of RDV. They
discovered that the virus’s genome is made up of 12 dsRNA segments (Akiew
et al. 1993).
3.5.2 Taxonomic Position and Nucleotide Sequence
RDV is from the family Reoviridae and genus Phytoreovirus. It contains a vast range
of hosts including plants, animals, insects, and humans (Nakagawa et al. 2018).
Their genome is transcribed inside the capsid that is intact. Before it is released from
the capsid, the nascent mRNA is capped (Konishi et al. 2010). Genome analysis
shows that every genome sequence of RDV has 4 30-terminal and six 50-terminal
nucleotides that are conserved in all 12 segments of double-stranded RNA (S1-S12)
(Akanda and Maino et al. 2004). These 12 segments of dsRNA encode structural and
non-structural protein. Seven structural proteins encoded are P1, P2, P3, P5, P7, P8,
and P9. The five non-structural proteins include Pns4, Pns6, Pns10, Pns11, and
Pns12 (Zhao et al. 2020).
3.5.3 Purification
It can be purified from the infected leaves of the host (rice) plant. The diseased
sample is places in phosphate buffer (pH 6.8) and 0.1% thioglycolic acid. The
sample is then centrifuged in chloroform followed by the pallet being resuspended
in the phosphate buffer solution (Miloševićet al. 2015). RNA can be extracted by
using the TRIzol reagent. The further PCR amplification program is 94 C for 3 min,
35 cycles, and 72 C for 10 min (Ren et al. 2018).
44 M. T. Abbas et al.
3.5.4 Geographic Distribution, Epidemiology, and Yield
It is distributed mainly in Asian locations like China, Japan, Fujian, Honshu, Korea
Republic, Shikoku, Zhejiang, Thailand, etc. (Barbosa et al. 2008). It is recently
reported in the Philippines (Takahashi et al. 1993).
3.5.5 Control/Management of the Disease
Controlling the insect vector is a common methodology to minimize the damage
caused by RDV. Another control method is by developing insect-resistant crops
through genetic engineering (Xia et al. 2021). By using chemical fertilizers as well as
synthetic insecticides, the cultivation of high-yielding varieties is feasible. Resistant
varieties can also be used to control the disease. The control of RCV through
elimination of weeds from fallow paddy fields is an idea that’s been proposed by
scientist but hasn’t been practically implemented (Palukaitis et al. 1992).
3.5.6 Disease Symptoms
One of the major symptoms that are found in the rice crops infected by RDV through
which they can be characterized is stunting of the crop (Kumar and Dasgupta 2021).
Other symptoms include increased tillering, dark-green discoloration, and white
chlorotic spots on the leaves (Haxim et al. 2017) (Fig. 3.4).
3.5.7 Host Range
This virus affects 28 species of 15 genera including Oryza sativa,H. distichum
var.nudum,H. vulgare,Triticum aestivum,Secale cereale,Avena sativa,Zea
mays saccharata,Setaria italica,Paspalum thunbergii,Polypogon fugax,Leersia
japonica,Eragrostis ferruginea,Lolium multiflorum,O. australiensis,
O. barthii,O. brachyantha,O. latifolia,O. nivara,O. glaberrima, and
Beckmann taerucaeformis (Ara et al. 2012).
3.5.8 Transmission
Rice dwarf virus is spread by Nephotettix cincticeps,Nephotettix nigropictus, and
Recilia dorsalis that are it’s insect vectors. Most of these insect vectors transmit the
virus till their death. RDV replicates and assembles its virions in the vector’s salivary
gland cells (Liu et al. 2021). Nephotettix cincticeps has the feeding periods of 5 min,
and the incubation period of RDV in the insect ranges from 12 days at 29.2 Cto
17 days at 20 C (Miloševićet al. 2015). However, the period of continuous
transmission is 5 days (Liu et al. 2021).
3 Viral Diseases of Rice 45
Fig. 3.4 Rice dwarf virus
causes chlorotic specks on the
leaf (Palukaitis et al. 1992)
3.5.9 Diagnostic Techniques
RT-PCR can be used to detect the virus. Applications such as studying viral
population dynamics, screening for viral resistance, virus-host interaction, and
virus multiplication are feasible with the use of RT-PCR (Jacquemond 2012).
Another method of detecting the presence of RDV is by extracting the RNA using
TRIzol (Invitrogen, California, United States). By using the One-Step gDNA
Removal kit and the cDNA Synthesis SuperMix Kit (TransGen Biotech, Beijing,
China), reverse transcription reactions can be performed. The synthesized Cdna can
be used as a template for PCR to confirm presence of RDV (Chen et al. 2021).
3.6 CRISPR and RNAi Tools for Managing Rice Virus Diseases
A technology that effectively targets and modifies a specific gene in plant has
potential for interpretation the function of genes hence improving the quality of a
crop. The present-day advance technology used for gene-editing that can be used for
this purpose is based on the CRISPER or CRISPER-associated genes systems. These
are said to be more effective, simpler, and flexible than transcription activator-like
effector nucleases and zinc finger nucleases, which are used in other gene-editing
approaches. CRISPER technology offers a better alternative approach to the tradi-
tionally used methods for the breeding of plants to improve their traits. Since plant
viruses bring about devastating losses to the crop production and its productivity and
quality, there has been a rise of interest in using various CRISPER/Cas techniques
and technologies to develop disease-resistant cultivars of plants which are less
susceptible to viral attack (Green and Hu 2017;Borrelli et al. 2018).
46 M. T. Abbas et al.
There are two ways the CRISPER/Cas system that can be used in the production
of resistant crop varieties against plant pathogenic viruses. First, by using CRISPER/
Cas, we can induce targeted mutation in the genes of the relevant host plants that
interfere with their ability to function as biosynthetic machinery which allows the
successful viral replication and infection of the plant. Secondly, CRISPER/Cas can
be used in plants to target the viral genome. For example, CRISPER/Cas systems
that target DNA could be used to target the genome of DNA-containing viruses.
Similarly RNA-cleaving CRISPER/Cas systems can target the RNA of
RNA-containing viruses, for example, CAS9 from Francisella novicida (FnCas9)
(Price et al. 2015) or Cas13a (previously known as C2c2) (Abudayyeh et al. 2016;
Green and Hu 2017). CRISPER/Cas systems have promising potential in controlling
viral infections and the general improvement of the crop. However, there is a notable
issue in their distribution, which is the lack of efficacy through which the reagents of
CRISPER/Cas are delivered into the cells of plants (Baltes et al. 2017). This
limitation can be overcome by establishing suitable and efficient protocols of
delivering CRISPER/Cas reagents into the plant tissues. Selecting the correct
CRISPER/Cas editing system is also crucial. The eukaryotic mechanism of RNA
interference (RNAi) refers to RNA-mediated sequence-specific gene silencing. This
technique has also proved to be effective in increasing the viral resistance of crops
(Dubrovina and Kiselev 2019).
3.7 Conclusion
In this chapter, we offer an overview of all the abovementioned viral diseases of rice
including their taxonomy, transmission, host range, symptoms, purification, diag-
nostic techniques, and their control/management. In the present era, there is still a
need for more detailed research on various viruses that cause devastating yield loss
in the production of rice since it is one of the most significant cereals and cash crops
that affects the livelihood of millions of people around the globe. It also has a
significant part in the global food security and worldwide economy. These viruses
infect the rice crop and cause several structural and physiological damages that
decrease its quality and economical value. The viruses of rice are usually carried
around by insect vectors. These viruses are found in various parts of the insect, for
example, the sucking gland cells. When these insect vectors feed on susceptible
crops, they transmit the virus. After the virus is transmitted, it becomes very difficult
to prevent infection, and hence the disease is formed. Only by avoiding transmission
of viruses and inhibiting secondary dissemination to other plants we can effectively
manage their spread. There are many strategies that can be used to prevent infection.
One of the main techniques is by using integrated pest management to control the
insect vectors, hence preventing the transmission. Another method is through the
production of resistant varieties by genetic engineering.
3 Viral Diseases of Rice 47
References
Abudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DB, Zhang F (2016)
C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector.
Science 353(6299):aaf5573
Abdul-Samad N, Mat M (1995) Hibiscus chlorotic ringspot virus in Malaysian Hibiscus. Plant Dis
79(9)
Adkins S, Kamenova I, Achor D, Lewandowski DJ (2003) Biological and molecular characteriza-
tion of a novel tobamovirus with a unique host range. Plant Dis 87(10):1190–1196
Adkins S, Kamenova I, Chiemsombat P, Baker CA, Lewandowski DJ (2006) Tobamoviruses from
hibiscus in Florida and beyond. Acta Hortic 722:65–70
Akanda S, Maino M (2004) Incidence and severity of rice diseases in six provinces of Papua NeV.
Papua New Guinea J Agric For Fish 49(2):35–40
Abou Ghanem-Sabanadzovic N, Sabanadzovic S, Gugerli P, Rowhani A (2012) Genome organiza-
tion, serology and phylogeny of Grapevine leafroll-associated viruses 4 and 6: taxonomic
implications. Virus Res 163(1):120–128
Akiew E, Trevorrow PR, Tonello PE (1993) Management of bacterial wilt of tobacco. In: ACiAR
proceedings. Australian Centre for International Agricultural Research, pp 270–270
Ali S, Ganai BA, Kamili AN, Bhat AA, Mir ZA, Bhat JA et al (2018) Pathogenesis-related proteins
and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiol
Res 212:29–37
Ara MR, Masud MMH, Akanda AM (2012) Detection of plant viruses in some ornamental plants
that act as alternate hosts. The Agriculturists 10(2):46–54
Asjes CJ, Blom-Barnhoorn GJ (2001) Control of aphid-vectored and thrips-borne virus spread in
lily, tulip, iris and dahlia by sprays of mineral oil, polydimethylsiloxane and pyrethroid insecti-
cide in the field. Ann Appl Biol 139(1):11–19
Azzam O, Chancellor TC (2002) The biology, epidemiology, and management of rice tungro
disease in Asia. Plant Dis 86(2):88–100
Baltes NJ, Gil-Humanes J, Voytas DF (2017) Genome engineering and agriculture: opportunities
and challenges. Prog Mol Biol Transl Sci 149:1–26
Bambaradeniya CNB, Edirisinghe JP (2009) Composition, structure and dynamics of arthropod
communities in a rice agro-ecosystem. Ceylon J Sci (Biol Sci) 37(1):23–48
Barbosa JC, Teixeira APM, Moreira AG, Camargo LEA, Filho AB, Kitajima EW, Rezende JAM
(2008) First report of Tomato chlorosis virus infecting tomato crops in Brazil. Plant Dis 92
(12):1709–1709
Bautista RC, Mau RF, Cho JJ, Custer DM (1995) Potential of tomato spotted wilt tospovirus plant
hosts in Hawaii as virus reservoirs for transmission by Franklinieila occidentalis (Thysanoptera:
Thripidae). Phytopathology 15:32
Blystad DR, van der Vlugt R, Alfaro-Fernández A, del Carmen Córdoba M, Bese G, Hristova D et
al (2015) Host range and symptomatology of Pepino mosaic virus strains occurring in Europe.
Eur J Plant Pathol 143(1):43–56
Borrelli VM, Brambilla V, Rogowsky P, Marocco A, Lanubile A (2018) The enhancement of plant
disease resistance using CRISPR/Cas9 technology. Front Plant Sci 9:1245
Brindhadevi S, Velprabakaran S, Niranjanadevi J (2021) Diseases of rice and their management.
Biotica Res Today 3(7):624–626
Brunt AA (1968) Tobacco streak virus in dahlias. Plant Pathol 17(3):119–122
48 M. T. Abbas et al.
Brunt AA (1971) Some hosts and properties of dahlia mosaic virus. Ann Appl Biol 67(3):357–368
Brunt AA, Barton RJ, Phillips SUE, Lana AO (1980) Hibiscus latent ringspot virus, a newly
recognised virus from Hibiscus rosa-sinensis (Malvaceae) in western Nigeria. Ann Appl Biol
96(1):37–43
Cagno V, Andreozzi P, D’Alicarnasso M, Jacob Silva P, Mueller M, Galloux M et al (2018) Broad-
spectrum non-toxic antiviral nanoparticles with a virucidal inhibition mechanism. Nat Mater 17
(2):195–203
Caguiat XGI, Waing FP, Millas RA, Aquino JD, Tabanao DA (2020) Genetic diversity of the coat
protein gene of Rice tungro bacilliform virus in the Philippines. Philipp J Sci 149(3):511–520
Caldwell J, Robb SM (1962) The identification of three virus diseases in the Dahlia
Chen R, Deng Y, Ding Y, Guo J, Qiu J, Wang B et al (2021) Rice functional genomics: decades’
efforts and roads ahead. Sci China Life Sci:1–60
Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH et al (2003) BWMK1, a rice mitogen-
activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expres-
sion by activation of a transcription factor. Plant Physiol 132(4):1961–1972
Costa AS (1945) The relationship between American tobacco streak and Brazilian “necrose branca”
or “couve”. Phytopathology 35(12):1029–1030
Costa AS, Carvalho AMB (1961) Studies on Brazilian tobacco streak. Phytopathol Z 42:113–138
De Haan P, Kormelink R, de Oliveira Resende R, Van Poelwijk F, Peters D, Goldbach R (1991)
Tomato spotted wilt virus L RNA encodes a putative RNA polymerase. J Gen Virol 72
(9):2207–2216
Dubrovina AS, Kiselev KV (2019) Exogenous RNAs for gene regulation and plant resistance. Int J
Mol Sci 20(9):2282
Eyvazi A, Massah A, Soorni A, Babaie G (2021) Molecular phylogenetic analysis shows that causal
agent of maize rough dwarf disease in Iran is closer to rice black-streaked dwarf virus. Eur J
Plant Pathol 160(2):411–425
Fekih-Hassan I, Gorsane F, Djilani F, Fakhfakh H, Nakhla M, Maxwell D, Marrakchi M (2003)
Detection of Tomato yellow leaf curl Sardinia virus in Tunisia. EPPO Bull 33(2):347–350
Gautam S (2019) The role of bemisia tabaci in the transmission of vegetable viruses in the
farmscape of Georgia Doctoral dissertation, University of Georgia
Gorovits R, Moshe A, Ghanim M, Czosnek H (2013) Recruitment of the host plant heat shock
protein 70 by Tomato yellow leaf curl virus coat protein is required for virus infection. PLoS
One 8(7):e70280
Goto S, Sasakura-Shimoda F, Suetsugu M, Selvaraj MG, Hayashi N, Yamazaki M et al (2015)
Development of disease-resistant rice by optimized expression of WRKY45. Plant Biotechnol J
13(6):753–765
Green JC, Hu JS (2017) Editing plants for virus resistance using CRISPR-Cas. Acta Virol 61(2):
138–142
Günther S, Emmerich P, Laue T, Kühle O, Asper M, Jung A et al (2000) Imported Lassa fever in
Germany: molecular characterization of a new Lassa virus strain. Emerg Infect Dis 6(5):466
Gulati A, Alapati K, Murthy A, Savithri HS, Murthy MRN (2016) Structural studies on tobacco
streak virus coat protein: insights into the pleomorphic nature of ilarviruses. J Struct Biol 193(2):
95–105
Harris MR, Eade G (1963) Dahlia diseases.Extension mimeo (Washington State University.
Extension), EM1342, Pullman, Washington: Washington State University. Extension.; 01/
1963; Handle, https://hdl.handle.net/2376/10348
Haxim Y, Ismayil A, Jia Q, Wang Y, Zheng X, Chen T et al (2017) Autophagy functions as an
antiviral mechanism against geminiviruses in plants. Elife 6:e23897
Hébrard E, Pinel-Galzi A, Oludare A, Poulicard N, Aribi J, Fabre S et al (2020) Identification of a
hypervirulent pathotype of Rice yellow mottle virus: a threat to genetic resistance deployment in
West-Central Africa. Phytopathology 108(2):299–307
3 Viral Diseases of Rice 49
Himeno M, Kitazawa Y, Yoshida T, Maejima K, Yamaji Y, Oshima K, Namba S (2014) Purple top
symptoms are associated with reduction of leaf cell death in phytoplasma-infected plants. Sci
Rep 4(1):1–7
Hirayama D, Iida T, Nakase H (2017) The phagocytic function of macrophage-enforcing innate
immunity and tissue homeostasis. Int J Mol Sci 19(1):92
Hull R (1996) Molecular biology of rice tungro viruses. Annu Rev Phytopathol 34(1):275–297
Issaka S, Traoré O, Longué RDS, Pinel-Galzi A, Gill MS, Dellicour S et al (2021) Rivers and
landscape ecology of a plant virus, Rice yellow mottle virus along the Niger Valley. Virus Evol
7(2):veab072
Jacquemond M (2012) Cucumber mosaic virus. Adv Virus Res 84:439–504
Jia Y, Martin R (2008) Identification of a new locus, Ptr(t), required for rice blast resistance gene Pi-
ta–mediated resistance. Mol Plant-Microbe Interact 21(4):396–403
Jochems SC (1930) Twee nieuwe virusziekten bij Deli-Tabak (Ringvlekziekte en nerf- streep). Bul.
Deli Proefstation Medan, Sumatra, Nr. 30, 24 S
Johnson JAMES (1936) Tobacco streak, a virus disease. Phytopathology 26(3):285–292
Kamenova I, Adkins S (2004) Transmission, in planta distribution, and management of hibiscus
latent Fort Pierce virus, a novel tobamovirus isolated from Florida hibiscus. Plant Dis 88(6):
674–679
Kainana WP (1976) Purification and properties of hibiscus chlorotic ringspot virus. virus 66:570–
575
Kannan M, Saad MM, Zainal Z, Kassim H, Ismail I, Talip N, Bunawan H (2020) Sequence and
phylogenetic analysis of the first complete genome of ricetungro spherical virus in Malaysia.
Iran J Biotechnol 18(4):e2566
Kannan M, Saad MM, Zainal Z, Kassim H, Ismail I, Talip N et al (2020) Sequence and phylogenetic
analysis of the first complete genome of Ricetungro spherical virus in Malaysia. Iran J
Biotechnol 18(4):e2566
Katsurayama AM, Martins LM, Iamanaka BT, Fungaro MHP, Silva JJ, Pitt JI et al (2020) Fungal
communities in rice cultivated in different Brazilian agroclimatic zones: from field to market.
Food Microbiol 87:103378
Kim KS, Beard JB (1988) Comparative turfgrass evapotranspiration rates and associated plant
morphological characteristics. Crop Sci 28(2):328–331
Konishi T, Miyazaki Y, Yamakawa S, Iwai H, Satoh S, Ishii T (2010) Purification and biochemical
characterization of recombinant rice UDP-arabinopyranose mutase generated in insect cells.
Biosci Biotechnol Biochem:0912011749–0912011749
Kumar G, Dasgupta I (2021) The titers of rice tungro bacilliform virus dictate the expression levels
of genes related to cell wall dynamics in rice plants affected by tungro disease. Arch Virol
166(5):1325–1336
Lan HH, Lu LM (2020) Characterization of hibiscus latent fort pierce virus-derived siRNAs in
infected Hibiscus rosa-sinensis in China. Plant Pathol J 36(6):618
Larsen RC, Miklas PN, Druffel KL, Wyatt SD (2005) NL-3 K strain is a stable and naturally
occurring interspecific recombinant derived from Bean common mosaic necrosis virus and Bean
common mosaic virus. Phytopathology 95(9):1037–1042
Lawson RJ, Schenker MB, McCurdy SA, Jenkins B, Lischak LA, John W, Scales D (1995)
Exposure to amorphous silica fibers and other particulate matter during rice farming operations.
Appl Occup Environ Hyg 10(8):677–684
Lin CM, Koh S, Stacey G, Yu SM, Lin TY, Tsay YF (2000) Cloning and functional characterization
of a constitutively expressed nitrate transporter gene, OsNRT1, from rice. Plant Physiol 122
(2):379–388
Liu J, Shabala S, Zhang J, Ma G, Chen D, Shabala L et al (2020) Melatonin improves rice salinity
stress tolerance by NADPH oxidase-dependent control of the plasma membrane K+ transporters
and K+ homeostasis. Plant Cell Environ 43(11):2591–2605
Liu Y, Wang H, Jiang Z, Wang W, Xu R, Wang Q et al (2021) Genomic basis of geographical
adaptation to soil nitrogen in rice. Nature 590(7847):600–605
50 M. T. Abbas et al.
Mabele AS, Mukoye B, Mukhongo DM (2020) Serological and molecular characterization detects
unique Rice yellow mottle virus strains in Kenya. Am J Plant Biol 5(4):120–124
Maloy OC, Murray TD (2001) Encyclopedia of plant pathology. Wiley
Manglli A, Zicca S, Tiberini A, Albanese G, Tomassoli L (2012) Iris yellow spot virus on onion
crops in Calabria, Southern Italy. J Plant Pathol 94(4)
Martin JP, Ervin JO, Shepherd RA (1959) Decomposition and aggregating effect of fungus cell
material in soil. Soil Sci Soc Am J 23(3):217–220
Marwal A, Gaur RK (2020) Molecular diversity of begomoviruses and DNA satellite molecules
infecting ornamental plants in India. In: Applied plant virology, pp 475–491
Matsui Y, Adkins S, Natsuaki KT (2005) Hibiscus latent Fort Pierce virus (HLFPV) from Hibiscus
rosa-sinesis in Japan and Indonesia. Jpn J Phytopathol 71(71):232–233
Matsukura K, Sanada-Morimura S, Fujii T, Matsumura M (2019) Potential risks of poaceous plants
as infectious sources of Rice black-streaked dwarf virus transmitted by the small brown
planthopper, Laodelphax striatellus. Plant Dis 103(6):1244–1248
Matsuura S, Ishikura S, Shigemoto N, Kajihara S, Hagiwara K (2004) Localization of Tomato
spotted wilt virus in chrysanthemum stock plants and efficiency of viral transmission from
infected stock plants to cuttings. J Phytopathol 152(4):219–223
MiloševićS, SimonovićA, Cingel A, JevremovićS, TodorovićS, FilipovićB, SubotićA (2012)
Response of antioxidative enzymes to long-term Tomato spotted wilt virus infection and virus
elimination by meristem-tip culture in two Impatiens species. Physiol Mol Plant Pathol
79:79–88
MiloševićD, Ignjatov M, NikolićZ, Gvozdanović-Varga J, TamindžićG, StankovićI, KrstićB
(2015) The presence of cucumber mosaic virus in pot marigold (Calendula officinalis L.) in
Serbia. Ratarstvo i povrtarstvo 52(2):67–73
Mitrofanova IV, Zakubanskiy AV, Mitrofanova OV (2018) Viruses infecting main ornamental
plants: an overview. Ornament Hortic 24:95–102
Mohammed H, Manglli A, Zicca S, El Hussein A, Mohamed M, Tomassoli L (2012) First report of
Papaya ringspot virus in pumpkin in Sudan. New Dis Rep 26(1):26–33
Mokra V, Gotzova B, Bezdekova V, Dedic P, Ptacek J (2008) First report of Tobacco streak virus
on Dahlia in the Czech Republic. Plant Dis 92(3):484–484
Nagpal P, Ellis CM, Weber H, Ploense SE, Barkawi LS, Guilfoyle TJ et al (2005) Auxin response
factors ARF6 and ARF8 promote jasmonic acid production and flower maturation
Nakagawa A, Miyazaki N, Higashiura A (2018) Hierarchical structure assembly model of rice
dwarf virus particle formation. Biophys Rev 10(2):659–665
Nerway HMS (2020) Study the influence of lateral shoot removal and foliar application of Algamix
on vegetative growth and yield of grapevine (Vitis vinifera L.) cv. Zark. J Duhok Univ 23
(2):13–19
Niu S, Gil-Salas FM, Tewary SK, Samales AK, Johnson J, Swaminathan K, Wong SM (2014)
Hibiscus chlorotic ringspot virus coat protein is essential for cell-to-cell and long-distance
movement but not for viral RNA replication. PLoS One 9(11):e113347
Odongo PJ, Onaga G, Ricardo O, Natsuaki KT, Alicai T, Geuten K (2021) Insights into natural
genetic resistance to Rice yellow mottle virus and implications on breeding for durable
resistance. Front Plant Sci 12:671355
Palukaitis P, Roossinck MJ, Dietzgen RG, Francki RI (1992) Cucumber mosaic virus. Adv Virus
Res 41:281–348
Pappu HR, Wyatt SD, Druffel KL (2005) Dahlia mosaic virus: molecular detection and distribution
in dahlia in the United States. HortScience 40(3):697–699
Parrella G, Gognalons P, Gebre-Selassie K, Vovlas C, Marchoux G (2003) An update of the host
range of Tomato spotted wilt virus. J Plant Pathol:227–264
Price AA, Sampson TR, Ratner HK, Grakoui A, Weiss DS (2015) Cas9-mediated targeting of viral
RNA in eukaryotic cells. Proc Natl Acad Sci 112(19):6164–6169
3 Viral Diseases of Rice 51
Ravindra S, Kalaria R (2019) Molecular identification and in silico characterization of coat protein
in Tomato Leaf Curl Virus associated in Tomato from South Gujarat Region of India. Int J Curr
Microbiol App Sci 8(7):456–466
Ren B, Yan F, Kuang Y, Li N, Zhang D, Zhou X et al (2018) Improved base editor for efficiently
inducing genetic variations in rice with CRISPR/Cas9-guided hyperactive hAID mutant. Mol
Plant 11(4):623–626
Richins RD, Shepherd RJ (1983) Physical maps of the genomes of dahlia mosaic virus and mirabilis
mosaic virus—two members of the caulimovirus group. Virology 124(1):208–214
Rosello S, Soler S, Diez MJ, Rambla JL, Richarte C, Nuez F (1999) New sources for high resistance
of tomato to the tomato spotted wilt virus from Lycopersicon peruvianum. Plant Breed 118
(5):425–429
Rumanti IA, Nugraha Y, Wening RH, Gonzaga ZJC, Nasution A, Kusdiaman D, Septiningsih EM
(2016) Development of high-yielding rice varieties suitable for swampy lands in Indonesia.
Plant Breed Biotechnol 4(4):413–425
Sangeetha J, Habeeb J, Thangadurai D, Alabhai JM, Hospet R, Maxim SS et al (2020) Potentiality
of wild rice in quality improvement of cultivated rice varieties. In: Rice research for quality
improvement: genomics and genetic engineering. Springer, Singapore, pp 61–85
Sankarganesh E, Sowmiya C, Geetha P (2020) Chapter 1. Plant virus-vector relationships and
disease transmission. In: Essentials of economic entomology, vol 1
Séré Y, Fargette D, Abo ME, Wydra K, Bimerew M, Onasanya A, Akator SK (2013) Managing the
major diseases of rice in Africa. In: Realizing Africa’s rice promise, p 213
Sether DM, DeAngelis JD (1992) Tomato spotted wilt virus host list and bibliography. In Special
Report 888 (17 pp). Agricultural Experiment Station: Oregon State University
Sharma TR, Rai AK, Gupta SK, Vijayan J, Devanna BN, Ray S (2012) Rice blast management
through host-plant resistance: retrospect and prospects. Agric Res 1(1):37–52
Sicard A, Zeilinger AR, Vanhove M, Schartel TE, Beal DJ, Daugherty MP, Almeida RP (2018)
Xylella fastidiosa: insights into an emerging plant pathogen. Annu Rev Phytopathol 56
Sõmera M, Sarmiento C, Truve E (2015) Overview on Sobemoviruses and a proposal for the
creation of the family Sobemoviridae. Viruses 7(6):3076–3115
Takahashi Y, Tiongco ER, Cabauatan PQ, Koganezawa H, Hibino H, Omura T (1993) Detection of
rice tungro bacilliform virus by polymerase chain reaction for assessing mild infection of plants
and viruliferous vector leafhoppers. Phytopathology-New York and Baltimore Then St Paul-
83:655–655
Tang X, Sretenovic S, Ren Q, Jia X, Li M, Fan T et al (2020) Plant prime editors enable precise gene
editing in rice cells. Mol Plant 13(5):667–670
Thomas HR, Zaumeyer WJ (1950) Red node, a virus disease of beans. Phytopathology 40(9):
832–846
Xia Y, Chen X, Zheng S, Gunina A, Ning Z, Hu Y et al (2021) Manure application accumulates
more nitrogen in paddy soils than rice straw but less from fungal necromass. Agric Ecosyst
Environ 319:107575
Zeng Z, Xiong F, Yu X, Gong X, Luo J, Jiang Y et al (2016) Overexpression of a glyoxalase gene,
OsGly I, improves abiotic stress tolerance and grain yield in rice (Oryza sativa L.). Plant Physiol
Biochem 109:62–71
Zhang C, Ding Z, Wu K, Yang L, Li Y, Yang Z et al (2016) Suppression of jasmonic acid-mediated
defense by viral-inducible microRNA319 facilitates virus infection in rice. Mol Plant 9
(9):1302–1314
Zhang A, Liu Y, Wang F, Li T, Chen Z, Kong D et al (2019) Enhanced rice salinity tolerance via
CRISPR/Cas9-targeted mutagenesis of the OsRR22 gene. Mol Breed 39(3):1–10
Zhao Q, Feng Q, Lu H, Li Y, Wang A, Tian Q et al (2018) Pan-genome analysis highlights the
extent of genomic variation in cultivated and wild rice. Nat Genet 50(2):278–284
Zhao Y, Yang X, Zhou G, Zhang T (2020) Engineering plant virus resistance: from RNA silencing
to genome editing strategies. Plant Biotechnol J 18(2):328–336
53
Etiology, Epidemiology, and Management
of Maize Diseases 4
Talha Javed, Rubab Shabbir, Ayesha Tahir, Sunny Ahmar,
Freddy Mora-Poblete, Maryam Razzaq, Muqmirah,
Zainab Qamar Javed, Muhammad Junaid Zaghum, Sadam Hussain,
Ahmed Mukhtar, and Muhammad Asad Naseer
Abstract
The production of maize (Zea mays) across the world is continually challenged by
the development of a variety of diseases like rust, northern leaf blight, maize
streak, and grey leaf spot. Developing host defences against these pathogens can
T. Javed
College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou, China
Department of Agronomy, University of Agriculture, Faisalabad, Pakistan
R. Shabbir
Department of Agronomy, University of Agriculture, Faisalabad, Pakistan
Seed Science and Technology, University of Agriculture, Faisalabad, Pakistan
A. Tahir · M. Razzaq · Z. Q. Javed
Seed Science and Technology, University of Agriculture, Faisalabad, Pakistan
S. Ahmar (*) · F. Mora-Poblete
Institute of Biological Sciences, Universidad de Talca, Talca, Chile
Muqmirah
College of Plant Protection, Fujian Agriculture and Forestry University, Fuzhou, China
M. J. Zaghum
Seed Science and Technology, University of Agriculture, Faisalabad, Pakistan
Laboratory of Photosynthesis and Environmental Biology, CAS Center for Excellence in Molecular
Plant Sciences, Institute of Plant Physiology and Ecology, Chinese Academy of Sciences,
Shanghai, China
S. Hussain · M. Asad Naseer
Department of Agronomy, Northwest A&F University, Xianyang, China
A. Mukhtar
Department of Agronomy, University of Agriculture, Faisalabad, Pakistan
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_4
be a critical aspect of integrative pest control. This chapter discusses ecological,
conventional, and molecular breeding strategies, as well as techniques for
improving resistance mechanisms. In collaboration with other scientists, we
will be able to use molecular breeding methods to improve the quality of
susceptibility factors by using appropriate experimentation methods.
54 T. Javed et al.
Keywords
Maize · Bacterial diseases · Modern breeding technologies · Host resistance ·
Sustainability
4.1 Introduction
The maize (Zea mays L.) family of Poaceae is the world’s most important annual
cereal crop. According to the Taino language, Zea means “sustaining life”, derived
from an ancient Greek word, and may also mean “life giver”. The word “maize”has
the Spanish connotation “maiz”, which is the best way to describe the plant.
Different other names like zea, silk maize, makka, barajovar, etc. are useful to
identify the plant (Kumar and Jhariya 2013). The crops are accepted as a staple
food source throughout the entire world. After rice and wheat, maize is the third most
important crop in the world (Sandhu et al. 2007). Maize has starch (72%), protein
(10%), and fat (4%), providing energy at 365 kcal/100 g (Nuss and Tanumihardjo
2010). Maize contains a lower amount of protein than rice and wheat. Maize gives B
vitamins and important minerals, including fibre content, but is poor in remaining
nutrients, like vitamin B12 and vitamin C, and contains less calcium, folate, and iron.
Daily food in the diet and other components, like vegetables, tea (e.g. oxalates),
coffee (e.g. polyphenols), eggs (e.g. phosvitin), and milk (e.g. calcium), inhibit the
absorption of nonheme iron content, which is present in maize (Nuss and
Tanumihardjo 2010).
The maize crop is attacked by about 65 pathogens, including fungi, bacteria, and
viruses (Pavan and Shete 2021). In 2001–2003, fungal, nematode, and bacterial
diseases were reported to cause a 9% loss in maize crops worldwide (Oerke 2006).
The yield loss in individual states of the United States and Ontario, Canada, was
evaluated by university plant pathologists. It has been reported that 7.5–13.5% of
grain production was from 2012 to 2015 (Mueller et al. 2016). The total yield loss in
the United States is more than 2–15% in a year (Munkvold and White 2016). Maize
is affected by many bacterial diseases. Some of the common bacterial diseases that
are frequently observed in maize include stalk rot (creating deficiency in grain filling
and lodging) and bacterial leaf blight, which are caused by Pseudomonas avenae,
bacterial stalk rot caused by Erwinia dissolvens, bacterial leaf spot caused by
Xanthomonas campestris, and Erwinia chrysanthemi, which is responsible for top
rot and bacterial stalk and many more. In addition, maize productivity is also
severely reduced by several fungal and viral pathogens and nematodes. Numerous
methods have been recommended for the control and management of maize diseases
(Pavan and Shete 2021). The availability, cost-effectiveness, and feasibility of each
method differ among production regions. Recommended practices for the control of
fungal pathogens include agronomic practices like conventional tillage,
intercropping, crop rotation, and fungicide application. Effective management of
bacterial pathogens focuses on protection by limiting the source of primary inoculum
through crop rotation and residue management and by reducing the rate of disease
development. However, planting of resistant cultivars, developed through modern
biotechnological approaches, can effectively reduce the incidence and disease index
and is widely recommended. Therefore, the present chapter will help to focus on the
etiology, epidemiology, and management of different maize diseases.
4 Etiology, Epidemiology, and Management of Maize Diseases 55
4.2 Etiology of Different Maize Diseases
Maize is responsible for the 20% of the calories consumed by the world, directly or
indirectly (Sabagh et al. 2021). Maize is grown in the areas wider than any other crop
because of its capability of growing under temperatures ranging from cool to very
hot on wet to semi-arid lands and in many different types of soils. Shiferaw et al.
(2011) reported that the total of 54% losses are estimated every year due to the insect
pests, diseases, and microorganisms. After the insects, diseases play a major role in
affecting maize quality and yield. Some common diseases that hold immense
importance throughout the globe include southern corn leaf blight (Bipolaris
maydis), common rust (Puccinia sorghi), southern rust (Puccinia polysora), north-
ern corn leaf blight (Exserohilum turcicum), grey leaf spot (Cercospora species),
kernel and ear rots (Fusarium and Aspergillus), stalk and ear rots (Diplodia and
Fusarium), etc. These species contaminate seeds by producing mycotoxins that
compromise human health, food quality, and safety. In developing countries like
Asia and Africa, maize crops experience downy mildews, post-flowering stalk rot,
sheath blight, maize streak virus, etc. These diseases affect the seed quality in the
field as well as during storage. Etiological studies refer to finding out the causes of
the diseases, the factors that the pathogens use, and the conditions that are favourable
for the pathogens to attack the susceptible host (Jeffers 2004; Edmeades et al. 2017).
There are different biological agents that are responsible for the diseases of maize in
storage and in the field. The diseases and agents that are critical for the maize crop
are discussed below.
4.2.1 Bacterial Diseases
Most of maize disorders are induced by fungus; others are affected by bacteria,
posing a serious danger to maize yield and profitability (Rehman et al. 2021). Insect
injuries and scrapes are the most common entry points for bacteria into the plant. A
bacterium called Pseudomonas syringae pv. syringae causes holcus leaf spot, the
most common bacterial disease (Shao et al. 2021). The symptoms appear on the
lower leaves of the maize plant at first reproduction stage. Dark green, water-soaked
spots appear in an irregular pattern. Later, the lesions dry out to form a papery texture
with no borders (Kour et al. 2019). The favourable conditions for Pseudomonas
syringae to become active are temperature range of 77–86 F. Along with the warm
conditions, humid conditions also attract the bacterial agent to attack the maize crop
(Jayapriya and Hemalatha 2020).
56 T. Javed et al.
Stewart’s wilt, which is a concern for sweet corn from over 100 years, is caused
by, Erwinia stewartii (syn. Pantoea stewartii). Erwinia stewartii is a facultative
anaerobic, Gram-negative, nonflagellate, nonspore-forming, rod-shaped bacterium.
Intracellularly, polysaccharides produced by this pathogen contribute to the block-
age of the vascular system, which responds to the appearance of symptoms (Ma et al.
2016). Stewart’s wilt occurs in two phases: the seedling phase and the leaf blight.
This bacterium does not travel to maize by itself but needs a vector to reach its target.
When feeding on maize crops, the corn flea beetle acts as a vector, transferring
bacteria to the plant (Stack et al. 2001; Cushatt 2020). Beetles feed on the leaves, and
white marks are left behind on the leaves as a result of their scraping. The infected
plants show pale green to yellow streaks initially and later become brown as the
tissues die. There is a chance of plant wilting if the plant stalk is infected. If cut, the
stalk will produce droplets of pale yellow bacteria (Doblas-Ibáñez et al. 2019). Leaf
blight is the second stage of the infection. Along the leaf’s length, water-soaked
lesions emerge, and as they mature, they turn necrotic. The main culprit for this
disease is the flea beetles, which emerge in the early spring, coinciding with the
maize crop in the field. Beetles can carry pathogens all winter long if they feed on
diseased plants, or they can receive the bacterium directly from eating those plants.
The disease risk and corn flea beetle population are said to increase if the sum of
average monthly temperatures during winters exceeds 90 F. At the same time,
lowering the average monthly temperature to 80 F reduces the risk of disease and
beetle survival (Duong et al. 2018).
The Goss’swilt is another disease with similar symptoms to Stewart’s wilt. This
disease first appeared in 2009 and now is widespread in the corn-producing states
(Cooper et al. 2018). It has two phases, just as Stewart’s wilt: seedlings wilt (which
causes a systemic infection) and leaf blight (which kills the leaves). It is caused by
bacterial pathogen, Clavibacter michiganensis subspecies nebraskensis. It stays in
the infected corn debris for a whole winter season and can be transmitted at a very
low level. While systemic wilt is not as common as leaf blight, if it does emerge, the
plants are fated for the rest of the growing season if it persists. Plant yield and
survival is highly compromised in this infection. The seedling wilt phase infects the
vascular bundles of the plant and travels along the xylem of the plant. Symptoms
show the discoloration of the xylem to plant wilting or death (Jackson et al. 2007,
2009).
The primary symptoms of leaf blight phase appear as the elongated grey to light
yellow lesions with irregular margins extending parallel to the veins. Shiny patches
of the dried bacterial discharge appear on the lesions (Cooper et al. 2018). Diseased
plant residues on the surface of the soil transmit bacteria, causing Goss’s wilt to
occur. Wind- or hail-induced wounds allow the pathogen access to the plant. Hot dry
weathers can inhibit disease development except for fields with overhead irrigation
(Cooper et al. 2018; Harding et al. 2018).
4 Etiology, Epidemiology, and Management of Maize Diseases 57
Erwinia dissolvens is another bacterial pathogen that causes threats to maize yield
and survival. The disease caused by this pathogen is called bacterial stalk rot, but the
symptoms appear at the whorl stage of the maize crop. This disease causes decay to
the first internode above the soil. The pith becomes soft and water soaked. The plant
remains green, but the stalk twists and falls over. Because the vascular tissue is still
intact, the plant’s green colour will not fade for several weeks (Jackson et al. 2009).
Bacteria cause degradation of the tissues, and the destroyed tissues form a slimy
substance that becomes the reason for the foul odour from the infected plants. When
the decay occurs prior to tasseling, the upper leaves of the plant that form the whirl
die and can be easily removed from the plants. However, the bottom leaves are still
in good condition. Viruses and other pathogens can infect a plant at any node
throughout its whole length, up to and including its leaves and tassel. However,
this disease affects the individual plants only and does not spread to neighbouring
plants (Kumar et al. 2017). High humidity and high temperatures (88–95 F)
following pollination favour the development of this pathogen. There are many
other bacterial pathogens that cause diseases and damage to the maize crop. Some
of them are mentioned in Table 4.1.
Table 4.1 Bacterial diseases their casual agents and favourable conditions for disease develop-
ment in maize
Disease Causal organism Favourable conditions Reference
Bacterial
leaf spot
Xanthomonas
campestris
pv. holcicola
Temperatures between 65 and 68 F, high
humidity, plant injury, and excessive
fertilization
Mbega
et al.
(2012)
Bacterial
stalk and top
rot
Erwinia
carotovora subsp.
carotovora
Erwinia
chrysanthemi
pv. zeae
High-temperatures and high-relative
humidity
Kumar
et al.
(2017)
Bacterial
stripe
Pseudomonas
andropogonis
High relative humidity, leaf wetness,
continuous corn, and minimum tillage.
Heavy rainfall and overhead irrigation also
may favour bacterial infection
Saha et al.
(2015)
Chocolate
spot
Pseudomonas
syringae
pv. coronafaciens
Mild, damp conditions with high humidity
and temperature between 0 and 30 C—the
optimum temperature around 15–20 C
Guo et al.
(2020)
Purple leaf
sheath
Hemiparasitic
bacteria
Abundant rainfall and temperature range
between 73 and 90 F
Li et al.
(2018)
Seed
rot-seedling
blight
Bacillus subtilis Wet soils, in low-lying areas in a field or in
soils that have been compacted or remain
wet for an extended period of time. Low soil
temperatures (50–55 F) and wet soil
conditions especially are favourable
Lanza
et al.
(2016)
58 T. Javed et al.
4.2.2 Fungal Diseases
Maize is an important cereal crop feeding a large population around the world.
Although important, maize is attacked by more than 60 diseases that affect its quality
and yield. Fungi are among the principle causes of maize deterioration during
storage and in field that could cause 50–80% losses of maize if the conditions are
favourable for fungi growth. A larger number of maize diseases are due to different
fungi. Penicillium,Fusarium spp., and Aspergillus spp. cause the major diseases,
which cause grain loss of about 11% of the total production (Mueller et al. 2016;
Mannaa and Kim 2017). The development of fungi is expected when the temperature
and moisture content of maize is high during storage. Aspergillus spp. becomes
systemic and produces harmful toxins in seedlings and contaminates seeds in storage
by producing aflatoxins. Fusarium invades seeds before harvest and produces
mycotoxins which are damaging for maize as well as humans (Tsedaley and Adugna
2016).
Common smut caused by Ustilago maydis produces light green galls containing
black masses of spores. These swollen galls later turn white and infect corn ears
through silks. These galls can appear at any time in the growing season anywhere in
the above-ground part of the plant. The fungus survives on corn debris and is
transmitted when the conditions are favourable. Smut spores can survive in the
soil for the whole winter season and are spread by wind and rain. Actively growing
young tissues are more susceptible (Neupane and Ghimire 2020). Head smut is
another fungus species that is responsible for head smut, a soilborne disease. The
pathogen enters systemically, and symptoms appear at the time of tasseling and
silking. Symptoms appear in the form of conspicuous galls that replace ears or
tassels. These galls are covered by fragile membranes containing masses of dark
brown spores, vascular bundles, and teliospores. The presence of vascular bundles
and a membrane makes it distinct from common smut. Once the membrane is
broken, wind and rain spread the teliospores to soil where it stays viable for a long
time. The favourable conditions for S. reiliana are dry and warm weather at
temperature 70–80 F (Simón et al. 2021). Aspergillus flavus and A. parasiticus
are the most important species of fungi that produces cancer causing aflatoxins. They
affect the seed quality as well as the health of the consumers. Aspergillus infections
and green fungal growth are common in the ear. When the seedlings are damaged by
insects or scars appear on plants due to hail, aspergillus ear rot infections are more
likely to occur. Infected ears produce a greenish-gold fluorescence when viewed
with a black light at a wavelength of 365 nm. The disease worsens in drought
conditions (Rehman et al. 2021).
Gibberellaear rot, caused by Gibberella zeae, which affects the tip of the ears and
produces pink to red fungus growths, which moves towards the end of the ears.
Infection occurs during silking. This disease is more prevalent when the weather is
cool and wet during first 21 days of the silking. The fungus survives in the soil debris
during winter seasons and enters the plant as soon as it is possible. The fungus
produces two mycotoxins that are vomitoxin (or DON) and zearalenone, both of
which are harmful for livestock. Extended periods of rain and fall increases the
severity of the disease (Dalla Lana et al. 2021). Stenocarpella maydis is the fungi
species that causes Diplodia ear rot in maize. The symptoms start at the base of the
ear but can appear on any part of the plant. The fungus produces white growth
between kernels which later appears grey with black pycnidia. The fungus transmits
to new plants by splashing water. The injured plants due to birds and insects invite
the pathogen for infection. Dry conditions during early vegetative growth stages
followed by warm, wet weather within the first 3 weeks after silking favour the
development of Diplodia ear rot (Atenya 2016; Mabuza 2017). Puccinia polysora,
responsible for southern corn rust, is favoured by warm and humid conditions.
4 Etiology, Epidemiology, and Management of Maize Diseases 59
Early symptoms include circular to oval-shaped lesions which are often
accompanied by light green to yellow halo. The lesions erupt from the epidermis
of the leaf surface. Heavily infected leaves die at premature stage. Spores are spread
by wind and grow when humid conditions are provided (Debnath et al. 2019; Wang
et al. 2019a,b). Another type of rust, which is known as common corn rust, is caused
by Puccinia sorghi. Common rust is common wherever corn is grown. The
favourable conditions for P. sorghi to cause common rust are similar to those for
southern corn rust to occur. The disease causes lesions on the leaves that look like
small tan spots on both sides of the leaves. These spots later turn into brick red or
cinnamon blisters. One distinctive feature of this disease is that the symptoms appear
on leaves only, not on sheaths, ears, or stalks. Infection is favoured by extreme
temperatures, high humidity, and temperatures of 16–25 C. Rust development and
spread are favoured by cool temperatures. Pustules develop on corn varieties and
hybrids which are susceptible after 7 days of infection (Dey et al. 2012; Debnath
et al. 2019). There are many fungi species that cause maize to suffer from diseases,
and some of them are mentioned in Table 4.2.
4.2.3 Parasitic Diseases
Plant parasitic nematodes can severely affect corn fields by deteriorating its quality
thereby reducing its yield. These parasites attack the root system of the plants to
lower the efficiency of the roots to take up the water and nutrients (Topalovićet al.
2020). The damage usually appears on roots and above ground parts of the plants.
The degree of damage is related to the types and population levels of nematodes
present as well as the environmental conditions present in a field. Different species of
nematodes include dagger (Xiphinema), lance (Hoplolaimus), lesion (Pratylenchus),
needle (Longidorus), spiral (Helicotylenchus), and stunt nematodes
(Tylenchorhynchus), but needle (Longidorus) and sting (Belonolaimus) species are
the most dangerous ones. Above-ground symptoms usually include stunted growth,
yellowing of leaves, uneven growth of tassels and ears, etc. while browning of roots
is also visible (Ismaiel and Papenbrock 2015). Root-knot nematodes (Meloidogyne
spp.) are present in all over the world, but the majority is found in areas with warm
and hot climates and short or mild winters. Root-knot nematodes result in poor
growth, decreased quality and yield of the crop, and reduced resistance of other
stresses (Ye et al. 2019). Nematode damaged roots do not utilize water and fertilizers
¼
60 T. Javed et al.
Table 4.2 Fungal diseases their casual agents and favourable conditions for disease development
in maize
Disease Causal organism Favourable conditions Reference
Anthracnose
leaf blight
Anthracnose
stalk rot
Colletotrichum graminicola
Glomerella graminicola
[teleomorph]
Glomerella tucumanensis
Glomerella falcatum
[anamorph]
Low fertility and wet and
warm weather provide
favourable conditions. Spores
transmit through rain water
Nicoli
et al.
(2016)
Black kernel
rot
Lasiodiplodia
theobromae ¼Botryodiplodia
theobromae
Moist and humid conditions Rehman
et al.
(2021)
Brown spot Physoderma maydis Abundant rainfall and
temperatures ranging between
73 and 90 F
Subedi
(2015)
Brown stripe
downy
mildew
Sclerophthora rayssiae High moisture conditions Basandrai
and
Basandrai
(2020)
Crazy top
downy
mildew
Sclerophthora
macrospora ¼Sclerospora
macrospora
Saturated soil conditions for
24–48 h from planting to
about the five-leaf stage of
growth. Accumulation of soil
and water in the whorl of
small plants results in
infection
Kim et al.
(2020)
Eyespot Aureobasidium
zeae Kabatiella zeae
Cool and wet conditions Wang et al.
(2021)
Fusarium ear
and stalk rot
Fusarium
subglutinans ¼Fusarium
moniliforme
High nitrogen, low potassium
fertility, high moisture in the
mid to late season after a dry
early season
Gai et al.
(2018)
Late wilt Cephalosporium maydis Moist soils and temperature of
30 C
Molinero-
Ruiz et al.
(2010)
Penicillium
ear rot
Blue eye
Blue mold
Penicillium spp.
Penicillium chrysogenum
Penicillium expansum
Penicillium oxalicum
Moist and humid conditions Kieh
(2014)
Pythium root
rot
Pythium spp.
Pythium arrhenomanes
Pythium graminicola
Cold temperatures and
saturated soils
Binagwa
et al.
(2016)
Red kernel
disease
Ear mold,
leaf and seed
rot
Epicoccum nigrum Warm and humid conditions Oldenburg
and Ellner
(2015)
Yellow leaf
blight
Ascochyta ischaemi
Phyllosticta maydis
Mycosphaerella zeae-maydis
[teleomorph]
Wet and warm conditions Rehman
et al.
(2021)
as effectively, and below-ground symptoms include severe galling, stunting, and
chlorosis of crops. Root swellings can be formed in other diseases as well, but the
root-knot galls have firm tissues near the fibrous vascular tissues of the roots
(Eisenback and Triantaphyllou 2020). The male and female nematodes of root-
knot have distinct morphology. Males are worm-like, with 1.2–1.5 mm in length
and 30–36 m in diameter. The females are pear-shaped and about 0.40–1.30 mm
long and 0.27–0.75 mm wide. The life cycle includes egg, juvenile, and adult stages.
A life cycle is completed in 25 days at 27 C, but it takes longer at lower or higher
temperatures. Each female lays approximately 500 eggs in a gelatinous substance
produced by the female (Eisenback and Triantaphyllou 2020). Cyst nematodes
(Heterodera zeae) produce light brown to dark reddish brown and brown cysts
that are shaped in an ovate and spheroid form. The symptoms relate to root damage
and include stunting of plants in patches, yellowing of leaves, and reduced size of
shoot parts. When a female dies, her body is tanned into a brown capsule containing
hundreds of eggs. Mature females are found attached to roots with heads embedded
in steles (Zheng et al. 2021). The male is wormlike, about 1.3 mm long and 30–40 m
in diameter. Fully developed females are lemon-shaped, 0.6–0.8 mm in length and
0.3–0.5 mm in diameter. Approximately 21–30 days are required for the completion
of the life cycle of the cyst nematode. 4- to 6-week-old plants can be seen in the root
system by 4- to 6-week-old plants (Ibrahim et al. 2017).
4 Etiology, Epidemiology, and Management of Maize Diseases 61
The root lesion nematodes (Pratylenchus spp.) are economically important Phyto
nematodes in maize fields. The plants show chlorosis, stunting, and a loss of vigour
which results in wilt (Puerari et al. 2015). Lesion nematodes reduce root develop-
ment by forming lesions on young roots. The affected roots then rot because of
secondary fungi and bacteria attacks. Both male and female nematodes are worm
like with 0.4–0.7 mm long 20–25 μm diameter. They are migratory endo-parasitic
nematodes. The life cycle of Pratylenchus is completed within 45–65 days (El-Nuby
2020). Rotylenchulus reniformis, commonly known as reniform nematodes, is the
most significant after root-knot. Maize serves as a good host for this nematode.
Affected plants show stunted growth and poor yields of maize (Lima et al. 2017).
This nematode is characterised as a semi-endoparasite, and it remains attached to
roots. Plants infested with nematodes exhibit stunted growth and root discoloration.
Loss in germination and crop stand occurs when nematodes damage the crops at the
pre- and post-emergence stages of seedlings. Under optimum conditions, the dura-
tion of the life cycle of this nematode is about 4–5 weeks. Soil pH, moisture, and
temperature have significant roles in penetration, infectivity, and the biology of
nematodes. The life cycle is completed in 25 days (Soler et al. 2021).
Hoplolaimus species (lance nematodes) is a very common nematode which can
be found on plant roots in all types of soil and climate (Holguin et al. 2016). These
parasites are known as sedentary ectoparasites because they often feed at a particular
spot for long time, and half of their bodies are embedded in the root system of the
plant. Damage may show up as patches of yellowing and dying. These symptoms
also can be caused by drought or nutrient deficiency. Lance nematodes multiply
slowly in comparison to endoparasitic nematodes, but they inflict significant crop
damage at a lower level of infection. The availability of feeder roots and temperature
are important factors for population buildup of this nematode (Singh et al. 2020).
Life cycle is completed in 13–38 days. Stem and bub nematodes (Ditylenchus spp.)
are found worldwide but are particularly present in areas with temperate climates
(Sturhan and Brzeski 2020). It is known to be the most destructive pathogens with
several hosts. Stem nematodes are responsible of heavy killing of seedlings,
dwarfing, causing distorted development of the plants, twisted and swollen stems,
as well as foliage. This nematode is barely present in soil and feed on stem and leaves
of the host plants. The nematode is 1.0–1.3 mm long and about 30 μm in diameter.
The females lay 200–500 eggs, mostly after fertilization by the males. The total
duration of life cycle ranges from 19 to 25 days (Sturhan and Brzeski 2020).
62 T. Javed et al.
4.2.4 Viral Diseases
Viruses are microscopic organisms that are unable to reproduce themselves but need
a host to continue their life cycle (Asiimwe et al. 2020). In most cases, viruses are
spread by insect vectors, which harm the plant by opening a channel for infections or
by dipping into the phloem to feed on the diseases. Once within the plant cells,
viruses manage the machinery using the few genes in their little genomes, all the
while evading the plant’s defences. RNA viruses are the most common types of plant
viruses that cause diseases and losses in maize fields (Carino et al. 2020). There are
more than 700 species of viruses, many of which cause diseases in a wide range of
hosts. These species of viruses are classified into 3 families and 32 groups based on
the type of nucleic acid, whether the nucleic acid is single-stranded or double-
stranded, and the means of transmission (Roossinck et al. 2015). Barley yellow
dwarf virus (BYDV) is a luteovirus that is distributed worldwide and affects major
cereal species. Two of the major viral diseases of maize are maize dwarf mosaic
(MDM) and maize chlorotic dwarf (MCD). Together, these two diseases can cause
losses of up to 90% in fields. These viruses attack all types of corn, but popcorn and
sweet corn are the hosts for these pathogens (Wijayasekara and Ali 2021; Bernardo
et al. 2021). Symptoms of these diseases resemble and can be influenced by
environmental conditions. Maize dwarf mosaic virus produces a faint or pale green
streaking pattern in young leaves along the veins. Spots of dark green tissues appear
on a light green background (Wijayasekara and Ali 2021). As the infected plants
move towards maturity, the discoloration of the leaves increases and becomes
yellowish green. Infected plants set a few seeds and produce multiple ear shoots.
Early infections cause stalk rots and root rots. Sometimes the plant can experience
death due to this infection (Bernardo et al. 2021).
The most destructive of all are maize streak virus (MSV), (Tembo et al. 2020;
Monjane et al. 2020; Emeraghi et al. 2021). This virus is transmitted by leafhoppers,
persistently. Streak viruses panicum streak virus (PanSV), sugarcane strains
Réunion and Egypt, and Digitaria strains digitaria streak virus (DSV) are all linked
to MSV in terms of genetics (Ma et al. 2015; Shafiq et al. 2020).The virus is
transmitted by the insect leafhopper Cicadulina spp. commonly found in fields of
late-planted maize to varieties that are susceptible to the disease. Disease symptoms
in infected maize plants, streak disease initially manifests as minute, pale, circular
spots on the lowest exposed portion of the youngest leaves. The only leaves that
develop symptoms are those that formed after infection, with older leaves remaining
healthy. Maize-infecting maize rough dwarf virus is one of the viruses found in Fiji
(MRDV). Early disease: white streaks and waxy swellings on the veins of the lower
side of the leaves indicate early disease. Symptoms begin to manifest 4–5 weeks
following the immunization. There are two known maize-infecting tenuiviruses, or
tenui-like viruses. It’s the maize stripe virus (MSpV) and the maize yellow stripe
virus (MYSV) that are causing the problem (Guadie et al. 2018). MSpV and MYSV
have been discovered in sorghum, where they cause sorghum stripe disease (SStD)
(Sharman et al. 2016). The maize planthopper, P. maidis, is the vector of MSpV
(Dumón et al. 2018). Although the virus reproduces and stays in the planthopper
(Liu and Wang 2018), it may be transferred occasionally. Nymphs are better at
passing on MSpV than adults, and they have the ability to spread the virus for a long
time (Barandoc-Alviar et al. 2016). The vector’s typical latent period is between
10 and 15 days, with transmission by people commencing as early as 4 days and
lasting as long as 22 days. Nymphs in their first instar are the most effective
transmitters (64%), followed by second to fourth instars (50%) and adults (50%)
(33%). MSpV is passed to a tiny percentage of progeny via the egg (Liu and Wang
2018).
4 Etiology, Epidemiology, and Management of Maize Diseases 63
4.3 Management of Maize Diseases
Diseases of the maize crop cause several losses to the human world. If these diseases
could not be eliminated, there would be a lot of starvation and famine, especially in
the zones where maize is used as a staple. In the USA, southern corn leaf blight
(casual agents were Cochliobolus maydis and Bipolaris maydis) caused direct
economic losses to the hundreds of corn growers. The annual estimation of eco-
nomic losses was one billion dollars (Maloy 2005). Annually, various maize
diseases cause minute dramatic losses throughout the globe. However, these diseases
tend to cause massive losses collectively to the farmers and also reduce the aesthetic
appeal of the farmlands (Kupatt et al. 2018). Management of maize diseases usually
relies upon the anticipation of the disease occurrence and the prone sites of the
disease cycle. These sites provide vulnerable links in the infection chain; therefore,
correct diagnosis of the disease cycle is the key to pathogen identification. For
effective disease management, a correct analytical knowledge of the disease host,
the prevailing environment, including climate, and other factors such as cultural
necessities of the host plants are necessary. The tactics of disease management can
be grouped under two major principles. However, the difference between these two
principles is often vague. The simplest rule of disease management is prevention and
therapy (Tripathy et al. 2020).
64 T. Javed et al.
4.3.1 Prevention
The very first principle of disease management includes the application of
techniques before infection and disease attack. In this way, the plant is ready to
cope with the upcoming challenges of severe disease attack. An example of this
principle is quarantine law enforcement (Ilyas et al. 2021).
4.3.2 Therapy
The second principle includes the curative functions in which any kind of disease-
eradicating measure is applied after the initiation of infection. Chemical treatment, in
which chemicals are applied to infected or diseased plants and plant parts, is an
example of this principle (Tripathy et al. 2020).
4.3.3 Other Principles
Other principles of disease management include:
Exclusion: It includes the principle of avoidance of pathogen introduction into a new
area (Maloy 2005; Pal and Gardener 2006).
Eradication: It includes elimination, eradication, and destruction of the inoculum
(Maloy 2005; Pal and Gardener 2006).
Protection: It includes the use of any toxicant or some other disinfectant barriers
(Maloy 2005; Pal and Gardener 2006).
Immunization: It includes the principle of resistance or tolerance towards infection
(Maloy 2005; Pal and Gardener 2006).
4.3.4 Studies on Cultural Control
Cultural practices have a major role in the management of a wide variety of plant
diseases. The purpose of cultural practices is to ensure the provision of favourable
environmental circumstances for crop development, which results in excellent plant
health, and to limit the establishment of phytopathogens, which reduces disease
incidence. Modifications to a variety of cultural techniques are critical for disease
control in every crop. Several common practises include the following: selection of
crop seasons and safe areas, proper tillage to excavate diseased plant debris, cultiva-
tion of crops other than disease hosts, selection of disease-tolerant planting materials,
proper crop direction to maximize sun and air exposure, proper irrigation, and
nutrition management of crop spacing and population, which helps to promote
root growth and prevent injury to the plants (Kumar and Gupta 2020).
Some of the cultural control techniques are listed below.
4 Etiology, Epidemiology, and Management of Maize Diseases 65
4.3.4.1 Tillage Techniques
Tillage, or turning maize residues, benefits the next crop by decreasing inoculum
survivability. Burying infected trash promotes decay and deprives the fungus of a
feeding source. The fungus is unable to thrive in the soil on its own. It can only
overwinter on dead corn tissue that remains on or above the soil surface (Ghanney
2017). Disking alone is not adequate to bury contaminated material. While mould
board ploughing is effective, it may not be recommended in certain areas because of
the increased erosion risk. Erosion may be minimized by ploughing in the autumn
and sowing a winter cover crop followed by a no-till maize plantation in the spring.
On the other hand, burial of infected material, on the other hand, may not be an
efficient method of decreasing grey leaf spot inoculum in areas where conservation
tillage is widely used, since the pathogen may be carried into a field by wind from
neighbouring fields (Munkvold 2003).
4.3.4.2 Agronomic Practices
Grey leaf spot intensity may be eliminating a field from corn cultivation or rotating to
a non-host crop for 1 year. The fungus cannot live in contaminated maize waste for
more than one season. Maize is the only crop known to be attacked by this fungus.
However, the risk of herbicide carryover may limit the crops included in the rotation
plan (Afzal et al. 2020). Another way of reducing disease infestation includes
growing maize for silage purpose. This can substantially decrease the quantity of
inoculum accessible to infect the next crop (Aglave 2018). To begin, silage corn is
often harvested before the severe attack of grey leaf spot blight. This strategy limits
the quantity of pathogen available to survive the winter months. Second, when maize
is harvested for ensilage, just approximately 6 in. of stalk remains in the ground. This
approach generates very minute contaminated material for the fungus to overwinter
(Aglave 2018). The timing of planting has an effect on disease incidence. Afzal et al.
(2020) discovered that maize plant spacing had a substantial impact on turcicum leaf
blight infection. Close spacing resulted in an intense degree of disease. This was also
true in the case of grey leaf spot and rust. The motive of this increment was that
increasing the space between and between rows lowered both the relative humidity
and free moisture on the leaves, thus reducing disease infestation (Afzal et al. 2020).
When maize was intercropped with sweet potato, leaf blight and common rust
severity were decreased. Additionally, when haricot bean was planted during inter-
crop cultivation, intercropping maize with haricot bean decreased the amount of
infestation of both diseases (intercrop cultivation) (Afzal et al. 2020). Planting maize
and sorghum together revealed that a high sorghum population resulted in greater
leaf blight intensity and lower corn rust, while a high maize population resulted in
low leaf blight severity (Afzal et al. 2020). The optimum levels of fertilization are
known to reduce the incidence of disease. Fertilizer application with NPK (0.96,
0.60, and 0.22 kg, respectively, for each pot of 25 cm diameter) levels reduced the
damping off disease in maize, reportedly (El-Demerdash et al. 2017). Contrastingly,
NPK levels of 0.77, 0.60, 0.22, and 0.77, 0.75, and 0.15 kg per pot reduced damping
off post seedling emergence. Another NPK level of 0.58, 0.75, and 0.075 kg
minimized the incidence of root rot in maize seedlings (El-Demerdash et al. 2017).
a
Different fertilizer application levels of biofertilizers such as farm yard manure have
been analysed against root rot and damping off in maize cultivars (El-Demerdash
et al. 2017). Varietal screening can prove helpful in reducing pathogen incidence in a
respective maize field. At Bako and Kelalbero in western Ethiopia, (Afzal et al.
2020) tested 34 maize accessions for resistance to turcicum leaf blight (TLB).
Despite the absence of an immune host, some varieties had a reduced incidence of
disease, while others showed a greater incidence (Afzal et al. 2020).
66 T. Javed et al.
4.3.5 Cultural Control of Various Maize Diseases
Common corn smut is produced by the fungus Ustilago maydis, which may persist
for many years as dormant spores in soil and maize waste. Spores are dispersed by
wind or sometimes by water splashing up onto the new plants. Spores may also be
transmitted via the dung of animals who have eaten contaminated maize (Kumar and
Gupta 2020). It can be controlled well via conducting a soil test based on fertility.
Prevention of mechanical damage during spraying and cultivation is another factor
that also helps to overcome the disease infestation. Gall removal is important before
the smut boils break and teliospores get discharged (Aglave 2018). Southern corn
leaf blight is usually caused by a fungal agent named Bipolaris maydis. There are
only two strains of this pathogen, “Race O”and “Race T”. Race O usually hits and
just leaves. The lesions produced by this type are tan-coloured, slightly rectangular
in form, and have reddish-brown borders. Race T damages leaves, husks, leaf
sheaths, and cobs. The most critical point in the removal of all corn blight strains
is the disease and inoculum prevalence. As the B. maydis overwinters in leaves and
sheath debris, it is quite crucial to remove the old plant debris. Efficient tillage
practise helps to break up the soil clods and plant debris. Thus, in this way, all
remnants of the past infestation are wiped out. In comparison to minimum tillage,
which might leave residue on the soil surface, burying residues by ploughing has
been found to minimise the incidence of SCLB. Another way to reduce the spread of
SCLB is to rotate crops with crops that are not host plants (Aglave 2018).
Grey leaf spot of corn, generally caused by the fungus named Cercospora zeae-
maydis, is a perennial and economically very harmful disease in the United States.
The disease infestation can be controlled via following the late sowing dates and
adaptation of minimum tillage systems. One should also know the previous disease
history of the corn fields before shifting towards intensive maize cultivation (Aglave
2018). Downy mildew is generally caused by Peronosclerospora sorghi.Itis
widely distributed disease of maize throughout many regions of the world. To
prevent this disease, there is a recommendation of planting corn away from the
low, damp areas where the disease is known to develop. Appropriate ground
drainage will decrease inoculum spread via flooding and infection thereafter (Aglave
2018). Destroying maize plant detritus, as well as removing and destroying collateral
hosts, aids in disease control. Proper nutrition at right rate may help to control
disease infestation (Javed et al. 2022b). Removal of such volunteer host is a safest
way towards the cultural control of dwarf mosaic virus. Best control is achieved
when all farmers in a community work together to eradicate Johnson grass. Plant the
maize crop early so that the aphid population could not grow faster (Aglave 2018).
4 Etiology, Epidemiology, and Management of Maize Diseases 67
Anthracnose is a fungal infection that affects the majority of corn tissues during
the plant’s growth. The fungus, entitled Colletotrichum graminicola, displayed
symptoms of necrosis with maize leaf samples exhibiting grey, brownish to black,
and oval to elongated lesions. Grain yield losses due to anthracnose are estimated to
range from 0% to 40%, depending on the hybrid, climate, infection timing, and other
stressors (Kumar and Gupta 2020). Tillage can minimise the danger of incorporating
the waste into the soil and the effects of a breakdown. At least 1 year of rotation to
non-corn crops may reduce anthracnose early in the season, but it does not affect the
disease late in the season. Another strategy is crop scouting. Examine maize at
regular intervals of 2 weeks until the dough stage is achieved (Aglave 2018).
Non-grass crop rotation, for example, the rotation of maize to legumes, can help to
lower the spread of disease inoculum. Soil sanitation is another remedy for disease
prevention. Weed management, selection of well-drained soils, and high fertility
gradients with optimum soil pH also reduce the inoculum spread (Aglave 2018). In
maize, younger leaf tissues are more prone to fungal attack then mature leaves.
Delayed disease progression in mature crops reduces the risk of productivity loss.
Therefore, some farmers prevent disease or limit its impacts in places where rusts are
a more constant concern. They lower the disease risks by not sowing late or utilizing
short-term hybrids. In doing so, the rust spores couldn’t enter the field and occasion-
ally disease may be entirely prevented (Aglave 2018). Maize eyespot (Kabatiella
zeae) has decreased the maize production up to 9% in the areas where maize is
cultivated on a large scale. Aglave (2018) proposed the crop rotation to minimize the
infection caused by K. zeae, a proper crop rotation and the thorough ploughing and
removal of after-harvest leftovers, particularly from severely affected plants. It can
also minimize the amount of infectious material. Deep burial of plant wastes reduces
sporulation and promotes breakdown of the spores which limits the early spread of
diseases (Aglave 2018). Corn cultivated for one growing season followed by tillage
operations is recommended to cut back the disease development in the subsequent
corn crops. Crop rotation for two growing seasons is considered more accurate to
prevent the amount of diseases inoculum (Aglave 2018).
4.3.6 Biological Control
The terms “biological control”and its shortened form “biocontrol”have been used in
several fields of biology, most notably entomology and plant pathology (Degani and
Dor 2021). It is a phrase used in entomology to describe the method of reducing
populations of specific pest insects by the use of live predatory insects,
entomopathogenic nematodes, or microbial illnesses. A biological control agent is
an organism that inhibits a pest or illness (BCA) (Bressan 2003). In a broader term,
the phrase “biological control”refers to the utilization of natural materials extracted
or fermented from a variety of sources. These formulations may be relatively basic
combinations of natural substances with particular activities, or they may be
complicated combinations having numerous effects on both the host and the target
pest or disease. Additionally, although non-living inputs may imitate the actions of
live creatures, they are more appropriately referred to as bio-pesticides or
bio-fertilizers, depending on the main benefit given to the host plant (Pal and
Gardener 2006).
68 T. Javed et al.
4.3.6.1 Biocontrol of Seed-Borne Fungi Via Actinomycetes
Bressan (2003) reported two Streptomyces strains that were evaluated for their
ability to suppress pathogenic fungus in stored maize grain. Seeds were disinfected
and inoculated with Streptomyces strains secluded from maize rhizospheres. The
Actinomycete inoculum was composed of filtered suspensions and complete
suspensions of Streptomyces spp. strains biomass. Streptomyces strains solely
inhibited the growth of Drechslera maydis,Curvularia lunata, and other Aspergillus
spp. and substantially decreased the exposure of Cephalosporium acremonium and
Fusarium subglutinans. In the development of techniques of inoculations, only
non-disinfested seed conjugated with filtered suspension did not constrain the
Penicillium development. However, inoculation of maize seeds in a complete
suspension of strains was the most efficient method of reducing the fungus preva-
lence. On the other hand, the combination of seed disinfection and inoculation with
complete suspension of strains was an excellent approach towards inhibiting the
growth of the Diplodia maydis. However, the strain DAUFPE 11470 was most
efficient in controlling fungi harmful to seeds. The treatment with this strain,
however, restricted root and shoot growth (Bressan 2003).
4.3.6.2 Biocontrol of Southern Corn Leaf Blight (SCLB) Via Trichoderma
Species
Southern corn leaf blight is caused by Cochliobolus heterostrophus, and it is among
the major global productivity threats to maize crop. Synergic applications of
low-toxicity chemical fungicides and bio-control agents may increase the stability
and effectiveness of biocontrol agents against plant diseases, thus reducing the need
for chemical fungicides (Wang et al. 2015). Trichoderma is a popular biocontrol
fungus and has been employed successfully to control a variety of foliar diseases.
However, few studies on the synergistic use of chemical fungicides and
Trichoderma have been published. Wang et al. (2019a,b) determined the control
impact of combining Trichoderma harzianum SH2303 and
difenoconazole-propiconazole (DP) against SCLB. The results indicated that when
DP and SH2303 were applied synergistically, the leaf spot area was decreased in
comparison to the control. The synergistic use of DP + SH2303 against SCLB was
shown to be effective for 15–20 days in pot trials conducted under greenhouse
conditions. The treatment increased the production of defence-related enzymes such
as phenylalanine ammonia lyase (PAL), catalase (CAT), and superoxide dismutase
(SOD) and the expression of PR1 genes (Wang et al. 2019a,b). Wang et al. (2015)
also determined the levels of RNA expression for PAL, SOD, and CAT. It has been
reported that the RNA expressions were increased, which correlated to the enzyme
activity simultaneously. Trichoderma SG3403 generated more evident enzyme
activities and related gene expression than pathogen alone, implying that
T. atroviride SG3403 promoted corn defence gene expression against pathogen
infection. Thus, an induced resistance mechanism may have been implicated via
T. atroviride SG3403 against SCLB (Wang et al. 2015).
4 Etiology, Epidemiology, and Management of Maize Diseases 69
4.3.6.3 Bacillus Species as a Biocontrol Agent Against Fusarium
Fusarium verticillioides causes rotting of stalk, ear, and root in maize. It has a
significant effect on crop output in tropical and subtropical territories. The team of
researchers isolated Firmicutes and Proteobacteria from rhizosphere samples which
were collected from infected spots of the maize plants either symptomatic or
asymptomatic. The whole collection was tested for potential action against Fusarium
verticillioides. The researchers used a liquid antagonism assay by preparing a dual
culture in solid medium. It resulted in the identification of 42 bacterial species
(Bacillus,Pseudomonas, and Paenibacillus) that suppress Fusarium verticillioides
growth (less than 45%). However, further assays revealed that three Bacillus isolates
had the maximum antagonistic activity against Fusarium verticillioides. It includes
Bacillus megaterium (B5), Bacillus cereus sensu lato (B25), and Bacillus sp. (B35).
4.3.6.4 Use of Biopesticides Against Maize Disease
Biopesticides are naturally occurring chemicals or agents derived from animals,
plants, and microorganisms such as bacteria, cyanobacteria, and algae. These bio-
chemical agents are used to manage agricultural pests and diseases. The US Envi-
ronmental Protection Agency defines biopesticides as substances originating from
natural sources such as animals, plants, microorganisms, and some minerals. These
biocontrol agents or products, such as genes and metabolites, may be utilized to
avoid crop damage. Biopesticides are much more beneficial than their chemical
equivalents, since they are environmentally benign and host specific. Biopesticides
can significantly enhance the usage and use of agro-based chemicals in the agricul-
tural industry to protect crops against invasions of infectious pests.
4.3.7 Chemical Control
The utilization of agrochemicals and pesticides, in particular, is common in agricul-
ture to control a variety of pests and diseases of crops. Fungicides and bactericides
are chemicals that play a critical role in a wide variety of disease control strategies.
Foliar applications usually protect plants from diseases that harm growing plants.
These sprays may be used as a preventative or curative measure. These compounds
may be either surface protectants or systemic in nature, depending on their mode of
action. Protectant pesticides work prophylactically, forming a protective barrier on
the seed or plant surface that inhibits pathogen development. Systemic insecticides
penetrate the plant tissues and destroy pathogens that have already developed.
Fungicides have been used to treat a variety of diseases for over a century, and the
process of developing new fungicide formulations is ongoing. The Bordeaux com-
bination was the first extensively used fungicide; it is a copper sulphate fungicide
that is being used in different forms today. The early classes of inorganic fungicides
were developed from simple components like sulphur, metallic mercury, or copper
complexes. Organic fungicides introduced in the 1950s, such as captan, thiram, and
carbamates, are protectant or contact fungicides and very effective against a variety
of fungal diseases (Kumar and Gupta 2020).
70 T. Javed et al.
Usually chemicals are applied in two different ways.
4.3.7.1 Spraying
According to Afzal et al. (2020), a combination treatment of mancozeb and
propiconazole at a dosage of 2.0 kg per hectare of maize (two to three times at
10-day intervals) effectively controlled the two diseases, turcicum leaf blight and
common rust. It has been reported that, in general, fungicide treatment is not cost
efficient for small-scale farmers in Ethiopia. It may, however, be lucrative for hybrid
seed producers (Afzal et al. 2020).
4.3.7.2 Chemical Treatment of Seeds
Maize kernel rot infections can cause serious injury to the grain after 3 months of
storage during the year’s dry and warm season. Research done at the Bako Research
Center determined that the use of a chemical named Luxan TMTD contributed to the
least amount of kernel rot destruction (9.16%) (Afzal et al. 2020).
4.3.7.3 Chemical Control for Various Maize Diseases
Numerous fungicides authorized for use on maize are efficient in controlling rust
diseases when applied properly. However, fungicide applications usually cost
between $15 and $20 per acre (including the $5 per acre cost of application), making
them often uneconomical. When corn prices are low, fungicide treatments provide
economic benefits when applied after infection to a sensitive hybrid with a high yield
potential, such as seed, white, or popcorn. Analyse weather predictions prior to
application to evaluate whether the weather conditions are friendly, especially high
humidity and warm temperatures. Due to the frequency of rust formation, it has been
unable to generate accurate treatment threshold data for local circumstances. Other
fungicide experiments for controlling corn rust usually show that they work best on
seed corn or sweet corn.
Globally, the most destructive fungal systemic disease of maize is common rust,
induced by Puccinia sorghi. It has been observed that common rust infections may
significantly decrease grain yields by up to 40% in many genotypes of maize. Foliar
disease management in maize is frequently described as an inappropriate pesticide
application or an over-reliance on host-plant resistance. IDM has demonstrated
conclusively that when low concentrations of host-plant tolerance are combined
with field intervention and low chemical management, expected yields and eco-
nomic returns are larger than when sensitive genotypes are chemically managed.
studied local agronomic practices. Tebuconazole was significantly superior and very
successful in decreasing disease rigorousness (19.74%) and increasing yield at
35 and 50 days after sowing at 0.1% foliar treatment. A 0.1% foliar spray of
Hexaconazole (35 and 50 days after planting) was the next most effective treatment
(28.23%), followed by a 0.1% foliar spray of Tebuconazole and Neemazole F (5%)
at 50 days after sowing.
4 Etiology, Epidemiology, and Management of Maize Diseases 71
4.3.7.3.1 Chemical Control for the Downy Mildew of Maize
On maize leaves, downy mildew (P. sorghi) is identified by elongated chlorotic
streaks with a downy development of conidia and conidiophores. 3–6 days after
infection, symptoms manifest as light yellow to white discolorations on the leaf
blade. Tassels and ears may be distorted. Metalaxyl (Apron 35SD) seed treatment at
a rate of 1.75–2.00 g/kg significantly decreases the disease incidence. Spray the
maize crop 3–4 times with Metalaxyl MZ (Ridomil MZ) at 0.2% beginning on the
20th day after planting to suppress the disease (Javed et al. 2022a). Spraying Dithane
(M 45) at 0.25% concentration or any other copper fungicide at 0.3% concentration
is also effective. The first spraying should be done as soon as the disease symptoms
start to show up, followed by two to three more times, depending on how bad the
condition is (Javed et al. 2022a).
4.3.7.3.2 Chemical Control of Corn Eyespot
In 2015, corn eyespot caused an annual loss of six million bushels in Ontario and
United States (Mueller et al. 2016). Early application of fungicide sprays may have a
major effect on disease and production. Fungicides may be financially beneficial,
particularly in the seed corn industry. Fungicides should be considered only in fields
where maize was damaged by eyespot the previous year and decreased tillage
techniques are being utilized. Hybrids that are resistant should be the primary option.
Mancozeb, propiconazole, chlorothalonil, and benomyl are all fungicides licensed
for use against K. zeae. Seed treatments are suggested for efficient protection against
K. zeae, followed by spraying the crop during the early stages of disease develop-
ment, when 1% or less of leaf area is affected. Multiple applications may be required
when disease circumstances are favourable. Except in seed-producing areas, the use
of fungicides against eyespot may be prohibitively costly. Pest management is
critical in decreasing the incidence of eyespot, especially reduction of Aphididae
and Thysanoptera, which feed on maize and may promote conidia penetration
(Aglave 2018).
4.3.7.3.3 Chemical Control for Grey Leaf Spot of Corn
Grey leaf spot of maize is a foliar disease usually spread by Cercospora zeae-
maydis. In the 1990s, reported yield losses due to grey leaf spot are as high as
50% in some US maize fields (Liu and Xu 2013). Currently, five fungicides are
available to treat maize grey leaf spot: EC Headline (active ingredient,
pyraclostrobin), Quilt (azoxystrobin + propiconazole), Proline 480 SC (active ingre-
dient, prothioconazole), Tilt 250 E, and Bumper-418 (active ingredient,
propiconazole) (Aglave 2018).
4.3.7.3.4 Chemical Control of Northern Corn Leaf Blight (NCLB)
Setosphaeria turcica is the pathogen that causes this disease. Northern leaf blight
lesions may coexist with other pathogenic diseases on the same or distinct leaves of
the plants and is identified by greenish tan lesions on leaves. The disease lowered
plant height by 8%, grain yield by 43%, biomass by 43%, and 1000 grain weight by
25% (Subedi 2015). Fungicide treatments are advised exclusively for farms produc-
ing fresh market sweet corn and hybrid seed. Spraying should begin as soon as the
first lesions develop on the leaves below the maize ear. Numerous fungicides are
currently available for NCLB control on maize (Subedi 2015). Fungicides that are
effective against NCLB include (strobilurins, such as Quadris and Headline FRAC)
(code provided by Fungicide Resistance Action Committee) group 11 and FRAC
group 3 (triazoles, e.g. Tilt). Additionally, there are a few items that include both
FRAC groups (11 + 3, e.g. Quilt and Stratego) (Aglave 2018). When signs of NCLB
are first detected in the field, rotate these FRAC codes and mix with a broad-
spectrum protectant against resistance. Because PHIs differ across each product,
therefore, it is critical to check labels carefully when a crop reaches harvest maturity.
Additionally, depending on the brand, NCLB may be referred to as
Helminthosporium leaf blight, a term used to refer to both NCLB and Southern
corn leaf blight together (Aglave 2018).
72 T. Javed et al.
4.3.7.3.5 ChemicalControl of Stewart Bacterial Wilt
The pathogen that induces this sickness is Erwinia stewartii. Erwinia stewartii’s
overwintering host and vector are corn flea beetles. Based on the cultivar’s tolerance
or sensitivity, chlorotic or necrotic tissues may stretch the entire expanse of
the leaves or may be restricted to a few centimetres. Stewart’s wilt might induce
the weakened plant to stem rot, resulting in decreased yield. Stewart’s wilt affects the
output of corn by roughly 0.8% per each 1% of seedlings impacted systematically
(Pataky 2003). Control flea beetles using pesticides, especially on vulnerable types
during the seedling stage. While this is not as much successful as resistant types, it
can mitigate losses in areas where the growers cultivate susceptible hybrids of corn.
Gaucho seed treatments suppress corn flea beetles systemically and mitigate the
intensity of Stewart’s wilt. Numerous pesticides are available under different brand
names for use as foliar sprays to combat maize flea beetles. While some of these
products last longer than others, the fast development of leaf tissue implies that
untreated surfaces are accessible to flea beetles that move into fields prior to
treatment. Stewart’s wilt can be controlled with flea beetle scouting (two or three
times a week) and re-applying pesticides if populations start to grow back (Aglave
2018).
4.3.7.3.6 Chemical Control for Corn Smut
Maize diseases, such as common smut, are caused by Ustilago zeae, while other
types of smut such as head smut are spread by Sphacelotheca reiliana. There are few
management options for these pathogenic fungi, but in other countries where maize
is grown, seed treatment and fungicides applied during the vegetative stage are
employed to prevent the incidence of maize smuts (Korbas 2006). Corn breeders
usually avoid utilizing highly disruptive inbred lines and their hybrids or variations.
Corn may be protected against insects (e.g. corn earworms and European corn
borers) by using pesticides as suggested by entomologists on a timely basis. This
often results in a reduction in the prevalence of common smut in sweet corn (Aglave
2018).
4 Etiology, Epidemiology, and Management of Maize Diseases 73
4.3.7.3.7 Chemical Protection Against Maize Late Wilt
Late wilt is a peculiar disease that is wreaking havoc on maize fields across Israel. Its
symptom includes the fast withering of maize plants prior to tasseling and until just
before maturity. The fungus Harpophora maydis is the disease’s causative agent.
Harpophora maydis is a soil and seed-borne pathogen that is presently managed via
the use of decreased sensitivity in maize varieties. In previous research, it has been
demonstrated that injecting azoxystrobin (AS) into a drip irrigation line allocated to
each specific row may effectively inhibit H. maydis in the field. Additionally, seed
coating with AS can also offer an extra layer of protection. Another more cost-
effective protective treatment employing this fungicide is in a combination with
Difenoconazole mixture (AS + DC), or Fluazinam, or Fluopyram and
Trifloxystrobin mixture, or Prothioconazole and Tebuconazole mixture via seed
coatings or drip irrigation (Javed et al. 2022b).
4.3.7.3.8 Chemical Control for Southern Corn Blight (SCLB)
This disease caused by Helminthosporium maydis is the most common disease that
usually appears at the time of tasseling. Southern corn leaf blight occurs worldwide
and is important in regions of warm damp climate of 20–30 C temperature. Yield
reduction of up to 50% was recorded (Subedi 2015). Fungicides applied to the leaves
may be utilized. Foliar disease management is essential between 14 and 21 days
during tasseling; this is the most vulnerable period for leaf blight damage.
Fungicides should be administered to plants infected with SCLB immediately
upon the appearance of lesions. Re-applications may be required throughout the
growth season, depending on the environmental circumstances. Headline, Quadris,
Quilt, PropiMax EC, Stratego, and Tilt are all common fungicides (Aglave 2018).
4.3.7.4 Biotechnological Measures
Biotechnological techniques have been shown to be effective against some crop-
disease combinations; they are generally underutilized. Thus, there are just three
well-publicized instances of crops utilized on a worldwide scale that show benefi-
cially increased disease resistance. Biotechnological methods include the use of the
BT toxin Cry1Ab from the Bacillus thuringiensis bacterium to impart insect resis-
tance in maize plants (Zea mays). Despite their insect resistance, these transgenic
cultivars show some resistance to Fusarium spp., particularly Fusarium
verticillioides. Several more transgenic crops have been created and field-tested. In
certain instances, they are also authorized for commercialization; for example,
potatoes are resistant to viruses (Collinge 2018).
74 T. Javed et al.
4.3.7.4.1 Advances in Genetic Engineering Against Maize Diseases
RNA Interference Is Being Used to Combat Maize Pathogens
Plants have developed a complex defensive system against microbial diseases. For
instance, pre-existing biotic barriers, as well as their reinforcements, prevent
pathogens from getting access to the interior of the cell. Immune receptors in the
plasma membrane and intracellular compartment trigger defensive retorts in
response to pathogen detection, both directly and physically engaging with
pathogen-derived immunogens or indirectly by governing pathogen-induced
changes to host targets. Antimicrobial peptides and other chemicals produced by
plants may reduce pathogenicity either directly or indirectly by inhibiting the action
of virulence factors. In addition, plants use RNA interference (RNAi) to find and
destroy viruses that come into their bodies (Rosa et al. 2018).
Pathogen’s Counterstrategies Against Plants’Defence Mechanism
Some virulent strains have developed ways to circumvent their plant hosts’defen-
sive mechanisms. For example, many bacterial and fungal diseases generate and
release enzymes that degrade cell walls. Additionally, pathogens may transport
effectors into the host cytoplasm, some of which inhibit host defence and increase
vulnerability. Almost all plant viruses generate viral suppressors of RNAi in order to
combat plant RNAi-based defence mechanisms. Additionally, some viruses use the
host RNAi system to silence host genes, thus increasing their virulence (Rosa et al.
2018).
Targeting Genes Against Mycotoxins Produced by Fungi
Aflatoxins are poisonous secondary metabolites generated by some Aspergillus
species and are a global agricultural economic and public health concern. Despite
decades of management attempts, aflatoxin contamination results in an annual
worldwide agricultural loss of millions of tonnes (Thakare et al. 2017). Some counts
of host-microbe interactions offer possibilities for gene targeting against diseases.
For example, plants may be genetically modified to express genes that encode
proteins capable of digesting mycotoxins or suppressing the activity of cell-wall
disintegrating enzymes. Additionally, there are possible genetic modifications in
plants that can manufacture and release antimicrobial peptides or other chemicals to
prevent microbial colonization directly. By targeting viral RNA, the RNAi machin-
ery may be used to impart strong viral protection (Rosa et al. 2018). Individual or
combined immunological receptors that detect several strains of a pathogen may be
introduced for strong, broad-spectrum disease tolerance. Essential regulatory genes
of the defence hub can be re-altered to fine-tune defensive responses. Susceptible
host targets may be transgened in order to avoid pathogen introduction and manipu-
lation. This also applies to host decoy proteins, which act as a “trap”for infectious
pathogens. They can be genetically changed to make them more specific for patho-
gen detection (Dong and Ronald 2019).
4 Etiology, Epidemiology, and Management of Maize Diseases 75
Use of Host-Induced Gene Silencing (HIGS) in Maize
Thakare et al. (2017) demonstrated that host-induced gene silencing is a very
efficient approach for removing aflatoxins from transgenic maize. The researchers
modified maize plants with an RNA interference (RNAi) gene cassette specific for
the aflCgene. This gene is responsible for encoding an enzyme involved in the
aflatoxin manufacturing pathway. Aflatoxins were not found in kernels from these
RNAi transgenic maize plants after pathogen infection. Contemporarily, the toxin
burdenized millions of non-transgene kernels. This technique in maize involves the
double-stranded RNA expressions to silence genes responsible for aflatoxin produc-
tion. Nowadays, HIGS have also been used to suppress genes specific for hosting
nematode feedings and fungi attacks (Thakare et al. 2017).
Use of CRISPR-Cas Against Maize Lethal Necrosis (MLN)
Some genetic engineering techniques may be more beneficial for developing
MLN-resistant maize variants. Genetically modified virus resistance conceived by
sequential expression of virulence exploits the plant’s inherent ability to induce
RNAi against viral sequences. The recent discovery of CRISPR-Cas for maize
enables the alteration of maize gene alleles to confer viral resistance on lines and
hybrids that lack non-maize regions in their genomes. Alternatively, CRISPR-Cas
may be used to build viral resistance in maize through RNAi engineering
(Redinbaugh and Stewart 2018).
Use of Quantitative Polymerase Chain Reactions (qPCR) to Identify Resistant Genes
Miranda et al. (2017) investigated the global gene expression alterations in maize.
Researchers studied the male and female inflorescences after local and systemic
fungal infection treatments. To identify genes involved in plant defence against
fungi such as Colletotrichum graminicola, RNA sequences were combined with
qPCR. The sequences revealed that the systemic acquired (SA) resistance in female
inflorescences is primarily mediated by the increase of SA-inducible defensive genes
(ZmNAC,ZmHSF,ZmWRKY,ZmbZIP, and PR1) and candidate genes for chromatin
modifications. Moreover, transcripts implicated in the jasmonic acid and ethylene
signalling were collected, which later on suggested that these may have contributed
in further immunization. Additionally, many genes were functionally used to anno-
tate the domain signatures, suggesting new possibilities for testing the techniques of
gene deletion and overexpression in maize plants (Miranda et al. 2017) (Fig. 4.1).
Resistance Breeding Against Various Maize Diseases
The apparent resistance varies among different maize variants and hybrids. The
greatest method of controlling common smut is to choose the most suited, resistant
hybrids and cultivars available. These hybrids are resistant to the corn-smut fungus
in general or in the field. The apparent resistance differs in between corn lines is
often due to the sheath and husks providing protection. The management of eyespot
of corn requires resistance to K. zeae, and disease resistant hybrids should be
planted. Aglave (2018) reported that Julia, Heros, Agio, and Aura are susceptible
hybrids; Kosmo and Elsa are more resistant hybrids. Even a well-known source of
resistance, such as the Oh43 line, may get infected in the event of epiphytosis
(Aglave ). The most cost-effective way of reducing production losses due to
maize grey leaf spot is the introduction of resistant crop variants. These crops may
eventually grow in areas where leaf spot develops while remaining resistant to the
diseases although the disease is not eradicated and resistant cultivars exhibit
symptoms. The disease is less efficient at decreasing crop output at the end of the
growing season. Aglave ( ) reported a corn variety resistant to grey leaf spot
entitled SC 407. If the incidence of grey leaf spot is significant, this variety may need
fungicide treatment to reach its full potential (Aglave ). Host resistance is a
useful strategy for controlling NCLB, particularly in sweet corn crops. Through
conventional breeding, several kinds of resistance genes have been introduced into
sweet corn hybrids (not GMOs). Hybrids may exhibit polygenic or partial resistance,
which offers resistance to both pathogen races but is not utterly against either any
race. Monogenic resistance hybrids used to impart resistance to just particular
pathogen races. These diverse resistance hybrids with various genes will serve to
restrict the size, quantity, and amount of sporulation inside each lesion. Due to the
presence of resistance genes in a hybrid, the size, form, and colour of lesions may
vary. For example, hybrids with one of the monogenic resistance genes Ht1,Ht2,or
Ht3 would have chlorotic lesions but will have restricted sporulation, preventing the
disease from spreading rapidly. Some seed firms employ a numerical rating scale to
indicate the degree of resistance, but pay careful attention to these scales. Different
2018
2018
2018
76 T. Javed et al.
Fig. 4.1 Use of different biological approaches against maize specific pathogens
companies use various numbers to represent the amount of resistance. Producers
should seek for hybrids with race-specific resistance genes (known as Ht genes) in
regions where NCLB is a persistent issue (Aglave 2018). Farmers should grow wilt-
resistant sweet corn types that are well-adapted to growing conditions. At the
moment, there are only a few early maturing hybrids with high levels of Stewart’s
wilt resistance. Resistance enhanced hybrids can withstand more infection with less
yield loss. Resistance inhibits the bacteria’s mobility inside the plant (Aglave 2018).
4 Etiology, Epidemiology, and Management of Maize Diseases 77
The most effective method of managing SCLB is to breed for host resistance.
Single gene and polygene resistance sources have been identified. Normal cytoplas-
mic maize is resistant to both Race T and Race C, which explains why Race O is
more prevalent. Although flecking may be seen in certain resistant hybrids, it is a
response to resistance and will not result in significant economic loss. The disease
may be controlled via breeding hybrids that are MDMV-tolerant or MDMV-
resistant. In dent corn, there is a high level of tolerance and resistance to strain A,
but only a fair level of tolerance and almost no resistance to strain B. There is a lack
of resistance to the maize chlorotic dwarf virus and only a moderate level of
tolerance (Aglave 2018). There is no significant control method against crazy top
that can be recommended. Very little is known about the degree of resistance to this
disease in corn hybrids (Aglave 2018). At the moment, the majority of popular sweet
maize hybrids are susceptible to rust. However, rust-resistant varieties are available.
Commercial breeders of sweet maize use two kinds of resistant varieties: race-
specific and partial resistance. If maize farmers want to plant their crops later, they
should choose resistant or moderately resistant cultivars because there will be more
fungal spores in the air because of the early planting (Aglave 2018).
4.4 Conclusion and Future Prospects
Corn diseases cause costly crop losses every year through problems with germina-
tion and establishment of a stand and through damaging effects on the quality and
size of the harvest. This chapter is designed to help in the identification of diseases
and present management strategies. Several methods, from physical to chemical
control of different maize diseases, have been employed to achieve higher produc-
tivity with minimal losses. However, each method has some pros and cons. There-
fore, integrated pest management (IPM) techniques in combination with modern
biotechnological approaches could be helpful for sustainable management of differ-
ent corn disease-causing pathogens.
References
Afzal I, Imran S, Javed T, Basra SMA (2020) Evaluating the integrative response of moringa leaf
extract with synthetic growth promoting substances in maize under early spring conditions. S
Afr J Bot 132:378–387
Aglave B (2018) Handbook of plant disease identification and management. CRC, Boca Raton, FL
78 T. Javed et al.
Asiimwe T, Stewart LR, Willie K, Massawe DP, Kamatenesi J, Redinbaugh MG (2020) Maize
lethal necrosis viruses and other maize viruses in Rwanda. Plant Pathol 69(3):585–597
Atenya CW (2016) Incidences and severity of Maize ear rot causing pathogens and response of
selected Maize hybrids to diplodia (Stenocarpella spp.) in selected counties in Nyanza region.
Doctoral dissertation, Maseno University
Barandoc-Alviar K, Ramirez GM, Rotenberg D, Whitfield AE (2016) Analysis of acquisition and
titer of Maize mosaic rhabdovirus in its vector, Peregrinus maidis (Hemiptera:Delphacidae). J
Insect Sci 16(1):14
Basandrai AK, Basandrai D (2020) Brown stripe downy mildew of maize and its integrated
management. In: Diseases of field crops: diagnosis and management apple. Academic, San
Diego, CA, pp 141–151
Bernardo P, Frey TS, Barriball K, Paul PA, Willie K, Mezzalama M, Kimani E, Mugambi C,
Wangai A, Prasanna BM, Redinbaugh MG (2021) Detection of diverse maize chlorotic mottle
virus isolates in maize seed. Plant Dis 105(6):1596–1601
Binagwa PH, Bonsi CK, Msolla SN, Ritte II (2016) Morphological and molecular identification of
Pythium spp. isolated from common beans (Phaseolus vulgaris) infected with root rot disease.
Afr J Plant Sci 10(1):1–9
Bressan W (2003) Biological control of maize seed pathogenic fungi by use of actinomycetes.
BioControl 48:233–240
Carino EJ, Scheets K, Miller WA (2020) The RNA of maize chlorotic mottle virus, an obligatory
component of maize lethal necrosis disease, is translated via a variant panicum mosaic virus-like
cap-independent translation element. J Virol 94(22):05–20
Collinge DB (2018) Transgenic crops and beyond: how can biotechnology contribute to the
sustainable control of plant diseases? Eur J Plant Pathol 152:977–986
Cooper JS, Balint-Kurti PJ, Jamann TM (2018) Identification of quantitative trait loci for Goss’s
wilt of maize. Crop Sci 58(3):1192–1200
Cushatt J (2020) Pantoea stewartii subspecies detection. ISSN 2572-679X
Dalla Lana F, Madden LV, Paul PA (2021) Natural occurrence of maize Gibberella ear rot and
contamination of grain with mycotoxins in association with weather variables. Plant Dis 105(1):
114–126
Debnath S, Chhetri S, Biswas S (2019) Southern rust disease of corn—a review. Int J Curr
Microbiol App Sci 8(11):855–862
Degani O, Dor S (2021) Trichoderma biological control to protect sensitive maize hybrids against
late wilt disease in the field. J Fungi 7(4):315
Dey U, Harlapur SI, Dhutraj DN, Suryawanshi AP, Badgujar SL, Jagtap GP, Kuldhar DP (2012)
Spatiotemporal yield loss assessment in corn due to common rust caused by Puccinia sorghi
Schw. Afr J Agric Res 7(37):5265–5269
Doblas-Ibáñez P, Deng K, Vasquez MF, Giese L, Cobine PA, Kolkman JM, Smith LG (2019)
Dominant, heritable resistance to Stewart’s wilt in maize is associated with an enhanced
vascular defense response to infection with Pantoea stewartii. Mol Plant Microb Interact
32(12):1581–1597
Dong OX, Ronald PC (2019) Genetic engineering for disease resistance in plants: recent progress
and future perspectives. Plant Physiol 180(1):26–38
Dumón AD, Caro EA, Mattio MF, Alemandri V, del Vas M, Truol G (2018) Co-infection with a
wheat rhabdovirus causes a reduction in Mal de Río Cuarto virus titer in its planthopper vector.
Bull Entomol Res 2:232–240
Duong DA, Jensen RV, Stevens AM (2018) Discovery of Pantoea stewartii ssp. stewartii genes
important for survival in corn xylem through a Tn-Seq analysis. Mol Plant Pathol 19(8):
1929–1941
Edmeades GO, Trevisan W, Prasanna BM, Campos H (2017) Tropical maize (Zea mays L.). In:
Genetic improvement of tropical crops. Springer, Cham, pp 57–109
Eisenback JD, Triantaphyllou HH (2020) Root-knot nematodes: meloidogyne species and races. In:
Manual of agricultural nematology. CRC Press, Boca Raton, FL, pp 191–274
4 Etiology, Epidemiology, and Management of Maize Diseases 79
El-Demerdash RR, Abbas EE, El-Said H, Atia M (2017) Management fusarium ear rot of maize and
its relation to damping-off. Zagazig J Agric Res 44:2021–2041
El-Nuby A (2020) First report of root-lesion nematode, Pratylenchus on new host, Deverra tortuosa,
in Mersa Matruh Coast, Egypt—a pilot study. Egypt J Agroematol 19(1):29–34
Emeraghi M, Achigan-Dako EG, Nwaoguala CN, Oselebe H (2021) Maize streak virus research in
Africa: an end or a crossroad. Theor Appl Genet 134:3785–3803
Gai X, Dong H, Wang S, Liu B, Zhang Z, Li X, Gao Z (2018) Infection cycle of maize stalk rot and
ear rot caused by Fusarium verticillioides. PLoS One 13(7):e0201588
Ghanney N (2017) Management of fungal plants diseases. Eur J Biol Res 7:309–314
Guadie D, Abraham A, Tesfaye K, Winter S, Menzel W, Knierim D (2018) First report of maize
yellow mosaic virus infecting maize (Zea mays) in Ethiopia. Plant Dis 102(5):1044–1044
Guo Z, Dong Y, Dong K, Zhu J, Ma L (2020) Effects of nitrogen management and intercropping on
faba bean chocolate spot disease development. Crop Prot 127:104972
Harding MW, Jindal K, Tambong JT, Daayf F, Howard RJ, Derksen H, Feng J (2018) Goss’s
bacterial wilt and leaf blight of corn in Canada—disease update. Can J Plant Pathol 40(4):
471–480
Holguin CM, Ma X, Mueller JD, Agudelo P (2016) Distribution of Hoplolaimus species in soybean
fields in South Carolina and North Carolina. Plant Dis 100(1):149–153
Ibrahim IKA, Handoo ZA, Basyony ABA (2017) The cyst nematodes Heterodera and Globodera
species in Egypt. Pak J Nematol 35(2):151–154
Ilyas MA, Rehman FU, Kalsoom M, Ilyas I, Ilahi H, Iqbal RU, Ahmad S (2021) Plant diseases: a
challenge for food security. Asian J Res Biosci 3(2):1–5
Ismaiel AA, Papenbrock J (2015) Mycotoxins: producing fungi and mechanisms of phytotoxicity.
Agriculture 5(3):492–537
Jackson TA, Harveson RM, Vidaver AK (2007) Goss’s bacterial wilt and leaf blight of corn.
NebGuide. G1675. University of Nebraska-Lincoln, Lincoln, NE
Jackson TA, Rees JM, Harveson RM (2009) Common stalk rot diseases of corn. EC1898.
University of Nebraska-Lincoln, Lincoln, NE
Javed T, Zhou J-R, Li J, Hu Z-T, Wang Q-N, Gao S-J (2022a) Identification and expression
profiling of WRKY family genes in sugarcane in response to bacterial pathogen infection and
nitrogen implantation dosage. Front Plant Sci 13:917953. https://doi.org/10.3389/fpls.2022.
917953
Javed T, Afzal I, Shabbir R, Ikram K, Zaheer MS, Faheem M, Ali HH, Iqbal J (2022b) Seed coating
technology: an innovative and sustainable approach for improving seed quality and crop
performance. J Saudi Soc Agric Sci
Jayapriya P, Hemalatha S (2020) Detection of maize stem and leaf diseases using edge detection
method to prevent the crops from diseases. J Xi’an Univ Archit Technol 12(8):1052
Jeffers D (2004) Maize diseases: a guide for field identification. CIMMYT, Mexico
Kieh H K (2014) Assessment of maize ear rot in major maize growing areas of Ashanti region of
Ghana. Doctoral dissertation
Kim HC, Kim KH, Song K, Kim JY, Lee BM (2020) Identification and validation of candidate
genes conferring resistance to downy mildew in maize (Zea mays L.). Genes 11(2):191
Korbas M (2006) Common smuts of maize and other diseases-harmfulness and possibilities of their
control. Prog Plant Prot 46:354–357
Kour D, Rana KL, Yadav N, Yadav AN, Kumar A, Meena VS, Saxena AK (2019) Rhizospheric
microbiomes: biodiversity, mechanisms of plant growth promotion, and biotechnological
applications for sustainable agriculture. In: Ashok K, Vijay S, Meena (eds) Plant growth
promoting rhizobacteria for agricultural sustainability. Springer, Singapore, pp 19–65
Kumar R, Gupta A (2020) Seed-borne diseases of agricultural crops: detection, diagnosis &
management. Springer, Singapore
Kumar A, Hunjan MS, Kaur H, Rawal R, Kumar A, Singh PP (2017) A review on bacterial stalk rot
disease of maize caused by Dickeya zeae. J Appl Nat Sci 9(2):1214–1225
80 T. Javed et al.
Kumar D, Jhariya AN (2013) Nutritional, medicinal and economical importance of corn: a mini
review. Res J Pharm Sci 2319:555X
Kupatt CC, Bassi AB, Allemann DV (2018) Future methods for controlling weeds, plant diseases,
and insects. In: Jack A (ed) Pesticide interactions in crop production. CRC Press, Boca Raton,
FL, pp 545–565
Lanza FE, Mayfield DA, Munkvold GP (2016) First report of Fusarium temperatum causing maize
seedling blight and seed rot in North America. Plant Dis 100:1019
Li P, Du C, Zhang Y, Yin S, Zhang E, Fang H, Yang Z (2018) Combined bulked segregant
sequencing and traditional linkage analysis for identification of candidate gene for purple leaf
sheath in maize. PLoS One 13(1):e0190670
Lima FS, Correa VR, Nogueira SR, Santos PR (2017) Nematodes affecting soybean and sustainable
practices for their management. In: Minobu K (ed) Soybean—basis of yield, biomass and
productivity. InTech, Croatia, pp 95–110
Liu W, Wang X (2018) New insights on the transmission mechanism of tenuiviruses by their vector
insects. Curr Opin Virol 33:13–17
Liu K-J, Xu X-D (2013) First report of gray leaf spot of maize caused by Cercospora zeina in China.
Plant Dis 97:1656–1656
Ma Y, Navarro B, Zhang Z, Lu M, Zhou X, Chi S, Li S (2015) Identification and molecular
characterization of a novel monopartite geminivirus associated with mulberry mosaic dwarf
disease. J Gen Virol 96(8):2421–2434
Ma Y, Yin Y, Rong C, Chen S, Liu Y, Wang S, Xu F (2016) Pantoea pleuroti sp. nov., isolated from
the fruiting bodies of Pleurotus eryngii. Curr Microbiol 72(2):207–212
Mabuza L (2017) Monitoring fusarium, gibberella and diplodia ear rots and associated mycotoxins
in maize grown under different cropping systems. Doctoral dissertation, Stellenbosch Univer-
sity, Stellenbosch
Maloy OC (2005) Plant disease management. In: Plant health instructor 10. The American
Phytopathological Society, St. Paul, MN
Mannaa M, Kim KD (2017) Influence of temperature and water activity on deleterious fungi and
mycotoxin production during grain storage. Mycobiology 45(4):240–254
Mbega ER, Mabagala RB, Adriko J, Lund OS, Wulff EG, Mortensen CN (2012) Five species of
xanthomonads associated with bacterial leaf spot symptoms in tomato from Tanzania. Plant Dis
96(5):760–760
Miranda V, Porto W, Fernandes G, Pogue R, Nolasco D, Araujo A, Cota L, Freitas C, Dias S,
Franco O (2017) Comparative transcriptomic analysis indicates genes associated with local and
systemic resistance to Colletotrichum graminicola in maize. Sci Rep 7:2483
Molinero-Ruiz ML, Melero-Vara JM, Mateos A (2010) Cephalosporium maydis, the cause of late
wilt in maize, a pathogen new to Portugal and Spain. Plant Dis 94(3):379–379
Monjane AL, Dellicour S, Hartnady P, Oyeniran KA, Owor BE, Bezuidenhout M, Martin DP
(2020) Symptom evolution following the emergence of maize streak virus. Elife 9:e51984
Mueller DS, Wise KA, Sisson AJ, Allen TW, Bergstrom GC, Bosley DB et al (2016) Corn yield
loss estimates due to diseases in the United States and Ontario, Canada from 2012 to 2015. Plant
Health Prog 17(3):211–222
Munkvold GP (2003) Cultural and genetic approaches to managing mycotoxins in maize. Annu
Rev Phytopathol 41:99–116
Munkvold GP, White DG (2016) Compendium of corn diseases. APS Press, St. Paul, MN
Neupane S, Ghimire TR (2020) Towards a landscape perspective of diseases in plants: an overview
and review of a critical but overlooked ecology issue in the Hindu Kush-Himalayan region. In:
Ganga RR, Falk H (eds) Hindu Kush-Himalaya watersheds downhill: landscape ecology and
conservation perspectives. Springer, Cham, pp 135–168
Nicoli A, Zambolim L, Costa RVD, Guimarães LJM, Lanza FE, Silva DDD, Cota LV (2016)
Identification of sources of resistance to anthracnose stalk rot in maize. Ciência Rural 46:1885–
1890
4 Etiology, Epidemiology, and Management of Maize Diseases 81
Nuss ET, Tanumihardjo SA (2010) Maize: a paramount staple crop in the context of global
nutrition. Compr Rev Food Sci Food Saf 9(4):417–436
Oerke EC (2006) Crop losses to pests. J Agric Sci 144(1):31–43
Oldenburg E, Ellner F (2015) Distribution of disease symptoms and mycotoxins in maize ears
infected by Fusarium culmorum and Fusarium graminearum. Mycotoxin Res 31(3):117–126
Pal KK, Gardener BM (2006) Biological control of plant pathogens. Plant Health Instr 2:1117–
1142
Pataky JK (2003) Stewart’s wilt of corn. APSnet Feature 2003:0703
Pavan GS, Shete P (2021) Symptomatology, etiology, epidemiology and management of Southern
corn leaf blight of maize (Bipolaris maydis) (Nisikado and Miyake) Shoemaker. Pharma Innov
10(5):840–844
Puerari HH, Dias-Arieira CR, Cardoso MR, Hernandes I, Brito ODC (2015) Resistance inducers in
the control of root lesion nematodes in resistant and susceptible cultivars of maize.
Phytoparasitica 43(3):383–389
Redinbaugh MG, Stewart LR (2018) Maize lethal necrosis: an emerging, synergistic viral disease.
Annu Rev Virol 5:301–322
Rehman F, Adnan M, Kalsoom M, Naz N, Husnain MG, Ilahi H, Ahmad U (2021) Seed-borne
fungal diseases of Maize (Zea mays L.): a review. Agrinula 4(1):43–60
Roossinck MJ, Martin DP, Roumagnac P (2015) Plant virus metagenomics: advances in virus
discovery. Phytopathology 105(6):716–727
Rosa C, Kuo YW, Wuriyanghan H, Falk BW (2018) RNA interference mechanisms and
applications in plant pathology. Annu Rev Phytopathol 56:581–610
Sabagh AE, ÇiğF, Seydoşoğlu S, Battaglia ML, Javed T, Iqbal MA, Mubeen M, Ali M, Ali M,
Bengisu G, Konuşkan Ö (2021) Salinity stress in maize: effects of stress and recent
developments of tolerance for improvement. In: Cereal grains. IntechOpen, Rijeka, Croatia
Saha S, Garg R, Biswas A, Rai AB (2015) Bacterial diseases of rice: an overview. J Pure Appl
Microbiol 9(1):725–736
Sandhu KS, Singh N, Malhi NS (2007) Some properties of corn grains and their flours. I:
Physicochemical, functional and chapati-making properties of flours. Food Chem 101(3):
938–946
Shafiq M, Qurashi F, Mushtaq S, Hussain M, Hameed A, Haider MS (2020) DNA plant viruses:
biochemistry, replication, and molecular genetics. In: Applied plant virology. Academic, San
Diego, CA, pp 169–182
Shao X, Tan M, Xie Y, Yao C, Wang T, Huang H, Zhang Y, Ding Y, Liu J, Han L, Hua C (2021)
Integrated regulatory network in Pseudomonas syringae reveals dynamics of virulence. Cell Rep
34(13):108920
Sharman M, Pagendam DE, Persley DM, Drenth A, Thomas JE (2016) Field evaluation of tolerance
to Tobacco streak virus in sunflower germplasm, and observations of seasonal disease spread.
Ann Appl Biol 168(3):390–399
Shiferaw B, Prasanna BM, Hellin J, Bänziger M (2011) Crops that feed the world 6. Past successes
and future challenges to the role played by maize in global food security. Food Secur 3(3):
307–327
Simón MR, Börner A, Struik PC (2021) Fungal wheat diseases: etiology, breeding, and integrated
management. Front Plant Sci 12:498
Singh VK, Singh V, Kumar D (2020) Nematode diseases of cereal crops and their management. In:
Diseases of field crops: diagnosis and management apple. Academic, San Diego, CA, pp
387–403
Soler A, Marie-Alphonsine PA, Quénéhervé P, Prin Y, Sanguin H, Tisseyre P, Daumur R,
Pochat C, Dorey E, Rodriguez RG, Portal N (2021) Field management of Rotylenchulus
reniformis on pineapple combining crop rotation, chemical-mediated induced resistance and
endophytic bacterial inoculation. Crop Prot 141:105446
Stack J, Chaky J, Giesler LJ, Wright RJ (2001) Stewart’swilt of corn. NebFact. NF01-473.
University of Nebraska-Lincoln, Lincoln, NE
82 T. Javed et al.
Sturhan DIETER, Brzeski MW (2020) Stem and bulb nematodes, Ditylenchus spp. In: Manual of
agricultural nematology. CRC Press, Boca Raton, FL, pp 423–464
Subedi S (2015) A review on important maize diseases and their management in Nepal. JMRD 1(1):
28–52
Tembo M, Adediji AO, Bouvaine S, Chikoti PC, Seal SE, Silva G (2020) A quick and sensitive
diagnostic tool for detection of Maize streak virus. Sci Rep 10(1):1–10
Thakare D, Zhang J, Wing RA, Cotty PJ, Schmidt MA (2017) Aflatoxin-free transgenic maize using
host-induced gene silencing. Sci Adv 3:e1602382
TopalovićO, Hussain M, Heuer H (2020) Plants and associated soil microbiota cooperatively
suppress plant-parasitic nematodes. Front Microbiol 11:313
Tripathy A, Kesharwani A, Malla AK, Behera J (2020) Chapter 4. An introduction to epidemiology
of plant diseases. In: Current research and innovations in plant pathology, p 49
Tsedaley B, Adugna G (2016) Detection of fungi infecting maize (Zea mays L.) seeds in different
storages around Jimma, Southwestern Ethiopia. J Plant Pathol Microbiol 7(3):1000338
Wang S, Chen Z, Tian L, Ding Y, Zhang J, Zhou J, Wu L (2019a) Comparative proteomics
combined with analyses of transgenic plants reveal Zm REM 1.3 mediates maize resistance to
southern corn rust. Plant Biotechnol J 17(11):2153–2168
Wang S, Jia M, Meng W, Wang X, Li Y, Jie C (2019b) Combined application of Trichoderma
harzianum SH2303 and difenoconazole-propiconazolein controlling Southern corn leaf blight
disease caused by Cochliobolus heterostrophus in maize. J Integr Agric 18:2063–2071
Wang M, Ma J, Fan L, Fu K, Yu C, Gao J, Li Y, Chen J (2015) Biological control of southern corn
leaf blight by Trichoderma atroviride SG3403. Biocontrol Sci Tech 25:1133–1146
Wang Y, Yao J, Xia X, Li Z, Zhou S, Liu W, Wu H (2021) Genomic sequence resource of
Kabatiella zeae, the causative pathogen of corn eyespot disease. Mol Plant Microbe Interact
34(10):1223–1226
Wijayasekara D, Ali A (2021) Evolutionary study of maize dwarf mosaic virus using nearly
complete genome sequences acquired by next-generation sequencing. Sci Rep 11(1):1–14
Ye W, Robbins RT, Kirkpatrick T (2019) Molecular characterization of root-knot nematodes
(Meloidogyne spp.) from Arkansas, USA. Sci Rep 9(1):1–21
Zheng Q, Putker V, Goverse A (2021) Molecular and cellular mechanisms involved in host-specific
resistance to cyst nematodes in crops. Front Plant Sci 12:363
83
Viral Diseases of Maize 5
Muhammad Taqqi Abbas, Muhammad Shafiq, Hibba Arshad,
Rajia Haroon, Hamza Maqsood, and Muhammad Saleem Haider
Abstract
Maize is a widely cultivated grain that is a staple food in many countries,
including the United States, Africa, and other areas of the world. After wheat
and rice, maize is the world’s third-largest crop, and it is cultivated in more
countries than any other. Maize is consumed as a major food source in many
regions of the world, with more maize production than that of wheat and rice. In
tropical, subtropical, and temperate climates, maize is farmed on almost 177 mil-
lion hectares. Global production is at 875 million metric tonnes per year, which is
more than wheat or rice. It is grown practically everywhere on the planet, except
for Antarctica. The availability of high-quality nutrients provides the health
benefits of maize. Virus infections are common in maize-growing locations
around the world, and they can result in significant losses for farmers. Maize
has been linked to the spread of more than 50 viruses. Maize streak virus (MSV),
maize stripe virus, and maize mosaic virus are the three primary tropical maize
viruses. Virus infection is usually first identified by signs, including stripes,
mosaics, and chlorosis. Plant viruses are responsible for a significant share of
agricultural illnesses and economic losses globally, with annual crop losses
exceeding USD 60 billion. In 2012, annual maize losses are expected to be 3%,
or around USD 8 billion. The global maize crop is suffering from a high
prevalence of virus infections, and losses might be significantly larger locally
or regionally. This chapter deals with maize virus infections as well as the
microorganisms that cause them. The factors that influence disease spread by
viruses and their management will be investigated, as well as our present knowl-
edge of the genetics of viral resistance in this essential crop.
M. T. Abbas · M. Shafiq(*) · H. Arshad · R. Haroon · H. Maqsood · M. S. Haider
Faculty of Agricultural Sciences, University of the Punjab, Lahore, Pakistan
e-mail: shafiq.iags@pu.edu.pk
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_5
84 M. T. Abbas et al.
Keywords
Maize streak virus · Maize dwarf mosaic virus · Maize stripe virus · Maize lethal
necrosis · Control · Symptoms
5.1 Introduction
Maize (Zea mays L.) is the third most important annual crop worldwide and has been
ingrained in modern culture. It is used as a prime meal and animal feed by over 4.5
billion people worldwide (FAO 2016). It is also the most significant grain in
sub-Saharan Africa, covering a larger area than other grains (Gent et al. 2011). In
a wide range of conditions, it is commonly produced for food and income. Of the
entire area planted, 7.85 million tonnes of maize were harvested during 2016/2017.
The most cost-effective approach to gaining basic calories is to eat the crop. It
accounts for 17% of total calorie consumption per capita. Maize also has the
advantage of being a less expensive protein source (Rashid 2011). With all its
economic and nutritional importance, in Pakistan its annual average is only
3.6 t ha
1
which is too less than global average yield of 5.6 t ha
1
(FAO 2015).
Plant viruses cause diseases and huge economic losses around the globe (Gómez
et al. 2009; Jahn et al. 2005), with annual crop losses exceeding $60 billion USD.
Annual losses in maize were estimated by Oerke and Dehne (2004) to be 3%, or over
$8 billion USD in 2012. Because virus infections affect the worldwide maize crop in
sporadic fashion, losses can be significantly higher locally or regionally. Several
viruses have been discovered to infect maize, and their consequences can be
damaging. There have been more than 32 viruses found in maize across the world
(Damsteegt 1981). Maize streak virus (MSV; genus Mastrevirus in the family
Geminiviridae), maize dwarf mosaic virus (MDMV), all belonging to the genus
Potyvirus in the family Potyviridae, and maize stripe virus (MSV) were previously
identified in the country (Mesfin et al. 1991; Lencho et al. 1997). Maize has been
shown to be infected with more than 50 viruses (Lapierre and Signoret 2004).
Sorghum mosaic virus (SrMV) (Shukla et al. 1998), Johnsongrass mosaic virus
(JGMV) (Seifers et al. 2000), Maize chlorotic mottle virus (MCMV), and Maize
chlorotic dwarf virus (MCDV) are a few examples. Maize dwarf mosaic virus
(MDMV) is the most important disease-causing agent in crops worldwide, with
maize dwarf mosaic disease (MDM) mostly occurring in Africa, the United States,
Asia, and Europe (Table 5.1).
The prevalence and spread of the four maize viral illnesses described above
(Table 5.2), as well as virus identification methodologies, were discussed in this
chapter to offer a foundation for reliable virus identification and diagnosis in corn
production.
Table 5.2 Maize impor-
tant viruses which trans-
mitted with different
vectors and cause the yield
losses
5 Viral Diseases of Maize 85
Table 5.1 Describe the common symptoms, host range, and mode of transmission of viral diseases
of maize
Diseases Host range Symptoms Transmission
Maize
streak
virus
MSV is generally
recognized as being
endemic throughout
sub-Saharan Africa
(Rossel and Thottappilly
1985)
Chlorotic streaks in veins
of leaf are common
symptoms of this disease
(Dhau et al. 2018)
Transmitted and spread
by leafhopper (Shepherd
et al. 2010)
Maize
dwarf
mosaic
virus
Dwarf mosaic virus of
maize is found in sugar
cane, sorghum, maize,
Eleusine spp., Panicum
spp., and Setaria spp.
(Redinbaugh and Stewart
2018)
Chlorotic mosaics,
mottles, or streaks on the
green tissues of infected
plants
In open-pollinated maize
populations, the severity
of disease symptoms can
vary greatly (Jones 2021)
Schizaphis graminum and
Aphis craccivora are
among the aphid genera
that disseminate maize
dwarf mosaic virus in a
non-unrelenting manner
(Ghosh et al. 2017)
Maize
stripe
virus
Its host and geographical
distributions are
effectively described by
vector
At start the symptoms are
fine chlorotic lesions
between leaf veins,
followed by chlorotic
stripes of varying severity
and width (Falk and Tsai
1998)
Maize stripe virus is
disseminated in a
persistent-propagative
way by the maize
delphacid Peregrinus
maidis
Maize
lethal
necrosis
The Poaceae family is the
only experimental host,
with maize being the
most prevalent natural
host. Zea mays var.
parviglumis and Zea
luxurians were also
infected by Kansas
serotype 1 (Gordon and
Thottappilly 1978)
Causes a wide spectrum
of symptoms in maize.
Stunting, leaf necrosis,
premature plant
mortality, shortened male
inflorescences with few
spikes, and/or shortened,
deformed, partially filled
ears are among the
symptoms
A broader panel of
possible carriers was
investigated in the United
States, and it was
discovered that some
beetles can spread MLN
at both larval and adult
stages, but some aphid
and leafhopper species, as
well as a mite, are virus-
free
Virus Host Vector
Maize Streak Virus Maize Leafhopper
Maize dwarf mosaic virus Maize Aphid
Maize stripe virus Maize Peregrinus maidis
Maize lethal necrosis Maize Aphid and leafhopper
5.2 Maize Streak Virus (MSV)
A 100 years ago, maize streak was known as the most crucial viral disease of maize
worldwide. MSV is a dangerous virus and is one of the most widespread viruses.
Maize yield is declining, putting food security at risk (Mbong et al. 2021). This
disease was discovered in 1901, and its symptoms were known as “mealie variega-
tion”before being called “maize streak”(Fuller 1901).
86 M. T. Abbas et al.
The maize streak virus (MSV) belongs to the family Geminiviridae, which is a
disease-causing agent and a well-known member of the genus Mastrevirus, which is
the major cause of the maize streak virus sickness (MSVD). With a single compo-
nent of a circular, single-stranded DNA genome of around 2700–2800 nucleotides
contained in germination particles, the virus is continually transmitted by migratory
leafhoppers of the genus Cicadulina (Family Cicadellidae, Order Hemiptera)
(Shepherd et al. 2010).
5.2.1 Transmission
Its transmission and spread by virus were revealed for the first time by a renowned
scientist, H.H. Storey, and transmitted by leafhopper (Shepherd et al. 2010). The
transmission cycle, latent period, and sensitivity of different host plants to the same
viruses were all interpreted by Storey and his colleagues (Dhau et al. 2018). For
more than 10 years (Mesfin et al. 1992; Bosque-Pérez 2000), MSV has been
intensively examined as the most important virus affecting corn yield in
sub-Saharan Africa (Mesfin et al. 1992) MSV’s geographic distribution (Alegbejo
et al. 2002), diversity, genomics and strain levels, also its host plant range, virus/
vector ecology and epidemiology in key African regions (Bosque-Pérez 2000;
Magenya et al. 2009; Martin and Shepherd 2009), the biology of its vector, which
causes diseases and its connection with MSV, and efforts at virus resistance breeding
(Welz et al. 1998).
5.2.2 Symptoms
•Chlorotic streaks in veins of leaf are common symptoms of this disease (Dhau
et al. 2018).
•These disease symptoms appear on infected maize plants as small, pale, circular
dots on the youngest leaves’lowest clear region. Only young infected leaves
show symptoms, and older leaves are uninfected.
•As the disease proceeds, fresher leaves acquire streaks in the leaf veins that can be
a few centimeters long, with tertiary veins being more affected than principal
veins.
•Streaks or lesions move latterly, forming narrow, broken chlorotic stripes that can
stretch the length of badly damaged leaves.
•Few viral strains cause red pigmentation on maize leaves, while some others
cause white to yellow lesions (Jacquat et al. 2020).
5 Viral Diseases of Maize 87
5.2.3 Control
It can be controlled by preventing maize plants from being close to the oldest grains
and using crop cycles that reduce leafhopper invading (Gichuru 2014). The vector
can be suppressed using systemic pesticides sprayed on the planting furrow during
maize planting. On the other hand, chemical seed treatments might be harmful if not
used correctly because they provide only minimal protection during intense stress.
The most efficient and cost-effective approach to preventing streak outbreaks is the
creation and application of streak-resistant cultivars (Emeraghi et al. 2021).
According to recent investigations, the strain of MSV (MSV-A), which is tolerated
by maize and causes more MSD, is causing diseases more quickly across Africa than
those less adapted variants, which are the cause of diseases in grasses (Varsani et al.
2008). Although the enhanced mobility might be due to the maize-adapted strain’s
wider host range than its grass-adapted siblings, as MSD is only transmitted through
humans, that’s why humans’migration with infected material from one place to the
other is blamed. African governments are looking to control the flow of maize leaf
material and insects across various nations in the coming future.
Whatever more ways are adopted to control MSD, it is likely that the disease will
continue to spread and be the reason for losses until a major portion of African
farmers have easy access to commercially acceptable MSD immune maize varieties.
Now we have no such types, but it is more likely that we will have them in the future
by adopting modern technologies. As with many other problems faced by the
world’s poorest people, it appears that the more financial assistance, scientific
efforts, and state leadership required to apparently address the MSD problem are
all in short supply. We won’t know how harshly to judge our inability to control
MSD until we know the true costs of the illness.
5.3 Dwarf Mosaic Virus of Maize (MDMV)
MDMV is a Potyvirus viral with a single-trapped, positive-sense RNA genome.
Maize, sorghum, and Johnson grass are among the plants infected with this virus
(Kannan et al. 2018). MDMV is a significant maize pathogen that has been spreading
over the world and is one of the most frequent viral infections for monocotyledonous
plants, causing up to a 70% loss in corn output since 1960. MDMV belongs to the
Potyvirus (Potyviridae) family and was initially discovered in maize and Johnson-
grass in Illinois in 1964. MDMV is a common single-stranded RNA virus that is
spread by numerous aphid species in a common way. MDMV is one of the most
common viral infections in maize across the world.
5.3.1 Host Range
MDMV is an intermediate host of maize and Johnson grass (Sorghum halepense)
(for specific strains). SCMV is found in sugar cane, sorghum, maize, Eleusine spp.,
Panicum spp., and Setaria spp. (Redinbaugh and Stewart 2018).
5.3.2 Transmission
Rhopalosiphum maidis,Rhopalosiphum padi,Myzus persicae,Schizaphis
graminum, and Aphis craccivora are among the aphid genera that disseminate
maize dwarf mosaic virus in a non-unrelenting manner (Ghosh et al. 2017). The
virus spread quickly through the sap, and seed transmission was also observed,
though at a modest rate (Kyallo et al. 2017).
5.3.3 Symptoms
There are various symptoms caused by this strain based on the of development of the
host at the start of infection, with early infections generating more severe effects than
late infection. Symptoms are:
88 M. T. Abbas et al.
•Chlorotic mosaics, mottles, or streaks on the green tissues of infected plants
(Fig. 5.1).
•Slowed growth and a halt in ear development.
•In open-pollinated maize populations, the severity of disease symptoms can vary
greatly (Jones 2021).
Fig. 5.1 Symptoms of MDMV in maize
5 Viral Diseases of Maize 89
5.3.4 Control
There is no cure for this disease, and affected plants should be eliminated from the
crop immediately. The principal approach to the disease’s management is the use of
resistant crop species (Dusfour et al. 2019). Interrupting vector-maize contact by
lowering vector virus populations in sensitive maize is one of the most popular
techniques for controlling the spread of viral infections in corn. Chemical pesticides
or aphicides can be used to do this (Ferro et al. 1980). However, this strategy simply
slows the virus’s internal spread inside a site, which has a negative impact on soil
fertility (Ismail et al. 1996). Furthermore, Toler (1985) has established that pesticides
have no effect on MDM illness. Breaking pathogen-vector and pathogen-maize
interrelationships by reducing viral sources is another typical way to reduce maize
dwarf mosaic. MDMV is mostly transmitted by Johnson grass (Sorghum halepense)
(Knoke et al. 1983).
5.4 Maize Stripe Virus
Maize stripe is a virus’s disorder that affects maize. Maize stripe virus infects maize
and sorghum in subtropical and tropical areas across the world (Bolus et al. 2021).
That can be found in the southern United States, Central America, Africa, Australia,
and a few Pacific islands and is likely to be found in most tropical maize-growing
areas. The disease first appeared in the continental United States in Florida in 1975
(Gordon and Thottappilly 2013).
Plant viruses can infect important crop plants and reduce their commercial
production, posing a danger to world food security and agricultural economies.
Stippling symptoms in maize caused by stripe virus, leaf veins finally converted
into chlorotic stripes. And more, young plant infection ultimately results in stunting
and striking “hoja blanca”or symptoms like turning leaf into white (Falk and Tsai
1998).
5.4.1 Host Range
Its host and geographical distributions are effectively described by vector, the maize
planthopper Peregrinus maidis (Ashmead), which spreads maize stripe virus by a
circulative-propagative mechanism (Bolus et al. 2021).
Maize stripe virus (MStpV) was initially detected in Hawaii, Cuba, Trinidad,
Mauritius, and East Africa, according to scientific sources (Storey 1936). MStpV
isolates from Florida, Venezuela, Peru, Australia, India, Mauritius, Réunion,
Thailand, and Taiwan were all found to be linked by serological testing (Gingery
et al. 1979; Greber 1981; Peterschmitt et al. 1987,1991; De Doyle et al. 1992; Chen
et al. 1993; Sdoodee et al. 1997).
5.4.2 Transmission
Maize stripe virus is disseminated in a persistent-propagative way by the maize
delphacid Peregrinus maidis (Ashmead) (Homoptera: Delphacidae) (Tsai and Zitter
1982).
MStpV’shost specificity and geographic dispersion are primarily explained by
the vector, the maize planthopper Peregrinus maidis (Ashmead), which transmits
MStpV by a circulative-propagative mechanism (Tsai and Zitter 1982; Nault and
Gordon 1988; Falk and Tsai 1998; Singh and Seetharama 2008). MSpV can also be
transmitted transovarially by corn planthoppers (Tsai and Zitter 1982).
5.4.3 Symptoms
90 M. T. Abbas et al.
•At the start the symptoms are fine chlorotic lesions between leaf veins, followed
by chlorotic stripes of varying severity and width (Falk and Tsai 1998).
•The new leaf shows complete chlorosis when young plants are infected at the
four- to five-leaf stage, whereas the central leaf is curled mostly (Falk and Tsai
1998).
5.4.4 Control
Traditional virus disease control measures are recommended, including vector
control, early removal of sick plants, eradication of itch grass near plantings, and
insect vector or virus resistance breeding. In Reunion, I RAT is working on
developing MStpV and other maize virus-resistant cultivars (Marchant and
Hainzelin 1986). MStpV resistance has been derived from the variety Revolution.
5.5 Maize Lethal Necrosis (MLN)
The virus was first detected in Kenya (Wangai et al. 2012) and then in Rwanda
(Adams et al. 2014), the Democratic Republic of Congo (Lukanda et al. 2014), and
Uganda’s border territories (Lukanda et al. 2014; Adams et al. 2014). According to
Grabherr et al. (2011), Ethiopian maize plants with severe symptoms were detected
sick in July 2014, proving the occurrence of MLN disease in the nation (Mahuku
et al. 2015). The fast spread of the MLN disease in east Africa has posed a serious
threat to maize output and impacted the region’s agricultural produce significantly.
The sickness has the potential to cause significant production losses, grain quality
deterioration, and food supply problems.
From seedling through maturity, MLN can impact maize plants at any stage of
growth. MLND is diagnosed by chlorotic mottling of leaves, necrosis from the leaf
border to the midrib, and a dead heart; later-stage infection might result in sterile
pollen, undersized cobs with poor seed set, or plant mortality. New and possibly
highly virulent MCMV and SCMV strains, a favourable environment for the
survival and spread of the two viruses’insect vectors (Cabanas et al. 2013), a
favourable environment for the proliferation of the two viruses’insect vectors, and
continuous maize cropping in certain regions leading to virus inoculum build-up are
all possible factors that contributed to the devastating effect of MLND in eastern
Africa.
5 Viral Diseases of Maize 91
5.5.1 Host Range
The Poaceae family is the only experimental host, with maize being the most
prevalent natural host (Gordon et al. 1984). Mechanical inoculation has been used
to infect Bromus spp., Digitaria sanguinalis,Sorghum spp., and Triticum aestivum
(Castillo and Hebert 1974; Niblett and Claflin 1978; Zhao et al. 2004), as well as Zea
mays (Castillo and Hebert 1974; Gordon and Thottappilly 2013). Zea mays var.
parviglumis and Zea luxurians were also infected by Kansas serotype 1 (Nault
et al. 1978).
5.5.2 Transmission
A broader panel of possible carriers was investigated in the United States, and it was
discovered that some beetles can spread MLN at both larval and adult stages, but
some aphid and leafhopper species, as well as a mite, are virus-free. The transmis-
sion of maize chlorotic necrosis by beetles is undeniable (Awata et al. 2019).
5.5.3 Symptoms
Depending on genotype, infection age, and climate changes, this virus (MCMV)
causes a wide spectrum of symptoms in plants. Stunting, leaf necrosis, early plant
mortality, truncated male inflorescences with few spikes, or diminished, deformed
ears partially filled are some of the symptoms (Castillo and Hebert 1974; Uyemoto
et al. 1981).
5.5.4 Control
Crop rotation is a good technique to keep this virus away from crops (Claflin et al.
1981). Two seasons, crop rotation at least with other crops such as potatoes, root
crops, cassava, legumes, column bulbs, green onions, vegetables, and garlic is
recommended. To diversify farm enterprises, new crops are planted each season.
Plant life may be enhanced by compost and basal/top dressing fertilizers.
To reduce alternate hosts for probable vectors, good field cleaning techniques,
including weed management methods, are required (Wangai et al. 2012). To mini-
mize pathogen and vector populations, infected foliar plant material should be
removed and discarded from the field. Although this material is safe for cattle, it is
not safe for humans or animals to eat decaying grain or cobs. The best approach to
get rid of them is to burn them. Farmers should avoid reusing seed and should only
plant seed that has been approved. Plant corn just before start of the major rainy
season rather than during the short rainy season to provide a buffer between maize
planting seasons. As a result, the number of vectors will decrease. MCMV expanded
to other Hawaiian Islands, but it was kept under control for a long time on Kaua’i
(Nelson).
92 M. T. Abbas et al.
5.6 Maize Virus Diseases: Genome Tools
Maize is the most important food and feed source for meeting food demands of the
world’s population. Its yield and production must be increased to meet the rapidly
increasing world’s food demand. In so many ways, maize research is looking for a
breakthrough, applaude to researchers as maize B73 genome sequence which is
nearly completed (Schnäble et al. 2009), there are few other sequences which are not
far enough from completion, the 5000-line nested association mapping (McMullen
et al. 2009). However, by applying genome sequence and relating DNA sequence to
function often happen research methods that have been not present in maize, where
generating transgenic plants is particularly difficult.
The present BMV-VIGS system works by generating capped in vitro transcripts.
Adapting the existing approach to Agrobacterium binary-based vectors for viral
inoculation would be a first step toward creating a system that allows for cost-
effective, high-throughput investigation of several candidate genes. Alternative viral
inoculation strategies in maize might potentially be investigated. For example, to
differentiate different maize lines for MSV resistance, direct inoculation of
Agrobacteria bearing T-DNA constructs that begin infection of maize streak virus
(MSV) into the coleoptilar node is regularly utilized (Grimsley and Bisaro 1987;
Martin et al. 1999). In addition, a vascular puncture inoculation approach has been
correctly used to inoculate several distinct maize viruses that are resistant to typical
inoculation processes such leaf rubbing (Redinbaugh et al. 2001).
The creation of effective VIGS tools for maize is a huge step forward in maize
research. Together with all of the tremendous resources available for maize genetics,
the availability of functional genomics methods for researching maize geneticists’
preferred candidate genes promises rapid findings (Benavente and Scofield 2011).
5.7 Conclusion
With a solid understanding of the consistency of virus incidence of disease and virus
trajectories, as well as their relationship to crop and climate, an effort will be made to
begin reducing plant virus losses by eradicating the source of infection, practising
proper field plant and soil management, cutting off virus transmission paths,
effectively adjusting cultivating time, and improving the management and farming
of powerful seedlings, as well as eradicating fungus.
5 Viral Diseases of Maize 93
References
Adams IP, Harju VA, Hodges T, Hany U, Skelton A, Rai S, Deka MK, Smith J, Fox A, Uzayisenga
B, Ngaboyisonga C, Uwumukiza B, Rutikanga A, Rutherford M, Ricthis B, Phiri N, Boonham
N (2014) First report of maize lethal necrosis disease in Rwanda. New Dis Rep 29:22–22
Alegbejo MD, Olojede SO, Kashina BD, Abo ME (2002) Maize streak Mastrevirus in Africa:
distribution, transmission, epidemiology, economic significance and management strategies. J
Sustain Agric 19:35–45
Awata O, Ifie E, Tongoona P, Danquah E, Jumbo B, Gowda M, Suresh M (2019) Maize lethal
necrosis and the molecular basis of variability in concentrations of the causal viruses in
co-infected maize plant. J Gen Mol Virol 9(1). https://doi.org/10.5897/JGMV2019.0073
Benavente M, Scofield R (2011) A new tool for functional genomics in maize. New Phytol 189(2):
363–365
Bolus S, Braithwaite S, Grinstead C, Fuentes-Bueno I, Beiriger R, Falk W, Mollov D (2021)
Completion of maize stripe virus genome sequence and analysis of diverse isolates. Front
Microbiol 12:684599
Bosque-Pérez NA (2000) Eight decades of maize streak virus research. Virus Res 71:107–121
Cabanas D, Watanabe S, Higashi CHV, Bressan A (2013) Dissecting the mode of maize chlorotic
mottle virus transmission (Tombusviridae: Machlomovirus) by Frankliniella williamsi
(Thysanoptera: Thripidae). J Econ Entomol 106:16–24
Castillo J, Hebert TT (1974) A new virus disease of maize in Peru. Fitopatologia 9(2):79–84
Chen C, Tsai J, Chiu R, Chen M (1993) Purification, characterization, and serological analysis of
maize stripe virus in Taiwan. Plant Dis 77:367–372
Damsteegt D (1981) Exotic virus and virusike diseases of maize. In: Virus and virus-like diseases of
maize in the United States. Southern cooperative series bulletin, vol 247. Ohio Agricultural
Research & Development Center, Wooster, OH, pp 110–123
De Doyle R, Autrey C, Jones P (1992) Purification, characterization and serological properties of
two virus isolates associated with the maize stripe disease in Mauritius. Plant Pathol 41:325–334
Dhau I, Adam E, Mutanga O, Ayisi KK (2018) Detecting the severity of maize streak virus
infestations in maize crop using in situ hyperspectral data. Trans R Soc S Afr 73(1):8–15
Dusfour I, Vontas J, David P, Weetman D, Fonseca M, Corbel V, Chandre F (2019) Management of
insecticide resistance in the major Aedes vectors of arboviruses Advances and challenges. PLoS
Negl Trop Dis 13(10):e0007615
Emeraghi M, Achigan-Dako G, Nwaoguala N, Oselebe H (2021) Maize streak virus research in
Africa: an end or a crossroad. Theor Appl Genet 134:3785–3803
Falk BW, Tsai JH (1998) Biology and molecular biology of viruses in the genus Tenuivirus. Annu
Rev Phytopathol 36(1):139–163
FAO (2015) Social protection and agriculture: breaking the cycle of rural poverty. In Nations, Food
and Agriculture Organization of the United
FAO (2016) Climate change and food security: risks and responses. In Nations, Food and Agricul-
ture Organization of the United. https://doi.org/10.1080/14767058.2017.1347921
Ferro N, Mackenzie D, Margolies C (1980) Effect of mineral oil and a systemic insecticide on field
spread of aphid-borne maize dwarf mosaic virus in sweet corn. J Econ Entomol 73:730–735
Fuller C (1901) Mealie variegation. In: First report of the government entomologist natal
1899–1900
Gent PR, Danabasoglu G, Donner LJ, Holland MM, Hunke EC, Jayne SR, Zhang M (2011) The
community climate system model version 4. J Clim 24(19):4973–4991
94 M. T. Abbas et al.
Ghosh A, Chakrabarti S, Mandal B, Kumar K (2017) Aphids as vectors of the plant viruses in
India. In: A century of plant virology in India. Springer Nature, Singapore, pp 515–536
Gichuru N (2014) Breeding investigations on utility of maize streak virus resistant germplasm for
hybrid development in the tropics. Doctoral dissertation
Gingery R, Re G, Rj L (1979) Occurrence of maize stripe virus in the United States and Venezuela.
Plant Dis Reporter 63:341–343
Gómez P, Rodríguez-Hernández AM, Moury B, Aranda MA (2009) Genetic resistance for the
sustainable control of plant virus diseases: breeding, mechanisms and durability. Eur J Plant
Pathol 125(1):1–22
Gordon DT, Thottappilly G (2013) 12. Maize and Sorghum. In: Virus and virus-like diseases of
major crops in developing countries. Springer Science & Business Media, p 295
Gordon DT, Bradfute OE, Gingery RE, Nault LR, Uyemoto JK (1984) Maize chlorotic mottle virus.
Description of plant viruses, p 284
Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L,
Raychowdhury R, Zeng Q, Chen Z, Mauceli E, Hacohen N, Gnirke A, Rhind N, di Palma F,
Birren BW, Nusbaum C, Lindblad-Toh K, Friedman N, Regev A (2011) Full-length
transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol 29
(7):644–652
Greber R (1981) Maize stripe disease in Australia. Aust J Agric Res 32:27–36
Grimsley N, Bisaro D (1987) Agroinfection. In: Schell J, Hohn T (eds) Plant DNA infectious
agents. Plant gene research. Springer, New York, pp 87–107
Ismail S, Ingon D, Omar O (1996) Effects of metolachlor on activities of enzymes in a Malaysian
soil. J Environ Sci Health Part B 31:1267–1278
Jacquat G, Theumer G, Cañizares C, Debat J, Iglesias J, García Pedrajas D, Dambolena S (2020) A
survey of mycoviral infection in Fusarium spp. Isolated from maize and sorghum in Argentina
identifies the first mycovirus from Fusarium verticillioides. Viruses 12(10):1161
Jones A (2021) Global plant virus disease pandemics and epidemics. Plants 10(2):233
Kang B-C, Yeam I, Jahn MM (2005) Genetics of plant virus resistance. Annu Rev Phytopathol 43
(1):581–621
Kannan M, Ismail I, Bunawan H (2018) Maize dwarf mosaic virus: from genome to disease
management. Viruses 10(9):492
Knoke K, Louie R, Madden V, Gordon T (1983) Spread of maize dwarf mosaic virus from
Johnsongrass to corn. Plant Dis 67:367–370
Kyallo M, Ateka M, Sseruwagi P, Ascencio-Ibáñez T, Ssemakula O, Skilton R, Ndunguru J (2017)
Infectivity of Deinbollia mosaic virus a novel weed-infecting begomovirus in East Africa. Arch
Virol 162(11):3439–3445
Lapierre H, Signoret A (2004) Viruses and virus diseases of Poaceae (Gramineae). Institut National
de la Recherche Agronomique, Paris
Lencho A, Abraham A, Bekele B, Tesera M (1997) Identification of viruses from maize and grass
hosts. Pest Manag J Ethiopia (Ethiopia)
Lukanda M, Owati A, Ogunsanya P, Valimunzigha K, Katsongo K, Ndemere H, Kumar PL (2014)
First report of Maize chlorotic mottle virus infecting maize in the Democratic Republic of the
Congo. Plant Dis 98(10):1448–1448
Magenya EV, Mueke J, Omwega C (2009) Association of maize streak virus disease and its vectors
(Homoptera: Cicadelidae) with soil macronutrients and altitudes in Kenya. Afr J Agric Res 4
(11):1284–1290
Mahuku G, Lockhart BE, Wanjala B, Jones MW, Kimunye JN, Stewart LR, Cassone BJ, Sevgan S,
Nyasani JO, Kusia E, Kumar PL, Niblett CL, Kiggundu A, Asea G, Pappu HR, Wangai A,
Prasanna BM, Redinbaugh MG (2015) Maize lethal necrosis (MLN), an emerging threat to
maize-based food security in sub-Saharan Africa. Phytopathology 105(7):956–965
Marchant JL, Hainzelin E (1986) The Reunion island maize breeding program. In: To feed
ourselves: a proceedings of the first eastern, central and southern Africa Regional Maize
Workshop, Lusaka, Zambia March 10-17, 1985, pp 80–85
5 Viral Diseases of Maize 95
Martin DP, Willment JA, Rybicki EP (1999) Evaluation of maize streak virus pathogenicity in
differentially resistant Zea mays genotypes. Phytopathology 89(8):695–700
Martin DP, Shepherd DN (2009) The epidemiology, economic impact and control of maize streak
disease. Food Secur 1:305–315
Mbong A, Suh C, Sime D, Anoumaa M, Fonkou T, Nkombo C, Abebe M (2021) Phytosanitary
situation of maize streak virus in the main maize production zones of Cameroon. Agric Sci
12(4):339–353
McMullen MD, Kresovich S, Sanchez-Villeda H, Bradbury P, Li H, Sun Q, Flint-Garcia S,
Thornsberry J, Acharya C, Bottoms C (2009) Genetic properties of the maize nested association
mapping population. Science 325:737–740
Mesfin T, Den Hollander J, Markham PG (1991) Cicadulina species and maize streak virus in
Ethiopia. Int J Pest Manag 37(3):240–244
Mesfin T, Bosque-Perez NA, Buddenhagen IW (1992) Studies on maize streak virus isolates from
grass and cereal hosts in Nigeria. Plant Dis 76:789–795
Nault R, Gordon T (1988) Multiplication of maize stripe virus in Peregrinus maidis. Phytopathol-
ogy 78(7):991–995
Nault LR, Styer WE, Coffey ME, Gordon DT, Negi LS, Niblett CL (1978) Transmission of maize
chlorotic mottle virus by chrysomelid beetles. Phytopathology 68(7):1071–1074
Niblett CL, Claflin LE (1978) Corn lethal necrosis-a new virus disease of corn in Kansas. Plant Dis
Rep 62(1):15–19
Oerke EC, Dehne HW (2004) Safeguarding production—losses in major crops and the role of crop
protection. Crop Prot 23(4):275–285
Peterschmitt M, Chatenet M, Baudin P (1987) Application de la méthode ELISA au diagnostic des
viroses du maïs. Agron Trop 42:131–138
Peterschmitt M, Ratna S, Sacks R, Reddy R, Mughogho K (1991) Occurrence of an isolate of maize
stripe virus on sorghum in India. Ann Appl Biol 118:57–70
Rashid S (2011) Intercommodity price transmission and food price policies: an analysis of
Ethiopian cereal markets. IFPRI-Discussion Papers (1079)
Redinbaugh G, Stewart R (2018) Maize lethal necrosis: an emerging synergistic viral disease. Annu
Rev Virol 5:301–322
Redinbaugh MG, Louie R, Ngwira P, Edema R, Gordon DT, Bisaro DM (2001) Transmission of
viral RNA and DNA to maize kernels by vascular puncture inoculation. J Virol Methods 98
(2):135–143
Rossel HW, Thottappilly G (1985) Virus diseases of important food crops in tropical Africa.
International Institute of Tropical Agriculture, Ibadan, Nigeria. 61pp
Schnäble S, Ware D, Fulton S, Stein C, Wei F, Pasternak S, Liang C, Zhang J, Fulton L, Graves A
(2009) The B73 maize genome: complexity, diversity, and dynamics. Science 326:1112
Sdoodee R, Teakle DS, Louie R (1997) Preliminary identification of maize stripe tenuivirus in
Thailand. Plant Dis 81(2):228
Seifers L, Salomon R, Marie-Jeanne V, Alliot B, Signoret P, Haber S, Loboda A, Ens W, She M,
Standing G (2000) Characterization of a novel potyvirus isolated from maize in Israel. Phyto-
pathology 90:505–513
Shepherd DN, Martin DP, Van der Walt E, Dent K, Varsani A, Rybicki EP (2010) Maize streak
virus: an old and complex ‘emerging’pathogen. Mol Plant Pathol 11(1):1–12
Shukla D, Tosic M, Jilka J, Ford E, Toler W, Langham C (1998) Taxonomy of potyviruses infecting
maize, sorghum, and sugarcane in Australia and the United States as determined by reactivities
of polyclonal antibodies directed towards virus-specific n-termini of coat proteins. Phytopathol-
ogy 79:223
Singh U, Seetharama N (2008) Host plant interactions of the corn planthopper Peregrinus maidis
Ashm (Homoptera: Delphacidae) in maize and sorghum agroecosystems. Arthropod Plant
Interact 2(3):163–196
Storey HH (1936) Virus diseases of east african plants: V.—streak disease of maize. East Afr Agric
J 1(6):471–475
96 M. T. Abbas et al.
Toler RW (1985) Maize dwarf mosaic, the most important virus disease of sorghum. Plant Dis 69:
1011–1015
Tsai H, Zitter A (1982) Characteristics of maize stripe virus transmission by the corn delphacid. J
Econ Entomol 75(3):397–400
Uyemoto JK, Claflin LE, Wilson DL, Raney RJ (1981) Maize chlorotic mottle and maize dwarf
mosaic viruses; effect of single and double inoculations on symptomatology and yield. Plant Dis
65(1):39–41
Varsani A, Shepherd DN, Monjane AL, Owor BE, Erdmann JB, Rybicki EP, Peterschmitt M,
Briddon RW, Markham PG, Oluwafemi S, Windram OP, Lefeuvre P, Lett JM, Martin DP
(2008) Recombination decreased host specificity and increased mobility may have driven the
emergence of maize streak virus as an agricultural pathogen. J Gen Virol 89:2063–2074
Wangai AW, Redinbaugh MG, Kinyua ZM, Miano DW, Leley PK, Kasina M, Mahuku G, Scheets
K, Jeffers D (2012) First report of maize chlorotic mottle virus and maize lethal necrosis in
Kenya. Plant Dis 96(10):1582–1582
Welz HG, Schechert A, Pernet A (1998) A gene for resistance to the maize streak virus in the
African CIMMYT maize inbred line CML202. Mol Breed 4:147–154
Zhao BY, Ardales E, Brasset E, Claflin LE, Leach JE, Hulbert SH (2004) The Rxo1/Rba1 locus of
maize controls resistance reactions to pathogenic and non-host bacteria. Theor Appl Genet 109
(1):71–79
97
Barley Diseases: Introduction, Etiology,
Epidemiology, and Their Management 6
Heba S. Abbas
Abstract
Barley is regarded as the globe’s fourth major cereal crop. A variety of airborne,
seedborne, and soilborne infective agents attack barley, causing a variety of
barley diseases and substantial losses in agricultural output. Brown and yellow
rusts, smut, net blotches, spot blotches, barley yellow dwarf, and molya disease
are among the most serious diseases. In general, employing integrated disease
management approaches is the best way to handle barley diseases. Growing
resistant or tolerant varieties with the fewest foliar fungicides is the most effective
approach for barley disease treatments. However, managing soilborne pathogens
in barley plants is problematic due to a deficiency in distinguishing symptoms for
diagnosis and the absence of fungicides or nematicides that are effective for these
pathogens. Recently, nanotechnology has driven the advancement of creative
concepts and agricultural productivity with a broad scope for managing plant
infections and pests. The antimicrobial properties of metallic and metal oxide
nanoparticulates such as silver, selenium, titanium dioxide, zinc oxide, and iron
oxide have been extensively researched. In this chapter, we go over barley disease
and the role of nanomaterials in reducing the incidence of disease and diagnosis,
as well as barley seed germination, physiology, and nutritional quality of barley
grain.
H. S. Abbas (*)
Microbiology Department, National Organization for Drug Control and Research (Recently,
Egyptian Drug Authority), Giza, Egypt
Microbiology Department, Faculty of Pharmacy, Misr University for Science and Technology,
Giza, Egypt
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_6
Keywords
Leaf rust disease · Net Blotch disease · Powdery mildew · Barley yellow dwarf ·
Barley smut · Spot blotch · Fungicides · Nanoparticulate
98 H. S. Abbas
6.1 Introduction
Nanotechnology causes the progress of innovative concepts and agricultural yield
with a vast perspective to manage plant pathogens and pests. Nanotechnology has
considerably developed in the field of pharmacological medicine, but has gained
moderately less awareness for agronomic purposes (Balaure et al. 2017; Sinha et al.
2017). The application of agricultural nanobiotechnology is presently being discov-
ered in the germination of seeds and the delivery of phytohormones, water manag-
ing, target genes transference, nano-barcoding, agro-nanosensors, and restricted
discharge of agrichemicals.
Nowadays, researchers have designed nanoparticles (NPs) with desired features,
to offer new pesticides and other actives for controlling plant disease and protect
plants through two diverse approaches: (a) nanoparticles for plant protection, or
(b) nanocarriers for the offered pesticides or other actives, including ds- RNA, and
can be practiced by spray purposes or onto waterlogged seeds, leaves, or roots.
Nanocarriers can offer some advantages, similar to (1) a better shelf life, (2) trans-
ferred the weakly water-soluble pesticides into soluble substances, (3) decreased
toxicity, and enhanced the uptake, efficiency, and constancy of the nano-pesticides
under unfavorable circumstances (Hayles et al. 2017; Khandelwal et al. 2016).
Metallic and metallic oxide nanoparticulates including silver, copper, iron oxide,
zinc oxide, and titanium dioxide have been widely investigated for their antimicro-
bial properties (Gogos et al. 2012; Kah and Hofmann 2014; Kim et al. 2018).
Recently, silver nanoparticulates have revealed inhibition of the fungal growth,
such as Alternaria alternata, Macrophomina phaseolina, Sclerotinia sclerotiorum,
Curvularia lunata, Botrytis cinerea, and Rhizoctonia solani (Krishnaraj et al.
2012a,b). Also, low concentrations of copper nanoparticulates increase the resis-
tance of seedlings to the harmful fungi, which cause root decaying in sprouts
(Maslobrod et al. 2014). Furthermore, NPs have a main effect on the plant’s
morphology and genome. A trivial number of nanoparticles can enhance crop
productions, but a large amount of nanoparticulates’exposure can cause disorder
in plants’physiology and oxidative damage. Furthermore, NPs can decrease the
efficiency of the oxidative enzymes that cause genotoxicity and toxicity (Ali et al.
2016; Rizwan et al. 2017).
One of the most crucial cereal plants is barley (Hordeum vulgare L.), which is
commonly used not only in agriculture but also in food manufacturing. Barley is
affected by different diseases, frequently caused by pathogens (Aubert et al. 2018;
Giraldo et al. 2019; Gozukirmizi and Karlik 2017; Kumar et al. 2012). The demand
for barley grains is rising because of their different uses and high nutritive signifi-
cance. Therefore, extensive production will be required over the next few years.
Several biotic and abiotic factors should be controlled to enhance the yield of barley.
Barley diseases significantly affect net blotch, rusts, spot blotch, stripe disease,
molya, powdery mildew, and barley yellow dwarf disease which are the main biotic
factors in improving the barley grain yield. Other diseases are vital for
manufacturing because they spoil the value of malt and beer.
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 99
Understanding the pathogens associated with the disease and modulating the
reacted variables are the most effective ways to manage it. Resistant variants are
the simplest and most efficient way to treat serious diseases. It is critical to employ
integrated disease management strategies that focus on variables for successful
disease management. Adoption of resistant barley cultivars provides the most
long-term pathogen control (for instance, cultivars with diverse MLO genes).
Using resistant cultivars for pathogens enhances output in their cultivated areas
automatically (Gangwar et al. 2018). Moreover, fungicide seed dressings or
fungicides sprayed in-furrow with fertilizer can protect barley from diseases or
reduce early seedling infection. The target diseases should guide the choice of
fungicide. Foliar fungicide treatment in the crop is intended to prevent disease
growth and keep the greening of leaves. It lessens the effect of diseases on produc-
tivity and grain quality. The economic effectiveness of foliar fungicide treatments is
determined by disease severity, variety susceptibility, crop production potential,
grain quality prognosis, and the environment. For example, triazole fungicides
have been effective at a rate of 0.1% against barley rust diseases (Bhardwaj et al.
2017).
Moreover, the disease still faces a critical challenge. Therefore, there is an urgent
need to achieve progress in the growing and productivity of barley crops as well as
develop an alternative control approach against barley diseases. However, the
absence of nanomaterials in the early stage of the plant indicates their unharmful
effects and the safety of their use. For example, manganese ferrite NPs, magnetite
NPs, and Fe/SiO2 enhance the growing factors of barley and can be planned for
future barley breeding applications (Disfani et al. 2017; Tombuloglu et al. 2018).
Also, iron oxide or magnetite nanoparticulates endorsed gene expression and profi-
cient photosynthetic activity of barley (Tombuloglu et al. 2019a) and stabilized
selenium NPs enhanced barley seed germination (Siddiqui et al. 2021). Barley
diseases and the impact of nanomaterials on controlling such diseases, germination
of seeds, physiology, and nutritional quality of barley grains were all explored in
depth in this chapter.
6.2 Barley Diseases and Their Managements
Barley is a major cereal crop that has been farmed for thousands of years, dating
back to early times, and is used in animal feed, malt products, and food production.
With around 150 million tons of grain production, it ranks fourth in the world (Arabi
and Jawhar 2004). In all places where barley is grown, barley leaf diseases produce
major output reductions while also lowering quality. Barley, like other cereals, is
susceptible to a variety of plant infections and illnesses, resulting in a considerable
drop in output and poor grain quality. In his “Compendium of Barley Diseases,”
Mathre (1997) listed around 80 diseases caused by pathogens, including net blotch,
yellow and brown rusts, powdery mildew, smut, spot blotch, speckled leaf blotch,
barley stripe, barley yellow dwarf, and molya disease, which are cautiously signifi-
cant in several countries. The routine of fungicides or disease-resistant varieties is
efficient in disease control, although pathogens have the potential to overcome plant
resistance genes and neutralize fungicide treatments (Ellwood et al. 2019;Hawkins
et al. 2014; Mohd-Assaad et al. 2016). The ability of diseases to evolve is useful in
the development of control approaches (Palumbi 2001; McDonald and Linde
2002a,b).
100 H. S. Abbas
6.2.1 Leaf Rust Disease
Leaf rust is the most common rust disease in the Hordeum vulgare crop, and it may
be found almost everywhere the crop is planted. It doesn’t happen very often, but it
can be very important in some places where barley is grown.
It has been stated as potentially harmful in North America (Reinhold and Sharp
1982; Mathre 1982) and Kenya (Reinhold and Sharp 1982; Mathre 1982). Actual
losses in field crops are hard to come by. However, in New Zealand (Arnst et al.
1979) and England, losses of 10–20% have been reported, at least in part due to leaf
rust (Jenkins et al. 1972). Infections caused by Puccinia hordei uredial grow on the
barley as little (up to 0.5 mm) orange-brownish pustules that blacken with time. The
pustules spread mostly on the superior and inferior leaf surfaces and sheaths and are
generally accompanied by chlorotic halos. Some stem, glume, and awn infections
can happen late in the season with severe infections, and there is often broad tissue
chlorosis and final necrosis accompanied by this severe pathogen. Blackish-brown
telia appear late in the season. They usually appear as stripes, especially on leaf
sheaths, and they can also be seen on stems, heads, and leaf edges. The host’s
consequences vary depending on the length and strictness of the infection, but
biotrophy generally has an unfavorable influence on photosynthesis, respiration,
nutrient passage, and water interactions, resulting in overall debilitation. Spring
barley is predominantly vulnerable, particularly if planted late, since it is susceptible
when the infection is vigorously growing. Primary, severe infections can cause
restricted growth and a lessening in the number of fertile tillers and grains per year
(Lim and Gaunt 1981; Udeogalanya and Clifford 1982). A lot of people have
problems with grain size and quality because epidemics don’t start for a long time
(Lim and Gaunt 1981; Udeogalanya and Clifford 1982).
Up until roughly 1970, leaf rust was thought to be not nearly as serious as other
Hordeum vulgare diseases. However, the disease’s recent spread, mainly in northern
and western Europe and portions of the US, has prompted an increase in both basic
investigation and the progress of disease management strategies that depend on both
plant resistance and fungicides. Despite the success of these efforts, more study is
needed to uncover new bases of resistance and novel fungicides to control any
damage to the outputs of current trials due to variations in the pathogen population.
To that end, research into pathogen evolution and the relationship between type II
plant resistance and current systemic fungicides should be pursued. There seems to
be a requirement for extra data on the resistant plant in order to make predictions
about its long-term viability (Clifford 1985). Until 2015, 21 seedling resistance
genes were known. It is expected that achieving long-term resistance to leaf rust in
Hordeum vulgare will necessitate the introduction of both seedling resistance genes
and adult-resistant plant (APR) genes (Park et al. 2015).
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 101
6.2.2 Net Blotch Disease
The ascomycete Pyrenophora teres causes net blotch, which has become one of the
most serious diseases of Hordeum vulgare. Net blotch is easily identified by brown
reticular bands on the susceptible barley leaf. It reduces production by up to 40% and
lowers seed quality. The pathogen’s life cycle, mechanism of spread, and expansion
allow for rapid infection of the host. Agricultural wastes, seeds, and grasses are the
pathogen’s origins. The relationship between the Hordeum vulgare plant and the
fungi is complicated, involving physiological fluctuations such as the appearance of
signs on the barley plant as well as genetic alterations such as the modification of
many genes involved in defensive pathways.
Net blotch resistance genes have been found, and their locations on 7 barley
chromosomes have been determined. Because of the disease’s importance, numer-
ous management measures have been used to combat net blotch. For instance, the
use of plant growth promoting rhizobacteria, which are helpful bacteria that colonize
the rhizosphere. The preventive role of these bacteria and their bioactive compounds
against possible pathogens has been described in several investigations. (Backes
et al. 2021). Small bacteriocins and fungal defensins are among the antimicrobial
peptides produced by bacteria (Waghu and Idicula-Thomas 2020). Microbes can
synthesize secondary products via non-ribosomal pathways (Montesinos et al.
2012). Useful bacteria also create antifungals known as cyclic lipopeptides, which
permit them to function as antagonists against pathogenic fungi. These compounds
are harmful to the progress of further species and have a low molecular weight
(Beneduzi et al. 2012). Due to their amphiphilic properties, lipopeptides, which are
synthesized non-ribosomally, have antibacterial and surfactant capabilities that have
piqued the interest of researchers (Cazorla et al. 2007). For instance, Bacillus sp. and
Burkholderia yield the majority of these antibiotics (Ongena et al. 2007; Pérez-
García et al. 2011; Esmaeel et al. 2016,2018).
6.2.3 Powdery Mildew
Powdery mildew (caused by the fungus Erysiphe graminis D.C.) is the most serious
disease afflicting barley around the globe. On the leaves, it is simply recognized by
its conidial phase, which usually appears in distinct lesions. However, it will
occasionally cover the entire leaf in a weft of spore-bearing mycelium. The fungi
demonstrate a high level of physiological specialization (Marchal 1902). It’s been
fascinating to see how the discovery of a successful systemic fungicide has affected
the amount of mildew research being done around the globe. Researchers now have
an active tool for estimating disease-related costs, and results from 25 nations show
that mildew is causing larger losses than previously thought. Because mildew
stagnates mostly in the winter season, the harvest is regarded as extremely risky in
places where spring barley is also cultivated. To avoid the initial formation of
reproductive structures in the spring barley, it is critical to evaluate the efficiency
of pesticides in reducing mildew over the winter. In the autumn of 1968, trials were
put up in the UK to investigate this issue. Due to the extremely rainy autumn, mildew
did not quickly expand into the developing crop. Ethirimol provided almost perfect
treatment of mildew attacks in the autumn. The next spring, there was no disease in
the treated plants, whereas the untreated plants showed a modest but unchanging
infection. Moreover, some control was maintained in the treated plants until June,
resulting in a significant reduction in crop spore production (Brooks 1970). Breeding
the broad-based mlo gene in barley is a good source of long-lasting resistance. It’s
possible to stack a lot of different types of resistance genes on top of each other or
use introgressions from bulbous barley (Dreiseitl 2020).
102 H. S. Abbas
6.2.4 Barley Yellow Dwarf
The most common viral disease of cereals is barley yellow dwarf (BYD), which is
caused by the barley yellow dwarf virus (BYDV). The virus is delivered to phloem
cells by aphids feeding on the leaf phloem. When viruses enter the plants, they
proceed to multiply and build new virions. This mechanism, which causes the
symptoms of this disease, necessitates a considerable metabolic input from the
plant. Symptoms begin about 14 days after the viral infection. Susceptible plants
exhibit yellowish or reddish leaves, an erect posture with thicker, stiffer leaves,
decreased root growth, and a reduced harvest. Because of saprotrophic fungus
colonization, the heads of infected plants persist erect and turn black and discolored
throughout maturation. Young plants are especially vulnerable. When the aphid
feeds, the viruses are propagated via the phloem. When an aphid eats, the virus’s
coat protein is detected by the epithelium of the aphid’s hindgut, and the virus
particle is permitted to enter the hemolymph of the insect and persist forever.
However, the virus is unable to multiply within this insect. The virus is energetically
carried into the attachment salivary gland, where it is discharged into the salivary
canals. In the aphid’s next feeding, the virus is expelled in its saliva (Gray and
Gildow 2003). Insecticide management of the aphid insect is one method of
preventing BYDV contamination. However, the use of insecticides is aggressively
discouraged because of environmental conditions and the potential for resistance to
progress. As a result, developing virus-resistant varieties is the most effective way to
mitigate the harmful effects of viral infection on farming. Exposure to viruses
indicates that they can proliferate and propagate within the plant, resulting in severe
disease signs. Because viral management is not achievable, resistant barley genes are
regarded as the best strategy to avoid the loss of products. Though multiple genes
and numerical trait loci for viral tolerance are recognized and employed in barley
breeding, little is known about the molecular and physiological basis of this charac-
teristic (Paulmann Maria et al. 2018). The higher productivity of the resistant variety,
which harbors the Ryd2 gene, was shown to be related to small degrees of hormone
signaling, offering innovative indicators for resistance and a novel framework for
researching the origin of viral resistance in barley (Ordon et al. 2009).
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 103
6.2.5 Barley Smut
Smut of barley is caused by the fungus Ustilago hordei. The disease is present all
over the world and is more widely transmitted than loose smut. Infected kernels are
substituted by masses of dark brown smut spores. Smutted heads are compact and
hard. Plants that have been infected may become stunted. Smut sori can also emerge
as lengthy streaks on leaf edges on rare occasions. To control covered smut disease,
resistant cultivars and seed treatments are applied (Mathre 1997). On the other hand,
Ustilago nuda generates loose barley smut. It is a disease that has the potential to
wipe out a large section of barley yield. Loose smut substitutes grain heads with
spores that invade open blossoms on plants and produce seed without causing visible
signs. The seeds seem to be in good health, and it is only after they mature the next
time of year that it is obvious that they were diseased.
The real-time PCR results showed that loose smut infection occurs at the second-
ary leaf phase and that it is therefore appropriate for practice in different barley
cultivars (Wunderle et al. 2012). Systemic fungicides are the primary technique of
controlling loose smut disease (Thomas 1984a,b). For covered smult, five barley
cultivars, including HBL 391, HBL 316, HBL 113, DWRUB 123, and DWRUB
92, were extremely resistant, although BL 1656 and BL 1562 germplasm lines
displayed a resistant response to Ustilago horde (Singh et al. 2020).
6.2.6 Spot Blotch
The causal agent of the spot blotch disease is Cochliobolus sativus. The disease can
be found anywhere barley is planted, but it only causes major output losses in warm,
humid areas (Mathre 1997; Martens et al. 1984). Infections manifest in the form of
dark, chocolate-colored spots. The spots meld together, leaving uneven necrotic
areas on the leaves. A zone of yellow leaf tissue of varied width may edge leaf spots.
During kernel filling, infections on the standard leaf are the most dangerous, with
heavily diseased leaves entirely drying up. Resistant cultivars, rotation by non-cereal
crops, seed treatments, and foliar fungicides are used to fight the disease. (Martens
et al. 1984). An eco-friendly foliar spray for control of this disease, Trichoderma
harzianum, neem, and tulsi extracts as biological control agents, and SAR chemical
(SA) can be applied (Kaur et al. 2021).
104 H. S. Abbas
6.2.7 Molya Disease
The Heterodera avenae nematode is responsible for “Molya disease”in wheat and
barley. The second juvenile (J2) swells and becomes a lemon-shaped, creamish-
white adult female as she grows. When this white female reaches maturity, she will
transform into a brown female known as a “Cyst”(dead female), with 400 eggs
inside her body acting as a protective cover against the harsh environment. When the
second stage, J2, detects humidity and a host plant, it raptures the cyst and emerges
from the birth hole to attack the crop the following season. Dissimilar to other
pathogens, nematode signs are not diagnostic since they are similar to water or
nutritional deprivation or any other physiological problem. There are two types of
nematode symptoms, and normally, above ground signs are not distinguishable and
can be readily confused with any other infection. However, in blown ground signs,
roots frequently become bushy, with mild swelling at the site of infection. The
brown cyst matures, it detaches from the roots and remains in the mud until the
following crop is grown, behaving as a source of infection for future years, and J2
hatches out upon identifying the host crop, precise temperature, and humidity
conditions. There are no other options for managing the nematode in standing
crops. To avoid additional output losses, it is recommended that certain agronomic
treatments (seed treatments, resistant cultivars, etc.) be implemented to regulate the
nematode population (Priyanka 2018).
6.2.8 Barley Diseases Control Using Fungicides
Fungicides are commonly employed to shield crops because they can offer
extremely high rates of disease avoidance. Foliar fungicides are applied to the
majority of Hordeum vulgare diseases in Europe. Nevertheless, unselective fungi-
cide usage, combined with disease adaptation, can significantly impair fungicide
efficiency. If administered before severe symptoms progress, metrafenone,
proquinazid, and cyflufenamid fungicides can provide excellent defense against
powdery mildew. It is very hard to control the disease when it has established itself
in the plant. Morpholines can eliminate powdery mildew and give effective short-
term elimination and protectant action. However, disease resistance renders
strobilurin fungicides ineffective against powdery mildew (HGCA 2011).
In net blotch disease, seed should be examined to determine if the treatment is
mandatory or not. In susceptible plants, SDHI fungicides and prothioconazole can
provide good protection. Furthermore, in order to eradicate brown rust disease,
SDHIs, as well as the majority of triazoles and strobilurins, are good controls.
However, the disease can be treated by combining morpholine with one or more
other fungicides. The optimum control for leaf spot disease is obtained by combining
a triazole with, for instance, boscalid or chlorothalonil.
Suitable fungicide choice is thus required to reduce yield losses. Before applying
fungicides, the counsellor or planter should assess the grade of fungicide resistance.
The Fungicide Resistance Action Group (FRAG) is the primary foundation of these
data in the United Kingdom. The majority of fungicides have extremely exacting
approaches to their target fungus. This uniqueness can frequently lead to fast fungal
development. The fungicide’s target place is a critical factor driving pathogen
progress because fungicides with only one target site frequently generate quick
resistance against fungicides, as seen with methyl benzimidazole carbamate
fungicides. As a result, to reduce the losses of active fungicides, an integrated
management system for the control of barley diseases must be adopted. The most
effective ways now being used are: delivering the suitable dose at the suitable time
and combining multiple compounds with distinct mechanisms of activity in con-
junction with the adoption of resistant varieties (Walters et al. 2012).
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 105
6.3 Nano Diagnostics for Barley Infections
Rapid detection solutions for plant pathogens with elevated sensitivity and selectiv-
ity are required to avoid disease propagation and limit losses to ensure maximum
production and food security. Microscopy and culturing are time-consuming, labor-
intensive methods that require complicated sample management. Immunological
and molecular approaches have evolved, although there are still significant
challenges with speed, signal strength, and equipment. The combination of molecu-
lar and immunologic diagnosis with nano-approaches yields a solution in which all
detection processes can be housed on a portable tiny instrument for quick and precise
diagnosis of plant infections (Kashyap et al. 2017).
Nanotechnology, nanoparticles, and quantum dots (QDs) have developed as
critical instruments for the rapid and precise detection of a specific biological
signature. Using biosensors, QDs, nano platforms, nanopore DNA sequencing
technologies, and nanoimaging can help improve disease diagnosis and crop protec-
tion. These technologies can also help with high-throughput analysis and crop
protection.
6.3.1 Nano Diagnostic Kits for Barley Mycotoxins
The term “nano diagnostic kit,”also known as “lab in a packet,”refers to the practice
of packing a laboratory’s instruments, reagents, power supply, and other
components into a package no larger or heavier than a briefcase (Khiyami et al.
2014). This allows for the simple and rapid identification of plant diseases in fields,
permitting specialists to assist agronomists in disease epidemic inhibition (Pimentel
2009; Nezhad 2014). A mycosensor is a dipstick-based antibody-based test for the
real-time diagnosis of Zearalenone, Trichothecene, Deoxynivalenol, and Fumonisin
B1/Fumonisin B2 mycotoxins in barley samples (Lattanzio et al. 2012).
Nano diagnostics using immunoassay kits and nucleic acid-based tests are quick,
inexpensive, and simple to use, making them ideal for on-site testing. However,
there are several hurdles, such as the detection and choice of efficient antigens,
antibodies, nucleotide targets, nanomaterials, and their manufacture as kits, which
need more research work to make them practicable at the ground level on a wide
scale (Lattanzio et al. 2012). Furthermore, the transportable diagnostic device,
nanoparticle-based, bio-barcoded DNA sensor, and QD might all be used to identify
plant diseases and toxogenic fungus. Transportable diagnostic tests have been
established to identify plant diseases quickly and may be applied to avert outbreaks.
These nano-based kits are rapid for pathogen identification and also improve diag-
nostic precision. Furthermore, the grouping of nanotechnology and microfluidic
devices has been successfully used in molecular studies of plant pathology and
may be customized to identify definite infections and poisons. For instance, the
micro-PCR, which can execute 40 cycles of PCR in a short time. In the near future,
nano-instruments with unique features might be employed to create smart agricul-
tural systems in the near future. These nanodevices, for example, may be applied to
detect plant health concerns before they become observable to the planter. Such
devices may be able to respond to unusual events, identifying the problem and
initiating disease management intervention. Nano-smart instruments will therefore
serve as both a defensive and an initial alarm system. Nanodevices that can do
thousands of measurements quickly and affordably will become available during the
next few years. The downsizing of biochip technology to the nanoscale level will
continue to improve future possibilities in plant disease diagnostics. Nano-
phytopathology can be used to better understand plant-pathogen interactions, per-
haps leading to novel crop protection measures. Specific nano-instruments and DNA
nano-instruments might provide precise tracking, diagnosis, and monitoring of the
pathogens in the first stage of plant infection (Khiyami et al. 2014).
106 H. S. Abbas
6.4 Effect of Metallic Oxide Nanoparticulates on the Barley
Varieties
Plants require iron as an essential micronutrient for their growth, whereas copper is a
microelement that aids in plant metabolism. Fertilizers containing iron oxide and
copper oxide nanoparticulates are applied in trace amounts to improve the necessary
metal content of the soil, thus enhancing crop development. These NPs are employed
in large dosages as antifungals to protect plants from diseases caused by fungal
pathogens (Anderson et al. 2018; Devi et al. 2019; Elmer et al. 2018). Also, zinc
oxide nanoparticles are found in a variety of commercial items, including
sunscreens, cosmetics, and paints (Hussain et al. 2018; Vance et al. 2015). Further-
more, ZnO NPs have been recommended as a fertilizer to provide Zn to plants.
Metal oxide nanoparticulates have a significant effect on the morphology of the
plant. Wheat, tomato, and lettuce roots can be lengthened with Fe
3
O
4
nanoparticles.
Different concentrations of CuO nanoparticulates can lower the length of roots and
shoots in chickpea plants. CuO NPs stress decreased the germination of cucumber,
lettuce, rice, and radish seeds (Konate et al. 2018; Kumar et al. 2019). Also, the
levels of microRNA expression in plants can be influenced by metal oxide
nanoparticles. It is known that microRNAs can defend plants against biotic stress,
such as infections that cause powdery mildew.
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 107
6.4.1 Barley Morphology and Seedlings Germination
Petrova et al. (2021) investigated the morphology, genotoxicity, and miRNA156a of
Hordeum vulgare L. cultivars Marthe and KWS Olof when they were grown in
different concentrations of iron oxide and copper oxide nanoparticles. The impact of
diverse doses of iron oxide and copper oxide nanoparticulates on shoot length on
Marthe and KWS Olof barley cultivars was compared; the 17 mg/L dose of iron
oxide nanoparticulates generated a substantial increase in the Marthe and KWS Olof
varieties. Only the Marthe variety’s shoot length was greatly boosted by treatment
with 35 mg/L of iron oxide nanoparticulates. Copper oxide nanoparticulates at
35 mg/L enhanced shoot length exclusively in the KWS Olof cultivar. The shoot
length of the Marthe cultivar control group was 16.15 cm, whereas the shoot length
of the groups treated with 17, 35, and 70 mg/L iron oxide nanoparticulates was
16.04, 18.96, and 17.23 cm, respectively (Fig. 6.1). However, when they were
treated with copper oxide nanoparticulates, the shoot length of the groups was
16.08, 15.58, and 15.18 cm at 17, 35, and 70 mg/L, respectively. On the KWS
Olof cultivar, the shoot length of the control group was 15.78 cm, whereas the shoot
length of the groups treated with iron oxide nanoparticulates at 17, 35, and 70 mg/L
was 18.53, 18.13, and 17.35 cm, respectively. The shoot length of copper oxide
nanoparticulates-treated KWS Olof variety attained 15.06, 17.36, 16.95 cm at
Fig. 6.1 Growth parameters expressed as the % of control; in barley cultivars, seedlings have
grown 8 days with different doses of iron oxide nanoparticulate. Diverse letters show significant
differences at p<0.05. However, the similar letters show no significant difference (Kokina et al.
2021)
17, 35, and 70 mg/L, respectively. All other iron oxide nanoparticulates treatments
improved the shoot length of both cultivars of barley.
108 H. S. Abbas
Copper oxide nanoparticulates at all treatments reduce the shoot length of Marthe
cultivar, but in the KWS Olof cultivar, all doses of CuO NPs in this cultivar enlarged
shoot length except in case of using 17 mg/L concentration of copper oxide
nanoparticulates (Petrova et al. 2021).
The root length of the Marthe and KWS Olof cultivars was unaffected by
different treatments of iron oxide nanoparticulates. All treatments of copper oxide
nanoparticulates lowered Marthe and KWS Olof roots lengths substantially. The root
length for the control group of Marthe cultivar was 7.58 cm, whereas the root length
of the group with iron oxide nanoparticulates at 17 and 35 mg/L concentrations was
7.17 and 6.33 cm, respectively. However, at the 70 mg/L concentration, the root
measured 9.86 cm long. The Marthe set with copper oxide nanoparticulates at 17, 35,
70 mg/L concentrations had a height of 3.08, 5.31, 5.76 cm, respectively. All Fe
3
O
4
NPs concentrations had a beneficial effect on the fresh biomass of the Marthe and
KWS Olof cultivars, with biomass increasing. However, iron oxide and copper oxide
NPs at 17, 70, and 35 mg/L did not influence the fresh biomasses of seedlings.
On the contrary, recent research by Kokina et al. (2021) showed the increase in
root length and shoot length in both Sencis and Abava varieties when they were
treated with iron oxide nanoparticulate. Abava seedlings grew to 1 cm in shoot
length and 0.1 cm in root number when given a 1 mg/L dose. However, insignificant
root development of Abava was observed when given a 20 mg/L dose. Moreover,
the reduction of growth parameters was observed only in the Quench variety
(Fig. 6.1).
Also, Petrova et al. (2021) showed that ZnO NPs improve barley seed growing,
shoot/root extension, and stress level of hydrogen peroxide and reduce the viability
of root cell, the stability of genomic template, and up/downregulated miRNAs in the
seeds. The seeds grown with the supplements 4 mg/L of ZnO NPs had the highest
germination rate (66%), while the control seedlings had a much lesser germination
percentage (42%). Germination rates at 2 mg/L and 1 mg/L were 57 and 63%,
respectively. ZnO NPs had a substantial influence on the regular length of shoots.
There was no noteworthy statistical variation between the length of the seedling root
and the number of seminal roots. The maximum dose (4 mg/L) of ZnO NPs had the
greatest impact on barley germination and shoot and root length. In another study,
Tombulogu et al. (2019b), cultivated Barley for 3 weeks in a hydroponic solution
enriched with different concentrations of NiFe2O4 NPs and the results in rising in
iron and nickel levels of leaves that were 5.5 and 8 times larger than the control,
respectively. Furthermore, the NPs treatment boosted the leaf’s calcium, potassium,
manganese, sodium, and magnesium constituent (Tombuloglu et al. 2019b).
Also, Rico et al. (2015) proved that cerium oxide NPs (nCeO
2
) improved
biomasses, plant height, and chlorophyll composition while decreasing spike forma-
tion in Hordeum vulgare L. Ce buildup by 294%, which was associated with
increased nutrient storage including phosphorous, potassium, magnesium, calcium,
iron, copper, sulfur, and zinc in grains. Similarly, nCeO
2
-amended soil (250 μg/kg
DW) improved the levels of amino acids including methionine, aspartic acid,
tyrosine, threonine, linolenic acid, and arginine in grains by up to 617, 31, 141,
58, 2.47, and 378%, respectively (Table 6.1) (Rico et al. 2015).
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 109
Table 6.1 Amino acid and fatty acid compositions in barley grains harvested from nCeO
2
-
amended soil (Rico et al. 2015)
N CeO
2
Concentrations (mg kg
1
)
0 125 250
Amino acids (μgg
1
dry wt)
Alanine 61.10 + 539 67.62 + 1 24 88.72 + 25 M
Amide-NH
3
78.37 + 5_12 84.36 + 236 99.52 + 24.45
Arginine 13.08 + 232c 3 7.19 + 3 25b 62.53 + 2.10a
Aspartic acid 126.56 + 83,713 123.05 + 292b 160.84 + 18.95a
Cysteine 6.57 + 1 36 832 + 0.70 6.25 + 0.77
Glutamic acid 500.49 + 52.65 47,327 + 14.55 573.74 + 189.40
Glycine 75.02 + 5.91 77.02 + O31 82.79 + 32.99
Isoleucine 41.30 + 5.48 5030 + 230 47.51 + 24.69
Leucine 67.48 + 830 7626 + 737 130.75 + 56.94
Lysine 42.16 + 3.19 4430+ 1.78 7 1.24 + 22.36
Methionine 4.36 + 0.433 5.80+ 1.98b 3 1.24 + 0.58a
Phenylalanine 35.56 + 2.78 3829 + 3.61 61.42 + 20.57
Proline 373.96 + 31.15 345.97+ 10.78 395.94 + 25.49
Serine 26.70 + 239 3 1.97 + 2.41 45.86 + 16.55
Threonine 65.86 + 5.5 8b 74.82 + 2.65ab 103.79 + 18.44a
Tyrosine 36.64 + 4.3 lb 6048 + 5.1 5ab 8 &35 + 25.95a
Valine 82.62 + 899 101.92 + 1 26 125.94 + 36.55
Total 1637.84 + 12,138 1702.14 + 36.82 1816.96 + 448.64
Fatty acids
(relative % abundance)
Linoleic acid 55.17 + 0.1 2b 54.76 + 04913 56.11 + 0.28a
Linolenic acid 6.62 + 0.11 6.8 1 + 0.1 1 7.10 + 0.29
Oleic acid 15.11 + 031 14.99 + 030 14.86 + 0.20
Palmitic acid 2 1.72 + 0.12a 2130 + 0.13b 21.54 + 0 1 2ab
Stearic acid 0.84 + 0.0313 1.00 + 0.05a 0.89 + 0.07ab
In that concern, nCeO
2
and nTiO
2
exhibited differential effects on the content and
nutritional value of H. vulgare kernels. Both MNPs did not affect β-glucans, but
lowered amylose concentration by around 21%. The majority of amino acids and
crude protein levels rose. Lysine, followed by proline, showed the greatest growth
among amino acids (51% and 37%, respectively) (Pošćićet al. 2016).
The oxidative stress in the leaves was not always caused by the nCeO
2
treatment;
nonetheless, yield was reduced at the maximum nCeO
2
concentration (500 mg/kg).
Further, the plant couldn’t form grain at this high concentration (Rico et al. 2015).
110 H. S. Abbas
6.4.2 Barley Genotoxicity
CuO NPs had a greater impact on the barley genome than Fe
3
O
4
NPs which
decreased genome constancy to 72% in the Marthe cultivar and 76.34% in the
KWS Olof cultivar, whereas CuO NPs raised genome stability from 53.33 to
78.66%, in the Marthe cultivar and reduced genome constancy to 68.81% in the
KWS Olof cultivar. After Fe
3
O
4
NPs treatments, levels of miRNA expression were
not altered in the Marthe cultivar, but rose in the KWS Olof cultivar. The treatment
by CuO NPs raised the expression levels of miRNA in the Marthe cultivar, but it
decreased in the KWS Olof cultivar. The results imply that the examined NPs may be
useful because they may alter the expression of miRNA, which affects plant resis-
tance (Petrova et al. 2021). Forthcoming research is required to examine the impact
of NPs stress on expressions of miR156 and other miRNA in mlo and non-mlo
barley seedlings, as well as the prospect of using NPs to boost the disease resistance.
6.5 Effect of Metallic Nanoparticles on the Barley Diseases,
Seed Germination, Root, and Shoot System
Seed nanoparticles are beneficial to seed growth and sowing quality. Plants grow
more resistant to harsh situations such as diseases and pests as a result of their
effects. In studies, nanoparticles have been shown to dramatically enhance seedling
germination during the early phases of growth (Barabanov et al. 2018; El-Ramady
et al. 2014; Krishnaraj et al. 2012a,b). The impact of nanoparticulates on plant
development can vary depending on the dose. It has been demonstrated, for example,
that increasing the absorption of silver nanoparticulates can delay seedling growth
compared to the control (Gubbins et al. 2011; Lee et al. 2012; Mirzajani et al. 2013).
Furthermore, the toxicity of nanoparticles may be affected by their size (Jiang et al.
2014). For instance, small silver nanoparticles with a diameter of 6 nm, for example,
have been shown experimentally to be more hazardous than the big ones
(20–1000 nm) (Musante and White 2012).
6.5.1 Selenium Nanoparticles (SeNPs)
The impacts of critical trace elements such as selenium are being studied in depth.
This component is required for the plant organism to function properly. The influ-
ence of SeNPs on diverse plant species differs substantially depending on the
development of plant growth, the extent of SeNPs exposure, as well as the
nanoparticle’s morphology, chemical structure, absorption, surface construction,
solubility, and aggregation (Romero et al. 2019). The effect of SeNPs on the
germination features of Hordeum vulgare L. seeds was examined by Siddiqui
et al. (2021). SeNPs were found to have a favorable influence on the shoot and
root length and the percentage of germination. The treated sample with the
formulation of SeNPs at a dose of 4.65 g/mL had the highest percentage of seed
germination (Siddiqui et al. 2021) (Fig. 6.2).
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 111
Fig. 6.2 Photos of Barley seeds: (a) barley seeds were treated with Selenium nanoparticulate in a
Petri dish; (b) only one germinated Hordeum seed (Siddiqui et al. 2021)
6.5.2 Silver Nanoparticles (AgNPs)
The dispersion of AgNPs in the shoot and root tissues and seedlings of Hordeum
vulgare was examined by Linares et al. (2020). The strong, linear responses of barley
seedlings to soil AgNP doses over a 14-day exposure time validate barley’s useful-
ness as a detective examination for silver bioavailability in AgNP biosolid-amended
soils. The growth of root and shoot was reduced linearly by the increased concen-
tration of AgNPs. Furthermore, Elamawi and Al-Harbi (2014) reported that the
lower doses of AgNPs enhanced the percentage of barley seed germination and
lessened the prevalence of barley seed rot disease produced by Fusarium oxysporum.
However, the higher doses of AgNPs reduced the germination of barley grain and
showed a robust lessening in the length of roots. The chlorosis of leaves was caused
by a loss in chlorophyll pigments and disorganization of chloroplast thylakoids in
positive silver ions and the treated barley groups with AgNPs. As a result, increased
monoaldehyde content in response to the influence of positive silver ions and AgNPs
gave an indication of oxidative stress intensification. Silver toxicity caused the death
of mitochondria, chloroplasts, and the nucleus, which showed that these were the
main goals of silver poisoning (Fayez et al. 2017).
6.5.3 Gold Nanoparticles (AuNPs)
Feichtmeier et al. (2015) investigated the influence of 2–19 nm spherical AuNPs on
barley seedling germination. There was no noteworthy influence on germination, but
there was wilting of leaves, blackening of roots, and reduced biomass, which
worsened as the concentration of AuNPs increased. However, a relatively modest
concentration of AuNPs in the nutritional media (1 g/mL) stimulated growth. It is
supposed that low concentrations trigger hormone roles (Barrena et al. 2009),
whereas higher concentrations and larger AuNPs have a negative outcome on barley
growth and biomass yield. Adsorption of AuNPs onto the primary root may have
reduced pore size, hindering water passage capacity and thus lessening barley
growth and related features. Previously, researchers explained this as well
(Feichtmeier et al. 2015; Asli and Neumann 2009).
112 H. S. Abbas
6.6 Conclusion
One of the most vital cereal plants is barley (Hordeum vulgare L.), which is widely
employed not only in agronomy but also in nutrient production. Barley is susceptible
to a variety of diseases, the majority of which are caused by plant pathogens. Fast
diagnosis methods for crop pathogens are needed to avoid disease spread and limit
losses in order to maximize output and food security. For instance, a mycosensor is a
dipstick-based antibody-based test that detects mycotoxins in barley samples in real
time. Barley diseases: nanotechnology propels a broad range of options for manag-
ing barley diseases. Silver, selenium, copper, iron oxide, zinc oxide, and titanium
dioxide nanoparticles have received a lot of attention. These nanomaterials have a
role in reducing disease incidence, as well as barley seed germination, physiology,
and nutritional quality of barley grain. Future studies are needed to investigate the
role of miR156 and other miRNA expressions in NP-stressed barley seedlings, as
well as to evaluate the feasibility of applying NPs to boost barley resistance to
diseases.
References
Ali A, Zafar H, Zia M et al (2016) Synthesis, characterization, applications, and challenges of iron
oxide nanoparticles. Nanotechnol Sci Appl 9:49–67
Anderson AJ, McLean JE, Jacobson AR, Britt DW (2018) CuO and ZnO nanoparticles modify
interkingdom cell signaling processes relevant to crop production. J Agric Food Chem 66(26):
6513–6524. https://doi.org/10.1021/acs.jafc.7b01302
Arabi MIE, Jawhar M (2004) Identification of Cochliobolus sativus (Spot Blotch) isolates
expressing differential virulence on barley genotypes in Syria. J Phytopathol 152:461–464
Arnst BJ, Martens JW, Wright GM, Burnett PΑ, Sanderson FR (1979) Incidence, importance and
virulence of Puccinia hordei on barley in New Zealand. Ann Appl Biol 92:185–190
Asli S, Neumann M (2009) Colloidal suspensions of clay or titanium dioxide nanoparticles can
inhibit leaf growth and transpiration via physical effects on root water transport. Plant Cell
Environ 32:577–584
Aubert MK, Coventry S, Shirley NJ et al (2018) Differences in hydrolytic enzyme activity
accompany natural variation in mature aleurone morphology in barley (Hordeum vulgare L.).
Sci Rep 8:11025
Backes A, Guerriero G, Ait Barka E, Jacquard C (2021) Pyrenophora teres: taxonomy, morphology,
interaction with barley, and mode of control. Front Plant Sci 12:614951. https://doi.org/10.
3389/fpls.2021.614951
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 113
Balaure PC, Gudovan D, Gudovan I (2017) Nanopesticides: a new paradigm in crop protection.
New Pestic Soil Sens 2017:129–192
Barabanov PV, Gerasimov AV, Blinov AV, Kravtsov AA, Kravtsov VA (2018) Influence of
nanosilver on the efficiency of pisum sativum crops germination. Ecotoxicol Environ Saf 147:
715–719
Barrena R, Casals E, Colón J, Font X, Sánchez A, Puntes V (2009) Evaluation of the ecotoxicity of
model nanoparticles. Chemosphere 75:850–857
Beneduzi A, Ambrosini A, Passaglia LMP (2012) Plant growth-promoting rhizobacteria (PGPR):
their potential as antagonists and biocontrol agents. Genet Mol Biol 35:1044–1051. https://doi.
org/10.1590/S1415-47572012000600020
Bhardwaj SC, Gangwar OP, Prasad P, Khan H, Kumar S (2017) Understanding wheat rusts and
managing them strategically. In: Gautam HR, Gupta SK (eds) Diseases of commercial crops in
India. Neoti Book Agency Pvt. Ltd., New Delhi, pp 9–29
Brooks DH (1970) Powdery mildew of barley and its control. Outlook Agric 6:122–127. https://doi.
org/10.1177/003072707000600306
Cazorla FM, Romero D, Pérez-García A, Lugtenberg BJJ, De Vicente A, Bloemberg G (2007)
Isolation and characterization of antagonistic Bacillus subtilis strains from the avocado rhizo-
plane displaying biocontrol activity. J Appl Microbiol 103:1950–1959. https://doi.org/10.1111/
j.1365-2672.2007.03433.x
Clifford BC (1985) Diseases, distribution, epidemiology, and control. Barley Leaf Rust, pp
173–205. https://doi.org/10.1016/b978-0-12-148402-6.50014-6
Devi H, Boda M, Shah M et al (2019) Green synthesis of iron oxide nanoparticles using Platanus
orientalis leaf extract for antifungal activity. Green Proc Synthes 8(1):38–45. https://doi.org/10.
1515/gps-2017-0145
Disfani MN, Mikhak A, Kassaee MZ, Maghari A (2017) Effects of nano Fe/SiO2 fertilizers on
germination and growth of barley and maize. Arch Agron Soil Sci 63:817–826
Dreiseitl A (2020) Specific resistance of barley to powdery mildew, its use and beyond. A concise
critical review. Genes (Basel) 11(9):971. https://doi.org/10.3390/genes11090971
Elamawi RM, Al-Harbi RE (2014) Effect of biosynthesized silver nanoparticles on fusarium
oxysporum fungus the cause of seed rot disease of faba bean, tomato and barley. J Plant Prot
and Path Mansoura Univ 5(2):225–237
Ellwood S, Piscetek V, Mair W, Lawrence J, Lopez-Ruiz F, Rawlinson C (2019) Genetic variation
of Pyrenophora teres f. teres isolates in Western Australia and emergence of a Cyp51A fungicide
resistance mutation. Plant Pathol 68:135–142
Elmer W, Ma C, White J (2018) Nanoparticles for plant disease management. Curr Opin Environ
Sci Health 6:66–70
El-Ramady HR, Domokos-Szabolcsy É, Abdalla NA, Alshaal TA, Shalaby TA, Sztrik A,
Prokisch J, Fári M (2014) Selenium and nano-selenium in agroecosystems. Environ Chem
Lett 12:495–510
Esmaeel Q, Pupin M, Kieu NP, Chataigné G, Béchet M, Deravel J et al (2016) Burkholderia
genome mining for nonribosomal peptide synthetases reveals a great potential for novel
siderophores and lipopeptides synthesis. Microbiology 5:512–526. https://doi.org/10.1002/
mbo3.347
Esmaeel Q, Miotto L, Rondeau M, Leclère V, Clément C, Jacquard C et al (2018) Paraburkholderia
phytofirmans PsJN-plants interaction: from perception to the induced mechanisms. Front
Microbiol 9:2093. https://doi.org/10.3389/fmicb.2018.02093
Fayez KA, El-Deeb BA, Mostafa N (2017) Toxicity of biosynthetic silver nanoparticles on the
growth, cell ultrastructure and physiological activities of barley plant. Acta Physiol Plant 39:
155. https://doi.org/10.1007/s11738-017-2452-3
Feichtmeier NS, Walther P, Leopold K (2015) Uptake, effects, and regeneration of barley plants
exposed to gold nanoparticles. Environ Sci Pollut Res Int 22:8549–8558
Gangwar OP, Bhardwaj S, Singh GP, Prasad P, Kumar S (2018) Barley diseases and their
management: an Indian perspective. Wheat Barley Res 10(138–150):2018
114 H. S. Abbas
Giraldo P, Benavente E, Manzano-Agugliaro F, Gimenez E (2019) Worldwide research trends on
wheat and barley: a bibliometric comparative analysis. Agronomy 9:352
Gogos A, Knauer K, Bucheli TD (2012) Nanomaterials in plant protection and fertilization: current
state, foreseen applications, and research priorities. J Agric Food Chem 60:9781–9792
Gozukirmizi N, Karlik E (2017) Barley (Hordeum vulgare L.) improvement past, present and
future. In: Brewing technology. IntechOpen, London
Gray S, Gildow FE (2003) Luteovirus-aphid interactions. Annu Rev Phytopathol 41:539–566
Gubbins EJ, Batty LC, Lead JR (2011) Phytotoxicity of silver nanoparticles to Lemna minor
L. Environ Pollut 159:1551–1559
Hawkins NJ, Cools HJ, Sierotzki H, Shaw MW, Knogge W, Kelly SL, Kelly DE, Fraaije BA (2014)
Paralog re-emergence: a novel, historically contingent mechanism in the evolution of antimi-
crobial resistance. Mol Biol Evol 31:1793–1802
Hayles J, Johnson L, Worthley, Losic D (2017) Nanopesticides: a review of current research and
perspectives. New Pestic, Soil Sens, pp 193–225
Home-Grown Cereals Authority (HGCA) (2011) The HGCA barley disease management guide.
HGCA, Stoneleigh Park, Warwickshire
Hussain A, Ali S, Rizwan M et al (2018) Zinc oxide nanoparticles alter the wheat physiological
response and reduce the cadmium uptake by plants. Environ Pollut 242:1518–1526
Jenkins JΕE, Melville SC, Jemmett JL (1972) The effect of fungicides on leaf diseases and on yield
in spring barley in south-West England. Plant Pathol 21:49–58
Jiang H-S, Qiu X-N, Li G-B, Li W, Yin L-Y (2014) Silver nanoparticles induced accumulation of
reactive oxygen species and alteration of antioxidant systems in the aquatic plant spirodela
polyrhiza. Environ Toxicol Chem 33:1398–1405
Kah M, Hofmann T (2014) Nanopesticide research: current trends and future priorities. Environ Int
63:224–235
Kashyap PL, Kumar S, Srivastava AK (2017) Nanodiagnostics for plant pathogens. Environ Chem
Lett 15:7–13. https://doi.org/10.1007/s10311-016-0580-4
Kaur A, Sharma VK, Sharma S (2021) Management of spot blotch of barley: an eco-friendly
approach. Aust Plant Pathol 50:389–401. https://doi.org/10.1007/s13313-021-00785-1
Khandelwal N, Barbole RS, Banerjee SS, Chate GP et al (2016) Budding trends in integrated pest
management using advanced micro-and nano-materials: challenges and perspectives. J Environ
Manag 184:157–169
Khiyami MA, Almoammar H, Awad YM et al (2014) Plant pathogen nanodiagnostic techniques:
forthcoming changes? Biotechnol Biotechnol Equip 28:775–785
Kim DY, Kadam A, Shinde S, Saratale RG, Patra J, Ghodake G (2018) Recent developments in
nanotechnology transforming the agricultural sector: a transition replete with opportunities. J
Sci Food Agric 298:849–864
Kokina I, Plaksenkova I, Galek R, Jermaļonoka M, Kirilova E, Gerbreders V, Krasovska M,
Sledevskis E (2021) Genotoxic evaluation of Fe
3
O
4
nanoparticles in different three barley
(Hordeum vulgare L.) genotypes to explore the stress resistant molecules. Molecules 26:6710.
https://doi.org/10.3390/molecules26216710
Konate M, Wilkinson MJ, Mayne BT, Pederson SM, Scott ES, Berger B, et al (2018) Salt stress
induces non-cg methylation in coding regions of barley seedlings (Hordeum vulgare).
Epigenomes 2:12. https://doi.org/10.3390/epigenomes2020012
Krishnaraj C, Jagan EG, Ramachandran R, Abirami SM, Mohan N, Kalaichelvan PT (2012a) Effect
of biologically synthesized silver nanoparticles on bacopa monnieri (Linn.) wettst. Plant growth
metabolism. Process Biochem 47:651–658
Krishnaraj C, Ramachandran R, Mohan K, Kalaichelvan P (2012b) Optimization for rapid synthesis
of silver nanoparticles and its effect on phytopathogenic fungi. Spectrochim. Acta Part A Mol
Biomol Spectrosc 93:95–99
Kumar S, Mishra CN, Sarkar B, Singh SS (2012) Barley (Hordeum vulgare L.). In: Breeding field
crops. AGROBIOS India, Jodhpur
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 115
Kumar GS, Kashyap PL, Awasthi S (2019) Deciphering rhizosphere microbiome for the develop-
ment of novel bacterial consortium and its evaluation for salt stress management in solanaceous
crops in India. Indian Phytopathol. https://doi.org/10.1007/s42360-019-00174-1
Lattanzio VMT, Nivarlet N, Lippolis V et al (2012) Multiplex dipstick immunoassay for semi-
quantitative determination of Fusarium mycotoxins in cereals. Anal Chim Acta 718:99–108
Lee W, Kwak JI, An Y-J (2012) Effect of silver nanoparticles in crop plants phaseolus radiatus and
sorghum bicolor: media effect on phytotoxicity. Chemosphere 86:491–499
Lim LG, Gaunt RΕ(1981) The timing of spray applications against powdery mildew and leaf rust in
barley. Proc ΝZ Weed Pest Control Conf 34:195–198
Linares M, Jia Y, Sunahara GI, Whalen JK (2020) Barley (Hordeum vulgare) seedling growth
declines with increasing exposure to silver nanoparticles in biosolid-amended soils. Can J Soil
Sci 100(3):189–197. https://doi.org/10.1139/cjss-2019-0135
Marchal E (1902) Compo rend. Acad Sci Paris 135:210
Martens JW, Seaman WL, Atkinson TG (1984) Diseases of field crops in Canada. Canadian
Phytopathological Society, p 160. ISBN 0-9691627-0-7
Maslobrod SN, Mirgorod YA, Borodina VG, Borsch NA (2014) Influence of water dispersed
systems with silver and copper nanoparticles on seed germination. Elect Process Mater 50(4):
103–112
Mathre DE (1997) Compendium of barley diseases. American Phytopathological Society,
St. Paul, MN
Mathre DE (1982) Compendium of barley diseases. American Phytopathological Society, pp 32–34
McDonald BA, Linde C (2002a) The population genetics of plant pathogens and breeding strategies
for durable resistance. Euphytica 124:163–180
McDonald BA, Linde C (2002b) Pathogen population genetics, evolutionary potential, and durable
resistance. Annu Rev Phytopathol 40:349–379
Mirzajani F, Askari H, Hamzelou S, Farzaneh, Ghassempour A (2013) Effect of silver nanoparticles
on Oryza sativa L. and its rhizosphere bacteria. Ecotoxicol Environ Saf 88:48–54
Mohd-Assaad N, McDonald BA, Croll D (2016) Multilocus resistance evolution to azole fungicides
in fungal plant pathogen populations. Mol Ecol 25:6124–6142
Montesinos E., Badosa E., Cabrefiga J., Planas M., Feliu, L., and Bardají, E (2012). Antimicrobial
peptides for plant disease control. From discovery to application. K. Rajasekaran, J. W. Cary,
J. M. Jaynes, and E. Montesinos In: Small wonders: peptides for disease control ACS sympo-
sium series (Washington, DC: American Chemical Society, 235–262
Musante C, White JC (2012) Toxicity of silver and copper to cucurbita pepo: differential effects of
nano and bulk-size particles. Environ Toxicol 27:510–517
Nezhad AS (2014) Future of portable devices for plant pathogen diagnosis. Lab Chip 14:2887–
2904
Ongena M, Jourdan E, Adam A, Paquot M, Brans A, Joris B et al (2007) Surfactin and fengycin
lipopeptides of Bacillus subtilis as elicitors of induced systemic resistance in plants. Environ
Microbiol 9:1084–1090. https://doi.org/10.1111/j.1462-2920.2006.01202.x
Ordon F, Habekuß A, Kastirr U, Rabenstein F, Kühne T (2009) Virus resistance in cereals: source
of resistance, genetics and breeding. J Phytopathol 157:535–545. https://doi.org/10.1111/j.
1439-0434.2009.01540.x
Palumbi SR (2001) Humans as the world’s greatest evolutionary force. Science 293:1786–1790
Park RF, Golegaonkar PG, Derevnina L et al (2015) Leaf rust of cultivated barley: pathology and
control. Annu Rev Phytopathol 53(1):565–589. https://doi.org/10.1146/annurev-phyto-
080614-120324
Paulmann Maria K, Kunert G, Zimmermann Matthias R et al (2018) Barley yellow dwarf virus
infection leads to higher chemical defense signals and lower electrophysiological reactions in
susceptible compared to tolerant barley genotypes. Front Plant Sci 9:145
Pérez-García A, Romero D, De Vicente A (2011) Plant protection and growth stimulation by
microorganisms: biotechnological applications of Bacilli in agriculture. Curr Opin Biotechnol
22:187–193. https://doi.org/10.1016/j.copbio.2010.12.003
116 H. S. Abbas
Petrova A, Plaksenkova I, Kokina I, Jermaļonoka M (2021) Effect of Fe3O4 and CuO nanoparticles
on morphology, genotoxicity and miRNA expression on different barley (Hordeum vulgare L.)
genotypes. Sci World J. https://doi.org/10.1155/2021/6644689
Pimentel D (2009) Invasive plants: their role in species extinctions and economic losses to
agriculture in the USA. In: Inderjit (ed) Management of invasive weeds, invading nature—
Springer series in invasion ecology, vol 5. Springer, Dordrecht, pp 1–7. https://doi.org/10.1007/
978-1-4020-9202-2_1
PošćićF, Mattiello A, Fellet G et al (2016) Effects of cerium and titanium oxide nanoparticles in soil
on the nutrient composition of barley (Hordeum vulgare L.) Kernels. Int J Environ Res Public
Health 13(6):577. https://doi.org/10.3390/ijerph13060577
Priyanka (2018) Cereal cyst nematode: a hidden foe to indian agriculture. Pop Kheti 6(2):142–143
Reinhold M, Sharp EL (1982) Resistance to leaf rust of barley in Southern Texas. Cereal Rusts Bull
10:4–10
Rico CM, Barrios AC, Tan W et al (2015) Physiological and biochemical response of soil-grown
barley (Hordeum vulgare L.) to cerium oxide nanoparticles. Environ Sci Pollut Res 22:10551–
10558. https://doi.org/10.1007/s11356-015-4243-y
Rizwan M, Ali S, Qayyum MF et al (2017) Effect of metal and metal oxide nanoparticles on growth
and physiology of globally important food crops: a critical review. J Hazard Mater 322:2–16
Romero I, de Francisco P, Gutiérrez JC, Martín-González A (2019) Selenium cytotoxicity in
Tetrahymena thermophila: new clues about its biological effects and cellular resistance
mechanisms. Sci Total Environ 671:850–865
Siddiqui SA, Blinov AV, Serov AV, Gvozdenko AA, Kravtsov AA, Nagdalian AA, Raffa VV,
Maglakelidze DG, Blinova AA, Kobina AV, Golik AB, Ibrahim SA (2021) Effect of selenium
nanoparticles on germination of Hordéum Vulgáre barley seeds. Coatings 11(7):862. https://doi.
org/10.3390/coatings11070862
Singh J, Kaur A, Sharma VK (2020) Evaluation of barley genotypes for resistance against covered
smut disease. Indian Phytopathol 73:359–360. https://doi.org/10.1007/s42360-020-00231-0
Sinha K, Ghosh J, Sil PC (2017) 2-New pesticides: a cutting-edge view of contributions from
nanotechnology for the development of sustainable agricultural pest control A2—Grumezescu,
Alexandru Mihai. In: New pesticides and soil sensors. Academic Press, Cambridge, MA
Thomas PL (1984a) An albino strain of Ustilago nuda from Canada (PDF). CJPP 6(2):98–100.
https://doi.org/10.1080/07060668409501567. Archived from the original (PDF) on 2007-
09-29. Retrieved 2007-03-03
Thomas PL (1984b) Recombination of virulence genes following hybridization between isolates of
Ustilago nuda infecting barley under natural conditions (PDF). CJPP 6(2):101–104. https://doi.
org/10.1080/07060668409501568
Tombuloglu H, Slimani Y, Tombuloglu G, Almessiere M, Baykal A (2019a) Uptake and translo-
cation of magnetite (Fe3O4) nanoparticles and its impact on photosynthetic genes in barley
(Hordeum vulgare L.). Chemosphere 226:110–122. https://doi.org/10.1016/j.chemosphere.
2019.03.075
Tombuloglu H, Slimani Y, Tombuloglu G et al (2019b) Tracking of NiFe2O4 nanoparticles in
barley (Hordeum vulgare L.) and their impact on plant growth, biomass, pigmentation, catalase
activity, and mineral uptake. Environ Nanotechnol Monit Manag 11:100223. https://doi.org/10.
1016/j.enmm.2019.100223
Tombuloglu H, Tombuloglu G, Slimani Y, Ercan I, Sozeri H et al (2018) Impact of manganese
ferrite (MnFe2O4) nanoparticles on growth and magnetic character of barley (Hordeum vulgare
L.). Environ Pollut 243(Pt B):872–881. https://doi.org/10.1016/j.envpol.2018.08.096
Udeogalanya AC, Clifford BC (1982) Control of barley brown rust, Puccinia hordei Otth., by
benodanil and oxycarboxin in the field and the effects on yield. Crop Prot 1:299–308
6 Barley Diseases: Introduction, Etiology, Epidemiology, and Their Management 117
Vance ME, Kuiken T, Vejerano EP et al (2015) Nanotechnology in the real world: redeveloping the
nanomaterial consumer products inventory. Beilstein J Nanotechnol 6(1):1769–1780
Waghu FH, Idicula-Thomas S (2020) Collection of antimicrobial peptides database and its
derivatives: applications and beyond. Protein Sci 29:42. https://doi.org/10.1002/pro.3714
Walters DR, Avrova A, Bingham IJ et al (2012) Control of foliar diseases in barley: towards an
integrated approach. Eur J Plant Pathol 133:33–73. https://doi.org/10.1007/s10658-012-9948-x
Wunderle J, Leclerque A, Schaffrath U et al (2012) Assessment of the loose smut fungi (Ustilago
nuda and U. tritici) in tissues of barley and wheat by fluorescence microscopy and real-time
PCR. Eur J Plant Pathol 133:865–875. https://doi.org/10.1007/s10658-012-0010-9
Part II
Plant Breeding and Diseases Management
121
Identification of a New Susceptibility Gene
and Its Role in Plant Immunity 7
Zohaib Asad, Maria Siddique, Muhammad Ashfaq,
and Zulqurnain Khan
Abstract
Host–pathogen interaction and crosstalk are very crucial to study disease suscep-
tibility and resistance. Various susceptibility genes (S-genes) have been reported
and studied for understanding the mechanism of disease development in plants.
Developing disease resistance using modern techniques is dependent on a com-
prehensive understanding of the role of susceptibility genes in disease develop-
ment. By disrupting susceptibility genes in the host, resistance has been
developed in rice, tomato, pepper, and many other plants. More precisely, in
the case of bacterial blight, effector-binding elements (EBE) in the promoter
region of the S-gene are important targets to restrict bacterial transcription factor
proteins from S-gene activation. Identification of S-genes along with R-genes is
very important for building the foundation of third-generation disease resistance
in plants.
Keywords
Alleles · Antibiotic · Cell wall · Genes · Jasmonate · Salicylic acid · Stomata ·
Susceptibility
Z. Asad
Department of Plant Pathology, PMAS—Arid Agriculture University, Rawalpindi, Pakistan
M. Siddique · Z. Khan (*)
Institute of Plant Breeding and Biotechnology, MNS University of Agriculture, Multan, Pakistan
e-mail: zulqurnain.khan@mnsuam.edu.pk
M. Ashfaq
Department of Plant Pathology, PMAS—Arid Agriculture University, Rawalpindi, Pakistan
Institute of Plant Protection, MNS University of Agriculture, Multan, Pakistan
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_7
122 Z. Asad et al.
7.1 Introduction
A genetic mutation increases a person’s susceptibility to a disease or ailment.
Symptoms are far more likely to arise when a variation (or mutation) is hereditary,
albeit not always known as a predisposing mutation, harmful mutation, disease-
causing mutation, pathogenic variation, or pathogenic variant (McCarthy 2004).
Plants often use dominant resistance genes to impart resistance to diseases and
pests. Because susceptibility is predicated on the identification of a particular
microbe’s molecular pattern, these narrow-range genes are usually easy to over-
come. Infection develops based on compatibility between both the plant and the
pathogen. As a result, changing a plant gene that is vital for compatibility may
provide an extra broad-spectrum as well as long-lasting form of resistance. This
section focuses solely on factors that lead to loss of compatibility for certain
susceptibility (S) genes. We found three distinct groups of susceptibility genes that
act at various phases of disease: early pathogen development, host defense modula-
tion, and microbe sustenance. Susceptible genetic traits have the ability to be used in
resistance breeding, as evidenced by the numerous examples presented here.
Because S genes have a function other than microbial compatibility, the negative
consequences of their mutation need a one-by-one assessment of their applicability.
With the widespread planting of “Victoria-type”oats, which possess the Pc-2
gene for rust susceptibility to Puccinia coronate, a rust fungal disease, a disorder
epidemic in oats appeared in the nineteenth century. Victoria blight, caused by the
fungus Cochliobolus victoriae, was found to be universally susceptible in oats
containing Pc-2. The pathogenicity of C. elegant victoriae is mainly reliant on the
production of a toxic chemical known as victorin, and the prominent (Vb) gene
imparts toxin susceptibility as well as high susceptibility to Victoria blight disease in
oats. Despite considerable attempts, rust resistance (Pc-2) and Victoria blight sus-
ceptibility (Vb) have yet to be genetically differentiated and are thought to have the
same identity, suggesting an unanticipated connection among plant disease resis-
tance and susceptibility (Eckardt 2002).
The main objectives of these chapters are the identification of susceptible genes
and highlighting their roles in plant defense mechanisms. Plant S genes may interfere
with host–pathogen compatibility and provide long-term resistance to plant disease
development.
7.1.1 Difference
Inherited tractability is thought to be the cause of the information gap between the
natures of resistance and susceptibility. Gene-for-gene type resistance is usually
initiated by a dominant, pathogen-derived avirulence (Avr) gene product activating a
genetically dominant resistance gene product. In the absence of their R protein
partners, Avr proteins frequently serve as virulence determinants, showing that
their primary function is pathogenicity and that recognition by R genes developed
from this role. Nucleotide-binding site-leucine-rich repeat (NBS-LRR) proteins are
the most common R proteins. These proteins’only known function in plants is to
condition disease resistance. In mammals, structurally similar proteins mediate the
innate immune response. Salicylic acid (SA), Jasmonic acid (JA), and/or ethylene
are required for R gene-mediated signaling cascades, which frequently involve
activation of hypersensitive cell death (HR) (Kwiatkowski 2000).
7 Identification of a New Susceptibility Gene and Its Role in Plant Immunity 123
The genes of vulnerability are less apparent in the bulk of plant diseases.
Microbes often have numerous viral proteins (called effectors), each adding progres-
sively to the disease phenotype, and host susceptibility is usually characterized in
terms of gains or losses of resistance. A noteworthy exception is Os8N3, a sexually
prominent rice gene which is upregulated by a bacterium type-III effector protein
and imparts disease susceptibility gene-for-gene. Also, susceptibility to Victoria
blight and other diseases caused by pathogens that kill cells during the process of
infection is determined by a single dominant region and a single pathogen-derived
host-selective toxin (HST) (Eckardt 2002). These diseases are caused by
necrotrophic pathogens, which are pathogens that kill cells during the process of
infection.
Viruses are cellular parasitic molecular parasites that consume cellular resources
throughout their reproduction cycle. Plant viruses also utilize virus-encoded moving
proteins as well as cellular components to travel from cell to cell (local) in infected
leaves and large distances via the vascular system (systemic movement). In most
cases, an insect vector delivers plant viruses into the cell, and infection begins in a
single cell. Viral proteins must be translated in order for viral replication, virion
assembly, and virus migration to adjacent cells to take place. The cycle is repeated
for every newly infected cell. Viruses travel vast distances after entering the circula-
tory system. Some viruses are only found in the blood vessels. Most viruses, on
the other hand, escape the vascular system and infect roots and young leaves far from
the original infection site. So, when a virus gets into a plant, it keeps multiplying at
the cell level and moving from one cell to another.
Plants defend themselves against viruses via a variety of mechanisms that target
viral nucleic acids or proteins. While gene silencing targets viral RNA and DNA,
autophagy and R-mediated innate immunity detect viral proteins. Antiviral defense,
with or without a hypersensitive reaction, inhibits viral RNA translation, replication,
movement, or virion assembly, resulting in virus buildup and/or movement delays
(Garcia-Ruiz 2018).
7.1.2 Virus Susceptibility Is Determined by Host Factors
At the cellular level, hosts possess components that are needed for all aspects of viral
reproduction. In plants, factors needed for local and systemic viral transport are
found. In the absence of necessary host components, this model predicts that viral
accumulation is decreased at the cellular and/or organism levels owing to ineffective
virus replication, mobility, or a combination of these factors. The final outcome is a
viral-resistant phenotype with decreased virus accumulation and mild symptoms in
comparison to susceptible plants, or no infection, comparable to a nonhost
phenotype. As a result, the existence of host components needed for viral infection
or transmission is a genetic determinant of virus susceptibility (McGee and Nichols
2016).
124 Z. Asad et al.
7.1.3 Alleles Associated with Host Susceptibility
The majority of plant diseases change the expression patterns of host genes in order
to benefit the pathogen directly. Disease susceptibility genes are reprogrammed
genes that help pathogens survive and reproduce. Disease susceptibility genes are
recessive resistance genes. Powdery mildew resistance was conferred through a
mutation in an Arabidopsis gene that produces pectate lyase (an enzyme involved
in cell wall breakdown). For example, Golovinomyces cichoracearum, the Barley
MLO gene, as well as its spontaneously changed pea and tomato MLO orthologs,
gives resistance to powdery mildew. In wheat, the Lr34 gene confers moderate
resistance to leaf and yellow rusts, as well as powdery mildew. Adenosine triphos-
phate (ATP)-binding cassette (ABC) transporter is encoded by Lr34. The disease-
resistant dominant allele was recently discovered in cultivated wheat (not wild
strains) and provides broad-spectrum resistance in barley, similar to MLO.
The eif4e and eif4g host translation elongation initiation factors have natural
alleles that provide virus resistance. Potyviruses have been used to manage barley,
rice, tomato, pepper, pea, lettuce, and melon. Following the finding, a successful
mutant screen for chemically induced eif4e alleles in tomato was carried out. The
development of recessive disease resistance alleles may be aided by natural promoter
variation. The rice recessive resistance gene xa13, for example, is an allele of
Os-8N3. Xanthomonas oryzae pv. oryzae strains expressing the TAL effector
PthXo1 activate Os-8N3 transcriptionally. The promoter of the xa13 gene contains
a mutant effector-binding region that prevents PthXo1-binding, making these lines
resistant to PthXo1-dependent strains. This discovery also proved that Os-8N3 is
necessary for susceptibility.
Pollen formation requires Xa13/Os-8N3, indicating that disease susceptibility
mutant alleles may be troublesome if their role in other processes is altered. Fusing
TAL effectors to nucleases, on the other hand, was used to make changes in the
Os11N3 (OsSWEET14) TAL effector-binding element (TALENs). Rice plants with
changed Os11N3-binding sites were resistant to Xanthomonas oryzae pv. Oryzae,
but nevertheless functioned normally throughout development (Garcia-Ruiz 2018).
7.1.4 Susceptibility Genes Have Many Different Types
A Warm Welcome to S Genes That Allow Basic Compatibility
Structure of the cuticle or cell wall
Stomata serve as entrance points
Immune Suppressor-Producing S Genes
Maintaining a healthy amount of salicylic acid
Sustenance for the Guests: Susceptible Genes Ensuring Sustained Compatibility
7 Identification of a New Susceptibility Gene and Its Role in Plant Immunity 125
7.1.5 A Warm Welcome to S Genes That Allow Basic Compatibility
Bacterial pathogens penetrate into apoplast through stomata via wounds, where they
often establish type III and type IV secretion systems for effector injections. Fungus
and oomycetes produce spores, which germinate and produce runner’s hyphae
which also enter the recipient via natural apertures or force entrance through cell
walls utilizing appressoria. After that, a haustorium may be built for nutrition and
effector transfer. Plant genes determine if a compatible relationship can be formed in
the new infection phases, from the synthesis of attractants through the formation of
structural components to produce a feeding site (van Schie and Takken 2014).
7.1.6 Structure of the Cuticle or Cell Wall
The cuticle, a sticky layer covering the leaf surface, is made up of cutin, waxes,
polysaccharides, and lesser chemicals like flavonoids. Glossy11, a corn mutant,
reduced very long-chain aldehyde content in leaf cuticles, leading to poor PM
spore germination. Decreased differentiation of fungus rust and anthracnose
parasites (Puccinia emaculata, Colletotrichum trifolii, and Phakopsora pachyrhizi)
was observed in a Medicago mutant, irg1, with lower levels of primary alcohols in
the surface wax. Because of decreased sensitivity to Phytophthora palmivora due to
disrupted appressoria development, another Medicago mutant, ram2, exhibits
changed cutin composition due to impaired glycerol-3-phosphate acyltransferase
activity. These examples show that filamentous pathogens utilize components in the
leaf cuticle as important developmental signals for pathogenicity. S genes are plant
genes/enzymes that are involved in the production of such compounds and contrib-
ute to susceptibility (van Schie and Takken 2014).
7.1.7 Stomata Serve as Entrance Points
Bacterial pathogens can’t get through the cell wall or cuticle; therefore, they rely on
wounds or natural holes like stomata and hydathodes to get through the apoplast via
vasculature. Stomatal closure caused by infections is an essential basic defensive
mechanism, and pathogens aggressively oppose it. After the disease threat has
passed, plants must reopen their stomata to allow gas exchange. LecRK
(a receptor kinase) is a powerful inducer of pathogen-induced stomatal closure,
and RIN4, along with H+ ATPase AHA1, is required for stomatal reopening. As a
result, pathogen entry in loss-of-function mutants of their generating genes is
reduced, resulting in S genes (Underwood et al. 2007).
126 Z. Asad et al.
7.1.8 Immune Suppressor-Producing S Genes
Suppression of immune system by negative immune regulators has been reported by
various researchers. Negative immune regulators are known as susceptibility genes
because their activation promotes vulnerability (Schulze et al. 2012).
7.1.9 Maintaining a Healthy Amount of Salicylic Acid
Constitutive defense signaling is typified by high SA concentrations and
pathogenesis-related (PR) gene expression; mutations in SA defense suppressors
usually improve bio-trophic infection resistance. In contrast, such mutants frequently
exhibit stunted growth or, in certain cases, HR-like indications known as lesion
mimics. Catabolizing SA is one method to regulate SA signaling, and genes
involved in SA converting may play a role in vulnerability. The variety of enzymes
that convert SA demonstrates the importance of SA catabolism as a regulating
mechanism. Glucosylation, methylation, hydroxylation, and conjugation of SA to
amino acids are all possible. Recently, the Arabidopsis SA 3-hydroxylase (S3H),
which converts SA to 2, 3-DHBA, was identified. Pseudomonas’syringe sensitivity
was reduced in a s3h mutant, suggesting that SA hydroxylation plays a role in
susceptibility. Mutants, on the other hand, have accelerated aging. It’s unclear if S3H
simply helps to lower SA levels or whether 2, 3-DHBA itself has particular roles in
aging and defense. The majority of the other enzymes involved in SA conversion do
not have a substantial role in susceptibility. UGT76B1, a glucosyltransferase mutant,
exhibited increased SA levels and reduced sensitivity to bio-trophic infections,
which was surprising. However, instead of SA, its substrate seemed to be isoleusic
acid. Isoleusic acid has the potential to inhibit the SA pathway. While genes
involved in SA conjugation/conversion are susceptibility genes, their involvement
in susceptibility appears to be limited, and specialized roles of SA conjugates in
other processes are expected to be discovered.
7.1.10 Susceptible Genes Ensure Long-Term Compatibility
After a pathogen-host relationship has formed, microbes continue to employ the host
cell mechanism to complete their metabolism and structural requirements for multi-
plication and proliferation. The relationship between rice and bacterial blight
(Xanthomonas Oryza) found that 10 of the 30 R genes are inherited recessively in
a 560 van Schiel pattern. Furthermore, in almost 50% of the instances, viral
resistance is inherited recessively. In these settings, pathogens appear to rely heavily
on host susceptibility traits for a successful relationship. Surprisingly, the majority of
susceptibility genes found in these two types of interactions are members of the same
group of host genes that are required for long-term compatibility, as discussed earlier
in this section (van Schie and Takken 2014; Naik et al. 2019).
7 Identification of a New Susceptibility Gene and Its Role in Plant Immunity 127
7.2 Role of Susceptibility Gene in Plants
7.2.1 Host Susceptibility Gene (HIPP27) in Arabidopsis
The bases of its host plant are infected by sedentary crop cyst nematodes, which are
obligatory bio-trophic. The parasitism of nematodes is based on the modification of
root cells to produce a highly metabolic syncytium from which they obtain suste-
nance. The goal of this research was to find nematode susceptibility genes in
Arabidopsis thaliana and explain their function in Heterodera schachtii parasitism.
By selecting genes that were significantly upregulated in response to cyst nematode
infection, we discovered HIPP27 (HEAVY METAL-ASSOCIATED
ISOPRENYLATED PLANT PROTEIN) as a host susceptibility factor required
for beet cyst nematode infection and development. HIPP27 is a cytoplasmic protein
that is abundantly generated in leaves, immature roots, and nematode-induced
syncytia, according to a comprehensive expression study. In Arabidopsis hipp27
mutants, loss-of-function H. schachtii sensitivity was significantly reduced, and
abnormal starch buildup in syncytial and periderm plastids was detected. Our
findings show that HIPP27 is an Arabidopsis susceptibility gene whose loss of
function reduces plant sensitivity to cyst nematode infections without increasing
pest susceptibility or having a negative influence on plant phenotypic traits
(Radakovic et al. 2018).
7.2.2 The Jasmonate Response’s Impact on Plant Susceptibility
Plants use a variety of resistance mechanisms to protect themselves from insects and
diseases. Two triggered responses that defend plants against these invaders are the
jasmonate and salicylate signaling pathways. Understanding how plants integrate
their defenses against a variety of challenges, as well as the broad impact of multiple
resistance mechanisms, demands a knowledge of the species affected by each
response. The jasmonate response has been shown to defend plants against a variety
of insect herbivores; in this research, we looked at the function of the jasmonate
responses in susceptibility to eighth diseases with different ways of life in the labs as
well as in the field. According to recent biochemical concepts, the pathogen’s
lifestyle (necrotrophs vs. bio-trophic) should indicate whether the jasmonate
response is implicated in resistance. The vulnerability of wild-type (cv Castlemart,
which has no known genes for disease resistance) and jasmonate-deficient mutant
tomato (Lycopersicon esculentum) plants was compared (def1), as well as using
mutant rescue therapies. The jasmonate response decreased plant sensitivity to five
of the eight pathogens we studied, such as two bacteria (Pseudomonas syringe and
Xanthomonas campestris), two fungi (Fusarium oxysporum f. sp. lycopersici and
Verticillium dahliae), and an oomycete (Phytophthora infestans and Pseudomonas
syringae). Three fungal susceptibility was unchanged (Cladosporium fulvum,
Septoria lycopersici, and Oidium neolycopersici). Our findings suggest that the
jasmonate response protects Arabidopsis against a broad variety of infections
associated with various lifestyles, which contrasts with the growing picture of
illnesses on Arabidopsis. The fact that tomato jasmonate-based resistance is ubiqui-
tous calls into question the notion that ecologically unique plant parasites are fought
through various mechanisms (Thaler et al. 2004).
128 Z. Asad et al.
7.2.3 The Function and Control of Programmed Cell Death
in Plant–Pathogen Interactions
To control their recipients, animal diseases often target and inhibit elements of the
programmed cell death (p.cd) pathway. Plant pathogens, on the other hand, often
cause p cd. The crop surveillance system has learnt to identify microbe molecules in
order to initiate a defense reaction in situations when plant p.cd is associated with
disease resistance, a phenomenon known as the hypersensitivity reaction. These
released compounds function as virulence factors in plants without hereditary
disease resistance, acting via mostly unknown processes. According to recent
research, various proteins are secreted by plants and pathogenic bacteria to enhance
their pathogenicity. Several fungal infections, on the other hand, produce
pcd-promoting compounds that are important virulence factors. In this study, we
review recent progress in understanding the function and management of plant p.cd
responses in both resistant and susceptible interactions. We also go through how far
we’ve come in figuring out how plant p.cd happens during these various interactions
(Greenberg and Yao 2004).
7.2.4 Targeting Susceptibility with Genome Editing Plant Disease
Resistance Genes
Plant diseases are a serious danger to agricultural yields. Phyto-pathogenic insects
often use the susceptibility (S) genes of plants to aid their spread. Trying to disrupt
particular susceptibility genes may disrupt the compatibility of the host and
infections, resulting in wide-ranging and long-lasting disease resistance. In the
past, disease resistance has been conferred through genetic modification of such
susceptibility genes in a variety of industrially useful crops. Recent genome editing
approaches, such as clustered regularly interspaced palindromic repeats (CRIPR),
have been applied in recent studies to accomplish this task in a transgene-free
environment (CRISPR). In this opinion piece, we look at how genome editing
may be used to target S genes in order to create transgene-free, disease-resistant
crop types (Zaidi et al. 2018; Peng et al. 2017).
7.3 Identification of Susceptible Gene
There are following approaches for the identification of the susceptibility gene.
7 Identification of a New Susceptibility Gene and Its Role in Plant Immunity 129
7.3.1 Identification of Susceptibility Gene for Antibiotic Sensitivity
Antibiotic sensitivity analysis, also known as antimicrobial susceptibility testing, is a
procedure for determining whether or not an antibiotic is effective. Antibiotic
susceptibility testing is a method of determining how susceptible bacteria are to
antibiotics. It’s true. This method is employed because certain antibiotics may be
resistant to germs. The findings of susceptibility testing may enable a physician to
alter their treatment plan. Antibiotics from empiric treatment, which is when an
antibiotic is given without a prescription, are chosen based on medical suspicions
regarding the infection’s source and common causative microorganisms, to directed
treatment, in which the decision is made by the patient. Antibiotics are chosen
depending on information about the organism and its environmental sensitivities.
Sensitivity testing is typically done at a medical laboratory, although it may also be
done at home. Based on bacteria being exposed to antibiotics during cultivation, or
genetic techniques for determining whether or not bacteria contain genes that give
resistance, measuring the diameter of regions is a common part of cultural
techniques. Zones of inhibition, or areas lacking bacterial growth, surround paper.
Antibacterial discs on gelatin culture plates that have been incubated are equally
inoculated with bacteria. The lowest possible inhibitory density, which is the
minimum concentration of the antibiotic that blocks the bacterial growth, can be
expected from the size of the zone of inhibition. Antibiotic sensitivity testing has
happened since the identification of the beta-lactam drug penicillin. Initial
techniques were phenotypic and required culture or dilution. The Etest is a test
that you may take. Since the 1980s, antimicrobial strips have been introduced, as
have genetic techniques such as polymerase chain reaction. Since the early 2000s,
chain reaction (PCR) testing has become accessible. Improved research is continuing
on existing techniques by making them more efficient or accurate, as well as creating
new testing methods, such as microfluidics (Bauer et al. 1959).
Antibiotic sensitivity testing is usually done in a lab. Following the discovery of a
bacteria utilizing microbiological techniques, antibiotics are chosen during suscepti-
bility testing based on culture. Susceptibility testing involves exposing
microorganisms to several chemicals, medications and watching the response (phe-
notypic analysis), or particular antibiotics and monitoring the response tests of
genetics (genetic testing). The methods employed may be qualitative, quantitative,
or both. A result indicates whether or not resistance exists or use an inhibition
activity (MIC) as a guideline to define the antibiotic concentration at which a
bacterium is sensitive. Antibiotic outcomes may be influenced by almost a dozen
variables; sensitivity testing, which includes instrument failure, temperature, and
other variables like wetness, and the antibacterial agent’sefficacy. Controlling the
quality (QC) testing ensures that test findings are accurate; the CLSI (Clinical and
Laboratory Standards Institute) has recommendations (Bell 1975; Garrod and
Waterworth 1971).
130 Z. Asad et al.
7.3.2 Function of Susceptibility Gene
In plants, dominant resistance genes are commonly utilized to provide disease and
insect resistance. The resistance is based on recognizing a certain microbial molecu-
lar pattern. Nevertheless, these restricted genes are usually easily overcome. Disease
is caused by a mutually beneficial relationship between the plant and the pathogen.
As a result, changing the plant gene that is important for compatibility may produce a
much more widespread and long-lasting form of resistance. These susceptibility
(S) genes are discussed in this article, with an emphasis on the processes that lead to
the loss of compatible. We found three distinct sets of S genes that operate at various
phases of infection: initial pathogen establishment, host defense regulation, and
pathogen sustenance. Susceptibility genes now have the potential to be utilized in
resistance breeding, as shown by the many instances presented below. Because
susceptibility genes serve a purpose other than pathogenic compatibility, the adverse
effects produced by genetic mutation need a one-by-one evaluation of their utility for
application (van Schie and Takken 2014; Gloyn et al. 2009) (Figs. 7.1 and 7.2).
Fig. 7.1 Susceptibility genes that help the parasite recognize and (pre) infiltrate the host. Infection
proteins involved in the early phases of infection are shown, including pathogen cues and cuticle
and cell wall component production (top left), extra haustoria membrane formation (middle), which
involves vesicular trafficking and actin polymerization, and penetration defense (bottom). (upper
right inset) For bacterial entry, stomatal (re) opening genes are required. When these genes are
altered, susceptibility to adaptive pathogens is lost
7 Identification of a New Susceptibility Gene and Its Role in Plant Immunity 131
SWEET COPT
LOX3 TAL Cu
Cell wall Ribosome
UPA7 PMR5/6
NAK2
TOM
vRNA
CCS52
TAL
MYB3R4
PUX2
TAL
Metabolism Positive regulator
Endoreduplication
Fig. 7.2 Pathogen survival is affected by susceptibility genes. Plant proteins involved in cell
expansion and endoreduplication are shown, allowing for improved metabolism (left), metabolite
production (middle), metabolite transport (top right), and viral replication (bottom left) (right)
7.4 S Gene Is More Durable than R Gene
It’s impossible to forecast a new resistance-enhancing trait’s long-term survivability,
which is mostly dictated by the pathogen’sflexibility. However, a few practical
examples and the underlying difference between resistance based on the S gene and
resistance based on the R gene offer some guidance. Resistance is caused by the loss
of function of a pathogen-dependent host component, and S genes are recessively
inherited. Resistance is initiated when the R protein detects a pathogen-derived
avirulence determinant, which is dominantly inherited (typically an effector).
Other PRRs that identify PAMPS or DAMPs, or genes that encourage the creation
of defense chemicals and/or structural barriers for the pathogen to overcome R gene-
based resistance, can mediate dominant resistance. A simple point mutation in a
protein/effector identified by an NB-LRR or a PRR may be enough to elude
detection. Many effectors are recognized indirectly by NB-LRRs monitoring a
host target. In that case, an effector’s behavior toward the host target would have
to change, or it would have to disappear totally. Effectors are usually redundant;
dozens of effectors may be injected into a host, and effectors are frequently placed in
genomic sites prone to mutation and reshuffling (Wulff et al. 2009; Rep and Kistler
2010; Ravensdale et al. 2011). Resistance endurance can be predicted using patho-
gen evolutionary potential as well as the fitness penalty of losing the effector;
recognition of conserved effectors is likely to be more persistent (Leach et al. 2001;
McDonald and Linde 2002; Vogel et al. 2002). R genes placed into plants with
quantitative/partial resistance [quantitative trait loci (QTLs)] have been
demonstrated to be more persistent than R genes introduced into plants with no
quantitative/partial resistance [quantitative trait loci (QTLs)] (Barbary et al. 2013;
Brun et al. 2010; St. Clair 2010). Furthermore, it is envisaged that R-gene stacking
would be used to improve disease resistance durability (Wang et al. 2013;Kim et al.
2012; Vleeshouwers et al. 2011). To overcome S gene-based resistance rather than R
gene-based recognition, a pathogen must overcome a dependency on a host compo-
nent. Obligate biotrophs, in particular, are extremely dependent on a range of host
factors, including essential metabolites that they are unable to produce (Spanu et al.
2010). As a result, we anticipate that resistance based on the S gene will last longer
than resistance based on the R gene. The most well-known S gene that gives long-
term PM resistance is MLO. It’s been around for a long time, and no pathogen strains
that break resistance have been discovered in the field (Jorgensen 1992). Plants
carrying the recessive mlo gene appear to be more resistant to penetration, but they
are less likely to cooperate with membrane and cytoskeleton reorganization to form
haustoria for food exchange. The pathogen will not be able to simply bypass this
mechanistic/structural requirement. In terms of persistence, eIF4E-based resistance
against potyviruses is the most well-studied type of recessive resistance (S-gene
mutant). Pepper pvr1/2 was the first recessive potyvirus (Potato virus Y) resistance
found, and it’s been in use for more than 50 years (Moury and Verdin 2012; Cook
1961). Changes in the viral protein VPg have been found in potyvirus isolates that
have broken eIF4E-based resistance (Truniger and Aranda 2009; Ayme et al. 2006;
Moury et al. 2004; Masuta et al. 1999). A physical interaction between the virus’s
VPg and plant eIF4E is required for effective replication (Charron et al. 2008;
Wittmann et al. 1997). eIF4E (or G) resistance-breaking strains may regain mutant
eIF4-binding capacity, acquire new specificity for a different eIF4 isoform, or even
skip the eIF4-binding requirement entirely. In one study, the latter was
recommended (Gallois et al. 2010).Many studies on resistance-breaking viruses
have been conducted in laboratories, with virus evolution being driven or simulated,
but resistance-breaking strains have been rare in the field. In two cases, a viral
protein other than VPg was responsible for avoiding the necessity for eIF4E (Abdul-
Razzak et al. 2009; Chen et al. 2007). For a resistance based on a changed physical
interaction between VPg and a mutant eIF4E, with only a few or a few point
mutations, the resistance is surprisingly long-lasting. Because it is encoded by a
viral genome and has very short generation durations and very high mutation rates,
VPg has the capacity to adapt and change swiftly. However, the amount of changes
that can be made in VPg is likely to be limited. Surprisingly, there appears to be a
relationship between the persistence of eIF4E alleles and their resistance spectrum
(number of different potyviruses). According to Moury et al. (2014),the resistance
spectrum of novel eIF4E alleles can be utilized to predict durability. Furthermore, it
was discovered that when eIF4E was introgressed into a genetic background harbor-
ing partial resistance quantitative trait locus, its durability was significantly increased
(Palloix et al. 2009).
132 Z. Asad et al.
7 Identification of a New Susceptibility Gene and Its Role in Plant Immunity 133
defense
phenotype related
genetic
remains remains
symbionts?
S gene not
usable depends on
conditions
depends on
conditions
S gene
usable
S gene not
usable
No
apparent
phenotype
Test different
genetic
background
Fig. 7.3 A categorization scheme is used to identify the usability of a susceptibility (S) gene.
There’s recessive resistance, for starters (mutant with reduced susceptibility). Second, pleiotropic
effects should be considered (growth, yield, fertility, senescence, and abiotic stress tolerance). It’s
vital to see if a deleterious trait can be alleviated in a different genetic setting if it exists. Finally, the
plant’s response to illnesses associated with different lifestyles (bio-trophic vs. necrotrophic) should
be evaluated. Finally, because interactions with beneficial microbes such as rhizobia and mycor-
rhiza may be altered, plant performance should be examined in the field
As demonstrated by the MLO and eIF4E instances, pathogens that rely on host
factors for successful establishment or replication are at a stalemate in the evolution-
ary arms race. Either they’d have to go back in time and retrieve a lost function, or
they’d have to abandon that host and look for another. Because of this rationale, S
genes could be used as targets for resistance breeding; as with many promises that
appear to be too good to be true (Fig. 7.3).
134 Z. Asad et al.
References
Abdul-Razzak A, Guiraud T, Peypelut M, Walter J, Houvenaghel MC (2009) Involvement of the
cylindrical inclusion (CI) protein in the overcoming of an eIF4E-mediated resistance against
lettuce mosaic potyvirus. Mol Plant Pathol 10:109–113
Ayme V, Souche S, Caranta C, Jacquemond M, Chadoeuf J (2006) Different mutations in the
genome-linked protein VPg of potato virus Y confer virulence on the pvr23 resistance in pepper.
Mol Plant-Microbe Interact 19:557–563
Barbary A, Palloix A, Fazari A, Marteu N, Castagnone-Sereno P, Djian-Caporalino C (2013) The
plant genetic background affects the efficiency of the pepper major nematode resistance genes
Me1 and Me3. Theor Appl Genet 127:499–507
Bauer AW, Perry DM, Kirby WM (1959) Single-disk antibiotic-sensitivity testing of staphylococci:
an analysis of technique and results. AMA Arch Intern Med 104:208–216
Bell SM (1975) The CDS disc method of antibiotic sensitivity testing (calibrated dichotomous
sensitivity test). Pathology 7:1–48
Brun H, Chèvre AM, Fitt BD, Powers S, Besnard AL, Ermel M, Andrivon D (2010) Quantitative
resistance increases the durability of qualitative resistance to Leptosphaeria maculans in Bras-
sica napus. New Phytol 185(1):285–299
Charron C, Nicolai M, Gallois JL, Robaglia C, Moury B et al (2008) Natural variation and
functional analyses provide evidence for co-evolution between plant eIF4E and potyviral
VPg. Plant J 54:56–68
Chen B, Jiang JH, Zhou XP (2007) A TOM1 homologue is required for multiplication of tobacco
mosaic virus in Nicotiana benthamiana. J Zhejiang Univ Sci B 8:256–259
Cook AA (1961) A mutation for resistance to potato virus Y in pepper. Phytopathology 51:550–552
Eckardt NA (2002) Plant disease susceptibility genes. Plant Cell 14:1983–1986
Gallois JL, Charron C, Sanchez F, Pagny G, Houvenaghel MC (2010) Single amino acid changes in
the turnip mosaic virus viral genome-linked protein (VPg) confer virulence towards Arabidopsis
thaliana mutants knocked out for eukaryotic initiation factors eIF(iso)4E and eIF(iso)4G. J Gen
Virol 91:288–293
Garcia-Ruiz H (2018) Susceptibility genes to plant viruses. Viruses 10:484
Garrod LP, Waterworth PM (1971) A study of antibiotic sensitivity testing with proposals for
simple uniform methods. J Clin Pathol 24:779–789
Gloyn AL, Braun M, Rorsman P (2009) Type 2 diabetes susceptibility gene TCF7L2 and its role in
β-cell function. Diabetes 58:800–802
Greenberg JT, Yao N (2004) The role and regulation of programmed cell death in plant–pathogen
interactions. Cell Microbiol 6:201–211
Jorgensen JH (1992) Discovery, characterization and exploitation of Mlo powdery mildew resis-
tance in barley. Euphytica 63:141–152
Kim HJ, Lee HR, Jo KR, Mortazavian SM, Huigen DJ, Evenhuis B, Vossen JH (2012) Broad
spectrum late blight resistance in potato differential set plants MaR8 and MaR9 is conferred by
multiple stacked R genes. Theor Appl Genet 124:923–935
Kwiatkowski D (2000) Susceptibility to infection. BMJ 321:1061–1065
Leach JE, Vera Cruz CM, Bai J, Leung H (2001) Pathogen fitness penalty as a predictor of
durability of disease resistance genes. Annu Rev Phytopathol 39:187–224
Masuta C, Nishimura M, Morishita H, Hataya T (1999) A single amino acid change in viral
genome- associated protein of potato virus y correlates with resistance breaking in “virgin a
mutant”tobacco. Phytopathology 89:118–123
McCarthy MI (2004) Progress in defining the molecular basis of type 2 diabetes mellitus through
susceptibility-gene identification. Hum Mol Genet 13:33–41
McDonald BA, Linde C (2002) Pathogen population genetics, evolutionary potential, and durable
resistance. Annu Rev Phytopathol 40:349–379
McGee RB, Nichols KE (2016) Introduction to cancer genetic susceptibility syndromes. In:
Hematology 2014, the American Society of Hematology Education Program Book, pp 293–301
7 Identification of a New Susceptibility Gene and Its Role in Plant Immunity 135
Moury B, Verdin E (2012) Viruses of pepper crops in the Mediterranean basin: a remarkable stasis.
Adv Virus Res 84:127–162
Moury B, Morel C, Johansen E, Guilbaud L, Souche S et al (2004) Mutations in potato virus Y
genome- linked protein determine virulence toward recessive resistances in Capsicum annuum
and Lycopersicon hirsutum. Mol Plant-Microbe Interact 17:322–329
Moury B, Charron C, Janzac B, Simon V, Gallois JL (2014) Evolution of plant eukaryotic initiation
factor 4E (eIF4E) and potyvirus genome-linked viral protein (VPg): a game of mirrors impacting
resistance spectrum and durability. Infect Genet Evol 27:472–480
Naik K, Mishra S, Srichandan H, Singh PK, Sarangi PK (2019) Plant growth promoting microbes:
potential link to sustainable agriculture and environment. Biocatal Agric Biotechnol 21:1878–
8181
Palloix A, Ayme V, Moury B (2009) Durability of plant major resistance genes to pathogens
depends on the genetic background, experimental evidence and consequences for breeding
strategies. New Phytol 183:190–199
Peng A, Chen S, Lei T, Xu L, He Y, Wu L, Zou X (2017) Engineering canker-resistant plants
through CRISPR/Cas9-targeted editing of the susceptibility gene Cs LOB 1 promoter in citrus.
Plant Biotechnol J 15:1509–1519
Radakovic ZS, Anjam MS, Escobar E, Chopra D, Cabrera J, Silva AC, Siddique S (2018)
Arabidopsis HIPP27 is a host susceptibility gene for the beet cyst nematode Heterodera
schachtii. Mol Plant Pathol 19:1917–1928
Ravensdale M, Nemri A, Thrall PH, Ellis JG, Dodds PN (2011) Co-evolutionary interactions
between host resistance and pathogen effector genes in flax rust disease. Mol Plant Pathol 12:
93–10
Rep M, Kistler HC (2010) The genomic organization of plant pathogenicity in Fusarium species.
Curr Opin Plant Biol 13:420–426
Schulze S, Kay S, Büttner D, Egler M, Eschen-Lippold L, Hause G, Bonas U (2012) Analysis of
new type III effectors from Xanthomonas uncovers XopB and XopS as suppressors of plant
immunity. New Phytol 195:894–911
Spanu PD, Abbott JC, Amselem J, Burgis TA, Soanes DM, Stuber K, van Themaat EVL, Brown
JKM, Butcher SA, Gurr SJ et al (2010) Genome expansion and gene loss in powdery mildew
fungi reveal tradeoffs in extreme parasitism. Science 330:1543–1546
St. Clair DA (2010) Quantitative disease resistance and quantitative resistance loci in breeding.
Annu Rev Phytopathol 48:247–268
Thaler JS, Owen B, Higgins VJ (2004) The role of the jasmonate response in plant susceptibility to
diverse pathogens with a range of lifestyles. Plant Physiol 135:530–538
Truniger V, Aranda MA (2009) Recessive resistance to plant viruses. Adv Virus Res 75:119–159
Underwood W, Melotto M, He SY (2007) Role of plant stomata in bacterial invasion. Cell
Microbiol 9:1621–1629
van Schie CC, Takken FL (2014) Susceptibility genes 101: how to be a good host. Annu Rev
Phytopathol 52:551–581
Vleeshouwers VG, Raffaele S, Vossen JH, Champouret N, Oliva R, Segretin ME, Kamoun S
(2011) Understanding and exploiting late blight resistance in the age of effectors. Annu Rev
Phytopathol 49:507–531
Vogel JP, Raab TK, Schiff C, Somerville SC (2002) PMR6, a pectate lyase-like gene required for
powdery mildew susceptibility in Arabidopsis. Plant Cell 14:2095–2106
136 Z. Asad et al.
Wang Y, Dang F, Liu Z, Wang X, Eulgem T, Lai Y, He S (2013) CaWRKY58, encoding a group I
WRKY transcription factor of Capsicum annuum, negatively regulates resistance to Ralstonia
solanacearum infection. Mol Plant Pathol 14:131–144
Wittmann S, Chatel H, Fortin MG, Laliberte JF (1997) Interaction of the viral protein genome
linked of turnip mosaic potyvirus with the translational eukaryotic initiation factor (iso) 4E of
Arabidopsis thaliana using the yeast two-hybrid system. Virology 234:84–92
Wulff BB, Chakrabarti A, Jones DA (2009) Recognitional specificity and evolution in the tomato–
Cladosporium fulvum pathosystem. Mol. Plant Microbe Interact 22:1191–1202
Zaidi SSEA, Mukhtar MS, Mansoor S (2018) Genome editing: targeting susceptibility genes for
plant disease resistance. Trends Biotechnol 36(9):898–906
137
Breeding Strategies for Developing
Disease-Resistant Wheat: Present, Past,
and Future
8
Anuj Choudhary, Antul Kumar, Harmanjot Kaur, Vimal Pandey,
Baljinder Singh, and Sahil Mehta
Abstract
Since its origin in Southeast Turkey, wheat (Triticum aestivum L. AABBDD;
Family Poaceae) has been a prime dietary cultivated cereal that is consumed
worldwide by nearly 20% of the world population. However, there are a wide
plethora of biological variables that seriously threaten production around the
world. Among the biological stresses, phytopathogens are considered the most
serious threat to yield. This can be further elaborated by the fact that since the
nineteenth century, more than 30 diseases have been reported to have had a
drastic impact as epidemics, including karnal bunt, smut, mildew, blight, rust, etc.
So far, in response, various landraces and several wild-related genera (such as
Thinopyrum,Triticum,Hordeum,Aegilopsis,Elymus, and Leymus) represent the
different gene pools that have been utilized in developing disease-resistant
varieties. With the emergence of advanced molecular markers, whole genome
sequences, and new genomic approaches, there are multiple ways and tools for
researchers to enhance durability and wide-range disease resistance in a short
period. The present documentation of trait introgression offers an effective option
to narrow down the cost of unsustainable fungicides. Therefore, the current
A. Choudhary · A. Kumar · H. Kaur
Department of Botany, Punjab Agricultural University, Ludhiana, India
V. Pandey
Department of Botany, Kalinga Institute of Social Sciences, Bhubaneswar, Odisha, India
B. Singh
National Institute of Plant Genome Research, New Delhi, India
S. Mehta (*)
School of Agricultural Sciences, K.R. Mangalam University, Gurugram, Haryana, India
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_8
chapter is an attempt to incorporate various successful reports regarding the
development of more resistant wheat cultivars using new breeding strategies.
138 A. Choudhary et al.
Keywords
Wheat · Diseases · Productivity · Fusarium · Spot blotch · Lr9 gene
Abbreviations
AgRenSeq Associated genetics R gene enrichment sequencing
Cas9 CRISPR-associated protein 9
CRISPR Clustered regularly interspaced palindromic repeats
dsRNA Double-stranded RNA
EMS Ethyl methanesulfonate
FHB Fusarium head blight
GE Genome editing
GWAS Genome-wide association sequences
LRR Leucine-rich repeat proteins
MAPK Mitogen-activated protein kinase
miRNA MicroRNA
MNs Meganucleases
MutChromSeq Mutant chromosome sequencing
NBS Nucleotide-binding site
NLR Nucleotide-binding and leucine-rich repeat
PGT Puccinia graminis f. sp. tritici
PST Puccinia striiformis f. sp. tritici
PT Puccinia triticina
QTL Quantitative trait locus
R gene Resistance gene
siRNA Small interfering RNAs
SSNs Sequence-specific nucleases
TACCA Targeted chromosome-based cloning via long-range assembly
TAL Transcription-activator-like
TALENs Transcription activator-like effector nucleases
ZFNs Zinc-finger nucleases
8.1 Introduction
With the doubling of the human population, the past decade has witnessed signifi-
cant growth in cereal production, resulting in a remarkable reduction in global food
hunger (FAO STAT 2018; Liu et al. 2018; Grote et al. 2021; Jiang et al. 2020; Liu
et al. 2021; Li et al. 2020a,b,c; Singh et al. 2021a). Despite no exaggeration, the
level of global poverty is currently lower than any recorded in modern times.
Nonetheless, the goal of “zero hunger”is not achieved and requires significantly
increased efforts (Mujeeb-Kazi et al. 2019; Shakeel et al. 2021; Singh et al. 2021b).
However, more than one in seven individuals did not fulfill the prerequisite of a
complete diet, and a higher number experienced different forms of malnutrition.
However, demand for food surges exponentially, causing the continuous rise in
population. As a result, qualitative and quantitative food production must be done in
a remarkable two-fold manner that is both socially and environmentally sustainable
(Hickey et al. 2019). The average grain production has increased from 1.35 tons/
hectare (1961) to 3.35 tons/hectare (2007) and is expected to reach 4.8 tons/hectare
by 2040. Recently, the agriculture area has been shrinking, with overarching issues
like a serious threat of climate change, posing issues of how adaptation and mitiga-
tion mechanisms may impact food supply (Singh et al. 2022; Choudhary et al.
2022; FAO STAT 2018; Liu et al. 2018; Hickey et al. 2019; Kumar et al. 2021a;
Paul et al. 2021).
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 139
Certain wheat diseases prominently contribute to losses by pathogens including
viruses, bacteria, and fungi responsible for blight, scab, rust, smut, blotches, and
blast diseases (Kumar et al. 2022a). Better management of fungal diseases is the
need of the hour, which results in a 15–20% yield loss of wheat per year. Rust fungi
are obligate biotrophic organisms that belong to the family Basidiomycete, which
means they are dependent on the living cells of plants for growth and reproduction.
Stem, stripe, and leaf rust are mainly three types of wheat rust diseases. Although the
causative agent of black rust disease (wheat stem rust), Puccinia graminis sp. tritici,
is widely distributed throughout the world, it is uncommon in comparison to other
rust diseases. Although rust diseases are controlled in yield in most parts of the
world, there are still global losses estimated at about 6.2 million metric tons per year
(Pardey et al. 2013; Figueroa et al. 2018; Kumar et al. 2021b). There is a reduction in
grain size along with the lodging of plants due to rust diseases (Miedaner and
Juroszek 2021). Thus, the emergence of recent fascinating approaches, including
clustered regularly interspaced palindromic repeats (CRISPR), CRISPR-associated
protein 9 (Cas9), genome-wide association sequences (GWAS), transcription
activator-like effector nucleases (TALENs), transcription-activator-like (TAL),
Meganucleases (MNs), and zinc-finger nucleases (ZFNs), etc., helps to overcome
the biotic and abiotic challenges in wheat (Mehta et al. 2020; Dilawari et al. 2021;
Chattopadhyay et al. 2022; Schenke and Cai 2020; Razzaq et al. 2021). The
understanding of plant–pathogen interaction and the advancement of new
approaches or molecular techniques including speed breeding, genome editing,
CRISPR/Cas9 (Cluster Regularly interspaced Palindromic Sequences/CRISPR-
associated protein 9), RNA interface (RNAi) Silencing, etc. are being harnessed
for gene editing or alteration of traits (Chattopadhyay et al. 2022; Schenke and Cai
2020; Paul et al. 2021; Zhang et al. 2017a,b; Kis et al. 2019; Verma et al. 2021).
Presently, conventional breeding approaches help to manage disease-free, highly
productive, nutritious, and safe crops. It also includes interspecific hybridization,
pure line selection, backcross, and pedigree methods (Kaiser et al. 2020).
140 A. Choudhary et al.
In the present document, we highlight the significant role of emerging breeding
techniques in the introgression of the novel resistance gene. We see advanced
breeding strategies as an affordable and efficient way forward to overcome the
consequences of climate change through the development of new resilient varieties.
There are many strategies like integrated or multidisciplinary includes in agronomy
pathology, seed production, pathology, postharvest methods, and extension (Raffan
et al. 2021; Li et al. 2018,2020a,b).
8.2 Disease’s Epidemics and Their Impact on Productivity
Wheat is the most essential staple crop that impregnates the human diet with protein
and calories (Rasool et al. 2021; Kumar et al. 2021b). The genetic diversity in the
wheat gene pool has been statistically increased, offering the most promising
possibilities to combat pathogen emergence meant to reduce the threat of diseases
to global wheat production (Kumar et al. 2022b). The preliminary step has been
integrated with traditional as well as advanced breeding tools to repair signaling
loops that effectively combat a variety of pathogens.
Rust pathogens have a long history dating back to the domestication of crops.
They have a good image in the hindrance of global wheat production. The global
losses due to wheat rust pathogens are estimated in the range of 4.3–5 billion US
dollars annually (Pardey et al. 2013; Tehseen et al. 2021). These are the obligatory
biotrophic pathogens that have completed their life cycle for nutritional resources
(Różewicz et al. 2021). Globally, there are three well-known rust diseases of wheat
caused by genus Puccinia (belongs to family Basidiomycetes), stem rust caused by
Puccinia graminis sp. tritici (PGT), stripe rust caused by Puccinia striiformis
sp. tritici (PST), and leaf rust caused by Puccinia triticina (PT) (Różewicz et al.
2021). Wheat stem or black rust usually prevails in moist and warm conditions and
materializes as red brick urediniospores on the stem, sheath, leaf, awns, and glumes
of susceptible cultivars (Kolmer 2005; Gupta et al. 2017). However, Leonard and
Szabo (2005) reported that the yield losses are due to the lodging of plants and grain
size reduction in the infected cultivars. Stem rust epidemics have historically
affected all major wheat-producing regions, and disease control was one of the
major milestones in the development of stem rust-resistant high-yielding wheat
cultivars during the green revolution (Figueroa et al. 2016).
According to forecasting models, the average loss is 6.2 million metric tons
annually during serious epidemics in the absence of durable, resistant varieties
(Pardey et al. 2013). The emergence of a new PGT population poses a threat on a
global scale, such as the Ug99 race in Uganda (1998), which expanded within
Africa, towards the Middle East, and was reported as Ug99 variants, showing the
immense threat to the wheat crop (Pretorius et al. 2000; Singh et al. 2015). It has
been estimated that about 90% of wheat varieties are prone to the Ug99 attack (Singh
et al. 2011). The ‘Digalu’race became an epidemic in 2014 in Ethiopia and was also
observed in Germany (Olivera Firpo et al. 2015,2017). Similarly, a “broadly”
disease race was reported as the Sicily wheat outbreak in 2016 (Bhattacharya
2017). Subsequently, it was reported in Bangladesh in Asia and Zambia in Africa.
Researchers have warned that there may be a possible expansion of disease to other
continents as well (Tembo et al. 2020).
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 141
Wheat stripe or yellow rust is prevailing in the cool and wet conditions of
temperate regions (Chen et al. 2014; Jamil et al. 2020). PGT is efficiently declining
the wheat yield by affecting nearly 100% of the susceptible cultivars. It has been
targeting 88% of the wheat varieties globally and losing 1 billion US dollars per year
(Wellings 2011; Beddow et al. 2015). Moreover, Murray and Brennan (2009)
reported 127 million AU dollar losses from stripe rust in Australia. In the last
50 years, PST has affected nearly 60 countries (Beddow et al. 2015). Since 2000,
PST virulence races have been spread to the non-affected regions of the world by
adapting to the higher temperatures of climates (Ali et al. 2014). The clonal
distribution of PST in Australia, North America, and Europe showed a significant
level of genetic diversity in the populations of pathogens (Chen et al. 2014). The
variants were also found in Central Asia and Western China, as well as the
Himalayas and their surrounding areas (Ali et al. 2014). Other race groups that
originated in the Himalayan regions (Hovmøller et al. 2015) also appeared and
spread in 2011, 2012/2013, and 2015 throughout Europe. Recent studies regarding
P. striiformis concluded that most of the recombinant population structure and the
highest levels of genetic diversity come from the Himalayan and its nearby regions,
which shows that this may be the area of its center of origin and diversity (Sheikh
et al. 2021).
Leaf rust is a well-known, common, and more widely distributed condition with a
prevalence in moist and mild temperature conditions (Bolton et al. 2008). The yield
losses are associated with the reduction in grains per head and the kernel weight.
About 350 million US dollars in losses have been estimated from the period of 2000
to 2004 in America (Huerta-Espino et al. 2011). There were total losses estimated to
be 12 million AU in Australia (Murray and Brennan 2009). The upper hand of the
leaf rust is due to high diversity in the pathogen population and emerged strains
showing wider adaptability too in a wide climatic range (Huerta-Espino et al. 2011;
McCallum et al. 2016).
Blotch diseases including Septoria nodorum, blotch tan spot, and Septoria tritici
blotch are caused by the Pyrenophora tritici-repentis,Parastagonospora nodorum,
and Zymoseptoria tritici, respectively. Septoria tritici blotch is the leaf disease of
wheat flourishing in the temperate regions. It is causing a primary threat to the wheat
yield at the cost of 280–1200 EU €annually in Europe (Fones and Gurr 2015). This
disease is causing 20 million AU$ losses in Australia, annually (Murray and
Brennan 2009). Tan spot disease is found in most wheat-growing regions such as
North America, Australia, and Europe. The yield losses are due to reducing the
grains per head and kernel weight (Shabeer and Bockus 1988). The yield losses are
200 million AU$ in Australia due to this disease annually (Murray and Brennan
2009).
Interestingly, Septoria nodorum blotch was fully replacing the Septoria tritici
blotch in the UK in the 1980s. The disease has been reported to be prevalent in
France and Scandinavian countries. The disease has a high prevalence in Australia,
causing 100 million AU$ annually (Murray and Brennan 2009). There are three
resistant alleles of tan spot disease investigated from germplasm present on
chromosomes 3AS, 3AL, 3BS, and 6AL along with genes tsn1 and tsc2 (Simón
et al. 2021; Kokhmetova et al. 2021).
142 A. Choudhary et al.
Fusarium head blight, or scab disease, or ear blight, or wheat scab, is caused by
Fusarium graminearum (belongs to Ascomycetes). The pathogen is causing prema-
ture senescence of wheat heads and, in combination with other Fusarium species, is
inducing severe epidemics (Brown and Proctor 2013). The disease onset rate is every
fourth to fifth year in the USA, EU, UK, Brazil, Africa, and China. Hence, the
disease is of prime concern and most hazardous. The yield losses in the USA were
3 billion US dollars between 1990 and 2008 due to fusarium head blight (Schumann
and D’Arcy 2009). During the anthesis stage, the disease is infecting the wheat crop
under the prevailing rain conditions. Grain quality, grain yield, and aggregation of
type B toxin deoxynivalenol (sesquiterpenoid trichothecene mycotoxin) reduce the
overall harvest of crop production and market value. The toxin poses a health risk to
humans, animals, and natural ecosystems. The legal limit has been set for the
permitted level of mycotoxins. For instance, permitted levels are 1250–2000 ppb
in the EU and 200–1000 ppb for the finished product in the USA (http://scabusa.
org). In North America, the Fg strain has been reported to produce two novel types,
NX-2 and NX-3 (trichothecene mycotoxins) (Varga et al. 2015).
Bipolaris sorokiniana causes spot blotch to have foliar and root damage. The
disease has a major impact and is reported in the eastern Gigantic plains, specifically
in India, Nepal, and Bangladesh (Duveiller and Sharma 2009). Significant losses
have been observed in South America under warm and humid climatic conditions
(Duveiller and Sharma 2012). Magnaporthe oryzae is another Triticum pathotype
causing wheat blast and recognized by head disease. The symptoms have appeared
as elliptical lesions to entire bleaching as well as empty spikes (Igarashi et al. 1986).
Warm (25 C) and humid (10-h wetting period) conditions are the prerequisites for
the development of wheat blasts (Cardoso et al. 2008). It was first observed in the
Paranástate of Brazil in 1985, followed by dissemination to Paraguay, Bolivia, and
Argentina (Igarashi et al. 1986). Previously, these pathogens were restricted to
regions of South America. However, they were discovered in 2016 in Bangladesh
and followed by India (Islam et al. 2016; Bhattacharya 2017).
8.3 Genepools Contribution in Disease Management
Race-specific resistance or qualitative or seedling resistance is conferring the
150 genes for rust resistance reported in local wheat varieties or their wild cousins.
Almost 50 genes are nominated for stem rust resistance genes against the reactions of
PGT. Sr31 is widely known for race-specific resistance against the PGT (Singh et al.
2004). However, Sr31 also led to the emergence of Ug99; besides this, resistance
due to Sr38,Sr36,Sr24,Sr21, and SrTmp has also been conquered by Digalu and
Ug99 races (Jin et al. 2008; Pretorius et al. 2010; Olivera Firpo et al. 2015).
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 143
Fig. 8.1 Illustration showing overview on major fungal diseases in wheat and associated genes/
QTLs for imparting resistance
Sr50,Sr45,Sr35,Sr33,Sr25,Sr23, and Sr2 are the most important genes against
the recently emerged races (Singh et al. 2015). Over 70 genes are nominated against
the yellow rust disease rust diseases (Jamil et al. 2020). Dakouri et al. (2013) studied
about 68 genes including the most common Lr20,Lr10,Lr3, and Lr1 widely used
against the leaf rust in global wheat cultivars. Similarly, Lr22,Lr21,Lr10,Lr1,Sr50,
Sr45,Sr35,Sr33,Sr22, and Yr10 are the 10 race-specific genes of wheat encoding
the nucleotide-binding site (NBS) leucine-rich repeat (LRR) proteins (Mago et al.
2015; Thind et al. 2017) (Fig. 8.1). Therefore, the resistance is conferred by the
indirect or direct recognition of alike Avr factors.
More than 24 major genes have been addressed against the resistance of Septoria
tritici blotch (Brown et al. 2015). One hundred and sixty seven genomic regions are
anchoring the quantitative trait loci (QTL) providing genetic resistance against the
Zymoseptoria tritici. The phenotyping study has been displaying the role of QTLs
against the sporulation, latency, and necrosis of different disease progression stages.
Against the Fusarium head blight, a few moderately resistant sources such as
Fontana from Brazil and Sumai-3 from China have been recognized. Several major
and minor QTLs have conferred the resistance to Fusarium head blight linked with
yield penalty or fitness cost (Gilbert and Haber 2013). More precisely, two of the
commercially important types of resistances, viz., Type I and type II, are considered
such as resistance to initial infection and resistance to spreading of Fusarium head
blight inside the host (Cuthbert et al. 2006).
144 A. Choudhary et al.
The resistance to spot blotch and Helminthosporium leaf blight is quantitatively
conquered in wheat (Singh et al. 2016). Wheat germplasm from China, Zambia, and
Brazil has resistance to both diseases including synthetic hexaploids, wide cross
derivatives, and Chinese materials. Association mapping and QTL are displaying the
involvement of several genes for resistance (Singh et al. 2016). Several genes such as
Rmg8,Rmg7,Rmg3, and Rmg2 might show promising results, but required field
confirmations for effective controls (Ahn et al. 2015).
Adult plant resistance or non-race-specific has conferred the resistance against the
rusts in wheat (Periyannan et al. 2017). Several genes such as Lr68,Lr67,Lr46,
Lr34,Sr2, and Yr36 are potential members in resistance (Ellis et al. 2014). Among
them, Yr36,Lr67, and Lr34 encode for cytoplasmic protein kinase, hexose trans-
porter, and ATP-binding cassette transporter, respectively, which are directly
involved in facilitating resistance (Fu et al. 2009; Dodds and Lagudah 2016).
8.4 New Breeding Tools to Attain Higher Disease Resistance
8.4.1 Pathogen-Resistant Germplasm
The adoption of monoculture and high-yield crops has been reducing the diversity
positioning and crop genetic diversity in modern crops at a high risk of disease
epidemics. The wild, landraces, or progenitor species are excellent sources of
Rgenes for effective pathogen control against the dominant pathogen races. Several
Rgenes have been introgressed successfully from the wild progenitor or landraces/
local varieties. For instance, Fhb7 (Fusarium head blight) has been introgressed from
the wild relatives of wheat to confer resistance against the Fhb (Wang et al. 2020).
Hence, the wild relatives and landraces are favorable mines for mining the new R
genes for the improvement of modern wheat cultivars (Dwivedi et al. 2016). The
identification of R genes requires efficient field trials for resistance evaluation for
utilization in breeding programs. Natural nursery-based selection should be set up
for pandemic pathogens in the diverse screening of highly resistant germplasm.
Under high selection pressure in natural nurseries, plants are under a mixed and
continuous type of infection in all growth stages.
Therefore, exclusive plasma member-anchored pattern recognition receptors (for
pathogen triggered immunity) and nucleotide-binding leucine-rich repeat proteins
(for effectors triggered immunity) will be identified to confer the broad-spectrum
resistance. A study was conducted in the Huang Huai-Hai region of china where
146 wheat entries were inoculated with races of PST, FHB, and BGT. Yr15,Yr18,
Pm21, and Fhb1 are recommended for breeding programs in combination with other
effective genes for broad-spectrum and durable resistance, whereas Yr10,Yr9,Yr26,
and Yr17 were ineffective against the PST races (Ma et al. 2021).
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 145
8.4.2 Identifying New R Genes Using High-Throughput Genomic
Approaches
Recent advances in genomic sequencing and bioinformatics have accelerated
approaches to improving R gene cloning. Sequencing-based mapping is regarded
as a potential tool in the mapping and cloning of R genes in plants (Wulff and
Moscou 2014; Mascher et al. 2014). With the aid of a GWAS, the genetic architec-
ture of many economically important crops, including wheat, has been studied with
the aid of a GWAS (Huang et al. 2010; Li et al. 2019; Lin et al. 2020). Kumar et al.
(2020) have been conducting the GWAS on spring wheat panels for leaf rust, stem
rust, and stripe rust. A total of 16, 18, and 27 QTLs have been discovered for
resistance against stripe rust, leaf rust, and stem rust, respectively. In seedling and
adult plant responses, a number of these regions were annotated with ABC trans-
porter protein, E3ubiquitin-protein ligase, and NB-LRR. According to Jupe et al.
(2013), resistance gene enrichment gene sequencing is another powerful tool to
identify newly NLR-like genes from landraces or wild species.
Steuernagel et al. (2016) demonstrated that MutRenSeq (combined approaches of
EMS and RenSeq mutagenesis) is used to identify NLR genes and used in isolating
Sr22 and Sr45 (stem rust-resistance genes) in wheat. Thind et al. (2017) also
investigated how the TACCA method was used to isolate Lr22a (R gene) from
wheat polyploidy genomes. MutChromSeq (a combined technique of high-
throughput sequencing, chromosome flow sorting, and EMS mutagenesis) was
used to identify the Pm2 gene (Sanchez-Martın et al. 2016). Similarly, AgRenSeq
(combining association genetics with RenSeq) was used to exploit the pan-genome
variations for the cloning of R genes from the diverse panels of germplasm in wheat,
such as SrTA1662, Sr46, Sr45, and Sr33 (Arora et al. 2019). Allele mining is a
simple and effective approach for the identification of elite alleles of R genes from
wild germplasm and landraces (Ashkani et al. 2015). In a study in which wild
germplasms of wheat were studied for resistance against the powdery mildew,
Pm3 alleles were observed in wild T. dicoccoides accessions (Kaur 2008).
8.4.3 Expanding NLR Recognition Specificity Through BSR Genes
Engineering
The period of resistance the R resistance gene induces is shortened by the adapted
virulence of the pathogen (McDonald and Linde 2002). This bottleneck can be
overcome with the aid of genetic engineering of NLR variants where engineered
NLR can respond to numerous pathogen effectors. According to Segretin et al.
(2014), different conserved domains and integrated domains of NLRs can be altered
to attain the new capability to progress in disease resistance against different
pathogens and strains. A few nucleotide differences among the coding regions of
genes, prime genome editing technology, and CRISPR-mediated homology direct
repair can be practiced to produce new R alleles with a broad resistance spectrum
(Lin et al. 2020). For example, using CRISPR/Cas9, EDR1, which acts as a negative
regulator in defensive responses against powdery mildew, was knocked out to
generate powdery mildew-resistant wheat plants (Zhang et al. 2017a,b). Similarly,
random elimination in the start codon containing a sequence of the TaHRC gene in
the Bobwhite (wheat variety cultivar) confirmed resistance against the Fusarium
head blight (Su et al. 2019). Modifications in the decoys or integrated domains of
NLRs can be helpful in the expansion of effector recognition specificity (Maqbool
et al. 2015;Kim et al. 2016). Therefore, various R variants can be produced for the
selection of required wide-range resistance in the crop by using CRISPR/Cas9
technology (Fig. 8.2).
146 A. Choudhary et al.
8.4.4 GWAS: A Step Ahead Toward Wheat Breeding
GWAS is currently known as the most common approach for decoding the
genotype-phenotype association in crop plants (Liu and Yan 2019). GWAS is the
more statistical strategy for mapping QTL to coordinate the desired phenotype with
the genotypes on the significance of historic linkage disequilibrium. GWAS can
increase the likelihood of identifying loci linked to crop domestication, crop
improvement, and grain yield (Li et al. 2019; Lujan Basile et al. 2019; Hao et al.
2020). Re-sequencing and GWAS studies on 145 elite wheat cultivars in China help
in the discovery of genomic regions integrated with crop improvement as well as
domestication, providing genetic resources for wheat improvement programs (Hao
et al. 2020). The study was conducted on 175 winter wheat genotypes from NordGen
and GWAS analysis was done. The phenotypic data indicated a significant variation
between genotypes in disease resistance response to Septoria tritici blotch as well as
powdery mildew. The genomic-assisted germplasm selection with superior alleles
for disease resistance in wheat could be then integrated into active breeding
programs (Alemu et al. 2021).
8.4.5 Speed Breeding
Generally, breeders take 8–10 years to develop novel wheat cultivars. Therefore,
novel elite crop development of wheat is a difficult task in terms of time consump-
tion and laboriousness. Speed breeding is one of the possible solutions to overcome
this prolonged time barrier. It involves specific growing conditions, including
optimal temperature and light intensity, photoperiod requirement, premature seed
harvesting, and shortening of generation time by up to 8–10 weeks. Speed breeding
was successfully deployed to obtain six generations in one year for bread wheat. The
attempt was made by Alahmad et al. (2018)toTriticum durum Desf. with the key
traits’involvement, such as phenotyping for resistance to leaf rust, tolerance to
crown rot, seminal root angle, seminal root number, and plant height.
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 147
Fig. 8.2 Landmarks for significant achievement in the deployment of trait improvement approaches
148 A. Choudhary et al.
8.4.6 Genome Editing (GE)
GE involves sequence-specific nucleases (SSNs) for desired gene modification via
introgression of selectable traits into a target crop in a transgenic-free selected
genome. SSNs induce specific alteration at the chromosomal level, leading to
insertion, substitution, or deletion of undesired sequence from a particular
position (Mehta et al. 2020; Dilawari et al. 2021; Chattopadhyay et al. 2022). Several
SSNs types are used, such as the CRISPR/Cas, TALENs, and ZFNs system are
particularly used for genomic modification. Such target genomic alteration has
become a distinct genetic tool for the introduction of disease resistance genes against
different pathogenic diseases (Jamil et al. 2020; Shakeel et al. 2020). Indeed, crop
susceptible genes are eliminated, edited, or restructured in such a manner to change
them into tolerant genes.
For instance, in T. aestivum, CRISPR/Cas9 has exhibited complete resistance
against powdery mildew by developing mutants like TaEDR1 by continuous editing
of TaEDR1 along with other homolog sequences. However, CRISPR/Cas9 was
significant for developing transgenic cultivars against fungal pathogens via deletion
(Jamil et al. 2020). In another study, successful editing of various genes has been
done using CRISPR/Cas9 such as TansLTP9,TaNFXL1, and TaABCC6, with
protoplasm fusion in wheat for stimulation of resistant mechanism toward Fusarium
head blight (FHB). Additionally, there are various reports on rust-resistant using
CRISPR/Cas9. Several reports have been published on stripe rust resistance gene
introgression into cultivated wheat (For detailed extension see Tables 8.1 and 8.2).
8.4.7 RNA Interface (RNAi) Silencing
RNAi silencing is a highly conserved process that mediates gene silencing or
restricts the functional mechanism of a selected gene of virulence pathogens. The
gene silencing RNAi involves double-stranded RNA (dsRNA), a homologous gene
of interest. The silencing process offers dsRNA cleavage into small RNA (21–26
nucleotide long), which are microRNA (miRNA) and small interfering RNAs
(siRNA). These miRNA or sRNA possibly stimulate the various cascade, viz.,
regulating RNA stability, processing of signals, and response to a different pathogen
in crop plants.
In stripe mosaic virus, the Pst from PR genes has been silenced that acts as a
vector for dsRNA homologous expression to Pst target gene (Qi et al. 2019; Jamil
et al. 2020). The transcription factor-like mitogen-activated protein kinase (MAPK)
stimulating gene (FUZ7), which is the crucial pathogenic factor of Pst mediating
fungal hyphal morphology and infection and triggering pathogenesis in the host
plant, was eliminated using RNAi. However, in the transgenic wheat line, RNAi
prepares Afuz7 targeting of Pst which was significantly expressed and strongly
confirmed the durable resistance against pathogenic strains. On contrary, another
CPK1 was eliminated in transgenic wheat lines with the help of RNAi. Moreover,
Pst knockdown uses different transgenic wheat lines that are PstGSRE1 and PsHXT1
genes (hexose transporter) (Qi et al. 2018; Satheesh et al. 2019; Ahmad et al. 2020;
Chang et al. 2020).
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 149
Table 8.1 Overview on the discovery of major disease-resistant genes and techniques used for
their introgression
Gene Techniques used Resistant against Reference
mtlD Plasmid-mediated gene
transfer
Mosaic virus (Aceria
tosichella)
Abebe et al.
(2003)
pac1 Agrobacterium-
mediated gene transfer
Barley yellow dwarf virus
(Cereal aphids)
Yan et al. (2006)
β-1,3-glucanase Agrobacterium-
mediated gene transfer
Powdery mildew (Blumeria
graminis)
Zhao et al. (2006)
TiERF1 Biolistics method Sharp eyespot (Rhizoctonia
cerealis)
Liang et al.
(2008)
TaPIMP1 Agrobacterium-
mediated gene transfer
Root rot (Bipolaris
sorokiniana)
Zhang et al.
(2012)
TiMYB2R-1 Biolistics method Take-all disease
(Gaeumannomyces
graminis)
Liu et al. (2013)
TaCLP1 Biolistics method Stripe rust (Puccinia
striiformis)
Zhang et al.
(2013)
SN1 Biolistics method Take all disease
(Gaeumannomyces
graminis)
Rong et al.
(2013)
Bt Agrobacterium-
mediated gene transfer
Armyworm (Spodoptera
frugiperda)
Huang et al.
(2014)
TaERF3 Virus-induced gene
silencing
Stripe mosaic virus
(Hordeivirus)
Rong et al.
(2014)
NIb8 Biolistics method Yellow mosaic virus
(Polymyxa graminis)
He et al. (2015)
Ta-Mlo RC24 Agrobacterium-
mediated method
Powdery mildew (Blumeria
graminis)
Acevedo-Garcia
et al. (2017)
viviparous 1 Agrobacterium-
mediated gene transfer
Rust (Puccinia triticina) Kocheshkova
et al. (2017)
KN2 Biolistics method Powdery mildew (Blumeria
graminis)
Zhang et al.
(2017a,b)
Mrl40 Agrobacterium-
mediated method
Powdery mildew (Blumeria
graminis)
Tang et al. (2018)
BADH Particle bombardment
method
Smut (Ustilago tritici) Khan et al.
(2019)
GhDREB Plasmid-mediated gene
transfer
Rust (Puccinia triticina) Andersen et al.
(2020)
TaNAC21 Agrobacterium-
mediated method
Stripe rust (Puccinia
striiformis)
Feng et al. (2014)
TaNAC069 Agrobacterium-
mediated gene method
Leaf rust fungus (Puccinia
triticina)
Zhang et al.
(2021)
150 A. Choudhary et al.
Table 8.2 Introgression of major disease-resistant genes from wild relative species into a wheat
plant
Wild progenitor
species
Target
Gene
Introgression
technique Resistance Reference
Aegilops
ventricosa
Cre2 Recombination Cyst
nematode
Jahier et al. (2001)
Taxodium
distichum
Sr2 Spontaneous Leaf rust Prins et al. (2001)
Aegilops
umbellulata
Lr9 Spontaneous Leaf rust Gupta et al. (2005)
Aegilops
triuncialis
Lr58 Recombination Leaf rust Kuraparthy et al.
(2007)
Aegilopss
umbellulata
Lr9 Irradiation Leaf rust Chhuneja et al.
(2007)
Aegilops
ventricosa
Rkn2 Recombination Root-knot
nematode
Williamson et al.
(2013)
Aegilops
speltoides
Sr32 Recombination Stem rust Mago et al. (2013)
Africallagma
elongatum
Lr19 Irradiation Stem rust Worku et al. (2016)
Triticum
timopheevii
Sr23 Homoeologous
recombination
Powdery
mildew
Liu et al. (2017)
Africallagma
elongatum
Lr24 Spontaneous Stem rust Kumar et al. (2017)
Africallagma
elongatum
Sr26 Irradiation Stem rust Rai et al. (2017)
Secale cereale Pm8 Spontaneous Stem rust Crespo-Herrera
et al. (2017)
Aegilops
ventricosa
Yr17 Recombination Stripe rust Coriton et al. (2019)
Aegilops
ventricosa
Pch1 Recombination Eyespot Pasquariello et al.
(2020)
Aegilops
longissima
Pm66 Spontaneous Powdery
mildew
Li et al.
(2020a,b,c,d)
Aegilops tauschii Dn3 Recombination Russian wheat
aphid
Kisten et al. (2020)
8.4.8 CRISPR/Cas9 and Disease Resistance: A Way Forward to More
Reliability
CRISPR/Cas9 genome editing is an established mechanism in bacteria that helps
protect them from harmful plasmids and bacteriophages. The spacer (a DNA frag-
ment of foreign pathogen and host) acts as a genetic memory for future infection.
During similar pathogenic attacks in the future, the CRISPR array gets transcribed
and processed, leading to the synthesis of CRISPR RNA fragments (Single Guide
RNA) via the activity of endonuclease (CAS9). The advancement of plant genome
editing, including CRISPR/Cas9 systems, suggests that this application is more
feasible and reliable. It significantly helps to increase multiple beneficial traits as
well as disease resistance in wheat (Langner et al. 2018; Zaynab et al. 2020).
However, genes encoding proteins that associate between plants and pathogens
have been targeted through CRISPR/Cas9 to explain the underlying genetic
pathways of plant–pathogen recognition and to produce investigation systems for
disease resistance (Li et al. 2018). Disease caused by viruses, bacteria, and fungi
could dramatically decrease the quality and quantity of wheat.
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 151
CRISPR/Cas9 has been significantly eliminating disease susceptible genes to
produce new resistance wheat cultivars. More likely, loss of function in MLO
(Mildew resistance locus) leads to gains of resistance against powdery mildew.
Such reports confirm a broad-spectrum range of MLO as a favorable site for
CRISPR/Cas9 to reduce susceptibility against powdery mildew (Gil-Humanes and
Voytas 2014). According to Wang et al. (2014), CRISPR/Cas9-guided wheat
mutant, a TaMLO-A1 (mildew resistance locus) of the homoalleles exhibited
enhanced resistance to infection against Blumeria graminis. CRISPR/Cas9 applica-
tion system to useful fungal pathogens including Trichoderma sp. to increase plant
defense system as a biocontrol agent against oomycetes and fungal is also a
promising agent. Certain MLO homo-alleles including TaMLO-B1,TaMLO-A1,
and TaMLO-D1 were edited using CRISPR/Cas9 and showed that TaMLO-A1-
mutagenized wheat plants have confirmed resistance against Blumeria graminis
(Tyagi et al. 2021). Such techniques like CRISPR/Cas9-dependent plant–pathogen
genome editing will draw much attention as well-adapted to increased pathogenic
resistance and transgenic-free plants and will be required for global food demand
(Paul et al. 2021).
In another study, the fusarium head blight, induced by Fusarium spp., was
managed in CRISPR/CAS9-silenced mutants. Studies demonstrated that RNA inter-
ference on trehalose 6-mutant (Δtri 6) of Fusarium spp. confirmed lowered disease
indices that lie from 40 to 80% in durum wheat (Muñoz et al. 2019). However, two
mutants (Δtri1 and Δtri6)ofFusarium spp. were incapable of pathogenic response to
the inflorescence and also elicited plant defense response. Moreover, Δmap 1
mutants of Fusarium spp. demonstrated two times reduction in the production of
mycotoxins, but was unable to colonize pathogens in other plant parts except for
grains. Such competition for nutrients and space between non-virulent and virulent
strains could decrease the disease severity, and the field liberation of non-virulent
CRISPR/Cas9-mutant strains of Fusarium spp. might help to overcome the
emerging issues (Zaidi et al. 2020; Zaynab et al. 2020;Zhang et al. 2017a,b;
Wang et al. 2020; Verma et al. 2021; Liu et al. 2021).
According to Wang et al. (2014), using CRISPR/Cas9 to mutate wheat cultivars
exhibits improved resistance toward powdery mildew resistance, caused by
Blumeria graminis. Additionally, CRISPR/Cas9 mediated site-specific mutagenesis
in springer and wheat varieties (Hahn et al. 2021). Similarly, mutagenization of
3 genes such as AUR1 (a visual marker), Tri5 (toxin production and infection), and
MGV1 (required for infection and reproduction) was done by CRISPR/Cas9. More
likely, silencing of Tri5 and MGV1 could suppress the fungal ability to suppress
infection in crops, whereas AUR1 silencing acts as an effective visual marker during
mutagenesis (Sack 2020). Recently, in wheat a serious fungal pathogen like powdery
mildews caused by Podosphaera xanthii was enhanced via editing Mildew Locus O
(MLO) gene through CRISPR/Cas9 technique. Knockdown of susceptibility loci
becomes highly complicated in wheat like targeting MLO homologous genes and
Enhanced disease resistance 1 (EDR1) using CRISPR/Cas9 editing (Wang et al.
2020; Verma et al. 2021; Raffan et al. 2021; Li et al. 2018,2020a,b).
152 A. Choudhary et al.
However,various target locus in the wheat dwarf virus (WDA) genome was
screened using CRISPR/Cas 9 direct sequences enclosing the PAMs motif. Several
target positions were designated that demonstrated no specific effect and were
efficient in attacking different viral DNA sequences. The single-guided RNA
WDA1 (sgRNA WDA1) displays the complementary overlapping in certain coding
sites; sgWDA2 targets the Rep/Rep (Shahriar et al. 2021). Moreover, crop engineer-
ing using CRISPR/Cas9 like techniques has helped to develop disease-resistant
varieties that are more resilient to climate change (Zaidi et al. 2020). Application
of CRISPR/Cas9 ultimately helps to improve disease resistance in wheat and other
crops and is well-documented (Schenke and Cai 2020; Paul et al. 2021; Zhang et al.
2017a,b; Kis et al. 2019; Verma et al. 2021; Gil-Humanes and Voytas 2014; Tyagi
et al. 2021; Duy et al. 2021).
8.5 Concluding Remarks
The conventional breeding approaches for disease-free wheat in modern agriculture
are transgenic, mutation breeding, and cross-breeding. These are laborious, time-
consuming, and unfocused crop improvement programs that are unable to meet food
demand. To cope with these challenges and to increase crop selection ability,
transgenic and marker-assisted breeding has been developed, harnessing target traits
via introgression into elite wheat varieties. Such advancements in plant breeding are
an excellent tool that maintains rapid mutation and can recognize the significant
genetic approaches for disease resistance. No doubt, crop breeding strategies are
propelled by next-generation breeding methods. New breeding resistant varieties
should remain the key focus. Some alternate approaches, viz., shifting plantation
date, integrating fungicide, and eradicating volunteer plants, should also be consid-
ered. Precise modification of existing allelic diversity via advanced genomic editing
is an efficient alternative for accelerating wheat improvement and sustainably
increasing wheat production. Although it is convenient to attain precise allele/gene
targeting or replacement in different cereal plant species, impressive work has been
published in past years in wheat molecular breeding, which eradicates the constraints
of the pathogen during crop improvement programs. In precise genome editing,
replacement, deletion, site-directed artificial evolution, knockdown module, and
insertion of allele/gene will be significantly facilitated by functional genomics.
The advancement of the different genome modifications provides ease to gene
pyramiding of novel resistance genes in the desired cultivar in a user-derived way
immediately, efficiently, and cost-effectively without any linkage drag from unde-
sired genes. More recently, CRISPR/Cas9 like techniques help in the transformation
of agriculture via the deletion or addition of alleles. No doubt, such techniques are
cost-effective but eco-friendly, thus becoming a reliable trend. However, approaches
like GWAS, RNAi silencing, genome edition, speed breeding, etc. will offer a huge
amount of genetic information and enhance disease resistance via genomic editing.
Genome editing approaches have various advantages over conventional breeding
techniques, given their high efficiency, simplicity, amenability to multiplexing, and
high specificity. Breeders strongly believe that combining molecular approaches
with numerous breeding strategies will underpin an attempt to create super wheat
cultivars for sustainable agriculture and ensure food security in an eco-friendly way.
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 153
References
Abebe T, Guenzi AC, Martin B, Cushman JC (2003) Tolerance of mannitol-accumulating trans-
genic wheat to water stress and salinity. Plant Physiol 131:1748–1755
Acevedo-Garcia J, Spencer D, Thieron H, Reinstädler A, Hammond-Kosack K, Phillips AL,
Panstruga R (2017) mlo-based powdery mildew resistance in hexaploid bread wheat generated
by a non-transgenic TILLING approach. Plant Biotechnol J 15:367–378
Ahmad S, Wei X, Sheng Z, Hu P, Tang S (2020) CRISPR/Cas9 for development of disease
resistance in plants: recent progress, limitations and future prospects. Brief Func Genomics
19:26–39
Ahn SY, Kim SA, Yun HK (2015) Inhibition of Botrytis cinerea and accumulation of stilbene
compounds by lightemitting diodes of grapevine leaves and differential expression of defense-
related genes. Eur J Plant Pathol 143(4):753–765
Alahmad S, Dinglasan E, Leung KM, Riaz A, Derbal N, Voss-Fels KP, Able JA, Bassi FM,
Christopher J, Hickey LT (2018) Speed breeding for multiple quantitative traits in durum wheat.
Plant Meth 14:1–15
Alemu A, Brazauskas G, Gaikpa DS, Henriksson T, Islamov B, Ørgensen LN, Koppel M,
Koppel R, Liatukas Ž, Svensson JT, Chawade A (2021) Genome-wide association analysis
and genomic prediction for adult-plant resistance to Septoria Tritici blotch and powdery mildew
in winter wheat. Front Genet 12:661742
Ali S, Gladieux P, Leconte M, Gautier A, Justesen AF, Hovmøller MS, Enjalbert J, de Vallavieille-
Pope C (2014) Origin, migration routes and worldwide population genetic structure of the wheat
yellow rust pathogen Puccinia striiformis f. sp. tritici. PLoS Pathog 10:e1003903
Andersen EJ, Nepal MP, Purintun JM, Nelson D, Mermigka G, Sarris PF (2020) Wheat disease
resistance genes and their diversification through integrated domain fusions. Front Genet 11:898
Arora S, Steuernagel B, Gaurav K, Chandramohan S, Long Y, Matny O, Johnson R, Enk J,
Periyannan S, Singh N (2019) Resistance gene cloning from a wild crop relative by sequence
capture and association genetics. Nat Biotechnol 37:139–143
Ashkani S, Yusop MR, Shabanimofrad M, Azady A, Ghasemzadeh A, Azizi P, Latif MA (2015)
Allele mining strategies: principles and utilisation for blast resistance genes in rice (Oryza sativa
L.). Curr Issues Mol Biol 17:57–73
Beddow JM, Pardey PG, Chai Y, Hurley TM, Kriticos DJ, Braun HJ, Park RF, Cuddy WS, Yonow
T (2015) Research investment implications of shifts in the global geography of wheat stripe rust.
Nat Plants 15:132
Bhattacharya S (2017) Deadly new wheat disease threatens Europe’s crops. Nature 542:145–146
Bolton MD, Kolmer JA, Garvin DF (2008) Wheat leaf rust caused by Puccinia triticina. Mol Plant
Pathol 9:563–575
Brown DW, Proctor RH (2013) Fusarium: genomics, molecular and cellular biology. Caister
Academic Press, Norfolk
154 A. Choudhary et al.
Brown JKM, Chartrain L, Lasserre-Zuber P, Saintenac C (2015) Genetics of resistance to
Zymoseptoria tritici and applications to wheat breeding. Fungal Genet Biol 79:33–41
Cardoso CADA, Reis EM, Moreira EN (2008) Development of a warning system for wheat blast
caused by Pyricularia grisea. Summa Phytopathol 34:216–221
Chang Q, Lin X, Yao M, Liu P, Guo J, Huang L (2020) Hexose transporter PsHXT1-mediated
sugar uptake is required for pathogenicity of wheat stripe rust. Plant Biotechnol J 18(12):
2367–2369
Chattopadhyay A, Purohit J, Mehta S, Parmar H, Karippadakam S, Rashid A, Balamurugan A,
Bansal S, Prakash G, Achary VMM, Reddy MK (2022) Precision genome editing toolbox:
applications and approaches for improving rice’s genetic resistance to pathogens. Agronomy
12:565
Chen W, Wellings C, Chen X, Kang Z, Liu T (2014) Wheat stripe (yellow) rust caused by Puccinia
striiformis f. sp. tritici. Mol Plant Pathol 15:433–446
Chhuneja P, Kaur S, Goel R, Aghaee M, Dhaliwal H (2007) Introgression of leaf rust and stripe rust
resistance genes from Aegilops Umbellulata to hexaploid wheat through induced homoeologous
pairing. Phytopathology 105:872–884
Choudhary JR, Tripathi A, Kaldate R, Rana M, Mehta S, Ahlawat J, Bansal M, Zaid A, Wani SH
(2022) Breeding Efforts for Crop Productivity in Abiotic Stress Environment. In: Augmenting
Crop Productivity in Stress Environment. Springer, Singapore, pp 63–103
Coriton O, Jahier J, Leconte M, Virginie H, Gwenn T, Dedryver F, deVallavieille PC (2019)
Double dose efficiency of the yellow rust resistance gene Yr17 in bread wheat lines. Plant Breed
139:263–271
Crespo-Herrera LA, Garkava-Gustavsson L, Åhman I (2017) A systematic review of rye (Secale
cereale L.) as a source of resistance to pathogens and pests in wheat (Triticum aestivum L.).
Hereditas 154:14
Cuthbert PA, Somers DJ, Thomas J, Cloutier S, Brule-Babel A (2006) Fine mapping Fhb1, a major
gene controlling fusarium head blight resistance in bread wheat (Triticum aestivum L.). Theor
Appl Genet 112:1465–1472
Dakouri A, McCallum BD, Radovanovic N, Cloutier S (2013) Molecular and phenotypic charac-
terization of seedling and adult plant leaf rust resistance in a world wheat collection. Mol Breed
32:663–677
Dilawari R, Kaur N, Priyadarshi N, Kumar B, Abdelmotelb KF, Lal SK, Singh B, Tripathi A,
Aggarwal SK, Jat BS, Mehta S (2021) Genome Editing: A Tool from the Vault of Science for
Engineering Climate-Resilient Cereals. In: Harsh environment and plant resilience: molecular
and functional aspects. Springer, Cham, pp 45–72
Dodds PN, Lagudah ES (2016) Starving the enemy. Science 354:1377–1378
Duveiller E, Sharma RC (2009) Genetic improvement and crop management strategies to minimize
yield losses in warm non-traditional wheat growing areas due to spot blotch pathogen
Cochliobolus sativus. J Phytopathol 157:521–534
Duveiller E, Sharma RC (2012) Wheat resistance to spot blotch or foliar blight. In: Sharma I
(ed) Disease resistance in wheat. CABI, Wallingford, pp 120–135
Duy PN, Lan DT, Pham Thu H, Thi Thu HP, Nguyen Thanh H, Pham NP et al (2021) Improved
bacterial leaf blight disease resistance in the major elite Vietnamese rice cultivar TBR225 via
editing of the OsSWEET14 promoter. PLoS One 16:9
Dwivedi SL, Ceccarelli S, Blair MW, Upadhyaya HD, Are AK, Ortiz R (2016) Landrace germ-
plasm for improving yield and abiotic stress adaptation. Trends Plant Sci 21:31–42
Ellis JG, Lagudah ES, Spielmeyer W, Dodds PN (2014) The past, present and future of breeding
rust resistant wheat. Front Plant Sci 5:641
FAO STAT (2018) FAO online database. Available at: http://www.fao.org/faostat/en/#data. Last
Access: May 2019
Feng H, Duan X, Zhang Q, Li X, Wang B, Huang L, Wang X, Kang Z (2014) The target gene of tae‐
miR164, a novel NAC transcription factor from the NAM subfamily, negatively regulates
resistance of wheat to stripe rust. Mol Plant Pathol 15:284–296
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 155
Figueroa M, Upadhyaya NM, Sperschneider J, Park RF, Szabo LJ, Steffenson B, Ellis JG, Dodds
PN (2016) Changing the game: using integrative genomics to probe virulence mechanisms of
the stem rust pathogen Puccinia graminis f. sp. tritici. Front Plant Sci 7:205
Figueroa M, Hammond-Kosack KE, Solomon PS (2018) A review of wheat diseases-a field
perspective. Mol Plant Pathol 19:1523–1536
Fones H, Gurr S (2015) The impact of Septoria tritici Blotch disease on wheat: an EU perspective.
Fungal Genet Biol 79:3–7
Fu D, Uauy C, Distelfeld A, Blechl A, Epstein L, Chen X, Sela H, Fahima T, Dubcovsky J (2009) A
kinase-START gene confers temperature dependent resistance to wheat stripe rust. Science 323:
1357–1360
Gilbert J, Haber S (2013) Overview of some recent research developments in fusarium head blight
of wheat. Can J Plant Pathol 35:149–174
Gil-Humanes J, Voytas DF (2014) Wheat rescued from fungal disease. Nat Biotechnol 32:886–887
Grote U, Fasse A, Nguyen TT, Erenstein O (2021) Food security and the dynamics of wheat and
maize value chains in Africa and Asia. Front Sustain Food Syst 4:617009
Gupta SK, Ashwini C, Sunita K, Kumble VP, Qazi MRH (2005) Development and validation of
molecular markers linked to an Aegilops umbellulata–derived leaf-rust-resistance gene, Lr9, for
marker-assisted selection in bread wheat. Genome 48:823–830
Gupta N, Batra N, Bhardwaj SC (2017) Wheat rust research–Status, efforts and way ahead. J Wheat
Res 9:72–86
Hahn F, Loures SL, Sparks CA, Kanyuka K, Nekrasov V (2021) Efficient CRISPR/ cas-mediated
targeted mutagenesis in spring and winter wheat varieties. Plan Theory 10:1481
Hao C, Jiao C, Hou J, Li T, Liu H, Wang Y, Zheng J, Liu H, Bi Z, Xu F (2020) Resequencing of
145 landmark cultivars reveals asymmetric sub-genome selection and strong founder genotype
effects on wheat breeding in China. Mol Plant 13:1733–1751
He Y, Wang Q, Zeng J, Sun T, Yang, Guang-xiao HE, Guang Y (2015) Current status and trends of
wheat genetic transformation studies in China. J Integr Agric 14:438–452
Hickey LT, Hafeez AN, Robinson H, Jackson SA, Leal-Bertioli SC, Tester M, Gao C, Godwin ID,
Hayes BJ, Wulff BB (2019) Breeding crops to feed 10 billion. Nat Biotechnol 37:744–754
Hovmøller MS, Walter S, Bayles RA, Hubbard A, Flath K, Sommerfeldt N, Leconte M, Czembor P,
Rodriguez-Algaba J, Thach T, Hansen JG, Lassen P, Justesen AF, Ali S, de Vallavieille-Pope C
(2015) Replacement of the European wheat yellow rust population by new races from the centre
of diversity in the near-Himalayan region. Plant Pathol 65:402–411
Huang X, Wei X, Sang T, Zhao Q, Feng Q, Zhao Y, Li C, Zhu C, Lu T, Zhang Z (2010) Genome-
wide association studies of 14 agronomic traits in rice landraces. Nat Genet 42:961–967
Huang F, Qureshi JA, Meagher RL Jr, Reisig DD, Head GP, Andow DA (2014) Cry1F resistance in
fall armyworm Spodoptera frugiperda: single gene versus pyramided Bt maize. PLoS One 9:
e112958
Huerta-Espino J, Singh R, German S, McCallum B, Park R, Chen WQ, Bhardwaj S, Goyeau H
(2011) Global status of wheat leaf rust caused by Puccinia triticina. Euphytica 179:143–160
Igarashi S, Utimada C, Igarashi L, Kazuma A, Lopes R (1986) Pyricularia sp. em
trigo. I. Ocorrencia de Pyricularia sp. no Estado do Parana. Fitopatol Bras 11:351–352
Islam MT, Croll D, Gladieux P, Soanes DM, Persoons A, Bhattacharjee P, Hossain MS, Gupta DR,
Rahman MM, Mahboob MG, Cook N, Salam MU, Surovy MZ, Sancho VB, Maciel JLN,
NhaniJunior A, Castroagudın VL, Reges JTA, Ceresini PC, Ravel S, Kellner R (2016) Emer-
gence of wheat blast in Bangladesh was caused by a South American lineage of Magnaporthe
oryzae. BMC Biol 14:84
Jahier J, Abelard P, Tanguy M, Dedryver F, Rivoal R, Khatkar S, Bariana HS, Koebner R (2001)
The Aegilops ventricosa segment on chromosome 2AS of the wheat cultivar ‘VPM1’carries the
cereal cyst nematode resistance gene Cre5. Plant Breed 120:125–128
Jamil S, Shahzad R, Ahmad S, Fatima R, Zahid R, Anwar M, Iqbal MZ, Wang X (2020) Role of
genetics, genomics, and breeding approaches to combat stripe rust of wheat. Front Nutr 7:
580715
156 A. Choudhary et al.
Jiang C, Kan J, Ordon F, Perovic D, Yang P (2020) Bymovirus-induced yellow mosaic diseases in
barley and wheat: viruses, genetic resistances and functional aspects. Theor Appl Genet 133:
1623–1640
Jin Y, Szabo LJ, Pretorius ZA, Singh RP, Ward R, Fetch T (2008) Detection of virulence to
resistance gene Sr24 within race TTKS of Puccinia graminis f. sp. tritici. Plant Dis 92:923–926
Jupe F, Witek K, Verweij W, Sliwka J, Pritchard L, Etherington GJ, Maclean D, Cock PJ, Leggett
RM, Bryan GJ (2013) Resistance gene enrichment sequencing (RenSeq) enables reannotation of
the NB-LRR gene family from sequenced plant genomes and rapid mapping of resistance loci in
segregating populations. Plant J 76:530–544
Kaiser N, Douches D, Dhingra A, Glenn KC, Herzig PR, Stowe EC et al (2020) The role of
conventional plant breeding in ensuring safe levels of naturally occurring toxins in food crops.
Trends Food Sci Technol 100:51–66
Kaur N (2008) Allele mining and sequence diversity at the wheat powdery mildew resistance locus
Pm3. Doctoral dissertation, University of Zurich
Khan S, Anwar S, Yu S, Sun M, Yang Z, Gao Z (2019) Development of drought-tolerant transgenic
wheat: achievements and limitations. Int J Mol Sci 20:3350
Kim SH, Qi D, Ashfield T, Helm M, Innes RW (2016) Using decoys to expand the recognition
specificity of a plant disease resistance protein. Science 351:684–687
Kis A, Hamar É, Tholt G, Bán R, Havelda Z (2019) Creating highly efficient resistance against
wheat dwarf virus in barley by employing CRISPR /Cas9 system. Plant Biotechnol J 17:1004–
1006
Kisten L, Tolmay VL, Mathew I, Sydenham SL, Venter E (2020) Genome-wide association
analysis of Russian wheat aphid (Diuraphis noxia) resistance in Dn4 derived wheat lines
evaluated in South Africa. PLoS One 15:e0244455
Kocheshkova AA, Kroupin PY, Bazhenov MS, Karlov GI, Pochtovyy AA, Upelniek VP (2017)
Pre-harvest sprouting resistance and haplotype variation of ThVp-1 gene in the collection of
wheat-wheatgrass hybrids. PLoS One 12:e0188049
Kokhmetova A, Sehgal D, Ali S, Atishova M, Kumarbayeva M, Leonova I, Dreisigacker S (2021)
Genome-wide association study of tan spot resistance in a hexaploid wheat collection from
Kazakhstan. Front Genet 11:581214
Kolmer JA (2005) Tracking wheat rust on a continental scale. Curr Opin Plant Biol 8:441–449
Kumar D, Dutta S, Singh D, Prabhu KV, Kumar M, Mukhopadhyay K (2017) Uncovering leaf rust
responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and
prediction of their targets through degradome analysis. Planta 245(1):161–182
Kumar D, Kumar A, Chhokar V, Gangwar OP, Bhardwaj SC, Sivasamy M, Prasad SV, Prakasha
TL, Khan H, Singh R, Sharma P (2020) Genome-wide association studies in diverse spring
wheat panel for stripe, stem, and leaf rust resistance. Front Plant Sci 11:748
Kumar A, Sharma A, Sharma R, Srivastva P, Choudhary A (2021a) Exploration of wheat wild
relative diversity from Lahaul valley: a cold arid desert of Indian Himalayas. Cereal Res
Commun. https://doi.org/10.1007/s42976-021-00166-w
Kumar A, Sharma A, Sharma R, Choudhary A, Srivastava P, Kaur H, Padhy AK (2021b) Morpho-
physiological evaluation of Elymus semicostatus (Nees ex Steud.) Melderis as potential donor
for drought tolerance in Wheat (Triticum aestivum L.). Gen Res Cop Evol 69(1):411–430.
https://doi.org/10.1007/s10722-021-01241-1
Kumar A, Choudhary A, Kaur H, Aggarwal SK, Mehta S (2022a) Smut and bunt diseases of wheat:
biology, identification, and management. In: New horizons in wheat and barley research.
Springer, Singapore, pp 107–131
Kumar A, Choudhary A, Kaur H, Mehta S (2022b) A walk towards wild grasses to unlock the
clandestine of gene pools for wheat improvement: a review. Plant Stress 3:100048
Kuraparthy V, Sood S, Chhuneja P, Dhaliwal H, Kaur S, Bowden R, Gill B (2007) A cryptic wheat–
translocation with leaf rust resistance gene. Crop Sci 47(5)
Langner T, Kamoun S, Belhaj K (2018) CRISPR crops: plant genome editing toward disease
resistance. Annu Rev Phytopathol 56:479–512
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 157
Leonard KJ, Szabo LJ (2005) Stem rust of small grains and grasses caused by Puccinia graminis.
Mol Plant Pathol 6:99–111
Li J, Zhang Y, Zhang Y, Yu P-L, Pan H, Rollins JA (2018) Introduction of large sequence inserts by
CRISPR-Cas9 to create pathogenicity mutants in the multinucleate filamentous pathogen
Sclerotinia sclerotiorum. MBio 9:e00567-18
Li F, Wen W, Liu J, Zhang Y, Cao S, He Z, Rasheed A, Jin H (2019) Genetic architecture of grain
yield in bread wheat based on genome-wide association studies. BMC Plant Biol 19:168
Li H, Dong Z, Ma C, Xia Q, Tian X, Sehgal S, Koo DK, Friebe B, Ma P, Liu W (2020a) A
spontaneous wheat-Aegilops longissima translocation carrying Pm66 confers resistance to
powdery mildew. Theor Appl Genet 133:1149–1159
Li W, Deng Y, Ning Y, He Z, Wang GL (2020b) Exploiting broad-spectrum disease resistance in
crops: from molecular dissection to breeding. Annu Rev Plant Biol 71:575–603
Li J, Li Y, Ma L (2020c) Recent advances in CRISPR/Cas9 and applications for wheat functional
genomics and breeding. aBiotech 2:375–385. https://doi.org/10.1007/s42994-021-00042-5
Li J, Jiao G, Sun Y, Chen J, Zhong Y, Yan L, Jiang D, Ma Y, Xia L (2020d) Modification of starch
composition, structure and properties through editing of TaSBEIIa in both winter and spring
wheat varieties by CRISPR/Cas9. Plant Biotechnol J 19:937–951
Liang C, Zeng YZ, Hong XL, Hong XL, LiPu D, Huijun X, Zhiyong X (2008) Overexpression of
TiERF1 enhances resistance to sharp eyespot in transgenic wheat. J Exp Bot 59:4195–4204
Lin Q, Zong Y, Xue C, Wang S, Jin S, Zhu Z, Wang Y, Anzalone AV, Raguram A, Doman JL
(2020) Prime genome editing in rice and wheat. Nat Biotechnol 38:582–585
Liu HJ, Yan J (2019) Crop genome-wide association study: a harvest of biological relevance. Plant J
97:8–18
Liu X, Yang L, Zhou X, Zhou M, Lu Y, Ma L, Ma H, Zhang Z (2013) Transgenic wheat expressing
Thinopyrum intermedium MYB transcription factor TiMYB2R-1 shows enhanced resistance to
the take-all disease. J Exp Bot 64:2243–2253
Liu W, Koo DH, Xia Q, Li C, Bai F, Song Y, Friebe B, Gill BS (2017) Homoeologous
recombination-based transfer and molecular cytogenetic mapping of powdery mildew-resistant
gene Pm57 from Aegilops searsii into wheat. Theor Appl Genet 130:841–848
Liu Y, Guo Y, Zhou Y (2018) Poverty alleviation in rural China: policy changes, future challenges
and policy implications. China Agric Econ Rev 10:241–259
Liu Y, Luo W, Linghu Q, Abe F, Hisano H, Sato K, Kamiya Y, Kawaura K, Onishi K, Endo M et al
(2021) In planta genome editing in commercial wheat varieties. Front Plant Sci 12:648841
Lujan Basile SM, Ramirez IA, Crescente JM, Conde MB, Demichelis M, Abbate P, Rogers WJ,
Pontaroli AC, Helguera M, Vanzetti LS (2019) Haplotype block analysis of an Argentinean
hexaploid wheat collection and GWAS for yield components and adaptation. BMC Plant Biol
19:553
Ma K, Li X, Li Y, Wang Z, Zhao B, Wang B, Li Q (2021) Disease resistance and genes in
146 wheat cultivars (Lines) from the Huang-Huai-Hai Region of China. Agronomy 11:1025
Mago R, Verlin D, Zhang P, Bansal U, Bariana H, Jin Y, Ellis J, Hoxha S, Dundas I (2013)
Development of wheat-Aegilops speltoides recombinants and simple PCR-based markers for
Sr32 and a new stem rust resistance gene on the 2S#1 chromosome. Theor Appl Genet 126:
2943–2955
Mago R, Zhang P, Vautrin S, Simkova H, Bansal U, Luo MC, Rouse M, Karaoglu H, Periyannan S,
Kolmer J, Jin Y, Ayliffe MA, Bariana H, Park RF, McIntosh R, Dolezel J, Bergès H,
Spielmeyer W, Lagudah ES, Ellis JG, Dodds PN (2015) The wheat Sr50 reveals a rich diversity
at a cereal disease resistance locus. Nat Plants 15:186
Maqbool A, Saitoh H, Franceschetti M, Stevenson CEM, Uemura A, Kanzaki H, Kamoun S,
Terauchi R, Banfield MJ (2015) Structural basis of pathogen recognition by an integrated HMA
domain in a plant NLR immune receptor. elife 4:e08709
Mascher M, Jost M, Kuon JE, Himmelbach A, Assfalg A, Beier S, Scholz U, Graner A, Stein N
(2014) Mapping-by sequencing accelerates forward genetics in barley. Genome Biol 15:R78
158 A. Choudhary et al.
Mehta S, Lal SK, Sahu KP, Venkatapuram AK, Kumar M, Sheri V, Varakumar P, Vishwakarma C,
Yadav R, Jameel MR, Ali M, Achary VMM, Reddy MK (2020) CRISPR/Cas9-edited rice: a
new frontier for sustainable agriculture. In: New frontiers in stress management for durable
agriculture. Springer, Singapore, pp 427–458
McCallum BD, Hiebert CW, Cloutier S, Bakkeren G, Rosa SB, Humphreys DG, Marais GF,
McCartney CA, Panwar V, Rampitsch C, Saville BJ, Wang X (2016) A review of wheat leaf
rust research and the development of resistant cultivars in Canada. Can J Plant Pathol 38:1–18
McDonald BA, Linde C (2002) Pathogen population genetics, evolutionary potential, and durable
resistance. Annu Rev Phytopathol 40:349–379
Miedaner T, Juroszek P (2021) Climate change will influence disease resistance breeding in wheat
in Northwestern Europe. Theor Appl Genet 134:1771–1785
Mujeeb-Kazi A, Munns R, Rasheed A, Ogbonnaya FC, Ali N, Hollington P, Dundas I, Saeed N,
Wang R, Rengasamy P, Saddiq MS (2019) Breeding strategies for structuring salinity tolerance
in wheat. Adv Agron 155:121–187
Muñoz IV, Sarrocco S, Malfatti L, Baroncelli R, Vannacci G (2019) CRISPR-Cas for fungal
genome editing: a new tool for the management of plant diseases. Front Plant Sci 10:135.
https://doi.org/10.3389/fpls.2019.00135
Murray GM, Brennan JP (2009) Estimating disease losses to the Australian wheat industry.
Australas Plant Pathol 38:558–570
Olivera Firpo P, Newcomb M, Szabo L, Rouse MN, Johnson JL, Gale SW, Luster D, Hodson D,
Cox JA, Burgin L (2015) Phenotypic and genotypic characterization of race TKTTF of Puccinia
graminis f. sp. tritici that caused a wheat stem rust epidemic in southern Ethiopia in 2013/14.
Phytopathology 105:917–928
Olivera Firpo P, Newcomb M, Flath K, Sommerfeldt-Impe N, Szabo L, Carter M, Luster D, Jin Y
(2017) Characterization of Puccinia graminis f. sp. tritici isolates derived from an unusual
wheat stem rust outbreak in Germany in 2013. Plant Pathol 66:1258–1266
Pardey P, Beddow J, Kriticos D, Hurley T, Park R, Duveiller E, Sutherst R, Burdon J, Hodson D
(2013) Right-sizing stem-rust research. Science 340:147–148
Pasquariello M, Berry S, Burt C (2020) Yield reduction historically associated with the Aegilops
ventricosa 7D
V
introgression is genetically and physically distinct from the eyespot resistance
gene Pch1. Theor Appl Genet 133:707–717
Paul NC, Park S-W, Liu H, Choi S, Ma J, MacCready JS, Chilvers MI, Sang H (2021) Plant and
fungal genome editing to enhance plant disease resistance using the CRISPR/Cas9 System.
Front Plant Sci 12:700925
Periyannan S, Milne RJ, Figueroa M, Lagudah ES, Dodds PN (2017) An overview of genetic rust
resistance: from broad to specific mechanisms. PLoS Pathog 13:e1006380
Pretorius ZA, Singh RP, Wagoire WW, Payne TS (2000) Detection of virulence to wheat stem rust
resistance gene Sr31 in Puccinia graminis. f. sp. tritici in Uganda. Plant Dis 84:203
Pretorius Z, Bender C, Visser B, Terefe T (2010) First report of a Puccinia graminis f. sp. tritici race
virulent to the Sr24 and Sr31 wheat stem rust resistance genes in South Africa. Plant Dis 94:784
Prins R, Groenewald JZ, Marais G, Snape J, Koebner R (2001) AFLP and STS tagging of Lr19, a
gene conferring resistance to leaf rust in wheat. Theor Appl Genet 103:618–624
Qi T, Zhu X, Tan C, Liu P, Guo J, Kang Z (2018) Host-induced gene silencing of an important
pathogenicity factor P s CPK 1 in Puccinia striiformis f. sp tritici enhances resistance of wheat to
stripe rust. Plant Biotechnol J 16:797–807
Qi T, Guo J, Liu P, He F, Wan C, Islam MA (2019) Stripe rust effector PstGSRE1 disrupts nuclear
localization of ROS-promoting transcription factor TaLOL2 to defeat ROS-induced defense in
wheat. Mol Plant 12:1624–1638
Raffan S, Sparks C, Huttly A, Hyde L, Martignago D, Mead A, Hanley SJ, Wilkinson PA,
Barker G, Edwards KJ et al (2021) Wheat with greatly reduced accumulation of free asparagine
in the grain, produced by CRISPR/Cas9 editing of asparagine synthetase gene TaASN2. Plant
Biotechnol J 19(8):1602–1613
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 159
Rai R, Das BK, Bhagwat SG (2017) Development and validation of scar marker for stem rust
resistance gene Sr26 in wheat (Triticum aestivum L.). Biol Syst Open Access 6:181
Rasool G, Ullah A, Jan A, Waris M, Tariq MA, Ahmad Q (2021) Morphological evaluation of
wheat genotypes for grain yield under arid environment of Balochistan. Pure Appl Biol 10:
1441–1449
Razzaq A, Kaur P, Akhter N, Wani SH, Saleem F (2021) Next-generation breeding strategies for
climate-ready crops. Front Plant Sci 12:620420
Rong W, Qi L, Wang J, Du L, Xu H, Wang A, Zhang Z (2013) Expression of a potato antimicrobial
peptide SN1 increases resistance to take-all pathogen Gaeumannomyces graminis var. tritici in
transgenic wheat. Funct Integr Genomics 13:403–409
Rong W, Qi L, Wang A, Ye X, Du L, Liang H, Xin Z, Zhang Z (2014) The ERF transcription factor
TaERF3 promotes tolerance to salt and drought stresses in wheat. Plant Biotechnol J 12:468–
479
Różewicz M, Wyzińska M, Grabiński J (2021) The most important fungal diseases of cereals—
problems and possible solutions. Agronomy 11:714
Sack GM (2020) Editing Fusarium graminearum using CRISPR/Cas9. Honors Program Theses,
p 431
Sanchez-Martın J, Steuernagel B, Ghosh S, Herren G, Hurni S, Adamski N, Vrana J,
KubalákováM, Krattinger SG, Wicker T (2016) Rapid gene isolation in barley and wheat by
mutant chromosome sequencing. Genome Biol 17:221
Satheesh V, Zhang H, Wang X, Lei M (2019) Precise editing of plant genomes–prospects and
challenges. In: Seminars in cell and developmental biology, vol 96. Academic Press, pp
115–123
Schenke D, Cai D (2020) Applications of CRISPR/Cas to improve crop disease resistance: beyond
inactivation of susceptibility factors. Science 23:101478. https://doi.org/10.1016/j.isci.2020.
101478
Schumann GL, D’Arcy CJ (2009) Essential plant pathology. APS Press, St. Paul, MN
Segretin ME, Pais M, Franceschetti M, Chaparro-Garcia A, Bos JIB, Banfield MJ, Kamoun S
(2014) Single amino acid mutations in the potato immune receptor R3a expand response to
Phytophthora effectors. Mol Plant-Microbe Interact 27:624–637
Shabeer A, Bockus WW (1988) Tan spot effects on yield and yield components relative to growth
stage in winter wheat. Plant Dis 72:599–602
Shahriar SA, Islam MN, Chun CNW, Rahim MA, Paul NC, Uddain J, Siddiquee S (2021) Control
of plant viral diseases by CRISPR/Cas9: resistance mechanisms, strategies and challenges in
food crops. Plan Theory 10:1264
Shakeel A, Xiangjin W, Zhonghua S, Peisong H, Shaoqing T (2020) CRISPR/Cas9 for develop-
ment of disease resistance in plants: recent progress, limitations and future prospects. Brief
Funct Genom 19:26–39
Shakeel A, Liqun T, Rahil S, Amos M, Gundra SR, Shakra J, Chen W, Zhonghua S, Gaoneng S,
Xiangjin W, Peisong H, Magdy M, Shikai H, Shaoqing T (2021) CRISPR-based crop
improvements: a way forward to achieve zero hunger. J Agric Food Chem 69:8307–8323
Sheikh SK, Vishal G, Devanshi P, Sonali A, Dechan C, Saima F, Rafakat H (2021) Epidemiology
of stripe rust of wheat: a review. Int J Curr Microbiol App Sci 10:1158–1172
Simón MR, Börner A, Struik PC (2021) Editorial: fungal wheat diseases: etiology, breeding, and
integrated management. Front Plant Sci 12:671060
Singh S, Franks CD, Huang L (2004) Lr41, Lr39, and a leaf rust resistance gene from Aegilops
cylindrica may be allelic and are located on wheat chromosome 2DS. Theor Appl Genet 108:
586–591
Singh RP, Hodson DP, Huerta-Espino J, Jin Y, Bhavani S, Njau P, Herrera-Foessel S, Singh PK,
Singh S, Govindan V (2011) The emergence of Ug99 races of the stem rust fungus is a threat to
world wheat production. Annu Rev Phytopathol 49:465–481
Singh RP, Hodson DP, Jin Y, Lagudah ES, Ayliffe MA, Bhavani S, Rouse MN, Pretorius ZA,
Szabo LJ, Huerta-Espino J, Basnet BR, Lan C, Hovmøller MS (2015) Emergence and spread of
new races of wheat stem rust fungus: continued threat to food security and prospects of genetic
control. Phytopathology 105:872–884
160 A. Choudhary et al.
Singh V, Singh G, Chaudhury A, Ojha A, Tyagi BS, Chowdhary AK, Sheoran S (2016)
Phenotyping at hot spots and tagging of QTLs conferring spot blotch resistance in bread
wheat. Mol Biol Rep 43:1–11
Singh M, Nara U, Kumar A, Thapa S, Chandan J, Singh H (2021a) Enhancing genetic gains through
marker-assisted recurrent selection: from phenotyping to genotyping. Cereal Res Commun.
https://doi.org/10.1007/s42976-021-00207-4
Singh M, Nara U, Kumar A, Choudhary A, Singh H, Thapa S (2021b) Salinity tolerance
mechanisms and their breeding implications. J Gen Eng Biotech 19:173
Singh A, Mehta S, Yadav S, Nagar G, Ghosh R, Roy A, Chakraborty A, Singh IK (2022) How to
cope with the challenges of environmental stresses in the era of global climate change: an update
on ROS stave off in plants. Int J Mol Sci 23:1995
Steuernagel B, Periyannan SK, Hernández-Pinzón I, Witek K, Rouse MN, Yu G et al (2016) Rapid
cloning of disease-resistance genes in plants using mutagenesis and sequence capture. Nat
Biotechnol 34(6):652–655
Su Z, Bernardo A, Tian B, Chen H, Wang S, Ma H, Cai S, Liu D, Zhang D, Li T (2019) A deletion
mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat Genet 51:
1099–1105
Tang S, Hu Y, Zhong S, Luo P (2018) The potential role of powdery mildew-resistance gene Pm40
in Chinese wheat-breeding programs in the Post-Pm21 Era. Engineering 4:500–506
Tehseen MM, Kehel Z, Sansaloni CP, Lopes MDS, Amri A, Kurtulus E, Nazari K (2021)
Comparison of genomic prediction methods for yellow, stem, and leaf rust resistance in wheat
landraces from Afghanistan. Plan Theory 10:558
Tembo B, Mulenga RM, Sichilima S, M’siska KK, Mwale M, Chikoti PC (2020) Detection and
characterization of fungus (Magnaporthe oryzae pathotype Triticum) causing wheat blast
disease on rain-fed grown wheat (Triticum aestivum L.) in Zambia. PLoS One 15:e0238724
Thind AK, Wicker T, Simkova H, Fossati D, Moullet O, Brabant C, Vrana J, Dolezel J, Krattinger
SG (2017) Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range
chromosome assembly. Nat Biotechnol 35:793–796
Tyagi S, Kumar R, Kumar V, Won SY, Shukla P (2021) Engineering disease resistant plants
through CRISPR-Cas9 technology. GM Crops & Food 12:125–144
Varga E, Wiesenberger G, Hametner C, Ward TJ, Dong Y, Schöfbeck D, Mccormick S, Broz K,
Stückler R, Schuhmacher R, Krska R, Kistler HC, Berthiller F, Adam G (2015) New tricks of an
old enemy: isolates of Fusarium graminearum produce a type A trichothecene mycotoxin.
Environ Microbiol 17:2588–2600
Verma AK, Mandal S, Tiwari A, Monachesi C, Catassi GN, Srivastava A, Gatti S, Lionetti E,
Catassi C (2021) Current status and perspectives on the application of CRISPR/Cas9 gene-
editing system to develop a low-gluten. Non-Transgenic Wheat Variety Foods 10:2351
Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C et al (2014) Simultaneous editing of three
homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat
Biotechnol 32:947–951. https://doi.org/10.1038/nbt.2969
Wang H, Sun S, Ge W, Zhao L, Hou B, Wang K, Lyu Z, Chen L, Xu S, Guo J (2020) Horizontal
gene transfer of Fhb7 from fungus underlies Fusarium head blight resistance in wheat. Science
368:eaba5435
Wellings CR (2011) Global status of stripe rust: a review of historical and current threats. Euphytica
179:129–141
Williamson VM, Thomas V, Ferris H, Dubcovsky J (2013) An Aegilops ventricosa translocation
confers resistance against root-knot nematodes to common wheat. Crop Sci 53:1412–1418
Worku D, Zerihun T, Daniel K, Habtemariam Z, Dawit A, Wanyera R (2016) Development of
wheat germplasm for stem rust resistance in eastern Africa. Afr Crop Sci J 24:25–33
Wulff BBH, Moscou MJ (2014) Strategies for transferring resistance into wheat: from wide crosses
to GM cassettes. Front Plant Sci 5:692
8 Breeding Strategies for Developing Disease-Resistant Wheat: Present, Past,... 161
Yan F, Zheng Y, Zhang W (2006) Obtained transgenic wheat expressing pac1 mediated by
Agrobacterium is resistant against Barley yellow dwarf virus-GPV. Chin Sci Bull 51:2362–
2368
Zaidi SS, Mahas A, Vanderschuren H, Mahfouz MM (2020) Engineering crops of the future:
CRISPR approaches to develop climate-resilient and disease-resistant plants. Genome Biol 21:
289
Zaynab M, Sharif Y, Fatima M, Afzal MZ, Aslam MM, Raza MF et al (2020) CRISPR/Cas9 to
generate plant immunity against pathogen. Microb Pathog 141:103996. https://doi.org/10.1016/
j.micpath.2020.103996
Zhang Z, Liu X, Wang X, Zhou M, Zhou X, Ye X, Wei X (2012) An R2R3 MYB transcription
factor in wheat, TaPIMP1, mediates host resistance to Bipolaris sorokiniana and drought
stresses through regulation of defense- and stress-related genes. New Phytol 196:1155–1170
Zhang Q, Wang Q, Wang X, Liu J, Li M, Huang L, Kang Z (2013) Target of tae-miR408, a
chemocyanin-like protein gene (TaCLP1), plays positive roles in wheat response to high-
salinity, heavy cupric stress and stripe rust. Plant Mol Biol 83:433–443
Zhang Y, Bai Y, Wu G, Zou S, Chen Y, Gao C, Tang D (2017a) Simultaneous modification of three
homoeologs of TaEDR1 by genome editing enhances powdery mildew resistance in wheat.
Plant J 91:714–724
Zhang Y, Bai Y, Wu G, Zou S, Chen Y, Gao C, Tang D (2017b) Simultaneous modification of three
homoeologs of TaEDR1 by genome editing enhances powdery mildew resistance in bread
confers heritable resistance to powdery mildew. Nat Biotechnol 32:947–951
Zhang Y, Geng H, Cui Z, Wang H, Liu D (2021) Functional analysis of wheat NAC transcription
factor, TaNAC069, in regulating resistance of wheat to leaf rust fungus. Front Plant Sci 12:
604797
Zhao TJ, Zhao SY, Chen HM, Zhao QZ, Hu ZM, Hou BK, Xia GM (2006) Transgenic wheat
progeny resistant to powdery mildew generated by Agrobacterium inoculum to the basal portion
of wheat seedling. Plant Cell Rep 25:1199–1204
163
Potential Breeding Strategies
for Developing Disease-Resistant Barley:
Progress, Challenges, and Applications
9
H. S. Mahesha, Ravi Prakash Saini, Tejveer Singh, A. K. Singh,
and R. Srinivasan
Abstract
There is a pressing call for enhancing world food production by at least 60% by
2050 using the same acreage. Barley (Hordeum vulgare L.), considered to be a
risk-avoidance crop, is the fourth-most important grain crop in the world in terms
of production after maize, wheat, and rice. The major barley producing countries
are the Russian Federation, Germany, Canada, France, Spain, and Ukraine.
Cultivated barley is an annual self-pollinating, true diploid (2n¼2x¼14) cereal,
primarily grown for its grain and mainly used as feed for livestock. The rest of the
barley grain is used as malted barley, as well as for human food and health food.
Barley also yields valuable forage that can be grazed; cut for green forage, hay or
silage while still green; cut for dual purpose (green forage and grain); or cut for
straw after grain harvest. Cultivated barley is adapted to stress-prone
environments, marginal and waste lands. Its wider adaptability, however, exposes
the barley crop to different biotic stresses such as insects, phytopathogens, and
weeds. Among them, plant pathogens are the most important constraints for the
quality production of barley. Although more than 250 different plant pathogens
infect barley, only a few of them cause considerable economic yield loss. In
commercial barley production, disease management relies heavily on fungicide
applications around the globe, which leads to higher production costs. Further,
the heavy doses of fungicides create residue problems in fodder and grain and
also lead to the development of resistant races or pathotypes. Hence, the best
approach for managing barley diseases is by developing disease-resistant
varieties. Earlier, the classical breeding approaches were followed to develop
resistant varieties, but this approach provides only short-term relief, and the
H. S. Mahesha · R. P. Saini · T. Singh · A. K. Singh · R. Srinivasan (*)
ICAR-Indian Grassland and Fodder Research Institute, Jhansi, India
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_9
breakdown of resistance occurs very fast. To overcome these challenges,
researchers changed their aim to advance breeding strategies with new molecular
approaches like marker-assisted selection (MAS); marker-assisted backcrossing
(MABC); targeting induced local lesions in genomes (TILLING); RNA interfer-
ence (RNAi); virus-induced gene silencing (VIGS); genome editing; and
RNA-dependent DNA methylation (RdDM) to breed disease-resistant barley
varieties.
164 H. S. Mahesha et al.
Keywords
Disease resistance · Molecular breeding · Powdery mildew · Rusts · Spot blotch ·
Stripe disease · Smut disease
9.1 Introduction
Cultivated barley, botanically known as Hordeum vulgare (L.), is the earliest
domesticated coarse cereal (Zohary and Hopf 2000; Harwood 2019) in the Poaceae
family, grown during the winter season. It is the fourth most important grain crop
grown in the world after maize, rice, and wheat, with a share of 7% of global cereal
production (Gangwar et al. 2018; Reddy et al. 2014). Barley is primarily grown for
its grain, which is mainly used as animal feed. The second use of barley grain is as
malted barley for alcoholic beverages, particularly beer. Barley grain is used as
human food as well as healthy food. The main type of fiber found in whole grains is
beta-glucan. It is also commonly used in the preparation of bread, soups, cakes, and
other healthy products. Almost 70% of total barley production is used for cattle and
poultry feed, 25% for malt and malt extract, and 5% for human consumption
(Gangwar et al. 2018; Singh et al. 2016). Barley produces valuable forage in addition
to grain, which can be grazed, cut for green forage, hay, or silage while still green in
the field, cut for dual purpose (first for green forage at vegetative stage and then
regenerated for grain), or cut for straw after grain harvest. Barley straw is used as
fodder for ruminants and as bedding material. Cultivated barley is a self-pollinating,
diploid (2n¼2x¼14), annual temperate grass capable of growing in various stress
conditions like salinity, drought, higher altitude, and low fertilization. Hence, this
characteristic makes barley grow in marginal and waste lands, so it is also known as
the poor man’s crop (Verma et al. 2012).
On the basis of spike morphology, barley is grouped into two types: two row and
six row, while on the basis of growth habit into three types: winter, spring, and
facultative (Poehlman 1994). It is also classified into hulled and hulless barley on the
basis of grain type. The lemma and palea are fused to the pericarp in hulled barley,
whereas chaff is easily separated from the grain in hulless type. Hulless barley is
used for human consumption due to its higher nutritive value. Barley grain consists
of 20% of dietary fiber and 3–7% of β-glucan (Oscarsson et al. 1996). The β-glucan
of barley has significant blood cholesterol-lowering effects (Martinez et al. 1991).
Moreover, Barley-glucan and non-starch polysaccharide increase the viscosity of
food material in the intestine which decreases its rate of digestion and absorption
(Anderson et al. 1990; Newton et al. 2011), thus useful to people with diabetes
(Gosain 1996). Because of its multifarious utilities, nutritive value, and increased
industrial demand, sustainable yield gains will be needed over future decades.
However, biotic stresses are the most serious constraints to barley production in
which phytopathogens cause total crop loss to the tune of about 20–45% (Bellard
et al. 2012;Savary et al. 2012). Barley is infected by more than 80 different plant
pathogens which cause diseases like yellow and brown rust, covered smut, powdery
mildew, net blotch, spot blotch, barley stripe, barley yellow dwarf, and molya
diseases which are economically important in a global context (Mathre 1997).
Disease resistance has been the second highest priority after grain yield in barley
breeding. Here, we are trying to highlight the major diseases of barley along with
their major symptoms and disease developmental conditions. We are also including
various molecular techniques that have been utilized in the discovery and classifica-
tion of disease-resistant genes in barley.
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 165
9.2 Major Diseases of Barley
The wider adaptability exposes the barley crop to different biotic stresses such as
insects, phytopathogens, and weeds. Among them, diseases are the most important
constraint for the production of quality barley (Pessarakli 2016). Phytopathogens
include fungi, bacteria, plant parasitic nematodes, and viruses that cause infection in
cultivated barley. The most important diseases responsible for considerable losses
are mentioned below.
9.2.1 Powdery Mildew
It’s a common disease of cultivated barley, caused by fungal pathogen Blumeria
graminis f. sp. hordei. Early infection can cause yield loss to the tune of 25%, while
infection at later stages affects yield loss by 10%. The disease incidence is more
during the early crop growth stage, but symptoms are first noticed at tillering stage
(Fig. 9.1). Both winter and spring barley varieties are susceptible to powdery mildew
disease. Blumeria graminis f. sp. hordei is a biotrophic pathogen and disease is
favored by cool (15–25 C) and humid weather, but can also occur in warmer and
semiarid environments. The important symptoms of the disease are whitish, fuzzy
fungal mycelium seen on the surface of leaves. Later, powdery or fluffy white
pustules of conidial chain are noticed on the leaves. The entire spikes of plants can
be infected with powdery mildew in addition to the leaves and leaf sheaths.
166 H. S. Mahesha et al.
Fig. 9.1 Powdery mildew in
barely
9.2.2 Rusts
Rusts are the most devastating diseases of barley (Duplessis et al. 2011), and these
pathogens have evolved further into many distinct physiological races or pathotypes.
Barley is infected by four different rusts, i.e., stem, leaf, yellow, and crown rust, all
caused by members of the genus Puccinia, family Pucciniaceae, order Pucciniales,
class Pucciniomycetes, subphylum Pucciniomycotina, Phylum Basidiomycota,
kingdom Fungi, and domain Eukarya (Bauer et al. 2006).
9.2.2.1 Black Stem Rust
Black stem rust of barley caused by Puccinia graminis f. sp. tritici is the most
important disease. It infects the crop late in the season; therefore, the losses are
minimal. The symptoms that develop predominantly occur on the leaf, blade, sheath,
and stem. Severe infections with many stem lesions may weaken plant stems and
result in the breaking of stems at the point of infection. Initially, rust pustules are
reddish-brown and later turn into black telia containing teliospores (Bhardwaj et al.
2017). Favorable conditions for infection require a temperature range of 15–28 C
with 6–8 h of free moisture on the leaf surface. Secondary infection occurs if wet
weather persists and the temperature remains in the range of 26–30 C. Several
cycles of uredospore production occur during the growing season.
9.2.2.2 Crown Rust
Crown rust of barley is caused by Puccinia coronate f. sp. hordei. Outbreak of crown
rust disease on barley was seen during 1991 in south central Nebraska, U.S.A. (Jin
and Steffenson 1999). Pathogen infects leaf blades, leaf sheaths, peduncles, and
awns. Symptoms starts on leaf blades; uredial pustules are linear, oblong with orange
to yellow color, followed by chlorosis.
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 167
9.2.2.3 Yellow (Stripe) Rust
Yellow rust is an important foliar disease of barley caused by Puccinia striiformis
f. sp. hordei. Early infection of yellow rust causes severe yield loss and also prevents
spike emergence or grain formation/development (Prakash and Verma 2009). In
cooler climates (2–15 C), the disease is more severe, followed by prolonged leaf
wetness (8–10 h). Uredial pustules are seen on leaves as narrow stripes that are
orange to yellow in color, and as disease progresses, the yellow stripes continue to
enlarge because of the partial systemic nature of pathogens. Black telia readily
develops from uredia as infected barley plants approach maturity. The uredial and
telial spore stages of P. striiformis f. sp. hordei occur on barley and various Hordeum
spp. (Marshall and Sutton 1995).
9.2.2.4 Leaf (Brown) Rust
Leaf rust, or brown rust, is a sporadic and most common disease of barley, caused by
the basidiomycota fungi Puccinia hordei. Small orange or brown uredial pustules are
mainly scattered on the upper surface of the leaf. Infection is also seen on the leaf
sheath. Uredial pustules are surrounded by chlorotic halos, or green islands. Sec-
ondary spread occurs by urediospore, which is formed within 7 to 10 days after
infection. A temperature ranging from 20 to 25 C and prolonged wet weather are
prerequisites for the faster spread of the disease.
9.2.3 Spot Blotch
Spot blotch, caused by the fungus Bipolaris sorokiniana (teleomorph: Cochliobolus
sativus), is a major foliar disease of barley (Arabi and Jawhar 2004). It occurs in the
warmer and more humid regions of the world. Yield losses in susceptible varieties
range from 10% to 30%. Spot blotch disease development is favorable when
temperatures are 15–22 C and relative humidity is greater than 90%. Hence, the
spot blotch disease of barley is considered to be one of the major threats to barley
production under climate change (Singh et al. 2014a,b). Infection is characterized by
small, dark brown lesions. As disease progresses, lesions are restricted in width by
leaf veins and turn dark brown with a chlorotic margin. Heavily infected leaves dry
out and die prematurely. If inoculum is available and the environmental conditions
are conducive to infection, the kernel blight phase (black point) of this disease may
develop.
9.2.4 Stripe Disease
Stripe disease of barley is caused by Drechslera gramineae, and the fungal pathogen
causes systemic infection only in barley. Symptoms start as small lesions on
seedlings and the most characteristic symptoms are long, narrow, and straw-colored
streaks or stripes that appear on the leaves. Later, parallel stripes may extend the
entire length of the leaf blade. The light straw-colored streaks soon turn to brown,
which leads to the drying out and splitting of the leaf blade. Severely infected plants
shrivel and die prematurely. Infected plants are severely stunted with few tillers and
the spikes fail to emerge. The ears that do emerge are greyish brown, withered,
twisted, erect, and often barren. The fungal pathogen remains alive for 3 years.
168 H. S. Mahesha et al.
9.2.5 Net Blotch
The fungal pathogen fungi Pyrenophora teres causes barley net blotch, an important
and destructive disease of barley. Under favorable environmental conditions, the
disease can be prevented (Murray and Brennan 2010). Disease has the potential to
cause yield losses of 10–44% in susceptible cultivars. Small dark brown lesions are
seen on leaves, sheaths, and glumes, which later develop into short brown stripes or
irregular blotches. Lesions may be surrounded by a yellow area. The ear can also be
infected, but lesions do not usually appear. The infection is more severe in humid
periods lasting for 10 or more hours at an optimum temperature of 15–20 C.
9.2.6 Smut Diseases
9.2.6.1 Loose Smut
Loose smut, an internally seed-borne disease of barley, is caused by Ustilago tritici.
When an infected seed germinates, the dormant mycelium inside the seed begins to
grow and causes systemic infection. The smut pathogen shows host specialization,
i.e., isolates that attack wheat do not attack barley and vice versa. The most obvious
symptoms occur only after the emergence of spikes. Infected ear heads emerge
earlier than normal, and grains are replaced with a mass of dark brown to black
teliospores. Disease spread is by wind-blown teliospores from smutted ears to
adjacent healthy flowering ears of barley. The teliospores grow and invade the
female parts of barley flowers. They then spread to the developing embryo.
9.2.6.2 Covered Smut
Covered smut of barley is one of the most common diseases caused by Ustilago
hordei. Smutted ear heads emerge at the same time or slightly later than healthy
plants. All the grains in the diseased spike and the entire spikes in the diseased plants
are infected. All the infected grains in the diseased spike are transformed into masses
of teliospores and these teliospores are held by tough greyish white membrane. The
membrane is the glume that usually remains intact until harvest or threshing.
9.2.7 Barley Yellow Dwarf Disease
It is caused by the Barley Yellow Dwarf Virus (BYDV), a member of the Luteovirus
group. The virus causes a 100% yield loss if infection occurs at an early stage of
growth (Mathre 1997). Initial symptoms are seen in plants randomly scattered in the
field. The most common noticeable symptoms are yellowing of leaves and a
reduction in the growth of plants, which appear either singly or in small patches.
Discoloration in shades of yellow, red, or purple is observed in the leaves of infected
plants, which typically starts at the tip or margin and moves towards the downside or
midrib, respectively. Leaves stand upright and rigid with rough leaf margins along
with less tillering, flowering, and sterile florets, which results in fewer filled and
smaller kernels with corresponding yield losses.
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 169
9.3 Sources of Disease-Resistant Genes
In the absence of genetic resistance, crop production is highly dependent on chemi-
cal control of pathogens. Barley disease management depends on repeated applica-
tion of chemical fungicides, but use of resistant varieties offers both an economical
and an environmentally sound method of management. The development of resistant
varieties is complicated and needs time, besides being broken by different
pathotypes of the pathogen. Bovill et al. (2010) attempted to identify the source of
resistance against spot blotch disease of barley caused by Bipolaris sorokiniana
(teleomorph: Cochliobolus sativus). Australian barley cultivars are highly suscepti-
ble to spot blotch disease, and hence, resistance sources have been identified in
North American two-row barley lines. In adult plants, spot blotch-resistant QTL
were found on chromosomes 3HS and 7HS, but seedling resistance is controlled by a
locus on chromosome 7HS. A total of 124 accessions of two-row barley were
screened for spot blotch resistance for 3 years under natural epiphytotic conditions
(Singh et al. 2014a,b). Accessions, viz. BCU422, BCU1204, and BCU5092, are
identified as resistant sources against the spot blotch pathogen, while BCU711,
K603, and RD2506 are noted as the most susceptible fungal pathogens to Bipolaris
sorokiniana. Several resistance genes (Mla1-Mla31 except Mla4, and Mlmr) are
identified against powdery mildew disease in barley and many more specific
resistances have been detected in cultivars, landraces, and wild barley. Dreiseitl
(2011) described three specific powdery mildew-resistant genes (Ml (Ro), MlaLv,
and Ml (Ve)); they are widely used in commercial cultivars. In 20 barley accessions,
39 powdery mildew-resistant genes are identified (Mastebroek et al. 1995). Dreiseitl
and Bockelman (2003) screened 1383 accessions collected from United States
Department of Agriculture (National Small Grains Collection). Among 1383
accessions, 123 accessions were resistant to 22 isolates.
9.4 Breeding Approaches for Disease Resistance
Durable resistance offers great prospective for global food security and
sustainability. Developing high-yielding barley varieties with enhanced resistance
to biotic and abiotic stresses and improved quality for feed, malt, food, and fodder is
imperative. Presently, researchers are trying to bring two or more desirable traits
together, like, for example, higher yield with enhanced resistance towards different
biotic and abiotic factors and improved dietary value of grain and fodder. Classical,
genetic, molecular, and new breeding approaches/technologies against diseases in
barley are mentioned in Table 9.1.
170 H. S. Mahesha et al.
Table 9.1 Various approaches for disease resistance breeding in barley
S. No. Approaches
1 Conventional breeding
•Introduction of exotic lines
•Selection
•Hybridization
•Backcrossing
•Mutagenesis using chemicals and radiations
2 Marker-assisted breeding
•Marker-assisted selection
•Marker-assisted backcrossing
•Genome-wide association mapping
•Genomic selection
3 Targeting induced local lesions in genome
•Eco-TILLING
•DEco-TILLING
4 Transgenics
•Agrobacterium-mediated transformation and regeneration protocols
•RNA interference
•Virus-induced gene silencing
•Genome editing tools
•Overexpression of genes
•Tissue or developmental stage-specific expression of genes
•Constitutive expression of genes
•Promoter trap
•Enhancer trap
The modern high-yielding barley varieties and breeding lines developed world-
wide are found to have a restricted genetic base in contrast to their natural ancestors
as most of the breeding objectives were mainly restricted to fewer traits (Caldwell
et al. 2005). Due to narrow genetic diversity, cultivated barley gene pool is vulnera-
ble to various diseases. The gene pool of cultivated barley was defined and the wild
progenitor, H. vulgare subsp. Spontaneum, is classified in the primary, H. bulbosum
in the secondary, while all other species in the tertiary gene pool. Crop wild relatives
are bestowed with desirable agronomic and stress-(biotic and abiotic) resistant traits
which could be useful for plant breeding initiatives. Due to limited variability of
resistant genetic resources in the cultivated gene pool of barley, significant attempts
have been made to introduce promising alleles from natural ancestors and landraces
into current breeding populations (Schmalenbach et al. 2008; Friedt et al. 2011).
Globally, around 4,66,531 accessions of barley gene pool are conserved, mainly
by Canada and USA (FAO 2010). In order to increase the utilization of conserved
barley germplasm for breeding programme, Knüpffer and van Hintum (2003)
formed two core collections of wild barley (one with 70 accessions and another
144 accessions), while Steffenson et al. (2007) established Wild Barley Diversity
Collection (WBDC) with 318 accessions. These core subsets are presently preserved
at the International Centre for Agricultural Research in the Dry Areas (ICARDA),
Aleppo, Syria. Fu and Horbach (2012) developed a core subset of 269 accessions
representing 16 countries from the collection of 3782 accessions. Neupane et al.
(2015) assessed 2062 accessions and identified 15 of them to have effective resis-
tance against four diverse isolates of Pyrenophora teres maculata collected world-
wide. Cope et al. (2021)analyzed 131 heritage cultivars and landrace lines of barley
against four diverse isolates of Barley ‘Scald’and three lines with new source of
resistance were identified. The disease resistance against leaf stripe (Drechslera
graminea) was reported in wild barley (Hordeum spontaneum) and barley landraces
(Oğuz 2019). Fetch et al. (2003) reported high frequency of resistance for septoria
speckled leaf blotch, leaf rust, net blotch, powdery mildew; intermediate for spot
blotch; and low for stem rust in Hordeum spontaneum. They also reported two
H. spontaneum accessions (Shechem 12–32 and Damon 11–11) having resistance
for all the six diseases as mentioned. Hordeum bulbosum L. (2n¼4x¼28) belongs
to the secondary gene pool of cultivated barley and has long been searched for novel
disease-resistant alleles (Pickering et al. 2006; Fetch et al. 2009). The quantitative
barley leaf rust resistance gene, Rph26, was fine-mapped within a H. bulbosum
introgression on barley chromosome 1HL for pyramiding with other resistance
genes (Xiaohui et al. 2018).
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 171
In barley, chromosome substitution lines (CSL) (Matus et al. 2003; Inostroza
et al. 2008), nested association mapping (NAM) panels (Schnaithmann et al. 2014),
advanced backcross lines (Pillen et al. 2003; Nice et al. 2016), and multi-parent
segregating populations (MAGIC) (Sannemann et al. 2015) are being utilized for the
identification of QTLs/genes responsible for disease resistance. Leng et al. (2018)
identified, fine-mapped, and physically anchored a dominant spot blotch suscepti-
bility gene Scs6 to a 125 kb genomic region containing the Mla locus on barley
chromosome 1H against pathotype 2 isolate (ND90Pr) of C. sativus in barley
cultivar Bowman. Leng et al. (2020) also mapped genetic loci controlling spot
blotch and powdery mildew diseases of barley using 138 recombinant inbred lines
(RILs). They recognized two QTLs, QSbs-1H-P1 and QSbs-7H-P1, responsible for
spot blotch on chromosomes 1H and 7H, respectively. Hickey et al. (2017) applied a
novel modified backcross strategy for rapid trait introgression to the European
two-rowed barley cultivar, Scarlett. Hautsalo et al. (2021) used four Multi-parent
Advanced Generation Inter-Cross (MAGIC) populations in Genome-Wide Associa-
tion Studies (GWAS) and identified nine areas on chromosomes 1H, 3H, 4H, 5H,
6H, and 7H associated with resistance, in which three of these regions are putatively
novel resistance sources. Pogoda et al. (2020) assessed the severity of powdery
mildew infection on detached seedling leaves of 267 barley accessions using two
poly-virulent isolates and identified four candidate genes against powdery mildew
attack. Therése et al. (2017) performed a genome-wide association study in a Nordic
spring barley panel consisting of 169 genotypes and identified a total of four QTLs,
one located on chromosome 4H and three on chromosome 6H.
Amouzoune et al. (2021) compared the Generation Challenge Program Reference
set (GCP) with 188 accessions against the Focused Identification of Germplasm
Strategy (FIGS) with 86 accessions for identifying new sources of resistance against
leaf rust of barley, and they reported FIGS as a better approach than GCP in yielding
higher percentages of resistant accessions at adult plant-resistant stage. Bilgic et al.
(2005) identified a gene (Rcs5) on chromosome 7H conferring seedling resistance to
pathotype I (ND85F) whereas in another study, Bilgic et al. (2006) used a doubled
haploid (DH) mapping population to identify a gene (designated as Rcs6) on
chromosome 1H conferring resistance to pathotype 2 (ND90Pr) of Bipolaris
sorokiniana.
172 H. S. Mahesha et al.
9.5 Molecular Breeding Approaches for Disease Resistance
Barley production is harshly affected by a range of biotic stresses. Usually, breeding
for disease-resistant genotypes involves manual inoculation of the pathogen into the
host at the right stage along with the desirable conditions for disease development,
but this technique is very cumbersome and can also lead to false negatives (Figs. 9.2
and 9.3). Therefore, use of advanced breeding approaches like Marker-Assisted
Selection (MAS), Genome-Wide Association Studies (GWAS), QTL mapping,
and high throughput molecular techniques like sequencing and genomics has been
utilized in accelerating breeding programs for various qualitative and quantitative
traits (Figs. 9.1 and 9.2). Long-lasting resistance requires combinations of several
resistance genes and QTLs in a genome.
Host-based resistance is one of the most feasible and eco-friendly approaches for
controlling disease-related losses in crop plants, and a diverse genetic base is one of
Fig. 9.2 Advanced breeding approaches for disease resistance
the primary requisites for it. Barley has one of the oldest cultivated crops and has a
rich genetic base, having geographically diverse wild accessions, landraces, and
cultivars. The genome of barley has already been mapped, and there are many
genomic resources available in public databases. These include expressed sequence
tags, full length cDNA (FL-cDNA) sequences, genome sequences, and pan genomic
data for 20 varieties of barley that include landraces, cultivars, and wild races (Zhang
et al. 2004; Sato et al. 2009; Mayer et al. 2012; Jayakodi et al. ). Barley has a
haploid genome size of nearly 5.1 Gigabases (gb) with nearly 26,000 highly
confident genes as supported by transcript and homology data. The International
Barley Genome Sequencing Consortium attempted sequencing of barley cv. Morex
in 2012 using a hierarchical shotgun sequencing approach (Mayer et al. ).
Molecular markers have served extensively in barley breeding programs for tracking
useful genes and in their isolation (Stein and Graner ; Perovic et al. ).
Single nucleotide polymorphism (SNP) markers are currently the most chosen
markers due to their high throughput detection employing NGS (Ganal et al.
). With the advent of the 9 K Illumina iSelect chip and the 50 K Illumina
Infinium array, the number of existing SNP markers has improved to 44,040 SNPs
(Stein et al. ; Close et al. ; Bayer et al. ). Zang et al. ( ) tried to fine
map the candidate gene responsible for loose smut resistance in barley by utilizing
dense linkage map saturated with various useful markers like RFLP, microsatellite,
and SNPs. They were able to enrich the genomic region associated with loose smut
resistance. Sayed and Baum ( ) screened two groups (homozygous-resistant and
susceptible), each comprising of 10 plants for barley scald disease caused by
Rhynchosporium commune from the recombinant inbred line (RIL) population at
F
7
generation with the help of 25 markers which lie close to scald-resistant genes.
2018
2015201720092007
2018
20182005
2012
2020
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 173
Fig. 9.3 Biotechnological approaches for disease resistance
Out of the 25 markers, only 5 markers showed clear discrimination between resistant
and susceptible plants. They reported that most of these markers reside near to the
centromeric region of the long arm of 3H chromosome. They anticipated that
presence of polymorphic markers will be extremely helpful in discriminating breed-
ing material in barley. Brueggeman et al. (2002) cloned Rpg1 (Resistant to Puccinia
graminis 1) gene against stem rust, caused by Puccinia graminis f. sp. tritici (Pgt)
through high-resolution map-based cloning. The Rpg1 gene encodes a receptor
kinase-like protein with two tandem protein kinase domains. In Northern America,
Rpg1gene offered strong resistance to barley varieties for nearly 40 years, but with
the appearance of a new race of Puccinia graminis f. sp. tritici (Pgt) TTKSK, an
alternative to Rpg1-resistant gene was needed. Jin et al. (1994) identified, cloned,
and characterized the rpg4, a recessive gene against the same. The rpg4 gene was
later found on the chromosome 5H in barley (Borovkova et al. 1995). Fusarium head
blight (FHB) is another devastating malady of barley which results in the reduction
of grain yield and accumulation of deoxynivalenol (DON) mycotoxin in grains. It
has been reported that the morphological and developmental characters of the host
plant, e.g., earliness and plant height, are linked with pathogen infection and its
severity. Ogrodowicz et al. (2020)investigated 100 recombinant inbred lines (RILs)
by employing a barley Ilumina 9 K iSelect platform and found a set of 70 quantitative
trait loci (QTLs). They suggested tight association of yield-related traits with
FHB-associated QTLs should be followed while designing a barley breeding
programme for FHB resistance. Powdery mildew of barley is caused by Blumeria
graminis f. sp. hordei. Recessive allelic form (mlo) of the barley Mildew resistance
locus o (Mlo) locus provides broad spectrum resistance to the fungal pathogen,
Erysiphe graminis f. sp. hordei. Büschges et al. (1997) utilized RFLP and AFLP
marker systems for the purpose of gene isolation. Later, Hoseinzadeh et al. (2019)
did high-resolution genetic and physical mapping of major powdery mildew-
resistant locus in barley through GBS approach. Vatter et al. (2018) followed
SNP-based nested association mapping (NAM) to map stripe rust and leaf rust
resistance QTL in barley. They reported 8 new QTLs for stripe rust and 2 new
QTLS for leaf rust. Hu et al. (2019) identified new major QTL on chromosome 5H
along with two minor QTLs on chromosome 7H providing tolerance against barley
yellow dwarf infection in barley. Visioni et al. (2020) employed High Input Associ-
ation Mapping (HI-AM) panel comprising 261 spring barley genotypes (including
released varieties, breeding material from ICARDA, and germplasm from GenBank)
to map spot blotch-resistant QTLs at seedling and adult plant stages in barley by
utilizing genome-wide association mapping (GWAM) approach. It was reported that
expression of wheat Lr34 gene in transgenic barley lines imparted resistance against
multiple fungal pathogens (Risk et al. 2013; Chauhan et al. 2015). Its constitutive
expression in transgenic barley lines caused upregulation of senescence and
pathogenesis-related genes, resulting in leaf tip necrosis in general and reduced
height and total gain weight in extreme cases which can be overcome through
regulated expression.
174 H. S. Mahesha et al.
Host-delivered RNA interference (HD-RNAi) approach has been effectively used
in various crop species to impart resistance, especially against viral diseases and
insect-pests damage (Tiwari et al. 2017; Joshi et al. 2020). In barley, there are few
reports where researchers have used RNAi against phytopathogens, e.g., Kis et al.
(2016) designed and expressed a polycistronic cassette of artificial microRNAs in
barley against wheat dwarf virus and found higher level of resistance at low
temperature conditions which are highly favorable for the insect vector to survive
and spread disease. In contrast to HD-RNAi approach, RNA-spray-mediated
approach has been also attempted, similar to pesticide application. Koch et al.
(2016) sprayed 791 nt long noncoding dsRNA molecule (CYP3-dsRNA) targeting
three essential genes of ergosterol biosynthesis pathway of Fusarium graminearum.
Their study revealed increased level of resistance in the sprayed as well as
non-sprayed portion of the detached leaves of barley. Acquired resistance observed
in the non-sprayed areas of the leaves indicated systemic movement of interfering
RNA from applied to adjacent non-applied areas through plant conducting tissues.
Moreover, their research also enlightened the role of fungal RNAi machinery like
fungal DICER-LIKE 1 (FgDCL-1) in spray-based RNAi approach. As per their
study, mutant form of FgDCL-1 was found to be nonfunctional against same
insecticidal dsRNA. Recently, Werner et al. (2020) also used spray-based RNAi
approach for silencing ARGONAUTE and DICER genes of Fusarium graminearum
(Fg). They also observed enhanced resistance in barley leaves. Genome editing
technologies have been deployed in various crop plants for imparting disease
resistance. But, in barley very few attempts have been made due to lack of enough
knowledge on techniques like gene transformation and tissue culture. Moreover,
success of transformation is highly genotype-dependent. CRISPR-Cas9 technology
has been employed in deciphering role of orthologous disease-related genes in barley
by using model organisms in which protocols of genetic transformation are well-
standardized (Low et al. 2020). Golden Promise is one such cultivar of barley which
is highly amenable for genetic transformation and shows higher regenerability. Its
genome has been recently sequenced and assembled through illumina-based next-
generation sequencing platform (NGS), which could be definitely useful for entire
barley research groups especially through CRISPR-Cas 9 platform (Schreiber et al.
2020). Kis et al. (2016) utilized CRISPR platform to enhance viral resistance in
Golden Promise cv. of barley against wheat dwarf virus. Due to its successful
transformation and regeneration ability, Golden Promise cv. was extensively used
for transgenic research. Recently, Han et al. (2021) developed a highly efficient and
genotype-independent gene editing technique based on anther culture. They found
that their platform can generate a greater number of transgenic plants within a similar
time frame along with high editing efficiency as compared to immature embryo
protocols. This technology may play a crucial role in imparting disease resistance
trait in commercial cultivars of barley as well as in functional validation of disease-
related genes.
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 175
176 H. S. Mahesha et al.
9.6 Conclusion
Barley, one of the oldest crops primarily grown for its grain, has the largest single
use in feeding livestock throughout the world. Despite the overall decline in barley
acreage, total production has increased due to the continuous improvement in barley
productivity (yield per hectare). But no breeding program can develop varieties with
acceptable levels of resistance to all diseases under all conditions. Moreover, the
climate is constantly changing owing to various anthropogenic activities, which may
further affect host and pathogen relationships. Therefore, our primary focus after
higher grain yield is to impart broad spectrum resistance to the crop species with
long-lasting impact. Traditional breeding methods (introduction of exotic lines,
selection, hybridization, backcrossing, gene pyramiding) and modern breeding
methods have been used to bring and improve resistance to biotic stresses in barley.
Modern breeding approaches overcome the problems of traditional breeding
strategies like more effort, more labor, transfer of non-desirable genes along with
resistant genes, short-term relief, limited resistance sources, breakdown of existing
resistance due to continuous evolution of new pathogen races, and being time-
consuming. Advanced breeding and biotechnological methods like QTL mapping,
gene mapping, MAS, MABC, TILLING, transgenics, RNA interference (RNAi)-
mediated gene silencing, gene and genome editing using CRISPR-Cas9, along with
bioinformatics and high throughput computational technologies, can enable us to
engineer durable resistance in cultivated barley. The ability of the CRISPR platform
to provide a transgene-free crop with desirable attributes is getting sincere applause
among the scientific community. The availability of various bioinformatics tools will
help us in the identification of pathogen-inducible promoters, key transcription
factors, and noncoding RNAs pertaining to pathogen attack and disease develop-
ment. They also allow us to decipher the actual biochemical roles of various disease-
related genes in the disease signaling pathways, as gene annotation has become a
major challenge in understanding their role. Global expression profiling techniques
like suppression subtractive hybridization, microarray, serial analysis of gene
expression (SAGE), and RNA seq. will allow us to capture the expression status
of several genes in resistant and susceptible genotypes, which will definitely help us
to focus on key or vital disease-related genes that could be used in the future.
Whatever the approach (conventional or molecular breeding), our main concern is
to increase productivity and minimize yield loss due to phytopathogens. It is very
certain that advancements made in the science of molecular biology will become
important pillars towards successful breeding methods in barley.
References
Amouzoune M, Amri A, Benkirane R, Kehel Z, Al-Jaboobi M, Moulakat A, Abderrazek J, Rehman
S (2021) Mining and predictive characterization for resistance to leaf rust (Puccinia hordei Otth)
using two subsets of barley genetic resources. Genet Resour Crop Evol. https://doi.org/10.1007/
s10722-021-01268-4
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 177
Anderson JW, Deakins DA, Floore TL, Smith BM, Whitis SE (1990) Dietary fibre and coronary
heart disease. Crit Rev Food Sci Nutr 29:95–147
Arabi MIE, Jawhar M (2004) Identification of Cochliobolus sativus (Spot Blotch) isolates
expressing differential virulence on barley genotypes in Syria. J Phytopathol 152:461–464
Bauer R, Begerow D, Sampaio JP, Weib M, Foberwinkler (2006) The simple-septate
basidiomycetes: a synopsis. Mycol Prog 5:41–66
Bayer MM, Rapazote-Flores P, Ganal M, Hedley PE, Macaulay M, Plieske J, Ramsay L, Russell J,
Shaw PD, Thomas W, Waugh R (2017) Development and evaluation of a barley 50k iSelect
SNP array. Front Plant Sci 8:1792
Bellard C, Bertelsmeier C, Leadley P, Thuiller W, Courchamp F (2012) Impacts of climate change
on the future of biodiversity. Ecol Lett 15:365–377
Bhardwaj SC, Gangwar OP, Prasad P, Khan H, Kumar S (2017) Understanding wheat rusts and
managing them strategically. In: Gautam HR, Gupta SK (eds) Diseases of commercial crops in
India. Neoti BookAgency Pvt. Ltd., New Delhi, pp 9–29
Bilgic H, Steffenson BJ, Hayes P (2005) Differential expression of seedling and adult plant
resistance to spot blotch in different genetic backgrounds of barley. Theor Appl Genet 111:
1238–1250
Bilgic H, Steffenson B, Hayes P (2006) Molecular mapping of loci conferring resistance to different
pathotypes of the spot blotch pathogen in barley. Phytopathology 96:699–708
Borovkova IG, Steffenson BJ, Jin Y, Rasmussen JB, Kilian A, Kleinhofs A, Rossnagel BG, Kao
KN (1995) Identification of molecular markers linked to the stem rust resistance gene rpg4 in
barley. Pythopathology 85:181–185. https://doi.org/10.1094/Phyto-85-181
Bovill J, Lehmensiek A, Sutherland M, Platz GJ, Usher T, Franckowiak J, Mace E (2010) Mapping
spot blotch resistance genes in four barley populations. Mol Breed 26(4):653–666
Brueggeman R, Rostoks N, Kudrna D, Kilian A, Han F, Chen J, Druka A, Steffenson B, Kleinhofs
A (2002) The barley stem rust-resistance gene Rpg1 is a novel disease-resistance gene with
homology to receptor kinases. Proc Natl Acad Sci 99(14):9328–9333
Büschges R, Hollricher K, Panstruga R, Simons G, Wolter M, Frijters A, Van Daelen R, Van der
Lee T, Diergaarde P, Groenendijk J, Töpsch S (1997) The barley Mlo gene: a novel control
element of plant pathogen resistance. Cell 88(5):695–705
Caldwell K, Russell J, Langridge P, Powell W (2005) Extreme population-dependent linkage
disequilibrium detected in an inbreeding plant species, Hordeum vulgare. Genetics 172:557–
567
Chauhan H, Boni R, Bucher R, Kuhn B, Buchmann G, Sucher J, Selter LL, Hensel G, Kumlehn J,
Bigler L, Glauser G (2015) The wheat resistance gene Lr34 results in the constitutive induction
of multiple defense pathways in transgenic barley. Plant J 84(1):202–215
Close TJ, Bhat PR, Lonardi S, Wu Y, Rostoks N, Ramsay L, Druka A, Stein N, Svensson JT,
Wanamaker S, Bozdag S (2009) Development and implementation of high-throughput SNP
genotyping in barley. BMC Genomics 10:582
Cope JE, Norton GJ, George TS, Newton AC (2021) Identifying potential novel resistance to the
foliar disease ‘Scald’(Rhynchosporium commune) in a population of Scottish Bere barley
landrace (Hordeum vulgare L.). J Plant Dis Prot 128:999–1012
Dreiseitl A (2011) Resistance of ‘Roxana’to powdery mildew and its presence in some European
spring barley cultivars. Plant Breed 130:419–422
Dreiseitl A, Bockelman HE (2003) Sources of powdery mildew resistance in a wild barley
collection. Genet Resour Crop Evol 50:345–350
Duplessis S, Cuomo CA, Lin YC, Aerts A, Tisserant E, Veneault-Fourrey C, Joly DL, Hacquard S,
Amselem J, Cantarel BL, Chiu R (2011) Obligate biotrophy features unraveled by the genomic
analysis of rust fungi. Proc Natl Acad Sci U S A 108(22):9166–9171
FAO (2010) The second report on the state of the world’s plant genetic resources for food and
agriculture. FAO, Rome
Fetch TG Jr, Steffenson BJ, Nevo E (2003) Diversity and sources of multiple disease resistance in
Hordeum spontaneum. Plant Dis 87(12):1439–1448
178 H. S. Mahesha et al.
Fetch T Jr, Johnston PA, Pickering R (2009) Chromosomal location and inheritance of stem rust
resistance transferred from Hordeum bulbosum into cultivated barley (H. vulgare). Phytopa-
thology 99(4):339–343
Friedt W, Horsley RD, Harvey BL et al (2011) Barley breeding history, progress, objectives, and
technology. In: Barley. Wiley-Blackwell, pp 160–220
Fu Y-B, Horbach C (2012) Genetic diversity in a core subset of wild barley germplasm. Diversity
4(2):239–257
Ganal MW, Plieske J, Hohmeyer A, Polley A, Röder MS (2018) High throughput genotyping for
cereal research and breeding. In: Miedaner T, Korzun V (eds) Applications of genetic and
genomic research in cereals. Woodhead Publishing, Sawston
Gangwar OP, Bhardwaj SC, Singh GP, Prasad P, Kumar S (2018) Barley disease and their
management: an Indian perspective. Wheat Barley Res 10(3):138–150
Gosain, K (1996) Long-term effects of barley bread products on metabolic control of non-insulin-
dependent diabetes mellitus. Master’s thesis, University of Alberta, Edmonton, AB
Han Y, Broughton S, Liu L, Zhang X-Q, Zeng J, He X, Li C (2021) Highly efficient and genotype
independent barley gene editing based on anther culture. Plant Comm 2(2):100082
Harwood WA (2019) An introduction to barley: the crop and the model. In: Barley. Humana Press,
New York, pp 1–5
Hautsalo J, Novakazi F, Jalli M, Göransson M, Manninen O, Isolahti M, Reitan L, Bergersen S,
Krusell L, Damsgård Robertsen C, Orabi J, Due Jensen J, Jahoor A, Bengtsson T, PPP Barley
Consortium (2021) Pyramiding of scald resistance genes in four spring barley MAGIC
populations. Theor Appl Genet 134(12):3829–3843
Hickey LT, Germán SE, Pereyra SA, Diaz JE, Ziems LA, Fowler RA, Platz GJ, Franckowiak JD,
Dieters MJ (2017) Speed breeding for multiple disease resistance in barley. Euphytica 213(3):64
Hoseinzadeh P, Zhou R, Mascher M, Himmelbach A, Niks RE, Schweizer P, Stein N (2019) High
resolution genetic and physical mapping of a major powdery mildew resistance locus in barley.
Front Plant Sci 10:146
Hu H, Choudhury S, Shabala S, Gupta S, Zhou M (2019) Genomic regions on chromosome 5H
containing a novel QTL conferring barley yellow dwarf virus-PAV (BYDV-PAV) tolerance in
barley. Sci Rep 9(1):1
Inostroza L, delPozo A, Matus I et al (2008) Association mapping of plant height, yield, and yield
stability in recombinant chromosome substitution lines (RCSLs) using Hordeum vulgare subsp.
spontaneum as a source of donor alleles in a Hordeum vulgare subsp. vulgare background. Mol
Breed 23:365–376. https://doi.org/10.1007/s11032-008-9239-6
Jayakodi M, Padmarasu S, Haberer G, Bonthala VS, Gundlach H, Monat C, Lux T, Kamal N,
Lang D, Himmelbach A, Ens J (2020) The barley pan-genome reveals the hidden legacy of
mutation breeding. Nature 588(7837):284–289
Jin Y, Steffenson BJ (1999) Puccinia coronata var. hordei var nov.: morphology and pathogenicity.
Mycologia 91:877–884
Jin Y, Steffenson BJ, Miller JD (1994) Inheritance of resistance to pathotypes QCC and MCC of
Puccinia graminis f. sp. tritici in barley line Q21861 and temperature effects on the expression
of resistance. Pathology 84:452–455
Joshi I, Kumar A, Kohli D, Singh AK, Sirohi A, Subramaniam K, Chaudhury A, Jain PK (2020)
Conferring root-knot nematode resistance via host-delivered RNAimediated silencing of four
Mi-msp genes in Arabidopsis. Plant Sci 298:110592
Kis A, Tholt G, Ivanics M, Várallyay É, Jenes B, Havelda Z (2016) Polycistronic artificial miRNA-
mediated resistance to wheat dwarf virus in barley is highly efficient at low temperature. Mol
Plant Pathol 17(3):427–437
Knüpffer H, van Hintum TJL (2003) Summarised diversity—the barley core collection. In: von
Bothmer R, van Hintum TJL, Knüpffer H, Sato K (eds) Diversity in barley (Hordeum vulgare).
Elsevier Science B.V., Amsterdam, pp 259–267
Koch A, Biedenkopf D, Furch A, Weber L, Rossbach O, Abdellatef E et al (2016) An RNAi-based
control of Fusarium graminearum infections through spraying of long dsRNAs involves a plant
passage and is controlled by the fungal silencing machinery. PLoS Pathog 12(10):e1005901.
https://doi.org/10.1371/journal.ppat.1005901
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 179
Leng Y, Zhao M, Wang R, Steffenson BJ, Brueggeman RS, Zhong S (2018) The gene conferring
susceptibility to spot blotch caused by Cochliobolus sativus is located at the Mla locus in barley
cultivar Bowman. Theor Appl Genet 131(7):1531–1539. https://doi.org/10.1007/s00122-018-
3095-5
Leng Y, Zhao M, Fiedler J, Dreiseitl A, Chao S, Li X, Zhong S (2020) Molecular mapping of loci
conferring susceptibility to spot blotch and resistance to powdery mildew in barley using the
sequencing-based genotyping approach. Phytopathology 110:140–146
Low YC, Lawton MA, Di R (2020) Validation of barley 2OGO gene as a functional orthologue of
Arabidopsis DMR6 gene in Fusarium head blight susceptibility. Sci Rep 10(1):1–3
Marshall D, Sutton RL (1995) Epidemiology of stripe rust, virulence of Puccinia striiformis f. sp.
hordei, and yield loss in barley. Plant Dis 79:732–737
Martinez VM, Newman K, Newman CW (1991) Barley diets with different fat sources have
hypocholesterolemic effects in chickens. J Nutr 122:1070–1076
Mastebroek HD, Balkema-Bomstra AG, Gaj M (1995) Genetic analysis of powdery mildew
(Erysiphe graminis f. sp. hordei) resistance derived from wild barley (Hordeum vulgare ssp.
Spontaneum). Plant Breed 114:121–125
Mathre DE (1997) Compendium of barley diseases. American Phytopathological Society,
St. Paul, MN
Matus I, Corey A, Filichkin T, Hayes PM, Vales MI, Kling J, Riera-Lizarazu O, Sato K, Powell W,
Waugh R (2003) Development and characterization of recombinant chromosome substitution
lines (RCSLs) using Hordeum vulgare subsp. spontaneum as a source of donor alleles in a
Hordeum vulgare subsp. vulgare background. Genome 46:1010–1023. https://doi.org/10.1139/
g03-080
Mayer KF, Waugh R, Langridge P, Close TJ, Wise RP, Graner A, Matsumoto T, Sato K,
Schulman A, Muehlbauer GJ, Stein N (2012) A physical, genetic and functional sequence
assembly of the barley genome. Nature 491(7426):711–716
Murray GM, Brennan JP (2010) Estimating disease losses to the Australian barley industry.
Australas Plant Pathol 39:85–96
Neupane A, Tamang P, Brueggeman RS, Friesen TL (2015) Evaluation of a barley core collection
for spot form net blotch reaction reveals distinct genotype-specific pathogen virulence and host
susceptibility. Phytopathology 105(4):509–517
Newton AC, Flavell AJ, George TS, Leat P, Mullholland B, Ramsay L, Revoredo-Giha C,
Russell J, Steffenson BJ, Swanston JS, Thomas WT (2011) Crops that feed the world. Barley:
a resilient crop? Strengths and weaknesses in the context of food security. Food Sec 3:141–178
Nice LM, Steffenson BJ, Brown-Guedira GL, Akhunov ED, Liu C, Kono TJ, Morrell PL, Blake
TK, Horsley RD, Smith KP, Muehlbauer GJ (2016) Development and genetic characterization
of an advanced backcross-nested association mapping (AB-NAM) population of wild cultivated
barley. Genetics 203:1453–1467. https://doi.org/10.1534/genetics.116.190736
Ogrodowicz P, Kuczyńska A, Mikołajczak K, Adamski T, Surma M, Krajewski P, Ćwiek-
Kupczyńska H, Kempa M, Rokicki M, Jasińska D (2020) Mapping of quantitative trait loci
for traits linked to fusarium head blight in barley. PLoS One 15(2):e0222375
Oğuz AÇ (2019) Resistance of wild barley (Hordeum spontaneum) and barley landraces to leaf
stripe (Drechslera graminea). Phytopathol Mediterr 58(3):485–495. https://doi.org/10.14601/
Phyto-10885
Oscarsson M, Andersson R, Salomonsson AC, Åman P (1996) Chemical composition of barley
samples focusing on dietary fibre components. J Cereal Sci 24:161–170
Perovic D, Kopahnke D, Habekuss A, Ordon F, Serfling A (2018) Marker-based harnessing of
genetic diversity to improve resistance of barley to fungal and viral diseases. In: Miedaner T,
Korzun V (eds) Applications of genetic and genomic research in cereals. Elsevier, Amsterdam,
pp 137–164
Pessarakli M (2016) Handbook of plant and crop stress. CRC Press, Boca Raton
180 H. S. Mahesha et al.
Pickering R, Ruge-Wehling B, Johnston P, Schweizer G, Ackermann P, Wehling P (2006) The
transfer of a gene conferring resistance to scald (Rhynchosporium secalis) from Hordeum
bulbosum into H. vulgare chromosome 4HS. Plant Breed 125:576–579
Pillen K, Zacharias A, Léon J (2003) Advanced backcross QTL analysis in barley (Hordeum
vulgare L.). Theor Appl Genet 107:340–352. https://doi.org/10.1007/s00122-003-1253-9
Poehlman JM (1994) Breeding barley and oats. In: Poehlman JM (ed) Breeding field crops. Iowa
State University Press, Ames, IA, pp 378–420
Pogoda M, Liu F, Douchkov D, Djamei A, Reif JC, Schweizer P, Schulthess AW (2020) Identifi-
cation of novel genetic factors underlying the host-pathogen interaction between barley
(Hordeum vulgare L.) and powdery mildew (Blumeria graminis f. sp. hordei). PLoS One
15(7):e0235565
Prakash V, Verma RPS (2009) Inheritance of yellow rust resistance in barley (Hordeum vulgare L.).
Indian J Genet Plant Breed 69(2):99–101
Reddy M, Reddy P, Prasad BN, Munilakshmi U (2014) Grain and milling quality of barley and their
suitability for preparation of traditional south Indian products. Int Organ Sci Res J Pharm 4:23–
27
Risk JM, Selter LL, Chauhan H, Krattinger SG, Kumlehn J, Hensel G, Viccars LA, Richardson TM,
Buesing G, Troller A, Lagudah ES (2013) The wheat L r34 gene provides resistance against
multiple fungal pathogens in barley. Plant Biotechnol J 11(7):847–854
Sato K, Shin-I T, Seki M, Shinozaki K, Yoshida H, Takeda K, Yamazaki Y, Conte M, Kohara Y
(2009) Development of 5006 full-length cDNAs in barley: a tool for accessing cereal genomics
resources. DNA Res 16(2):81–89
Sannemann W, Huang BE, Mathew B, Léon J (2015) Multi-parent advanced generation inter-cross
in barley: highresolution quantitative trait locus mapping for flowering time as a proof of
concept. Mol Breed 35:1–16
Savary S, Ficke A, Aubertot J-N, Hollier C (2012) Crop losses due to diseases and their implications
for global food production losses and food security. Food Security 4(2):519–537
Sayed H, Baum M (2018) Marker-assisted selection for scald (Rhynchosporium commune L.)
resistance gene (s) in barley breeding for dry areas. J Plant Protect Res 58:335–344
Schmalenbach I, Körber N, Pillen K (2008) Selecting a set of wild barley introgression lines and
verification of QTL effects for resistance to powdery mildew and leaf rust. Theor Appl Genet
117:1093–1106. https://doi.org/10.1007/s00122-008-0847-7
Schnaithmann F, Kopahnke D, Pillen K (2014) A first step toward the development of a barley
NAM population and its utilization to detect QTLs conferring leaf rust seedling resistance.
Theor Appl Genet 127:1513–1525. https://doi.org/10.1007/s00122-014-2315-x
Schreiber M, Mascher M, Wright J, Padmarasu S, Himmelbach A, Heavens D, Milne L, Clavijo BJ,
Stein N, Waugh R (2020) A genome assembly of the barley ‘transformation reference’cultivar
Golden Promise. G3-Genes Genom Genet 10(6):1823–1827
Singh S, Singh H, Sharma A, Meeta M, Singh B, Joshi N, Grover P, Al-Yassin A, Kumar S (2014a)
Inheritance of spot blotch resistance in barley (Hordeum vulgare L.). Can J Plant Sci 94:1203–
1209
Singh T, Mishra VK, Prasad LC, Chand R (2014b) Genetic evaluation of barley (Hordeum vulgare
L.) germplasm for resistance components of spot blotch disease. Electr J Plant Breed 5(2):
158–164
Singh J, Lal C, Kumar D, Khippal A, Kumar L, Kumar V, Malik R, Kumar S, Kharub AS, Verma
RPS, Sharma I (2016) Widening the genetic base of Indian barley through the use of exotics. Int
J Trop Agric 34(1):1–10
Steffenson BJ, Olivera P, Roy JK, Jin Y, Smith KP, Muehlbauer GJ (2007) A walk on the wild side:
mining wild wheat and barley collections for rust resistance genes. Aust J Agric Res 58:532–544
Stein N, Graner A (2005) Map-based gene isolation in cereal genomes. In: Gupta PK, Varshney RK
(eds) Cereal genomics. Springer, Dordrecht, pp 331–360
9 Potential Breeding Strategies for Developing Disease-Resistant Barley:... 181
Stein N, Prasad M, Scholz U, Thiel T, Zhang H, Wolf M, Kota R, Varshney RK, Perovic D,
Grosse I, Graner A (2007) A 1,000-loci transcript map of the barley genome: new anchoring
points for integrative grass genomics. Theor Appl Genet 114(5):823–839
Therése B, Åhman I, Manninen O, Reitan L, Christerson T, Jensen JD, Krusell L, Jahoor A, Orabi J
(2017) A novel QTL for powdery mildew resistance in nordic spring barley (Hordeum vulgare
L. ssp. vulgare) revealed by genome-wide association study. Front Plant Sci 8:1954. https://doi.
org/10.3389/fpls.2017.01954
Tiwari IM, Jesuraj A, Kamboj R, Devanna BN, Botella JR, Sharma TR (2017) Host delivered
RNAi, an efficient approach to increase rice resistance to sheath blight pathogen (Rhizoctonia
solani). Sci Rep 7(1):1–4
Vatter T, Maurer A, Perovic D, Kopahnke D, Pillen K, Ordon F (2018) Identification of QTL
conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia
hordei) in barley using nested association mapping (NAM). PLoS One 13(1):e0191666
Verma RPS, Kumar V, Sarkar B, Kharub AS, Kumar D, Selvakumar R, Malik R, Sharma I (2012)
Barley cultivars releases in India: names, parentages, origins and adaptations. Research bulletin
no 29, DWR, Karnal, India, p 26
Visioni A, Rehman S, Viash SS, Singh SP, Vishwakarma R, Gyawali S, Al-Abdallat AM, Verma
RPS (2020) Genome wide association mapping of spot blotch resistance at seedling and adult
plant stages in barley. Front Plant Sci 11:642
Werner BT, Gaffar FY, Schuemann J, Biedenkopf D, Koch AM (2020) RNA-spray-mediated
silencing of Fusarium graminearum AGO and DCL genes improve barley disease resistance.
Front Plant Sci 11:476. https://doi.org/10.3389/fpls.2020.00476
Xiaohui Y, Kong HY, Meiyalaghan V, Casonato S, Chng S, Jones EE, Butler RC, Pickering R,
Johnston PA (2018) Genetic mapping of a barley leaf rust resistance gene Rph26 introgressed
from Hordeum bulbosum. Theor Appl Genet 131:2567–2580
Zang W, Eckstein PE, Colin M, Voth D, Himmelbach A, Beier S, Stein N, Scoles GJ, Beattie AD
(2015) Fine mapping and identification of a candidate gene for the barley Un8 true loose smut
resistance gene. Theor Appl Genet 128(7):1343–1357
Zhang H, Sreenivasulu N, Weschke W, Stein N, Rudd S, Radchuk V, Potokina E, Scholz U,
Schweizer P, Zierold U, Langridge P (2004) Large scale analysis of the barley transcriptome
based on expressed sequence tags. Plant J 40(2):276–290
Zohary D, Hopf M (2000) Domestication of plants in the old world: the origin and spread of
cultivated plants in West Asia, Europe, and the Nile Valley, 3rd edn. Oxford University Press,
pp 59–69
183
Economic and Eco-friendly Alternatives
for the Efficient and Safe Management
of Wheat Diseases
10
Abdulwareth A. Almoneafy, Kaleem U. Kakar, Zarqa Nawaz,
Abdulhafed A. Alameri, and Muhammad A. A. El-Zumair
Abstract
The achievement of high cereal production while considering environmental and
health safety standards is an essential goal for all countries to meet their own food
needs and feed the rapidly growing population around the world. In this regard,
wheat (Triticum aestivum L.) is a strategic crop of great importance to global food
security, especially in developing countries. It is even more important for the
consumers of all sectors and regions where people rely on wheat as a significant
element in their diets. However, several biotic and abiotic stress factors bring
about the limiting and declining of local wheat production in return for the
increasing needs of the growing population. To deal with such challenges,
procedures allow for the use of agrochemicals as a means of achieving a high
wheat yield. However, the unrestricted use of such chemicals causes serious
damage to the agricultural ecosystem, particularly in those ecosystems that lack
organic soil content and a high level of biodiversity, which help to restore its
natural vigor after extensive use of agrochemicals. As a result, these demands to
look for other eco-friendly alternatives will help us make satisfactory progress in
A. A. Almoneafy (*) · A. A. Alameri
Department of Biology Sciences, College of Education and Science at Rada’a, Albaydha
University, Rada’a, Yemen
K. U. Kakar
Department of Microbiology, Faculty of Life Sciences, Balochistan University of Information
Technology, Engineering and Management Sciences (BUITEMS), Quetta, Pakistan
Z. Nawaz
Department of Botany, University of Central Punjab, Rawalpindi, Pakistan
M. A. A. El-Zumair
Department of Plant Protection, Faculty of Agriculture, Food and Environment, Sana’a University,
Sana’a, Yemen
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_10
controlling wheat disease and successfully restore and sustain our agricultural
ecosystem. In this chapter, we’re going to talk about natural ways to boost the
production of wheat cultivars by making them more able to fight off or at least
tolerate wheat diseases.
184 A. A. Almoneafy et al.
Keywords
Wheat · Biostimulants · Wheat diseases · Biocontrol · Biotic stress
10.1 Introduction
Triticum aestivum L. is one of the world’s most important staple cereals and a major
source of 20% of calories and plant-based proteins in human meals (Almoneafy
2006; Mehta 2014b; Tilman et al. 2011; Vidal et al. 2020). As per the latest statistical
report of the Food and Agriculture Organization, global wheat production in
2019–20 was about 765,769,635 tons (FAO 2020). Moreover, the current supply
of wheat is adequate for world demand, according to the FAO’s most recent wheat
production valuation (http://www.fao.org/worldfoodsituation/csdb/en/). In the
future, as the world’s population grows, the wheat supply needs to be expanded
further, which is expected to reach nine billion by 2050. Wheat growth and produc-
tion will be boosted largely by an increase in yield due to high competition for arable
lands with limited production (http://www.fao.org/state-of-food-security-nutrition/
en/). Integrated disease and pest management, tolerance to warmer climates with
increased frequency of abiotic challenges, and reduced water and other resource use
can all help to improve this situation (Mehta 2014a). Wheat, like many other crops,
is vulnerable to a variety of diseases that, if left unattended, can result in alterations
in the chemical properties and quality of wheat grain as well as a significant decrease
in yield (Matzen et al. 2019). Many strategies have been used to eliminate or mitigate
the negative impact of wheat diseases, such as the use of various agronomic
practices, the introduction of resistant varieties, and the use of microbiocidal syn-
thetic compounds or chemical control. The latter is widely used as the most effective
and common method of controlling wheat phytopathogens. The haphazard use of
synthetic microbiocidals, on the other hand, has several serious drawbacks and
threats, including pathogen resistance to these chemicals, eradication of beneficial
microorganisms in the surrounding environment, reduction of soil organic content,
and a decrease in biodiversity within plant-associated niches. Furthermore, because
pathogen sensitivity to these compounds decreases, the applied dose of them must be
increased. Due to this dosage increase, the resulting control costs, the environmental
threats posed by these compounds, and their negative side effects on human health
will significantly rise (Gao et al. 2020). The harmful effects of these synthetic
chemicals are exacerbated in arid and semiarid lands due to their lower organic
matter content and, as a result, lower biodiversity, which do not allow them to
mitigate any deleterious changes caused by uncontrolled application of these
chemicals (Santos et al. 2011). Therefore, in this chapter, we highlight and discuss
the beneficial effects of some inexpensive, safe, available, and efficient alternatives
to managing wheat diseases in order to reduce agrochemical inputs in the agricultural
sector and sustain our environmental resources.
10 Economic and Eco-friendly Alternatives for the Efficient and... 185
10.2 The Well-Reported Eco-friendly Approaches Used in Wheat
Disease Management
Several approaches have been evaluated by researchers as safe alternatives to
synthetic pesticides for controlling wheat phytopathogens. The search for and
evaluation of the biocidal activity of various biological/nonbiological procedures
or biologically based means against wheat phytopathogens is still ongoing. In this
section, we will look at some well-known methods for controlling wheat diseases.
10.2.1 Applying of Biogenic Nanoparticles
Nanotechnology has been suggested as a potential new technology for satisfying
worldwide demands for sustainable agriculture and crop loss deterrence (Rai-Kalal
et al. 2021). Within this context, numerous researchers have focused their efforts on
developing nano-formulations that are low-cost, biodegradable, environmentally
friendly, and exhibit biocontrol activities towards phytopathogens (He et al. 2019;
Partila 2019). To minimize hazardous waste produced by the nanomaterials industry,
“green”synthetic processes should be used to supplement the increasing demand for
these materials. Biogenic NP synthesis is a very appealing, greener, and more
eco-friendly production option due to the use of lower toxicity compounds,
pressures, and surrounding temperatures during the synthesis (Chhipa 2019). As a
safe and eco-friendly technology, a variety of prokaryotic and eukaryotic organisms
are utilized in the biosynthesis of metallic nanoparticles such as platinum, gold,
silver, zirconium, iron, cadmium, and palladium, as well as metal oxides like
titanium oxide and zinc oxide (Luo et al. 2018). Around 75% of the potential
application of nanoparticles in agriculture was directed toward the primary goal of
controlling plant diseases (He et al. 2019; Luo et al. 2018). Of their physicochemical
properties and nano size, they can easily penetrate the cellular envelops and
membranes of microbial phytopathogens’internal compartments and induce a fatal
effect on them (Khan and Rizvi 2014). Due to the obvious differences in charges
between nanoparticles and microorganism macromolecules, they can act as electro-
magnetic absorbers and attach to the cell surface, causing oxidation of microbe
surface molecules, and eventually cell death (Lin and Xing 2007). Many researchers
have used biogenic nanoparticles as an efficient, low-cost, and safe method of
managing wheat diseases. Most of the time, these materials were able to help
wheat plants fight off phytopathogens, and this was usually accompanied by a
boost in plant growth. For instance, Satti et al. (2021) biosynthesized and applied
40 mg/L titanium dioxide nanoparticles from Moringa oleifera Lam. aqueous leaf
extract, which resulted in biocontrol of Bipolaris sorokiniana that causes spot blotch
in wheat. Additionally, the biosynthesized silver nanoparticles (AgNPs) have been
demonstrated to inhibit fungal growth and reduce mycotoxin production of Fusar-
ium graminearum, which cause Fusarium head blight in wheat. According to
electron microscopy images, nanoparticle treatment caused hypha deformation and
collapsing, which resulted in the leaking of genetic materials and proteins outside of
the fungal hypha (Ibrahim et al. 2020). In a different research, researchers revealed
that applying biogenic AgNPs significantly reduced Bipolaris sorokiniana infection
in wheat plants in vivo. AgNPs caused lignin deposition in the host plant’s vascular
bundles, according to further histochemical analysis (Mishra et al. 2014). Table 10.1
shows some remarkable outcomes.
186 A. A. Almoneafy et al.
10.2.2 Harnessing of Beneficial Microorganisms (Biological Control)
Using beneficial microbes to improve plant growth and agricultural sustainability is
a promising strategy. Beneficial microorganisms associated with plants can alleviate
the harmful effects of pathogenic/environmental stresses in plants, boost plant
growth, improve the cycle of biologically active compounds (e.g., enzymes,
hormones, and vitamin), and decompose organic matter residues in agricultural
soil (Saberi-Riseh et al. 2021; Smolińska and Kowalska 2018). These
microorganisms can also effectively colonize the plant phytosphere, i.e., rhizo-
sphere, phyllosphere and anthosphere. As a result of their capability to promote
plant growth, improve plant health, and control plant diseases, beneficial
microorganisms are a promising strategy for long-term plant disease management
(Almoneafy et al. 2021). They can directly benefit plants by exerting an antagonistic
effect on plant pathogens via colonization of infection site, competition for nutrient
uptake, and occupation of niche (Köhl et al. 2019). The indirect mechanisms include
interaction with plants that involves the induction of plant resistance to
phytopathogens and the promotion of plant growth by facilitating nutrients uptake
and phytohormones’production (Vos et al. 2015; Wang et al. 2021). Furthermore,
their positive interaction with the concerned plant causes changes in the plant’s
secondary metabolite status (Etalo Desalegn et al. 2018). This method is useful and
promising when applied to all arable lands, and its benefit increases in arid and
semiarid lands because its soil organic content is increased, which improves its
ability to retain water for a longer period. Moreover, it strengthens the environment’s
ability to recover from the detrimental consequences of randomized agrochemical
application (Kaushal and Wani 2016). Biocontrol of phytopathogens through micro-
bial agents or their metabolites is a cheap and environment-friendly component of a
successful wheat disease management program (Sood and Kaushal 2021; Xu et al.
2021). In order to combat these pathogens, the quest for biocontrol agents for wheat
diseases and the importance of various beneficial microorganism–pathogen
interactions have been highlighted in numerous reports. In this regard, one of the
most notable examples of antagonistic bacteria protecting plant roots can be found in
soils that suppress wheat take-all disease. Take-all decline (TAD) is well-known to
result from the accumulation of populations of 2,4-diacetylphloroglucinol
Pathogen Resulted effect Reference
(continued)
10 Economic and Eco-friendly Alternatives for the Efficient and... 187
Table 10.1 Some effective instances of nonbio/bio-derived agents used to safely manage wheat
diseases
Type of
controlling
approach
Disease’s
name
Biogenic
nanoparticles
(titanium
nanoparticles)
Bipolaris
sorokiniana
Spot
blotch
disease
Significant reduction of
disease severity
Satti et al.
(2021)
Biogenic
nanoparticles
(silver
nanoparticles)
Fusarium
graminearum
Fusarium
head
blight
Inhibition of fungal
growth and reduction of
mycotoxin in wheat
grains
Ibrahim
et al.
(2020)
Biogenic
nanoparticles
(silver
nanoparticles)
Bipolaris
sorokiniana
Spot
blotch
disease
AgNPs deposited lignin
in the vascular bundles of
the host plant
Mishra
et al.
(2014)
Plant extracts
(extracts of
5 plants)
Puccinia
triticina
Wheat
leaf rusts
Treatment resulted in a
significant decrease in the
coefficient of infection of
wheat leaf rust as well as
an increase in wheat yield
Draz et al.
(2019)
Plant extracts
(Curcuma
zedoaria
rhizomes or its
substance)
Puccinia
triticina
Wheat
leaf rusts
In vivo, the treatment
significantly suppressed
wheat leaf rust
Han et al.
(2018)
Plant extracts
(extracts of neem,
clove, and garden
quinine)
Puccinia
triticina
Wheat
leaf rusts
Treatment completely
prevented the
development of leaf rust
in treated plants
Shabana
et al.
(2017)
Plant extracts
(Agapanthus
africanus
extracts)
Puccinia
triticina
Wheat
leaf rusts
The treatment increased
the activities of
-1,3-glucanase, chitinase,
and peroxidase in both
susceptible and resistant
wheat cultivars
Cawood
et al.
(2010)
Plant extracts
(aqueous leaf
extracts of
Jacaranda
mimosifolia)
Puccinia
triticina
Wheat
leaf rusts
Plant extract treatment
alone or in combination
with 0.05% Amistar Xtra
increased PR protein
expression in treated
plants
Naz et al.
(2014)
Plant resistance
inducers (N-
hydroxypipecolic
acid)
Fusarium
graminearum
Fusarium
head
blight
Treatment boosts
immune response,
enabling wheat plants to
defend themselves
against pathogens
Zhang et al.
(2021)
Plant resistance
inducers
(saccharin)
Zymoseptoria
tritici
Septoria
tritici
blotch
Treatment reduced
disease severity by 77%
by eliciting and priming
Mejri et al.
(2020)
(2,4-DAPG)-producing fluorescent Pseudomonas spp. during wheat monoculture.
This is due to the unique fungicidal activity of 2,4-DAPG against the causal agents
of this disease, Gaeumannomyces graminis var. tritici (Durán and de la Luz Mora
; Kwak et al. ; Kwak and Weller ). Similarly, Yang et al. ( )
discovered that the in vitro growth of Gaeumannomyces graminis var. tritici and
Rhizoctonia solani AG-8 was inhibited by cyclic lipopeptide (CLP) produced by
Pseudomonas fluorescens HC1–07. In another study, Bacillus velezensis CC09 was
shown to demonstrate 66.67% disease-control efficacy (DCE) of take-all and
21.64% DCE of spot blotch by efficiently colonizing the wheat leaves, roots, and
stem and leaves, respectively (Kang et al. ). Furthermore, wheat powdery
mildew was significantly suppressed by B. subtilis (4 10
5
CFU ml
1
) during
in vitro via inhibition of conidial germination and normal appressorium develop-
ment, or in vivo via induction of disease resistance in wheat (Xie et al. ).
Additionally, pathogenicity-related genes of Gaeumannomyces graminis var. tritici
were downregulated in pathogen-inoculated roots of wheat treated with the biocon-
trol agent Bacillus velezensis CC09 (Kang et al. ). Similarly, Bacillus
amyloliquefaciens subsp. plantarum XH—9 demonstrated a high capacity to colo-
nize wheat roots and significantly reduced Fusarium oxysporum in roots of the
treated plants as revealed by qRT PCR analysis (Wang et al. ). Despite the
fact that antagonistic fungi have been shown to have biocontrol capacity against
various cereal pathogens, chemical fungicides are not quietly replaced by commer-
cial fungal biocontrol. So far, research on bio-management of wheat pathogens by
antagonistic fungi has primarily focused on using Trichoderma.Trichoderma
harzianum, for example, outperformed T. viride as a bioagent, inhibiting the growth
of spot blotch disease by 60.82% in vitro (Kaur et al. ). Arbuscular mycorrhizal
fungi (AMF), which share symbiotic relationship with nearly all plants, are
2021
2018
2019
2021
2018
2014201320122021
Pathogen Resulted effect
lipoxygenase and PR
gene-related defense
pathways
188 A. A. Almoneafy et al.
Table 10.1 (continued)
Type of
controlling
approach
Disease’s
name Reference
Plant resistance
inducers (several
chemical
inducers)
Mycosphaerella
graminicola
Septoria
leaf
blotch
The treatment had a
suppressive effect on
Septoria leaf blotch, as
well as an increase in
wheat grain yield
El-Gamal
et al.
(2021)
Plant resistance
inducers (salicylic
acid)
Zymoseptoria
tritici
Septoria
tritici
blotch
Treatment resulted in the
induction of pathogen
resistance in wheat-
treated plants by
increasing the expression
of both the PAL and PR2
genes
Mahmoudi
et al.
(2021)
important fungi that live in the rhizospheric soil and could be used to control wheat
diseases. AMF has been shown in this symbiosis to improve growth and crop yield,
as well as to provide tolerance against different stress factors, including protection
against many phytopathogenic fungi and heavy metal toxicity (Eke et al. 2016;
Spagnoletti et al. 2017,2018). In this context, inoculation with AMF Rhizophagus
intraradices significantly reduced the population density of Fusarium
pseudograminearum by 75.7% and 39% disease severity in wheat grown in green-
house (N.C. Schenck and G.S. Sm.), via a mechanism of redox balance and
competition for root colonization compared to the untreated control (Spagnoletti
et al. 2021). Plant endophytic microorganisms may be better adapted than epiphytic
microorganisms to enter, colonize, and secrete secondary metabolites within the
plant (Busby et al. 2016; Ulloa-Ogaz et al. 2015). In this respect, pre-colonization of
wheat with endophytic fungi Sarocladium zeae, followed by F. graminearum inoc-
ulation, resulted in a significant reduction of fusarium head blight symptoms (57.9%)
and a 61.2% reduction in mycotoxin content in harvested wheat heads (Kemp et al.
2020). Remarkable results are listed in Table 10.2.
10 Economic and Eco-friendly Alternatives for the Efficient and... 189
10.2.3 Applying of Plant Extracts
Plant-derived natural products have grown into one of the leading resources for
discovering novel compounds with distinct biological functions, resulting in remark-
able number of novel phytopathogen-controlling agrochemicals (Agarwal et al.
2020; Lorsbach et al. 2019; Umetsu and Shirai 2020). Several natural plant products
have been shown to reduce foliar pathogen populations and limit disease develop-
ment, implying that these plant extracts could be used as eco-friendly alternatives
and components in integrated pest management approaches (Draz et al. 2019).
Several plant species have been found to contain natural substances that are either
toxic to several wheat pathogens or can induce plant systemic resistance against
them (Draz et al. 2019; Han et al. 2018). In this context, numerous related
experiments have been performed to investigate the effectiveness of plant extracts
in controlling leaf rust in wheat caused by Puccinia triticina. For example,
pre-application of five plant extracts significantly reduced the coefficient of infection
of wheat leaf rust, and the yield was significantly increased (Draz et al. 2019).
Likewise, spraying Curcuma zedoaria rhizomes or its isolated substance sesquiter-
pene ketolactone showed significant activity against wheat leaf rust in vivo (Han
et al. 2018). In another study, spraying four-day post-inoculated wheat plants with
clove, neem, and garden quinine extracts resulted in complete prevention of leaf rust
development in treated plants (Shabana et al. 2017). More intriguing results were
observed during foliar application of Agapanthus africanus extracts, which unani-
mously improved the in vitro activities of three pathogenesis-related proteins (PR);
i.e., chitinase, -1,3-glucanase, and peroxidase; in susceptible and resistant wheat
cultivars, regardless of whether they were infected or uninfected with leaf rust
(Cawood et al. 2010). Furthermore, it has been reported that spraying wheat leaves
as a pretreatment with bioformulations consisting of aqueous leaf extracts from
Pathogen Resulted effect Reference
(continued)
190 A. A. Almoneafy et al.
Table 10.2 Some successful examples of environmentally friendly biological agents/products
used to control wheat diseases
Type of
controlling
approach
Disease’s
name
Biological
control
(Pseudomonas
fluorescens)
Gaeumannomyces
graminis var.
tritici
Take-all
disease
Take-all declination in
wheat plants caused
by the toxic effect of
2,4-DAPG on the
pathogen
Durán and de
la Luz Mora
(2021)
Biological
control
(Pseudomonas
fluorescens
HC1–07)
Gaeumannomyces
graminis var.
tritici and
Rhizoctonia solani
AG-8
–In vitro inhibition of
fungal growth
Yang et al.
(2014)
Biological
control (Bacillus
velezensis
CC09)
Gaeumannomyces
graminis var.
tritici and
Bipolaris
sorokiniana
Take-all
disease +
spot
blotch
disease
66.67% and 21.64%
disease-control
efficacy of take-all and
spot blotch,
respectively
Kang et al.
(2018)
Biological
control
(B. subtilis)
Blumeria graminis
f. sp. Tritici
Wheat
powdery
mildew
Treatment inhibited
conidial germination
and normal
appressorium
development in vitro
and induced disease
resistance in wheat
in vivo
Xie et al.
(2021)
Biological
control (Bacillus
velezensis
CC09)
Gaeumannomyces
graminis var.
tritici
Take-all
disease
Pathogen
pathogenicity-related
genes are
downregulated as a
result of bioagent
treatment
Kang et al.
(2019)
Cultivar
mixtures
Zymoseptoria
tritici
Septoria
tritici
blotch
AUDPC of susceptible
plants was reduced by
68% in the
heterogeneous
mixture and by 32%
and 34% in the
homogeneous
mixtures with 75%
and 25% of resistant
plants, respectively
Vidal et al.
(2017)
Cultivar
mixtures
Puccinia
striiformis f. sp.
tritici
Wheat
yellow
rust
In comparison to pure
stands, heterogeneous
mixtures reduced the
variability of disease
severity and yield
Vidal et al.
(2020)
Cultivar
mixtures
Zymoseptoria
tritici
Adding 25% of a
resistant cultivar to a
Ben M'Barek
et al. (2020)
Pathogen Resulted effect Reference
Jacaranda mimosifolia only and/or combined with 0.05% Amistar Xtra improves
leaf rust resistance due to the extract’s ability to increase PR protein expression in
treated plants (Naz et al. 2014). Plant extracts, on the other hand, were used to
counter other diseases that afflicted the wheat plant and demonstrated remarkable
efficacy in controlling those diseases. For instance, several studies have reported that
plant extracts have remarkable antimicrobial activities against Bipolaris sorokiniana
and other wheat fungal pathogens (Bahadar et al. 2016; Magar et al. 2020; Naz et al.
2018; Perelló et al. 2013). Findings related to the controlling effect of plant extracts
are listed within Table 10.1.
10 Economic and Eco-friendly Alternatives for the Efficient and... 191
Table 10.2 (continued)
Type of
controlling
approach
Disease’s
name
Septoria
tritici
blotch
pure stand of a
susceptible cultivar
reduces disease
severity by nearly
50%
Biofumigation
(Brassica
carinata as a
break crop)
Bipolaris
sorokiniana and
Fusarium
culmorum
Common
root rot
and
fusarium
foot rot
Treatment reduced the
incidence and severity
of fusarium foot rot by
40.6% and 56.3%,
respectively, and
completely eliminated
common root rot on
wheat
Campanella
et al. (2020)
Biofumigation
(white mustard
meal)
Fusarium
culmorum Sacc
Common
root rot
In a greenhouse trial,
treatment reduced
pathogen infection by
38% and improved
wheat growth and
grain quality
parameters in afield
trial
Kowalska
et al. (2021)
Biofumigation
(mulch layer and
botanical
extracts of three
plants)
Fusarium
graminearum
Fusarium
head
blight
Treatment resulted in
consistent suppression
of fusarium head
blight and a significant
reduction of
mycotoxins in wheat
grains
Drakopoulos
et al. (2020)
Biofumigation
(isothiocyanates
compounds)
Fusarium
graminearum
Fusarium
head
blight
In vitro inhibition of
conidial germination
and mycelium radial
growth is enhanced by
isothiocyanates, allyl,
and methyl
isothiocyanates
Ashiq et al.
(2021)
192 A. A. Almoneafy et al.
10.2.4 Cultivar Mixtures for Wheat Disease Management
Cultivar mixtures/multiline cultivars can be an efficient technique for managing crop
diseases, especially those caused by airborne pathogens. Though some seedlings can
be affected by certain elements of the pathogen population, the host mixture overall
elicits considerable resistance, owing primarily to host diversification (Brooker et al.
2021; Mundt 2002; Zhang et al. 2018). Several mechanisms can be used to demon-
strate disease suppression among combinations of susceptible and resistant plant
cultivars. In this regard, de Vallavieille-Pope (2004), Finckh et al. (2000), and Mundt
(2002) demonstrated several potential mechanisms for elucidating the reductive
effect of cultivar mixtures on plant diseases. Such mechanisms include pathogen
spread restriction because of the resistant plants present among susceptible plants,
induction of host resistance as a result of infection by avirulent strains, which can
decrease subsequent infection by virulent strains, and competition among pathogen
populations for available host tissues (Fig. 10.1). Vidal et al. (2017) recently
demonstrated four mechanisms by which cultivar mixtures reduce disease. The
first is the density effect, which involves distancing the susceptible cultivars within
the mixture, minimizing the amount of inoculum reaching them. Second, there is the
barrier effect, which is represented by the interception of pathogen spores in the
mixtures by resistant plants. Third, induced resistance occurs when an avirulent
pathogen race infects an incompatible host. Finally, microclimate modification
occurs as a result of the varied characteristics of mixed cultivars, such as plant
height, canopy structure, and so on, which alter the microenvironment, making it
unsuitable for the development of plant diseases. Cultivar mixtures are not used to
get rid of phytopathogens. Instead, they are used to reduce disease development in
Fig. 10.1 Some of the known mechanisms by which cultivar mixtures can suppress foliar diseases
in wheat
the mixture by lowering the amount of inoculum needed for a severe infection
(Kumar et al. 2021; Vidal et al. 2017,2020). Besides, it has also been demonstrated
that cultivating mixtures of cultivars with varying disease resistance levels and
agronomic traits in the same field at the same time produces higher yields than
pure cultivars (Fang et al. 2014;Župunski et al. 2021). Similarly, Kristoffersen et al.
(2020) revealed that cultivar mixtures reduced (by 10.6%) the severity of Septoria
tritici blotch caused by Zymoseptoria tritici and improved yields by 1.4% across all
tests in a meta-analysis of 406 trials conducted over 19 years. However, in another
study, cultivar mixtures reduced wheat stripe rust to a lesser extent than susceptible
pure stands (Huang et al. 2011). Recently, it was stated that increasing the number of
cultivars with regard to diversification in agronomical characteristics such as plant
height and earliness did not have a negative impact on the performance of the
mixtures, but rather contributed to stabilizing the reduction of pathogen spread
within the mixtures population and improving their yield when compared to their
corresponding pure stands (Vidal et al. 2020). Another meta-analysis study found
that disease reduction of wheat stripe rust provided by cultivar mixtures may be more
effective during intensive disease infection and moderate wheat sowing density
(Huang et al. 2012).Due to the fact that farmers prefer susceptible components
within cultivar mixtures for their agronomical traits over resistant components,
researchers are increasingly investigating the performance of mixtures with a con-
siderable ratio of the resistant cultivar which offer a comparable level of disease
reduction as pure resistant components. In this regard, Ben M’Barek et al. (2020)
revealed that mixing 25% resistant cultivar with pure stand of susceptible cultivar
leads to a considerable reduction (nearly 50%) in Septoria tritici blotch disease
severity when compared to the pure susceptible component. Canopy architecture of
cultivar mixture components must be considered in addition to disease resistance in
order to improve cultivar mixture performance in disease reduction (Vidal et al.
2017). Furthermore, wheat cultivar mixtures had no beneficial effect on soil
collembola as beneficial insects contribute to the regulation of the activities of
decomposing microorganisms, consuming fungal phytopathogens in soil, and
regulating the activity of mycorrhizal fungi (Salmon et al. 2021). Additionally,
cultivar mixtures have proven to have a higher potential for yield increase when
compared to pure components, particularly in low pesticide input cropping systems
(Borg et al. 2018). The presentative findings related to the role of cultivar mixtures in
the reduction of wheat diseases are summarized in Table 10.2.
10 Economic and Eco-friendly Alternatives for the Efficient and... 193
10.2.5 Estimation of Plant Resistance Inducers’Mitigating Effect
Against Wheat Phytopathogens
Agents that improve plant resistance to pathogens by stimulating the plant’s particu-
lar defense mechanisms, or its own induced resistance, are called Plant resistance
inducers (Alexandersson et al. 2016). To deal with biotic stresses or pathogens,
plants typically have an advanced immune system. Plants physically defend them-
selves by barriers like dense cuticles, waxes, and unique trichomes that inhibit
pathogens and insects from staying on plants. Additionally, chemical complexes are
produced by plants as defense against pathogens and herbivores (Moustafa-Farag
et al. 2020). However, in order to properly deal with such a challenge, the plant must
first identify a biotic stress casual factor or pathogen as an unfriendly component that
must be dealt with. Pathogens can be recognized by plants via two pathways that
activate defense responses. First, pathogen-associated molecular patterns (PAMPs)
including peptidoglycans, fungal chitin, bacterial lipopolysaccharides, and quorum
sensing are recognized by the pattern recognition receptors. PAMP-triggered immu-
nity is the most basic form of defense (PTI) (Monaghan and Zipfel 2012). The
second pathway of the immune system (ETI) comprises secretion of plant resistance
proteins (R), which through effector-triggered immunity process detect pests’/
pathogens’specific effectors (Avr proteins) and activate the plant defense response.
As a result, hypersensitive responses (HR) are triggered, which involve programmed
cell death in affected cells and their adjacent regions (Spoel and Dong 2012).
Generally, phytohormones such as ethylene (ET), salicylic acid (SA), and jasmonic
acid (JA) act as signaling molecules for two types of efficient plant pathogen
resistance. The first type is called systemic acquired resistance (SAR) that occurs
when necrotizing pathogens infect the cells and are associated with large amount of
SA and pathogenesis-related proteins (Grant and Lamb 2006). The second type of
plant resistance is induced systemic resistance (ISR), which is activated by the
application of plant resistance inducers, which can be either biotic, such as non-
pathogenic root-colonizing microorganisms or any other non-virulent pathogen, or
nonbiotic, such as chemical agents or plant extracts. Such resistance necessitates the
use of signaling compounds such as JA and ET (Alexandersson et al. 2016).
However, as many studies have shown, many chemical inducers can also activate
the first type of resistance in plants (Lee et al. 2014,2015; Zhao et al. 2019). Plant
resistance inducers can have a systemic effect, as described above, or a local effect,
such as changes in composition of the cell wall, hypersensitive response (HR), and
producing antimicrobial protein and phytoalexins (Alexandersson et al. 2016). Many
chemical inducers, such as SA, benzothiadiazole (BTH), 2,6-dichloroisonicotinic
acid (INA), acetylsalicylic acid, β-aminobutyric acid (BABA), and trehalose....
etc., have been widely used to control wheat disease. For instance, in a three-year
field trial, wheat plants treated with chemical inducers or some plant extracts
exhibited long-term-induced resistance and a reduction in powdery mildew disease
severity ranging from 2% to 53% (Vechet et al. 2009). In another study, although
pretreatment of wheat plantlets with N-hydroxypipecolic acid moderately increases
resistance to Fusarium graminearum, it improves immune response, allowing wheat
plants to defend themselves against pathogens (Zhang et al. 2021). Furthermore,
under greenhouse conditions, foliar treatments of wheat seedlings with saccharin, a
metabolite derived from probenazole, caused a 77% decline in Septoria tritici blotch
disease onset, and the protective effect of saccharin was attributed to induction and
priming of lipoxygenase and PR gene-related defense pathways (Mejri et al. 2020).
194 A. A. Almoneafy et al.
Meanwhile, spray application of several chemical inducers under field conditions
suppressed Septoria leaf blotch, particularly treatment with potassium silicate and
sodium silicate; this positive effect was accompanied by an increase in grain yield in
sprayed wheat plants that were sprayed (El-Gamal et al. 2021). Also, pretreatment of
wheat seedlings with SA resulted in the induction of resistance against Septoria
tritici blotch in wheat plants by significantly upregulating the phenylalanine
ammonia-lyase (PAL) and β-1,3-glucanase (PR2) genes in wheat-treated plants
compared to untreated ones (Mahmoudi et al. 2021). Table 10.1 summarizes the
preliminary findings concerning the function of plant resistance inducers in the
reduction of wheat diseases.
10 Economic and Eco-friendly Alternatives for the Efficient and... 195
10.2.6 Biofumigation for the Safe Management of Wheat Diseases
Biofumigation is the suppression of soilborne pathogens through the decomposition
of organic material, such as agricultural by-products or manure, which releases
volatile chemicals that have the ability to reduce different types of phytopathogens
including bacteria, fungi, and nematodes (Baysal-Gurel et al. 2020; Madhavi
Gopireddy et al. 2019; Matthiessen and Kirkegaard 2006). Biofumigation can be
accomplished by including green manure, seed meals, or dried plant matter that has
been treated to retain isothiocyanate activity into the soil (Lu et al. 2010; Matthiessen
and Kirkegaard 2006). Plants in the Brassicaceae family are more appropriate for
biofumigation because their tissues contain a high concentration of glucosinolates
and other sulfur-containing compounds (Campanella et al. 2020). As a result of the
hydrolysis of glucosinolates by the action of the myrosinase enzyme, these plants
emit toxic substances such as nitriles, thiocyanates, isothiocyanates, oxazolidine,
methanethiol, and dimethyl sulfide (Fahey et al. 2001).
The hydrolyzation process happens when plant tissues are injured or chopped.
Consequently, fresh Brassicaceae plants or seed meals are chopped and mixed into
the soil to perform biofumigation (Ziedan 2022). Because of their exposure to the
slowly released toxic substances, many harmful soilborne phytopathogens, weeds,
and insects are effectively suppressed (Madhavi Gopireddy et al. 2019). Further-
more, these substances can boost the activity of beneficial soil microorganisms and
increase their competitiveness against non-beneficial microorganisms (Galletti et al.
2008; Gimsing and Kirkegaard 2009). Additionally, this process can help improve
soil fertility by increasing available nutrients, enhancing soil properties, and
enriching soil organic matter (Galletti et al. 2008; Gimsing and Kirkegaard 2009;
Matthiessen and Kirkegaard 2006). Biofumigation with brassica plant materials has
proven to be an operative method for controlling wheat soilborne pathogens, either
alone or in combination with other methods. In this regard, using Brassica carinata
as a break crop with durum wheat reduced the occurrence and intensity of Fusarium
foot rot by 40.6% and 56.3%, respectively, as well as no symptoms of common root
rot on wheat plants cultivated after B. carinata break crop. These positive results
were accompanied by a significant boost in wheat yield when compared to wheat
monoculture (Campanella et al. 2020). Moreover, using white mustard meal as a
wheat seed wet dressing reduced Fusarium culmorum Sacc. infection by 38 to 44%
in a greenhouse trial and improved wheat growth and grain quality parameters in a
field trial (Kowalska et al. 2021). Similarly, mulch layer and botanical extract
treatments of Sinapis alba,Brassica juncea,orTrifolium alexandrinum on top of the
maize remains infected with Fusarium graminearum after wheat planting
demonstrated consistent suppression of fusarium head blight and remarkable reduc-
tion of mycotoxins contents in wheat grains over 2 years of field experiments
(Drakopoulos et al. 2020). Additionally, Ashiq et al. (2021) found that
isothiocyanates, allyl, and methyl isothiocyanates have greater inhibition abilities
against conidial germination and mycelium radial growth than the other
isothiocyanates compounds during in vitro evaluation of antifungal activity against
Fusarium graminearum. Table 10.2 illustrates the initial findings regarding the role
of biofumigation as an effective means of suppressing soilborne wheat diseases.
196 A. A. Almoneafy et al.
10.3 Conclusions and Prospects for the Future
The uncontrolled use of agrochemicals has caused significant damage to resource-
poor ecosystems with low biodiversity. The severity of these damages has reached
an unprecedented level in recent years, particularly in developing countries. For
example, the accumulation of high concentrations of agrochemicals in agricultural
soils has negatively impacted the positive role of their beneficial microorganisms
and significantly reduced their organic matter content, significantly reducing their
ability to retain moisture content and negatively affecting their other physical
properties. Such that if these irresponsible behaviors of random and excessive use
of these chemicals are not remedied, this may result in irreversible damage to these
poor ecosystems’vitality, components, and natural resources. This is in addition to
the significant health consequences for humans and animals. As a result, it is critical
that we use safe environmental alternatives to achieve environmentally friendly pest
management of agricultural pests in order to restore and repair damaged ecosystems.
The continued use of these alternatives will allow us to sustain our ecosystems’
limited natural resources. This is accomplished practically by incorporating these
alternatives into integrated pest management programs for cereal crops, particularly
wheat, either individually or in combination with the other available alternatives.
Furthermore, such incorporation should be carried out in a way that does not
negatively impact the performance of currently used methods, as well as
the components and resources of existing ecosystems, and is also compatible with
the limited material capabilities of low-income farmers. This will contribute to the
gradual disappearance of pollution challenges caused by the accumulation of high
levels of agrochemical concentrations in soil and other ecosystem components.
Figure 10.2 depicts a number of anticipated benefits from the use of environmentally
friendly approaches in the control of wheat diseases.
10 Economic and Eco-friendly Alternatives for the Efficient and... 197
Fig. 10.2 The anticipated advantages of using eco-friendly alternatives for the safe management of
wheat diseases are many
References
Agarwal G, Carcache PJB, Addo EM, Kinghorn AD (2020) Current status and contemporary
approaches to the discovery of antitumor agents from higher plants. Biotechnol Adv 38:107337
Alexandersson E, Mulugeta T, Lankinen Å, Liljeroth E, Andreasson E (2016) Plant resistance
inducers against pathogens in Solanaceae species—from molecular mechanisms to field appli-
cation. Int J Mol Sci 17(10)
Almoneafy AA (2006) Pathological studies on Wheat Yellow Rust (Puccinia striiformis f.sp tritici)
in Yemen.Master thesis: Sana’a University, Sana’a, Yemen
Almoneafy AA, Moustafa-Farag M, Mohamed HI (2021) The auspicious role of plant growth-
promoting rhizobacteria in the sustainable management of plant diseases. In: Mohamed HI,
El-Beltagi HE-DS, Abd-Elsalam KA (eds) Plant growth-promoting microbes for sustainable
biotic and abiotic stress management. Springer, Cham, pp 251–283
Ashiq S, Edwards SG, Fatukasi O, Watson A, Back MA (2021) In vitro activity of isothiocyanates
against Fusarium graminearum. Plant Pathol 71(3):594–601
Bahadar K, Munir A, Asad S (2016) Management of Bipolaris sorokiniana the causal pathogen of
spot blotch of wheat by eucalyptus extracts. JPPM 7(1):1000326
198 A. A. Almoneafy et al.
Baysal-Gurel F, Liyanapathiranage P, Addesso KM (2020) Effect of Brassica crop-based
biofumigation on soilborne disease suppression in woody ornamentals. Can J Plant Pathol
42(1):94–106
Ben M’Barek S, Karisto P, Abdedayem W, Laribi M, Fakhfakh M, Kouki H, Mikaberidze A,
Yahyaoui A (2020) Improved control of septoria tritici blotch in durum wheat using cultivar
mixtures. Plant Pathol 00:1–11
Borg J, Kiær LP, Lecarpentier C, Goldringer I, Gauffreteau A, Saint-Jean S, Barot S, Enjalbert J
(2018) Unfolding the potential of wheat cultivar mixtures: a meta-analysis perspective and
identification of knowledge gaps. Field Crops Res 221(2018):298–313
Brooker RW, George TS, Homulle Z, Karley AJ, Newton AC, Pakeman RJ, Schöb C (2021)
Facilitation and biodiversity–ecosystem function relationships in crop production systems and
their role in sustainable farming. J Ecol 109(5):2054–2067
Busby PE, Ridout M, Newcombe G (2016) Fungal endophytes: modifiers of plant disease. Plant
Mol Biol 90(6):645–655
Campanella V, Mandalà C, Angileri V, Miceli C (2020) Management of common root rot and
Fusarium foot rot of wheat using Brassica carinata break crop green manure. Crop Protect. 130:
105073
Cawood ME, Pretorius JC, van der Westhuizen AJ, Pretorius ZA (2010) Disease development and
PR-protein activity in wheat (Triticum aestivum) seedlings treated with plant extracts prior to
leaf rust (Puccinia triticina) infection. Crop Protect. 29(11):1311–1319
Chhipa H (2019) Chapter 5 - Mycosynthesis of nanoparticles for smart agricultural practice: a green
and eco-friendly approach. In: Shukla AK, Iravani S (eds) Green synthesis, characterization and
applications of nanoparticles. Elsevier, pp 87–109
de Vallavieille-Pope C (2004) Management of disease resistance diversity of cultivars of a species
in single fields: controlling epidemics. C R Biol 327(7):611–620
Drakopoulos D, Kägi A, Gimeno A, Six J, Jenny E, Forrer H-R, Musa T, Meca G, Vogelgsang S
(2020) Prevention of Fusarium head blight infection and mycotoxins in wheat with cut-and-
carry biofumigation and botanicals. Field Crops Res 246:107681
Draz IS, Elkhwaga AA, Elzaawely AA, El-Zahaby HM, Ismail A-WA (2019) Application of plant
extracts as inducers to challenge leaf rust of wheat. Egypt J Biol Pest Control 29(1):6
Durán P, de la Luz Mora M (2021) Plant–soil–microorganism interaction involved in natural
suppression of take-all disease. In: Kaushal M, Prasad R (eds) Microbial biotechnology in
crop protection. Springer, Singapore, pp 171–188
Eke P, Chatue Chatue G, Wakam LN, Kouipou RMT, Fokou PVT, Boyom FF (2016) Mycorrhiza
consortia suppress the fusarium root rot (Fusarium solani f. sp. Phaseoli) in common bean
(Phaseolus vulgaris L.). Biol Control 103:240–250
El-Gamal NG, El-Mougy NS, Abdel-Kader MM, Ali Khalil MS (2021) Influence of inorganic salts
and chitosan as foliar spray on wheat septoria leaf blotch disease severity under field conditions.
Arch Phytopathol Plant Protect 54(13–14):836–849
Etalo Desalegn W, Jeon J-S, Raaijmakers JM (2018) Modulation of plant chemistry by beneficial
root microbiota. Nat Prod Rep 35(5):398–409
Fahey JW, Zalcmann AT, Talalay P (2001) The chemical diversity and distribution of
glucosinolates and isothiocyanates among plants. Phytochemistry 56(1):5–51
Fang Y, Xu B, Liu L, Gu Y, Liu Q, Turner NC, Li FM (2014) Does a mixture of old and modern
winter wheat cultivars increase yield and water use efficiency in water-limited environments?
Field Crops Res 156:12–21
FAO (2020) FAOSTAT statistical database. Food and Agriculture Organization of the United
Nations, Rome
Finckh M, Gacek E, Goyeau H, Lannou C, Merz U, Mundt C, Munk L, Nadziak J, Newton A, De
Vallavieille-Pope C, Wolfe M (2000) Cereal variety and species mixtures in practice, with
emphasis on disease resistance. Agronomie 20(7):813–837
Galletti S, Sala E, Leoni O, Burzi PL, Cerato C (2008) Trichoderma spp. tolerance to Brassica
carinata seed meal for a combined use in biofumigation. Biol Control 45(3):319–327
10 Economic and Eco-friendly Alternatives for the Efficient and... 199
Gao T, Bian R, Joseph S, Taherymoosavi S, Mitchell DRG, Munroe P, Xu J, Shi J (2020) Wheat
straw vinegar: a more cost-effective solution than chemical fungicides for sustainable wheat
plant protection. Sci Total Environ 725:138359
Gimsing AL, Kirkegaard JA (2009) Glucosinolates and biofumigation: fate of glucosinolates and
their hydrolysis products in soil. Phytochem Rev 8(1):299–310
Grant M, Lamb C (2006) Systemic immunity. Curr Opin Plant Biol 9(4):414–420
Han JW, Shim SH, Jang KS, Choi YH, Dang QL, Kim H, Choi GJ (2018) In vivo assessment of
plant extracts for control of plant diseases: a sesquiterpene ketolactone isolated from Curcuma
zedoaria suppresses wheat leaf rust. J Environ Sci Health Pt B: Pestic Food Contam Agric
Wastes 53(2):135–140
He X, Deng H, Hwang H-m (2019) The current application of nanotechnology in food and
agriculture. J Food Drug Anal 27(1):1–21
Huang C, Sun ZY, Wang HG, Luo Y, Ma ZH (2011) Spatiotemporal effects of cultivar mixtures on
wheat stripe rust epidemics. Eur J Plant Pathol 131:483–496
Huang C, Sun ZY, Wang HG, Luo Y, Ma ZH (2012) Effects of wheat cultivar mixtures on
stripe rust: a meta-analysis on field trials. Crop Prot 33:52–58
Ibrahim E, Zhang M, Zhang Y, Hossain A, Qiu W, Chen Y, Wang Y, Wu W, Sun G, Li B (2020)
Green-synthesization of silver nanoparticles using endophytic bacteria isolated from garlic and
its antifungal activity against wheat fusarium head blight pathogen fusarium graminearum.
Nano 10(2):219
Kang X, Zhang W, Cai X, Zhu T, Xue Y, Liu C (2018) Bacillus velezensis CC09: a potential
‘vaccine’for controlling wheat diseases. Mol Plant-Microbe Interact 31(6):623–632
Kang X, Guo Y, Leng S, Xiao L, Wang L, Xue Y, Liu C (2019) Comparative transcriptome
profiling of Gaeumannomyces graminis var. tritici in wheat roots in the absence and presence of
biocontrol bacillus velezensis CC09. Front Microbiol 10:1474
Kaur A, Sharma VK, Sharma S (2021) Management of spot blotch of barley: an eco-friendly
approach. Australas Plant Pathol 50(4):389–401
Kaushal M, Wani SP (2016) Plant-growth-promoting rhizobacteria: drought stress alleviators to
ameliorate crop production in drylands. Ann Microbiol 66(1):35–42
Kemp ND, Vaughan MM, McCormick SP, Brown JA, Bakker MG (2020) Sarocladium zeae is a
systemic endophyte of wheat and an effective biocontrol agent against Fusarium head blight.
Biol Control 149:104329
Khan MR, Rizvi TF (2014) Nanotechnology: scope and application in plant disease management.
Plant Pathol J 13(3):214–231
Köhl J, Kolnaar R, Ravensberg WJ (2019) Mode of action of microbial biological control agents
against plant diseases: relevance beyond efficacy. Front Plant Sci 10:845
Kowalska J, Tyburski J, Krzymińska J, Jakubowska M (2021) Effects of seed treatment with
mustard meal in control of fusarium culmorum Sacc. and the growth of common wheat
(Triticum aestivum ssp. vulgare). Eur J Plant Pathol 159(2):327–338
Kristoffersen R, Jørgensen LN, Eriksen LB, Nielsen GC, Kiær LP (2020) Control of Septoria tritici
blotch by winter wheat cultivar mixtures: meta-analysis of 19 years of cultivar trials. Field Crops
Res 249:107696
Kumar G, Rashid M, Teli B, Bajpai R, Nanda S, Yadav S (2021) Cultivar mixture: old but impactful
plant disease management strategy. Int J Econ Plants 8:113–119
Kwak Y-S, Weller DM (2013) Take-all of wheat and natural disease suppression: a review. Plant
Pathol J 29(2):125–135
Kwak Y-S, Bonsall RF, Okubara PA, Paulitz TC, Thomashow LS, Weller DM (2012) Factors
impacting the activity of 2,4-diacetylphloroglucinol-producing Pseudomonas fluorescens
against take-all of wheat. Soil Biol Biochem 54:48–56
Lee HY, Byeon Y, Back K (2014) Melatonin as a signal molecule triggering defense responses
against pathogen attack in Arabidopsis and tobacco. J Pineal Res 57(3):262–268
Lee HY, Byeon Y, Tan D-X, Reiter RJ, Back K (2015) Arabidopsis serotonin N-acetyltransferase
knockout mutant plants exhibit decreased melatonin and salicylic acid levels resulting in
susceptibility to an avirulent pathogen. J Pineal Res 58(3):291–299
200 A. A. Almoneafy et al.
Lin D, Xing B (2007) Phytotoxicity of nanoparticles: inhibition of seed germination and root
growth. Environ Pollut 150(2):243–250
Lorsbach BA, Sparks TC, Cicchillo RM, Garizi NV, Hahn DR, Meyer KG (2019) Natural products:
a strategic lead generation approach in crop protection discovery. Pest Manag Sci 75(9):
2301–2309
Lu P, Gilardi G, Gullino ML, Garibaldi A (2010) Biofumigation with brassica plants and its effect
on the inoculum potential of Fusarium yellows of brassica crops. Eur J Plant Pathol 126(3):
387–402
Luo K, Jung S, Park K-H, Kim Y-R (2018) Microbial biosynthesis of silver nanoparticles in
different culture media. J Agric Food Chem 66(4):957–962
Madhavi Gopireddy B, Gali UD, Kotamraju VKK, Babu Tatinaeni R, Naidu CM (2019) Compati-
bility potential of brassica species and mustard seed meal with Pseudomonas fluorescens for
biological control of soilborne plant diseases. In: Sayyed RZ, Reddy MS, Antonius S (eds) Plant
growth promoting rhizobacteria (PGPR): prospects for sustainable agriculture. Springer,
Singapore, pp 217–231
Magar PB, Baidya S, Koju R, Adhikary S (2020) In-vitro evaluation of botanicals and fungicides
against Bipolaris sorokiniana, causing spot blotch of wheat. J Agric Nat Resour 3(2):296–305
Mahmoudi Z, Taliei F, Ahangar L, Kheyrgoo M (2021) Assessment of salicylic acid-induced
resistance against Septoria tritici blotch disease on wheat using real-time PCR. JCP 10(1):
151–165
Matthiessen JN, Kirkegaard JA (2006) Biofumigation and enhanced biodegradation: opportunity
and challenge in soilborne pest and disease management. Crit Rev Plant Sci 25(3):235–265
Matzen N, Ravn Jørgensen J, Holst N, Nistrup Jørgensen L (2019) Grain quality in wheat—impact
of disease management. Eur J Agron 103:152–164
Mehta YR (2014a) Pillars of integrated disease management. In: Mehta YR (ed) Wheat diseases and
their management. Springer, Cham, pp 17–63
Mehta YR (2014b) Wheat and wheat production constraints. In: Mehta YR (ed) Wheat diseases and
their management. Springer, Cham, pp 1–16
Mejri S, Magnin-Robert M, Randoux B, Ghinet A, Halama P, Siah A, Reignault P (2020) Saccharin
provides protection and activates defense mechanisms in wheat against the hemibiotrophic
pathogen Zymoseptoria tritici. Plant Dis 105(4):780–786
Mishra S, Singh BR, Singh A, Keswani C, Naqvi AH, Singh HB (2014) Biofabricated silver
nanoparticles act as a strong fungicide against Bipolaris sorokiniana causing spot blotch disease
in wheat. PLoS One 9(5):e97881
Monaghan J, Zipfel C (2012) Plant pattern recognition receptor complexes at the plasma membrane.
Curr Opin Plant Biol 15(4):349–357
Moustafa-Farag M, Almoneafy A, Mahmoud A, Elkelish A, Arnao MB, Li L, Ai S (2020)
Melatonin and its protective role against biotic stress impacts on plants. Biomol Ther 10(1):54
Mundt CC (2002) Use of multiline cultivars and cultivar mixtures for disease management. Annu
Rev Phytopathol 40(1):381–410
Naz R, Bano A, Wilson NL, Guest D, Roberts TH (2014) Pathogenesis-related protein expression in
the apoplast of wheat leaves protected against leaf rust following application of plant extracts.
Phytopathology 104(9):933–944
Naz R, Nosheen A, Yasmin H, Bano A, Keyani R (2018) Botanical-chemical formulations
enhanced yield and protection against Bipolaris sorokiniana in wheat by inducing the expres-
sion of pathogenesis-related proteins. PLoS One 13(4):e0196194
Partila AM (2019) Bioproduction of silver nanoparticles and its potential applications in
agriculture. In: Panpatte DG, Jhala YK (eds) Nanotechnology for agriculture: advances for
sustainable agriculture. Springer, Singapore, pp 19–36
Perelló AE, Noll U, Slusarenko AJ (2013) In vitro efficacy of garlic extract to control fungal
pathogens of wheat. J Med Plants Res 7(119):1809–1817
Rai-Kalal P, Tomar RS, Jajoo A (2021) Seed nanopriming by silicon oxide improves drought stress
alleviation potential in wheat plants. Funct Plant Biol 48(9):905–915
10 Economic and Eco-friendly Alternatives for the Efficient and... 201
Saberi-Riseh R, Moradi-Pour M, Mohammadinejad R, Thakur VK (2021) Biopolymers for
biological control of plant pathogens: advances in microencapsulation of beneficial
microorganisms. Polymers 13(12):1938
Salmon S, Vittier T, Barot S, Ponge J-F, Ben-Assoula F, Lusley P (2021) Responses of Collembola
communities to mixtures of wheat varieties: a trait-based approach. Pedobiologia (Jena) 87–88
(150755)
Santos SN, Kavamura VN, da Silva JL, de Melo IS, Andreote FD (2011) Plant growth promoter
rhizobacteria in plants inhabiting harsh tropical environments and its role in agricultural
improvements. In: Maheshwari DK (ed) Plant growth and health promoting bacteria. Springer,
Berlin, Heidelberg, pp 251–272
Satti SH, Raja NI, Javed B, Akram A, Mashwani Z-u-R, Ahmad MS, Ikram M (2021) Titanium
dioxide nanoparticles elicited agro-morphological and physicochemical modifications in wheat
plants to control Bipolaris sorokiniana. PLoS One 16(2):e0246880
Shabana YM, Abdalla ME, Shahin AA, El-Sawy MM, Draz IS, Youssif AW (2017) Efficacy of
plant extracts in controlling wheat leaf rust disease caused by Puccinia triticina. Egypt J Basic
Appl Sci 4(1):67–73
Smolińska U, Kowalska B (2018) Biological control of the soil-borne fungal pathogen sclerotinia
sclerotiorum –– a review. J Plant Pathol 100(1):1–12
Sood G, Kaushal R (2021) Plant growth promoting rhizobacteria for crop health in wheat-maize
cropping systems in Northwest Himalayas. In: Kaushal M, Prasad R (eds) Microbial biotech-
nology in crop protection. Springer, Singapore, pp 269–287
Spagnoletti F, Carmona M, Gómez NET, Chiocchio V, Lavado RS (2017) Arbuscular mycorrhiza
reduces the negative effects of M. phaseolina on soybean plants in arsenic-contaminated soils.
Appl Soil Ecol 121:41–47
Spagnoletti FN, Leiva M, Chiocchio V, Lavado RS (2018) Phosphorus fertilization reduces the
severity of charcoal rot (Macrophomina phaseolina) and the arbuscular mycorrhizal protection
in soybean. J Plant Nutr Soil Sci 181(6):855–860
Spagnoletti FN, Carmona M, Balestrasse K, Chiocchio V, Giacometti R, Lavado RS (2021) The
arbuscular mycorrhizal fungus Rhizophagus intraradices reduces the root rot caused by fusar-
ium pseudograminearum in wheat. Rhizosphere 19:100369
Spoel SH, Dong X (2012) How do plants achieve immunity? Defence without specialized immune
cells. Nat Rev Immunol 12(2):89–100
Tilman D, Balzer C, Hill J, Befort BL (2011) Global food demand and the sustainable intensifica-
tion of agriculture. PNAS 108(50):20260
Ulloa-Ogaz AL, Muñoz-Castellanos LN, Nevárez-Moorillón GV (2015) Biocontrol of
phytopathogens: antibiotic production as mechanism of control. In: Méndez-Vilas A (ed) The
battle against microbial pathogens: basic science, technological advances and educational
programs, pp 305–309
Umetsu N, Shirai Y (2020) Development of novel pesticides in the 21st century. J Pestic Sci 45(2):
54–74
Vechet L, Burketova L, Sindelarova M (2009) A comparative study of the efficiency of several
sources of induced resistance to powdery mildew (Blumeria graminis f. sp. tritici) in wheat
under field conditions. Crop Protect 28(2):151–154
Vidal T, Boixel A-L, Durand B, de Vallavieille-Pope C, Huber L, Saint-Jean S (2017) Reduction of
fungal disease spread in cultivar mixtures: impact of canopy architecture on rain-splash dis-
persal and on crop microclimate. Agric For Meteorol 246:154–161
Vidal T, Saint-Jean S, Lusley P, Leconte M, Ben Krima S, Boixel A-L, Wheatamix C, de
Vallavieille-Pope C (2020) Cultivar mixture effects on disease and yield remain despite
diversity in wheat height and earliness. Plant Pathol 69(6):1148–1160
Vos CMF, De Cremer K, Cammue BPA, De Coninck B (2015) The toolbox of Trichoderma spp. in
the biocontrol of Botrytis cinerea disease. Mol Plant Pathol 16(4):400–412
Wang X, Wang C, Li Q, Zhang J, Ji C, Sui J, Liu Z, Song X, Liu X (2018) Isolation and
characterization of antagonistic bacteria with the potential for biocontrol of soil-borne wheat
diseases. J Appl Microbiol 125(6):1868–1880
202 A. A. Almoneafy et al.
Wang H, Liu R, You MP, Barbetti MJ, Chen Y (2021) Pathogen biocontrol using plant growth-
promoting bacteria (PGPR): role of bacterial diversity. Microorganisms 9(9):1988
Xie D, Cai X, Yang C, Xie L, Qin G, Zhang M, Huang Y, Gong G, Chang X, Chen H (2021)
Studies on the control effect of Bacillus subtilis on wheat powdery mildew. Pest Manag Sci
77(10):4375–4382
Xu W, Xu L, Deng X, Goodwin PH, Xia M, Zhang J, Wang Q, Sun R, Pan Y, Wu C, Yang L (2021)
Biological control of take-all and growth promotion in wheat by Pseudomonas chlororaphis
YB-10. Pathogens 10(7):903
Yang M-M, Wen S-S, Mavrodi DV, Mavrodi OV, von Wettstein D, Thomashow LS, Guo J-H,
Weller DM (2014) Biological control of wheat root diseases by the CLP-producing strain
pseudomonas fluorescens HC1-07. Phytopathology 104(3):248–256
Zhang H, Li Y, Zhu J-K (2018) Developing naturally stress-resistant crops for a sustainable
agriculture. Nat Plants 4(12):989–996
Zhang ET, Zhang H, Tang W (2021) Transcriptomic analysis of wheat seedling responses to the
systemic acquired resistance inducer N-hydroxypipecolic acid. Front Microbiol 12:621336
Zhao L, Chen L, Gu P, Zhan X, Zhang Y, Hou C, Wu Z, Wu YF, Wang QC (2019) Exogenous
application of melatonin improves plant resistance to virus infection. Plant Pathol 68(7):
1287–1295
Ziedan E-SH (2022) A review of the efficacy of biofumigation agents in the control of soil-borne
plant diseases. J Plant Prot Res 62(1):1–11
Župunski V, JevtićR, LaloševićM, JockovićB, Župunski L, SkenderovićN (2021) Effect of
cultivation practices on diversity in susceptibility reactions of winter wheat genotypes to
fusarium head blight. Eur J Agron 125:126250
Part III
Genome Editing
205
Resistance Gene Identification, Cloning,
and Characterization in Plants 11
Muhammad Abu Bakar Saddique, Saad Zafar, Zulkifl Ashraf,
Muhammad Atif Muneer, Babar Farid, and Shehla Shabeer
Abstract
Various plant diseases and diverse microbial communities, including bacteria,
fungi, oomycetes, viruses, and nematodes, drastically deteriorate crop quality and
yield worldwide. Plant-pathogen interaction mechanisms have been extensively
studied, which involve the activation of signaling events that lead to the suppres-
sion of pathogen attacks. Several R genes have been found in plants containing
conserved functional domains and nucleotide-binding sites with leucine-rich
repeats (NBS-LRR). So far, different experimental approaches have been used
to identify resistant genes in a variety of plant species. For example, PCR-based
cloning has been employed to identify putative NB-containing R genes that help
to identify potential resistance gene homologs (RGHs). Besides, multiple or
complicated features connected to a single or several stress responses can be
studied using genome-wide association studies (GWAS). In recent years, for the
cloning and mapping of resistance gene analogues (RGAs), a sequence-
homology-based approach has been extensively used. In this chapter, the identi-
fication of resistant genes, their resistance, cloning types, and the identification
M. A. B. Saddique (*) · S. Zafar · Z. Ashraf · S. Shabeer
Institute of Plant Breeding and Biotechnology, MNS University of Agriculture Multan, Multan,
Pakistan
M. A. Muneer
International Magnesium Institute, College of Resources and Environment, Fujian Agriculture and
Forestry University, Fuzhou, China
B. Farid
Institute of Plant Breeding and Biotechnology, MNS University of Agriculture Multan, Multan,
Pakistan
College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, China
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_11
and characterization of RGA have been discussed. Simultaneously, the
mechanisms of the different resistant genes and their functions in different
crops have been reviewed. Furthermore, the RGAs that have been cloned in
many different crops have been suggested as a source of genetic material for
cultivars that are resistant to disease for a long time in crop-breeding programs.
206 M. A. B. Saddique et al.
Keywords
Plant pathogens · Resistance · Plant disease · Plant breeding · Biotechnology ·
Cloning · Food security
11.1 Introduction
Climate change is the major threat to mankind. Globally, it causes 0.4 million deaths
per year due to an increase in temperature and greenhouse gas (GHG)
concentrations. These changes cause drastic effects on crop growth, development,
and cultivation of crops on the globe. Simultaneously, these changes cause
disturbances in the reproduction and severity of many plant pathogens (Gautam
et al. 2013). Plant diseases are the result of the interaction of these plant pathogens
like bacteria, fungi, viruses, nematodes, and insects with susceptible hosts and the
environment. It causes a huge reduction in crop production globally. According to
FAO, about 20–40% of global crop yield is reduced each year due to biotic factors
(pests and diseases). Climate change has made it easier for many plant pathogens to
move around, which has resulted in the emergence of new diseases that could spread
in uncontrollable rashes and endanger food security (Piquerez et al. 2014). A lot of
research work has been done by plant scientists to deal with these issues by finding
disease resistance genes and their mechanisms in plants for better crop productivity
and developing resistant cultivars.
To cope with this biotic stress, plants develop several tolerance mechanisms
through the activation of specific genes. Interaction of a plant with a pathogen is
one of the well-understood mechanisms. It involves the activation of signals, which
often leads to a quick defense response against a variety of diseases. This response
supports the host plant’s defense against that disease infestation. Belkhadir et al.
(2004) describe the specialized genes that induce defense signaling and recognition
of pathogen effectors by plants (Belkhadir et al. 2004). Resistance genes (R genes)
have a significant role in crop protection against diseases. In the last 30 years,
researchers have identified 300 functional R genes in different crops (Kourelis and
Van Der Hoorn 2018). Numerous identified plant-specific R genes are currently
being employed in crop improvement programs. Plant R genes are used to generate
disease-resistant varieties as an alternative to conventional means of disease control,
such as using pesticides or other chemical control approaches. Introduction of R
genes into susceptible plants will result in an efficient reduction of pathogen growth,
low host plant damage, and zero pesticide application by farmers. The conventional
breeding methods for developing disease resistance are time-consuming and
laborious because, for this purpose, repeated backcrossing has to be performed until
complete transfer of resistant genes into susceptible genotypes is achieved. Cur-
rently, a large number of nonconventional techniques have been developed to
develop tolerant genotypes against disease. Plant resistance genes have undergone
extensive functional research, cloning, characterization, and genetic transformation.
That is expected to fuel researchers in resolving these issues (Gururani et al. 2012). R
genes provide host resistance, which is a cost-effective and eco-friendly biotechno-
logical technique. It reduces agricultural diseases and increases crop yield by
producing disease-resistant crops (Kumar et al. 2017). This review accentuates
plant diseases caused by climate change, the identification and characterization of
disease-resistant genes, and tolerance mechanisms in crop plants.
11 Resistance Gene Identification, Cloning, and Characterization in Plants 207
11.2 Identification of Resistant Genes for Plant Diseases
There are increasing strains of plant pathogens producing harmful diseases. The
spread of plant pathogens and the severity of these diseases cause huge yield
reductions. To minimize this effect, many resistant genes have been identified in
crop plants. Many other advanced techniques have been developed as well. For the
identification of resistant genes, in silico analysis was performed by scientists with
their expressional profiling. Over the last two decades, new DNA sequencing
technologies have proliferated. Mainly, next-generation sequencing (NGS) and
third-generation sequencing (TGS) have improved the reliability and speed of
sequencing, although the entire sequencing still takes hours or days to complete
(Van Dijk et al. 2018). For medical and research purposes, sequencing is essential in
biological classification, cell biology, forensic investigation, gene identification, and
gene manipulation. Experimental approaches such as PCR cloning have been used to
find probable NB-containing R genes in a range of plant species, including those that
also identify RGHs in different plant species such as Arabidopsis (Meyers et al.
1999), rice (Bai et al. 2002), and cotton (He et al. 2004). Homology-based bioinfor-
matics techniques have found thousands of possible NB-containing R genes in crops
like rice (Monosi et al. 2004), potato (Lozano et al. 2012), and soybean (Nepal and
Benson 2015). These genes are thought to be R genes.
Genome-wide association studies (GWAS) are an effective method for examining
multiple or complex traits linked to a single or many stress responses. Novel
candidate genes or quantitative trait loci (QTLs) responsible for abiotic and biotic
stress have been identified by GWAS in many crop plants. Traditional gene mapping
has several limitations, which are overcome by the genome-wide association tech-
nique (GWAS) (Brachi et al. 2011). Since the introduction of high-density single-
nucleotide polymorphisms (SNPs), whole-genome scans have been able to uncover
discrete haplotype blocks that are strongly linked to quantitative trait variation.
Resistance gene analogues (RGAs) have been shown to be an important method
for identifying disease resistance genes in a variety of crops. A large number of
disease resistance genes have been found and successfully cloned in a few crops
until today. RGAs have opened new paths in research on genetic organization and
evolutionary aspects of distinct classes of resistance genes among diverse plant
species (Zhang et al. 2016). The Plant Resistance Genes database (PRGdb) has
been updated with a new user interface, sections, tools, and data for genetic
improvement. Plant scientists and plant breeders use these resources to develop
high-yielding and disease-resistant genotypes.
208 M. A. B. Saddique et al.
11.3 Mechanism of Resistance Gene
Plant resistance genes encode special proteins that can detect pathogens. For
decades, R genes have been used in plant breeding approaches for developing
resistant genotypes with varying success rates. In many agricultural plants, genetic
resistance has been the most successful disease management approach. The two
main types of host resistance are major gene resistance and quantitative resistance.
Major gene resistance is predominantly controlled by a single gene and also engaged
in ETI, whereas quantitative resistance is under the influence of many genes that
involve plant defenses induced by PTI. It also helps in understanding the significant
connections between the processes triggered by ETI and PTI. In agronomic terms,
significant gene resistance results in a “clean”crop, but its durability is unknown. On
the other hand, quantitative resistance allows for some disease infection while
maintaining stability. Plants have the ability to identify pathogens and their modes
of reproduction and growth (Leach et al. 2014). Plants have a complicated immune
system based on their ability to recognize phytopathogens. The presence of pathogen
recognition genes (PRGs), which encode specific receptors, is activated. Pathogen-
associated molecular patterns-triggered immunity (PTI) and effector-triggered
immunity (ETI) are two tiers of defensive mechanisms in the plant immune system.
Hundreds of immunological receptors activate these pathways when pathogen-
derived signals are detected (Xue et al. 2020). Death of infected cells occurs due
to the activation of resistant R proteins in the ETI mechanism. NBS-LRR/NLR
(nucleotide-binding domain and leucine-rich repeats) is the class of intracellular
receptors that contains many R proteins (DeYoung and Innes 2006; Jacob et al.
2013). PAMPs (Pathogen-associated molecular patterns) receptors are classified as
R genes because they provide partial or even complete resistance to pathogens
(Lacombe et al. 2010). Recent molecular techniques are influencing the use of R
genes due to their signaling mechanisms for disease response (Fig. 11.1).
11.3.1 Different Identified R Genes and Their Resistance
Mechanisms
In different plant species, different numbers of R genes are present, and when a
pathogen attacks, those genes are activated against that disease and develop toler-
ance mechanisms. A single R gene can produce complete resistance against one or
more strains of harmful pathogens when transferred to the susceptible plant of the
same species (McDowell and Woffenden 2003). That’s why they are used in
different breeding programs for developing resistant genotypes. Further, the
variations in plant phenotype and response to pathogen attack urge scientists to
work on their cloning and investigations into their molecular modes of action
(Table 11.1).
11 Resistance Gene Identification, Cloning, and Characterization in Plants 209
Fig. 11.1 Interaction between plant R proteins and pathogen Avr proteins occurs during the
resistance mechanism when a pathogen attacks a host plant having an Avr gene, resulting in the
activation of R genes to provoke the disease infection. Their genes produce corresponding proteins,
which results in their strong interaction, which causes disease resistance. Plants missing R genes
suffer from disease attack and yield reduction
11.4 Genetics of Resistance
For sustainable agriculture, disease-resistant plants are one of the prerequisites.
Basically, genetic resistance is classified into two categories.
11.4.1 Race-Specific or Vertical Disease Resistance
As the name indicates, resistance to a specific race of pathogen. These genes are
effective against a limited number of pathogens, but not all. They generally follow
the gene-for-gene model. This type of resistance is controlled by a single gene
known as monogenic resistance, but it is not durable or long-lasting because
(continued)
210 M. A. B. Saddique et al.
Table 11.1 R genes and disease tolerance mechanisms
Mechanism Description R Genes References
RLP/RLK,
direct
A pathogen-derived
effector interacts directly
with a cell surface
RLK/RLP receptor to
trigger the recognition of
disease-resistant genes
RLP23, EFR,RBGP1,
LORE,LYM1/LYM3,
LYK3,FLS2, LYK4,
LYK5,LYM2,
(Arabidopsis), CEBiP,
LYP4/LYP6,OsFLS2
(rice), FLS3,SlFLS2,
LeEIX2,CORE, (tomato),
VvFLS2 (grapevine)
Hind et al. (2016),
Katsuragi et al.
(2015), Zhang
et al. (2013)
RLP/RLK,
indirect
The activation of resistant
genes occurred by the
binding of effector to the
host plant or by binding
of effector-mediated
modification of host
triggered by an
RLP/RLK
Cf-2 (tomato) Seear and Dixon
(2003)
NLR, direct Recognition triggered by
direct interaction of a
pathogen-derived
component and an NLR
HRT1, SUMM2,RPS2,
RPM1, RPS5,ZAR1
(Arabidopsis), Gpa2,
R2-like,Rpi-abpt,Rx1,
Rx2, Rpi-blb3,R2,
(potato), Rpg1r, Rpg1-b
(soybean)
Kourelis and Van
Der Hoorn (2018),
Krasileva et al.
(2010)
NLR, indirect The activation of resistant
genes occurred by the
binding of effector to the
host plant or by binding
of effector-mediated
modification of host
triggered by an NLR
RanGAP2,BSL1
(soybean), RIN4,TIP,
PBS1,CRCK3,RKS1,
PBL2, ZED1,ZRK3,
(Arabidopsis)
Lewis et al.
(2010), Russell
et al. (2015), Seto
et al. (2017)
NLR-ID In this mechanism, the
recognition of resistant
genes is triggered by the
binding of effector with a
domain or by effector-
mediated modified
domain that is integrated
in the host NLR
R1 (potato), RRS1-R,
RRS1B,RRS1-S
(Arabidopsis), RGA5-A,
Xa1 (rice)
Cesari et al.
(2013), Saucet
et al. (2015)
Executor The pathogen effector
TAL activates the
executer gene which
helps in recognition of
resistant gene
Bs3,Bs4C-R, Bs3-E
(pepper), Xa10,Xa7,
Xa23, (rice)
de Lange et al.
(2013), Gu et al.
(2005)
Other, active This mechanism helps in
reducing the
susceptibility by directly
affecting pathogen by
Hm1,qMdr9.02,Hm2,
(maize), At1,At2
(melon), STV11-R (rice),
Ty-1,Tm-1,Ty-3
(tomato)
Butterbach et al.
(2014), Johal and
Briggs (1992),
Sindhu et al.
(2008)
disturbing its
pathogenicity process
pathogens continuously evolve with the passage of time for their survival.
Mendelian-resistant genes are found in higher plants and are genes for race-specific
resistance. The resistance in plants is based on a genetic interaction between
pathogen avirulence (Avr) genes and host-resistance (R) genes (Periyannan et al.
2017). The response of these genes varies from specie to specie. The Avr genes in
flax rust (Melampsora lini) code for tiny, secreted proteins are produced in the
haustoria and recognized by the host cell. The host plant cell contains specialized
sense organs that easily identified the pathogen avirulence genes and show response
to that type of genes. The recognition event that leads to resistance occurs on at least
two occasions. One is that the flax NLR protein directly interacts with the pathogen
Avr protein and develops resistance (Anderson et al. 2016). The second mechanism
is that, following the entry of Avr genes, the host plant activates the transfer of
signals to effectors that act to minimize the effect of the pathogen Avr genes. In this
mechanism (Ravensdale et al. 2011), the host plant activates the transfer of signals to
the effectors that act to minimize the effect of the pathogen Avr genes. Nucleotide-
binding domain is connected to ATP rather than adenosine diphosphate (ADP) in
this mechanism. Some genes that make wheat and other cereals more resistant to
different races have been genetically found and cloned (Steuernagel et al. 2016). The
present advancement of NLR gene capture techniques promises to boost the number
of cloned rust resistance genes significantly. In wheat, nine genes Lr1, Lr10, Lr21
and Sr33, Sr22, Sr45, Sr50, Sr35, and Yr10 conferring to leaf, stem, and stipe rust
pathogens, respectively, have been identified, cloned, and characterized (Ellis et al.
2014; Krattinger and Keller 2016; Steuernagel et al. 2016). R genes are the first class
of resistant genes that have been genetically defined, and they produce high pheno-
typic variations from single genes. These genes can be easily identified in
glasshouses at seedling stages.
11 Resistance Gene Identification, Cloning, and Characterization in Plants 211
Table 11.1 (continued)
Mechanism Description R Genes References
Other, passive This mechanism helps in
losing the susceptibility
of host plant by mutation
that leads to the failure to
manipulate the host
rwm1,lov1
(Arabidopsis), Mo-1
(lettuce), Rym-4,Rym-5
(barley), sbm1 (pea),
retr01 (cabbage), bc-3
(French bean), Pvr2
1
,
pvr6, Pvr2
2
(pepper),
xa13,xa25, xa5 (rice),
Eva1 (potato), Asc-1,
Ty-5,Pot-1 (tomato)
Huang et al.
(2016), Kang et al.
(2005), Reddy
et al. (2009)
Reprogramming A deregulated host causes
loss of susceptibility
Lr34,Lr67,YrL693,Yr36
(wheat), GH3-8,GH3-
2(rice)
Ellis et al. (2014),
Moore et al.
(2015)
212 M. A. B. Saddique et al.
11.4.2 Non-race-Specific or Horizontal Disease Resistance
Non-race-specific resistance refers to a host plant’s resistance to all races of a disease
pathogen, and it can be effective against multiple infections at the same time. This
type of resistance is usually quantitative and controlled by many genes. It is also
known as polygenic resistance and is also known as durable resistance. Here, in this
type of resistance, there is no visible immune response, but plants show partial
resistance, which inhibits pathogen growth (Ellis et al. 2014). In wheat, this type of
resistance occurs at later stages of development, which is why it is referred to as adult
plant resistance (APR). APR genes are highly durable as compared to
NLR-encoding R genes (Periyannan et al. 2017). The cloning of numerous wheat
APR genes recently revealed new information on the mechanisms of non-race-
specific resistance (Gou et al. 2015). The most important stem rust-resistant APR
gene in wheat is Sr2 and Lr34, a gene that produces resistance to leaf rust, stripe rust,
and powdery mildew. Similar to these, scientists are trying to identify and clone new
genes that produce resistance (Ellis et al. 2014).
11.5 Gene Cloning
Gene cloning is a molecular technique that involves copying a gene of interest into
numerous identical copies. Plant cloning (e.g., roots, shoots, or axillary buds) seems
to be the most important modern technique of plant cloning (e.g., roots, shoots, or
axillary buds) (Renneberg et al. 2017). Plants employ a variety of tactics to defend
themselves against the wide range of diseases that can be found in their
environments. For example, the Hm1, the first resistance gene (R gene) to be cloned
in maize (Zea mays), was reported more than 25 years ago; countless more R genes
have since been discovered and isolated (Kourelis and Van Der Hoorn 2018). The
presence of the R gene may detect the presence of a specific pathogen by identifying
the ligands transcribed by Avr genes (a-virulence genes) and is recognized as the
most important and effective strategy to combat the pathogen attack (Peng et al.
2014). PCR cloning is a quick approach to cloning genes, and it’s commonly used
for applications that require higher throughput than other cloning methods can
provide. Scientists can also clone DNA fragments that aren’t easy to get in large
amounts.
MutRenSeq is a technique for the cloning of disease resistance genes (R genes) in
plants. It combines the R genes of structural class and the mutational genes. It also
identifies the single gene mutations by comparing the wild-type parental sequence to
numerous independently produced (Peng et al. 2014; Steuernagel et al. 2016). The
MutRenSeq process necessitates the genetic isolation of a single R gene in an
otherwise susceptible background. Random mutations will, with a certain frequency,
knock out the R gene and cause the loss of resistance conferred by that gene. A
mutation directly in the R gene causes loss-of-function mutants (Steuernagel et al.
2017). A single gene must govern disease resistance in the mutagenesis line in order
to get susceptible mutants. The majority of EMS-induced (ethyl methanesulfonate)
mutations are point mutations, while some are deletion mutations (Periyannan et al.
2013).
11 Resistance Gene Identification, Cloning, and Characterization in Plants 213
AgRenSeq, or speed cloning, is a technique developed by John Innes Centre
researchers and collaborators in the United States and Australia to help speed up the
fight against diseases that endanger food crops around the world.
11.5.1 MutMap Technique
The era of genomics starts with the discovery of DNA sequencing techniques
developed by Sanger. With the advancement and improvement in the sequencing
techniques, the time and cost of sequencing have significantly reduced that resulted
in high quality genomic data. Along with improved sequencing technologies, new
bioinformatic tools have also contributed for generating quality data. MutMap
technique depends on the cross of mutant specie with its wild type itself. It identifies
SNPs generated through mutation that causes phenotypic variation. It also involves
the chemical mutagen to create a mutant population for choosing lines with highly
desirable traits in M
2
or subsequent generations (Takagi et al. 2013). MutMap is a
technique for mapping the traits controlled by single recessive genes and was
demonstrated in rice (Abe et al. 2012). In a similar way to QTL-sequence, whole-
genome sequencing is performed to phenotype bulks of F2 individuals generated by
crossing the selected mutant with the appropriate wild-type parent and categorized
according to the intended mutant phenotype (Zhang et al. 2019). MutMap-Gap is a
slight modification of MutMap that helps to find causal SNPs in genomic regions
where the standard genome sequence is missing. The causative gene of the lmm24
lesion mimic mutant was cloned using MutMap in rice (Sánchez-Martín et al. 2016),
which boosted the fungus Magnaporthe oryzae resistance and upregulated the
defense responsive genes (Fig. 11.2).
11.6 Resistance Gene Analogs (RGA) Identification
and Characterization Through In Silico Analysis
In the past 20 years, genome sequencing has grown rapidly, which has resulted in an
increase in the quality and quantity of the available genomic resources. In 2000, the
genome assembly of the first land plant, Arabidopsis, was published (Initiative
2000). With this, the genomes of many other crop plants have also been sequenced
and assembled. These genomes are also available on different databases and gene
banks. According to an estimate, nearly 0.16% of the 350,000 plant species have
been sequenced, assembled, and are available on different databases. Of these
genomes, some crop plants like Arabidopsis, rice, and maize have been resequenced
by using modern sequencing techniques that increase the quality of the genomes
(Marks et al. 2021). Publically accessible databases such as NCBI, TAIR,
Phytozome, and Ensemble Plants FTP sites, among many others, store the published
whole-genome sequences. As a result of advancements in next-generation
sequencing technology, whole-genome sequencing has become one of the most
significant tools in current biological studies. The absence of functional annotations
for the enormous number of macromolecules is one of the most significant obstacles
to genome sequencing. On the other hand, experiments to assign protein functions
are costly and time-consuming. Hence, the computational strategies for functional
prediction are extremely interesting for resolving this difficult problem (Peng et al.
2014).Therefore, computational approaches can be used to find and analyze the
genome-wide plant RGAs owing to their major structural characteristics and
conserved domains.
214 M. A. B. Saddique et al.
Fig. 11.2 MutMap technique for identifying SNPs
First, an RGA database was developed that contained all reported RGA genes and
their protein sequences. GenBank and PRGdb are two significant repositories of
well-organized RGA sequences (Pruitt et al. 2009). Second, to find putative RGA
candidate genes, the BLAST search tool was used against the RGA database with an
E-value ranging from 1e 5 to 1, depending on genome size. Third, numerous
software programs are utilized to detect and align numerous conserved domains and
motifs utilizing the RGA candidates as input. For example, Sanger’s pfam scan.pl
and InterproScan programs can be executed concurrently (Sanseverino et al. 2010).
A script is also needed to classify RGA candidates by their domain and motif
structures, or a combination of both, so that they can be put into groups.
11 Resistance Gene Identification, Cloning, and Characterization in Plants 215
11.6.1 Characterization of RGAs
RGAs have been identified, mapped, and characterized across the plant genome
using whole-genome sequencing. RGAs containing NBS-LRR have been exten-
sively investigated in numerous plants, e.g., rice, maize, sorghum, barely, apple,
medicago, and Arabidopsis (Sekhwal et al. 2015). The most important class of R
genes implicated in disease resistance in plants are NBS-LRR genes (Porter et al.
2009), as they are highly duplicated, clustered, and are evolutionarily diverse
(Radwan et al. 2008). For genome-wide characterization and identification, several
bioinformatic tools are used for analysis. Their functions are described in Table 11.2.
A lot of NBS-LRR genes have been identified and cloned from different crop
plants. These genes are grouped into different superfamilies. The genes that are
mostly cloned belong to the eLRR, LRR-Kinase superfamily or NB-LRR
superfamilies. These families were initially identified in Arabidopsis, tobacco, and
tomato by map-based cloning. The cloning techniques require specialized infrastruc-
ture that was mainly not available for many crops which can be the main sources of
disease-resistant genes. Angiosperms have NBS-LRR-encoding genes, whereas
grass genomes and other monocot genomes lack TNL-encoding genes (Guo et al.
2011).
Through the genome-wide identification and also the characterization, many
resistant genes have been identified that show their response to specific plant
diseases. The majority of monocots have more NBS-LRR and CNL-encoding
genes than dicots (Table 11.3).
11.7 Conclusion
To feed the increasing population, there is need to develop disease-resistant and
high-yielding genotypes. Due to change in climate patterns, a large number of new
strains of pathogens have developed and cause harmful diseases. Plant diseases
reduce the plant growth, development, and ultimately reduce yield. To minimize
this yield reduction, different molecular and breeding approaches have been used.
The main thing during this pathogen attack is host plant–pathogen interactions
which have gained much attention by scientists. Several other factors have driven
the research, including disease challenges linked with modern agricultural methods
and climate change into a new era. The main purpose of that research is to develop
disease-resistant and long-lasting pathogen-resistant crops. For this purpose,
disease-resistant genes (R genes) have been identified and cloned. Various RGAs
have been cloned and characterized from various plant species which have devel-
oped DNA markers as well as disease resistance genes. The cloning and
characterization of R genes and RGAs help in identification of resistant genes that
can be further transferred into the susceptible plants to develop resistance. Race-
specific R genes are more likely to breakdown because of changes in pathogen
avirulence (Avr) genes, as well as the resistance of non-race-specific genes, which
make them less likely to work. In short, due to climate change, the pathogens adapt
to the changing environmental conditions that result in increase of new strains of
pathogens which affect crop plants. To minimize pathogen virulence and increase
resistance duration, several genes have been identified and yet have to develop
strategies involving both race-specific and non-race-specific genes and adopt new
molecular approaches.
216 M. A. B. Saddique et al.
Table 11.2 Bioinformatic analysis used for genome-wide characterization and their functions
Analysis Function References
Phylogenetic
analysis
A powerful approach used for identification of
evolutionary history of current day species. It also
explains the similarities and differences in the
species. It is also performed to identify the spread
of harmful diseases
Munjal et al. (2018)
Conserved domain
analysis
Domains are the proteins conserved units. This
analysis is used to classify proteins and to identify
the function of specialized protein
Fong and
Marchler-Bauer
(2008)
Subcellular
localization
analysis
This analysis helps to identify the location of
proteins either present in cytoplasm, mitochondria,
Golgi apparatus, or any other organelle. These
locations help to identify the function of proteins
Pan et al. (2021)
Sequence logo
analysis
The graphical representation of multiple aligned
sequences used to identify and visualize short,
conserved patterns in the RNA, DNA and proteins
sequences
Dey et al. (2018)
Multiple sequence
alignment analysis
This analysis helps in identifying the similarities
and differences of sequences of different species
Pirovano and
Heringa (2008)
Ka/ks calculation
analysis
This analysis helps to identify the divergence of
gene after duplication
Nekrutenko et al.
(2002)
Promoter analysis This analysis helps to predict and identify
regulatory elements which perform specific
functions
Mariño-Ramírez
et al. (2009)
Synteny analysis This analysis is performed to compare different
genomes and to identify the genomic evolution of
the related species
Cheng et al. (2012)
Protein and protein
interaction analysis
These interactions can handle a variety of
biological processes. This analysis helps in
predicting the function of specific protein
Rao et al. (2014)
Gene expression
analysis
This analysis helps to identify the expression of
gene in different plant tissues either leaf, fruit,
roots, flowers, seeds, etc. through qRT-PCR
Segundo-Val and
Sanz-Lozano
(2016)
Class Disease References
(continued)
11 Resistance Gene Identification, Cloning, and Characterization in Plants 217
Table 11.3 List of resistance genes identified in different crops
Gene
name
Location on
chromosome
Identification
in crops
RPP13 3 NBS Downy
mildew
Arabidopsis Bittner-Eddy et al.
(2000)
RCY1 5 NBS Mosaic type Arabidopsis Takahashi et al. (2002)
RPP1 3 NBS Downy
mildew
Arabidopsis Botella et al. (1998)
RPP4 4 NBS Downy
mildew
Arabidopsis Van Der Biezen et al.
(2002)
RPS4 4 NBS Powdery
mildew
Arabidopsis Gassmann et al. (1999)
RPP5 4 NBS Downy
mildew
Arabidopsis Noël et al. (1999)
RPS5 1 NBS Downy
mildew
Arabidopsis Warren et al. (1998)
RRS1 5 NBS Bacterial
wilt
Arabidopsis Deslandes et al. (2002)
RPP27 1 NBS Downy
mildew
Arabidopsis Tör et al. (2004)
Hs1pro-
1
1 RLP Beet cyst Sugar beet Cai et al. (1997)
Rp1-D 10 NBS Rust Maize Collins et al. (1999)
Hm1 1 Corn leaf
blight
Maize Johal and Briggs
(1992)
Pi9 6 NBS Blast Rice Liu et al. (2002)
Rpr1 11 NBS Blast Rice Sakamoto et al. (1999)
Pid3 6 NBS Blast Rice Shang et al. (2009)
Xa21 11 RLK Bacterial
blight
Rice Song et al. (1995)
Xa3/
Xa26
11 RLK Bacterial
blight
Rice Sun et al. (2006)
Xa10 11 Oth-
R
Bacterial
blight
Rice Tian et al. (2014)
Xa25 12 Oth-
R
Bacterial
blight
Rice Liu et al. (2011)
Xa27 6 RLP Bacterial
blight
Rice Bimolata et al. (2013)
Pi-d2 6 RLK Blast Rice Chen et al. (2006)
Xa1 4 NBS Bacterial
blight
Rice Yoshimura et al. (1998)
Pib 2 NBS Blast Rice Wang et al. (1999)
Pi-ta 12 NBS Blast Rice Bryan et al. (2000)
Pi-36 8 NBS Blast Rice Lin et al. (2007)
Pia 11 NBS Blast Rice Okuyama et al. (2011)
Pi37 1 NBS Blast Rice Lin et al. (2007)
Xa5 5 NBs Bacterial
blight
Rice Iyer and McCouch
(2004)
Class Disease References
218 M. A. B. Saddique et al.
Table 11.3 (continued)
Gene
name
Location on
chromosome
Identification
in crops
Xa13 8 Oth-
R
Bacterial
blight
Rice Chu et al. (2006)
Rx 12 NBS PVX Potato Bendahmane et al.
(1999)
RB 8 NBS Late blight Potato Song et al. (2003)
Rx2 5 NBS PVX Potato Bendahmane et al.
(2000)
Prf 5 NBS Bacterial
speck
Tomato Salmeron et al. (1996)
Mi 6 NBS Root knot Tomato Milligan et al. (1998)
I2 11 NBS Fusarium
wilt
Tomato Ori et al. (1997)
Ph-3 9 NBS Late blight Tomato Zhang et al. (2014)
Sw-5 9 NBS Tomato
spotted wilt
Tomato Brommonschenkel and
Tanksley (1997)
Tm-2 9 NBS Tobacco
mosaic
Tomato Lanfermeijer et al.
(2003)
Bs4 5 NBS Bacterial
spot
Tomato Schornack et al. (2004)
Hero 4 NBS Potato cyst Tomato Ernst et al. (2002)
Cf-2 6 RLP Leaf mold Tomato Dixon et al. (1996)
Cf-4 1 RLP Leaf mold Tomato Parniske et al. (1997)
Cf-5 6 RLP Leaf mold Tomato Dixon et al. (1998)
Cf-9 1 RLP Leaf mold Tomato Jones et al. (1994)
Vel1,2 9 RLP Verticillium
wilt
Tomato Kawchuk et al. (2001)
Fen 5Oth-
R
Bacterial
speck
Tomato Martin et al. (1994)
References
Abe A, Kosugi S, Yoshida K, Natsume S, Takagi H, Kanzaki H, Matsumura H, Yoshida K,
Mitsuoka C, Tamiru M (2012) Genome sequencing reveals agronomically important loci in
rice using MutMap. Nat Biotechnol 30:174–178
Anderson C, Khan MA, Catanzariti AM, Jack CA, Nemri A, Lawrence GJ, Upadhyaya NM,
Hardham AR, Ellis JG, Dodds PN (2016) Genome analysis and avirulence gene cloning
using a high-density RADseq linkage map of the flax rust fungus, Melampsora lini. BMC
Genomics 17:1–20
Bai J, Pennill LA, Ning J, Lee SW, Ramalingam J, Webb CA, Zhao B, Sun Q, Nelson JC, Leach JE
(2002) Diversity in nucleotide binding site–leucine-rich repeat genes in cereals. Genome Res
12:1871–1884
Belkhadir Y, Subramaniam R, Dangl JL (2004) Plant disease resistance protein signaling: NBS–
LRR proteins and their partners. Curr Opin Plant Biol 7:391–399
11 Resistance Gene Identification, Cloning, and Characterization in Plants 219
Bendahmane A, Kanyuka K, Baulcombe DC (1999) The Rx gene from potato controls separate
virus resistance and cell death responses. Plant Cell 11:781–791
Bendahmane A, Querci M, Kanyuka K, Baulcombe DC (2000) Agrobacterium transient expression
system as a tool for the isolation of disease resistance genes: application to the Rx2 locus in
potato. Plant J 21:73–81
Bimolata W, Kumar A, Sundaram RM, Laha GS, Qureshi IA, Reddy GA, Ghazi IA (2013) Analysis
of nucleotide diversity among alleles of the major bacterial blight resistance gene Xa27 in
cultivars of rice (Oryza sativa) and its wild relatives. Planta 238:293–305
Bittner-Eddy PD, Crute IR, Holub EB, Beynon JL (2000) RPP13 is a simple locus in Arabidopsis
thaliana for alleles that specify downy mildew resistance to different avirulence determinants in
Peronospora parasitica. Plant J 21:177–188
Botella MA, Parker JE, Frost LN, Bittner-Eddy PD, Beynon JL, Daniels MJ, Holub EB, Jones JD
(1998) Three genes of the Arabidopsis RPP1 complex resistance locus recognize distinct
Peronospora parasitica avirulence determinants. Plant Cell 10:1847–1860
Brachi B, Morris GP, Borevitz JO (2011) Genome-wide association studies in plants: the missing
heritability is in the field. Genome Biol 12:1–8
Brommonschenkel S, Tanksley S (1997) Map-based cloning of the tomato genomic region that
spans the Sw-5 tospovirus resistance gene in tomato. Mol Gen Genet 256:121–126
Bryan GT, Wu KS, Farrall L, Jia Y, Hershey HP, McAdams SA, Faulk KN, Donaldson GK,
Tarchini R, Valent B (2000) A single amino acid difference distinguishes resistant and suscep-
tible alleles of the rice blast resistance gene Pi-ta. Plant Cell 12:2033–2045
Butterbach P, Verlaan MG, Dullemans A, Lohuis D, Visser RG, Bai Y, Kormelink R (2014)
Tomato yellow leaf curl virus resistance by Ty-1 involves increased cytosine methylation of
viral genomes and is compromised by cucumber mosaic virus infection. Proc Natl Acad Sci U S
A 111:12942–12947
Cai D, Kleine M, Kifle S, Harloff HJ, Sandal NN, Marcker KA, Klein-Lankhorst RM, Salentijn EM,
Lange W, Stiekema WJ (1997) Positional cloning of a gene for nematode resistance in sugar
beet. Science 275:832–834
Cesari S, Thilliez G, Ribot C, Chalvon V, Michel C, Jauneau A, Rivas S, Alaux L, Kanzaki H,
Okuyama Y (2013) The rice resistance protein pair RGA4/RGA5 recognizes the Magnaporthe
oryzae effectors AVR-Pia and AVR1-CO39 by direct binding. Plant Cell 25:1463–1481
Chen X, Shang J, Chen D, Lei C, Zou Y, Zhai W, Liu G, Xu J, Ling Z, Cao G (2006) AB-lectin
receptor kinase gene conferring rice blast resistance. Plant J 46:794–804
Cheng F, Wu J, Fang L, Wang X (2012) Syntenic gene analysis between Brassica rapa and other
Brassicaceae species. Front Plant Sci 3:198
Chu Z, Yuan M, Yao J, Ge X, Yuan B, Xu C, Li X, Fu B, Li Z, Bennetzen JL (2006) Promoter
mutations of an essential gene for pollen development result in disease resistance in rice. Genes
Dev 20:1250–1255
Collins N, Drake J, Ayliffe M, Sun Q, Ellis J, Hulbert S, Pryor T (1999) Molecular characterization
of the maize Rp1-D rust resistance haplotype and its mutants. Plant Cell 11:1365–1376
de Lange O, Schreiber T, Schandry N, Radeck J, Braun KH, Koszinowski J, Heuer H, Strauß A,
Lahaye T (2013) Breaking the DNA-binding code of Ralstonia solanacearum TAL effectors
provides new possibilities to generate plant resistance genes against bacterial wilt disease. New
Phytol 199:773–786
Deslandes L, Olivier J, Theulières F, Hirsch J, Feng DX, Bittner-Eddy P, Beynon J, Marco Y (2002)
Resistance to Ralstonia solanacearum in Arabidopsis thaliana is conferred by the recessive
RRS1-R gene, a member of a novel family of resistance genes. Proc Natl Acad Sci U S A 99:
2404–2409
Dey KK, Xie D, Stephens M (2018) A new sequence logo plot to highlight enrichment and
depletion. BMC Bioinform 19:473
DeYoung BJ, Innes RW (2006) Plant NBS-LRR proteins in pathogen sensing and host defense. Nat
Immunol 7:1243–1249
220 M. A. B. Saddique et al.
Dixon MS, Jones DA, Keddie JS, Thomas CM, Harrison K, Jones JD (1996) The tomato Cf-2
disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins.
Cell 84:451–459
Dixon MS, Hatzixanthis K, Jones DA, Harrison K, Jones JD (1998) The tomato Cf-5 disease
resistance gene and six homologs show pronounced allelic variation in leucine-rich repeat copy
number. Plant Cell 10:1915–1925
Ellis JG, Lagudah ES, Spielmeyer W, Dodds PN (2014) The past, present and future of breeding
rust resistant wheat. Front Plant Sci 5:641
Ernst K, Kumar A, Kriseleit D, Kloos DU, Phillips MS, Ganal MW (2002) The broad-spectrum
potato cyst nematode resistance gene (Hero) from tomato is the only member of a large gene
family of NBS-LRR genes with an unusual amino acid repeat in the LRR region. Plant J 31:127–
136
Fong JH, Marchler-Bauer A (2008) Protein subfamily assignment using the conserved domain
database. BMC Res Notes 1:114
Gassmann W, Hinsch ME, Staskawicz BJ (1999) The Arabidopsis RPS4 bacterial-resistance gene is
a member of the TIR-NBS-LRR family of disease-resistance genes. Plant J 20:265–277
Gautam H, Bhardwaj M, Kumar R (2013) Climate change and its impact on plant diseases. Curr Sci
5:1685–1691
Gou JY, Li K, Wu K, Wang X, Lin H, Cantu D, Uauy C, Dobon-Alonso A, Midorikawa T, Inoue K
(2015) Wheat stripe rust resistance protein WKS1 reduces the ability of the thylakoid-associated
ascorbate peroxidase to detoxify reactive oxygen species. Plant Cell 27:1755–1770
Gu K, Yang B, Tian D, Wu L, Wang D, Sreekala C, Yang F, Chu Z, Wang GL, White FF (2005) R
gene expression induced by a type-III effector triggers disease resistance in rice. Nature 435:
1122–1125
Guo YL, Fitz J, Schneeberger K, Ossowski S, Cao J, Weigel D (2011) Genome-wide comparison of
nucleotide-binding site-leucine-rich repeat-encoding genes in Arabidopsis. Plant Physiol 157:
757–769
Gururani MA, Venkatesh J, Upadhyaya CP, Nookaraju A, Pandey SK, Park SW (2012) Plant
disease resistance genes: current status and future directions. Physiol Mol Plant Pathol 78:51–65
He L, Du C, Covaleda L, Xu Z, Robinson AF, Yu JZ, Kohel RJ, Zhang HB (2004) Cloning,
characterization, and evolution of the NBS-LRR-encoding resistance gene analogue family in
polyploid cotton (Gossypium hirsutum L.). Mol Plant-Microbe Interact 17:1234–1241
Hind SR, Strickler SR, Boyle PC, Dunham DM, Bao Z, O'Doherty IM, Baccile JA, Hoki JS, Viox
EG, Clarke CR (2016) Tomato receptor FLAGELLIN-SENSING 3 binds flgII-28 and activates
the plant immune system. Nat Plants 2:1–8
Huang S, Antony G, Li T, Liu B, Obasa K, Yang B, White FF (2016) The broadly effective
recessive resistance gene xa5 of rice is a virulence effector-dependent quantitative trait for
bacterial blight. Plant J 86:186–194
Initiative A (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana.
Nature 408:796–815
Iyer AS, McCouch SR (2004) The rice bacterial blight resistance gene xa5 encodes a novel form of
disease resistance. Mol Plant Microbe Interact 17:1348–1354
Jacob F, Vernaldi S, Maekawa T (2013) Evolution and conservation of plant NLR functions. Front
Immunol 4:297
Johal GS, Briggs SP (1992) Reductase activity encoded by the HM1 disease resistance gene in
maize. Science 258:985–987
Jones DA, Thomas CM, Hammond-Kosack KE, Balint-Kurti PJ, Jones JDG (1994) Isolation of the
tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science 266:
789–793
Kang BC, Yeam I, Jahn MM (2005) Genetics of plant virus resistance. Annu Rev Phytopathol 43:
581–621
11 Resistance Gene Identification, Cloning, and Characterization in Plants 221
Katsuragi Y, Takai R, Furukawa T, Hirai H, Morimoto T, Katayama T, Murakami T, Che FS (2015)
CD2-1, the C-terminal region of flagellin, modulates the induction of immune responses in rice.
Mol Plant Microbe Interact 28:648–658
Kawchuk LM, Hachey J, Lynch DR, Kulcsar F, van Rooijen G, Waterer DR, Robertson A,
Kokko E, Byers R, Howard RJ, Fischer R, Prüfer D (2001) Tomato Ve disease resistance
genes encode cell surface-like receptors. Proc Natl Acad Sci U S A 98:6511–6515
Kourelis J, Van Der Hoorn RA (2018) Defended to the nines: 25 years of resistance gene cloning
identifies nine mechanisms for R protein function. Plant Cell 30:285–299
Krasileva KV, Dahlbeck D, Staskawicz BJ (2010) Activation of an Arabidopsis resistance protein is
specified by the in planta association of its leucine-rich repeat domain with the cognate
oomycete effector. Plant Cell 22:2444–2458
Krattinger SG, Keller B (2016) Molecular genetics and evolution of disease resistance in cereals.
New Phytol 212:320–332
Kumar P, Chandra S, Sangeeta Srivastava VC (2017) RGAs approach in identification of disease
resistance genes and their deployment in crops improvement. Int J Appl Agric Sci 12:185–198
Lacombe S, Rougon-Cardoso A, Sherwood E, Peeters N, Dahlbeck D, van Esse HP, Smoker M,
Rallapalli G, Thomma BPHJ, Staskawicz B, Jones JDG, Zipfel C (2010) Interfamily transfer of
a plant pattern-recognition receptor confers broad-spectrum bacterial resistance. Nat Biotechnol
28:365–369
Lanfermeijer FC, Dijkhuis J, Sturre MJG, de Haan P, Hille J (2003) Cloning and characterization of
the durable tomato mosaic virus resistance gene Tm-22 from Lycopersicon esculentum. Plant
Mol Biol 52:1039–1051
Leach JE, Leung H, Tisserat NA (2014) Plant disease and resistance. In: Van Alfen NK
(ed) Encyclopedia of agriculture and food systems. Academic Press, Oxford, pp 360–374
Lewis JD, Wu R, Guttman DS, Desveaux D (2010) Allele-specific virulence attenuation of the
Pseudomonas syringae HopZ1a Type III effector via the Arabidopsis ZAR1 resistance protein.
PLoS Genet 6:e1000894
Lin F, Chen S, Que Z, Wang L, Liu X, Pan Q (2007) The blast resistance gene Pi37 encodes a
nucleotide binding site–leucine-rich repeat protein and is a member of a resistance gene cluster
on rice chromosome 1. Genetics 177:1871–1880
Liu G, Lu G, Zeng L, Wang GL (2002) Two broad-spectrum blast resistance genes, Pi9(t) and
Pi2(t), are physically linked on rice chromosome 6. Mol Genet Genomics 267:472–480
Liu Q, Yuan M, Zhou Y, Li X, Xiao J, Wang S (2011) A paralog of the MtN3/saliva family
recessively confers race-specific resistance to Xanthomonas oryzae in rice. Plant Cell Environ
34:1958–1969
Lozano R, Ponce O, Ramirez M, Mostajo N, Orjeda G (2012) Genome-wide identification and
mapping of NBS-encoding resistance genes in Solanum tuberosum group phureja. PLoS One 7:
e34775
Mariño-Ramírez L, Tharakaraman K, Spouge JL, Landsman D (2009) Promoter analysis: gene
regulatory motif identification with A-GLAM.Methods Mol Biol 537:263–276
Marks RA, Hotaling S, Frandsen PB, VanBuren R (2021) Representation and participation across
20 years of plant genome sequencing. Nat Plants 7:1571–1578
Martin GB, Frary A, Wu T, Brommonschenkel S, Chunwongse J, Earle ED, Tanksley SD (1994) A
member of the tomato Pto gene family confers sensitivity to fenthion resulting in rapid cell
death. Plant Cell 6:1543–1552
McDowell JM, Woffenden BJ (2003) Plant disease resistance genes: recent insights and potential
applications. Trends Biotechnol 21:178–183
Meyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan S, Sobral BW, Young ND (1999)
Plant disease resistance genes encode members of an ancient and diverse protein family within
the nucleotide-binding superfamily. Plant J 20:317–332
Milligan SB, Bodeau J, Yaghoobi J, Kaloshian I, Zabel P, Williamson VM (1998) The root knot
nematode resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding,
leucine-rich repeat family of plant genes. Plant Cell 10:1307–1319
222 M. A. B. Saddique et al.
Monosi B, Wisser RJ, Pennill L, Hulbert SH (2004) Full-genome analysis of resistance gene
homologues in rice. Theor Appl Genet 109:1434–1447
Moore JW, Herrera-Foessel S, Lan C, Schnippenkoetter W, Ayliffe M, Huerta-Espino J, Lillemo M,
Viccars L, Milne R, Periyannan S (2015) A recently evolved hexose transporter variant confers
resistance to multiple pathogens in wheat. Nat Genet 47:1494–1498
Munjal G, Hanmandlu M, Srivastava S (2018) Phylogenetics algorithms and applications. In:
Ambient communications and computer systems: advances in intelligent systems and comput-
ing, vol 904. Springer, Singapore, pp 187–194
Nekrutenko A, Makova K, Li WH (2002) The Ka/Ks ratio test for assessing the protein-coding
potential of genomic regions: an empirical and simulation study. Genome Res 12:198–202
Nepal MP, Benson BV (2015) CNL disease resistance genes in soybean and their evolutionary
divergence. Evol Bioinforma 11:S21782
Noël L, Moores TL, Van Der Biezen EA, Parniske M, Daniels MJ, Parker JE, Jones JD (1999)
Pronounced intraspecific haplotype divergence at the RPP5 complex disease resistance locus of
Arabidopsis. Plant Cell 11:2099–2111
Okuyama Y, Kanzaki H, Abe A, Yoshida K, Tamiru M, Saitoh H, Fujibe T, Matsumura H,
Shenton M, Galam DC (2011) A multifaceted genomics approach allows the isolation of the
rice Pia-blast resistance gene consisting of two adjacent NBS-LRR protein genes. Plant J 66:
467–479
Ori N, Eshed Y, Paran I, Presting G, Aviv D, Tanksley S, Zamir D, Fluhr R (1997) The I2C family
from the wilt disease resistance locus I2 belongs to the nucleotide binding, leucine-rich repeat
superfamily of plant resistance genes. Plant Cell 9:521–532
Pan X, Li H, Zeng T, Li Z, Chen L, Huang T, Cai YD (2021) Identification of protein subcellular
localization with network and functional embeddings. Front Genet 11:626500
Parniske M, Hammond-Kosack KE, Golstein C, Thomas CM, Jones DA, Harrison K, Wulff BB,
Jones JD (1997) Novel disease resistance specificities result from sequence exchange between
tandemly repeated genes at the Cf-4/9 locus of tomato. Cell 91:821–832
Peng W, Wang J, Cai J, Chen L, Li M, Wu FX (2014) Improving protein function prediction using
domain and protein complexes in PPI networks. BMC Syst Biol 8:1–13
Periyannan S, Moore J, Ayliffe M, Bansal U, Wang X, Huang L, Deal K, Luo M, Kong X, Bariana
H (2013) The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust
race Ug99. Science 341:786–788
Periyannan S, Milne RJ, Figueroa M, Lagudah ES, Dodds PN (2017) An overview of genetic rust
resistance: from broad to specific mechanisms. PLoS Pathog 13:e1006380
Piquerez SJ, Harvey SE, Beynon JL, Ntoukakis V (2014) Improving crop disease resistance:
lessons from research on Arabidopsis and tomato. Front Plant Sci 5:671
Pirovano W, Heringa J (2008) Multiple sequence alignment. Bioinformatics:143–161
Porter BW, Paidi M, Ming R, Alam M, Nishijima WT, Zhu YJ (2009) Genome-wide analysis of
Carica papaya reveals a small NBS resistance gene family. Mol Genet Genomics 281:609–626
Pruitt KD, Tatusova T, Klimke W, Maglott DR (2009) NCBI reference sequences: current status,
policy and new initiatives. Nucleic Acids Res 37:D32–D36
Radwan O, Gandhi S, Heesacker A, Whitaker B, Taylor C, Plocik A, Kesseli R, Kozik A,
Michelmore RW, Knapp SJ (2008) Genetic diversity and genomic distribution of homologs
encoding NBS-LRR disease resistance proteins in sunflower. Mol Genet Genomics 280:111–125
Rao VS, Srinivas K, Sujini GN, Kumar GNS (2014) Protein-protein interaction detection: methods
and analysis. Int J Proteomics 2014:147648
Ravensdale M, Nemri A, Thrall PH, Ellis JG, Dodds PN (2011) Co-evolutionary interactions
between host resistance and pathogen effector genes in flax rust disease. Mol Plant Pathol 12:
93–102
Reddy D, Sudarshana M, Fuchs M, Rao N, Thottappilly G (2009) Genetically engineered virus-
resistant plants in developing countries: current status and future prospects. Adv Virus Res 75:
185–220
11 Resistance Gene Identification, Cloning, and Characterization in Plants 223
Renneberg R, Berkling V, Loroch V (2017) Green biotechnology. Biotechnology for beginners.
Elsevier, pp 233–279
Russell AR, Ashfield T, Innes RW (2015) Pseudomonas syringae effector AvrPphB suppresses
AvrB-induced activation of RPM1 but not AvrRpm1-induced activation. Mol Plant Microbe
Interact 28:727–735
Sakamoto K, Tada Y, Yokozeki Y, Akagi H, Hayashi N, Fujimura T, Ichikawa N (1999) Chemical
induction of disease resistance in rice is correlated with the expression of a gene encoding a
nucleotide binding site and leucine-rich repeats. Plant Mol Biol 40:847–855
Salmeron JM, Oldroyd GE, Rommens CM, Scofield SR, Kim HS, Lavelle DT, Dahlbeck D,
Staskawicz BJ (1996) Tomato Prf is a member of the leucine-rich repeat class of plant disease
resistance genes and lies embedded within the Pto kinase gene cluster. Cell 86:123–133
Sánchez-Martín J, Steuernagel B, Ghosh S, Herren G, Hurni S, Adamski N, Vrána J,
KubalákováM, Krattinger SG, Wicker T (2016) Rapid gene isolation in barley and wheat by
mutant chromosome sequencing. Genome Biol 17:1–7
Sanseverino W, Roma G, De Simone M, Faino L, Melito S, Stupka E, Frusciante L, Ercolano MR
(2010) PRGdb: a bioinformatics platform for plant resistance gene analysis. Nucleic Acids Res
38:D814–D821
Saucet SB, Ma Y, Sarris PF, Furzer OJ, Sohn KH, Jones JD (2015) Two linked pairs of Arabidopsis
TNL resistance genes independently confer recognition of bacterial effector AvrRps4. Nat
Commun 6:1–12
Schornack S, Ballvora A, Gürlebeck D, Peart J, Ganal M, Baker B, Bonas U, Lahaye T (2004) The
tomato resistance protein Bs4 is a predicted non-nuclear TIR-NB-LRR protein that mediates
defense responses to severely truncated derivatives of AvrBs4 and overexpressed AvrBs3. Plant
J 37:46–60
Seear PJ, Dixon MS (2003) Variable leucine-rich repeats of tomato disease resistance genes Cf-2
and Cf-5 determine specificity. Mol Plant Pathol 4:199–202
Segundo-Val S, Sanz-Lozano CS (2016) Introduction to the gene expression analysis. Methods Mol
Biol 1434:29–43
Sekhwal MK, Li P, Lam I, Wang X, Cloutier S, You FM (2015) Disease resistance gene analogs
(RGAs) in plants. Int J Mol Sci 16:19248–19290
Seto D, Koulena N, Lo T, Menna A, Guttman DS, Desveaux D (2017) Expanded type III effector
recognition by the ZAR1 NLR protein using ZED1-related kinases. Nat Plants 3:1–4
Shang J, Tao Y, Chen X, Zou Y, Lei C, Wang J, Li X, Zhao X, Zhang M, Lu Z (2009) Identification
of a new rice blast resistance gene, Pid3, by genomewide comparison of paired nucleotide-
binding site-leucine-rich repeat genes and their pseudogene alleles between the two sequenced
rice genomes. Genetics 182:1303–1311
Sindhu A, Chintamanani S, Brandt AS, Zanis M, Scofield SR, Johal GS (2008) A guardian of
grasses: specific origin and conservation of a unique disease-resistance gene in the grass lineage.
Proc Natl Acad Sci U S A 105:1762–1767
Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH
(1995) A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science
270:1804–1806
Song J, Bradeen JM, Naess SK, Raasch JA, Wielgus SM, Haberlach GT, Liu J, Kuang H, Austin-
Phillips S, Buell CR (2003) Gene RB cloned from Solanum bulbocastanum confers broad
spectrum resistance to potato late blight. Proc Natl Acad Sci U S A 100:9128–9133
Steuernagel B, Periyannan SK, Hernández-Pinzón I, Witek K, Rouse MN, Yu G, Hatta A,
Ayliffe M, Bariana H, Jones JD (2016) Rapid cloning of disease-resistance genes in plants
using mutagenesis and sequence capture. Nat Biotechnol 34:652–655
Steuernagel B, Witek K, Jones JD, Wulff BB (2017) MutRenSeq: a method for rapid cloning of
plant disease resistance genes. In: Wheat rust diseases. Methods in molecular biology, vol 1659.
Springer, New York, pp 215–229
Sun X, Cao Y, Wang S (2006) Point mutations with positive selection were a major force during the
evolution of a receptor-kinase resistance gene family of rice. Plant Physiol 140:998–1008
224 M. A. B. Saddique et al.
Takagi H, Uemura A, Yaegashi H, Tamiru M, Abe A, Mitsuoka C, Utsushi H, Natsume S,
Kanzaki H, Matsumura H (2013) MutMap-Gap: whole-genome resequencing of mutant F
2 progeny bulk combined with de novo assembly of gap regions identifies the rice blast
resistance gene Pii. New Phytol 200:276–283
Takahashi H, Miller J, Nozaki Y, Sukamto Takeda M, Shah J, Hase S, Ikegami M, Ehara Y, Dinesh-
Kumar S (2002) RCY1,anArabidopsis thaliana RPP8/HRT family resistance gene, conferring
resistance to cucumber mosaic virus requires salicylic acid, ethylene and a novel signal
transduction mechanism. Plant J 32:655–667
Tian D, Wang J, Zeng X, Gu K, Qiu C, Yang X, Zhou Z, Goh M, Luo Y, Murata-Hori M (2014)
The rice TAL effector-dependent resistance protein XA10 triggers cell death and calcium
depletion in the endoplasmic reticulum. Plant Cell 26:497–515
Tör M, Brown D, Cooper A, Woods-Tör A, Sjölander K, Jones JD, Holub EB (2004) Arabidopsis
downy mildew resistance gene RPP27 encodes a receptor-like protein similar to CLAVATA2
and tomato Cf-9. Plant Physiol 135:1100–1112
Van Der Biezen EA, Freddie CT, Kahn K, Parker JE, Jones JD (2002) Arabidopsis RPP4 is a
member of the RPP5 multigene family of TIR-NB-LRR genes and confers downy mildew
resistance through multiple signalling components. Plant J 29:439–451
Van Dijk EL, Jaszczyszyn Y, Naquin D, Thermes C (2018) The third revolution in sequencing
technology. Trends Genet 34:666–681
Wang ZX, Yano M, Yamanouchi U, Iwamoto M, Monna L, Hayasaka H, Katayose Y, Sasaki T
(1999) The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich
repeat class of plant disease resistance genes. Plant J 19:55–64
Warren RF, Henk A, Mowery P, Holub E, Innes RW (1998) A mutation within the leucine-rich
repeat domain of the Arabidopsis disease resistance gene RPS5 partially suppresses multiple
bacterial and downy mildew resistance genes. Plant Cell 10:1439–1452
Xue JY, Takken FLW, Nepal MP, Maekawa T, Shao ZQ (2020) Editorial: evolution and functional
mechanisms of plant disease resistance. Front Genet 11:593240
Yoshimura S, Yamanouchi U, Katayose Y, Toki S, Wang ZX, Kono I, Kurata N, Yano M, Iwata N,
Sasaki T (1998) Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by
bacterial inoculation. Proc Natl Acad Sci U S A 95:1663–1668
Zhang L, Kars I, Essenstam B, Liebrand TWH, Wagemakers L, Elberse J, Tagkalaki P, Tjoitang D,
van den Ackerveken G, van Kan JAL (2013) Fungal endopolygalacturonases are recognized as
microbe-associated molecular patterns by the arabidopsis receptor-like protein responsiveness
to Botrytis polygalacturonases1. Plant Physiol 164:352–364
Zhang C, Liu L, Wang X, Vossen J, Li G, Li T, Zheng Z, Gao J, Guo Y, Visser RGF, Li J, Bai Y, Du
Y (2014) The Ph-3 gene from Solanum pimpinellifolium encodes CC-NBS-LRR protein confer-
ring resistance to Phytophthora infestans. Theor Appl Genet 127:1353–1364
Zhang S, Li CZ, Yang QH, Dong XH, Chi SY, Liu HY, Shi LL, Tan BP (2016) Molecular cloning,
characterization and expression analysis of Wnt4, Wnt5, Wnt6, Wnt7, Wnt10 and Wnt16 from
Litopenaeus vannamei. Fish Shellfish Immunol 54:445–455
Zhang Y, Liu Q, Zhang Y, Chen Y, Yu N, Cao Y, Zhan X, Cheng S, Cao L (2019) LMM24 encodes
receptor-like cytoplasmic kinase 109, which regulates cell death and defense responses in rice.
Int J Mol Sci 20:3243
225
The Role of Genetic, Genomic, and Breeding
Approaches in the Fight Against Fungal
Diseases in Wheat
12
Antul Kumar, Anuj Choudhary, Radhika Sharma, Harmanjot Kaur,
Khushboo Singh, Baljinder Singh, and Sahil Mehta
Abstract
Wheat is a major, widely cultivated staple cereal food resource, representing
almost 200 million ha of agricultural areas. It is regarded as the second most
important cultivated crop, equally consumed in different forms. In recent years,
enormous progress in genomic advancement in fungal disease resistance has
partially solved the problem throughout the globe. The landraces, conventional
varieties, and wild species (primary, secondary, and tertiary gene pools) have
been explored in search of resistant genes. Wheat’s cosmopolitan distribution and
changes in global climatic conditions exposed the crop to various strains of fungal
pathogens. Conventional and advanced breeding techniques provide a platform
for identification and introgression of potential genes that help to combat the
fungal disease exploits. Furthermore, the use of new genomic techniques such as
marker-assisted breeding, RNAi editing, genome editing, speed breeding tilling,
and so on empowers the harnessing of new rust-resistant genes. The chapter
highlights the importance of potential donors of fungal resistance alleles in
breeding strategies and new emerging techniques. Moreover, translational
A. Kumar · A. Choudhary · H. Kaur
Department of Botany, Punjab Agricultural University, Ludhiana, India
R. Sharma
Department of Soil Science, Punjab Agricultural University, Ludhiana, India
K. Singh · S. Mehta (*)
School of Agricultural Sciences, K.R. Mangalam University, Gurugram, Haryana, India
B. Singh
National Institute of Plant Genome Research, Aruna Asaf Ali Marg, New Delhi, India
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_12
approaches are also essential to achieve long-term durable resistance along with
the variable resistance nature of fungal pathogens.
226 A. Kumar et al.
Keywords
Wheat · Productivity · Fungal diseases · Markers gene Lr78
Abbreviations
AFLPs Amplified fragment length polymorphisms
BAC libraries Bacterial artificial chromosome libraries
CAPS Cleaved amplified-polymorphic sequence
CASS Chromosome arm-specific sequencing
DArT markers Diversity arrays markers
DHs Doubled haploids production
dsRNA Double-stranded RNA
FST Flow sorting technology
GM crops Genetically modified crops
GS Genomic determination
GWAS Genome-wide association studies
HIGS Host-induced gene silencing
MABS Marker-assisted backcrossing
MAS Marker-assisted selection
MNs Meganucleases
NGS Next-generation sequencing technologies
PM resistance genes Powdery mildew resistance genes
PtCNB Calcineurin B
PtCYC1 Cyclophilin
PtMAPK1 Mitogen-activated protein kinase 1
QTL Quantitative trait locus
R gene Resistance genes
RFLPs Restriction fragment length polymorphism
RNAi RNA interference
S genes Susceptibility genes
SIGS Spray-induced gene silencing
SNPs Single nucleotide polymorphism
SSD Single-seed-descent
SSRs Simple sequence repeats
STS Sequence targeted site
TILLING Targeting induced local lesions in genomes
WGSA Whole-genome shotgun approach
ZFNs Zinc-finger nucleases
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 227
12.1 Introduction
In 2050, agriculture will need to produce more than double the food because of the
exponentially growing world population and increased reliance on cereal crops
(Choudhary et al. 2022; Singh et al. 2022; Zhang et al. 2021). Considering the
future projections, the production of major cereal wheat should need to be increased
to provide 20% of the protein and calories for human nutrition worldwide (Mehta
et al. 2019; Singh et al. 2019; Rahman et al. 2019). The wheat crop is mainly
threatened by strong abiotic and biotic undesirable components and is strongly
threatened by crop productivity from seed germination to crop harvesting. Increasing
food demands will need to be fulfilled via sustainable disease-free plants combining
management of pest and pathogen adaptation to changing climate conditions and
fluctuating abiotic challenges with adapting to low water conditions (FAOSTAT
2020; Savary et al. 2019; Ahmad et al. 2020; Mbinda and Masaki 2021; Kumar et al.
2022a; Kumar et al. 2022b) (Fig. 12.1). Overall, biotic strains cause 21.1% yield loss
managed only by pests and diseases, whereas almost 31 crop pathogens are reported
in wheat, such as fusarium head blight, leaf rust, stripe rust, Septoria leaf blotch, tan
spot blotch, and powdery mildew which cause severe losses. These diseases’abrupt
plant physiological and biochemical processes lead to alteration in qualitative and
quantitative crop loss (Corredor-Moreno and Saunders 2020; Fones et al. 2020;
Simón et al. 2021; Fernando et al. 2021; Bishnoi et al. 2021). Wheat diseases
significantly affect the growth as well as productivity of crops. For example, rust
Fig. 12.1 An illustration showing the available genetic techniques used in wheat breeding to
improve resistance (a) Wheat fungal diseases caused via obligate and facultative pathogens;
(b) various methods of virulence evolution; (c) effects on physiological and biochemical process
is the most serious disease both quantitatively and qualitatively (Fig. 12.1). Wheat
germplasm contains a lot of genetic variation when it comes to disease resistance,
and several race-specific and long-lasting resistance genes have been identified. The
chapter highlights the importance of potential donors of fungal resistance alleles in
breeding strategies and new emerging techniques. Moreover, translational
approaches are also essential to achieve long-term durable resistance along with
the variable resistance nature of fungal pathogens.
228 A. Kumar et al.
By methodically transferring several resistance genes from diverse species and
genera linked to wheat by cytogenetic treatments, the diversity has been further
enhanced. Resistance is normally conferred from the seedling development stage
through physiological maturity by race-specific or main genes. However, resistance
expression can begin at later growth stages in some circumstances. Furthermore, the
level of resistance provided by these genes varies greatly, ranging from complete
immunity to minor decreases in disease symptoms. Although matching virulences in
the pathogen population were able to overcome numerous known race-specific rust
and PM resistance genes, there is potential to increase their lifetime by pyramiding
several undefeated genes through marker-assisted selection (MAS) (Ahmad et al.
2020; Mbinda and Masaki 2021).
Another method, genomic determination (GS), is utilized to foresee breeding
qualities, empowering the choice of competitors before phenotyping, and is a better
approach than MAS for progeny traits. New genetic methods such as molecular
marker technologies offer a viable option for improving wheat-resistant cultivars. In
the previous decades, RFLPs, SSRs, AFLPs, SNPs, and DArT markers have played
a crucial role in developing resistant cultivars against fungal infections in wheat. For
increasing grain production, genomics methods like TILLING RNAi and
epigenetics are required. Disease resistance through mutagenesis and bioinformatics
is becoming an established scientific method for analyzing wheat genome structure
and function.
Single nucleotide polymorphism (SNP) genotyping is employed for gene
sequencing processes in huge populations quickly with a large number of markers
and a variety of genotyping systems. SNP data are commonly utilized to determine
marker-trait relationships in (QTL) mapping investigations and genome-wide asso-
ciation studies (GWAS). The use of high-density SNP arrays has proved effective in
genetic research of a variety of commercially significant crops. For GWAS of several
rice accessions, a 44K SNP genotyping chip was used and several alleles important
for controlling morphological and agronomic features were found (Hane et al. 2007;
Islam et al. 2020; Santillán Martínez et al. 2020; Tyagi et al. 2021). The literature
used for gene-based tolerance for rust-smut disease and the techniques used for their
introgression are summarized in Table 12.1.
(continued)
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 229
Table 12.1 List of genes used for tolerance in rust-smut disease and techniques used for their
introgression
Plant species Genes
DNA
marker
Marker
systems Resistance References
Aegilops
umbellulata
Lr9 cMWG684 Sequence-
tagged site
(STS)
Leaf rust Ganeva
et al. (2000)
Agropyron
elongatum
Lr19 STSLr19130 Randomly
amplified
polymorphic
DNA
Leaf rust Prins et al.
(2001)
Triticum
tauschii
Lr39 Xcmwg682 Microsatellites
or simple
sequence
repeats
Leaf rust Singh et al.
(2004)
Triticum
tauschii
Lr41 GMM210 Amplified
fragment
length
polymorphism
Leaf rust Singh et al.
(2004)
Triticum
ventricosum
Lr3 M39
175
Amplified
fragment
length
polymorphisms
Leaf rust Diéguez
et al. (2006)
Triticum
aestivum
Lr68 Psy1-1 Single
nucleotide
polymorphism
Leaf rust Herrera-
Foessel et al.
(2012)
Triticum
aestivum
Pm38 Swm10 Diversity
arrays
technology
Leaf rust, stem
rust, yellow rust,
and yellow
dwarf virus, and
powdery
mildew
Ellis et al.
(2014)
Puccinia
graminis
Sr2 Xgwm533 Restriction
fragment
length
polymorphism
Stem rust Mago et al.
(2014)
Cantalupensis
Charentais
Pm1 M75/
H35_155
Sequence-
tagged site
Powdery
mildew
Elkot et al.
(2015)
Aegilops
umbellulata
Yr40 gwm190 Restriction
fragment
length
polymorphism
Stripe rust Bansal et al.
(2016)
Triticum
aestivum
Lr75 swm271 Simple-
sequence
repeats
Leaf rust Singla et al.
(2017)
Thinopyrum
bessarabicum
Lr24 SCS5550 Restriction
fragment
length
polymorphism
Leaf rust Singh et al.
(2017)
Plant species Genes Resistance References
230 A. Kumar et al.
Table 12.1 (continued)
DNA
marker
Marker
systems
Triticum
aestivum
Lr78 IWA6289 Diversity
arrays
technology
Leaf rust Kolmer
et al. (2018)
Triticum
dicoccoides
Yr15 uhw250 Randomly
amplified
polymorphic
DNA
Stripe rust Klymiuk
et al. (2018)
Triticum
aestivum
Lr77 IWB10344 Single-
nucleotide
polymorphism
Leaf rust Kolmer
et al. (2018)
Secale cereale Lr26 P6M12 Amplified
fragment
length
polymorphism
Stem rust and
powdery
mildew
Tomkowiak
et al. (2019)
Triticum
ventricosum
Lr37 Xcmwg682 Sequence-
tagged site
Leaf rust Randhawa
et al. (2019)
Triticum
turgidum
Yr30 csSr2-SNP Restriction
fragment
length
polymorphism
Yellow stem and
leaf rust
Rani et al.
(2019)
Triticum
aestivum
Lr74 cfb5006 Simple-
sequence
repeats
Leaf rust Kthiri et al.
(2019)
Triticum
aestivum
Ltn2 csLV46 Cleaved
amplified
polymorphic
sequences
Leaf rust and
stripe rust
Babu et al.
(2020)
Triticum
aestivum
Yr46 gwm165 Amplified
fragment
length
polymorphism
Stripe rust and
leaf rust
Huerta-
Espino et al.
(2020)
Triticum
speltoides
Lr35 BCD260 Restriction
fragment
length
polymorphism
Leaf rust Gultyaeva
et al. (2021)
12.2 Conventional Breeding and Factors Affecting Disease
Resistance
Conventional breeding methods for qualitative resistance usually begin with the
screening of a large number of lines in which vulnerable plants are removed by
producing epiphytic conditions. After that, the resistant lines or plants are chosen
and developed in breeding programs, i.e., mass selection or pure selection. Another
method is hybridization and selection, which includes intervarietal methods like the
Pedigree Method Bulk Method and Single Seed Descent Method. The Modified
Bulk Method includes multiline varieties polyploidy breeding and population
approaches mutation breeding. The next method is backcrossing, which entails
crossing a resistant parent with an excellent but susceptible parent, then backcrossing
progenies with the susceptible parent until the required level of susceptible parent
genome is regained. Homozygous-resistant lines may be established in a relatively
small number of breeding cycles in qualitative resistance breeding, and no additional
resistance allele selection is necessary. However, a variety of highly heritable traits
may be chosen for quantitative resistance (Bisht et al. 2019; Zatybekov et al. 2022;
Zhang et al. 2022). Molecular markers, csLV34, Gb, Sr24#12, and wmc44 (SSR)
markers, helped in the identification of leaf rust and stem rust resistance genes that
might be used as important donors in wheat breeding for achieving durable rust
resistance. The abundance of Sr24/Lr24 using a specific Sr24 # 12 marker was
identified in HS545 that exhibited monogenic regulation of leaf rust resistance
toward pathotype. Specific rust resistance of genotypes G19 and G12 had significant
grain production superior to HS490, which might be an ideal option for their use in
developing rust resistance cultivars. These marker validations also confirmed the
abundance of Sr24/Lr24 genes in more than half of the wheat lines, whereas almost
22.2% of the lines are enriched with Lr24/Sr24 and Sr57/Lr34/Pm38/Yr18 gene
combinations. Such genetic labels used in this study may aid in the transfer or
pyramiding of resistance genes for agronomically important disease susceptible
wheat genotypes (Pal et al. 2022).
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 231
In wheat, the fungal disease is presently caused by obligate pathogens or parasites
(smuts, bunts, rusts, powdery mildews) and facultative parasites (scab, tan spot, spot
blotch, Septoria nodorum blotch, Septoria tritici blotch). Such highly specialized
obligate parasites show significant variation in the fungal population for pathogenic-
ity towards resistance race-specific genes (Santillán Martínez et al. 2020; Tyagi et al.
2021; Yin and Qiu 2019). The advent of new virulence evolution achieved by
mutation migration and preexisting virulence recombination and their adaptability
are highly common in powdery mildew and rust fungi (Fig. 12.1). The technologies
that can help to combat fungal diseases are genome sequencing, GWAS analysis,
CRISPR/Cas-regulated multiplex system, gene stacking by synthetic biology, devel-
opment of diverse genotypic-independent approaches, and speed breeding (Bisht
et al. 2019; Li et al. 2021a,b). However, breeding for disease resistance has always
been challenging and specific. In this context, smut and bunts are more specifically
known for strains or physiological races, whereas the selection and evolution of new
strains are less frequent (Corredor-Moreno and Saunders 2020; Esse et al. 2020;Li
et al. 2021a,b; Pandurangan et al. 2021; Rasheed et al. 2021; Upadhyaya et al.
2021).
232 A. Kumar et al.
12.3 Role of Genomics in Wheat Breeding to Combat Fungal
Threats
Among the biotic stresses which pose a threat to wheat production, fungal pathogens
like rust are mainly considered as major threats with high impact. It causes severe
loss in the crop if the epidemic is well-favored by environmental conditions like high
humidity, excessive rainfall, etc. (Fabre et al. 2020). In recent years, the emergence
of gene-specific DNA markers has made it reliable and efficient to expedite resis-
tance gene pyramiding in new cultivars. Complexity, enormous genome size, and
identical sequences in the homologous genome repetitive sequences have created a
challenge in creating robust DNA markers and enlisting wheat genome sequence.
Several markers-based approaches, such as CAPS (Cleaved Amplified-Polymorphic
Sequence), STS (Sequence Targeted Site), and SSR (Simple Sequence Repeats),
have been extensively investigated for disease resistance over the last decade. Wheat
genomics has been the witness to the advent of NGS (Next-generation Sequencing
Technologies) from (CASS) Chromosome Arm Specific Sequencing Flow sorting
technology, WGSA (Whole-Genome Shotgun Approach), de-novo whole-genome
assembly, and long-range sequencing through the WGSA approach (Babu et al.
2020; Pramanik et al. 2021; Huerta-Espino et al. 2020). The accelerating pace of
genomics-based molecular disease characterization and developing resistance wheat
is propelled by an enhanced understanding of the pathogen and its molecular
components related to resistance interaction. Depending upon the information on
the genomic size of pathogens, the genomic sequence also varies in terms of quality
and contiguity of segments; more likely the complete genome of Puccinia graminis
f. sp. tritci (Wheat stem rust), P. triticina (wheat leaf rust), and Stagonospora
nodorum Blumeria graminis f. sp. Tritici (Powdery mildew) has been determined
(Duplessis et al. 2011; Hane et al. 2007; Islam et al. 2020; Parlange et al. 2011).
Such molecular sequences have been positively complemented for fungal
pathogens by various genomics approaches, including physical mapping and BAC
libraries. Furthermore, the host is very concerned about molecular mining for
revealing the interaction between wheat and pathogens. The recognition of
pathogens depends upon molecular factors identified by the receptors engaged
during the resistance system. More likely in powdery mildew, two virulence genes
have been discovered using combined methods associated with GWAS or
map-oriented cloning techniques. The AvrPm2 (powdery mildew2) gene in wheat
shows homology with the rye mildew gene and is confirmed by pm2
immunoreceptors. The finding confirms the successful introgression of wheat-rye
against powdery mildew, whereas an identical Avr subset also confirms resistance
against mildew on other crops. Similarly, two stem rust genes, AvrSr35 and AvrSr50,
were isolated based on whole-genome analysis and are considered the first genes of
stem rust reported in wheat. On-field pathogenomics was performed on diseased
wheat plants in the United Kingdom (Mago 2021). In wheat cultivars, durable
resistance is a very effective and well-known approach to managing stripe rust
disease. Such durable type resistance can be attained by incorporating multiple
APR genes into the specific target so that each introgressed gene is relatively specific
but small and possesses an individual role. In the case of Fengdecun 12 and Ruihua
520, two Chinese wheat cultivars exhibit APR to stripe rust in different
environments. More than 170 recombinant wheat inbred lines from crossing the
RH520 FDC12 were utilized to evaluate the molecular basis of resistance and
recognize genomic regions related to resistance to stripe rust.
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 233
On a global scale, the Lr34 ensures multiple resistance against rust pathogens. For
instance, powdery mildew and leaf rust pathogens emerging on partial resistance
identified through transcriptomics Lr34- carrying barley or wheat host were
associated with fungal pathogens growing isogenic host or other cultivars of wheat
lack Lr34. No doubt, pathogens do not act toward the negative effect of Lr34 and it is
tempering to consider the predictable role of Lr34 as in durable resistance. In some
cases, overexpressing of AtLTP4.4 like nonspecific lipid-transfer gene in transgenic
wheat (nsLTP) gene, lower accumulation of (DON) deoxynivalenol, inhibiting
oxidative stress and causing accumulation of hydrogen peroxide accumulation
showed a reduction in Fusarium head blight caused by Fusarium graminearum
(McLaughlin et al. 2021; Collinge and Sarrocco 2022). Another, Trichoderma
gamsii A5MH is an endophytic strain of wheat that suppressed the
F. pseudograminearum abundance that causes crown-rot disease and increased
wheat durum growth in natural Chromosol and Kandosol cropping soils (Stummer
et al. 2022). Use of Trichoderma gamsii T6085 reduced growth of F. graminearum
in wheat straw. This interaction with the plant also increased defense-related genes
PAL1 and PR1 significantly. The ability to compete, resistance to host, and endo-
phytic behavior can be achieved with the use of T6085 in the soil as well as on crops
(Sarrocco et al. 2020).
12.4 Role of Genetics in Fungal Disease Management
Most fungal pathogens affecting wheat possess genetic diversity and its control
through using race-specific-resistant genes holds the great capability to generate
more permanent resistance and increase worldwide wheat output (Xu et al. 2019;
Wang et al. 2018a; Miedaner and Juroszek 2021). Resistance genes (R) are classified
as major (seedling resistance vertical and all stage resistance genes) and minor genes
(APR). R genes identify pathogen proteins, encode them, and initiate an immune
response. Major genes control qualitative resistance and minor genes control quan-
titative resistance. Among major genes, 21 have been identified that are gene-
specific and not likely to be durable (Wang et al. 2018b). These genes usually give
resistance from seedling to maturity and sometimes at later growth stages. Minor
genes have weaker specificity and are more durable. Analysis using RNA-based
disease control strategy, the design that involves the use of RNA silencing, is widely
applicable for diverse pathogens. Using the Fusarium graminearum pathosystem,
the spray of CYP3-dsRNA or noncoding dsRNA 791 suppresses the growth of three
fungal cytochrome P450 lanosterol C-14α-demethylases, which inhibited fungus
populations. The effective spray that controls infections rate and severity directly
indulged in the movement of CYP3-dsRNA after pathogen uptake and its movement
through vascular tissue (Koch et al. 2013,2016).
234 A. Kumar et al.
The presence of major and minor genes can provide resistance to diseases caused
by biotrophic and necrotrophic fungi. Biotrophic fungi attack only the living plants
and are obligate in nature. Examples include the Stem rust resistance gene is Sr26,
leaf rust resistance gene is Lr68, rusts resistance gene is Lr34-Yr18-Sr57, powdery
mildew resistance gene is Pm18, and Yr5 against stripe rust. Necrotrophic fungi feed
on the dead and decaying organisms and they are facultative in nature (Prins et al.
2001; Duplessis et al. 2011; Parlange et al. 2011; Huerta-Espino et al. 2020). The
presence of Rmg8 and Rmg7 genes provides resistance to the wheat blast fungus and
Fhb1 Fhb2 and Fhb5 are among the most important that confer resistance against
Fusarium head blight (Mandalà et al. 2019; Milne et al. 2019). Quantitative trait
locus (QTL) mapping can also be used to identify the chromosomal position of genes
or genetic variations that influence a particular trait. Over the past years, 500 QTLs
conferred small to moderate effects for the different resistance (Buerstmayr et al.
2002; Wang et al. 2020;Lietal.2020). Similarly, 79 Lr-genes and more than
200 QTLs and 82 Yr-genes and 140 QTLs have been reported for seedling and adult
plant LR and SR resistance. Stb6 QTL is determined at or near loci of qualitative
genes that provide several kinds of resistance. Plants also have susceptibility
(S) genes that encourage and assist the spread of any disease or pathogen infection
in contrast to R genes. If these genes are thrown away, resistance to certain infections
can be improved (Milne et al. 2019; Zhang et al. 2017; Su et al. 2019; Corredor-
Moreno and Saunders 2020). The gene Lr34 is resistant to stripe rust leaf rust and
powdery mildew and generally appears on flag leaf and functions in an adult plant. It
appears similar to ATP transporter PEN3 that causes movement of metabolites to
provide resistance. Powdery mildew, a damaging disease caused by Blumeria
graminis, may drastically impair wheat harvests. At present, 78 powdery mildew
resistance alleles and 50 powdery mildew loci have been found and given names.
However, only a few genes have been defined molecularly and functionally, for
example CC-NBS-LRR protein is encoded by Pm21 that provides wider powdery
mildew resistance. Zymoseptoria tritici causes STB that might result in global
economic losses. Wheat contains 21 Stb resistance genes. Only one gene Stb6 has
been cloned and studied thus far. These are genes for a conserved wall-associated
receptor-like kinase that impart pathogen resistance without causing hypersensitivity
(Li et al. 2020; Corredor-Moreno and Saunders 2020;Esse et al. 2020). Despite
these, the stable overexpression of TaWRKY19 in wheat or repression of TaNOX10
enhanced susceptibility toward PST, avirulent race, whereas mutations in different
copies of TaWRKY19 suggested good resistance to PST by alleviating ROS accu-
mulation in host plant species. Studies demonstrate that a transcriptional repressor
like TaWRKY19 binds to the promoter of TaNOX10 at the W-box element. TNOX10
encodes for NADPH oxidase and significantly stimulates the production of ROS,
confirming host resistance to PST reported by Wang et al. (2022). The detailed case
studies on major rust resistance genes and their isolation from different sources have
been explained in Table 12.2.
Plant source Gene Resistance References
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 235
Table 12.2 List of major rust resistance genes and their isolation from different sources
DNA
marker
Chromosomal
region
Triticum
ventricosum
Lr37 Xcmwg682 2AS Leaf rust Helguera et al.
(2002)
Aegilops
tauschii
Lr10 KSUD14 1AS Leaf rust Feuillet et al.
(2003)
Triticum
tauschii
Lr39 BARC124 1DS Leaf rust Singh et al.
(2004)
Triticum
tauschii
Lr41 GMM210 1D Leaf rust Singh et al.
(2004)
Triticum
aestivum
Lr1 RGA567-5 5DL Leaf rust Cloutier et al.
(2007)
Aegilops
tauschii
Lr22a GWM296 2DS Leaf rust Hiebert et al.
(2007)
Triticum
spelta
Lr34 cssfr6 7DS Stripe rust Lagudah et al.
(2009)
Triticum
aestivum
Lr67 csSNP856 4DL Powdery
mildew
Forrest et al.
(2014)
Agropyron
elongatum
Lr19 STSLr19130 7DL Leaf rust Wessels and
Botes (2014)
Triticum
aestivum
Ltn3 gwm 165 4DL Stripe rust Ren et al. (2015)
Triticum
aestivum
Pm38 csLV34 7DS Powdery
mildew
Reddy et al.
(2016)
Triticum
turgidum
Yr30 csSr2-SNP 3BS Yellow and
stem rust
Rani et al.
(2019)
Triticum
aestivum
Pm46 cfb5006 7BL Leaf rust Chandra et al.
(2020)
Triticum
aestivum
Ltn2 csLV46 1BL Stripe rust Gebrewahid
et al. (2020)
Aegilops
umbellulata
Lr9 J13 6BL Leaf rust Narang et al.
(2020)
12.4.1 Speed Breeding
For the objective of reducing harvest time in wheat, a method known as “Speed
Breeding”was developed by researchers at the University of Queensland. Speed
breeding is suited for a wide range of germplasm and does not require specialized
in vitro culturing technology. The premise of speed breeding is to accelerate the rate
of photosynthesis by controlling light intensity, temperature, and daytime duration,
which directly encourage early blooming (Ahmar et al. 2020). This is combined with
yearly seed harvesting to minimize the generation period. The protocol involved
artificial treatment of 22 h daylight and 2 h night light. The light intensity was
adjusted to be 360–380 mol/m
2
at the ground level and 450–500 mol/m
2
at the top
level. A 22 C temperature is applied in the light period and a 17 C temperature in
the dark period. The humidity level is kept between 60% and 70% generations and
can be grown in a year and harvesting can be done within 60 days. The shorter
breeding time will be beneficial in genetic research tissue culture studies, mapping
populations, seed reproduction, marker-based selection characterization, and devel-
oping varieties resistant to biotic and abiotic stresses (Ahmar et al. 2020; Watson
et al. 2018). The speed breeding method is an inexpensive technique compared to
other methods used in classical breeding as it requires less labor (Singh et al. 2016;
Qi et al. 2019). In the Single Seed Descent method, one seed per plant is required to
develop each generation. It facilitates the production of homozygous lines.
Integrating speed breeding and SSD techniques can effectively accelerate the gener-
ation of inbred lines for research and plant breeding programs in less time (Bariana
et al. 2013; Zhou et al. 2011; Goutam et al. 2015; Li et al. 2020). In addition, the
wheat Stagonospora leaf and glume blotch are caused by fungus Parastagonospora
nodorum.Stagonospora nodorum interaction of Snn–SnTox3, Snn1–SnTox1, and
Tsn1–SnToxA is considered as an extensively studied association because of its
involvement in the suppression of ROS production and regulation. The mechanism
regulating the concentration of cytokinin during the infection stage might be effec-
tively utilized for disease control and its management strategies (Katoch et al. 2022).
236 A. Kumar et al.
12.4.2 MAS
MAS (marker-assisted selection) has been utilized for protection from certain
infections in wheat. MAS is favored over traditional approaches to provide adequate
heritability reducing dominant behavior and destructive phenotyping. MAS is used
to study the interaction between genotype and phenotypes. With the use of molecular
biology, a particular trait from a donor can be selected and can be transformed by
crossing over, but only desired trait should be selected (Wang et al. 2014; Nalam
et al. 2015; Gupta et al. 2010; Li et al. 2020; Singh et al. 2016). It involves
backcrossing up to 3–4 generations and complete recovery is possible. MAS is
beneficial in QTL and associated mapping. The efficiency of marker-assisted selec-
tion declines when the number of plants reflecting the desired research in a popula-
tion grows exponentially and the number of QTLs grows.
Different types of molecular markers are used (RFLP: Restriction fragment length
polymorphism), where a mutant allele is identified through a restricted digestion
pattern; VNTR that shows repeated clusters aligned in the same direction with varied
lengths, SSR are the satellite repeats of dinucleotide and trinucleotide; dCAPS in
which dominant and recessive are known by PCR and restriction digestion; CAPS
that identify recessive alleles and amplify them; RAPD that does not need informa-
tion about genomic sequence; FLP is used for insertion-deletion; and SNP that gives
the highest resolution in the map. The pyramiding of genes through MAB also
prevents certain fungal diseases. Many strategies have proved beneficial for MAS in
wheat. It entails combining desired traits into a single genotype or transferring them
from donor to recipient as a single allele. It can be achieved through either
backcrossing, forward breeding, or double haploids (Gupta et al. 2010). Marker-
assisted backcrossing (MABC) is utilized to create parent lines with specific features
that will transfer these genes into germplasm. Specific features are transferred into
different breeding lines, resulting in the creation of parental lines for the transfer of
important genes taken from different locations into the finest germplasm. This
selection is made for recurrent parents, and the selection of the targeted locus is
based on phenotype. It can delete non-desirable genes. Calculations are done
theoretically through simulations of the wheat genome structure on computers, and
eventually, the experience of the Yr15 gene transfer was used to suggest a four-stage
MABS technique. Forward breeding MAS is the technique in which a locus in the
heterozygous state is targeted, then selected plants are self-pollinated till the progeny
becomes homozygous. This method is superior to MABC because superior lines are
created using genes from both parents, and there is introgression of genes that are
targeted. Doubled haploid production (DHs), in which plants derived from single
pollen grains are doubled artificially to form homozygous diploids (Gupta et al.
2010; Jamil et al. 2020; Li et al. 2020). The most expensive part of MAS is DNA
isolation, but once that’s done, markers associated with a variety of attributes may be
genotyped to choose a complete genotypic bundle. To properly select a suitable
number of genotypes harboring positive alleles for numerous trait loci, larger
population sizes are necessary. Several breeding strategies were used to determine
the size of the population for MAS with various numbers of loci. In the case of
doubled haploid/recombinant inbred lines and single backcross procedures, a signif-
icantly smaller number is required (Randhawa et al. 2019). Yr molecular markers
may be used to map the detection of stripe rust resistance genes in host plants. One of
the most significant and urgently required research fields on rusts, notably stripe rust,
is the marker-assisted selection of specific genotypes for the Yr gene. Stripe rust
resistance can also be achieved if there is stacking of multiple APR Pst resistance
genes through MAB. With the significant expense in the genotyping absence of
authentic markers and perfection in phenotypic determination, most reproducing
programs rely on phenotypic selection (Randhawa et al. 2019; Prasad et al. 2019;
Jamil et al. 2020).
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 237
Recently, reports confirmed that Powdery mildew resistance locus-associated trait
TraesCS3B02G014800 was considered as a most promising candidate gene for QPm.
caas-3BS (a stagnant quantitative trait locus (QTL) for offering adult plant resistance
(APR) against powdery mildew in the popular population of recombinant inbred
line ex: Zhou8425B/Chinese Spring by phenotyping across four environments. In
addition, TraesCS3B02G016400 and TraesCS3B02G016300 were not much reliable
candidates depending on sequence variation and gene annotations between the
parents. The above findings result not only provide high-throughput KASP markers
for enhancement of resistance against powdery mildew, but also direct the way the
map depends upon resistance gene cloning (Dong et al. 2022).
12.4.3 RNAi (RNA Interference)
RNAi is a self-defense mechanism to protect against fungal diseases. Cellular
enzymes can cause the degradation of viral mRNA through cellular enzymes.
Plant protection techniques based on RNA interference (RNAi) were developed
based on the understanding that exogenous or plant-derived double-stranded RNA
(dsRNA) molecules may silence critical or virulence genes in microbial diseases and
pests. Due to the extremely specialized, ecologically friendly and changeable char-
acter of dsRNAs, these tactics are advantageous. Furthermore, RNAi is successful in
suppressing plant-pathogens when further administered by transgenic host-induced
gene silencing (HIGS) or environmental absorption (ex. Spray-Induced Gene Silenc-
ing; SIGS). A bidirectional method called “cross-kingdom communication”silences
virulence genes by exchanging RNA duplexes between plant and microbial cells.
Fungal pathogens such as Pst carry out the uptake of nutrients and secretion of
effectors. From the transgenic host plants, siRNAs, along with other nutrients, are
transported to the obligate fungus, B. graminis.
238 A. Kumar et al.
The transgenic host plants that contained RNAi reduced the growth of the
biotrophic B. graminis. Thus, RNAi-based crop protection strategy could be
deployed against fungal pathogens. The powdery mildew of wheat caused by
Blumeria graminis f. sp. tritici is a serious disease and dsRNA targeting the
avirulence gene AVRa10 which is recognized by the resistance gene Mla10 signifi-
cantly reduced fungal development in the absence of Mla10 and the silencing of
13-b-glucanosyltransferases (BgGTF1 and BgGTF2) reduced the early development
of the pathogen. BSMV-HIGS (Barley stripe mosaic virus) provides a way to
analyze the function and to screen RNAi targets for the control of rust diseases.
Silencing of the genes through A. tumefaciens to genes encoding mitogen-activated
protein kinase 1 (PtMAPK1) cyclophilin (PtCYC1) and calcineurin B (PtCNB) from
Puccinia triticina controlled disease symptoms and decreased sporulation. Further
silencing of PtMAPK1,PtCYC1, and PtCNB also reduces the impact of rust fungi.
The hairpin RNAi creations of the homologous gene of MAP kinase (PtMAPK1) and
the cyclophilin (PtCYC1) of leaf rust hindered fungal growth and drastically
decreased fungal biomass in transgenic wheat (Qi et al. 2019). RNA interference
was first used on gene vernalization gene TaVRN2, which delays flowering time. A
study concluded that with the reduction of VRN2 by RNAi, flowering time in winter-
wheat plants is accelerated by more than a month. Wheat was targeted with MAPK
kinase gene PsFUZ7 which plays a crucial part in developing Pst virulence to stripe
rust by regulating hyphal morphology and development as the target for RNAi (Zhu
et al. 2017).
The expression RNAi construct in transgenic wheat plants imparts significant and
long-lasting resistance to Pst as well as a severe limitation of Pst development. This
effective disease inhibition suggests that HIGS is a powerful strategy for engineering
transgenic wheat resistant to the obligate biotrophic pathogen Pst and that it could be
used instead of conventional breeding or chemical treatment to develop environ-
mentally friendly and long-lasting resistance in wheat and other food crops. Another
host-induced gene silencing the FgCh3b enhanced resistance against Fusarium
graminearum (Koch et al. 2013)PtCNB PtCYC1 and PtMAPK1 exhibits resistance
from P. striiformis and P. graminis and P. triticina (Panwar et al. 2013a) and FcGls
from Fusarium culmorum (Panwar et al. 2013b). The TaCSN5 like overexpression in
wheat lines considerably reduces the accumulation of salicylic acid and enhances
susceptibility to P. striiformis (Pst). Similarly, TaCSN5-RNAi wheat lines are
confined opposite feedback mechanistic cascade. Also, TaCSN5 negatively
stimulated TaG3NPR1 genes indulged in the SA-signaling pathway. Additionally,
TaCSN5-RNAi lines exhibited enhanced multiple races-specific resistance to Pst.
The combining results confirm that TaCSN5 involves in negatively regulating the
expression into PST resistance in an SA-based manner (Bai et al. 2021).
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 239
12.4.4 Genome Editing
Just like the rice, recognizing and editing the genetic makeup of wheat would help in
the development of high-yielding varieties (Mehta et al. 2020; Dilawari et al. 2021;
Chattopadhyay et al. 2022). The most current and commonly utilized genome-
modifying tools are the meganucleases (MNs), zinc-finger nucleases (ZFNs),
TALENs, and the CRISPR/Cas9 system. CRISPR/Cas9 and its variations hold
enormous promise for developing novel wheat types with increased yield potential
as they are simple and extremely efficient (Fig. 12.2). Using the CRISPR/Cas9
Fig. 12.2 Overview of fungal wheat diseases and other factors that affect the virulence of new
pathotypes
system in wheat, a targeted genome of the TaMLO-A1 allele was modified, which
resulted in the complete removal of powdery mildew (Yin and Qiu 2019; Ahmad
et al. 2020).
240 A. Kumar et al.
MLO loci decrease the defense mechanism against powdery mildew and when
MLO was modified, resistance to the fungal pathogens against Blumeria graminis
f. sp. tritici (Bgt) is increased. The three MLO homoeologs in bread wheat (TaMLO-
A1, TaMLO-B1, and TaMLOD1) look identical, and if they are modified, varieties
resistant to Bgt can be developed (Wang et al. 2014). If genes like LOX1 or LOX5 are
modified, it can also enhance disease resistance to F. graminearum in the
corresponding mutant plants (Nalam et al. 2015). In some cases, powdery mildew,
caused by the pathogenic fungus Blumeria graminis, has restricted wheat production
in different major wheat cultivation regions throughout the globe. Introgression of
Pm60 like tolerance genes that were initially identified in Triticum urartu (diploid
wild wheat) into wheat cultivar can harbor the genetic diversity for various disease
resistance breeding. ‘Bridge’approach or durum like intermediate species was used
to introgress Pm60b and Pm60 into common /hexaploid wheat that was noted by
genetic markers and confirms the powdery mildew resistance (Zhang et al. 2022).
Using the GWAS technique in cultivated wheat, 11 quantitative trait loci (QTLs) for
5 out of 6 specific strains or races of Pt and Pgt were reported. Out of 11 QTLs, nine
were demonstrated as leaf- and stem-resistant during the growth stages of wheat and
these can be used at all growth stages for improving resistance to wheat (Zatybekov
et al. 2022). Except these, genotyping was conceded out using 8 QTL and 55 K SNP
array and was identified on different chromosome arms 4BL, 3BS, 2DS, 2AL, 5BL,
and 7BL through inclusive composite-interval mapping. The QYr.nwafu-4BL.2 from
FDC12 and QYr.nwafu-3BS from RH520 were uniform across the four different
testing regimes. Results depicted that QYr.nwafu-3BS is behaving similar to the Sr2/
Yr30, a pleiotropic resistance gene (Liu et al. 2022).
12.5 Concluding Remarks
Crop cultivars have been improved using traditional plant breeding techniques.
Several existing cases involve outstanding efforts by breeders that resulted in the
development and release of disease-resistant crop types. The use of DNA markers
has further aided breeders in reducing the breeding cycle, hence improving the
efficiency and precision of traditional plant breeding. To some extent, mutation
breeding has been effective in generating unique genetic variants. However, because
it is a random process, evaluating and identifying acceptable mutants is a time-
consuming and arduous procedure. Furthermore, after suitable mutants have been
found, additional breeding processes are needed to establish homozygosity and
eliminate unwanted mutations. DNA technology offers a viable alternative to tradi-
tional breeding since it allows for the transmission of beneficial genes across genus
boundaries.
So far, GM crops developed through DNA technology make the plants resistant
to viral infections. In addition, plant breeders and pathologists have a fantastic
platform to produce resistant cultivars because of the development of genome
editing RNAi silencing technologies like MAS, etc. Although the major focus
should remain on breeding resistant cultivars, several other approaches such as
integrating fungicides, moving planting dates, modifying crop feeding patterns,
eliminating volunteer plants, cultivar mixing, and intercropping may be used as a
temporary measure to prevent diseases. These things continue to develop and
distribute resistant wheat cultivars side by side to give a cost-effective and environ-
mentally sustainable alternative.
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 241
Marker-assisted breeding CRISPR and even bioinformatics allow researchers to
investigate and make modifications in hitherto unexplored areas of plant science as
well as bring together the genetic underpinnings of a wide range of agricultural plant
activities. These instruments are a sign that the plant crop and other plant species will
be used properly and in a useful way in the future. These tools are now being studied
in many labs across the world. In the future, sequencing tools with low-cost
procedures will undoubtedly aid in the identification of novel genes in a short period
of time in many crop species in a cost-effective manner.
References
Ahmad S, Wei X, Sheng Z, Hu P, Tang S (2020) CRISPR/Cas9 for development of disease
resistance in plants: recent progress limitations and future prospects. Brief Funct Genomics
19:26–39
Ahmar S, Gill RA, Jung KH, Faheem A, Qasim MU, Mubeen M, Zhou W (2020) Conventional and
molecular techniques from simple breeding to speed breeding in crop plants: recent advances
and future outlook. Int J Mol Sci 21:2590
Babu P, Baranwal DK, Harikrishna Pal D, Bharti H, Joshi P, Thiyagarajan B, Gaikwad KB,
Bhardwaj SC, Singh GP, Singh A (2020) Application of genomics tools in wheat breeding to
attain durable rust resistance. Front Plant Sci 11:567147
Bai X, Huang X, Tian S, Peng H, Zhan G, Goher F, Guo J (2021) RNAi-mediated stable silencing
of TaCSN5 confers broad-spectrum resistance to Puccinia striiformis f. sp. tritici. Mol Plant
Pathol 22(4):410–421
Bansal M, Kaur S, Dhaliwal H, Bains N, Bariana H, Chhuneja P, Bansal U (2016) Mapping of
Aegilops umbellulata—derived leaf rust and stripe loci in wheat. Plant Pathol 66:38–44. https://
doi.org/10.1111/ppa.12549
Bariana HS, Bansal UK, Basandrai D, Chhetri M (2013) Disease resistance. In: Genomics and
breeding for climate-resilient crops. Springer, Berlin, pp 291–314
Bishnoi SK, Kumar S, Singh GP (2021) Wheat blast readiness of the Indian wheat sector. Curr Sci
120:262–263
Bisht DS, Bhatia V, Bhattacharya R (2019) Improving plant resistance to insect-pests and
pathogens: the new opportunities through targeted genome editing. Semin Cell Dev Biol 96:
65–76
Buerstmayr H, Lemmens M, Hartl L, Doldi L, Steiner B, Stierschneider M, Ruckenbauer P (2002)
Molecular mapping of QTLs for Fusarium head blight resistance in spring wheat. I. Resistance
to fungal spread (Type II resistance). Theor Appl Genet 104:84–91
Chandra S, Satapathy L, Basu S, Jha SK, Kumar M, Mukhopadhyay K (2020) Characterization of
the leaf rust responsive ARF genes in wheat (Triticum aestivum L.). Plant Cell Rep 39:1639–
1654
Chattopadhyay A, Purohit J, Mehta S, Parmar H, Karippadakam S, Rashid A, Balamurugan A,
Bansal S, Prakash G, Achary VMM, Reddy MK (2022) Precision genome editing toolbox:
applications and approaches for improving rice’s genetic resistance to pathogens. Agronomy
12:565
242 A. Kumar et al.
Choudhary JR, Tripathi A, Kaldate R, Rana M, Mehta S, Ahlawat J, Bansal M, Zaid A, Wani SH
(2022) Breeding efforts for crop productivity in abiotic stress environment. In: Augmenting crop
productivity in stress environment. Springer, Singapore, pp 63–103
Cloutier S, McCallum BD, Loutre C, Banks TW, Wicker T, Feuillet C, Keller B, Jordan MC (2007)
Leaf rust resistance gene Lr1 isolated from bread wheat (Triticum aestivum L.) is a member of
the large psr567 gene family. Plant Mol Biol 65:93–106
Collinge DB, Sarrocco S (2022) Transgenic approaches for plant disease control: status and
prospects 2021. Plant Pathol 71(1):207–225
Corredor-Moreno P, Saunders DGO (2020) Expecting the unexpected: factors influencing the
emergence of fungal and oomycete plant pathogens. New Phytol 225:118–125
Diéguez MJ, Altieri E, Ingala LR (2006) Physical and genetic mapping of amplified fragment length
polymorphisms and the leaf rust resistance Lr3 gene on chromosome 6BL of wheat. Theor Appl
Genet 112:251–257
Dilawari R, Kaur N, Priyadarshi N, Kumar B, Abdelmotelb KF, Lal SK, Singh B, Tripathi A,
Aggarwal SK, Jat BS, Mehta S (2021) Genome editing: a tool from the vault of science for
engineering climate-resilient cereals. In: Harsh environment and plant resilience: molecular and
functional aspects. Springer, Cham, pp 45–72
Dong Y, Xu D, Xu X, Ren Y, Gao F, Song J, Jia A, Hao Y, He Z, Xia X (2022) Fine mapping of
QPm. caas-3BS, a stable QTL for adult-plant resistance to powdery mildew in wheat (Triticum
aestivum L.). Theor Appl Genet 10:1–7
Duplessis S, Cuomo CA, Lin YC, Aerts A, Tisserant E (2011) Obligate biotrophy features
unraveled by the genomic analysis of rust fungi. Proc Natl Acad Sci U S A 108:9166–9171
Elkot AFA, Chhuneja P, Kaur S, Saluja M, Keller B, Singh K (2015) Marker assisted transfer of two
powdery mildew resistance genes PmTb7A.1and PmTb7A.2from Triticum boeoticum (Boiss.)
to Triticum aestivum (L.). PLoS One 10:e0128297
Ellis JG, Lagudah ES, Spielmeyer W, Dodds PN (2014) The past present and future of breeding rust
resistant wheat. Front Plant Sci 5:641
Esse HP, Reuber TL, Does D (2020) Genetic modification to improve disease resistance in crops.
New Phytol 225:70–86
Fabre F, Rocher F, Alouane T, Langin T, Bonhomme L (2020) Searching for FHB resistances in
bread wheat: susceptibility at the crossroad. Front Plant Sci 11:731
FAOSTAT (2020) Rome. http://www.fao.org
Fernando WD, Oghenekaro AO, Tucker JR, Badea A (2021) Building on a foundation: advances in
epidemiology resistance breeding and forecasting research for reducing the impact of fusarium
head blight in wheat and barley. Can J Plant Pathol 1:32
Feuillet C, Travella S, Stein N, Albar L, Nublat A, Keller B (2003) Map-based isolation of the leaf
rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc
Natl Acad Sci U S A 100:15253–15258
Fones HN, Bebber DP, Chaloner TM, Kay WT, Steinberg G, Gurr SJ (2020) Threats to global food
security from emerging fungal and oomycete crop pathogens. Nat Food 1:332–342
Forrest K, Pujol V, Bulli P, Pumphrey M, Wellings C, Herrera-Foessel S, Huerta-Espino J, Singh R,
Lagudah E, Hayden M, Spielmeyer W (2014) Development of a SNP marker assay for
theLr67gene of wheat using a genotyping by sequencing approach. Mol Breed 34:2109–2118
Ganeva G, Georgieva V, Panaĭotova M, Stoilova TS, Balevska P (2000) The transfer of genes for
Brown Rust resistance from Aegilops umbellulata Eig. to wheat (Triticum aestivum L.) genome.
Genetika 36(1):71–76
Gebrewahid T, Zhang P, Zhou Y, Yan X, Xia X, He Z, Liu D, Li Z (2020) QTL mapping of adult
plant resistance to stripe rust and leaf rust in a Fuyu 3/Zhengzhou 5389 wheat population. Crop J
8. https://doi.org/10.1016/j.cj.2019.09.013
Goutam U, Kukreja S, Yadav R, Salaria N, Thakur K, Goyal AK (2015) Recent trends and
perspectives of molecular markers against fungal diseases in wheat. Front Microbiol 6:861
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 243
Gultyaeva E, Shaydayuk E, Gannibal P (2021) Leaf rust resistance genes in wheat cultivars
registered in Russia and their influence on adaptation processes in pathogen populations.
Agriculture 11:319
Gupta PK, Langridge P, Mir RR (2010) Marker-assisted wheat breeding: present status and future
possibilities. Mol Breed 26:145–161
Hane JK, Lowe RG, Solomon PS, Tan KC, Schoch CL (2007) Dothideomycete plant interactions
illuminated by genome sequencing and EST analysis of the wheat pathogen Stagonospora
nodorum. Plant Cell 19:3347–3368
Helguera M, Khan I, Kolmer J, Lijavetzky D, Zhong-qi L, Dubcovsky J (2002) PCR assays for the
Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring
wheat lines. Crop Sci 43:1839–1847
Herrera-Foessel S, Singh R, Huerta-Espino J, Rosewarne G, Periyannan S, Viccars L, Calvo-
Salazar V, Lan C, Lagudah E (2012) Lr68: a new gene conferring slow rusting resistance to
leaf rust in wheat. Theor Appl Genet 124:1475–1486
Hiebert CW, Thomas JB, Somers DJ, McCallum BD, Fox SL (2007) Microsatellite mapping of
adult-plant leaf rust resistance gene Lr22a in wheat. Theor Appl Genet 115:877–884. https://
maswheat.ucdavis.edu/
Huerta-Espino J, Singh R, Crespo-Herrera LA, Villaseñor-Mir HE, Rodriguez-Garcia MF,
Dreisigacker S, Barcenas-Santana D, Lagudah E (2020) Adult plant slow rusting genes confer
high levels of resistance to rusts in bread wheat cultivars from Mexico. Front Plant Sci 11:824
Islam MT, Gupta DR, Hossain A, Roy KK, He X, Kabir MR, Wang GL (2020) Wheat blast: a new
threat to food security. Phytopathol Res 2:1–13
Jamil S, Shahzad R, Ahmad S, Fatima R, Zahid R, Anwar M, Wang X (2020) Role of genetics
genomics and breeding approaches to combat stripe rust of wheat. Front Nutr 7:173
Katoch S, Sharma V, Sharma D, Salwan R, Rana SK (2022) Biology and molecular interactions of
Parastagonospora nodorum blotch of wheat. Planta 255(1):1–18
Klymiuk V, Yaniv E, Huang L (2018) Cloning of the wheat Yr15 resistance gene sheds light on the
plant tandem kinase-pseudokinase family. Nat Commun 9:3735
Koch A, Kumar N, Weber L, Keller H, Imani J, Kogel KH (2013) Host-induced gene silencing of
cytochrome P450 lanosterol C14α-demethylase–encoding genes confers strong resistance to
Fusarium species. Proc Natl Acad Sci U S A 110:19324–19329
Koch A, Biedenkopf D, Furch A, Weber L, Rossbach O, Abdellatef E et al (2016) An RNAi-based
control of Fusarium graminearum infections through spraying of long dsRNAs involves a plant
passage and is controlled by the fungal silencing machinery. PLoS Pathog 12:e1005901
Kolmer JA, Su Z, Bernardo A, Bai G, Chao S (2018) Mapping and characterization of the new adult
plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat. Theor Appl Genet 131:
1553–1560
Kumar A, Choudhary A, Kaur H, Aggarwal SK, Mehta S (2022a) Smut and bunt diseases of wheat:
biology, identification, and management. In: New horizons in wheat and barley research.
Springer, Singapore, pp 107–131
Kumar A, Choudhary A, Kaur H, Mehta S (2022b) A walk towards Wild grasses to unlock the
clandestine of gene pools for wheat improvement: A review. Plant Stress 3:100048
Kthiri D, Loladze AN, Diaye A, Nilsen KT, Walkowiak S, Dreisigacker S, Ammar K, Pozniak CJ
(2019) Mapping of genetic loci conferring resistance to leaf rust from three globally resistant
durum wheat sources. Front Plant Sci 10:1247
Lagudah ES, Krattinger SG, Herrera-Foessel S (2009) Gene-specific markers for the wheat gene
Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor Appl Genet 119:
889–898
Li J, Yang J, Li Y, Ma L (2020) Current strategies and advances in wheat biology. Crop J 8:879–
891
Li QY, Gao C, Li YK (2021a) Advances in genetic studies of black point disease in wheat. J Plant
Dis Prot 1:9
244 A. Kumar et al.
Li S, Zhang C, Li J, Yan L, Wang N, Xia L (2021b) Present and future prospects for wheat
improvement through genome editing and advanced technologies. Plant Commun 2:100211
Liu S, Wang X, Zhang Y, Jin Y, Xia Z, Xiang M, Huang S, Qiao L, Zheng W, Zeng Q, Wang Q
(2022) Enhanced stripe rust resistance obtained by combining Yr30 with a widely dispersed,
consistent QTL on chromosome arm 4BL. Theor Appl Genet 135(1):351–365
Mago R (2021) Genome improvement for rust disease resistance in wheat. In: Genome engineering
for crop improvement. Springer, Cham, pp 141–161
Mago R, Tabe L, Vautrin S (2014) Major haplotype divergence including multiple germin-like
protein genes at the wheat Sr2 adult plant stem rust resistance locus. BMC Plant Biol 14:379
Mandalà G, Tundo S, Francesconi S, Gevi F, Zolla L, Ceoloni C, D’Ovidio R (2019)
Deoxynivalenol detoxification in transgenic wheat confers resistance to Fusarium head blight
and crown rot diseases. Mol Plant-Microbe Interact 32:583–592
Mbinda W, Masaki H (2021) Breeding strategies and challenges in the improvement of blast disease
resistance in finger millet. A current review. Front Plant Sci 5:2151
McLaughlin JE, Darwish NI, Garcia-Sanchez J, Tyagi N, Trick HN, McCormick Dill-Macky R,
Tumer NE (2021) A lipid transfer protein has antifungal and antioxidant activity and suppresses
Fusarium head blight disease and DON accumulation in transgenic wheat. Phytopathology 111:
671–683
Mehta S, Singh B, Dhakate P, Rahman M, Islam MA (2019) Rice, marker-assisted breeding, and
disease resistance. In: Disease resistance in crop plants. Springer, Cham, pp 83–111
Mehta S, Lal SK, Sahu KP, Venkatapuram AK, Kumar M, Sheri V, Varakumar P, Vishwakarma C,
Yadav R, Jameel MR, Ali M, Achary VMM, Reddy MK (2020) CRISPR/Cas9-edited rice: a
new frontier for sustainable agriculture. In: New frontiers in stress management for durable
agriculture. Springer, Singapore, pp 427–458
Miedaner T, Juroszek P (2021) Climate change will influence disease resistance breeding in wheat
in Northwestern Europe. Theor Appl Genet 1:15
Milne RJ, Dibley KE, Schnippenkoetter W, Mascher M, Lui AC, Wang L, Lo C, Ashton AR, Ryan
PR, Lagudah ES (2019) The wheat Lr67 gene from the sugar transport protein 13 family confers
multipathogen resistance in barley. Plant Physiol 179:1285–1297
Nalam VJ, Alam S, Keereetaweep J, Venables B, Burdan D, Lee H, Shah J (2015) Facilitation of
Fusarium graminearum infection by 9-lipoxygenases in Arabidopsis and wheat. Mol Plant-
Microbe Interact 28:1142–1152
Narang D, Kaur S, Steuernagel B (2020) Discovery and characterisation of a new leaf rust resistance
gene introgressed in wheat from wild wheat Aegilops peregrina. Sci Rep 10:7573
Pal D, Kumar S, Bhardwaj SC, Devate NB, Patial M, Parmeshwarappa SKV (2022) Molecular
marker aided characterization of race specific and non-race specific rust resistance genes in elite
wheat (Triticum spp.) germplasm. Australas Plant Pathol 51:261–272
Pandurangan S, Workman C, Nilsen K, Kumar S (2021) Introduction to marker-assisted selection in
wheat breeding. In: Accelerated breeding of cereal crops. Humana, New York, pp 77–117
Panwar V, McCallum B, Bakkeren G (2013a) Endogenous silencing of P uccinia triticina pathoge-
nicity genes through in planta-expressed sequences leads to the suppression of rust diseases on
wheat. Plant J 73(3):521–532
Panwar V, McCallum B, Bakkeren G (2013b) Host-induced gene silencing of wheat leaf rust
fungus Puccinia triticina pathogenicity genes mediated by the Barley stripe mosaic virus. Plant
Mol Biol 81(6):595–608
Parlange F, Oberhaensli S, Breen J, Platzer M, Taudien S (2011) A major invasion of transposable
elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr
Genom 11:671–677
Pramanik D, Shelake RM, Kim MJ, Kim JY (2021) CRISPR-mediated engineering across the
central dogma in plant biology for basic research and crop improvement. Mol Plant 14:127–150
Prasad P, Siddanna S, Bhardwaj SC, Gangwar OP, Subodh K (2019) Rust pathogen effectors:
perspectives in resistance breeding. Planta 250:1–22
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 245
Prins R, Groenewald JZ, Marais G, Snape J, Koebner R (2001) AFLP and STS tagging of Lr19 a
gene conferring resistance to leaf rust in wheat. Theor Appl Genet 103:618–624
Qi T, Guo J, Peng H, Liu P, Kang Z, Guo J (2019) Host-induced gene silencing: a powerful strategy
to control diseases of wheat and barley. Int J Mol Sci 20:206
Rahman M, Sultana S, Nath D, Kalita S, Chakravarty D, Mehta S, Wani SH, Islam MA (2019)
Molecular breeding approaches for disease resistance in sugarcane. In: Disease resistance in
crop plants. Springer, Cham, pp 131–155
Randhawa MS, Bains NS, Sohu VS, Chhuneja P, Trethowan RM, Bariana HS, Bansal U (2019)
Marker assisted transfer of stripe rust and stem rust resistance genes into four wheat cultivars.
Agronomy 9:497
Rani R, Singh R, Yadav N (2019) Evaluating stripe rust resistance in Indian wheat genotypes and
breeding lines using molecular markers. C R Biol 342:154–174. https://doi.org/10.1016/j.crvi.
2019.04.002
Rasheed A, Gill RA, Hassan MU, Mahmood A, Qari S, Zaman QU, Wu Z (2021) A critical review:
recent advancements in the use of CRISPR/Cas9 technology to enhance crops and alleviate
global food crises. Curr Issues Mol Biol 43:1950–1976
Reddy I, Kottakota C, Belay Y, Dinoor A, Keller B, Ben-David R (2016) Identification and genetic
mapping of PmAF7DS a powdery mildew resistance gene in bread wheat (Triticum aestivum
L.). Theor Appl Genet 129. https://doi.org/10.1007/s00122-016-2688-0
Ren Y, Liu L, He Z, Wu L, Bai B, Xia X (2015) QTL mapping of adult-plant resistance to stripe rust
in a ‘Lumai 21 Jingshuang 16’wheat population. Plant Breed 134. https://doi.org/10.1111/
pbr.12290
Santillán Martínez MI, Bracuto V, Koseoglou E, Appiano M, Jacobsen E, Visser RGF (2020)
CRISPR/Cas9-targeted mutagenesis of the tomato susceptibility gene PMR4 for resistance
against powdery mildew. BMC Plant Biol 20:284
Sarrocco S, Esteban P, Vicente I, Bernardi R, Plainchamp T, Domenichini S, Puntoni G,
Baroncelli R, Vannacci G, Dufresne M (2020) Straw competition and wheat root endophytism
of Trichoderma gamsii T6085 as useful traits in the biocontrol of Fusarium head blight.
Phytopathology 111(7):1129–1136
Savary S, Willocquet L, Pethybridge SJ, Esker P, Mc Roberts N, Nelson A (2019) The global
burden of pathogens and pests on major food crops. Nat Ecol Evol 3:430–439
Simón MR, Börner A, Struik PC (2021) Fungal wheat diseases: etiology breeding and integrated
management. Front Plant Sci 12:671060
Singh S, Franks CD, Huang L (2004) Lr41 Lr39 and a leaf rust resistance gene from Aegilops
cylindrica may be allelic and are located on wheat chromosome 2DS. Theor Appl Genet 108:
586–591
Singh RP, Singh PK, Rutkoski J, Hodson DP, He X, Jørgensen LN, Huerta-Espino J (2016) Disease
impact on wheat yield potential and prospects of genetic control. Annu Rev Phytopathol 54:
303–322
Singh M, Mallick N, Chand S, Kumari P, Sharma JB, Sivasamy M, Jayaprakash P, Prabhu KV, Jha
SK, Vinod (2017) Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes
Lr19 and Lr24 in bread wheat variety HD2733. J Genet 96:951–957
Singh B, Mehta S, Aggarwal SK, Tiwari M, Bhuyan SI, Bhatia S, Islam MA (2019) Barley, disease
resistance, and molecular breeding approaches. In: Disease resistance in crop plants. Springer,
Cham, pp 261–299
Singh A, Mehta S, Yadav S, Nagar G, Ghosh R, Roy A, Chakraborty A, Singh IK (2022) How to
cope with the challenges of environmental stresses in the era of global climate change: An
update on ROS stave off in plants. Int J Mol Sci 23:1995
Singla J, Lüthi L, Wicker T, Bansal U, Krattinger SG, Keller B (2017) Characterization of Lr75: a
partial broad-spectrum leaf rust resistance gene in wheat. Theor Appl Genet 130:1–12
Stummer BE, Zhang X, Yang H, Harvey PR (2022) Co-inoculation of Trichoderma gamsii A5MH
and Trichoderma harzianum Tr906 in wheat suppresses in planta abundance of the crown rot
pathogen Fusarium pseudograminearum and impacts the rhizosphere soil fungal microbiome.
Biol Control 165:104809
246 A. Kumar et al.
Su Z, Bernardo A, Tian B, Chen H, Wang S, Ma H, Cai S, Liu D, Zhang D, Li T (2019) A deletion
mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat Genet 51:
1099–1105
Tomkowiak A, Skowrońska R, Buda A, Kurasiak-Popowska D, Nawracała J, Kowalczewski PŁ,
Pluta M, Radzikowska D (2019) Identification of leaf rust resistance genes in selected wheat
cultivars and development of multiplex PCR. Open Life Sci 14:327–334
Tyagi S, Kumar R, Kumar V, Won SY, Shukla P (2021) Engineering disease resistant plants
through CRISPR-Cas9 technology. GM Crops Food 12:125–144
Upadhyaya NM, Mago R, Panwar V, Hewitt T, Luo M, Chen J, Dodds PN (2021) Genomics
accelerated isolation of a new stem rust avirulence gene–wheat resistance gene pair. Nat Plants
7:1220–1228
Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C, Qiu JL (2014) Simultaneous editing of three
homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat
Biotechnol 32:947–951
Wang Z, Cheng J, Fan A, Zhao J, Yu Z, Li Y, Wang X (2018a) LecRK-V an L-type lectin receptor
kinase in Haynaldia villosa plays positive role in resistance to wheat powdery mildew. Plant
Biotechnol J 16:50–62
Wang W, Pan Q, He F, Akhunova A, Chao S, Trick H, Akhunov E (2018b) Transgenerational
CRISPR-Cas9 activity facilitates multiplex gene editing in allopolyploid wheat. CRISPR J 1:
65–74
Wang K, Gong Q, Ye X (2020) Recent developments and applications of genetic transformation
and genome editing technologies in wheat. Theor Appl Genet 133:1603–1622
Wang N, Fan X, He M, Hu Z, Tang C, Zhang S, Lin D, Gan P, Wang J, Huang X, Gao C (2022)
Transcriptional repression of TaNOX10 by TaWRKY19 compromises ROS generation and
enhances wheat susceptibility to stripe rust. Plant Cell 34(5):1784–1803
Watson A, Ghosh S, Williams MJ, Cuddy WS, Simmonds J, Rey MD, Hickey LT (2018) Speed
breeding is a powerful tool to accelerate crop research and breeding. Nat Plants 4:23–29
Wessels E, Botes WC (2014) Accelerating resistance breeding in wheat by integrating marker-
assisted selection and doubled haploid technology. S Afr J Plant Soil 31:35–43
Xu Z, Xu X, Gong Q, Li Z, Li Y, Wang S, Yang Y, Ma W, Liu L, Zhu B (2019) Engineering broad-
spectrum bacterial blight resistance by simultaneously disrupting variable TALE-binding
elements of multiple susceptibility genes in rice. Mol Plant 12:1434–1446
Yin K, Qiu JL (2019) Genome editing for plant disease resistance: applications and perspectives.
Philos Trans R Soc Lond Ser B Biol Sci 374:20180322
Zatybekov A, Genievskaya Y, Rsaliyev A, Maulenbay A, Yskakova G, Savin T, Abugalieva S
(2022) Identification of quantitative trait loci for leaf rust and stem rust seedling resistance in
bread wheat using a genome-wide association study. Plan Theory 11(1):74
Zhang Y, Bai Y, Wu G, Zou S, Chen Y, Gao C, Tang D (2017) Simultaneous modification of three
homoeologs of TaEDR1 by genome editing enhances powdery mildew resistance in wheat.
Plant J 91:714–724
Zhang Y, Yang Z, Ma H, Huang L, Ding F, Du Y, Ma Z (2021) Pyramiding of Fusarium head blight
resistance quantitative trait loci Fhb1 Fhb4 and Fhb5 in modern Chinese wheat cultivars. Front
Plant Sci 5:12
Zhang Q, Li Y, Li Y, Fahima T, Shen QH, Xie C (2022) Introgression of the powdery mildew
resistance genes Pm60 and Pm60b from Triticum urartu to common wheat using durum as a
‘bridge’. Pathogens 11(1):25
Zhou XL, Wang WL, Wang LL, Hou DY, Jing JX, Wang Y (2011) Genetics and molecular
mapping of genes for high-temperature resistance to stripe rust in wheat cultivar Xiaoyan 54.
Theor Appl Genet 123:431–438
12 The Role of Genetic, Genomic, and Breeding Approaches in the Fight... 247
Zhu X, Qi T, Yang Q, He F, Tan C, Ma W, Guo J (2017) Host-induced gene silencing of the
MAPKK gene PsFUZ7 confers stable resistance to wheat stripe rust. Plant Physiol 175:1853–
1863
249
Disease Resistance Genes’Identification,
Cloning, and Characterization in Plants 13
Siddra Ijaz, Imran Ul Haq, Maria Babar, and Bukhtawer Nasir
Abstract
In plant-pathogen interactions, signal activation and transduction confer resis-
tance in plants against various pathogens. Communication between host and
pathogen is the prime step for a pathogen to cause infection. The molecular
basis of pathogen response in plants depends on the pathogen types. Hypersensi-
tive reactions usually result from Avr-R interactions that restrict pathogens’
development through cell death. These avr genes can be recognized directly
and indirectly by the resistance (R) gene. The NBS-LRR family is an important
resistance gene (R gene) family in plants, which is divided into subclasses.
Resistant gene analogues (RGAs) are candidates for R genes that have a signifi-
cant role in defense response against disease-causing pathogens and are classified
into two classes. The first class is based on the immediate recognition of a
pathogen called resistance genes (Rgenes), while the second class is based on
the defense response generated by recognition events. Hence, this chapter
attempts to delineate a comprehensive overview of resistance genes, their classes,
identification, and characterization in plants.
Keywords
Disease resistance · Rgenes · Resistance genes analogs · Plant-pathogen
interaction
S. Ijaz (*) · M. Babar · B. Nasir
Centre of Agricultural Biochemistry and Biotechnology (CABB), University of Agriculture
Faisalabad, Faisalabad, Pakistan
I. U. Haq
Department of Plant Pathology, University of Agriculture Faisalabad, Faisalabad, Pakistan
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_13
250 S. Ijaz et al.
13.1 Introduction
Microbes interact with plants in two ways: they are in a symbiotic relationship with
each other, or they invade to cause an infection that results in disease occurrence.
Generally, invaded pathogens alter plants’various metabolic pathways, develop-
mental stages, and reproduction cycles. Bacterial, fungal, viral, and nematode
diseases reduce crop health and productivity, resulting in significant financial losses
for agricultural landowners. Among different devastating pathogens, major plant
infections are caused by fungi, and approximately 80% of the causal agents of
various plant diseases are fungi (El Hussein et al. 2014). Plants have evolved several
defense systems to protect themselves against disease attacks (Seherm and Coakley
2003; Fujita et al. 2006).
Plants do not possess the adaptive immunity, usually exhibited by vertebrates, to
fight against pathogens. For efficient detection and prevention against pathogens,
plants rely on their genetic attributes (Chisholm et al. 2006). There are mainly two
mechanisms through which plants respond to pathogen invasion. The first one is the
basal defense, which primarily acts through the basal immune system. It was
described for the first time over 30 years ago (Albersheim and Anderson-Prouty
1975). The elicitors (mainly elongation factors), which generally indicate the
pathogen’s presence and help initiate the mechanism, include chitin,
lipopolysaccharides, hepta glucosides, or bacterial flagellins (Jones and Takemoto
2004). The second one has induced plant defense immunity, including pathogen-
triggered immunity (PTI) and effector-triggered immunity (ETI). PTI is activated by
PAMP (pathogen-associated molecular patterns) and plays a crucial role in the
activation of primary defense responses like stomata closure, ROS (reactive oxygen
species) generation, and the initiation of transcription processes of particular genes
involved in the defense mechanism. ETI is stimulated by plant resistance genes
(R genes) by recognizing pathogenic factors.
Moreover, ETI is linked with plants’HR (hypersensitive response) (Mandadi and
Scholthof 2013; Yuan et al. 2021). Rgenes of plants are complementary to
Avirulence (Avr) genes products coded by pathogens. These avr genes can be
recognized, directly as well as indirectly, by the resistance gene products. The
guard and decoy hypothesis perturbs the adaptive immune system components due
to the Avr gene products, separate from the R proteins. The resistance genes
(Rgenes) are activated by perturbation, which acts as a trigger. The avirulence
gene of Pseudomonas syringae (AvrPphB) is an example of protease involved in the
host protein kinase’s cleavage. Cognate R protein (RPS5) plays its role in detecting
this cleavage, resulting in its activation (Ade et al. 2007; Dodds and Rathjen 2010;
Yuan et al. 2021). The MAMP (microbe-associated molecular patterns) receptors are
relatively heritable as well as stable, so the diversification and selection are
employed on the adaptive immune system’s components in individuals’somatic
cells, giving rise to a constant coevolution of plants and pathogens (Bent and
Mackey 2007). The chapter covers the basics of resistance (R) genes, their
classifications, and their role in disease resistance. It also emphasizes the
identification, characterization, and cloning of numerous Rgenes and RGAs in
several crop species to combat harmful infectious diseases.
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 251
13.2 Resistance Genes
Resistance (R) genes are categorized into various classes. Nucleotide-binding leu-
cine-rich repeats (NBS LRR/NLR) are the most significant type of Rgene (Van
Ooijen et al. 2007). Phylogenetic analysis of the NBS gene was reassembled by an
extensive study of resistance gene analogs (RGAs) available in various genomes and
NBS domains (Pan et al. 2000). Depending on the presence or absence of multiple
domains at the N-terminal (amino-terminal) region, NL proteins are classified into
two subclasses; the Toll/ interleukin receptor-nucleotide-binding site-leucine-rich
repeats (TIR-NBS-LRR/TNL) and coiled-coil nucleotide-binding site-leucine-rich
repeats (CNL). In a phylogenetic analysis, TNL and CNL formed discrete clades
(McHale et al. 2006).
The first group of NBS domain of Rgenes contains TIR sequence in the
N-terminal region (TNL) that is extensively distributed in dicot species of plants.
In contrast, the second group is always associated with the CC domain in their amino
terminal region (CNL) and is widely distributed in angiosperms. CNL and TNL are
based on the N-terminal region, and their distribution in plant species is not in the
same ratio. The absence of TNL among monocotyledonous species is the most
prominent example. The genomes of A. lyrate, soybean, and A. thaliana contain
two to three folds more TNL than CNL genes. However, potato and Medicago
truncatula have a more significant number of CNL genes in their genome (Kang
et al. 2012). Both TNL and CNL classes are comprised of the members who undergo
the mechanism of alternative splicing. In animals, alternative splicing of TIR
receptors is commonly accruing. For instance, the splicing of mouse TIR receptor,
i.e., TLR4 variants, is the part of the regulatory mechanism that inhibits the exces-
sive responses to bacterial lipopolysaccharide (Jordan et al. 2002).
13.3 NBS-LRR Class of RGenes in Plants
NBS-LRR are categorized into TNL and CNL (Hammond-Kosack and Jones 1997).
TNLs are solely found in dicotyledonous plants, while CNLs are found in both
monocotyledonous and dicotyledonous plants (Jacob et al. 2013). These two classes
of NBS-LRR are distinct due to N terminal domains. LRR domain plays a vital role
in protein-protein interaction (Martin et al. 2003) and recognizing various patho-
genic avr proteins. Like LRR, NBS domains are very conserved and have the
potential of binding with GTP or ATP. The P-loop sub-domain plays a vital role
in binding nucleotides with protein. The operating range of NLRs increases when it
gets translocated to some unlinked locus (Wu et al. 2017). NLRs get activated when
their interaction occurs with pathogen effectors, which makes them quite helpful in
detecting and controlling pathogens in various crops and various plant species.
252 S. Ijaz et al.
Proteins containing the NBS-LRR (NLR) domain have a variable N-terminal
domain (~200 amino acids), NBS domain (~300 amino acids), and LRR domain
(10–40 short leucine-rich repeats) (Young 2000; Kang et al. 2005). The accessibility
to plant genome sequences has encouraged scientists to identify and characterize NL
encoding genes and RGAs in various plants and crops genomes to protect them
against pathogens. Several hundred NL encoding genes have been investigated in
alfalfa (Medicago sativa), Arabidopsis thaliana, grapevine (Vitis vinifera), rice
(Oryza sativa), Medicago species, soybean (Glycine max), and chickpea (Cicer
arietinum) (Zhou et al. 2004; Tan et al. 2007; Moroldo et al. 2008; Porter et al.
2009) using molecular biology and computational biology techniques..
NLR is the largest class of Rgenes, having conserved domains (Yue et al. 2012).
Out of 150 cloned RGAs, 80% encodes these conserved domains (Guo et al. 2016).
Resistance genes (Rgenes) are categorized into four structurally discrete classes.
Serine-threonine kinase protein is the first class among these classes, which phos-
phorylate the ser/thr residues and control signaling networks (Ellis et al. 2000). The
second class of Rgenes comprises putative transmembrane receptors along with the
extracellular LRR domain (Chakraborty et al. 2019). The third class of Rgenes
encodes receptors like kinase protein possessing the first- and second-class
properties.
Moreover, the fourth class belongs to the NLR associated either with the CC
domain or the TIR domain at N terminus, which exhibits significant plant disease
resistance against pathogen. LRR domain involves recognizing pathogen specificity
through ligand-binding and protein-protein interaction (Ellis et al. 2000). The
interaction between distinct R proteins and other proteins acting downstream in
the cascade is altered by nucleotide triphosphate-binding. LRRs play a vital role in
protein-protein interactions, which are highly adaptable structural domains, and are
involved in recognizing multiple pathogenic avr proteins (Bent 1996; Jones and
Dangl 2006).
NBS-LRR class is categorized into TNL and non-TNL types on the basis of
amino terminal region. TNL type of NBS-LRR class possesses domain homologs to
the interleukin-1 receptor and toll receptors; on the contrary, non-TNL types of
NBS-LRR class have coiled-coil protein commonly known as CC-NBS-LRR
(Meyers et al. 2003). The interleukin-1 receptor domain is involved in pathogen
detection, while the coiled-coil domain is associated with protein-protein interaction.
The nucleotide-binding site domain consists of kinases (2a and 3a), P-loop, and
hydrophobic GLPL motif. LRR domain interacts with pathogens directly or indi-
rectly. These conserved Rgene domains have been used to design the primer to
identify and screen resistant gene analogs (RGAs) within or related crops (Kanazin
et al. 1996).
The conserved domain of resistance genes (Rgenes) is part of the superfamily
known as STAND with ATPase activity. To maintain the close conformation, the
conserved domain of NB-ARC interacts with both its N and C-terminal. To get
activated, the leucine-rich repeat must separate from the nucleotide-binding site
domain. After separation, the conserved domain of NB-ARC modifies its state
from ADP nucleotides to an ATP nucleotide to allow the rotation within the
NB-ARC domain that leads to an open conformation. It allows the amino terminal
region to get exposed (Leipe et al. 2004; Takken and Goverse 2012). The effector
recognition specificity depends on the leucine-rich domain (LRR), which ensures the
coevolution with the pathogen effector under diversifying selection. Some other
conserved motifs have also been recognized and characterized in the available NL
conserved domains, which form the R proteins, nucleotide-binding adaptor shared
by APAF-1 (apoptotic protease activating factor 1), and CED-4 (C. elegans Death-4)
in the NB-ARC domain. The presence of ARC1 and ARC2 subunits was revealed
during functional analysis of the NB-ARC domain (Qi et al. 2012).
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 253
The conserved nucleotide-binding site domains are associated with signaling, and
they contain several conserved domains as well as motifs, including P-loop (also
known as a kinase-1a motif or Walker A motif), kinase-2 domain (also called Walker
B), and GLPL motifs (Tan and Wu 2012). Among these essential motifs of the NBS
region, the ATP/GTP-binding loop (P-loop)/Walker A/Kinase-1a motif has a pivotal
role. This motif is consisted of a glycine (Gly)-rich, flexible loop and also has lysine
(Lys) residues that allow binding to the phosphate group of nucleotides (Saraste et al.
1990). The ATP hydrolysis is governed by the coordination of threonine or serine
(Thr/Ser) residues with the magnesium ion ATP (Mg
+2
ATP) and coordination of
positively charged primary amine (ε-amino group) of Lys residue with beta and
gamma phosphates (β–and γ–phosphates) of ATP (Cremo et al. 1989). Therefore,
the classical signature sequence of the Walker A motif is (G/A)(4X)GK(T/S), where
“X”is for any amino acid. The P-loop motif is essential in plant defense signaling
(Hishida et al. 1999). A mutation study at the P-loop motif predicted that any
substitution in Lys-residues reduces or even loses ATP-binding and ATP hydrolysis
(Tameling et al. 2002). Moreover, ATP-binding (or ATPase activity) is the general
recognition feature of the NBS site. LRRs are involved in protein interactions, which
are highly adaptable structural domains, and they can evolve different binding
specificities. At the level of predicted solvent-exposed residues, the leucine-rich
repeats are under differentiating selection. In this region, these conserved domains
lack conservation property and are more diverse than random genetic drift. (Ellis
et al. 2000; Jones and Dangl 2006). It proposes that the emergence of new pathogen
specificities is promoted by selective pressures to recognize different pathogenic Avr
proteins.
The NL class of Rgenes confers a hypersensitive response in viral diseases,
showing its resistance potential against them (Hull 2002). In extreme resistance, the
multiplication of viral pathogen is constrained to a single cell level where necrotic
lesions do not appear at the site of primary infection. The extreme resistance feature
is showed in Solanum tuberosum, where Rx genes (CNL) resist Potato Virus X
(Sekine et al. 2008). In A. thaliana, HRT gene-mediated resistance against TCV
(Turnip CrinkleVirus) is an example of HR resistance. The type of resistance
determines the Rgenes’expression level. In A. thaliana, the overexpression of
RCY1, which confers resistance against CMV (Y), is an allelic form of hypersensi-
tive response to the TCV extreme-resistance phenotype (Sekine et al. 2008).
For NLR proteins, the induction of alternative splicing of variants upon pathogen
recognition has also been observed in plants. This observation suggested that the
variant’s alternative splicing may involve the defense mechanism’s regulatory
process (Jordan et al. 2002). Several transcripts have been identified for TNL
encoding proteins. The TNL encoding genes identified in various plants species
include RPP5, RAC1, and RPS4 in Arabidopsis (Parker et al. 1997), L6 gene in flax
(Linum usitatissimum) (Ayliffe et al. 1999), N gene against Tobacco Mosaic Virus in
tobacco (Nicotiana tabacum) (Marathe et al. 2002), and Y-1 and Bs4 genes in potato
(Solanum tuberosum) and tomato (Solanum lycopersicum), respectively (Vidal et al.
2002; Schornack et al. 2004).
254 S. Ijaz et al.
Regardless of the specificnature of interactions among pathogens’avirulence
gene and Rgenes of plants, no distinct specificities are present in reactions of NL
proteins against any specific pathogen. The allelic forms residing at the same NLR
locus provide resistance to various disease-causing microbial strains, even though
the strains belong to different classes. Three proteins of A. thaliana, i.e., RPP8,
RCY1, and HRT, are encoded by multiple alleles residing at a single locus. RPP8
protein confers resistance against oomycetes, while RCY1 and HRT resist viral
pathogen. Similarly, there are two highly alike proteins, the Rx protein of potato and
Gpa2 (Globodera pallida 2) protein, but the potato Rx protein recognizes a virus, and
Gpa2 protein recognizes a nematode (Van der Vossen et al. 2003).
In NBS conserved domain, the P-loop motif is a prerequisite for nucleotide-
binding. Moreover, any mutation or alteration in the P-loop motif leads to loss of
NBS-LRR protein functionality (Williams et al. 2011). Mutations determine the
auto-activation of NBS-LRR protein in the MHD (Met-His-Asp) motif present in the
ARC2 subunit, which involves nucleotide-dependent conformational changes (Van
Ooijen et al. 2008). The coiled-coil domain exclusively triggers the cell-death
response in CNL protein. In Arabidopsis, three proteins (RPS5, RPM1, RPS2) resist
P. syringae Pv Maculicola 1 attack and activate the ADR1 (disease resistance 1)
gene. The locus A10 gene resists barley mildew disease in barley, and in Nicotiana
benthamiana, NRG1 genes resist TMV infection (Collier et al. 2011).
13.4 Resistance Gene Analogs (RGAs)
Resistance gene analogs (RGAs) are candidates of Rgenes having conserved motifs
and conserved domains. RGAs can be categorized into NBS-LRR and TM-LRR
(transmembrane leucine-rich repeat). NBS-LRR are complex Rgene families which
alter their state from ADP to ATP on occurrence with pathogen effector. NLR is
present in the cytoplasm; however, LRR is positioned on the C-terminal, recognizing
different effectors. A homology region is present between these domains, ARC, i.e.,
APAF1, resistance (R) proteins, and CED4 (C. elegans Death-4) domain. The
functional characterization revealed the presence of ARC1 and ARC2 subunits.
Structurally, ARC1 is a four-helix bundle, while ARC2 forms a winged-shaped
helix bundle. ADP-binding occurs through four water-mediated and eight direct
interactions between ARC1 and ARC2 subunits (Riedl et al. 2005). Conserved
motifs including P-loop, kinase-2 motif, and kinase-3a motif are present in NB site
of P-loop NTPase (Walker et al. 1982; Traut 1994). The lysine residue in the Walker
A motif helps in the coordination of βand γphosphate inbound NTP. In comparison,
the first Asp residue of Walker B helps in Mg
2+
ion coordination at the catalytic site,
while the second residue plays the role of the catalytic base in ATP hydrolysis.
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 255
13.5 Resistance Genes in Cereals
A large group of microbes, including bacteria, fungi, viruses, and nematodes, are
responsible for causing infectious diseases in cereal crops like wheat, sorghum,
barley, and maize. Every year, farmers face huge economic losses due to the
pathogen attack. Numerous Rgenes have been identified and characterized for
long-term disease management from wheat, maize, barley, and rice. NLR not only
recognizes and provides resistance against bacteria and fungi, but also against
nematodes and viruses. In maize, Rp1-D and Rp3 genes encode NL and confer
resistance against leaf rust disease caused by Puccinia sorghi, while the Hm1 gene
encodes HC toxin reductase, which resists Southern corn leaf blight disease caused
by Cochliobolus carbonum. In barley, Mla1 and Mla6 encode NL, which resists
Blumeria graminis, which is responsible for powdery mildew disease.
Additionally, the Rpg1 gene encodes protein kinase, which helps provide resis-
tance against Puccinia graminis (causal agent of stem rust disease in barley). Lr21,
Lr10, and Pm3 genes have been identified in wheat which encodes NL. The former
two genes confer resistance against Puccinia triticina (causal agent of leaf rust
disease), while the latter one helps resist Blumeria graminis. In rice, Xa21 and
Xa26 encode receptor kinases that play an imperative role in the defense mechanism
against Xanthomonas oryzae, responsible for bacterial blight. However, Pi-b and
Pi-ta encode NL genes which help in conferring resistance against Magnaporthe
grisea, a fungal pathogen responsible for rice blast (Ayliffe and Lagudah 2004).
13.6 Resistance Genes’Identification, Cloning,
and Characterization
Disease-resistant genes are identified by their degree of expression in the defense
response and their ability to boost the defense mechanism (Wang et al. 2010). The
proteins of disease-resistant genes encode structural proteins (which assimilated into
the extracellular space that contribute to the confinement of pathogen), secondary
mechanism enzymes, regulatory genes (that control the expression level of defense
response genes), as well as the catalases, chitinase, or peroxidase, etc. enzymes that
are directly involved in defense mechanisms (Dixon and Harrison 1990). According
to structural and functional similarities and the presence of conserved regions,
sequencing of identified R-genes has revealed signal transduction and protein-
protein interaction in specific conserved domains (Gassmann et al. 1999).
NBS-LRR conserved domains are present in most of the genes. For example,
CLASS-1 includes the Prf gene in tomato (Solanum lycopersicum), N in tobacco
(Nicotiana tabacum), RPS2 and RPMI of Arabidopsis, and L6 gene of flax (Linum
usitatissimum) which encode cytoplasmic receptor containing an LRR and NBS
domain. Class-II includes CF2, CF4, CF5, and CF9 of S. lycopersicum resistant to
different Cladosporium fulvum. Class-III includes Xa21 of O. sativa resistant to
bacterial pathogens and Xanthomonas oryzae pv oryzae with an extracellular LRR
domain and an intracellular serine kinase domain. Class-IV includes the Pto gene of
Solanum lycopersicum resistant to Cochliobolus fuluvm, and the Hml gene in maize
(Zea mays) encodes functional HC toxin reductase domain. Cloning and characteri-
zation of RGAs are based upon different strategies like map-based positional
cloning, homology-based degenerate primers, and transposon tagging, which have
exposed the amino acid domains with extensive sequence homology (Madsen et al.
2003).
256 S. Ijaz et al.
In various crops and plant species, multiple RGAs have been identified against
different pathogens. A study conducted by Liang et al. (2005) revealed the identifi-
cation and characterization of RGAs in peach (Prunus persica L.) against peach
scab. The identified and isolated resistant gene analogs in peach provide the basis for
studying the genes involved in conferring resistance in peach and other closely and
distantly related species (Liang et al. 2005). Wan et al. (2012) proposed a research
study to isolate potential NBS type Rgene in sweet pepper. Degenerate primers
identified the resistant gene analogs (RGAs) from conserved GLPL, P-loop, and
NBS regions. Of 78 RGAs, 51 RGAs encoded conserved kinase-2a, P-loop, GLPL
motifs, and some previously identified resistant (R) genes from tomato and
Arabidopsis. The phylogenetic tree grouped the identified pepper RGAs into TIR
and non-TIR clusters, and their findings fully support that both these types are
widely present in dicot plants. Analysis of qRT-PCR revealed that abscisic and
salicylic acids change the expression of identified RGAs, ultimately suggesting their
involvement in plant defense response by activating signaling cascades.
Subcellular localization is imperative for R protein functionality, and various R
proteins are localized in the nucleus and the cytoplasm. In barley, Bai et al. (2012)
showed that the activity of MLA10 in a nucleus is suppressed to cell-death
signalings, while in a cytoplasmic location, it is observed to be enhanced. Sufficient
MLA10 is present in the cytoplasm; the enforced retaining in the cytoplasm has
strengthened MLA10 function in cell-death signaling. Particular intramolecular and
intermolecular interactions are linked to the role of MLA10 residing in the nucleus.
The latest study has also disclosed that a rod-shaped homodimer is formed through
the CC domain of MLA in solution. The same study also revealed that a minimal
functional unit is mainly defined by MLA dimers, ultimately responsible for trigger-
ing cell-death response in tobacco and barley plants (Maekawa et al. 2011). In maize,
identified RGAs are involved in flavone biosynthesis pathway with the trait loci and
show resistance against maize disease like corn earworm. The locus of p1 in maize
codes for transcriptional activator with three other RGAs accounts for 76% of
phenotypic changes for developing resistance against the pathogen (Zhang et al.
2003).
R-genes belonging to NL conserved domains have displayed a significant level of
sequence homology compared to other classes of RGAs, and during evolution, these
genes indicated the possible gene duplication. Eighty-eight (88) Rgenes, identified
in sugarcane (Saccharum officinarum), represent three influential groups: NBS/LRR
domain, LR repeats, or S/T KINASE domains. Sequential association of two
NBS/LRR RGAs clusters in Oryza sativa and Zea mays also showed orthologs’
polyphyletic origins. This present information suggested that paralogous RGAs in
Saccharum officinarum have a more considerable degree of divergence than that
from an ortholog in a distant species (Rossi et al. 2003). Dicot Rgenes showed
shared motifs on peptide sequence comparisons, but monocot showed no evidence
for shared motifs in a specific signature.
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 257
RGAs mapping revealed linkage to the identified and characterized resistance (R)
genes which ensured the presence of mixed clusters. This investigation of identified
R-genes showed nonsystemic mapped locations between cereals like foxtail millet
(Setaria italica), rice (Oryza sativa), and barley species (Leister et al. 1998). The
study implies the rearrangement of Rgene loci, suggesting various NBS and LRR
mechanisms for Rgene evolution compared with other monocot genomes. A string
of 6 conserved motifs is shown by comparing 25 genes segments of NL encoding
resistant genes from O. sativa. The mapping of this gene in O. sativa showed linkage
to Rgenes. The genes (Xa1, Xa3, and Xa4) showed race-specific resistance against
rice blight disease. Barley RGAs also showed linkage with powdery mildew and
rust-resistant genes (Leister et al. 1999).
Seah and his colleagues isolated NL gene sequences at the Cre3 locus in wheat
(Triticum aestivum) and barley (Hordeum vulgare) using specific primer pairs.
These sequences showed the resistance against cereal cyst nematode disease of
wheat (Seah et al. 1998). It revealed that RGAs of Hordeum vulgare and Triticum
aestivum contain some conserved motifs in identified Rgenes of various crops. At
the Cre3 locus, 55–99% protein sequences showed similarity with NBS-LRR
conserved domain. Mapping of barley-derived RGAs on chromosome 2H loci
(Sharma et al. 2005), 5H (Whitham et al. 1994), and 7H (Liu et al. 2007) was linked
to the resistance against CNN and CLA (corn leaf aphids). Sixty cloned fragments
were analyzed by Southern blot during amplification of RGAs from Asian gall
midge-resistant rice line (Mago et al. 1999) and characterized into 14 categories.
Twelve clones were then mapped onto five diverse rice chromosomes with a
significant cluster of eight RGAs on chromosome XI. This work indicates that insect
and disease resistance genes shared common conserved NBS-motifs.
In the rice genome, scientists selected 68 nonredundant clones of sequences
homology to the known Rgene. They mapped 15 clones on 17 loci on chromosome
numbers III, IV, XI, and XII mapped in the rice (Oryza sativa). The mapped clones’
loci correlate with rice Rgene against rice blast and blight resistance on
chromosomes XI and XII, and some occurred in clusters on chromosome III,
which showed correlation with bacterial leaf blight resistance (BLB) (Wang and
Xiao 2002). Mohler et al. (2002) also found an association with disease resistance in
Triticeae during mapping. In O. sativa and H. vulgare, powdery mildew resistance
genes linked to Pin17 and Mlal were also observed. All RGAs classes were mapped
in the genome of Hordeum vulgare using PCR-based marker techniques, including
RFLP. Moreover, these identified RGAs were near the previously identified disease
resistance loci in H. vulgare and various cereals. In Dioscorea alata, Saranya and his
colleagues identified and characterized the Rgenes against Anthracnose disease by
PCR (Saranya et al. 2016).
258 S. Ijaz et al.
For testing the association of disease resistance as molecular markers in rice
against blast, brown planthopper (BPH), sheath blight (SB), and bacterial blight
(BB), the candidate genes are involved in putative defense response experimenta-
tion. Scientists derived one hundred eighteen (118) molecular markers from
identified resistance gene analogs (RGAs) and putative disease-resistant genes of
Zea mays,Hordeum vulgare, and Oryza sativa (Ramalingam et al. 2003). Upon
hybridization, several identified RGAs and disease-resistant genes identified a locus
with different copy numbers and mapped mostly on chr11 of O. sative. Several
known blasts and bacterial leaf blight (BLB)-resistant genes were present. The
candidate resistance genes and disease-resistant genes’molecular markers were
mainly associated with the pathogen’s quantitative trait loci (QTLs).
In Zea mays, 11 non-cross hybridizing sequences of resistance gene analogs with
NL proteins’identity were identified (Collins et al. 1998). These identified RGAs of
Zea mays and one RGA of wheat were used to probe for mapping twenty (20) RFLP
loci in Z. mays. Few of these loci were mapped to fungal and viral resistance genes
regions —the identified RGAs co-segregate with maize rust resistance loci, rp1 and
rp3. The study results revealed that the RGA probe linked with (rp1) maize rust
resistance loci could identify rp1 mutants in Z. mays.
The NBS-LRR conserved domain possesses resistance potential against various
disease-causing pathogens. By computational biology, 104 NBS-LRR genes were
identified and characterized in chickpea (Sharma et al. 2017). Phylogenetic analysis
analyzed the deduced RGAs of chickpea and their divergence into TNL and
non-TNL types. In silico promoter analysis analyzed four cis-regulatory elements,
i.e., GCC, DRE, WBOX, and CBF boxes, found in the promoter regions of identified
NBS-LRR genes of chickpea. Similarly, Hussain et al. (2020) classified and
characterized 3085 Rgenes in Gossypium arboreum, 3024 in Gossypium hirsutum,
and 5355 genes in Gossypium raimondii cotton species by computational biology
tool. The in silico analysis of promoter elements predicted that the cis-regulatory
elements were present in different NBS-LRR classes of Rgenes in these cotton
species.
RGAs were identified in wheat (Triticum aestivum) for developing disease-linked
molecular markers (Xie et al. 2008). RGA 200 and RGA390 markers were identified
closely associated with Pm31 (powdery mildew Rgene) and utterly co-segregated
with Xpsp3029 (marker allele) linked to Pm31, with a genetic distance of 0.6 cM.
RGAs were also used for molecular markers, so, in Triticum aestivum, these two
identified RGAs (RGA200 and RGA 390) were then incorporated into the previ-
ously developed microsatellite map of the Pm31 region. Previous literature identified
and functionally validated the importance of conserved Rgenes’domains in plant-
pathogen interaction (Grund et al. 2019). WRKY domain, present at the C terminal
of NBS from the RPS4 complex, is involved in the detection of AvrRps4 and
activation of defense mechanism (Sarris et al. 2015). The WRKY domain is
comprised of BLR genes that confer resistance against rust diseases in Triticum
aestivum (Wang et al. 2020).
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 259
Previous research studies support that Rgenes are involved in resistance to
significant pathogenic diseases. Lv et al. (2020) identified and characterized
Rgenes in Brassica napus to improve resistance against Sclerotinia stem rot,
clubroot, downy mildew, and Blackleg fungal diseases. Additionally, different
identified Rgenes have been used in resistance breeding programs. The eIF (iso)
4E variant transferred into Brassica rapa under turnip mosaic virus challenge; as a
result, broad-spectrum resistance was observed in transgenic plants (Kim et al.
2014).
The degenerate primers, designed from the conserved P-loop and GLPL regions
of NLR, were used to amplify the NBS region from the resistant chili genotype.
Naresh et al. (2017) researched to screen the chili genotypes against several viruses
from multiple virus-resistant genotypes, i.e., IHR 2451. Moreover, the alignment of
deduced protein sequence and phylogenetic analysis grouped conserved domains
into TIR and non-TIR clades and confirmed the conservation of kinase-2a, GLPL,
P-loop, and RNBS-A motif. Both TIR and non-TIR types are present in dicotyle-
donous plants. Identified resistant gene analogs (RGAs) showed conserved motif
subjected to Blastp, indicating homology with Rgenes such as the Pvr9 gene, which
exhibit resistance against potyvirus and RIB-23 gene homology with putative late
blight resistance protein (Naresh et al. 2017).
NBS profiling by PCR technique was performed to identify and map RGAs in
apple. Degenerate primers were synthesized from the conserved P-loop motif.
Identified RGAs were mapped on 10 (out of 17) linkage groups of apple genetic
maps residing near the QTL for resistance against mildew and apple scab diseases
(Calenge et al. 2005). In another research study, Zhang and colleagues identified and
characterized the Rgenes based on the NBS-LRR domain, RPW8 domain in
Dioscorea rotundata. It is an imperative crop in Africa and is commonly known
as yams and sweet potatoes. Different types of pathogens infected the crop during
their life span and reduced the quality and quantity of crops (Zhang et al. 2020). The
NBS profiling method was also accomplished in potato, tomato, and lettuce to
identify RGAs at their transcript level. Therefore, for the generation of the candidate
marker genes associated with resistant gene (R-gene) in crop plants, the NBS
profiling is a significant technique for identifying candidate Rgene that is transcribed
and functional in crop plants (Brugmans et al. 2008).
Resistance gene analogs were identified and characterized by sequence analysis
and reannotation analysis. Ren et al. (2020) conducted a research study to character-
ize the NBS genes under biotic and abiotic challenges in orchardgrass. The sequence
analysis showed that 17 NBS genes were expressed under abiotic challenges,
whereas 23 NBS genes were differentially expressed under rust challenges. Another
fungal disease in common beans (P. vulgaris) causes severe losses in the field. The
most effective practice for cultivating P. vulgaris is to use the resistant cultivars to
overcome disease losses. Vaz Bisneta and Gonçalves-Vidigal (2020) identified the
256 nucleotide-binding sites, LRR proteins, and 200 kinases proteins under the
fungal disease challenge.
NLR encoding genes are present in angiosperms; however, grasses and monocots
lack genes that encode TNL (McDowell and Simon 2006;Guo et al. 2011). The
absence of TNL class from monocots is hypothesized as loss or the failure to amplify
these genes in monocot lineage. Moreover, the absence of these genes in monocot
might be because of more dependence on CNL proteins than TNL proteins (Kim
et al. 2012). The downstream signaling pathways and disease resistance factors
differ for CNL and TNL classes (Glazebrook 2001). Mutation in genes encoding
for components involved in TNL pathways has caused the genomic shift to genes
encoding for CNL in monocots, ultimately resulting in loss of TNL gene functions
and conservative selection. It is hypothesized that due to lack of conservative
selection, genes encoding for TNL might have never amplified in monocot genomes
(Meyers et al. 2002).
260 S. Ijaz et al.
Dicots like Arabidopsis possess more TNL as compared to CNL (Yang et al.
2008). Along with TNLs and CNLs, various NBS encoding genes, including N, CN,
TN, and NL, are present, which vary in abundance. Many other NBS-LRR like
domains, including CNLX, CNXL, CXN, NLX domains in sorghum, CTN and
CTNL in apple, and TTNL, TN-TNL, XTNX in Arabidopsis, have been reported
(Chelkowski and Koczyk 2003; Cheng et al. 2010; Arya et al. 2014). Many TIR-X
RGAs have been reported in various plant genomes, including 67 in cottonwood,
126 in cabbage (Brassica oleracea var. capitata), 46 and 92 in Arabidopsis and
Medicago, respectively (Yu et al. 2014). Moreover, RLKs members, i.e., 1200 in
rice and 600 in Arabidopsis, were also identified (Dardick et al. 2007). RLKs have
been reported in wheat (Triticum aestivum), cottonwood (Populus deltoides), tomato
(Solanum lycopersicum), and maize (Zea mays) as well. In addition to RLKs, RLPs
(with TM domain) have been reported in tomato as well as in Arabidopsis.
Crop plants’whole-genome sequencing has aided in the mapping, identification,
and characterization of resistance gene analogues. These RGAs having conserved
NL domain have been assessed in crop plants, i.e., Arabidopsis, grape, apple, black
cottonwood, rice, wheat, Medicago, barley, and sorghum. The number of Rgenes
containing conserved domains has been recognized in crop plants against various
diseases (Radwan et al. 2008). The NL domain is highly conserved, evolutionarily
diverse, and assembled gene families, and it represents the primary class of Rgenes
in plants, which contribute to conferring resistance against deadly disease (Porter
et al. 2009). Some RGAs are identified as pseudogenes, which have been reported in
several plants, including rice (Oryza sativa) (Luo et al. 2012), potato (Solanum
tuberosum) (Lozano et al. 2012), Arabidopsis (Meyers 2003), lotus (Nelumbo
nucifera) (Li et al. 2010), Medicago (Ameline-Torregrosa et al. 2008), and cotton-
wood (Populus deltoides) (Kohler et al. 2008). Numerous RGAs have been
identified in many plant genomes (Table 13.1).
13.7 Conclusion
Phytopathogens are greatly responsible for various plant and crop diseases. The
deadly diseases significantly decrease crop productivity, affecting the economies of
agricultural countries. Over the decades, phytopathogens have evolved and devel-
oped numerous ways of attacking plants and overcoming plant defense mechanisms.
RGAs Plant Disease Pathogen References
(continued)
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 261
Table 13.1 Resistance gene analogues (RGAs) in different plant genomes
Sr
No.
1 MB-ClsRCaG1,
MB-ClsRCaG2,
MB-ClsRCaG3
Mungbean Cercospora
leaf spot
Cercospora
canescens
Babar et al.
(2021)
2 Rev1, Rev7,
Rev8, Rev11,
Rev12, Rev35,
Rev43, Rev45,
Rev67, Rev68,
Rev84
Chickpea Fusarium wilt Fusarium
oxysporum
Priyanka et al.
(2021)
3 RGA-012,
RGA-087,
RGA-118,
RGA-533,
RGA-542
Sugarcane Red rot Colletotrichum
falcatum
Parvaiz et al.
(2021)
4 PnRGA1,
PnRGA3,
PnRGA5,
PnRGA8,
PnRGA11,
PnRGA24
Black
pepper
(Piper
nigrum L.)
Phytophthora
foot rot
Phytophthora
capsici
Suraby et al.
(2020)
5 OLE 1121/1122
(RGA)
Apple Powdery
mildew
Podosphaera
leucotricha
Jamalvand
et al. (2020)
6 Rdr1 gene Roses Black spot Diplocarpon
rosae
Menz et al.
(2020)
7 RGA003,
RGA020,
RGA028,
RGA035,
RGA042,
RGA054,
RGA055,
RGA057,
RGA062,
RGA068,
RGA082,
RGA092,
RGA100,
RGA101a,
RGA106,
RGA121,
RGA140,
RGA144,
RGA162,
RGA199,
RGA201,
RGA206,
RGA207,
RGA235,
Peanut Leaf spot Cercospora
arachidicola
Dang et al.
(2019)
RGAs Plant Disease Pathogen
RGA240,
RGA250,
RGA260,
RGA265,
RGA270,
RGA286,
RGA304,
RGA314,
RGA315,
RGA321a,
RGA340,
RGA341,
RGA348,
RGA355,
RGA359
262 S. Ijaz et al.
Table 13.1 (continued)
Sr
No. References
8 RM1, RM6,
RM8, RM12 and
RM31
Cotton Cotton leaf
curl virus
Whitefly
Bemisia tabaci
Mushtaq et al.
(2018)
9 RGA1-RGA15 Sugarcane Red rot Colletotrichum
falcatum
Hameed et al.
(2015)
10 MNBS1-
MNBS17
Banana Fusarium wilt Fusarium
oxysporum
Sutanto et al.
(2014)
11 RGPM213 Pearl millet Downy
mildew
Sclerospora
graminicola
Ranjini et al.
(2011)
12 Rps1-k-1, Rps1-
k-2
Soybean Root and
stem rot
Phytophthora
sojae
Gao and
Bhattacharyya
(2008)
13 Ha-NTIR1-
Ha-NTIR12,
Ha-TIR3,
Ha-TIR14,
Ha-NTIR15
Sunflower Downy
mildew
Plasmopara
halstedii
Radwan et al.
(2003)
14 GLP1–12,
MHD145,
MHD98
Grapevine Powdery
mildew
Uncinula
necator
Donald et al.
(2002)
15 RGA1, RGA2 Common
bean
(Phaseolus
vulgaris)
Anthracnose Colletotrichum
lindemuthianum
López et al.
(2003)
16 RGA7 Common
bean
(Phaseolus
vulgaris)
Angular leaf
spot
Phaeoisariopsis
griseola
López et al.
(2003)
17 Xa21 Rice Rice bacterial
blight
Xanthomonas
oryzae
Song et al.
(1995)
This attribute of pathogens caused devastating effects on crop physiology and
production that ultimately resulted in systemic damage. Economic losses and crop
damage can be lessened through various crop management and disease control
strategies. Agriculturists have employed multiple strategies to overcome the situa-
tion. The usage of chemicals poses a negative impact on the environment as well as
on all living organisms. To overcome this problem, an eco-friendly, long-term, and
sustainable strategy should be designed. In this regard, identifying RGAs and their
characterization in different crops against various pathogens has opened new disease
management avenues. The knowledge of identified and characterized R genes in
plant species provides basic information on genetic and molecular mechanisms
involved in the regulation of gene resistance. Resistance gene analogues (RGAs)
are candidates for R genes possessing disease resistance potential. Among distinct
classes of resistance (R) genes, the most significant class is NBS LRR. NL proteins
are involved in conferring defense against fungal, bacterial, and viral infections.
Apart from NL, many different R genes have been identified that do not encode NBS
LRR, but possess resistance ability against the pathogen, e.g., Xa21 and X26 genes
in rice. Recently, numerous resistance genes have been identified in different crops
like mungbean (against Cercospora leaf spot), chickpea (against Fusarium wilt),
sugarcane (against Red Rot), and black pepper (against Footrot). The identified R
genes can be used to design degenerate primers, which can be further used to identify
R genes in diverse and distant species. In the future, using RGAs has made it
possible to reduce crop productivity losses by developing resistant varieties and
controlling diseases in a long-term way.
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 263
References
Ade J, DeYoung BJ, Golstein C, Innes RW (2007) Indirect activation of a plant nucleotide binding
site–leucine-rich repeat protein by a bacterial protease. Proc Natl Acad Sci U S A 104:2531–
2536
Albersheim P, Anderson-Prouty AJ (1975) Carbohydrates, proteins, cell surfaces, and the biochem-
istry of pathogenesis. Annu Rev Plant Physiol 26:31–52
Ameline-Torregrosa C, Wang BB, O'Bleness MS, Deshpande S, Zhu H, Roe B, Young ND,
Cannon SB (2008) Identification and characterization of nucleotide-binding site-leucine-rich
repeat genes in the model plant Medicago truncatula. Plant Physiol 146:5–21
Arya P, Kumar G, Acharya V, Singh AK (2014) Genome-wide identification and expression
analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in
Rosaceae. PLoS One 9:e107987
Ayliffe MA, Lagudah ES (2004) Molecular genetics of disease resistance in cereals. Ann Bot 94:
765–773
Ayliffe MA, Frost DV, Finnegan EJ, Lawrence GJ, Anderson PA, Ellis JG (1999) Analysis of
alternative transcripts of the flax L6 rust resistance gene. Plant J 17:287–292
Babar M, Ijaz S, Khan MS, Ul Haq I (2021) Computational genomics based probing of resistance
gene analogs (RGAs) in mungbean under cercospora leaf spot disease challenge. Pak J Agric Sci
58:1–14
Bai S, Liu J, Chang C, Zhang L, Maekawa T, Wang Q, Xiao W, Liu Y, Chai J, Takken FL, Schulze-
Lefert P (2012) Structure-function analysis of barley NLR immune receptor MLA10 reveals its
cell compartment specific activity in cell death and disease resistance. PLoS Pathog 8:e1002752
264 S. Ijaz et al.
Bent AF (1996) Plant disease resistance genes: function meets structure. Plant Cell 8:1757–1771
Bent AF, Mackey D (2007) Elicitors, effectors, and R genes: the new paradigm and a lifetime
supply of questions. Annu Rev Phytopathol 45:399–436
Brugmans B, Wouters D, van Os H, Hutten R, van der Linden G, Visser RG, van Eck HJ, van der
Vossen EA (2008) Genetic mapping and transcription analyses of resistance gene loci in potato
using NBS profiling. Theor Appl Genet 117:1379–1388
Calenge F, Drouet D, Denancé C, Van de Weg WE, Brisset MN, Paulin JP, Durel CE (2005)
Identification of a major QTL together with several minor additive or epistatic QTLs for
resistance to fire blight in apple in two related progenies. Theor Appl Genet 111:128–135
Chakraborty S, Nguyen B, Wasti SD, Xu G (2019) Plant leucine-rich repeat receptor kinase
(LRR-RK): structure, ligand perception, and activation mechanism. Molecules 24:3081
Chelkowski J, Koczyk G (2003) Resistance gene analogues of Arabidopsis thaliana: recognition by
structure. J Appl Genet 44:311–321
Cheng X, Jiang H, Zhao Y, Qian Y, Zhu S, Cheng B (2010) A genomic analysis of disease-
resistance genes encoding nucleotide binding sites in Sorghum bicolor. Genet Mol Biol 33:292–
297
Chisholm ST, Coaker G, Day B, Staskawicz BJ (2006) Host-microbe interactions: shaping the
evolution of the plant immune response. Cell 124:803–814
Collier SM, Hamel LP, Moffett P (2011) Cell death mediated by the N-terminal domains of a
unique and highly conserved class of NB-LRR protein. Mol Plant-Microbe Interact 24:918–931
Collins NC, Webb CA, Seah S, Ellis JG, Hulbert SH, Pryor A (1998) The isolation and mapping of
disease resistance gene analogs in maize. Mol Plant-Microbe Interact 11:968–978
Cremo CR, Grammer JC, Yount RG (1989) Direct chemical evidence that serine 180 in the glycine-
rich loop of myosin binds to ATP. J Biol Chem 264:6608–6611
Dang PM, Lamb MC, Bowen KL, Chen CY (2019) Identification of expressed R-genes associated
with leaf spot diseases in cultivated peanut. Mol Biol Rep 46:225–239
Dardick C, Chen J, Richter T, Ouyang S, Ronald P (2007) The rice kinase database. A
phylogenomic database for the rice kinome. Plant Physiol 143:579–586
Dixon RA, Harrison MJ (1990) Activation, structure, and organization of genes involved in
microbial defense in plants. Adv Genet 28:165–234
Dodds PN, Rathjen JP (2010) Plant immunity: towards an integrated view of plant–pathogen
interactions. Nat Rev Genet 11:539–548
Donald TM, Pellerone F, Adam-Blondon AF, Bouquet A, Thomas MR, Dry IB (2002) Identifica-
tion of resistance gene analogs linked to a powdery mildew resistance locus in grapevine. Theor
Appl Genet 104:610–618
El Hussein AA, Alhasan RE, Abdelwahab SA, Marmar A (2014) Isolation and identification of
Streptomyces rochei strain active against phytopathogenic fungi. Microbiol Res 7:1057–1068
Ellis J, Dodds P, Pryor T (2000) Structure, function and evolution of plant disease resistance genes.
Curr Opin Plant Biol 3:278–284
Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y, Yamaguchi-Shinozaki K, Shinozaki K
(2006) Crosstalk between abiotic and biotic stress responses: a current view from the points of
convergence in the stress signaling networks. Curr Opin Plant Biol 9:436–442
Gao H, Bhattacharyya MK (2008) The soybean-Phytophthora resistance locus Rps1-k encompasses
coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences. BMC
Plant Biol 8:1–4
Gassmann W, Hinsch ME, Staskawicz BJ (1999) The Arabidopsis RPS4 bacterial-resistance gene is
a member of the TIR-NBS-LRR family of disease-resistance genes. Plant J 20:265–277
Glazebrook J (2001) Genes controlling expression of defense responses in Arabidopsis—2001
status. Curr Opin Plant Biol 4:301–308
Grund E, Tremousaygue D, Deslandes L (2019) Plant NLRs with integrated domains: unity makes
strength. Plant Physiol 179:1227–1235
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 265
Guo YL, Fitz J, Schneeberger K, Ossowski S, Cao J, Weigel D (2011) Genome-wide comparison of
nucleotide-binding site-leucine-rich repeat-encoding genes in Arabidopsis. Plant Physiol 157:
757–769
Guo C, Sun X, Chen X, Yang S, Li J, Wang L, Zhang X (2016) Cloning of novel rice blast
resistance genes from two rapidly evolving NBS-LRR gene families in rice. Plant Mol Biol 90:
95–105
Hameed U, Pan YB, Iqbal J (2015) Genetic analysis of resistance gene analogues from a sugarcane
cultivar resistant to red rot disease. J Phytopathol 163:755–763
Hammond-Kosack KE, Jones JD (1997) Plant disease resistance genes. Plant Mol Biol 48:575–607
Hishida T, Iwasaki H, Yagi T, Shinagawa H (1999) Role of Walker motif A of RuvB protein in
promoting branch migration of Holliday junctions: Walker motif A mutations affect ATP
binding, ATP hydrolyzing, and DNA binding activities of RuvB. J Biol Chem 274:25335–
25342
Hull R (2002) Mathews’plant virology, 4th edn. Academic Press, New York
Hussain A, Farooq M, Naqvi RZ, Amin I, Pervaiz K, Saeed M, Asif M, Mukhtar MS, Mansoor S
(2020) Genome-wide identification and classification of resistance genes predicted several
decoy domains in Gossypium sp. Plant Gene 24:100250
Jacob F, Vernaldi S, Maekawa T (2013) Evolution and conservation of plant NLR functions. Front
Immunol 4:297
Jamalvand M, Sharifnabi B, Rahimi Tamandegani P, Ghaderi F (2020) Apple powdery mildew
resistance genes in Iranian wild apple genotypes. Iran J Plant Pathol 56(3):319–328
Jones JD, Dangl JL (2006) The plant immune system. Nature 444:323
Jones DA, Takemoto D (2004) Plant innate immunity–direct and indirect recognition of general and
specific pathogen-associated molecules. Curr Opin Immunol 16:48–62
Jordan T, Schornack S, Lahaye T (2002) Alternative splicing of transcripts encoding toll-like plant
resistance proteins–what’s the functional relevance to innate immunity? Trends Plant Sci 7:392–
398
Kanazin V, Marek LF, Shoemaker RC (1996) Resistance gene analogs are conserved and clustered
in soybean. Proc Natl Acad Sci U S A 93:11746–11750
Kang BC, Yeam I, Jahn MM (2005) Genetics of plant virus resistance. Annu Rev Phytopathol 43:
581–621
Kang YJ, Kim KH, Shim S, Yoon MY, Sun S, Kim MY, Van K, Lee SH (2012) Genome-wide
mapping of NBS-LRR genes and their association with disease resistance in soybean. BMC
Plant Biol 12:1–3
Kim J, Lim CJ, Lee BW, Choi JP, Oh SK, Ahmad R, Kwon SY, Ahn J, Hur CG (2012) A genome-
wide comparison of NB-LRR type of resistance gene analogs (RGA) in the plant kingdom. Mol
Cells 33:385–392
Kim J, Lee J, Choi JP, Park I, Yang K, Kim MK, Lee YH, Nou IS, Kim DS, Min SR, Park SU
(2014) Functional innovations of three chronological mesohexaploid Brassica rapa genomes.
BMC Genomics 15:1–5
Kohler A, Rinaldi C, Duplessis S, Baucher M, Geelen D, Duchaussoy F, Meyers BC, Boerjan W,
Martin F (2008) Genome-wide identification of NBS resistance genes in Populus trichocarpa.
Plant Mol Biol 66:619–636
Leipe DD, Koonin EV, Aravind L (2004) STAND, a class of P-loop NTPases including animal and
plant regulators of programmed cell death: multiple, complex domain architectures, unusual
phyletic patterns, and evolution by horizontal gene transfer. J Mol Biol 343:1–28
Leister D, Kurth J, Laurie DA, Yano M, Sasaki T, Devos K, Graner A, Schulze-Lefert P (1998)
Rapid reorganization of resistance gene homologues in cereal genomes. Proc Natl Acad Sci U S
A 95:370–375
Leister D, Kurth J, Laurie DA, Yano M, Sasaki T, Graner A, Schulze-Lefert P (1999) RFLP-and
physical mapping of resistance gene homologues in rice (O. sativa) and barley (H. vulgare).
Theor Appl Genet 98:509–520
266 S. Ijaz et al.
Li X, Cheng Y, Ma W, Zhao Y, Jiang H, Zhang M (2010) Identification and characterization of
NBS-encoding disease resistance genes in Lotus japonicus. Plant Syst Evol 289:101–110
Liang FS, Kong FN, Zhou CJ, Cao PX, Ye CJ, Wang B (2005) Cloning and characterization of a
non-TIR-NBS-LRR type disease resistance gene analogue from peach. DNA Seq 16:103–110
Liu J, Liu X, Dai L, Wang G (2007) Recent progress in elucidating the structure, function and
evolution of disease resistance genes in plants. J Genet Genomics 34:765–776
López CE, Acosta IF, Jara C, Pedraza F, Gaitán-Solís E, Gallego G, Beebe S, Tohme J (2003)
Identifying resistance gene analogs associated with resistances to different pathogens in com-
mon bean. Phytopathology 93:88–95
Lozano R, Ponce O, Ramirez M, Mostajo N, Orjeda G (2012) Genome-wide identification and
mapping of NBS-encoding resistance genes in Solanum tuberosum group phureja. PLoS One 7:
e34775
Luo S, Zhang Y, Hu Q, Chen J, Li K, Lu C, Liu H, Wang W, Kuang H (2012) Dynamic nucleotide-
binding site and leucine-rich repeat-encoding genes in the grass family. Plant Physiol 159:197–
210
Lv H, Fang Z, Yang L, Zhang Y, Wang Y (2020) An update on the arsenal: mining resistance genes
for disease management of Brassica crops in the genomic era. Hortic Res 7:1–8
Madsen LH, Collins NC, Rakwalska M, Backes G, Sandal N, Krusell L, Jensen J, Waterman EH,
Jahoor A, Ayliffe M, Pryor AJ (2003) Barley disease resistance gene analogs of the NBS-LRR
class: identification and mapping. Mol Genet Genomics 269:150–161
Maekawa T, Kufer TA, Schulze-Lefert P (2011) NLR functions in plant and animal immune
systems: so far and yet so close. Nat Immunol 12:817–826
Mago R, Nair S, Mohan M (1999) Resistance gene analogues from rice: cloning, sequencing and
mapping. Theor Appl Genet 99:50–57
Mandadi KK, Scholthof KB (2013) Plant immune responses against viruses: how does a virus cause
disease? Plant Cell 25:1489–1505
Marathe R, Anandalakshmi R, Liu Y, Dinesh-Kumar SP (2002) The tobacco mosaic virus resis-
tance gene, N. Mol Plant Pathol 3:167–172
Martin GB, Bogdanove AJ, Sessa G (2003) Understanding the functions of plant disease resistance
proteins. Annu Rev Plant Biol 54:23–61
McDowell JM, Simon SA (2006) Recent insights into R gene evolution. Mol Plant Pathol 7:437–
448
McHale L, Tan X, Koehl P, Michelmore RW (2006) Plant NBS-LRR proteins: adaptable guards.
Genome Biol 7:212
Menz I, Lakhwani D, Clotault J, Linde M, Foucher F, Debener T (2020) Analysis of the Rdr1 gene
family in different Rosaceae genomes reveals an origin of an R-gene cluster after the split of
Rubeae within the Rosoideae subfamily. PLoS One 15:e0227428
Meyers BC (2003) Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell
15:809–834
Meyers BC, Morgante M, Michelmore RW (2002) TIR-X and TIR-NBS proteins: two new families
related to disease resistance TIR-NBS-LRR proteins encoded in Arabidopsis and other plant
genomes. Plant J 32:77–92
Meyers BC, Kozik A, Griego A, Kuang H, Michelmore RW (2003) Genome-wide analysis of
NBS-LRR–encoding genes in Arabidopsis. Plant Cell 15:809–834
Mohler V, Klahr A, Wenzel G, Schwarz G (2002) A resistance gene analog useful for targeting
disease resistance genes against different pathogens on group 1S chromosomes of barley, wheat
and rye. Theor Appl Genet 105:364–368
Moroldo M, Paillard S, Marconi R, Fabrice L, Canaguier A, Cruaud C, De Berardinis V,
Guichard C, Brunaud V, Le Clainche I, Scalabrin S (2008) A physical map of the heterozygous
grapevine ‘Cabernet Sauvignon’allows mapping candidate genes for disease resistance. BMC
Plant Biol 8:1–4
Mushtaq R, Shahzad K, Mansoor S, Shah ZH, Alsamadany H, Mujtaba T, Al-Zahrani Y, Alzahrani
HA, Ahmed Z, Bashir A (2018) Exploration of cotton leaf curl virus (CLCuV) resistance genes
and their screening in Gossypium arboreum by targeting resistance gene analogues. AoB Plants
10:1–15
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 267
Naresh P, Reddy MK, Reddy AC, Lavanya B, Reddy DL, Reddy KM (2017) Isolation, characteri-
zation and genetic diversity of NBS-LRR class disease-resistant gene analogs in multiple virus
resistant line of chilli (Capsicum annuum L.). 3 Biotech 7:1–10
Pan Q, Wendel J, Fluhr R (2000) Divergent evolution of plant NBS-LRR resistance gene
homologues in dicot and cereal genomes. J Mol Evol 50:203–213
Parker JE, Coleman MJ, Szabò V, Frost LN, Schmidt R, van der Biezen EA, Moores T, Dean C,
Daniels MJ, Jones JD (1997) The Arabidopsis downy mildew resistance gene RPP5 shares
similarity to the toll and interleukin-1 receptors with N and L6. Plant Cell 9:879–894
Parvaiz A, Mustafa G, Khan MS, Ali MA (2021) Characterization and expression analysis of
resistance gene analogues in elite sugarcane genotypes. Protein Pept Lett 28:1–10
Porter BW, Paidi M, Ming R, Alam M, Nishijima WT, Zhu YJ (2009) Genome-wide analysis of
Carica papaya reveals a small NBS resistance gene family. Mol Genet Genomics 281:609–626
Priyanka K, Dubey SC, Upadhyay BK (2021) Cloning, characterization and expression analysis of
resistant gene analogues for wilt resistant in chickpea. Indian Phytopathol 15:649–658
Qi D, DeYoung BJ, Innes RW (2012) Structure-function analysis of the coiled-coil and leucine-rich
repeat domains of the RPS5 disease resistance protein. Plant Physiol 158:1819–1832
Radwan O, Bouzidi MF, Vear F, Philippon J, De Labrouhe DT, Nicolas P, Mouzeyar S (2003)
Identification of non-TIR-NBS-LRR markers linked to the Pl5/Pl8 locus for resistance to downy
mildew in sunflower. Theor Appl Genet 106:1438–1446
Radwan O, Gandhi S, Heesacker A, Whitaker B, Taylor C, Plocik A, Kesseli R, Kozik A,
Michelmore RW, Knapp SJ (2008) Genetic diversity and genomic distribution of homologs
encoding NBS-LRR disease resistance proteins in sunflower. Mol Genet Genomics 280:111–
125
Ramalingam J, Vera Cruz CM, Kukreja K, Chittoor JM, Wu JL, Lee SW, Baraoidan M, George
ML, Cohen MB, Hulbert SH, Leach JE (2003) Candidate defense genes from rice, barley, and
maize and their association with qualitative and quantitative resistance in rice. Mol Plant-
Microbe Interact 16:14–24
Ranjini P, Shailasree S, Kini KR, Shetty HS (2011) Isolation and characterisation of a NBS-LRR
resistance gene analogue from pearl millet. Arch Phytopathol Pflanzenschutz 44:1014–1024
Ren S, Sun M, Yan H, Wu B, Jing T, Huang L, Zeng B (2020) Identification and distribution of
NBS-encoding resistance genes of Dactylis glomerata L. and its expression under abiotic and
biotic stress. Biochem Genet 58:824–847
Riedl SJ, Li W, Chao Y, Schwarzenbacher R, Shi Y (2005) Structure of the apoptotic protease-
activating factor 1 bound to ADP. Nature 434:926–933
Rossi M, Araujo PG, Paulet F, Garsmeur O, Dias VM, Chen H, Van Sluys MA, D'Hont A (2003)
Genomic distribution and characterization of EST-derived resistance gene analogs (RGAs) in
sugarcane. Mol Genet Genomics 269:406–419
Saranya G, Nath VS, Jeeva ML, Sheela MN, Makeshkumar T (2016) Mining of resistance gene
analogues for anthracnose disease in greater yam (Dioscorea alata L.). J Root Crops 42:115–120
Saraste M, Sibbald PR, Wittinghofer A (1990) The P-loop—a common motif in ATP-and
GTP-binding proteins. Trends Biochem Sci 15:430–434
Sarris PF, Duxbury Z, Huh SU, Ma Y, Segonzac C, Sklenar J, Derbyshire P, Cevik V, Rallapalli G,
Saucet SB, Wirthmueller L (2015) A plant immune receptor detects pathogen effectors that
target WRKY transcription factors. Cell 161:1089–1100
Schornack S, Ballvora A, Gürlebeck D, Peart J, Ganal M, Baker B, Bonas U, Lahaye T (2004) The
tomato resistance protein Bs4 is a predicted non-nuclear TIR-NB-LRR protein that mediates
defense responses to severely truncated derivatives of AvrBs4 and overexpressed AvrBs3. Plant
J 37:46–60
Seah S, Sivasithamparam K, Karakousis A, Lagudah ES (1998) Cloning and characterisation of a
family of disease resistance gene analogs from wheat and barley. Theor Appl Genet 97:937–945
268 S. Ijaz et al.
Seherm H, Coakley SM (2003) Plant pathogens in a changing world. Australas Plant Pathol 32:
157–165
Sekine KT, Kawakami S, Hase S, Kubota M, Ichinose Y, Shah J, Kang HG, Klessig DF, Takahashi
H(2008) High level expression of a virus resistance gene, RCY1, confers extreme resistance to
Cucumber mosaic virus in Arabidopsis thaliana. Mol Plant-Microbe Interact 21:1398–1407
Sharma TR, Madhav MS, Singh BK, Shanker P, Jana TK, Dalal V, Pandit A, Singh A, Gaikwad K,
Upreti HC, Singh NK (2005) High-resolution mapping, cloning and molecular characterization
of the Pi-k h gene of rice, which confers resistance to Magnaporthe grisea. Mol Genet Genomics
274:569–578
Sharma R, Rawat V, Suresh CG (2017) Genome-wide identification and tissue-specific expression
analysis of nucleotide binding site-leucine rich repeat gene family in Cicer arietinum (kabuli
chickpea). Genom Data 14:24–31
Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH,
Fauquet C (1995) A receptor kinase-like protein encoded by the rice disease resistance gene,
Xa21. Science 270:1804–1806
Suraby EJ, Prasath D, Babu KN, Anandaraj M (2020) Identification of resistance gene analogs
involved in Phytophthora capsici recognition in black pepper (Piper nigrum L.). J Plant Pathol
102(4):1121–1131
Sutanto A, Sukma D, Hermanto C, Sudarsono M (2014) Isolation and characterization of resistance
gene analogue (RGA) from Fusarium resistant banana cultivars. Emir J Food Agric 25:508–518
Takken FL, Goverse A (2012) How to build a pathogen detector: structural basis of NB-LRR
function. Curr Opin Plant Biol 15:375–384
Tameling WI, Elzinga SD, Darmin PS, Vossen JH, Takken FL, Haring MA, Cornelissen BJ (2002)
The tomato R gene products I-2 and MI-1 are functional ATP binding proteins with ATPase
activity. Plant Cell 14:2929–2939
Tan S, Wu S (2012) Genome wide analysis of nucleotide-binding site disease resistance genes in
Brachypodium distachyon. Comp Funct Genomics 2012:1–12
Tan X, Meyers BC, Kozik A, West MA, Morgante M, St Clair DA, Bent AF, Michelmore RW
(2007) Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and
related genes in Arabidopsis. BMC Plant Biol 7:1–20
Traut TW (1994) The functions and consensus motifs of nine types of peptide segments that form
different types of nucleotide-binding sites. In: Christen P, Hofmann E (eds) EJB reviews.
Springer, Berlin, pp 105–115
Van Der Vossen E, Sikkema A, Hekkert BT, Gros J, Stevens P, Muskens M, Wouters D, Pereira A,
Stiekema W, Allefs S (2003) An ancient R gene from the wild potato species Solanum
bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato
and tomato. Plant J 36:867–882
van Ooijen G, van den Burg HA, Cornelissen BJ, Takken FL (2007) Structure and function of
resistance proteins in solanaceous plants. Annu Rev Phytopathol 45:43–72
Van Ooijen G, Mayr G, Kasiem MM, Albrecht M, Cornelissen BJ, Takken FL (2008) Structure–
function analysis of the NB-ARC domain of plant disease resistance proteins. J Exp Bot 59:
1383–1397
Vaz Bisneta M, Gonçalves-Vidigal MC (2020) Integration of anthracnose resistance loci and RLK
and NBS-LRR-encoding genes in the Phaseolus vulgaris L. genome. Crop Sci 60:2901–2918
Vidal S, Cabrera H, Andersson RA, Fredriksson A, Valkonen JP (2002) Potato gene Y-1 is an N
gene homolog that confers cell death upon infection with potato virus Y. Mol Plant-Microbe
Interact 15:717–727
Walker HG, Kohler GO, Garrett WN (1982) Comparative feeding value of alfalfa press cake
residues after mechanical extraction of protein. J Anim Sci 55:498–504
Wan H, Yuan W, Ye Q, Wang R, Ruan M, Li Z, Zhou G, Yao Z, Zhao J, Liu S, Yang Y (2012)
Analysis of TIR-and non-TIR-NBS-LRR disease resistance gene analogous in pepper: charac-
terization, genetic variation, functional divergence and expression patterns. BMC Genomics 13:
1–5
13 Disease Resistance Genes’Identification, Cloning, and Characterization... 269
Wang S, Xiao X (2002) Isolation and linkage mapping of disease-resistance-like sequences from
various rice cultivars, containing different recognition specificities. Plant Breed 121:203–209
Wang H, Jiang YP, Yu HJ, Xia XJ, Shi K, Zhou YH, Yu JQ (2010) Light quality affects incidence
of powdery mildew, expression of defence-related genes and associated metabolism in cucum-
ber plants. Eur J Plant Pathol 127:125–135
Wang HE, Cheng CM, Bai YM, Hsu JW, Huang KL, Su TP, Tsai SJ, Li CT, Chen TJ, Leventhal
BL, Chen MH (2020) Familial coaggregation of major psychiatric disorders in first-degree
relatives of individuals with autism spectrum disorder: a nationwide population-based study.
Psychol Med 11:1–11
Whitham S, Dinesh-Kumar SP, Choi D, Hehl R, Corr C, Baker B (1994) The product of the tobacco
mosaic virus resistance gene N: similarity to toll and the interleukin-1 receptor. Cell 78:1101–
1115
Williams SJ, Sornaraj P, deCourcy-Ireland E, Menz RI, Kobe B, Ellis JG, Dodds PN, Anderson PA
(2011) An autoactive mutant of the M flax rust resistance protein has a preference for binding
ATP, whereas wild-type M protein binds ADP. Mol Plant-Microbe Interact 24:897–906
Wu J, Zhu J, Wang L, Wang S (2017) Genome-wide association study identifies NBS-LRR-
encoding genes related with anthracnose and common bacterial blight in the common bean.
Front Plant Sci 9:1398
Xie Y, Ling T, Han Y, Liu K, Zheng Q, Huang L, Yuan X, He Z, Hu B, Fang L, Shen Z (2008)
Carbon monoxide enhances salt tolerance by nitric oxide-mediated maintenance of ion homeo-
stasis and up-regulation of antioxidant defence in wheat seedling roots. Plant Cell Environ 31:
1864–1881
Yang S, Zhang X, Yue JX, Tian D, Chen JQ (2008) Recent duplications dominate NBS-encoding
gene expansion in two woody species. Mol Genet Genomics 280:187–198
Young ND (2000) The genetic architecture of resistance. Curr Opin Plant Biol 3:285–390
Yu J, Tehrim S, Zhang F, Tong C, Huang J, Cheng X, Dong C, Zhou Y, Qin R, Hua W, Liu S
(2014) Genome-wide comparative analysis of NBS-encoding genes between Brassica species
and Arabidopsis thaliana. BMC Genomics 15:1–8
Yuan M, Ngou BP, Ding P, Xin XF (2021) PTI-ETI crosstalk: an integrative view of plant
immunity. Curr Opin Plant Biol 62:102030
Yue JX, Meyers BC, Chen JQ, Tian D, Yang S (2012) Tracing the origin and evolutionary history
of plant nucleotide-binding site–leucine-rich repeat (NBS-LRR) genes. New Phytol 193:1049–
1063
Zhang P, Wang Y, Zhang J, Maddock S, Snook M, Peterson T (2003) A maize QTL for silk maysin
levels contains duplicated Myb-homologous genes which jointly regulate flavone biosynthesis.
Plant Mol Biol 52:1–5
Zhang YM, Chen M, Sun L, Wang Y, Yin J, Liu J, Sun XQ, Hang YY (2020) Genome-wide
identification and evolutionary analysis of NBS-LRR genes from Dioscorea rotundata. Front
Genet 11:484–495
Zhou T, Wang Y, Chen JQ, Araki H, Jing Z, Jiang K, Shen J, Tian D (2004) Genome-wide
identification of NBS genes in japonica rice reveals significant expansion of divergent non-TIR
NBS-LRR genes. Mol Genet Genomics 271:402–415
271
Utilization of Biosensors
in the Identification of Bacterial Diseases
in Maize
14
Luis Germán López-Valdez, Braulio Edgar Herrera-Cabrera,
Rafael Salgado-Garciglia, Gonzalo Guillermo Lucho-Constantino,
Fabiola Zaragoza Martínez, Jorge Montiel-Montoya,
José Lorenzo Laureano, Luz María Basurto González, César Reyes,
and Hebert Jair Barrales-Cureño
Abstract
Nanotechnology is an emerging technological and scientific breakthrough that
can transform agricultural sectors by providing novel tools for the molecular
L. G. López-Valdez
Laboratorio de Productos Naturales, Área de Química, AP74 Oficina de correos Chapingo,
Universidad Autónoma Chapingo, Texcoco, Estado de México, Mexico
B. E. Herrera-Cabrera
Colegio de Postgraduados, Campus Puebla, Santiago Momoxpan, Puebla, Mexico
R. Salgado-Garciglia
Instituto de Investigaciones Químico Biológicas, Universidad Michoacana de San Nicolásde
Hidalgo, Edificio B-3, Ciudad Universitaria, Morelia, Michoacán, Mexico
G. G. Lucho-Constantino
Instituto Tecnológico de Jesús Carranza, Jesús Carranza, Veracruz, Mexico
F. Z. Martínez
Centro de Investigación y Estudios Avanzados del IPN, Gustavo A. Madero, Ciudad de México,
Mexico
J. Montiel-Montoya
Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional, Instituto Politécnico
Nacional Unidad Sinaloa, Guasave, Sinaloa, Mexico
J. L. Laureano · C. Reyes
Universidad Intercultural del Estado de Puebla, Puebla, Mexico
L. M. B. González · H. J. Barrales-Cureño (*)
Instituto Tecnológico de Estudios Superiores de Zamora, Ingeniería en Innovación Agrícola
Sustentable, Zamora, Michoacán, Mexico
e-mail: hebert.bc@zamora.tecnm.mx;hebert.jair@uiep.edu.mx
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_14
detection of biotic and abiotic stress, and the rapid detection of phytopathogenic
diseases. In plants, it has the potential to enhance their capacity to absorb water
and nutrients from the soil. Furthermore, nanobiotechnology improves our under-
standing of crop biology, yields, and nutritional values. The various applications
of nanotechnology in agriculture are (1) energy storage, production and conver-
sion (photovoltaic modules); (2) increased agricultural productivity (nanoporous
zeolites for prolonged and efficient release of fertilizers); (3) capsules for the
specific release of pesticides; (4) the use of biosensors for monitoring the soil
quality and plant vitality; (5) pest and phytopathogen detection biosensors; and
(6) pesticide biosensors. Nanosensors and intelligent delivery systems based on
nano-products are used in the agricultural sector to combat crop pathogens. This
nanotechnology seeks to minimize nutrient losses in fertilization and improve
crop productivity by optimizing the use of water and nutrients. Nanotechnology
provides a wide range of opportunities to produce agro-products based on
nanomaterials such as fertilizers, pesticides, herbicides, and nanosensors. These
will make it possible to increase the food yield sustainably, reduce the environ-
mental impact and detect infections in plants. This chapter talks about how
nanotechnology can be used in plant pathology and how nanomaterials can be
used to make biosensors that can detect the main bacterial diseases in maize.
272 L. G. López-Valdez et al.
Keywords
Biosensors · Nanobiotechnology · Nanomaterials · Nanoparticles · Nanosensors
14.1 Introduction
Zea mays is the third most widely cultivated cereals grain in the world, serving as
livestock feed, biofuel, human food, and a raw material in the industry. Its commer-
cial impact exceeds US$50 billion. A biosensor is an integrated receptor-transducer
device structured by a biological recognition element (cell, tissue, receptor, nucleic
acid, enzyme, ribozyme, or antibody, among others), or nanomaterials (nanoparticles
and nanocomposites), intelligent materials or biomimetic compounds (aptamers,
polymers of intrinsic microporosity, and nucleic acid probes), which is associated
with a detection mechanism and interpretation of the variation of optical, physico-
chemical, and electrical properties, among others, obtained from the interaction
between the analyte and the analytical device (Volkov 2000; Turner and Newman
1998). The type of recognition element determines the transducer system, and the
physicochemical characteristics of the analyte are determinants for the choice of
biological and biometric materials. Biosensors present an analytical approach of
greater speed, simplicity, and low economic cost. DNA biosensors based on nucleic
acid recognition have applications such as in electrophoresis analysis of amplified
DNA. The applications of DNA-based biosensor analysis extend to the field of food
control, process control of raw materials, and traceability in industrial processing
plants, and in the field of food control, not only for raw materials but also for process
control and traceability in industrial processing plants (Minunni et al. 2005;
Mannelli et al. 2003; Bogani et al. 2008). Label-free piezoelectric DNA biosensors
present adequate specificity and high sensitivity, allowing rapid and real-time
control of DNA hybridisation (Lucarelli et al. 2008; Wu et al. 2007; Sun et al.
2006). Biosensors are designed to detect analytically important molecules such as
toxic compounds or pathogens in order to provide reliable, rapid and accurate
information about the analyte of interest. Biosensors take part in the important
growth of analytical tools useful in the detection of hazardous biological and
chemical compounds for health care, food safety and environmental monitoring
(Luong et al. 2008; Mascini 2008; Amine et al. 2006). Plant pathogens reduce
crop productivity and cause a decrease in food for human and animal consumption.
Currently, many methods have been developed to detect crop-dependent
phytopathogens of biochemical and molecular types, but they lack speed, reliability,
specificity and accuracy, being not suitable for the in situ analysis system. Therefore,
there is great interest in developing biosensor systems for early and accurate
detection of phytopathogens (bacteria, fungi, and viruses) (Wijesuriya & Rechnitz
1993; Dyussembayev et al. 2021; Ammar 2018).
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 273
Climate change and population growth alter agricultural production. Crop engi-
neering is increasingly necessary. Nanoparticle-based biosensors are new tools to
advance agricultural practices. As these nanoparticle-based biosensors enter and
travel through biofluidic complexes within plants, biomolecules, including proteins,
metabolites, lipids and carbohydrates, adsorb onto the surfaces of the nanoparticles,
forming a coating known as a “bio-crown”. On the other hand, screen-printed carbon
electrodes are adapted to different biorecognition elements, including enzymes,
antibodies, and aptamers, often with other modifiers, such as mediators and
nanoparticles, to produce electrochemical biosensors for a variety of analytes of
importance in agri-food safety. Emphasis is placed on biosensor fabrication
strategies and device performance characteristics. In addition to biosensors for a
range of analytes in different agri-food matrices, there are also those with potential in
agri-food safety (Smart et al. 2020; Voke et al. 2021). Of importance is the high
specificity and sensitivity to be able to detect physiological and pathogenic
molecules, which offers a useful opportunity in the treatment of plant pathogenic
disease with early diagnosis. There is also the optical-based biosensor in which a
fibre-optic cable is used in the different investigations. Bacteriophages are ubiqui-
tous viruses found wherever bacteria exist. It is estimated that there are more than
1031 bacteriophages on the planet, more than all other organisms on the earth,
including bacteria. In recent years, biosensors have been widely recognized as
having several potential applications in the food industry (Nasrullah 2021).
Nano-inspired biosensors have acquired a vital role in improving the quality of
life through various botanical and environmental applications worldwide. Several
nano-inspired biosensors have been reported, ranging from detection of plant
infections (fungal, viral, and bacterial), abiotic stress, metabolic content,
phytohormones, miRNAs, and genetically modified (GM) plants to transcriptional
and genetically encoded biosensors in a very short time. For in vitro and in vivo
measurements, with the existing tools and technologies (such as molecularly
imprinted polymers, microfluidics, plasmonic nanosensors, surface-enhanced
Raman scattering (SERS), fluorescence, chemiluminescence, quartz crystal micro-
balance, and advanced electrochemical measurements), together with customizable
nanomaterials or nanocomposites, a potential niche has recently been discovered and
is being exploited to make nano-inspired plant-based biosensors. Although the
research based on plant-based biosensors has gained momentum very recently,
few research results are available (Kumar and Arora 2020). There are new emerging
biosensor technologies such as isothermal amplification, nanomaterial detection,
paper-based techniques, robotics, and lab-on-a-chip analytical devices. However,
these constitute a novelty in research and development of approaches for the early
diagnosis of pathogens in sustainable agriculture (Ali et al. 2021).
274 L. G. López-Valdez et al.
Both bacterial and fungal diseases can be diagnosed with biosensors because of
their potential capacity, real-time detection, and advantages, among other analytical
techniques. For example, mycotoxins, which are naturally occurring toxic secondary
metabolites produced by fungi, can be determined. Biosensors are effective and
efficient for the accurate detection of these toxic molecules in food, combining a
biochemical recognition element with a physical transducer (Shrivastava and
Sharma 2021).
Plant diseases minimize crop productivity. Another very dangerous plant disease
is bacterial stalk rot in maize, which disrupts the flow of nutrients from the primary
and secondary roots to other parts of the plant, infecting the inner tissue of the stalk
until it rots completely. The disease has been reported to attack maize crops in Asia
and Europe. Molecular identification results indicated that this disease is caused by
the bacterium Dickeya zeae (Patandjengi et al. 2021). The pathogen needs to be
identified both in the field and in greenhouse. Current technologies, such as quanti-
tative polymerase chain reaction (Q-PCR), are time-consuming and lack high sensi-
tivity. They require large amounts of target tissue and several assays to accurately
identify different plant pathogens. Biosensors are low-cost methods to improve the
accuracy and speed of plant-pathogen diagnosis. However, nanotechnology,
nanoparticles, and quantum dots (QDs) are essential tools for the rapid detection
of a given biomarker with extreme precision. Biosensors, QDs, nanostructured
platforms, nanoimaging, and nanopore DNA sequencing tools have the potential
to increase the sensitivity, specificity, and speed of pathogen detection, facilitate
high-throughput analysis, and be used for high-quality monitoring and crop protec-
tion. In addition, nanodiagnostic kits can easily and quickly detect potentially
serious and dangerous plant pathogens, allowing experts to assist farmers in the
prevention of epidemic diseases (Khiyami et al. 2014; Prasad et al. 2014).
Other biotechnological advances developed are quorum quenching (QQ), which
is a technique to control quorum-mediated bacterial pathogens by interfering with
population sensing systems, catalysing degradative enzymes, modifying signals, and
inhibiting signal synthesis. In many Gram-negative pathogenic bacteria, chemically
conserved signalling molecules called N-acyl homoserine lactones (AHLs) are
studied. AHLs modulate virulence factors in several plant pathogenic bacteria,
including Dickeya zeae. Dickeya zeae is a bacterium that causes plant rot in
maize, causing economic crop losses. Zhang et al. (2021) isolated an
AHL-degrading bacterial strain W-7 from samples of Pseudomonas nitroreducens.
Strain W-7 revealed a superior ability to degrade N-(3-oxododecanoyl)-L-
homoserine lactone (OdDHL), when it completely degraded 0.2 mmol/L OdDHL
in 48 h. By GC-MS, N-cyclohexyl-propanamide was identified as the main interme-
diate metabolite during AHL biodegradation (Zhang et al. 2021).
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 275
Food safety and security must be ensured for plant pathogenic microorganisms to
become a threat to global food consumption. Also, nanomaterials have chemical and
physical properties, which are used for high-throughput, non-invasive detection, and
as diagnostic techniques for various plant pathogens. The sensitivity and selectivity
are currently improved due to the use of engineered nanomaterials corresponding to
molecular and sequencing techniques. This is a biotechnological alternative needed
for rapid, in situ diagnostics of diseased plants and long-term monitoring of plant
health conditions (Li et al. 2020).
Aflatoxin is a carcinogen secreted by fungi and is found dangerously in some
food samples. Many detection methods have been developed to determine traces of
aflatoxin. Dyussembayev et al. (2021) developed a specific, cost-effective, and
simple colorimetric competitive assay method to detect aflatoxin B1 based on the
interaction of gelatin-functionalized gold nanoparticles in a specific enzymatic
reaction. The results obtained showed that through this approach aflatoxin could
be detected in a linear range of 10–140 pg mL
1
, with a detection limit of 4 pg mL
1
.
The assay on real saffron samples showed a recovery rate of 92.4–95.3%. The
analysis should be efficient and highly sensitive in testing to achieve the best
detection of pathogens in food as the limit of detection by analyzing the highest
amount of volume. Xu et al. (2019) developed a flow-through
immunoelectrochemical biosensor to identify two types of bacteria (E. coli O157:
H7 and Salmonella) in food. The electrode was formed with a porous, antibody-
coated graphite felt electrode that served as a solid support coated with
biorecognition elements for capturing target pathogens as a signal transducer, and
large volumes of the aqueous sample can be rapidly exposed to the solid support
through gravity flow (Xu et al. 2019). Therefore, this chapter addresses the
applications of nanobiotechnology in plant pathology, as well as biosensor platforms
based on nanomaterials to detect the main bacterial diseases in maize.
14.2 Biosensors
A biosensor is a device that measures biological or chemical reaction that detects,
records, transmits, and provides specific quantitative or semi-quantitative analytical
information from its environment using a specific biological recognition element
with a physiological change/process in a biological system, providing specific
biochemical interactions or reactions, or uses biological materials to monitor the
presence of various chemicals in a substance. According to the International Union
of Pure and Applied Chemistry (IUPAC) definition, a biosensor is an analytical
device used for sensitive and selective biomarkers for the detection of chemical
compounds, usually by optical, thermal, or electrical type signals (McNaught and
Wilkinson 1997). In most successful biosensors, the principle underlying the deter-
mination of a chemical or biological molecule is the specific interaction of that
analyte molecule with the biological material present in the biosensor probe device.
Figure 14.1 describes the elements of a biosensor.
276 L. G. López-Valdez et al.
Fig. 14.1 Components of a biosensor
14.3 Mechanism of Biosensors
Biosensors are devices that combine a bioreceptor, and a suitable transducer, which
measures the effect produced by the interaction between the substrate and the
bioreceptor and transforms it into an electrical signal. Bioreceptors such as tissues,
cells, nucleic acids, artificial binding proteins, monoclonal and polyclonal
antibodies, as well as enzymes, among others, bind to a specific compound using
higher-order structural elements. Depending on the transduction mechanism,
biosensors can be classified as electrochemical, piezoelectric, thermal, optical, etc.
The overall reaction/interaction of the bioreceptor and analyte is transduced into a
signal that is easily quantifiable by the transducer. The biological recognition
element is usually in close contact with a transducer, using an additional element
located between the recognition element and the transducer corresponding to an
interface composed of hybrid, inorganic or organic materials, with the objective of
improving the functionality of the device, either by providing greater stability or by
amplifying the signal (Eggins 2002;Bănică2012; Thévenot et al. 2001).
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 277
14.4 Biosensor Types
14.4.1 Enzymatic Biosensors
The development of new biosensors has been investigated in a variety of biological
materials and transduction methods, such as enzymes immobilized as biological
material and electrochemical transducers (Volkov et al. 1998; Volkov and
Mwesigwa 2001). One of the alternative applications of enzymatic biosensors is to
inspect different pollutants present in the environment in an automated, efficient,
fast, and economical way. Oxidative enzymes, such as polyphenol oxidases
(laccases and tyrosinases) and peroxidases, are interesting, highly functional and
versatile enzymes used as analyte recognition elements in biosensors. With these
biosensors, contaminants can be detected, as recognition elements mediate the use of
oxidative enzymes and detection of contaminants such as toxic compounds and
environmental pollutants: pharmaceuticals, heavy metals, phenols, and pesticides
(Patel 2002; Rebollar-Pérez et al. 2020).
The generation of electrochemical sensing and biosensors based on the modifica-
tion of the working electrode is a suitable tool for quality assurance in the food
industry (Table 14.1). Petrlova et al. (2007) reported that the process could be used
to determine an avidin-modified carbon paste electrode to determine concentrations
up to 3 pm in solution and 170 nM in a corn seed extract.
14.4.2 Chemical Biosensors
In 1924, Palmer studied the coherence of contact-free thin filaments induced by
electromagnetic waves in the presence of different gases and the correlation between
the observed responses and the heat of gas absorption. This was one of the first
chemical sensors ever recorded (Datskos et al. 2005). A chemical sensor is defined as
a physical transducer (transducer of physical quantities into suitable output signals)
and a chemically selective layer so that measurable output signals can be produced in
response to a chemical stimulus (Datskos et al. 2005; Liawruangrath et al. 2001). In
the design of a chemical sensor, molecule-selective coatings can be used, which
means that these coatings can be chemically functionalized with compounds that
recognize or interact with other chemical molecules of interest for detection or
monitoring, such as sensors used for the detection of polluting particles in the
environment or in water, to cite some examples. Another relevant aspect of these
sensors are the different transduction modes; basically, these can be thermal, mass,
electrochemical, and optical (Fig. 14.2).
Chemical sensors have been actively used within the MEMS
(microelectromechanical systems) family, especially the simple structures called
microcantilevers that have proven to be very useful as transducers of physical,
Analyte Matrix References
278 L. G. López-Valdez et al.
Table 14.1 Biosensors applied to evaluate food quality
Recognition
enzyme
Transduction
system
Glucose Grape juice, wine,
juice, honey,
milk, and yogurt
Glucose oxidase Amperometric Centonze et al.
(1997), Ángeles
and Cañizares
(2004)
Fructose Juice, honey,
milk, gelatin, and
artificial
edulcorants
Fructose
dehydrogenase, D-
fructose
5-dehydrogenase
Amperometric Bassi et al.
(1998),
Palmisano et al.
(2000)
Lactose Milk ß-galactosidase Amperometric Marconi et al.
(1996),
Palmisano et al.
(2000)
Lactate Cider and wine Transaminase and
lactate
dehydrogenase
Amperometric Silber et al.
(1994),
Ramanathan
et al. (2001)
Lactulose Milk Fructose
dehydrogenase and
ß-galactosidase
Amperometric Sekine and Hall
(1998)
L-amino
acids
Milk and fruit
juices
D-amino acid
oxidase
Amperometric Sarkar et al.
(1999)
L-
glutamate
Soya sauce and
condiments
L-glutamate
oxidase
Amperometric Kwong et al.
(2000)
L-lysine Milk, pasta and
fermentation
samples
Lysine oxidase Amperometric Kelly et al.
(2000),
Olschewski et al.
(2000)
L-malate Wine, cider and
juices
Dehydrogenated
malate, others
Amperometric Miertus et al.
(1998)
Ethanol Beer, wine and
other alcoholic
drinks
Alcohol oxidase,
alcohol
dehydrogenase,
NaDH oxidase
Amperometric Katrlık et al.
(1998)
Glycerol Wine Glycerophosphate
oxidase and
glycerol kinase
Amperometric Niculescu et al.
(2003)
Catechol Beer Polyphenol oxidase Amperometric Eggins et al.
(1997)
Cholesterol Butter, lard, and
egg
Cholesterol oxidase
and peroxidase
Amperometric Akyilmaz and
Dinckaya (2000)
Citric acid Juice and athletic
drinks
Citrate lyase Amperometric Prodromidis
et al. (1997)
Lecithin Egg yolk, flour,
and soya sauce
Phospholipase D
and choline oxidase
Electrochemical Mello and
Kubota (2002)
biological or chemical stimuli into measurable signals. Sensors based on cantilevers
involve measurements of their deflection, resonance frequency, and damping
characteristics.
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 279
Fig. 14.2 (a) Schematic representation of a chemical or biological sensor with an output signal in
response to the presence of an analyte source or chemical compound of interest. (b) Chemical
sensor with a receiver layer that provides a selective response to chemical or biological molecules
14.4.3 Biological Sensors
A biological sensor has an operating principle similar to that of a chemical sensor,
but in this case, specific interactions can occur between biomolecules of the
functionalized device, with the biomolecules of interest for detection, such as
antibody-antigen, enzyme-substrate (biomolecule) interactions, and DNA strand
recognition; even microorganism-culture medium or culture medium interactions
can occur to carry out the biodetection of the recognition of the biomolecule of
interest (Capobianco et al. 2021). These interactions result in the variation of one or
more physico-chemical properties (pH, electron transfer, heat transfer, change of
potential, mass variations, and variation of optical properties, among others) that are
finally detected by the transducer. This system transforms the response of the
recognition element into an electrical signal indicative of the presence of the analyte
under study proportional to its concentration in the sample or to the growth of the
micro-organism (Velasco-García and Mottram 2003). Biosensors can be classified in
four different ways (Gonzalez et al. 2005) according to Table 14.2.
In practice, the choice of biological material depends on the characteristics of the
compound to be analyzed, and the choice of the transducer is conditioned by the type
of element to be recognized, as this determines what variation in physicochemical
properties will occur as a consequence of the interaction (Datskos et al. 2005).
280 L. G. López-Valdez et al.
Table 14.2 Biosensors classification
Type of interaction Characteristic
Between the recognition element
and the analyte
Biocatalytic, bioaffinity
Method used to detect such
interaction
Direct and indirect
Nature of the recognition
element
Enzyme, organelle, tissue or whole cell, biological receptor,
antibody, nucleic acids, PNA (peptide nucleic acid),
aptamers (single-stranded nucleic acids or chemical
antibodies)
Transduction system Electrochemical, optical, piezoelectric, thermometric,
nanomechanical
14.4.4 Mass Biosensors
A mass biosensor is a device capable of detecting the magnitude of mass and
transforming this detection into an electrical variable: resistance, capacitance, volt-
age, current and frequency, among others. Currently, there are systems capable of
detecting mass variations in picograms up to sensitivities of 0.18 ag/cm2, in com-
mercial devices, at high frequencies (10–15 MHz) (Qsense 2011). Probably the most
widely used biosensor with this function is the quartz microbalance (QCM, Quartz
Crystal Microbalance or QMB, Quartz microbalance), which achieves an absolute
mass resolution of 0.9 ng
2
/cm
2
. Quartz balances are used in chemical reaction
monitoring, biomedical biosensors, metal deposition monitoring and environmental
control. These systems sometimes allow electrochemical measurements in liquid,
known as EQCM (Electrochemical Quartz Crystal Microbalance).
The quartz microbalance works by applying an external electrical potential to a
quartz disc with two metal electrodes (usually gold), producing an acoustic wave that
propagates through the crystal. This wave encounters a minimum impedance when
the thickness of the system is a multiple of half the wavelength of the acoustic wave.
The quartz crystal disc must be cut with a specific orientation with respect to
the crystalline axes. The deposition of thin layers on the crystal surface decreases
the frequency proportionally to the mass of the deposited layer. By detecting the
variation in frequency, the deposited mass can be determined (O’Sullivan and
Guilbautl 1999).
Zhang et al. proposed a system based on a comb microoscillator using parametric
resonance amplification with picogram resolution in the air (Zhang and Turner
2005). Ekinci, on the other hand, presents a resonant nano-bridge with magnetic
detection that allows absolute mass resolutions in the order of the atogram (Ekinci
et al. 2004). This bridge is placed in a perpendicular magnetic field to excite the
resonance, and together with the alternating current passing through it, an
electromotive force is generated, which is detected through a network analyzer,
and the mass changes are known. Devices capable of detecting 7 zeptograms have
been designed, taking measurements in ultra-high vacuum and at temperatures
below 7 K. Other results from biosensors based on piezoelectric resonant
membranes for biochemical detection indicate that resolutions close to
300 femtograms/Hz can be achieved (Nicu et al. 2005).
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 281
14.5 Biosensors to Detect Pathogens
Among the biological sensing components that can be used by optical biosensors are
aptamers, which are single strands of DNA or RNA containing include aptamers
with a three-dimensional structure, capable of recognizing specific molecules by
binding to them (IBIAN 2020; Tombelli et al. 2009). There are several advantages of
using aptamers, such as their high affinity and specificity, as they can be synthesized
in a customized way (IBIAN 2020), their thermal and chemical stability, their low
cost, and, in general, their numerous applications (Song et al. 2012). In plants,
optical biosensors have been used for detecting pathogens of agricultural or epide-
miological importance, as well as for detecting the presence of substances of interest,
including allergens, toxins, and heavy metals (Sadanandom 2010; Michelini et al.
2008). Particularly, aptamer-based biosensors promise to be an ideal technique for
the detection of commercially important metabolites, displacing traditional detection
methods that can be time-consuming and resource-intensive to perform
(Sadanandom 2010; Amini and Saify 2017). An important application of optical
biosensors in plant biology is the assessment of the physiological state of a plant
according to the content of secondary metabolites present in a given tissue (Coppedè
et al. 2017). Secondary metabolites are compounds that play an important role in the
interaction of plants with the environment, as their synthesis constitutes a physio-
logical defence response against biotic stress conditions (insect attacks, infections,
etc.) or abiotic stress conditions (droughts, extreme temperatures, etc.) (Pagare 2015;
Zimdahl 1999; Kumar and Kumar 2018).
14.5.1 Biosensor Applications in Zea mays
Goron and Raizada (2016), studied more than 1500 maize seedling leaf extracts,
which were treated with different N rates under uptake/assimilation systems. In situ
imaging allowed demonstrated in all leaves sampled those multifactorial interactions
allow Gln accumulation at the position within each leaf. In situ imaging localized
Gln in leaf veins for the first time. These authors reported to GlnLux biosensor,
which can measure relative Gln levels inexpensively with tiny amounts of tissue.
Liu et al. (2020) designed an electrochemical DNA biosensor based on nitrogen-
dropped graphene nanosheets and gold nanoparticle nanocomposites for event-
specific detection of the transgenic maize MIR162. This biosensor exhibits high
reproducibility of fabrication, high selectivity, and good stability. The response
choice they chose to monitor the target DNA hybridization event was methylene
blue differential pulse voltammetry. Under optimal conditions, the peak current
increased linearly with the logarithm of the DNA concentration in the range of
1.0 10
14
to 1.0 10
8
M, and the detection limit was 2.52 10–15 M. The
biosensor was effectively applied to detect MIR162 in real samples, demonstrating
its potential as an effective and efficient tool for transgenic crop identification
analysis.
282 L. G. López-Valdez et al.
Zeng et al. (2013) reported a biosensor based on Surface Plasmon resonance
(SPR) to detect maize chlorotic mottle virus (MCMV). The effects of coupling
reaction time and antibody concentration on detection sensitivity indicated that the
developed SPR biosensor showed highly specific recognition for both purified
MCMV and crude extracts from real-world samples.
Fumonisins are natural toxins produced by fungi species of the genus Fusarium.
Fumonisins B1, B2 and B3 (also called FB1, FB2) are found in foods and were
discovered in 1988. Fumonisins have health effects on livestock and other animals,
contributing to health problems such as cancer or birth defects. The fungi
F. verticillioides,F. proliferatum and F. fujikuroi are species that emerge in warm
climates and tropical zones, and are the main contaminants of corn. An evanescent
wave fiber-optic biosensor, which was competitive for fumonisin B1 and
non-competitive for aflatoxin B1 was developed by Maragos and Thompson (1999).
14.5.1.1 Bacterial Detection Biosensors in Maize
Aflatoxin B1 (AFB1) is mycotoxin, carcinogenic, nephrotoxic, and hepatotoxic in
humans and animals. Mycotoxins infect maize. Zearalenone is a mycotoxin consid-
ered as a xenoestrogen, similar to natural estrogens because it binds to estrogen
receptors leading to various reproductive diseases, especially hormone imbalance.
ZEN has toxic carcinogenic effects on human health. Valuable electrochemical
detection assays based on nanomaterials included several immunodetection studies
for the highly sensitive determination of several ZEN families (Sohrabi et al. 2022;
Shahi et al. 2021).
Wang et al. (2021) developed an immunochromatographic assay with polysty-
rene microspheres to detect AFB1 mycotoxin sensitively and quantitatively. The
reliability of the microspheres was confirmed with Liquid Chromatography-Tandem
Mass Spectrometry.
A wide range of specific biosensors for mycotoxins and bacterial toxins are
available for environmental and food control (Guilbault et al. 1993; Carter et al.
1994; Delehanty and Ligler 2002; Palleschi et al. 1997; Tran and Pandey 1992).
Boiarski et al. (1996) developed an integrated optical biosensor to analyze aflatoxin
B in maize plants to analyze ricin and saxitoxin, based on the impedance of an
ultrathin platinum film with an immobilized layer of antibodies against staphylococ-
cal enterotoxin B. On the other hand, Kumar et al. (1994) designed an evanescent
wave immunosensors detecting botulinum with ultra-low detection limits while
Ogert et al. (1992) obtained a highly specific reaction fiber-optic based biosensor
that uses the evanescent wave of a conical optical of a sensitive and rapid
immunosensor type to detect Clostridium botulinum toxin A by means of a rhoda-
mine label at concentrations of 5 ng/mL.
The technique lateral flow immunoassays are based on gold colloidal
nanoparticles for the detection of various plant pathogens, such as potato virus X
(Drygin et al. 2012), Fusarium species (Xu et al. 2019), and P. stewartii subsp.
stewartii (Pss) bacteria in maize was also detected (Zhang et al. 2014; Feng et al.
Biosensor type Technique Pathogen References
2015). The causal agent of late blight in potatoes and tomatoes was detected by a
combined lateral flow biosensor (Zhan et al. 2018) and integrated asymmetric PCR,
mediated by a universal primer (Table 14.3).
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 283
Table 14.3 Biosensors developed for the detection of plant pathogens in Zea mays
Bio-
recognition
element
Detection
limit
Optical Antibody Lateral flow
immunoassay
Pantoea
stewartia
sbusp.
stewartii
538 pg/mL Feng et al.
(2015)
Optical Antibody Lateral flow
immunoassay
Pantoea
stewartia
sbusp.
stewartii
5.38 pg/mL Zhang
et al.
(2014)
Electrochemical DNA Quartz crystal
microbalance-
based
detection
Maize
chlorotic
mottle
virus
2.5 10
5
pg/
mL
Huang
et al.
(2014)
Wen et al. (2015) generated a new low-cost and easy-to-use real-time technology
with the objective of detecting biotic stress in the field; this system consisted of a
lateral flow detection biosensor integrated into a corn leaf, while microspheres
conjugated with analyte-specific and concentration-specific capture antibodies are
non-invasively injected. In order to achieve infiltration and immobilization in the
corn leaf, the size of the microspheres was optimized. In addition, a fluorescent
biomarker, fluorescein, is detected in a living corn plant.
Syringe agroinfiltration is a system for introducing genes into host plants using
Agrobacterium (Chen et al. 2013). It has been successful in several plant species
(Wroblewski et al. 2005) because it uses simple equipment. The method consists of
filling a needleless syringe with a solution containing Agrobacterium and injecting it
manually. The tip is positioned on the dorsal side of an intact leaf. A temporary color
change from light green to dark green indicates infiltration of Agrobacterium into the
leaf (Annamalai et al. 2006). Wen et al. (2015) complemented this biosensor
technology using a live corn leaf as a lateral flow “test strip”, but injecting and
immobilizing antibody-conjugated microspheres in the leaf interstitium (Fig. 14.3).
Detection and identification of plant pathogens are essential to improve crop
yields by PCR or ELISA assay, which are time-consuming and destructive to the
sample. Raman spectroscopy (RS) is a non-invasive and non-destructive analytical
technique to know the chemical structure of the sample. Faber and Kurousky (2018)
studied that Raman spectrometer, in combination with chemometric analysis in a
stand-alone, portable and sample-independent manner, could distinguish between
healthy and diseased maize (Z. mays) kernels, as well as in other crops, between
different diseases, with 100% accuracy (Faber and Kurousky 2018). Faber and
Kurousky (2018) demonstrated that RS can be used to detect and identify plant
pathogens in intact maize kernels. These researchers obtained Raman spectra of
individual maize kernels using a Rigaku Progeny ResQ portable spectrometer
equipped with a 1064 nm Nd:YAG laser. These spectra show the average spectra
of a healthy corn and the corn infected by the plant pathogenic fungi Diplodia spp.,
Fusarium spp., A. niger, and Aspergillus flavus.
284 L. G. López-Valdez et al.
Fig. 14.3 One-step lateral flow detection method of plant-pathogen markers in live maize leaves.
Detection of a fluorescent biomarker using antibody-conjugated microspheres (a) Detection of
non-fluorescent biomarkers by incorporation of stimuli-sensitive colorimetric vesicles, (b) Sche-
matic of microsphere infiltration into leaf tissue (left) before infiltration and (right) after infiltration,
(c)Infiltration into a maize (Zea mays) leaf: (i)infiltration with a needleless syringe, (ii) immedi-
ately after infiltration, when the injected buffer solution is visible and (iii) 10 min after infiltration,
when the injected buffer has evaporated without leaving visible marks. (Source: Wen et al. (2015))
Biosensors are bacterial cells containing a reporter gene (fluorescence marker),
such as a green fluorescent protein (GFP) expression cassette (Sorensen et al. 2009).
There are a limited number of reporter genes. With this method, using epifluorescent
and confocal microscopy, bacterial colonization and activity are detected at the
single-cell level in rhizosphere microsites. Götz et al. (2006) and Germaine et al.
(2004) successfully introduced GFP-tagged plasmids to monitor rhizosphere coloni-
zation of endophytic bacterial strains as Pseudomonas putida PRD16 and
Enterobacter cowanii strain PRF116. Weyens et al. (2012) investigated the ability
and colonization of plant growth promotion by endophytic P. putida strain W619
with GFP-tag insertion, without growth promotion. High background fluorescence
limits the performance and detection of biosensors as a function of sample prepara-
tion and handling.
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 285
14.6 Nanosensors
The origin of nanotechnology goes back to research by the American physicist
Richard Phillips Feynman, winner of the Nobel Prize in Physics. Important events
for the foundation of nanotechnology lie in the 1982 invention of the scanning
tunneling microscope by Swiss Gerd Binnig and German Heinrich Ruhrer, which
made it possible to observe objects on a nanometer scale. In September 2003, the
application of nanotechnology in agriculture and the food industry was discussed for
the first time at the United States Department of Agriculture (USDA) (Weiss et al.
2006; Alam et al. 2016; Agrawal and Rathore 2014). Nano-sensors are devices that
can treat and detect a fungal or bacterial infection, nutrient deficiency, or any other
phytosanitation problem, long before phenotypic symptoms appear in plants
(Fraceto et al. 2016; Rai et al. 2012). The application of nanotechnology in agricul-
ture and the food industry receives a lot of attention nowadays. Investments in
nanotechnology for food and agriculture are increasing due to its potential benefits,
which range from improved quality and safety of agricultural inputs to better
processing and higher nutritional value of agricultural inputs (Dasgupta et al.
2015). Agricultural scientists face a wide range of challenges such as stagnant
crop yields, climate change, multi-nutrient deficiencies, low macro- and micro-
nutrient use efficiency, reduced availability of arable land, declining soil organic
matter, and a shortage of water and labor for the field (Shiva, 2016). Recent research
on the use of nanotechnology in plants shows that the incorporation of synthetic
nanoparticles can increase photosynthesis and transform leaves into biochemical
sensors. The single-walled carbon nanotubes (SWNTs) coated with single-stranded
DNA infiltrate the lipid envelope of extracted plant chloroplasts and assemble with
photosynthetic proteins. The same occurred when SWNTs were released into the
living leaves of Arabidopsis thaliana through the stomata. The researchers
demonstrated that photosynthetic activity was three times higher in SWNT-
containing chloroplasts than in controls due to increased light capture by the
photosynthetic molecules. The use of nanotechnology allows the development of
potential techniques for disease management in crops. Nanoparticles can be used in
the preparation of new formulations such as insecticides, fungicides, insect
repellents, and pheromones, which is made possible thanks to the new properties
of these materials, such as their reactivity, quantum effects, and electrical
conductivity.
286 L. G. López-Valdez et al.
14.7 Nanobiosensors
These biosensors have a huge impact on precision agriculture methods. Nanotech-
nology allows monitoring to be done in real time where biosensors are linked to GPS
systems. These biosensors monitor the soil conditions and crop phenological status
over large areas of land (Nair et al. 2010). Some commercial biosensors use plant
redox enzymes. For example, superoxide dismutase is used to assess antioxidant
activity and tyrosinase (monophenol monooxygenase) to monitor phenolic contami-
nation. The enzyme laccase is used to monitor the presence of flavonoids in foods.
Some biosensors such as electronic noses are used to analyze volatile organic
compounds from diseased and healthy plants in crops such as potatoes and tomatoes.
The work of Pérez and Rubiales (2009) highlighted that nanotechnology is
opening new potential applications for agriculture, which are already being explored.
These authors also point out the potential of nanotechnology to develop nanodevices
and nano-transporters to be used as smart systems to target specific chemical
emission sites in plants.
Nanometer gold with sizes from 5 to 25 nm is used to deliver and incorporate
DNA into plant cells, while 30 nm iron oxide was used in nano-sensors to detect
pesticides at very small concentrations. These functions aid the development of
precision agriculture, minimizing contamination and allowing maximizing sustain-
able agricultural practices (Malsch et al. 2015; Subramanian et al. 2015). N toxicity
can be attributed to the following two actions: (1) chemical toxicity based on the
release of toxic ions; (2) stress or stimuli caused by surface area, particle size, and/or
shape. NPs oxide solubility has been confirmed to significantly affect plant response.
In the studies of Zhang et al. (2014), the phytotoxicity of ZnO NPs on the
germination of maize (Zea mays L.) and cucumber (Cucumis sativus L.) seeds was
investigated. Regarding root elongation, all seedlings were affected when exposed to
a concentration of 1000 mg L
1
. On their side, research by El-Temsah and Joner
(2012) determined the phytotoxic potential of iron (Fe) NPs, using three types of
particle sizes in the range of 1–20 nm, in the seed germination of barley and flax
species.
Researchers at Iowa State University have used 3 nm-sized mesoporous silica
(MSN) NPs as carriers and for the delivery of DNA and chemicals inside isolated
plant cells. The MSN NPs are chemically coated and serve as gene containers that
are then applied to the plants. This coating causes the plant to take up the particles
through the cell walls and membranes where they are inserted, activating the
biological genes in a precise and controlled manner without causing any toxic side
effects afterwards. This technique has been successfully applied to introduce NPs
into pumpkins and DNA into tobacco and corn plants (Corredor et al. 2009).
Silver can be integrated into inert materials, such as zeolite, silicate, and clay.
Silver zeolite (Ag-zeolite) is produced by replacing Na ions in the zeolite with Ag
ions; it is one of the most widely used antimicrobial agents, as it is a broad-spectrum
antimicrobial agent that kills bacteria, yeasts, and mycelia, but not the spores of heat-
resistant bacteria. Ag-zeolite incorporated into chitosan film shows strong antimi-
crobial activity against Gram-positive and -negative bacteria. Nanocomposites such
as silver silicate have been produced using a flame spray pyrolysis process and
incorporated into polystyrene. This complex showed good antibacterial activity
against Escherichia coli and Staphylococcus aureus. A green synthetic approach
for the preparation of antimicrobial silver nanoparticles has been suggested, by using
carbohydrates from sucrose, or waxy and soluble corn starch (Zea mays L.).
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 287
Carbohydrates act as reducing agents and as a template for the realization of silver
nanoparticles with excellent antibacterial activity.
14.8 Carbon Nanotubes
In the agri-food sector, water intake, crop growth rates, and uptake of essential nutrients
are enhanced by the use of multi-walled carbon nanotubes (Scrinis and Lyons 2007).
One of the functions of carbon nanotubes is the promotion of plant growth without any
inhibitory, toxic or adverse effects on plants (Srilatha 2011). Rameshaiah et al. (2015)
have reported that a concentration of 50 μgmL
1
with multi-walled carbon nanotubes
increased the root and shoot length, and improved the seed germination time and
growth of crops such as maize (Zea mays L.), wheat (Triticum aestivum L.), groundnut
(Arachis hypogaea L.), and garlic (Allium sativum L.).
14.9 Conclusions
Corn (Zea mays L.) is a crop of great importance that is exposed to factors such as the
presence of disease-causing phytopathogens, which limit the maximum expression
of its productive potential. Nanosensors can prevent the spread of diseases between
crops by non-destructively detecting the presence of plant pathogens before
symptoms appear.
References
Agrawal S, Rathore P (2014) Nanotechnology pros and cons to agri-food: a review. Int J Curr
Microbiol App Sci 3(3):43–55. https://www.ijcmas.com/vol-3-3/Shweta%20Agrawal%20and
%20Pragya%20Rathore.pdf
Akyilmaz E, Dinckaya E (2000) A mushroom (Agaricus bisporus) tissue homogenate based alcohol
oxidase electrode for alcohol determination in serum. Talanta 53:505–509
Alam AR, Ismat F, Sayeed K, Khan A, Akhtar S, Farooqui A, Siddiqui MH (2016) Application of
nanotechnology in agri-food and food science. World J Pharm Sci 4(7):45–54. http://www.
wjpsonline.org/admin/uploads/Oc52t6.pdf
Ali Q, Ahmar S, Sohail MA, Kamran M, Ali M, Saleem MH, Ali S (2021) Research advances and
applications of biosensing technology for the diagnosis of pathogens in sustainable agriculture.
Environ Sci Pollut Res 28(8):9002–9019
Amine A, Mohammadi H, Bourais I, Palleschi G (2006) Enzyme inhibition-based biosensors for
food safety and environmental monitoring. Biosens Bioelectron 21:1405–1423
Amini M, Saify H (2017) Application of aptamers in medicinal plants. MedCrave. https://
medcraveonline.com/MOJBM/application-of-aptamers-inmedicinal-plants.html
288 L. G. López-Valdez et al.
Annamalai K, Puri IK (2006) Combustion science and engineering, 1st edn. Boca Raton CRC
Press, 1184 p
Ammar AS (2018) Nanotechnologies associated to floral resources in agri-food sector. Acta Agron
67(1):146–159
Ángeles A, Cañizares M (2004) Desarrollo de un sistema sensor para la cuantificación de glucosa en
jugos de frutas. Rev Soc Quím Méx 8:106–110
BănicăFG (2012) Chemical sensors and biosensors: fundamentals and applications, 1st edn. Wiley,
Chichester, p 541
Bassi AS, Lee E, Zhu JX (1998) Carbon paste mediated, amperometric, thin film biosensors for
fructose monitoring in honey. Food Res Int 31:119–127
Bogani P, Minunni M, Spiriti MM, Zavaglia M, Tombelli S, Buiatti M, Mascini M (2008) Food
Chem 113:658
Boiarski AA, Busch JR, Brody RS, Ridgway RW, Altman WP, Golden C (1996) Proc SPIE-Int Soc
Opt Eng 2686:45–52
Capobianco JA, Armstrong CM, Lee J, Gehring AG (2021) Detection of pathogenic bacteria in
large volume food samples using an enzyme-linked immunoelectrochemical biosensor. Food
Control 119:107456
Carter RM, Lubrano GJ, Guilbault GG (1994) Life Chem Rep 11:271–277
Centonze D, Zambonin CG, Palmisano F (1997) Determination of glucose in nonalcoholic
beverages by a biosensor coupled with microdialysis fiber samplers. J AOAC Int 80:829–833
Chen C, Xie Q, Yang D, Xiao H, Fu Y, Tan Y, Yao S (2013) Recent advances in electrochemical
glucose biosensors: a review. RSC Adv 3(14):4473–4491
Coppedè N, Janni M, Bettelli M (2017) A in vivo biosensing, biomimetic electrochemical transistor
with applications in plant science and precision farming. Sci Rep 7:16195. https://doi.org/10.
1038/s41598-017-16217-4
Corredor E, Testillano P, Coronado M, González P, Fernández P, Marquina C, Ibarra R, de la
Fuente, Rubiales D, Pérez A, Risueño M (2009) Nanoparticle penetration and transport in living
pumpkin plants: in situ subcellular identification. BMC Plant Biol 9:1–11
Dasgupta N, Ranjan S, Mundekkad D, Ramalingam C, Shanker R, Kumar A (2015) Nanotechnol-
ogy in agro-food: from field to plate. Food Res Int 69:381–400
Datskos PG, Lavrik VN, Sepaniak MJ (2005) Chemical and biological sensors based on
microcantilevers. Kluwer Academic Publishers
Delehanty JB, Ligler FS (2002) Anal Chem 74:5681–5687
Drygin YF, Blintsov AN, Grigorenko VG, Andreeva IP, Osipov AP, Varitzev YA (2012) Highly
sensitive field test lateral flow immunodiagnostics of PVX infection. Appl Microbiol Biotechnol
93:179–189
Dyussembayev K, Sambasivam P, Bar I, Brownlie JC, Shiddiky MJA, Ford R (2021) Biosensor
technologies for early detection and quantification of plant pathogens. Front Chem 9:63624.
https://doi.org/10.3389/fchem.2021.636245
Eggins BR (2002) Chemical sensors and biosensors. Wiley, Chichester
Eggins BR, Hickey C, Toft SA, Zhou DM (1997) Determination of flavonols in beers with tissue
biosensors. Anal Chim Acta 347:281–288
Ekinci KL, Huang XMH, Roukes ML (2004) Ultrasensitive nanoelectromechanical mass detection.
Appl Phys Lett 84:4469
El-Temsah Y, Joner E (2012) Impact of Fe and Ag nanoparticles on seed germination and
differences in bioavailability during exposure in aqueous suspension and soil. Environ Toxicol
27:42–49
Faber C, Kurousky D (2018) Detection and identification of plant pathogens on maize kernels with
a hand-held Raman spectrometer. Anal Chem 90:3009–3012
Feng M, Kong D, Wang W, Liu L, Song S, Xu C (2015) Development of an
immunochromatographic strip for rapid detection of Pantoea stewartii subsp. stewartii. Sensors
15:4291–4301. https://doi.org/10.3390/s150204291
Fraceto L, Grillo R, de Medeiros G, Scognamiglio V, Rea G, Bartolucci C (2016) Nanotechnology
in agriculture: which innovation potential does it have? Front Environ Sci 4:1–5
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 289
Germaine K, Keogh E, Garcia-Cabellos G, Borremans B, Lelie D, Barac T, Oeyen L, Vangronsveld
J, Moore FP, Moore ERB, Campbell CD, Ryan D, Dowling DN (2004) Colonization of poplar
trees by gfp expressing bacterial endophytes. FEMS Microbiol Ecol 48:109–118
Gonzalez RV, Garcia IE, Ruiz GO, Gago LC (2005) Aplicaciones de biosensores en la industria
agroalimentaria. Technical report. Universidad complutense de Madrid
Goron TL, Raizada MN (2016) Biosensor-based spatial and developmental mapping of maize leaf
glutamine at vein-level resolution in response to different nitrogen rates and uptake/assimilation
durations. BMC Plant Biol 16:230
Götz M, Gomes NCM, Dratwinski A, Costa R, Berg G, Peixoto R, Mendonça-Hagler L, Smalla K
(2006) Survival of gfp–tagged antagonistic bacteria in the rhizosphere of tomato plants and their
effects on the indigenous bacterial community. FEMS Microbiol Ecol 56:207–218
Guilbault GG, Sibley DET, Carter RM, Lubrano GJ, Nato S (1993) Ser Ser E 252:377–385
Huang X, Xu J, Ji HF, Li G, Chen H (2014) Quartz crystal microbalance based biosensor for rapid
and sensitive detection of maize chlorotic mottle virus. Anal Methods 6:4530–4536. https://doi.
org/10.1039/c4ay00292j
IBIAN (2020) Aptámeros. IBIAN Technologies. https://www.ibiantech.com/aptameros/
Katrlık J, Svorc J, Stred’ansky M, Miertus M (1998) Composite alcohol biosensors based on solid
binding matrix. Biosens Bioelectron 13:183–191
Kelly SC, O’Connell PJ, O’Sullivan CK, Guilbault GG (2000) Development of an interferent free
amperometric biosensor for determination of L-lysine in food. Anal Chim Acta 412:111–119
Khiyami MA, Almoammar H, Awad YM, Alghuthaymi MA, Abd-Elsalam KA (2014) Plant
pathogen nanodiagnostic techniques: forthcoming changes? Biotechnol Biotechnol Equip
28(5):775–785
Kumar V, Arora K (2020) Trends in nano-inspired biosensors for plants. Mater Sci Energy Technol
3:255–273
Kumar I, Kumar R (2018) Production of secondary metabolites in plants under abiotic stress: an
overview. Signif Bioeng Biosci. ISSN 2637-8078. https://crimsonpublishers.com/sbb/pdf/
SBB.000545.pdf
Kumar P, Colston JT, Chambers JP, Rael ED, Valdes JJ (1994) Biosens Bioelectron 9:57–63
Kwong AWK, Gründig B, Hu J, Renneberg R (2000) Comparative study of hydrogel-immobilized
L-glutamate oxidases for a novel thick-film biosensor and its application in food samples.
Biotechnol Lett 22:267–272
Li Z, Yu T, Paul R, Fan J, Yang Y, Wei Q (2020) Agricultural nanodiagnostics for plant diseases:
recent advances and challenges. Nanoscale Adv 2(8):3083–3094
Liawruangrath S, Oungpipat W, Watanesk S, Liawruangrath B, Dongduen C, Purachat P (2001)
Asparagus-based amperometric sensor for fluoride determination. Anal Chim Acta 448:37–46
Liu F, Li K, Zhang Y, Ding J, Wen T, Pei X, Yan Y, Ji W, Liu J, Zhang X, Li L (2020) An
electrochemical DNA biosensor based on nitrogen-doped graphene nanosheets decorated with
gold nanoparticles for genetically modified maize detection. Microchim Acta 187(10):574
Lucarelli F, Tombelli S, Minunni M, Marrazza G, Mascini M (2008) Anal Chim Acta 609:139
Luong JHT, Male KB, Glennon JD (2008) Biosensor technology: technology push versus market
pull. Biotechnol Adv 26:492–500
Malsch I, Subramanian V, Semenzin E, Hristozov D, Marcomini A (2015) Supporting decision-
making for sustainable nanotechnology. Environ Sys Decis 35:54–75
Mannelli I, Minunni M, Tombelli S, Mascini M (2003) Quartz crystal microbalance (QCM) affinity
biosensor for genetically modified organisms (GMOs) detection. Biosens Bioelectron 18:129
Maragos CM, Thompson VS (1999) Fiber-optic immunosensor for mycotoxins. Nat Toxins 7(6):
371–376
Marconi E, Panfili G, Messia MC, Cubadda R, Compagnone D, Palleschi G (1996) Fast analysis of
lysine in food using protein microwave hydrolysis and an electrochemical biosensor. Anal Lett
29:1125–1137
Mascini MST (2008) Biosensors for biomarkers in medical diagnostics. Biomarkers 13:637–657
McNaught A, Wilkinson A (1997) Compendium of chemical terminology, 2nd edn. (The “Gold
Book”), Blackwell Scientific Publications, Oxford
290 L. G. López-Valdez et al.
Mello LD, Kubota LT (2002) Review of the use of biosensors as analytical tools in the food and
drink industries. Food Chem 77:237–256
Michelini E, Simoni P, Cevenini L, Mezzanotte L, Roda A (2008) New trends in bioanalytical tools
for the detection of genetically modified organisms: an update. Anal Bioanal Chem 392(3):
355–367
Miertus S, Katrlík J, Pizzariello A, Stred’anský M, Svitel J, Svorc J (1998) Amperometric
biosensors based on solid binding matrices applied in food quality monitoring. Biosens
Bioelectron 13:911–923
Minunni M, Tombelli S, Fonti J, Spiriti MM, Mascini M, Bogani P, Buiatti M (2005) Detection of
fragmented genomic DNA by PCR-free piezoelectric sensing using a denaturation approach. J
Am Chem Soc 127:7966
Nair R, Varghese SH, Nair BG, Maekawa T, Yoshida Y, Kumar DS (2010) Nanoparticulate
material delivery to plants. Plant Sci 179(3):154–163. https://doi.org/10.1016/j.plantsci.2010.
04.012
Nasrullah U (2021) Review on biological techniques, microbial food testing approaches, biosensors
principles and applications. Sch Bull 7(4):82–86
Nicu L, Guirardel M, Chambosse F, Rougerie P, Hinh S, Trevisiol E, Francois JM, Majoral JP,
Caminade AM, Cattan E, Bergaud C (2005) Resonating piezoelectric membranes for
microelectromechanically based bioassay: detection of streptavidin-gold nanoparticles interac-
tion with biotinylated DNA. Sens Actuators B
Niculescu M, Mieliauskiene R, Laurinavicius V, Csöregi E (2003) Simultaneous detection of
ethanol, glucose and glycerol in wines using pyrroloquinoline quinone dependent
dehydrogenases based biosensors. Food Chem 82:481–489
O’Sullivan CK, Guilbautl GG (1999) Commercial quartz cristal microbalances-theory and
applications. Biosens Bioelectron 14(8–9):663–670
Ogert RA, Brown JE, Singh BR, Shriver-Lake LC, Ligler FS (1992) Anal Biochem 205:306–312
Olschewski H, Erlenkötter A, Zaborosch C, Chemnitius GC (2000) Screen-printed enzyme sensors
for l-lysine determination. Enzym Microb Technol 26:537–543
Pagare S (2015) Secondary metabolites of plantas and their role:overview. Curr Trends Biotechnol
Pharm 9(3):293–304
Palleschi G, Compagnone D, Moscone D (1997) Construction and application of highly selective
sensors and biosensors using nonconducting electropolymerized films. VTT Symp 177:141–
160
Palmisano F, Rizzi R, Centonze D, Zambonin PG (2000) Simultaneous monitoring of glucose and
lactate by an interference and cross-talk free dual electrode amperometric biosensor based on
electropolymerized thin films. Biosens Bioelectron 15:531–539
Patandjengi B, Junaid M, Muis A (2021) The presence of bacterial stalk rot disease on corn in
Indonesia: a review. In: IOP conference series: earth and environmental science, vol 911(1). IOP
Publishing, p 012058
Pérez A, Rubiales D (2009) Nanotechnology for parasitic plant control. Pest Manag Sci 65:540–545
Patel PD (2002) (Bio)sensors for measurement of analytes implicated in food safety: a review.
Trends Anal Chem 21(2):96–115
Petrlova J, Krizkova S, Supalkova V, Masarik M, Adam V, Havel L, Kramer KJ, Kizek R (2007)
The determination of avidin in genetically modified maize by voltametric techniques. Plant Soil
Environ 53(8):345–349
Prasad R, Kumar V, Prasad KS (2014) Nanotechnology in sustainable agri-food: present concerns
and future aspects. Afr J Biotechnol 13(6):705–713. https://doi.org/10.5897/AJBX2013.13554
Prodromidis MI, Tzouwara-Karayanni SM, Karayannis MI, Vadgama PM (1997)
Bioelectrochemical determination of citric acid in real samples using a fully automated flow
injection manifold. Analyst 122:1101–1106
Qsense (2011) QSense. http://www.q.sense.com technical report
Rai V, Acharya S, Dey N (2012) Implications of nanobiosensors in agriculture. J Biomater
Nanobiotechnol 3:315–324
Ramanathan K, Jönsson BR, Danielsson B (2001) Sol-gel based thermal biosensor for glucose.
Anal Chim Acta 427:1–10
14 Utilization of Biosensors in the Identification of Bacterial Diseases in Maize 291
Rameshaiah GN, Pallavi J, Shabnam S (2015) Nano fertilizers and nano sensors—an attempt for
developing smart agri-food. Int J Eng Res Gen Sci 3(1):314–320. http://pnrsolution.org/
Datacenter/Vol3/Issue1/40.pdf
Rebollar-Pérez G, Campos-Teran J, Ornelas-Soto N, Méndez-Albores A, Torres E (2020) Biosen-
sor base on oxidative enzymes for detection of environmental pollutants. Biocatalysis 1:118–
129
Sadanandom A (2010) Biosensors in plants. Curr Opin Plant Biol 13(6):736–743
Sarkar P, Tothill IE, Setford SJ, Turner APF (1999) Screen-printed amperometric biosensors for the
rapid measurement of L- and D-amino acids. Analyst 124:865–870
Scrinis G, Lyons K (2007) The emerging nano-corporate paradigm: nanotechnology and the
transformation of nature, food and agri-food systems. Int J Sociol Food Agric 15(2):22–44.
http://www.ijsaf.org/archive/15/2/scrinis_lyons.pdf
Sekine Y, Hall EAH (1998) A lactulose sensor based on coupled enzyme reactions with a ring
electrode fabricated from tetrathiafulvalen-tetracyanoquinodimetane. Biosens Bioelectron 13:
995–1005
Shahi SC, Dadmehr M, Korouzhdehi B, Tavassoli A (2021) A novel colorimetric biosensor for
sensitive detection of aflatoxin mediated by bacterial enzymatic reaction in saffron samples.
Nanotechnology 32(50):505503
Shiva V (2016) The violence of the green revolution: third world agriculture, ecology, and politics.
University Press of Kentucky, Lexington, KY
Shrivastava A, Sharma RK (2021) Biosensors for the detection of mycotoxins. Toxin Rev:1–21
Silber A, Bräuchle C, Hampp N (1994) Dehydrogenase-based thick-film biosensors for lactate and
malate. Sensor Actuat B Chem 18:235–239
Smart A, Crew A, Pemberton R, Hughes G, Doran O, Hart JP (2020) Screen-printed carbon-based
biosensors and their applications in agri-food safety. TrAC Trends Anal Chem 127:115898
Sohrabi H, Majidi MR, Arbabzadeh O, Khaaki P, Pourmohammad S, Khataee A, Orooji Y (2022)
Recent advances in the highly sensitive determination of zearalenone residues in water and
environmental resources with electrochemical biosensors. Environ Res 204:112082
Song K, Lee S, Ban C (2012) Aptamers and their biological applications. Sensors (Basel) 12(1):
612–631
Sorensen J, Ncolaisen MH, Ron E, Simonet P (2009) Molecular tools in rhizosphere microbiology-
from single-cell to whole-community analysis. Plant Soil 321:483–512
Srilatha B (2011) Nanotechnology in agri-food. J Nanomed Nanotechnol 2(7):123–128. https://doi.
org/10.4172/2157-7439.1000123
Subramanian V, Semenzin E, Hristozov D, Zondervan E, Linkov I, Marcomini A (2015) Review of
decision analytic tools for sustainable nanotechnology. Environ Sys Decis 35:29–41
Sun H, Zhang Y, Fung Y (2006) Flow analysis coupled with PQC/DNA biosensor for assay of
E. coli based on detecting DNA products from PCR amplification. Biosens Bioelectron 22:506
Thévenot DR, Toth K, Durst RA, Wilson GS (2001) Electrochemical biosensors: recommended
definitions and classification. Biosens Bioelectron 16:121–131
Tombelli S, Mascini M, Scherm B, Battacone G, Migheli Q (2009) DNA biosensors for the
detection of aflatoxin producing Aspergillus flavus and A. parasiticus. Monatsh Chem 140(8):
901–907
Tran MC, Pandey PC (1992) Biosensors for environmental applications: future development trends.
Bull Electrochem 8:199–204
Turner AP, Newman JD (1998) An introduction to biosensor. In: Gateshead TW (ed) Biosensor for
food analysis. Athenaeum, London, pp 13–27
Velasco-García M, Mottram T (2003) Biosensor technology addressing agricultural problems.
Biosyst Eng 84(1):1–12
Voke E, Pinals RL, Goh NS, Landry MP (2021) In planta nanosensors: understanding biocorona
formation for functional design. ACS Sens 6(8):2802–2814
Volkov AG (2000) Green plants: electrochemical interfaces. J Electroanal Chem 483:150–156
292 L. G. López-Valdez et al.
Volkov AG, Mwesigwa J (2001) Interfacial electrical phenomena in green plants: action
potentials. In: Volkov AG (ed) Liquid interfaces in chemical, biological, and pharmaceutical
applications. M Dekker, New York, pp 649–681
Volkov AG, Deamer DW, Tanelian DI, Markin VS (1998) Liquid interfaces in chemistry and
biology. Wiley, New York
Wang J, Li X, Shen X, Zhang A, Liu J, Lei H (2021) Polystyrene microsphere-based
immunochromatographic assay for detection of aflatoxin B1 in maize. Biosensors 11:200.
https://doi.org/10.3390/bios11060200
Weiss B, Schaefer U, Zapp J, Lamprecht A, Stallmach A, Lehr C (2006) Nanoparticles made of
fluorescencelabelled poly (L-lactide-co-glycolide): preparation, stability, and biocompatibility.
J Nanosci Nanotechnol 6:3048–3056
Wen JT, Castro C, Tsutsui H (2015) In planta microsphere-based lateral flow leaf biosensor in
maize. J Lab Autom 20(4):500–505
Weyens N, Boulet J, Adriaensen D, Timmermans JP, Prinsen E, Van Oevelen S, D’Haen J, Smeets
K, van der Lelie D, Taghavi S, Vangronsveld J (2012) Contrasting colonization and plant
growth promoting capacity between wild type and a gfp-derative of the endophyte Pseudomo-
nas putida W619 in hybrid poplar. Plant Soil 356(1):217–230
Wijesuriya DC, Rechnitz GA (1993) Biosensors based on plant and animal tissues. Biosens
Bioelectron 8:155–160
Wroblewski T, Tomczak A, Michelmore R (2005) Optimization of Agrobacterium-mediated
transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnol J 3:
259–273. https://doi.org/10.1111/j.1467-7652.2005.00123.x
Wu VCH, Chen SH, Lin CS (2007) Real-time detection of Escherichia coli O157:H7 sequences
using a circulating-flow system of quartz crystal microbalance. Biosens Bioelectron 22:2967
Xu S, Zhang G, Fang B, Xiong Q, Duan H, Lai W (2019) Lateral flow immunoassay based on
polydopamine-coated gold nanoparticles for the sensitive detection of zearalenone in maize.
ACS Appl Mater Int 11:31283–31290. https://doi.org/10.1021/acsami.9b08789
Zeng C, Huang X, Jiangmin X, Li G, Ma J, Ji H-F, Zhu S, Chen H (2013) Rapid and sensitive
detection of maize chlorotic mottle virus using surface plasmon resonance-based biosensor.
Anal Biochem 440(1):18–22. https://doi.org/10.1016/j.ab.2013.04.026
Zhang W, Turner KL (2005) Application of parametric resonances amplification in a single-crystal
silicon micro-oscillator based mass sensor. Sens Actuators A 122:23–30
Zhang F, Zou M, Chen Y, Li J, Wang Y, Qi X (2014) Lanthanide labeled immunochromatographic
strips for the rapid detection of Pantoea stewartii subsp. stewartii. Biosens Bioelectron 51:29–
35. https://doi.org/10.1016/j.bios.2013.06.065
Zhang W, Fan X, Li J, Ye T, Mishra S, Zhang L, Chen S (2021) Exploration of the quorum-
quenching mechanism in Pseudomonas nitroreducens W-7 and its potential to attenuate the
virulence of Dickeya zeae EC1. Front Microbiol 12
Zhan MY, Bin T, Lan L, Hao T, Li JT, Jian HJ (2018) Spinach-based fluorescent light-up
biosensors for multiplexed and label-free detection of microRNAs. Chem Commun 54(24):
3010–3013
Zimdahl RL (1999) Fundamentals of weed science, 3rd edn. Academic Press, London, p 689p.
http://base.dnsgb.com.ua/files/book/Agri-food/Weed/Fundamentals-of-Weed-Science.pdf
Part IV
Nanobiotechnology
Nanomaterials for Integrated Crop Disease
Management 15
Muhammad Ashar Ayub, Asad Jamil, Muhammad Shabaan,
Wajid Umar, Muhammad Jafir, Hamaad Raza Ahmad,
and Muhammad Zia ur Rehman
Abstract
Because of the rising food demand, climate change, and environmental pollution,
the global agricultural system is under increasing stress. In the current era,
nanotechnology has demonstrated several applications in a variety of areas,
including agriculture, medicine, and drugs. Due to their nano size, the increased
surface to volume ratio, and unique morphology, nanoparticles have different
characteristics than bulk materials. Nanoparticulated systems are being developed
for use as fertilizers, insecticides, herbicides, sensors, and quality enhancers in
agriculture. The present chapter discusses the use of nanoparticles (NPs) to
improve sustainable agriculture and the environment by managing plant diseases
directly as well as indirectly. The use of nanoparticles in plant disease control is a
potential method for dealing with global concerns and ensuring sustainable crop
production. This chapter will cover the basics of nanoparticles (NPs) and their
uses in plant disease control. Plant disease management via the use of
non-conventional nano-pesticides and fertilizer can play a pivotal role in
mitigating the global food challenges and agricultural pollution concerns.
M. A. Ayub (*) · A. Jamil · M. Shabaan · H. R. Ahmad · M. Zia ur Rehman
Insitutue of Soil and Environmental Sciences, University of Agriculture, Faisalabad, Faisalabad,
Punjab, Pakistan
W. Umar
Institute of Environmental Science, Hungarian University of Agriculture and Life Sciences,
Gödöllő, Hungary
M. Jafir
Department of Entomology, University of Agriculture, Faisalabad, Faisalabad, Pakistan
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_15
295
296 M. A. Ayub et al.
Keywords
Nanoparticles · Nano-pesticides · Nano-fertilizers · Nano-fungicides ·
Bioavailability
15.1 Introduction
Agricultural pests and pathogens are responsible for 20–40% of crop losses each
year globally (Worrall et al. 2018; Mesterházy et al. 2020). Despite many
advantages, such as high availability, quick action, and effectiveness, pesticides
exert negative impacts on non-target species, resulting in insecticide resistance.
Furthermore, during or after the application, about 90% of applied pesticides are
lost (Ghormade et al. 2011; Willkommen et al. 2021; Spinozzi et al. 2021). So, there
is a greater need to produce efficient, high-performance, and low-persisting
pesticides that are also environmentally friendly (Hatami et al. 2021). Nanotechnol-
ogy has helped to make new agricultural ideas and products that have a lot of
potential to help solve the problems (Worrall et al. 2018).
Nanoparticles (NPs) possess characteristics that differ from bulk and macroscopic
materials, and these differences influence their destiny and impact on the biotic and
abiotic components (Klaine et al. 2008; Gonçalves et al. 2021). The nanoparticles
(NPs) are nanometer-sized particles that have shown some beneficial properties for
sensing and detecting biological activities and structures in living bodies (Singh et al.
2008; Nie et al. 2021). Their size, large surface area, reactivity, absorbance, and
aggregation govern their adherence to the soil as well as their subsequent mobility
and movement (Borm et al. 2006; Xu et al. 2022). Although the NPs are used as
antimicrobial agents against disease-causing bacteria, their overuse is hampering soil
biodiversity, which executes important natural functions such as plant development,
element cycling, and pollutant breakdown (Molina et al. 2006). As such,
nanomaterials (NMs) are an important component of both biotic and abiotic remedi-
ation efforts because they interact with soil contaminants, affecting their toxicity,
fate, and mobility (Usman et al. 2020). Rapid advances in nanotechnology have
prompted concerns about the incidence, distribution, destiny, and mobility of NPs in
the environment (Kurwadkar et al. 2015). Nanotechnology can help to ensure food
security by improving crop productivity because NPs have the potential to improve
plant development and production (Sadak 2019). They act as “magic bullets,”
holding fertilizers, genes, herbicides, or nano-pesticides, and concentrating their
contents on certain cellular organelles in the plant (Siddiqui et al. 2015). NPs may
be naturally or synthetically originated (Khan 2020). They can serve as a source of
nutrients by ensuring their slow and controlled release, particularly micronutrients,
and thus, limiting their access to the surrounding environmental barriers, as plants
only require a small amount of these minerals (Tripathi et al. 2015; Dimkpa and
Bindraban 2017). The NPs synthesis plays an important role in their properties.
That’s why several synthesis techniques are being researched to improve their
qualities while decreasing the manufacturing costs (Kim et al. 2013; Jamkhande
et al. 2019). Some techniques are modified to improve the mechanical, optical,
chemical, and physical characteristics of individual nanoparticles (Cho et al.
2013). A significant advancement in instrumentation has resulted in the enhance-
ment of their characterization as well as their application.
15 Nanomaterials for Integrated Crop Disease Management 297
Plants, the most significant part of the terrestrial ecosystem, play an important
role in nanoparticle uptake and transport through absorption and bioaccumulation
(Monica and Cremonini 2009). The response of plants to nanoparticles is of great
interest (Dimkpa et al. 2013; Hernandez-Viezcas et al. 2013), as the use of NPs as
nano-pesticides has the ability to revolutionize agriculture (Adisa et al. 2019). Due to
their physicochemical properties, NPs have a lot of potential in agriculture. The
NPs–plant interactions cause a range of genotoxic, physiological, and morphological
changes that must be understood for nanotechnology to be employed effectively in
agriculture, especially in integrated disease management (Nair 2016; Elmer et al.
2018). The size of plant tissues and cells is the first requirement for NP penetration.
Plants allow NPs with a diameter of 40–50 nm to easily enter and translocate into
their bodies (Sabo-Attwood et al. 2011). For penetration, NPs adopt either apoplast
or symplast transportation to travel through tissues. Plant cell NPs travel across the
extracellular space of the plasma membrane to reach plant cell vessels in apoplast
transportation (Sattelmacher 2001). Apoplast transportation enables NPs to travel
radially across the plant’s vascular system and into the central cylinder of the roots.
NPs are transported by cell sieves and plasmodesmata during symplast movements
(Roberts and Oparka 2003). This chapter is a brief review of the potential role of
nanoparticles in plant disease management.
Owing to the immense potential use of nanotechnology and nanoparticles, their
potential in pest and disease management of plants is also being explored, in which
metal-based nanoparticles are very important. This chapter is a review of all the
potential applications of nanoparticles in plant disease management.
15.2 Nanoparticles: Types, Synthesis, and Classification
The nanoparticles are a diverse class of chemical compounds made in a special way
to get particle size on the nm scale. The nanoparticles can be organic (including
dendrimers, micelles, liposomes, and ferritin) or inorganic (metal, metal oxide,
mixed, metalloid, or beneficial nutrient NPs) in nature. The most widely employed
metals for nanoparticle synthesis are aluminum (Al), zinc (Zn), cobalt (Co), silver
(Ag), copper (Cu), gold (Au), and iron (Fe). Metal oxide nanoparticles are produced
largely for their improved efficiency and reactivity. Magnetite (Fe
3
O
4
), cerium oxide
(CeO
2
), iron oxide (Fe
2
O
3
), zinc oxide (ZnO), silicon dioxide (SiO
2
), aluminum
oxide (Al
2
O
3
), and titanium oxide are some of the most frequent metal/metalloid
oxide NPs (Tiwari et al. 2008; Salavati-Niasari et al. 2008).
Nanoparticles can be manufactured in several ways, including bottom-up or
top-down methods. Bottom-up or constructive material accumulation refers to the
accumulation of material from a single atom to clusters, which are subsequently
turned into nanoparticles. Sol-gel, biosynthesis, pyrolysis, chemical vapor
deposition, and spinning are the most frequently utilized bottom-up procedures for
nanoparticle production. A top-down or destructive technique is used to reduce a
bulk material to nanometric-sized particles. Top-down nanoparticle production
methods include mechanical milling, nanolithography, laser ablation, sputtering,
and thermal breakdown. In the classification of nanoparticles, shape (2D-3D) and
particle size (spherical, rods, crystals, etc.) are important, while the chemical nature
of nanoparticles is also used to classify them (organic, inorganic, metal/metalloid/
metal oxide-based, etc), as explained in the literature reviews (Sohail et al. 2019,
2021). Figure 15.1 is a pictorial summary of the NPs’preparation methods and
classifications.
298 M. A. Ayub et al.
Characterization
Surface
Based
Surface
Area
Zeta
Potential
Physical
Shape based
Size
Shape and
optical
properties
Chemical
nature
Chemical
element
Acidic/
basic
character
Water
solubility
Origin based
Organic
Inorganic
Natural/Artifici
al
Dimension
1-D
2-D
3-D
Basic
element
Metallic
Non-
Metallic
Metal
oxide
Categories
Preparation methods
•Making nanoparticles form
bulk material via using
physical or chemical means
Top Down
•Combining molecules to
make new latices and
structural planes (crystals)
Boom Up
Nanoparticle
characterization
methods
•XRD •SEM •EDX
Fig. 15.1 Synthesis, types, and classification of nanoparticles (NPs)
15.3 Cereal Disease and NPs Interaction
The NPs can be utilized to fight arthropod pests, as well as to develop new insect
repellants, insecticides, and insecticide formulas (Barik et al. 2008). The
nanoencapsulation technology is used to deliver chemicals such as pesticides to a
specific plant as a host, with the goal of controlling insect pests. The
nanoencapsulated insecticides benefit plants by absorbing poisons (Scrinis and
Lyons 2012). Nanoencapsulation is now seen as the most promising method of
shielding host plants against insects and pests. Plants have been observed to absorb a
nano-silica-silver silicon composite that helps them cope with stress and sickness
(Brecht et al. 2003). Pathogenic bacteria that cause powdery mildew or downy
mildew in plants are believed to be effectively suppressed by an aqueous silicate
solution. It also increases plant growth and physiological development, as well as
stress and disease tolerance (Kanto et al. 2004). Plant nanotechnology also has an
important application in gene transfer technology, assisting in the provision of plant
protection via chemicals as well as DNA delivery to receptor cells of plants (Wang
et al. 2016). In this regard, nanoencapsulation is an important tool for the potentially
slow and timely release of encapsulated chemicals for a prolonged time period. This
can have a higher efficiency compared to traditional pesticides prone to runoff and
leading to the human food chain (Agrawal and Rathore 2014; Khot et al. 2012).
15 Nanomaterials for Integrated Crop Disease Management 299
15.3.1 Nano-pesticide
A nano-pesticide is a pesticide formulation or product that contains engineered
nanoparticles with biocidal properties as active ingredients (A.I), either as a whole
or as part of the designed structure (Kah and Hofmann 2014). In the presence of
specific NMs, slow degradation and regulated release of active components may
provide long-term pest control (Chhipa 2016). Nano-pesticides are required for the
effective and long-term control of a wide range of pests, and they can assist in
minimizing the use of synthetic chemicals and the environmental dangers that come
with them. Due to their tiny size, nano-pesticides function differently than regular
pesticides, and plants may absorb them more quickly (Kah et al. 2019). Kumpiene
et al. (2008) suggest that nanoparticles may be transported in two ways: dissolved
and colloidal. This explains why they act differently from other forms of solutes.
Rice (Oryza sativa L.) is a widespread staple food that is grown on vast swaths of
fertile land all over the world (Zhu et al. 2017). Approximately 90% of the world’s
rice is grown in Asia, while China is one of the world’s largest rice producers (Zahra
et al. 2018; Li et al. 2015a,b). Plant diseases are the most important biotic
restrictions on crop output in agriculture, and they have the potential to cause
worldwide food devastation (Khoa et al. 2017). The most frequent bacterial patho-
gen in rice is Xanthomonas oryzae pv. oryzae, which causes bacterial leaf blight
(Ryan et al. 2011; Udayashankar et al. 2011). Biogenic silver nanoparticles (AgNPs)
have received a great deal of interest due to their exceptional biological, physico-
chemical, and antibacterial properties in decreasing plant illness (Adil et al. 2015).
Wheat, after rice, is regarded as a basic grain due to its great nutritional content and
numerous applications (Peng et al. 2011). In spite of other biotic stress-causing
agents, various fungi have severely damaged the wheat crop, resulting in a 12.4%
yearly yield loss worldwide (Galvano et al. 2001). A nano-pesticide is a pesticide
formulation or product that contains engineered nanoparticles with biocidal
properties as active ingredients, either as a whole or as part of the designed structure
(Kah and Hofmann 2014). In the presence of specific NMs, slow degradation and
regulated release of active components may provide long-term insect control
(Chhipa 2016). Nano-pesticides are needed for the effective and long-term control
of a wide range of pests, and they can assist in reducing the use of synthetic
chemicals and the environmental dangers that come with them. Due to their tiny
size, nano-pesticides function differently than regular pesticides, and plants may
absorb them more quickly (Kah et al. 2019). Because nanoparticles (NPs) may be
delivered in two states: dissolved and colloidal, they act differently than conven-
tional solutes (Kumpiene et al. 2008).
Planthoppers are a major threat to world rice production. In China alone, they
damage over 20 million hectares of rice-growing land each year (Hu et al. 2019).
Engineered nanomaterials (ENM) have the potential to be employed as nano-
insecticides in agriculture (Adisa et al. 2019; Sun et al. 2019). The ENMs have
also been demonstrated to penetrate rice cells, interact with DNA, and boost relative
Os06g32600 expression, resulting in enhanced disease tolerance (Li et al. 2018).
Insects have developed resistance to pesticides because of their widespread usage,
raising concerns about the environment (Zhang et al. 2017a,b; Wang et al. 2018).
While omethoate, imidacloprid, and acetamiprid have shown to be effective against
wheat aphids, their poor persistence makes them unsuitable for use during
epidemics. A 40% dilution of Omethoate EC demonstrated that it had no effect on
the wheat aphids in a field experiment (Yu et al. 2019). Incorporating nanotechnol-
ogy into pesticide formulations is a new strategy for prospective organic crop growth
that reduces the indiscriminate use of synthetic pesticides, while also offering
environmentally friendly applications (Kumar et al. 2019). The United States Food
and Drug Administration has given chitin and its derivatives a safe (GRAS) desig-
nation as a food additive since they are non-toxic and have been reported to be safe
for humans, cattle, and animals. Because of their biocompatibility, biodegradability,
and lack of cytotoxicity, nano-chitin components have been widely employed in
biomedical manufacturing (Yang et al. 2020). Nano-chitin whiskers are non-toxic at
quantities less than 50 g mL
1
and exhibit a greater cytocompatibility at 200 g mL
1
(Zhao et al. 2019). Chitosan was shown to be the most efficient in pest management,
with molecular weights ranging from 2.27105 to 5.97105 g mol
1
(Badawy and
El-Aswad 2012). As a result, nano-chitin has a demonstrated pro-insecticidal effect
on chemical pesticides while causing no harm to non-target populations.
300 M. A. Ayub et al.
In an investigation by Choudhary et al. (2019), the Zn-encapsulated chitosan
nanoparticles were reported to have antifungal activity on maize crops. The potential
foliar as well as seed treatment of Zn nanoparticles was also proved to be linked with
the control of Curvularia Leaf Spot (CLS) disease in maize. The findings of Wagner
et al. (2016) conclude that Zn nanoparticles can act as a non-persistent and economi-
cal antimicrobial agent against oomycete P. tabacina. Similarly, their toxicity
against Xanthomonas oryzae pv. Oryzae is also reported by Ogunyemi et al.
(2019) in addition to their well-established antifungal properties (Navale et al.
2015; Savi et al. 2015; Wagner et al. 2016). Another important element, silver
(Ag) nanoparticles, also has been tested and their antimicrobial activity has been
reported as they can interfere with the microbial enzymatic system (Kim et al. 2017).
It is reported that nanoparticles are helpful in controlling pathogens causing
diseases like belly rot (Rhizoctonia solani), Common Root Rot (Bipolaris
sorokiniana), rice blast fungus (Magnaporthe grisea), grey mould (Botrytis
cinerea), seedling blight, foot rot, ear blight (Fusarium culmorum), cottony soft
rot (Scalrotinia sclerotiorum), colletotrichum fungal plant pathogens
(Colletotrichum gloeosporioides), and black-leg of seedlings (Pythium ultimum)
(Park et al. 2006; Gopal et al. 2011; Rai et al. 2014; Yah and Simate 2015). The
Ag nanoparticles have been reported to eliminate the effects of the sun-hemp rosette
virus (Jain and Kothari 2014). That is the reason Ag NPs are being used in some
commercial fungicides like Kocide
®
to control Alternaria solani (causative agent of
early blight disease), as reported by studies (Nejad et al. 2016). The use of Ag NPs
against insects is also reported as Ag NPs prepared from green methods exhibited
larvicidal and toxicity against the house fly (Abdel-Gawad 2018) and the mosquito
(Culex pipiens pallens), respectively (Fouad et al. 2016). The study conducted by
Ismail et al. (2016) reported that Se and Cu NPs can be an effective way of
controlling the attack of Alternaria solani on tomato plants. The third important
nanoparticle involved in the management of pests in plants is Cu, with its extraordi-
nary antimicrobial properties reported for the control of disease spread by
Xanthomonas sp. (Chhipa and Joshi 2016) and are widely being used because of
their broad-spectrum antimicrobial properties (Esteban-Tejeda et al. 2009). The Cu
nanoparticles have been reported to be effective against diseases like fusarium wilt
and early blight, which cause diseases in tomatoes (Saharan et al. 2015). Further-
more, the insecticidal aspects of Cu nanoparticles are also present, as reported by Le
Van et al. (2016), with Cu NPs in low concentration increasing the expression of Bt
toxin protein, thus improving the pest resistance of transgenic cotton. The fourth
important nanoparticle being used as nano-pesticide is silica (Si-NPs) and has been
reported by various studies as presented in Table 15.1. The Si-NPs are reported to
have lethal properties against Callosobruchus maculatus (Rouhani et al. 2012) and
are being used in commercial pesticides to control the early blight of tomatoes
(Derbalah et al. 2018) and spot diseases in dragon fruit (Tuan et al. 2018; Verma
2018). The role of Si-NPs in the control of various pests is also well reported for the
control of lesser grain borer (R. dominica), confused flour beetle (T. confusum)
(Ziaee and Ganji 2016), African cotton leafworm (Spodoptera littoralis) larvae
(El-Helaly et al. 2016), and cowpea weevil (Callosobruchus maculatus) (Rouhani
et al. 2012). Moreover, the application of Si-NPs has also been reported to control
pests strains and diseases like P. fluorescens causing pink eye potato,the bacterial
blast caused by P. syringae and P. carotovorum (Cadena et al. 2018), Staphylococ-
cus aureus, Proteus mirabilis, Pseudomonas aeruginosa (Mohammadi et al. 2016),
Listeria innocua (Ruiz-Rico et al. 2017), Escherichia coli (Mohammadi et al. 2016;
Shevchenko et al. 2017), Staphylococcus aureus, Aspergillus fumigatus (Song et al.
2018), B. subtilis, S aureus, and P. aeruginosa (Tahmasbi et al. 2018) is also well
known.
15 Nanomaterials for Integrated Crop Disease Management 301
15.3.2 Nano-fertilizers
Fortifying wheat with essential micronutrients like zinc and iron is one approach for
combating “secret hunger”in a major section of the world’s population and is also an
integral part of integrated pest management, as a healthy plant can fight diseases very
well. The availability of essential nutrients has imparted significant impacts on crop
nutrition, health, and output (Chhipa 2016). Nanoparticles improve crop yield and
ensure food safety either upon direct application to the soil or as foliar sprays to the
plants (Dimkpa and Bindraban 2017). Large amounts of micronutrients used during
fertilization can result in nutrient waste and environmental contamination. There-
fore, the application of nano-fertilizers to the crops is considered a more efficient
method due to the high penetration in the plant. “Nano fertilizers are synthesized or
modified forms of conventional fertilizers, which can enhance nutrient use efficiency
(NUE) via various mechanisms such as controlled release and target delivery.
Moreover, they can release their active ingredients in response to environmental
triggers as well as biological demands”(Solanki et al. 2015). The physical and
chemical properties of nanoscale materials vary from those of bulk materials (Nel
302 M. A. Ayub et al.
Table 15.1 Effects of various nanoparticles in plants
Type Source Dose Organism of action Effect References
ZnNPs ZnNPs formed via
green synthesis using
Sargassum vulgare
Variable dose Aspergillus, Candida and
Saccharomyces cerevisiae
Potential antifungal activity was
observed in the prepared NPs
Karkhane
et al. (2020)
ZnNPs Zn and ZnO 8 and
10 mg L
1
Peronospora tabacina (Tabaco
infecting pathogen)
Both doses as well as sources were
found to be toxic for pathogen
germination and growth, suggesting
its potential role as nano-pesticide
Wagner et al.
(2016)
ZnNPs ZnO 0–100 mgL
1
Pathogenic bacteria and fungi Strong antimicrobial activity of NPs
was observed owing to their capability
in ROS production
Navale et al.
(2015)
Zn
compounds
Zn, ZnO, ZnSO4 and
nano ZnO
Various doses Fusarium head blight on wheat
(Triticum aestivum L.)
Zn compounds in addition to existing
formulations, can help in overcoming
the deoxynivalenol formation in wheat
plant
Savi et al.
(2015)
Chitosan
NPs coated
with Zn
Zn-chitosan NPs 0.01–0.16% Maize (Zea mays) Zn-chitosan NPs proved to be helpful
in promoting maize growth, disease
control and help in nutrient
fortification
Choudhary
et al. (2019)
Se and Cu
NPs
Se and Cu NPs Foliar
application of
various doses
Tomato (Solanum lycopersicum)
under fungal pathogen Alternaria
solani attack
The exogenous application of Se and
Cu-NPs helped enhance plant growth
and control pathogen effect on the
plant by improving contents of various
inorganic and organic compounds
Ismail et al.
(2016)
Carbon Carbon nanoparticles Variable
doses
Rice (Oryza sativa) The carbon nanoparticles helped rice
plant in increasing plant growth as
well as disease resistance
Li et al.
(2018)
Silica and
silver
SiO and Ag NPs 1–2.5 g kg
1
Cowpea seed beetle Callosobruchus
maculatus F
Both NPs have shown a potential
effect on larvae mortality, suggesting
their pesticide potential
Rouhani et al.
(2012)
(continued)
Silica NPs Silica gel and silica gel
NPs
Variable
doses
Moth (Tuta absoluta) Potential toxicity of NPs was observed
for tested insects, larvae, and adults
Magda and
Hussein
(2016)
Silica NPs Silica –Early blight of tomato (Alternaria
solani)
The NPs have proven to be better
antifungal agents compared to
metalaxyl (commercially available
fungicide)
Derbalah
et al. (2018)
Silica NPs Silica NPs 1% by wt in
PDA media
Trichoderma harzianum and
rhizoctonia solani
Antifungal properties were observed Verma
(2018)
nSiO
2
–OC Oligochitosan
(OC) and nanosilica
–Dragon fruit Brown spot disease
caused by Neoscytalidium
dimidiatum fungus
The NPs treatment enhanced chitinase
production and helped in the reduction
of disease severity
Tuan et al.
(2018)
AgNPs AgNO
3
500, 1000,
2000 &
4000 mg/L
Spodoptera litura The growth index of lepidopteran
species were decreased, damage to the
nucleolus by the deposition of AgNPs
in midgut cells
Yasur and
Rani (2015)
AgNPs Green synthesized Ag
NPs
Variable
doses
Cluster bean leaves inoculated with
sunhemp rosette virus
The green synthesized ag NPs have
shown a successful suppression of
viral disease onset showing potential
antiviral properties
Jain and
Kothari
(2014)
AgNPs AgNO
3
30, 60, 90,
120 &
150 ppm
Spodoptera litura &Helicoverpa
armigera
Damage the epithelial tissues and
goblet cells of larval midgut of
Spodoptera litua & Helicoverpa
armigera
Manimegalai
et al. (2020)
Ag and Zn
NPs
Ag and Zn NPs
prepared
Various doses House Fly (Musca domestica) The applied doses of NPs have shown
positive effects on controlling early
staged individuals of houseflies
suggesting strong possible use as an
alternative pesticide
Abdel-
Gawad
(2018)
15 Nanomaterials for Integrated Crop Disease Management 303
Table 15.1 (continued)
Type Source Dose Organism of action Effect References
AgNPs AgNO
3
100,
500, 1000 &
1500 mg/L
Spodoptera litura Acute toxic effect on Spodoptera litura
larvae, non-significant effect on the
activity of detoxification enzymes
(glutathione-s-transferase & carboxyl
esterases enzymes)
Jafiretal.
(2021)
Glass
containing
Cu NPs
Sepiolite fibres
containing
monodispersed Cu NPs
Variable
doses
Fungal species Ca(2+) lixiviated mediated toxicity to
fungal species, suggesting the strong
antifungal potential of hybrid
nanoparticles
Esteban-
Tejeda et al.
(2009)
Carbon and
Cu NPs
Chitosan, chitosan-
saponin and
Cu-chitosan
nanoparticles
0.001–0.1%
doses in
invitro study
Phytopathogenic fungi (Alternaria
alternata,Macrophomina phaseolina
and Rhizoctonia solani)
Model has shown NPs capability in
controlling fungal sprawl suggesting
its long term and field application as a
possible option
Saharan etal.
(2013)
Cu-carbon Cu-chitosan based NPs Variable
doses
Alternaria solani and Fusarium
oxysporum affecting tomato plant
The model demonstrated a potential
antifungal effect on both species
suggesting the potential applicability
of NPs in field conditions
Saharan etal.
(2015)
ZnO, Cu,
and Cu
2
O/
Cu
Zn and Cu
nanoparticles
Variable
doses
F. oxysporum, F. solani,
C. gloeosporioides
A net inhibition of growth of all fungal
species was observed
Pariona et al.
(2021)
CuO-NPs CuO Variable dose Bt Cotton The exogenous application of
CuO-NPs helped in gene triggering of
crops involved in better disease
prevention
Le Van et al.
(2016)
CuO-NPs CuSO
4
5H
2
O 100,
150, 200,
250 &
300 ppm
Triticum aestivum Acute toxic effect against Sitophilus
granarius and Rhyzopertha dominic,
improves the plant physiology and
yields related parameters
Rai et al.
(2018)
304 M. A. Ayub et al.
CuO-NPs Sigma–Aldrich 100 mg/L Galleria mellonella L Increases the activity of CAT & GST
while decreasing the activity of SOD
& AChE in the midgut of Galleria
mellonella L
Tuncsoy et al.
(2019)
CuNPs NanoSany Corporation
(Iran)
50, 100 &
200 ppm
Pepper Transcriptionally down-regulates the
MVK gene involved in the
metabolism of terpenoids and
upregulated the microR159 in pepper,
increased concentration poses the
oxidative stress, upregulates the
activity of catalase, peroxidase, &
polyphenol peroxidase
Tabatabaee
et al. (2021)
15 Nanomaterials for Integrated Crop Disease Management 305
et al. 2006). Nano-fertilizers penetrate the seeds and increase the nutritional status of
seedlings, resulting in healthier and longer shoot and root lengths. Nano-fertilizers
are classified as either micronutrient or macronutrient nano-fertilizers, depending on
their nutritional status (Chhipa 2016). Plant metabolism is stimulated by nanoscale
nutrient forms, which improve development, nutritional quality, and growth
(Dimkpa and Bindraban 2017). Nano-fertilizers increase nutrient use efficiency,
minimize important nutrient immobilization, and reduce nutrient leaching through
agricultural run-off (Liu and Lal 2015). As compared to conventional fertilizers,
nano-fertilizers enhance chlorophyll synthesis as well as the rate of photosynthesis,
and thereby increase the transfer of the photosynthates to different plant parts and
increase crop production (Ali and Al-Juthery 2017; Singh et al. 2017).
306 M. A. Ayub et al.
In waterlogged conditions, zinc (Zn) is an essential nutrient for rice growth and
development (Naik and Das 2007). The foliar application of Zn to plants increases its
concentration (Saha et al. 2017). The use of Zn nano-fertilizer benefits rice develop-
ment by providing nutrients slowly during crucial periods (Yuva Raj and
Subramanian 2021). The use of Si and Zn nano-fertilizers boosted the concentrations
of essential plant nutrients silicon and zinc in rice plants by around 24% and 21%,
respectively (Ghasemi et al. 2014). Nano-silicon fertilizers have high availability
because of their small size and strong penetration power, whereas standard silicon
fertilizers have low availability. Nano-silicon fertilizers, when compared to tradi-
tional Si fertilizers, can minimize silicon (Si) accumulation (Wang et al. 2016). It’sa
reported fact that micronutrients and beneficial nutrients can be very effective agents
for plants to fight against diseases, and exogenous application of these nutrients can
help plants in various diverse ways in coping biotic stress (Datnoff et al. 2007; Fones
and Preston 2013).
15.4 Bioavailability, Concentration, and Toxicity
of the Nanoparticles
Because many NPs contain biotic life, the incorporation of NPs into plant reproduc-
tive and eating tissues is of special importance (Rizwan et al. 2016). The absorption
and transportation of the NPs depend upon the plant species, cultivars, and develop-
mental stages (Anjum et al. 2015; Shi et al. 2014). Plant tissues’natural micro-meter
or nanometer-scale pores allow NPs to attach to and pass through plant surfaces
(Schwabe et al. 2015). The uptake of the NP is characterized as an “active-transport
mechanism”because it involves a variety of cellular processes such as recycling,
signaling, and plasma membrane regulation (Wang et al. 2012). Before adopting the
apoplastic way to the epidermis and cortical cells, the NPs adhere to the root surface
(Anjum et al. 2015,2016). When NPs enter plants, they penetrate through the cell
membrane and cell wall of root epidermal cells before being guided via the xylem
(vascular bundle) by a series of complicated processes before being transported to
the stele via the symplast route and are eventually translocated to the leaves. Cell
membrane holes tailored to the size of the nanomaterial allow NPs to penetrate
through the integral cell membrane (Tripathi et al. 2015). The NPs must be absorbed
by a passive channel via the endodermal apoplast before they can get near to the stele
(Judy et al. 2016). Xylem is a plant-based mechanism for allocating and transporting
nanoparticles (Aslani et al. 2014).
15 Nanomaterials for Integrated Crop Disease Management 307
15.5 Fate and Safety Aspects of Nanoparticles
The fast growth of nanotechnology has prompted concerns about the risks of a wide
range of hazardous NPs, and their uncontrolled usage as nano-pesticide and nano-
fungicide formulations should be monitored since they can contaminate the soil. In
order to establish safe nanomaterial-based technology release mechanisms, the
formation of these NPs in soil, and their absorption into the food chain, should be
monitored. The NPs have been shown to exert dose-dependent toxicity in agricul-
tural plants in several studies (Li et al. 2015a,b). Pure aluminum NPs, for example,
inhibited root development in maize, tomato, cucumber, carrot, cabbage, and soy-
bean plants (Hassan et al. 2013). Plant development is inhibited by alumina (Al
2
O
3
)
NPs, which are contaminants in the environment. Tobacco seedlings demonstrated a
continuous and significant reduction in average leaf count, biomass, and root length
when exposed to high levels of Al
2
O
3
-NP (Burklew et al. 2012). Copper NPs were
cytotoxic to mung beans, but Ag-NPs were cytotoxic to zucchini and onions. At
higher concentrations, multi-walled carbon nanotubes (MWCNTs) have been
proven to be cytotoxic in a variety of plants, including Arabidopsis and rice (Nair
et al. 2010). These findings emphasize the need to understand the ecosystem’s lowest
safe NP threshold. Nano-ZnO, for example, is taken from the soil by the roots and
accumulated in the edible parts of soybean plants, decreasing food quality. Similarly,
nano-CeO
2
lowered soybean plants’capacity to fix nitrogen and hence reduced the
yield.
15.6 Conclusion
Nanotechnology is a branch of science that has applications in a wide range of fields.
Nanotechnology is undergoing intensive research in an attempt to commercialize it
around the world. In agriculture, nanoparticles are used to reduce the use of plant
protection chemicals, reduce nutrient losses, and boost yields. Because food demand
is increasing every day and staple food crop yields are low, metal nanoparticles must
be commercialized for sustainable agriculture. NPs promote plant metabolic activity
and act as a plant nutritional fertilizer to boost crop yield. Every day, food demand
rises while primary food crop yields diminish. Today, however, increasing the food
supply is important in order to feed the world’s growing population. Commerciali-
zation of metal nanoparticles for sustainable agriculture is consequently required.
308 M. A. Ayub et al.
References
Abdel-Gawad R (2018) Insecticidal activity of Moringa oleifera synthesized silver and zinc
nanoparticles against the house fly, Musca domestica L. Egypt Acad J Biol Sci A Entomol
11:19–30. https://doi.org/10.21608/eajbsa.2018.17729
Adil SF, Assal ME, Khan M et al (2015) Biogenic synthesis of metallic nanoparticles and prospects
toward green chemistry. Dalt Trans 44:9709–9717. https://doi.org/10.1039/c4dt03222e
Adisa IO, Pullagurala VLR, Peralta-Videa JR et al (2019) Recent advances in nano-enabled
fertilizers and pesticides: a critical review of mechanisms of action. Environ Sci Nano 6:
2002–2030. https://doi.org/10.1039/c9en00265k
Agrawal S, Rathore P (2014) Nanotechnology pros and cons to agriculture: a review. Int J Curr
Microbiol App Sci 3:43–55
Ali NS, Al-Juthery HWA (2017) The application of nanotechnology for micronutrient in agricul-
tural production. Iraqi J Agric Sci 48:984
Anjum NA, Adam V, Kizek R et al (2015) Nanoscale copper in the soil–plant system—toxicity and
underlying potential mechanisms. Environ Res 138:306–325. https://doi.org/10.1016/j.envres.
2015.02.019
Anjum NA, Rodrigo MAM, Moulick A et al (2016) Transport phenomena of nanoparticles in plants
and animals/humans. Environ Res 151:233–243. https://doi.org/10.1016/j.envres.2016.07.018
Aslani F, Bagheri S, Muhd Julkapli N et al (2014) Effects of engineered nanomaterials on plants
growth: an overview. ScientificWorldJournal 2014:641759. https://doi.org/10.1155/2014/
641759
Badawy MEI, El-Aswad AF (2012) Insecticidal activity of chitosans of different molecular weights
and chitosan-metal complexes against cotton leafworm Spodoptera littoralis and oleander aphid
Aphis nerii. Plant Prot Sci 48:131–141. https://doi.org/10.17221/67/2010-pps
Barik TK, Sahu B, Swain V (2008) Nanosilica—from medicine to pest control. Parasitol Res 103:
253–258. https://doi.org/10.1007/s00436-008-0975-7
Borm P, Klaessig FC, Landry TD et al (2006) Research strategies for safety evaluation of
nanomaterials, part V: role of dissolution in biological fate and effects of nanoscale particles.
Toxicol Sci 90:23–32. https://doi.org/10.1093/toxsci/kfj084
Brecht M, Datnoff L, Nagata R, Kucharek T (2003) The role of silicon in suppressing gray leaf spot
development in St. Augustinegrass: PP-67/PP114, 7/2003. EDIS, 2003(17)
Burklew CE, Ashlock J, Winfrey WB, Zhang B (2012) Effects of aluminum oxide nanoparticles on
the growth, development, and microRNA expression of tobacco (Nicotiana tabacum). PLoS
One 7:e34783. https://doi.org/10.1371/journal.pone.0034783
Cadena MB, Preston GM, Van der Hoorn RA, IP THET (2018) Species-specific antimicrobial
activity of essential oils and enhancement by encapsulation in mesoporous silica nanoparticles.
Ind Crop Prod 122:582–590
Chhipa H (2016) Nanofertilizers and nanopesticides for agriculture. Environ Chem Lett 15:15–22.
https://doi.org/10.1007/s10311-016-0600-4
Chhipa H, Joshi P (2016) Nanofertilisers, nanopesticides and nanosensors in agriculture. Nanosci
Food Agric 1:247–282
Cho EJ, Holback H, Liu KC et al (2013) Nanoparticle characterization: state of the art, challenges,
and emerging technologies. Mol Pharm 10:2093–2110. https://doi.org/10.1021/mp300697h
Choudhary RC, Kumaraswamy RV, Kumari S, Sharma SS, Pal A, Raliya R, Biswas P, Saharan V
(2019) Zinc encapsulated chitosan nanoparticle to promote maize crop yield. Int J Biol
Macromol 127:126–135
Datnoff LE, Elmer WH, Huber DM (2007) Mineral nutrition and plant disease, vol 7. American
Phytopathological Society. APS Press, pp 89–92
Derbalah A, Shenashen M, Hamza A et al (2018) Antifungal activity of fabricated mesoporous
silica nanoparticles against early blight of tomato. Egypt J Basic Appl Sci 5:145–150. https://
doi.org/10.1016/j.ejbas.2018.05.002
15 Nanomaterials for Integrated Crop Disease Management 309
Dimkpa CO, McLean JE, Martineau N et al (2013) Silver nanoparticles disrupt wheat (Triticum
aestivum L.) growth in a sand matrix. Environ Sci Technol 47:1082–1090. https://doi.org/10.
1021/es302973y
Dimkpa CO, Bindraban PS (2017) Nanofertilizers: new products for the industry? J Agric Food
Chem 66(26):6462–6473. https://doi.org/10.1021/acs.jafc.7b02150
Elmer W, Ma C, White J (2018) Nanoparticles for plant disease management. Curr Opin Environ
Sci Heal 6:66–70. https://doi.org/10.1016/j.coesh.2018.08.002
El-Helaly AA, El-Bendary HM, Abdel-Wahab AS, El-Sheikh MAK, Elnagar S (2016) The silica-
nano particles treatment of squash foliage and survival and development of Spodoptera littoralis
(Bosid.) larvae. Pest Control 5:6
Esteban-Tejeda L, Malpartida F, Esteban-Cubillo A et al (2009) Antibacterial and antifungal
activity of a soda-lime glass containing copper nanoparticles. Nanotechnology 20:505701.
https://doi.org/10.1088/0957-4484/20/50/505701
Fones H, Preston GM (2013) The impact of transition metals on bacterial plant disease. FEMS
Microbiol Rev 37:495–519. https://doi.org/10.1111/1574-6976.12004
Fouad H, Hongjie L, Yanmei D et al (2016) Synthesis and characterization of silver nanoparticles
using Bacillus amyloliquefaciens and Bacillus subtilis to control filarial vector Culex pipiens
pallens and its antimicrobial activity. Artif Cells Nanomed Biotechnol 45:1369–1378. https://
doi.org/10.1080/21691401.2016.1241793
Galvano F, Piva A, Ritieni A, Galvano G (2001) Dietary strategies to counteract the effects of
mycotoxins: a review. J Food Prot 64:120–131. https://doi.org/10.4315/0362-028x-64.1.120
Ghasemi M, Mobasser HR, Asadimanesh H, Gholizadeh A (2014) Investigating the effect of
potassium, zinc and silicon on grain yield, yield components and their absorption in grain rice
(Oryza sativa L.)
Ghormade V, Deshpande MV, Paknikar KM (2011) Perspectives for nano-biotechnology enabled
protection and nutrition of plants. Biotechnol Adv 29:792–803. https://doi.org/10.1016/j.
biotechadv.2011.06.007
Gonçalves C, Ramalho MJ, Silva R, Silva V, Marques-Oliveira R, Silva AC, Pereira MC, Loureiro
JA (2021) Lipid nanoparticles containing mixtures of antioxidants to improve skin care and
cancer prevention. Pharmaceutics 13:2042
Gopal J, Narayana JL, Wu HF (2011) TiO
2
nanoparticle assisted mass spectrometry as biosensor of
Staphylococcus aureus, key pathogen in nosocomial infections from air, skin surface and human
nasal passage. Biosens Bioelectron 27:201–206
Hassan AA, Howayda ME, Mahmoud HH (2013) Effect of zinc oxide nanoparticles on the growth
of mycotoxigenic mould. SCPT 1:66–74
Hatami E, Toghraei A, Darband GB (2021) Electrodeposition of Ni–Fe micro/nano urchin-like
structure as an efficient electrocatalyst for overall water splitting. Int J Hydrog Energy 46:9394–
9405
Hernandez-Viezcas JA, Castillo-Michel H, Andrews JC et al (2013) In situ synchrotron X-ray
fluorescence mapping and speciation of CeO
2
and ZnO nanoparticles in soil cultivated soybean
(Glycine max). ACS Nano 7:1415–1423. https://doi.org/10.1021/nn305196q
Hu G, Lu M-H, Reynolds DR et al (2019) Long-term seasonal forecasting of a major migrant
insect pest: the brown planthopper in the Lower Yangtze River Valley. J Pest Sci 92:417–428.
https://doi.org/10.1007/s10340-018-1022-9
Ismail A-W, Sidkey N, Arafa R et al (2016) Evaluation of in vitro antifungal activity of silver and
selenium nanoparticles against Alternaria solani caused early blight disease on potato. Br
Biotechnol J 12:1–11. https://doi.org/10.9734/bbj/2016/24155
Jafir M, Ahmad JN, Arif MJ et al (2021) Characterization of Ocimum basilicum synthesized silver
nanoparticles and its relative toxicity to some insecticides against tobacco cutworm, Spodoptera
litura Feb. (Lepidoptera; Noctuidae). Ecotoxicol Environ Saf 218:112278. https://doi.org/10.
1016/j.ecoenv.2021.112278
Jain D, Kothari S (2014) Green synthesis of silver nanoparticles and their application in plant virus
inhibition. J Mycol Plant Pathol 44:21–24
310 M. A. Ayub et al.
Jamkhande PG, Ghule NW, Bamer AH, Kalaskar MG (2019) Metal nanoparticles synthesis: an
overview on methods of preparation, advantages and disadvantages, and applications. J Drug
Delivery Sci Technol 53:101174
Judy JD, Kirby JK, McLaughlin MJ et al (2016) Symbiosis between nitrogen-fixing bacteria and
Medicago truncatula is not significantly affected by silver and silver sulfide nanomaterials.
Environ Pollut 214:731–736. https://doi.org/10.1016/j.envpol.2016.04.078
Kah M, Hofmann T (2014) Nanopesticide research: current trends and future priorities. Environ Int
63:224–235. https://doi.org/10.1016/j.envint.2013.11.015
Kah M, Tufenkji N, White JC (2019) Nano-enabled strategies to enhance crop nutrition and
protection. Nat Nanotechnol 14:532–540. https://doi.org/10.1038/s41565-019-0439-5
Kanto T, Miyoshi A, Ogawa T et al (2004) Suppressive effect of potassium silicate on powdery
mildew of strawberry in hydroponics. J Gen Plant Pathol 70. https://doi.org/10.1007/s10327-
004-0117-8
Karkhane M, Lashgarian HE, Mirzaei SZ et al (2020) Antifungal, antioxidant and photocatalytic
activities of zinc nanoparticles synthesized by Sargassum vulgare extract. Biocatal Agric
Biotechnol 29:101791. https://doi.org/10.1016/j.bcab.2020.101791
Khan FA (2020) Nanomaterials: types, classifications, and sources. Appl Nanomater Hum Heal
1–13
Khoa NĐ,XạTV, Hào LT (2017) Disease-reducing effects of aqueous leaf extract of Kalanchoe
pinnata on rice bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae involve induced
resistance. Physiol Mol Plant Pathol 100:57–66. https://doi.org/10.1016/j.pmpp.2017.06.005
Khot LR, Sankaran S, Maja JM et al (2012) Applications of nanomaterials in agricultural produc-
tion and crop protection: a review. Crop Prot 35:64–70. https://doi.org/10.1016/j.cropro.2012.
01.007
Kim BH, Hackett MJ, Park J, Hyeon T (2013) Synthesis, characterization, and application of
ultrasmall nanoparticles. Chem Mater 26:59–71. https://doi.org/10.1021/cm402225z
Kim K-H, Kabir E, Jahan SA (2017) Exposure to pesticides and the associated human health
effects. Sci Total Environ 575:525–535. https://doi.org/10.1016/j.scitotenv.2016.09.009
Klaine SJ, Alvarez PJJ, Batley GE et al (2008) Nanomaterials in the environment: behavior, fate,
bioavailability, and effects. Environ Toxicol Chem 27:1825. https://doi.org/10.1897/08-090.1
Kumar S, Nehra M, Dilbaghi N et al (2019) Nano-based smart pesticide formulations: emerging
opportunities for agriculture. J Control Release 294:131–153. https://doi.org/10.1016/j.jconrel.
2018.12.012
Kumpiene J, Lagerkvist A, Maurice C (2008) Stabilization of As, Cr, Cu, Pb and Zn in soil using
amendments—a review. Waste Manag 28:215–225. https://doi.org/10.1016/j.wasman.2006.
12.012
Kurwadkar S, Pugh K, Gupta A, Ingole S (2015) Nanoparticles in the environment: occurrence,
distribution, and risks. J Hazard Toxic Radioact Waste 19:4014039. https://doi.org/10.1061/
(asce)hz.2153-5515.0000258
Le Van N, Ma C, Shang J et al (2016) Effects of CuO nanoparticles on insecticidal activity and
phytotoxicity in conventional and transgenic cotton. Chemosphere 144:661–670. https://doi.
org/10.1016/j.chemosphere.2015.09.028
Li K-E, Chang Z-Y, Shen C-X, Yao N (2015a) Toxicity of nanomaterials to plants. Nanotechnol
Plant Sci 101–123
Li X, Xie K, Yue B et al (2015b) Inorganic arsenic contamination of rice from Chinese major rice-
producing areas and exposure assessment in Chinese population. Sci China Chem 58:1898–
1905. https://doi.org/10.1007/s11426-015-5443-5
Li H, Huang J, Lu F et al (2018) Impacts of carbon dots on rice plants: boosting the growth and
improving the disease resistance. ACS Appl Bio Mater 1:663–672. https://doi.org/10.1021/
acsabm.8b00345
Liu R, Lal R (2015) Potentials of engineered nanoparticles as fertilizers for increasing agronomic
productions. Sci Total Environ 514:131–139. https://doi.org/10.1016/j.scitotenv.2015.01.104
15 Nanomaterials for Integrated Crop Disease Management 311
Magda S, Hussein MM (2016) Determinations of the effect of using silica gel and nano-silica gel
against Tutaabsoluta (Lepidoptera: Gelechiidae) in tomato fields. J Chem Pharm Res 8:506–512
Manimegalai T, Raguvaran K, Kalpana M, Maheswaran R (2020) Green synthesis of silver
nanoparticle using Leonotis nepetifolia and their toxicity against vector mosquitoes of Aedes
aegypti and Culex quinquefasciatus and agricultural pests of Spodoptera litura and Helicoverpa
armigera. Environ Sci Pollut Res 27:43103–43116. https://doi.org/10.1007/s11356-020-
10127-1
Mesterházy Á, Oláh J, Popp J (2020) Losses in the grain supply chain: causes and solutions.
Sustainability 12:2342
Mohammadi H, Esmailpour M, Gheranpaye A (2016) Effects of TiO
2
nanoparticles and water-
deficit stress on morpho-physiological characteristics of dragonhead (Dracocephalum
moldavica L.) plants. Acta Agric Slov 107:385. https://doi.org/10.14720/aas.2016.107.2.11
Molina MA, Ramos J-L, Espinosa-Urgel M (2006) A two-partner secretion system is involved in
seed and root colonization and iron uptake by Pseudomonas putida KT2440. Environ Microbiol
8:639–647. https://doi.org/10.1111/j.1462-2920.2005.00940.x
Monica RC, Cremonini R (2009) Nanoparticles and higher plants. Caryologia 62:161–165. https://
doi.org/10.1080/00087114.2004.10589681
Naik SK, Das DK (2007) Effect of split application of zinc on yield of rice (Oryza sativa L.) in an
inceptisol. Arch Agron Soil Sci 53:305–313. https://doi.org/10.1080/03650340701311398
Nair R (2016) Effects of nanoparticles on plant growth and development. In: Plant nanotechnology.
Springer, Cham, pp 95–118
Nair R, Varghese SH, Nair BG et al (2010) Nanoparticulate material delivery to plants. Plant Sci
179:154–163. https://doi.org/10.1016/j.plantsci.2010.04.012
Navale SA, Swami SB, Thakor NJ (2015) Extrusion cooking technology for foods: a review. J
Ready Eat Food 2:66–80
Nejad MS, GHS B, Khatami (2016) In vitro and in vivo antifungal properties of silver nanoparticles
against Rhizoctonia solani, a common agent of rice sheath blight disease. IET Nanobiotechnol
11:236–240
Nel A, Xia T, Madler L, Li N (2006) Toxic potential of materials at the nanolevel. Science 311:622–
627
Nie KB, Wang XJ, Deng KK, Hu XS, Wu K (2021) Magnesium matrix composite reinforced by
nanoparticles–a review. J Magnesium Alloys 9:57–77
Ogunyemi SO, Abdallah Y, Zhang M, Fouad H, Hong X, Ibrahim E, Masum MMI, Hossain A,
Mo J, Li B (2019) Green synthesis of zinc oxide nanoparticles using different plant extracts and
their antibacterial activity against Xanthomonas oryzae pv. oryzae. Artif Cell Nanomed
Biotechnol 47:341–352
Pariona N, Basurto Cereceda S, Mondaca F et al (2021) Antifungal activity and degradation of
methylene blue by ZnO, Cu, and Cu
2
O/Cu nanoparticles, a comparative study. Mater Lett 301:
130182. https://doi.org/10.1016/j.matlet.2021.130182
Park H-J, Kim S-H, Kim H-J, Choi S-H (2006) A new composition of nanosized silica-silver for
control of various plant diseases. Plant Pathol J 22:295–302. https://doi.org/10.5423/ppj.2006.
22.3.295
Peng JH, Sun D, Nevo E (2011) Domestication evolution, genetics and genomics in wheat. Mol
Breed 28:281–301. https://doi.org/10.1007/s11032-011-9608-4
Rai M, Kon K, Ingle A et al (2014) Broad-spectrum bioactivities of silver nanoparticles: the
emerging trends and future prospects. Appl Microbiol Biotechnol 98:1951–1961. https://doi.
org/10.1007/s00253-013-5473-x
Rai M, Ingle AP, Pandit R et al (2018) Copper and copper nanoparticles: role in management of
insect-pests and pathogenic microbes. Nanotechnol Rev 7:303–315. https://doi.org/10.1515/
ntrev-2018-0031
Rizwan M, Ali S, Ali B, Adrees M, Arshad M, Hussain A, Rehman MZ, Waris AA (2016) Zinc and
iron oxide nanoparticles improved the plant growth and reduced the oxidative stress and
cadmium concentration in wheat. Chemosphere 214:269–277
312 M. A. Ayub et al.
Roberts AG, Oparka KJ (2003) Plasmodesmata and the control of symplastic transport. Plant Cell
Environ 26:103–124. https://doi.org/10.1046/j.1365-3040.2003.00950.x
Rouhani M, Samih MA, Kalamtari S (2012) Insecticidal effect of silica and silver nanoparticles on
the cowpea seed beetle, Callosobruchus maculatus F. (Col.: Bruchidae). J Entomol Res 4:297–
305
Ruiz-Rico M, Pérez-Esteve É, Bernardos A et al (2017) Enhanced antimicrobial activity of essential
oil components immobilized on silica particles. Food Chem 233:228–236. https://doi.org/10.
1016/j.foodchem.2017.04.118
Ryan RP, Vorhölter F-J, Potnis N et al (2011) Pathogenomics of Xanthomonas: understanding
bacterium–plant interactions. Nat Rev Microbiol 9:344–355. https://doi.org/10.1038/
nrmicro2558
Sabo-Attwood T, Unrine JM, Stone JW et al (2011) Uptake, distribution and toxicity of gold
nanoparticles in tobacco (Nicotiana xanthi) seedlings. Nanotoxicology 6:353–360. https://doi.
org/10.3109/17435390.2011.579631
Sadak MS (2019) Impact of silver nanoparticles on plant growth, some biochemical aspects, and
yield of fenugreek plant (Trigonella foenum-graecum). Bull Natl Res Cent 43. https://doi.org/
10.1186/s42269-019-0077-y
Saha S, Chakraborty M, Padhan D et al (2017) Agronomic biofortification of zinc in rice: influence
of cultivars and zinc application methods on grain yield and zinc bioavailability. Field Crop Res
210:52–60. https://doi.org/10.1016/j.fcr.2017.05.023
Saharan V, Mehrotra A, Khatik R et al (2013) Synthesis of chitosan based nanoparticles and their
in vitro evaluation against phytopathogenic fungi. Int J Biol Macromol 62:677–683. https://doi.
org/10.1016/j.ijbiomac.2013.10.012
Saharan V, Sharma G, Yadav M et al (2015) Synthesis and in vitro antifungal efficacy of Cu–
chitosan nanoparticles against pathogenic fungi of tomato. Int J Biol Macromol 75:346–353.
https://doi.org/10.1016/j.ijbiomac.2015.01.027
Salavati-Niasari M, Davar F, Mir N (2008) Synthesis and characterization of metallic copper
nanoparticles via thermal decomposition. Polyhedron 27:3514–3518. https://doi.org/10.1016/
j.poly.2008.08.020
Sattelmacher B (2001) The apoplast and its significance for plant mineral nutrition. New Phytol
149:167–192. https://doi.org/10.1046/j.1469-8137.2001.00034.x
Savi GD, Piacentini KC, de Souza SR et al (2015) Efficacy of zinc compounds in controlling
Fusarium head blight and deoxynivalenol formation in wheat (Triticum aestivum L.). Int J Food
Microbiol 205:98–104. https://doi.org/10.1016/j.ijfoodmicro.2015.04.001
Schwabe F, Tanner S, Schulin R et al (2015) Dissolved cerium contributes to uptake of Ce in the
presence of differently sized CeO
2
-nanoparticles by three crop plants. Metallomics 7:466–477.
https://doi.org/10.1039/c4mt00343h
Scrinis G, Lyons K (2012) Nano-functional foods. Innov Heal Funct Foods:547–554
Shevchenko SN, Burkhardt M, Sheval EV et al (2017) Antimicrobial effect of biocompatible silicon
nanoparticles activated using therapeutic ultrasound. Langmuir 33:2603–2609. https://doi.org/
10.1021/acs.langmuir.6b04303
Shi L-E, Li Z-H, Zheng W et al (2014) Synthesis, antibacterial activity, antibacterial mechanism and
food applications of ZnO nanoparticles: a review. Food Addit Contam Part A 31:173–186.
https://doi.org/10.1080/19440049.2013.865147
Siddiqui MH, Al-Whaibi MH, Firoz M, Al-Khaishany MY (2015) Role of nanoparticles in
plants. In: Siddiqui M, Al-Whaibi M, Mohammad F (eds) Nanotechnology and plant sciences.
Springer, Cham. https://doi.org/10.1007/978-3-319-14502-0_2
Singh M, Singh S, Prasad S (2008) Nanotechnology in medicine and antibacterial effect of silver
nanoparticles. Dig J Nanomater Biostruct 3:115–122
Singh A, Sharma S, Singh B (2017) Effect of germination time and temperature on the functionality
and protein solubility of sorghum flour. J Cereal Sci 76:131–139. https://doi.org/10.1016/j.jcs.
2017.06.003
15 Nanomaterials for Integrated Crop Disease Management 313
Sohail MI, Waris AA, Ayub MA et al (2019) Environmental application of nanomaterials: a
promise to sustainable future. In: Comprehensive analytical chemistry, vol 87. Elsevier, pp 1–54
Sohail MI, Ayub MA, Zia ur Rehman M et al (2021) Sufficiency and toxicity limits of metallic
oxide nanoparticles in the biosphere. In: Nanomaterials: synthesis, characterization, hazards and
safety. Elsevier, pp 145–221
Solanki P, Bhargava A, Chhipa H et al (2015) Nano-fertilizers and their smart delivery system.
Nanotechnol Food Agric 81–101
Song Y, Jiang H, Wang B, Kong Y, Chen J (2018) Silver-incorporated mussel-inspired
polydopamine coatings on mesoporous silica as an efficient nanocatalyst and antimicrobial
agent. ACS Appl Mater Interfaces 10:1792–1801
Spinozzi E, Maggi F, Bonacucina G, Pavela R (2021) Apiaceae essential oils and their constituents
as insecticides against mosquitoes—a review. Ind Crop Prod 171:113892
Sun Y, Liang J, Tang L et al (2019) Nano-pesticides: a great challenge for biodiversity? Nano
Today 28:100757. https://doi.org/10.1016/j.nantod.2019.06.003
Tabatabaee S, Iranbakhsh A, Shamili M, Oraghi Ardebili Z (2021) Copper nanoparticles mediated
physiological changes and transcriptional variations in microRNA159 (miR159) and
mevalonate kinase (MVK) in pepper; potential benefits and phytotoxicity assessment. J Environ
Chem Eng 9:106151. https://doi.org/10.1016/j.jece.2021.106151
Tahmasbi L, Sedaghat T, Motamedi H, Kooti M (2018) Mesoporous silica nanoparticles supported
copper(II) and nickel(II) Schiff base complexes: synthesis, characterization, antibacterial activ-
ity and enzyme immobilization. J Solid State Chem 258:517–525. https://doi.org/10.1016/j.jssc.
2017.11.015
Tiwari DK, Behari J, Sen P (2008) Time and dose-dependent antimicrobial potential of Ag
nanoparticles synthesized by top-down approach. Curr Sci:647–655
Tripathi DK, Singh VP, Prasad SM et al (2015) Silicon nanoparticles (SiNp) alleviate chromium
(VI) phytotoxicity in Pisum sativum (L.) seedlings. Plant Physiol Biochem 96:189–198. https://
doi.org/10.1016/j.plaphy.2015.07.026
Tuan LNA, Du BD, Ha LDT et al (2018) Induction of chitinase and brown spot disease resistance
by oligochitosan and nanosilica–oligochitosan in dragon fruit plants. Agric Res 8:184–190.
https://doi.org/10.1007/s40003-018-0384-9
Tuncsoy B, Tuncsoy M, Gomes T, Sousa V, Teixeira MR, Bebianno MJ, Ozalp P (2019) Effects of
copper oxide nanoparticles on tissue accumulation and antioxidant enzymes of galleria
mellonella L. B Environ Contam Tox 102:341–346
Udayashankar AC, Nayaka SC, Reddy MS (2011) Plant growth-promoting rhizobacteria mediate
induced systemic resistance in rice against bacterial leaf blight caused by Xanthomonas oryzae
pv. oryzae. Biol Control 59:114–122
Usman M, Farooq M, Wakeel A et al (2020) Nanotechnology in agriculture: current status,
challenges and future opportunities. Sci Total Environ 721:137778. https://doi.org/10.1016/j.
scitotenv.2020.137778
Verma J (2018) Analysis on synthesis of silica nanoparticles and its effect on growth of
T. Harzianum & Rhizoctonia species. Biomed J Sci Tech Res 10. https://doi.org/10.26717/
bjstr.2018.10.001972
Wagner G, Korenkov V, Judy JD, Bertsch PM (2016) Nanoparticles composed of Zn and ZnO
inhibit Peronospora tabacina spore germination in vitro and P. tabacina infectivity on tobacco
leaves. Nanomaterials 6:50. https://doi.org/10.3390/nano6030050
Wang Z, Xie X, Zhao J et al (2012) Xylem- and phloem-based transport of CuO nanoparticles in
maize (Zea mays L.). Environ Sci Technol 46:4434–4441. https://doi.org/10.1021/es204212z
Wang Q, Huo Z, Zhang L et al (2016) Impact of saline water irrigation on water use efficiency and
soil salt accumulation for spring maize in arid regions of China. Agric Water Manag 163:125–
138. https://doi.org/10.1016/j.agwat.2015.09.012
Wang K, Zhang M, Huang Y et al (2018) Characterisation of imidacloprid resistance in the bird
cherry-oat aphid, Rhopalosiphum padi, a serious pest on wheat crops. Pest Manag Sci 74:1457–
1465. https://doi.org/10.1002/ps.4834
314 M. A. Ayub et al.
Willkommen S, Lange J, Ulrich U, Pfannerstill M, Fohrer N (2021) Field insights into leaching and
transformation of pesticides and fluorescent tracers in agricultural soil. Sci Total Environ 751:
141658
Worrall E, Hamid A, Mody K et al (2018) Nanotechnology for plant disease management.
Agronomy 8:285. https://doi.org/10.3390/agronomy8120285
Xu T, Zhang S, Liu Y et al (2022) Slow resistance evolution to neonicotinoids in field populations
of wheat aphids revealed by insecticide resistance monitoring in China. Pest Manag Sci. https://
doi.org/10.1002/ps.6760
Yah CS, Simate GS (2015) Nanoparticles as potential new generation broad spectrum antimicrobial
agents. Daru 23:43. https://doi.org/10.1186/s40199-015-0125-6
Yang X, Liu J, Pei Y et al (2020) Recent progress in preparation and application of nano-chitin
materials. Energy Environ Mater 3:492–515. https://doi.org/10.1002/eem2.12079
Yasur J, Rani PU (2015) Lepidopteran insect susceptibility to silver nanoparticles and measurement
of changes in their growth, development and physiology. Chemosphere 124:92–102
Yu L, Wang L, Zhao Y, Wang B (2019) Identification and dissipation of omethoate and its main
metabolite DMP in wheat determined by UPLC-QTOF/MS. J Agric Food Chem 67(20):
5891–5898
Yuva Raj M, Subramanian KS (2021) Carbon sphere-zinc sulphate nanohybrids for smart delivery
of zinc in rice (Oryza sativa L). Sci Rep 11:1–13
Zahra S, Wahid A, Maqbool N, Ibrahim M (2018) Effect of thiourea on physiological performance
of two salt affected rice (Oryza sativa L.) cultivars. Annu Res Rev Biol 27:1–10. https://doi.org/
10.9734/arrb/2018/41352
Zhang L, Lu H, Guo K et al (2017a) Insecticide resistance status and detoxification enzymes of
wheat aphids Sitobion avenae and Rhopalosiphum padi. Sci China Life Sci 60:927–930. https://
doi.org/10.1007/s11427-017-9105-x
Zhang P, Ma Y, Liu S et al (2017b) Phytotoxicity, uptake and transformation of nano-CeO
2
in sand
cultured romaine lettuce. Environ Pollut 220:1400–1408. https://doi.org/10.1016/j.envpol.2016.
10.094
Zhao X, Wan Q, Fu X et al (2019) Toxicity evaluation of one-dimensional nanoparticles using
Caenorhabditis elegans: a comparative study of halloysite nanotubes and chitin nanocrystals.
ACS Sustain Chem Eng 7:18965–18975. https://doi.org/10.1021/acssuschemeng.9b04365
Zhu D, Wei H, Guo B et al (2017) The effects of chilling stress after anthesis on the physicochemi-
cal properties of rice (Oryza sativa L) starch. Food Chem 237:936–941. https://doi.org/10.1016/
j.foodchem.2017.06.039
Ziaee M, Ganji Z (2016) Insecticidal efficacy of silica nanoparticles against Rhyzopertha dominica
F. and Tribolium confusum Jacquelin du Val. J Plant Prot Res 56:250–256. https://doi.org/10.
1515/jppr-2016-0037
315
Metallic Nanoparticles and Nano-Based
Bioactive Formulations as Nano-Fungicides
for Sustainable Disease Management
in Cereals
16
Hossam S. El-Beltagi, Eslam S. Bendary, Khaled M. A. Ramadan,
and Heba I. Mohamed
Abstract
The main challenge in disease management is to develop and enhance long-term
management strategies that diminish the pathogen’s ability to pose a threat in the
future. The use of fungicides and the planting of resistant varieties are two of the
most common ways to combat blast disease. Natural products, botanical extracts,
and nanoparticles have been increasingly used as safer antibacterial treatments
against plant infections in recent years. Plant tonics and extracts are environmen-
tally safe goods and there is no risk of resistance to their use, as there is with
traditional pesticides. The goal of the present chapter was to focus on the effect of
the application of these products on the causal agents of cereal diseases. In vitro
and in vivo tests were used to assess the impact of plant products or manufactured
nanoparticles on crop disease. Application of plant natural compounds
H. S. El-Beltagi (*)
Agricultural Biotechnology Department, College of Agriculture and Food Sciences, King Faisal
University, Al-Ahsa, Saudi Arabia
Biochemistry Department, Faculty of Agriculture, Cairo University, Giza, Egypt
e-mail: helbeltagi@kfu.edu.sa
E. S. Bendary
Central Laboratories, King Faisal University, Al-Ahsa, Saudi Arabia
K. M. A. Ramadan
Central Laboratories, King Faisal University, Al-Ahsa, Saudi Arabia
Agricultural Biochemistry Department, Faculty of Agriculture, Ain-Shams University, Cairo,
Egypt
H. I. Mohamed
Biological and Geological Sciences Department, Faculty of Education, Ain Shams University,
Cairo, Egypt
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_16
suppressed mycelial growth and conidial growing conditions of fungus consider-
ably in vitro, with maximum suppression. Plant tonic application and
nanocarbons were likewise the most effective treatments in in vivo settings,
resulting in a considerable reduction in the area under the disease progress
curve (AUDPC) value when compared to the control. The application of plant
tonics and natural products resulted in a higher phenolic compound accumulation
and higher activity of peroxidase and polyphenol oxidase enzymes than the
control. Plant tonic, natural products, and nano-carbon treated rice plants showed
no phytotoxicity when compared to the control. The benefits of plant natural
products and nanoparticles in suppressing the rice blast disease were confirmed
by the findings presented in this chapter. As a result, their application may aid in
the development of appropriate managementmethods and provide the possibility
of a cleaner and safer agricultural environment.
316 H. S. El-Beltagi et al.
Keywords
Antifungal · Characterization · Fungicide · Fusarium · Plant extract ·
Nanoparticles · Synthesis
16.1 Introduction
Nanotechnology is rising in prominence as a result of its numerous agricultural
applications (Chowdappa and Gowda 2013; Ul Haq and Ijaz 2019). Among other
disease control measures, nanobiotechnology plays a vital role in early diagnosis,
presumed fungicides (nanofungicides), and is effective for fungicide distribution to
plants (Mishra and Singh 2015). It is this groundbreaking science that has
transformed the green revolution into the green nano-bio revolution. It is centered
on two parts: nanomaterial fabrication and implementation (Khan and Rizvi 2014).
Technology enables real-time tracking of agricultural crops for smart farming,
resulting in greater production with minimal input (Sharma et al. 2010a,b).
Herbicides and fungicides are extensively used, resulting in ecotoxicity and the
emergence of novel resistant phytopathogen species (Chen et al. 2015). As a result,
there is a pressing need to develop new approaches to managing crop diseases
(Vu et al. 2015). The use of environmentally friendly methods that produce less
toxic waste is urgently needed on a global scale. Scientists have become more aware
of the need to embrace and create “green synthesis”methodologies and techniques
as a result of this circumstance. Nanobiotechnology as a green chemistry strategy
aims to minimize the manufacturing of hazardous materials using nontoxic and
eco-friendly assets. As a result, utilizing biological agents (bio-macromolecules
and microorganisms) for nanoparticle production is a unique notion in green chem-
istry, opening up new paths for studying a wide range of biological species
(Chowdappa et al. 2013; Prasad et al. 2018).
Plant extract-based bio-reduction processes for nanomaterial generation involve a
variety of biomolecules, including polysaccharides, plant resins, organic
compounds, tannins, pigments, proteins, and enzymes (Nam et al. 2008; Prasad
2014) of green chemistry that connects microbial biotechnology and nanotechnol-
ogy. Inorganic chemicals are accumulated by microbes either inside or outside the
cell, and bio-reduce metals including copper, gold, platinum, silica, and silver to
produce nanoparticles (Prasad 2016).
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 317
By improving sustainable agriculture, nanoparticles play a critical role in produc-
ing better food (Gruère 2012). A wide spectrum of phytopathogens causes damage to
crop plants, ornamental plants, and trees, resulting in significant economic damage.
Many of them have harmful consequences for human health. In the next half-
century, global food demand is predicted to double, posing a significant challenge
to food production losses (Tournas 2005).
Because of exhaustion during the application, photodegradation, and off-target
deposition, only a trace amount of fungicides and pesticides (0.1%) find the exact
site of action; these losses have an impact on the ecosystem and raise production
costs. When a fungicide or pesticide is implemented to target pathogens, it may alter
their population into new species or strains through genome recombination, resulting
in the evolution of new species with resistance to that fungicide or pesticide (Castro
et al. 2013; Chowdappa et al. 2013). The best method to deal with this problem right
now is to use nanomaterials in illness control, disease monitoring, and precise or
controlled dispersion of bioactive agents (Johnston 2010). These nanoparticles are
aimed at fixing specific agricultural issues, such as plant protection (disease control)
and crop improvement (Ghormade et al. 2011). Nanoparticles’high surface-to-
volume proportion makes them more responsive and biochemically active. They
attach to pathogen cell walls, causing cell membrane distortion due to high-energy
transfer and causing the pathogen to die (Dubchak et al. 2010). These nanoparticles
or nanoparticle-based formulations form a robust nanoscale framework that allows
agrochemicals to be entrapped and encapsulated for gradual and targeted delivery of
their active components while also reducing agrochemical runoff into the environ-
ment (Chen and Yada 2011). As a result, this emerging science could play a critical
role in global sustainable agriculture. This chapter discusses the importance, pro-
duction, and properties of nanoparticles (particularly metallic nanoparticles) as well
as their use as nanofungicides for long-term disease management in plants (Gruère
2012).
16.2 Cu Nanoparticles (Cu-NPs) Fungicides Against Fusarium
16.2.1 Synthesis and Characterization of Copper Nanoparticles
Copper nanoparticles were created through the use of the cetyltrimethyl ammonium
bromide method (Kanhed et al. 2014). The process was optimized for the optimal
concentration of copper nitrate and cetyltrimethyl ammonium bromide (CTAB) in
terms of nanoparticle stability. The optimization study used 20 mL of copper nitrate
at room temperature, with concentration ranges of 0.010–0.100 M for cetyltrimethyl
ammonium bromide and 0.0010–0.0100 M for copper nitrate (Bramhanwade et al.
2016). Different concentrations of CTAB solution (0.001–0.01 M) and 20 mL of
CTAB solution (0.001–0.01 M) were prepared in isopropyl alcohol. Drop by drop,
copper nitrate solution was poured into the CTAB solution while vigorously stirring.
Copper nanoparticles have a well-known feature of easily oxidizing in the presence
of oxygen. This can be avoided by applying a capping agent to cover the
nanoparticles. In this method, the concentrations of copper nitrate and CTAB were
adjusted to produce copper nanoparticles. Copper nitrate at 0.003 M was discovered
to be the lowest concentration that might support copper nanoparticle production,
while CTAB at 0.02 M was determined to be the lowest concentration that might
support copper nanoparticle synthesis. Moreover, Kanhed et al. (2014) used a
comparable concentration of copper nitrate (0.003 M) but a larger concentration of
CTAB to synthesize copper nanoparticles (0.090 M). For the manufacture of copper
nanoparticles, different amounts of CTAB were used, including 0.087 M, 0.09 M,
and 50% (Zhang and Cui 2009). Upon adding copper nitrate to the CTAB solution
with continual swirling and magnetic stirring, the color shift for copper nanoparticles
was gloomy violet. Bahadory (2008) attributed the color change to surface
plasmonic stimulation in metal nanoparticles. The stability of the CTAB procedure
of copper nanoparticle manufacturing was one of its shortcomings (Shah et al. 2014).
318 H. S. El-Beltagi et al.
To determine the stability of copper nanoparticles, the zeta potential was
evaluated. It is based on charge behavior phenomena. Nanoparticles are said to be
unstable if their zeta potential value is between 30 and +30. The stability of
generated copper nanoparticles was taken into account when measuring the zeta
potential of various concentrations of copper nitrate and CTAB.
16.2.2 Antifungal Activity of Cu-NPs Toward Fusarium
The use of nanoparticles in a variety of disciplines has a principal impact on society
and the global economy. In a continuous flow mode, copper metals were success-
fully absorbed from polluted water using an alginate-immobilized water hyacinth,
i.e., Eichhornia crassipes, which serves as a potential biosorbent in acidic media
(Bramhanwade et al. 2016). Fusarium culmorum,Fusarium oxysporum, and Fusar-
ium equiseti belong to the Fusarium species. In barley and wheat, F. culmorum
causes pre-emergence cotyledon blight, root rot, foot rot, or head blight (Mesterhazy
et al. 2005).
Chickpea wilt, Fusarium crown, Fusarium head blight, yellows, black point
disease, corm rot, root rot, vascular wilt, or damping-off are all plant diseases caused
by F. oxysporum in spinach, sugarcane, lettuce, prickly pear, tomato, garden pea,
pansy, potato, cultivated zinnia, cowpea, and Assam rattlebox. F. equiseti is a soil-
dwelling parasite that can infect a range of crop seeds, roots, tubers, and fruits. It
causes disease in a broad range of crop plants (Raabe et al. 1981).
Copper nanoparticles were tested in vitro for antifungal activity versus three
different crop fungal pathogens: Fusarium sp., Fusarium oxysporum,orFusarium
equise. Copper nanoparticles, interestingly, had a lot of effect against the crop
pathogenic fungi that were studied. Amphotericin B was utilized as a conventional
antifungal drug for antifungal action. Copper nanoparticles had the most action
versus F. culmorum,F. equiseti or F. oxysporum. Kanhed et al. (2014) discovered
in vitro antifungal activity of chemically generated copper nanoparticles combined
with the marketed antifungal drug Bavistin against four different plant pathogenic
fungi, including F. oxysporum,C. lunata,A. alternata and P. destructiva. Copper
nanoparticles have been known to be successful against a wide variety of plant
species.
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 319
16.3 Iron Nanoparticle Biofabrication and Fungicidal Properties
Iron nanoparticles (FeNPs) are used in magnetic storage devices, ferrofluids, mag-
netic refrigeration systems (Ahmad et al. 2017), medication administration, hyper-
thermia, bio-separation, and magnetic resonance imaging (e.g., enzyme-linked
immunosorbent assay) (Sophie et al. 2008). FeNPs are used in a variety of
applications due to their high magnetism, tiny size, microwave absorption
capabilities, and low toxicity (Chang et al. 2011). FeNP has been created using a
number of chemical processes. Electrospray synthesis, microemulsions,
sonochemical reactions, chemical co-precipitation of iron salts, hydrothermal
reactions, sol–gel synthesis, and hydrolysis and thermolysis of precursors are some
of the popular methods used for FeNP synthesizing (Albornoz and Jacobo 2006).
Numerous scientists have created techniques for green synthesis of Fe
3
O
4
nanoparticles in response to the requirement to produce beneficial formulations of
bioactive chemicals utilizing nanomaterials that are both environmentally and eco-
nomically beneficial (Venkateswarlu et al. 2013). Using phytochemicals to generate
iron oxide nanoparticles is also a simple, cost-effective, less poisonous, and environ-
mentally friendly method that has previously been used to make other heavy metal
nanoparticles. One of the major components in the antibacterial activity mechanism
can be active oxygen types created by these metal oxide materials. In this way,
nanoparticles of related metal oxides could be good antibacterial agents (Ales et al.
2009).
16.3.1 Plant Extracts Are Used to Produce Iron Oxide Nanoparticles
FeNPs were made utilizing processes that have previously been revealed (Xiulan
et al. 2013; Valentin et al. 2014). 6H
2
O was handled by 10% plant extract in a 1:
2 ratio with around 0.1 M FeCl
2
. The combination was thoroughly agitated at 100 C
till the greenish hue entirely changed to a deep black solution. The solution was
seated for 72 h (on Petri plates) inside a 60 C oven. Eventually, the blackish dry
matter was subjected to several characterization procedures.
16.3.1.1 FeNPs Characterization
Surface plasmon resonance (SPR) uptake transition is the most distinguishing
feature of nanoparticles. The yellow-colored reaction mixture turned dark brown
after overnight incubation in the dark. It could be due to the produced nanoparticles’
SPR excitation (Gopinatha et al. 2012). The reaction medium of iron chloride and
neem extract showed a strong peak at 272 nm, confirming the synthesis of FeNPs.
Due to N–H stretching and bending vibration of amine group NH
2
and O–H
overlying and stretching mode of soluble neem leaf extract particles, the Fourier
transform IR spectroscopy (FTIR) summary of neem extract and FeNPs exhibited
continuous spectrum of about 3000 cm
1
focused at 3325 cm
1
. Methyl C–H stretch
is indicated by peaks at 2916 and 2850 cm
1
, whereas –CHO group of neem extract
is indicated by peaks at 1728 cm
1
. The existence of ester linkages is noted by a
sharp peak at 1725 cm
1
, whereas the peaks at 1522 and 1453 cm
1
in neem extracts
can be attributed to bending vibrations of aromatic nitro compounds and carbonate
ions, respectively. As reported earlier (Gotic et al. 2009), the band around 600 cm
1
revealed Fe O extending of FeNPs, indicating the synthesis of nanomaterials.
According to the general FTIR image, neem extract has the highest FeNP lowering
potential, which has been validated by other investigations.
320 H. S. El-Beltagi et al.
The FeNPs are grouped and embedded in plant components due to the presence of
plant detritus. Nanoparticles were discovered to have an average size of 20–80 nm.
SAED (selected area electron diffraction) reveals that FeNPs have a less crystalline
structure. Along with FeNPs, bio-coatings were apparent, confirming neem extract’s
capacity to intervene as a protective coating for FeNPs. In FeNPs, the XRD report
reveals a thick downward slope with no sharp peaks. In FeNPs, there were no
diffraction pattern peaks associated with the prolonged crystalline form. Rather, a
wideband appears, which is characteristic of nebulous and ultra-small crystal
structures, with poorly defined diffraction patterns. Previous research on plant
extract-based FeNP synthesis has found the same things (Mahnaz et al. 2013;
Monalisa and Nayak 2013).
16.4 Green Synthesis of Zinc Oxide Nanoparticles
Research on nanoparticles is being conducted for its potential, especially in biomed-
ical research, converting agriculture and food wastes to fuel and other useful residues
via enzyme nano-bioprocessing, and managing phytopathogens in agriculture using
various types of nanocides (Joshi et al. 2019; Ahmad et al. 2020; Nandini et al. 2020;
Sangeetha et al. 2017), as well as, drug delivery and bioimaging probes, have proved
to have a wide variety of functions in molecular diagnostics, detection, and micro-
electronics (Sangeetha et al. 2017). ZnONPs have a unique feature towards bacterial
cellulase, which was discovered by studying the creation of hydrogen peroxide on
the exterior of ZnONPs (Sharma et al. 2010a,b). The antibacterial properties of
nanomaterials have been shown to be more effective than zinc oxide (Kumar et al.
2014). This is because smaller particles have a higher surface-to-volume ratio, with
strong antibacterial properties (Kumar et al. 2014; Sharathchandra et al. 2016).
ZnONPs are also excellent photocatalysts, which are used to sanitize wastewater
and degrade or decrease herbicides and pesticides. Hydrothermal synthesis
(Thilagavathi and Geetha 2014), electrochemical approach, mechano-chemical
method, laser ablation, sono-chemical, and polyol methods are some of the com-
mercial routes for ZnONPs manufacture (Muneer et al. 2015), sol-gel method,
precipitation method, microwave technique, and vapor-phase transport method
(Wang et al. 2014), and by aerosol process (Ozcelik and Ergun 2014). These
approaches can be used to make nanoparticles using either chemical or plant-derived
materials. The chemical production of metal nanoparticles necessitates the use of
synchronized conditions and specific external catalysts. In the case of plant-derived
nanoparticles, plants secrete catalysts in the form of co-enzymes that are non-toxic
and environmentally friendly reactants, and the reaction takes place at room
temperature.
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 321
16.4.1 Biomaterial Preparation
As a bio-reducing agent, Eucalyptus globulus leaves have been chosen for prepara-
tion. Plant materials have been shade-dried, cleaned in distilled water, sterilized for
30 s with mercuric chloride (0.1%), and washed five times with sterile water, and
then shade-dried again. Using a laboratory blender, the leaves were grinded and
utilized for additional research. Fifteen gram of leaf powder has been mixed with
200 mL of deionized water in a flask and incubated for 6 h in a shaker at 80 C and
1500 rpm. The extract was centrifuged at 10,000 rpm for 10 min before being filtered
through Whatman No. 1 paper to achieve a completed volume of 100 mL (Ahmad
et al. 2020).
16.4.2 Phytosynthesis of Zinc Nanoparticles
In a plant extract solution, 1 mM of zinc nitrate hexahydrate (Zn(NO
3
)
2
6H
2
O) was
postponed in a 1:2 ratio with continuous stirring and was agitated at 150 C for 2–3h
after it was completely dissolved, and the supernatant was discarded. The solid was
centrifuged two times at 6000 rpm for 10 min each time before being cleaned and
dehydrated at 80 C for 5–6 h. Dry particles have been kept at room temperature till
they change color before being used in future studies (Ahmad et al. 2020).
16.4.3 Formation of Zinc Nanoparticles
E. globulus leaf extracts were used to make zinc oxide. The color change from
colorless to pale yellow confirmed the production of ZnONPs. Other metals have
been reported to have color changes that indicate preliminary confirmation of the
creation of nanoparticles (Joshi et al. 2019). The presence of ZnONPs is confirmed
by the color change in the reaction mixture caused by surface plasmon resonance
(Shekhawat et al. 2014). Without any additives or reactions, plant-derived
nanomaterials respond quickly at room temperature (Ahmad et al. 2020). When
compared to other techniques like physical, chemical, biological, or hybrid
approaches, which require additional power and may introduce dangerous materials
that lose their consistency, this method is simple and best suited for measuring
biological activity.
322 H. S. El-Beltagi et al.
16.4.4 Characterization of ZnNPs
SEM pictures of ZnONPs produced utilizing E. globulus extract demonstrate that
agglomerations of molecules were more common when this technique of production
was used. The presence of biological material in the sample is confirmed by the
clustered form of nanoparticles. The shape and size of created ZnONPs were
discovered utilizing TEM. The resulting ZnONPs were often circular, with some
extended particle sizes ranging from 52 to 70 nm. E. globulus extracts have
previously been shown to behave as an active template during synthesis, avoiding
the agglomeration of nanoparticles generated (Gnanasangeetha and Sarala 2013).
16.4.5 Antifungal Activity of ZnONPs
ZnONPs are inorganic nanoparticles that have multiple functions, including
antibacterial capabilities. The rate of antifungal activity of ZnONPs produced with
E. globulus extract was higher than that of Zn bulk material. The activity of ZnONPs
had been dose-dependent; at 25 ppm, there was reasonable to fine suppression,
followed by a considerable rise in pathogen inhibition at higher concentrations of
50 and 100 ppm (Sharma et al. 2010a,b). In comparison to synthetic ZnONPs, green
ZnONPs demonstrated a significant improvement in biological activity against a
variety of diseases. Eman et al. (2013) discovered t hat ZnONPs have antifungal
action toward Microsporum canis,Candida albicans,Aspergillus fumigatus, and
Trichophyton mentagrophyte (Eman et al. 2013). The synergetic effect of ZnONPs
and Eucalyptus globulus extracts in equal proportion on fungal mycelial growth was
assessed. In the instance of B. dothidea and A. mali, the synergetic activity resulted
in a total suppression (100%) of the mycelium at 100 ppm.
16.4.5.1 Fungi Treated with Zinc Nanoparticles Under Microscope
Microscopic examination revealed a rupture at the hyphae tip, which is a site for the
generation of new conidia, as well as unconnected conidia in two fungi. The
discharge of cellular components could be triggered by damage to the fungal
hyphae’s surface caused by hyphal contraction. Water-treated hyphae, on the other
hand, are unaffected by hyphal injury (Shetty et al. 2019).
16.4.5.2 Effects of ZnONPs on Fungal Mycelia as Examined by SEM
The influence of nanoparticles on developing hyphae was studied under the micro-
scope, and it was discovered that ZnONPs visibly harmed D. seriata hyphae, but
hyphae handled with water appeared to be unaffected. Under treatment with
nanoparticles, distortions and injuries of D. seriata hyphal cell wall, degeneration
of sexual organs, and serious damaged hyphal wall layers resulted in severely
fractured hyphal wall layers retaining few and shrunken hyphae. Surprisingly,
these changes in mycelium structures had no effect on the fungus’s life cycle.
Villamizar-Gallardo et al. (2016) made a similar observation claiming that produced
AgNPs cause significant structural damage to Aspergillus flavus, but have no effect
on the fungus’s life cycle creation.
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 323
16.5 Metallic MgO Nanoparticles
As scientific knowledge has advanced, developing unique alternative techniques for
managing soilborne fungal infections has become increasingly desirable (Chen et al.
2020). Magnesium oxide nanomaterials (MgONPs) have been acknowledged by the
US Food and Drug Administration as safe disinfection agents with no toxic
consequences, and they have significant potential in medical therapies and water
disinfection (Chalkidou et al. 2011). Furthermore, earlier research has shown that
MgONPs can be employed as microbicide in vitro versus gram-positive (Staphylo-
coccus aureus,Bacillus subtilis) and gram-negative (E. coli) bacterial and fungal
pathogens. MgONPs’antibacterial activity is influenced by their pH, size, concen-
tration, or shape (Parizi et al. 2014).
These toxic effect processes, unlike agro-chemicals, quite probably result from
immediate physiochemical deletion upon contact, which prevents the disintegration
of vegetative fungal spores by producing malic acid and amino acids. Numerous
findings have argued that the production of ROS and their buildup in cells is an
actual mechanism of metal nanomaterials’antibacterial pathogen defense; this is
especially true since ROS formation directly limits a cell’s ability to reproduce
(Chen et al. 2014). Disinfection of microorganisms is assumed to be based on direct
contact among biological cells and nanomaterials (Zhao et al. 2018a,b). Superoxide
ion production on the exterior of MgONPs, for example, disrupts peptide
connections in the bacterial cell membrane. Ralstonia solanacearum, a medicinal
and foodborne pathogen, has shown antibacterial potential, successfully lowering
agricultural bacterial and fungal infections (Sierra-Fernandez et al. 2017). Despite
this, little study has been done on the impacts of MgONPs on fungal infections or
complex antimycotic processes. MgONPs could be antifungal by acting directly on
fungal cells. Most importantly, an ideal agricultural microbicide would be free of
phytotoxicity, which is critical for environmentally friendly and sustainable agricul-
ture. Foliar spray of MgONPs as nanoscale fertilizers or optical absorption boosters
substantially boosted crop growth, which was very exciting (Cai et al. 2018). It also
showed that Chen et al. (2020) looked into how MgONPs antifungal mechanisms
worked against phytopathogenic fungi. This was in comparison to macroscale MgO
(mMgO) antifungal mechanisms.
324 H. S. El-Beltagi et al.
16.5.1 Synthesis of MgONPs
Under vigorous stirring, 10 mL of Carica papaya L. leaf extract was progressively
combined with 50 mL of 0.1 M magnesium nitrate solution. As a result, some white
precipitates, primarily composed of Mg(OH)
2
, were identified. To remove any
remaining impurities, the material was centrifuged three times with deionized
water at 5000 rpm for 10 min. Finally, the precipitate was dehydrated at 100 C
and calcined at 400 C to yield MgONPs (Oladipo et al. 2017).
16.5.2 Characterization of MgO Nanoparticles
Several methods were used to characterize the MgONPs, including morphological
structure and aggregation state analysis. Nanoparticles were irregularly spherical and
had a size distribution of 100 nm. Nanoparticles, on the other hand, tended to clump
together in stacks, as shown by TEM pictures of the nanoparticle morphology,
showing poor dissolvability because of van der Waals (vdW) force (Stabryla et al.
2018). The SAED pattern of MgONPs confirms the material’s nanocrystalline
structure as well as its ability to be archived into the cubic structure of MgONPs,
which is consistent with XRD analysis (Makhluf et al. 2005). In HRTEM image, the
interplanar distance between interlayer outskirts is 0.237 nm. The (111), (200),
(220), (311), and (222) crystallographic planes of face-centered cubic (FCC)-
structured MgO nanoparticles were attributed to only a few strong peaks situated
at 36.95, 42.92, 62.30, 74.76, and 78.61, respectively, according to classic XRD
spectra (Fig. 16.1a–e).
16.5.3 Fungitoxic Mechanism of MgO Nanomaterials
Among all testing conditions, MgONPs reduced both fungi’s mycelial development,
exhibiting significant concentration-dependent toxic impacts that were consistent
with many other metallic nanomaterials (Sun et al. 2018). On the third day, the mean
mycelial size of colonies grown on plates containing 125–500 g/mL nanoparticles
were 2.1, 1.32, and 0.63 cm, and on the fifth day, it was 5.84, 3.17, and 0.63 cm for
P. nicotianae; these were much lower groups (Fig. 16.2a). Untreated samples, on the
other hand, obtained values of up to 6.21 and 8.3 cm at similar intervals. T. basicola
mycelia grew slowly in comparison to controls, and flagellated colony expansion
was significantly reduced after 10 and 20 days of incubation, with 1.89 and 3.18 cm
after 250 g/mL MgONPs, and 2.09 and 2.96 cm after 500 g/mL MgONPs
(Fig. 16.2b). Despite the fact that 125 g/mL MgONPs also had no effect on colony
size, closer examination revealed a loosening of the mycelial structure as compared
to the control group’s thick and dense colony. Both fungi’s hyphae developed slowly
after 5 and 20 days of incubation. In comparison, we used the same approach to
investigate the biocidal activity of mMgO (Makhluf et al. 2005).
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 325
Fig. 16.1 (a) Inset of representative transmission electron microscopy (TEM) photos of produced
MgO nanomaterials with selected area electron diffraction (SAED) patterns (MgONPs). (b) High
magnification of MgONPs. (c) Size distributions of nanoparticles (D,E) X-ray diffraction (XRD)
and X-ray photoelectron spectroscopy (XPS) survey spectrum of nMgO. The inset plot indicates the
strong XPS scan spectrum of nanoparticles in Mg 2p and Mg 2s spectral areas (Chen et al. 2020)
5
0
125
250
500
0
125
250
500
4
3
2
1
Growth days (d)
20
10
5
15
Growth days (d)
Concentration (mg/mL)
nMgOnMgO
0
125
250
500
0
125
250
500
Concentration (mg/mL)
nMgO nMgO
Mycelium colony diameter (cm)
0
1
2
3
4
5
6
7
8
9
Mycelium colony diameter (cm)
0
1
2
3
4
5
6
7
8
9
ab
Fig. 16.2 P. nicotianae (a)and T. basicola (b) mycelium colony diameter upon 5 and 20 days of
application to oatmeal agar (OA) and potato dextrose agar (PDA) media varying concentrations
(0, 125, 250, 500 g/mL) of MgO particles or (MgONPs) particles, respectively (Chen et al. 2020)
326 H. S. El-Beltagi et al.
The results demonstrated that mMgO followed the same concentration-dependent
pattern as two types of fungus that were treated with MgONPs. Surprisingly,
P. nicotianae hyphae growth was substantially hindered, despite T. basicola toxicity
being quite low. Diameters of two hyphal colonies cultivated for 10 and 20 days in
media containing 125 and 250 g/mL mMgO, respectively, compared with those of
control were not statistically different, while control exhibited thinner mycelia.
Especially for T. basicola and P. nicotianae growth inhibition rates were 29.63%,
61.8%, 92.4% and 0%, 60.88%, 63.59%, upon MgONPs treatment for 5 and
20 days, whereas mMgO treatment caused 11.46%, 40.0%, 84.80% and 2.91%,
10.00%, 16.10% inhibition rates. In other words, as the incubation time increased,
the growth suppressive impact of nanoparticles became stronger. It’s possible that
when original normal hyphae came into contact with MgONPs, they were severely
injured, and the compromised fungal hyphae kept growing, but at a much slower
rate. During the incubation period, it appears that the antifungal activity of
nanoparticles diminished progressively. Importantly, the antifungal activity of
MgONPs was dose-dependent, similar to other metallic oxide nanoparticles and
carbon-based nanomaterials (Chen et al. 2016a). It’s worth noting that mMgO
fungistatic activity was not as high as that caused by MgONPs. Metal oxide
nanoparticles have been shown to be more harmful to bacteria, fungus, and plants
than their bulked counterparts (Heinlaan et al. 2002). TiO
2
, CuO, and ZnO
nanoparticles had also exhibited distinct antifungal action against numerous
phytopathogens, including Gloeophyllum trabeum,Lycopersicon esculentum,
Tinea versicolor,Botrytis cinerea,Fusarium oxysporum, and Pseudoperonospora
(Terzi et al. 2016; Hao et al. 2017). It is the result of increased effective surface area,
i.e., compact size that enhances the chances of nanoparticles contacting biological
samples, allowing for a broad variety of diverse interactions in nanobiosystems.
Further theory holds that when nanoparticles interact with biological cells and
membranes, they form a variety of cell-nanoparticle interfaces including protein
corona creation, particle encasing, or even intracellular utilization (Nel et al. 2009).
16.5.4 Repression of Conidial Spore Germination and Sporangium
Formation
Spores are the smallest propagative components of fungal infections; they signifi-
cantly contribute to the pathogenic achievement of hosts and have a modest dormant
survival potential, such that spore regeneration is required; this is the most important
stage in the development of vegetative and reproductive protonema. In the following
study, to further test the fungicidal efficiency of nanomaterials, conidial spores of
fungal species were assessed for the existence of MgONPs and mMgO (Judelson and
Blanco 2005). Microscopy photos of T. basicola and P. nicotianae spore detentions
after incubation with various concentrations demonstrated a significant reduction in
spore germination rate, when compared to untreated fungus acting as control
samples (approximately complete germination). There was no germination when
fungal spores were incubated at their greatest dosage, indicating that they had
complete sporicidal effects. The MgONPs have shown a stronger sporicidal effect
than MgONPs and that the antagonistic impact on spore development is as strong as
the effect on mycelial growth. On the other hand, MgONPs had a significant impact
on sporangium production. As shown in Fig. 16.3, sporangia of T. basicola and
P. nicotianae developing in the control group contained a lot of conidia. Neverthe-
less, the number of sporangia and their morphology pattern were significantly
reduced in the MgONPs-exposed group at the concentrations tested, which can be
attributed to the hypothesis that profoundly directs nanomaterial-hyphae interaction;
this disrupts cellular protein and chemical characteristics that are implicated in
sporangium forming (Chen et al. 2016a). The T. basicola sporangial wall’s outer
electron-dense layer had disappeared, and the sporangium’s structure was loosening
(red arrow). However, after 500 g/mL of mMgO treatment, there was a moderately
substantial suppression of sporangia production, indicating that mMgO had a mild
fungistatic impact (Fig. 16.3). In vivo and in vitro, metals, metal oxide
nanomaterials, single-walled carbon nanotubes (SWCNTs), multi-walled carbon
nanotubes (MWCNTs), and graphene have all been shown in studies to have
sporicidal properties against a variety of phytopathogenic fungi (Liu et al. 2017a,b).
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 327
Fig. 16.3 Microscopic photos of P. nicotianae (a,b) and T. basicola (c,d) sporangia after
co-culture with tested concentrations of MgONPs and micro-Mgo particles, respectively (Chen
et al. 2020)
Wani and Shah (2012) observed the nanotoxicity of MgONPs on many agricul-
tural pathogenic funguses and considerable suppression of spore development of
Mucor plumbeus,Rhizopus stolonifer,F. oxysporum, and Alternaria alternata.
MgONPs were recently discovered to inhibit sporulation in seven distinct
rot-causing fungi (Aspergillus alternata,Aspergillus niger,M. plumbeus,
Trichothecium roseum,Penicillium chrysogenum,Rhizoctonia solani,and Penicil-
lium expansum) with no reason. Also, a comparative toxicity experiment was
performed on metal nanoparticles’antifungal effectiveness toward seven species
of major foliar and soilborne plant diseases, including B. cinerea,A. alternata,
Verticillium dahlia,Monilinia fructicola, and Fusarium solani. Copper
nanoparticles (CuNPs) have been found to be most impactful on the majority of
fungal spores studied, followed by zinc oxide nanoparticles (ZnONPs), which were
also more poisonous than advertising fungicide Cu(OH)
2
(Malandrakis et al. 2019).
Nevertheless, there was no proof of their antifungal mechanisms. In this respect, we
discovered that MgONPs can inhibit sexual reproduction in fungal cells, and future
research will look into why MgONPs causes such great sensitivity in fungal cells.
328 H. S. El-Beltagi et al.
16.5.5 Direct Physical Connection of Nanoparticles with Fungal Cells
Several investigations have shown that manufactured nanomaterials come into direct
contact with biological tests such as bacteria, fungi, and cells, as well as exterior
adhesion and cell absorption patterns (Rodriguez-Gonzalez et al. 2016). Certain
metal oxide nanomaterials bond to the surfaces of harmful bacteria, as predicted
(Jiang et al. 2009). The authors used SEM/EDS to examine morphological changes
in live cells and visually detect the existence of nanoparticles on hyphae to investi-
gate the impact of MgONPs on fungal hyphae.
In this experiment, two types of vegetative mycelia were generated and cultured
for 3 h with varied quantities of nanoparticles before being supported on the grid and
observed. T. basicola and P. nicotianae were treated with MgONPs at 500 g/mL,
which resulted in clearly undesirable changes after crumbled morphologies under
SEM upon exposure. That preserved a filled, uniform, and well-developed tube-like
formation. Sunken and bloated, mycelia developed an aberrant structure. In this
experiment, two types of vegetative mycelia were generated and cultured for 3 h
with varied quantities of nanoparticles before being supported on the grid and
examined. T. basicola and P. nicotianae were exposed to MgONPs at 500 g/mL,
which resulted in a clearly undesired alteration, which preserved a complete, consis-
tent, and well-developed tube-like shape under SEM upon treatment. Mycelia sunk
and bloated, and they evolved an abnormal structure. EDS was utilized to evaluate if
ether MgONPs was present in or on fungi, or to validate the chemical makeup of
associated agglomerates because it could trace the atomic number of every atom in a
substance (Rodriguez-Gonzalez et al. 2016).
Furthermore, the presence of MgONPs on the hyphal exterior has been
established, resulting in cell membrane local disruption. The presence of MgONPs
in the cell membrane was investigated as well. These findings back up the theory that
metal-based nanoparticles have particle-specific antifungal mechanisms (Stabryla
et al. 2018). Furthermore, TEM photos demonstrated that regulated fungal mycelia
had normal dense cytoplasm with regular organelle distribution and typical inner and
outer cell wall layers.
In summary, the first steps are thought to be harmful to the exterior cell membrane
and downregulation of the cellular membrane; as a result, a sequence of essential
reactions occur, including successive nanomaterial uptake and communication to
biological components such as lipids, DNA, and protein, leading to apoptosis.
Aggregation circumstances, geometry, size, and physical qualities all influence the
inactivation effects of nanoparticles (Herd et al. 2013). Numerous studies using
nanomaterials which physically coated and permeated bacterial membranes
demonstrated that they behaved differently than one’s microscale aggregates, such
as Al
2
O
3
or SiO
2
in comparison to their microscale aggregates (Xue et al. 2014). It
appears that understanding the underlying mechanism requires mechanistic interfa-
cial contact among nanoparticles and biological membranes (Sharma et al. 2015).
Cell wall structure and composition of fungus could be to blame for these events.
Chitin, 1,3 glucans, and 1,6 glucans, as well as a variety of glycoproteins, make up
the hyphal cell wall (Brown et al. 2015). Adhesins, or glycoproteins, play a role in
adhesion to inorganic or organic surfaces, as well as host–pathogen interactions.
Agglutinin-like sequence (ALS) and glycosylphosphatidylinositol (GPI)-modified
cell membrane protein families are two main members (Bamford et al. 2015).
Nanoparticles, for instance, can behave like promoters, encouraging direct interac-
tion in the same way as carbon nanotubes (CNTs) drive pathogen agglomeration.
Sugar-based ligands have been added to CNTs, which are recognized by receptors
on Bacillus spore surfaces (Luo et al. 2009).
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 329
16.5.6 Membrane Destabilization in Fungal Cells
In addition, the contribution of glycoproteins to the negative charge of the fungal cell
wall cannot be overlooked. Outstanding nanoparticle–cell aggregates that have been
found in previous findings of the antibacterial activity of a series of nanoparticles
could be mediated by electrostatic contact (Chen et al. 2016a,b). MgONPs and
graphene were discovered to be directly bound to phytopathogens, altering cell
membrane potential and energy metabolism (Cai et al. 2018). Enhanced adhesion
caused by MgONPs adsorption on fungal cells should, in theory, alter membrane
potential. Pan et al. (2013) suggest that the Zeta potential of fungal cells has been
altered by electrostatic forces among positive-charged MgONPs and fungi, allowing
MgONPs to come into close contact with the cell surface and deposit (Pan et al.
2013). Reduced electric repulsive forces resulted in improved antifungal medication
adhesion to microorganisms. As a result, as indicated by the SEM and TEM photos
discussed above, nanoparticles may be capable of physically harming the cell
envelope (Sharma et al. 2015). Leung et al. (2014) discovered that MgONPs
effectively conversed with Escherichia coli, causing downregulation of membrane
proteins like connection porins and ion channel proteins and disruption of proteins
associated with membrane lipid metabolism, resulting in cell lysis. Because the
internal membrane was directly touched by MgONPs, the nanoparticle–cell interface
was extremely diversified. Nanomaterials, afterwards, stimulated vibrant
physiochemical conversations that were motivated by adhesion forces that could
emerge from specific or non-specific conversations like electrostatic, hydrophobic
forces, twisting, vdW, and deforming membranes and rising cytoplasmic membrane
permeability to nanomaterials (Wu et al. 2015).
16.6 Fungal Cells’Oxidative Stress Responding
More research is needed to investigate if nanoparticles generate subcellular or cell
membrane oxidative stressors, which has been previously assumed to be the most
conceivable method for nanomaterials in living organisms, given the significant
activity of MgONPs versus fungal cells in response to direct interaction. After
treatment with modest concentrations of MgONPs, bacterial Ralstonia
solanacearum cells accumulated ROS (Cai et al. 2018). This is due to the fact that
metal nanoparticles’free radicals can damage lipids in bacterial cell membranes
(Lopes et al. 2016). However, when fungal pathogens react with nanoparticles,
oxidative stress has not been examined. Various species are reported to be the
most prominent indicators of oxidative stress erupting in cellular components,
including O
2
•
,H
2
O
2
, and ROS (Rispail et al. 2014). While two kinds of fungal
hyphae have been subjected to a variety of MgONPs levels, H
2
DCFH-DA fluores-
cence was generated inordinately compared to the control. Once the concentration of
MgONPs has been improved, the creation of fluorescence improved, demonstrating
that MgONPs do indeed induce the generation of ROS.
330 H. S. El-Beltagi et al.
16.7 Bimetallic Nanoparticles: Flow Synthesis and Fungicidal
Activity
AgNPs (Długosz et al. 2021) are the most widely characterized nanomaterials. They
are particularly active against bacteria and can be applied to a wide range of various
products (Peszke et al. 2017). Despite nanosilver’s numerous advantages, like small
doses adequate to restrict bacteria growth, a vast variety of options, and simplified
techniques for generating steady suspensions, substances which would operate well
for biocide while restricting nanosilver’s negative effects are also being sought
(Ahmed et al. 2016). CuNPs which have strong antibacterial and antifungal
properties are instances of particles with similar properties to AgNPs (Chatterjee
et al. 2014). In addition, CuNPs are less costly and easier to find than AgNPs
(Asghar et al. 2018). Basic disadvantage of utilizing CuNPs is the challenge of
establishing good suspension with sufficient nanoparticle concentration to guarantee
adequate bactericidal activity. The technique of generating CuNPs would be time-
consuming, and nanomaterials themselves are often bigger than AgNPs, which could
reduce CuNPs biocidal potential (Tan and Cheong 2013).
The combination of AgNPs antibacterial capabilities with CuNPs antifungal
qualities allows for the creation of material with a broad spectrum of antimicrobial
activity (Kalinska et al. 2019). It is feasible to lower quantities of individual metals
while keeping similar antibacterial action by synthesizing a product that contains
both components. Single-stage or multi-stage techniques can be used to create
bimetal molecules or multi-stage core-shell molecules (Liu et al. 2017a,b). The
biological activity of the final substance is affected by the ion reducing sequence.
Furthermore, the biocidal characteristics of nanoparticles are dependent on the
donation of particular metals to item and molecule form. Hikmah et al. (2016)
investigated the microstructure or morphology of silver-copper core-shell
nanoparticles as a function of Ag to Cu molar proportions. Depending on the
metal concentration, nanoparticles varying in size between 25 and 50 nm were
created. The magnitude of CuNPs grew significantly as the proportion of copper in
the material increased. This could be due to CuNPs reduced stability, whereas
AgNPs remained unaffected by process conditions, and their size stayed unaltered.
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 331
Utilization of copper, silver, and bimetallic nanomaterials results in slow mobile
ions into a scheme that is important in antibacterial action. Metal ions release ROS
that, among other things, impair the action of cell respiratory enzymes. The presence
of thiol groups –SH makes it easier for silver ions to interact with each other,
enhancing ROS production. On the one hand, AgNPs interact with the bacterial
membrane of cells, injuring it, and on the other side, it helps silver ions enter the cell,
deactivating it (Sreeju et al. 2016).
Metal nanoparticle suspensions were created in the microwave reactor’sflow
system. The experimental system’s schematic diagram was previously published
(Banach and Długosz 2019). In a continuous microwave flow reactor, metal and
bimetallic nanoparticles were synthesized (CMFR). Solutions have been hyped
through microwave (Samsung, 100–800 W, 2.45 GHz frequency) using an HPLH
dosing micropump (model pulse free). The length and diameter of the glass pipe
were 550 mm and 70 mm, respectively. To generate nanomaterials, a flow of metal
saline solution has been coupled with a flow of tannic acidic media, followed by the
flow of hydroxide solution. The overall current of mixture ranged from 171.5 to
343.0 lm
3
/s depending on residence time. Metal ion solution, tannic acid solution or
alkaline solution had reagent volume ratios of 5:2:3. The final volume of
nanomaterials has been 500 mg/dm
3
.
16.8 Pectinase-Responsive Mesoporous Silica Nanoparticle
Carriers (MSNPs)
To protect crops from pests, a great array of chemical pesticides is used in agriculture
around the world. However, upwards of 90% of pesticides are misplaced throughout
application due to deterioration parameters such as hydrolysis, light, microbes,
temperature, and others. Furthermore, non-systemic pesticides are quickly washed
into groundwater by rain and are influenced by immediate exposure to external
elements like temperature or ultraviolet rays (Zhu et al. 2018). All of these
difficulties pose serious risks to the environment and non-target creatures and the
increasing expense of agricultural applications. As a result, it’s critical to get
insecticides to the right target location in plants without decreasing its potency
(Kumar et al. 2014). Nanotechnology can currently improve pesticide transfer and
distribution in plants, resulting in increased use efficiency (Kumar et al. 2014).
Mesoporous silica nanoparticles (MSNPs) offer a lot of potential as nanocarriers
for delivering chemicals to plant cells because of their simplicity of fabrication and
surface alteration, high surface area, maximum load performance, bioactivity, and
general stability (Sun et al. 2014). As a result, MSNPs have been used in a variety of
applications, including the packing of molecules like nucleic acids (Kamegawa et al.
2018), proteins, drugs, or pesticides (Shao et al. 2018). On the other hand, MSNPs
still need to be improved in terms of control safety and effectiveness. Initial pesticide
discharge from MSNPs, for instance, and lower service performance could both lead
to low control systems (Manzano and Vallet-Regí 2020). As a result, developing
MSNPs predicated on an encapsulation strategy could indeed help to avoid the
untimely secretion of packed cargo in MSNPs.
332 H. S. El-Beltagi et al.
Smart stimuli-reacting materials are stimulated by light, redox potential (Tryfon
et al. 2019; Liang et al. 2020), pH (Xiang et al. 2018), temperature (Gao et al. 2020),
or enzymes (Kaziem et al. 2018). They are good for putting pesticides inside
nanoparticles so that they stay stable and can be released for a long time. Because
of their biodegradability, eco-friendliness, and ease of availability, natural polymers
such as chitosan, cellulose, alginate, pectin, and hyaluronan have been widely used
in a variety of sectors (Xu et al. 2018; Pang et al. 2019). Because of its abundance of
functional groups that could be altered to convey unique physicochemical
characteristics, pectin, or polysaccharide, was used as an intermediary for content
delivery methods. Moreover, coating a vehicle with pectin, which could be broken
down by plant pathogen-secreted enzymes like pectinase, enables pesticide release
over a lengthy period of time. Pathogens which induce apoptosis, besides damaging
plant cell walls, frequently use the pectin secretion mechanism (Fan et al. 2017).
Rice (Oryza sativa L.) is the significant yield that feeds over half of the world’s
inhabitance. Rice blast disease, induced by Magnaporthe oryzae, is among the most
damaging diseases to rice, resulting in 80–100% production losses in epidemic areas
(Hendy et al. 2019). Rice blast can affect different sections of the rice plant,
including leaf collars, pedicels, panicles, seeds, leaves, or necks, causing symptoms
and lesions. Rice blast is combated with a variety of pesticides, including nonsys-
temic insecticides. Efficiency of insecticides against rice blast could be increased by
using transport features of nanomaterials in plants. Among other cell wall
components, M. oryzae produces enzymes that break down cellulose, hemicellulose,
cutin, and pectin (Quoc and Bao Chau 2017). Scientists have utilized these enzymes
as stimuli throughout investigations on the sustained releasing of pesticides on
regular basis (Liang et al. 2020).
Prochloraz (N-propyl-N-(2-(2,4,6-trichlorophenoxy)ethyl)-imidazole-1-
carboxamide) (Pro) is an imidazole fungicide that is proudly utilized to protect
plants from a wide range of fungi, including M. oryzae (Quoc and Bao Chau
2017). This substance is a 14-demethylation inhibitor that inhibits the CYP51
enzyme encrypted by the CYP51 gene. Pro is a nonsystemic fungicide of low
plant uptake, due to ineffective use of field capacity (Zhao et al. 2018a,b). The
purpose of this study was to look into the migration and allocation of Pro-loaded
MSNPs that had been cross-linked by pectin (Pro@MSN-Pec) throughout rice
plants. MSNPs have been produced or fluorescein isothiocyanate (FITC) labeled
tracking the carriers’migration through rice plants utilizing optical microscopy.
Pro@MSN-Pec and/or commercial formulation antifungal and hybridization
characteristics were examined further. Upon revealing rice leaves to Pro@MSN-
Pec and commercial formulations, the pro-content in rice plant organs has been
determined using high-performance liquid chromatography (HPLC). Utilizing
ultrahigh-performance liquid chromatography/mass spectrometry (UPLC/MS), the
ultimate residue quantities of Pro in the field have been evaluated.
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 333
16.8.1 Pro@MSN-Pec Synthesis and Characterization
MSN nanoparticles were produced by condensing silica prelude TEOS in the
existence of CTAB, resulting in a configuration that served as a pattern for
nanomaterial formation. Because of the reactivity of silica, the exterior of
nanomaterials is protected by a large number of available –OH groups, providing
a platform for transplanting multipurpose polymers onto the exterior and inner
streams of nanomaterials. In this study, APTES was used to alter the surface of
MSN to amino (–NH
2
) clusters via organic silane clusters (Hussain et al. 2013). In
addition, Pro in hexane has been packed into MSNPs. Morphology of MSNPs and
Pro@SN-Pec was classified using SEM or TEM. SEM and TEM were used to
classify the morphology of MSNPs and Pro@SN-Pec. MSNPs have been found to
have stable appearance or spherical shape, with noticeable mesoporous configura-
tion. MSNPs ranged in size from 20 to 50 nm. TEM and SEM assessments revealed
changes in particle morphology and size between MSNPs and Pro@MSN-Pec after
Pro-loaded MSNPs were transplanted with pectin. Shell structure of Pro@MSN-Pec
differed from those of MSNPs, implying that pectin overlay was powerfully encased
onto the exterior of MSN to great miscibility and unified form. Particles’sizes
ranged from 19 to 110 nm, with an estimate of 70.89 nm. FTIR spectroscopy has
been used to explore structural maledictions that occurred following the initial
transplantation of particles to different functional clusters. FTIR spectrum of
MSNPs revealed intense peak at 1087 cm
1
(asymmetric Si–O–Si stretching),
975 cm
1
(Si–O stretching), 833 cm
1
(symmetric Si–O–Si stretching), or
462 cm
1
(bending vibrations) (Hussain et al. 2013). Absorption band at
1643 cm
1
confirmed that Si(OH)
4
remained the dominant Si species in MSNPs.
In the spectrum of MSN-NH
2
, a novel absorption peak of the amino (–NH
2
) cluster
has been noted at 1535 cm
1
, along with the absorption band of the methylene
(–CH
2
) group at 2980 cm
1
, demonstrating that –NH
2
cluster was effectively
connected on MSN exterior. In MSN-NH-pectin spectrum, sharp peaks for the
amide (–CONH–) bond, including at 1458 cm
1
(C–N), emerged, confirming the
creation of conjugate from the reaction between amino clusters of MSN-NH
2
and
carboxyl clusters of pectin (Liang et al. 2018). Internal plant pathogen stimuli, like
pectinase, might dissolve the pectin protective layer around MSNPs, triggers the
production of Pro from Pro@MSN-Pec at a specified location and also triggers the
delivery mechanism via pectin-cross-linked MSNPs. Pectinase is relatively stable at
room temperature and under neutral conditions. Addition of pectinase resulted in
significant accumulated discharge of Pro.
16.8.2 Pro@MSN-Pec Fungicidal Activity
After 7 days, fungicidal activity results revealed that Pro@MSN-Pec has been more
effective than Pro EC and technical Pro (Table 16.1). After 14 days, Pro@MSN-Pec
had greater fungicidal activity than Pro EC or technical Pro at the same
concentrations (Abdelrahman et al. 2021), which was most likely due to
334 H. S. El-Beltagi et al.
Table 16.1 Fungicidal activity of Pro@MSN-Pec, Prochloraz EC, or Prochloraz technical material toward Magnaporthe oryzae (Abdelrahman et al. 2021)
Pesticides
Days following
treatment
EC50 SE
(mg/L)
95% Confidence limits
(mg/L)
EC90 SE
(mg/L)
95% Confidence limits
(mg/L)
Pro@MSN-Pec 7 0.113 0.004 0.092 0.134 0.657 0.050 0.401 0.906
Prochloraz EC 0.151 0.013 0.085 0.218 1.197 0.113 0.636 1.759
Prochloraz technical 0.196 0.017 0.112 0.280 1.911 0.164 1.096 2.725
Pro@MSN-Pec 14 0.248 0.012 0.191 0.306 2.301 0.049 2.060 2.542
Prochloraz EC 0.453 0.007 0.419 0.486 3.352 0.014 3.283 3.421
Prochloraz technical
7
0.725 0.024 0.606 0.844 6.339 0.393 4.385 8.294
Notes: EC50 inhibitory level which inhibits 50% of exposure fungus, EC90 inhibitory level which inhibits 90% of exposure fungus, or SE is standard error (all
values are mean of triplicates)
Pro@MSN-Pec’s ability to decrease active substance deterioration and thus prolong
its efficient period. Furthermore, as a result of response to intensifying stimuli, active
ingredient’s release may become higher and faster over time, resulting in an increase
in Pro’s fungicidal activity (Liang et al. 2018). In comparison to Pro EC and
technical Pro, stimuli-responsive Pro loaded into pectin covered MSNPs had supe-
rior and longer-lasting fungicidal efficacy against M. oryzae. The percentage of
recovery was calculated using the quantity of Pro injected into blank samples. In
blank samples spiked with Pro at three fortified concentrations of 1, 10, and 100 mg/
kg, correctness of the analytical technique was explored. Pro recoveries in leaves
ranged from 70.1% to 86.5%, in stems from 88.7% to 98.8%, or in roots from 91.6%
to 97.9%. Relative standard deviation (RSD %, n¼3) was utilized to convey the
reproducibility of the current process, with an RSD of 8% in all instances. Agilent
software determined detection limit (LOD) as observed signal-to-noise ratio (S/N of
3).
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 335
16.8.3 MSNPs Translocation in Rice Plants
FITC has been transplanted on the exterior of MSNPs and samples have been
investigated under fluorescence microscopy to clearly show MSN diffusion in rice
plant organs. MSN-FITC has been used to treat rice plant seedlings in hydroponic
systems. To cure rice plants, two application methods were used: the first was to cure
leaves to guarantee diffusion of MSNPs via leaves to other sections of the rice plant,
and the other would be to cure roots to guarantee the transition of MSNPs by roots to
various parts of the rice plant. These findings suggest that MSNPs can be utilized as
pesticide commercial vehicles for plants, which is consistent with reports that
MSN-FITC can act quickly via plant parts (Zhu et al. 2018). Furthermore, previous
research has demonstrated that MSNPs can transport particles inside plants (Sun
et al. 2014).
16.8.4 Pro Distribution in Rice Plants
Pro@MSN-Pec allocation conduct showed that Pro might be transmitted via rice
plant organs like stems, roots, or leaves. The content of Pro throughout leaves
handled by Pro@MSN-Pec has been greater than in leaves handled with advertising
Pro over a duration of 4 h to 14 days (Abdelrahman et al. 2021). Furthermore, the
concentration of Pro in handled leaves peaked on the first day of diagnosis and
afterwards gradually declined from 1 to 14 days. From 4 h to 14 days, fungicide was
detected through stems or roots. Such findings suggest that Pro might be transmitted
through various regions of rice organs. In terms of uptake and accumulation in rice
leaves, stems, or roots, Pro@ MSN-Pec outperformed traditional Pro
EC. Furthermore, Pro quantities in stems or roots peaked on the third day of
diagnosis and subsequently declined for 3–14 days. Several studies found that pectin
encasing all over Pro-loaded MSNPs might preserve or extend the active ingredient’s
Compound
efficient period, particularly after the third day to 14 days, when contrasted to Pro EC
treatment. Particles smaller than 100 nm may also be easily transported into plant
tissues (Zhao et al. 2018a,b; Avellan et al. 2019). These particles may contain
compounds that plants are unable to absorb, such as pesticides, particularly nonsys-
temic insecticides, which may enhance their game and extend the active ingredient’s
lifetime in field treatments against target pests (Zhu et al. 2018).
336 H. S. El-Beltagi et al.
Table 16.2 Last residue amounts of prochloraz in rice plant stems, roots, seeds, leaves, or soil
(Abdelrahman et al. 2021)
Residues (mg/kg)
Stems Roots Rice seeds Leaves Soil
Pro@MSN-Pec
(1 g/L)
0.004 0.015 0.004 0.004 0.004
Pro@MSN-Pec
(2 g/L)
0.004 0.017 0.004 0.020 0.004
Pro@MSN-Pec
(4 g/L)
0.004 0.026 0.011 0.027 0.004
Prochloraz EC
(2 mL/L)
0.009 0.015 0.004 0.006 0.004
16.8.5 Pro Residues in Various Sections of Rice or Soil Below Field
Conditions
Prior to harvest, pro content was evaluated across several areas of the rice plant,
including stems, leaves, roots, seeds and soil (Table 16.2). Residue quantities in rice
stems, leaves, or roots have been marginally greater than in rice leaves, stems, or
roots handled to advertise Pro EC 44%, but residue amounts in seeds or soil are the
same. There was a slight difference in the Pro@MSN-Pec levels in rice plants when
different Pro@MSN-Pec levels were compared. The highest residue levels found in
the 2RD treatment residue limit (MRL) for Pro through rice calculated by the
European Union, Japan, China, and Hong Kong were 0.5, 1, and 0.5 mg/kg,
respectively. When residue values were contrasted to MRLs, it was found that
final Pro concentrations in rice were below maximum allowable concentrations,
implying that Pro@MSN-Pec treatment on rice organs presented a minimal risk.
16.9 Conclusion
Plant breeding and IPM are currently insufficient agricultural approaches, and
innovative alternative solutions that can fulfill our present and future food demands
are needed. Investing in cutting-edge agronanotechnology research that is just a
couple of decades old is worthwhile. We could save money on plant protection
chemicals, reduce yield losses, and increase agricultural productivity by using NPs.
The method is sufficient for dealing with issues such as rising chemical input costs,
ineffectual pesticide use, and pesticide contamination of land and groundwater.
Because zero-valent iron nanoparticles have a strong attraction to organic molecules
or heavy metals, they could be used to remediate pesticide-infested soil. Addition-
ally, FeNPs, like CaCo
3
, have excellent soil-binding properties. Furthermore, in
order to reduce the environmental impact of NM manufacturing, greater emphasis
needs to be placed on using agricultural residues as raw resources. Advances in
nanobiotechnology, such as the use of green chemistry to synthesize nanoparticles
from living tissues and plant extracts, provide guarantees of environmental protec-
tion. The diverse potential of nanoparticles includes one’s use as vehicles for active
targeting of antimicrobial substances and, moreover, one’s inherent antimicrobial
impacts and properties, both of which prove their own utility when used as
nanopesticides or nanofungicides toward plant pathogens.
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 337
Acknowledgments This work was supported by the Deanship of Scientific Research, Vice
Presidency for Graduate Studies and Scientific Research, King Faisal University, Saudi Arabia
(GRANT76).
References
Abdelrahman TM, Qin X, Li D, Senosy IA, Mmby M, Wan H, Li J, He S (2021) Pectinase-
responsive carriers based on mesoporous silica nanoparticles for improving the translocation
and fungicidal activity of prochloraz in rice plants. Chem Eng J 404:126440. https://doi.org/10.
1016/jcej2020126440
Ahmad H, Rajagopal K, Shah AH, Bhat AH, Venugopal K (2017) Study of bio-fabrication of iron
nanoparticles and their fungicidal property against phytopathogens of apple orchards. IET
Nanobiotechnol 11(3):230–235. https://doi.org/10.1049/iet-nbt20150061
Ahmad H, Venugopal K, Rajagopal K, De Britto S, Nandini B, Pushpalatha HG, Konappa N,
Udayashankar AC, Geetha N, Jogaiah S (2020) Green synthesis and characterization of zinc
oxide nanoparticles using eucalyptus globules and their fungicidal ability against pathogenic
fungi of apple orchards. Biomol Ther 10(3):1–13. https://doi.org/10.3390/biom10030425
Ahmed S, Ahmad M, Swami BL, Ikram S (2016) A review on plants extract mediated synthesis of
silver nanoparticles for antimicrobial applications: a green expertise. J Adv Res 7:17–28. https://
doi.org/10.1016/jjare201502007
Albornoz C, Jacobo S (2006) Preparation of a biocompatible magnetic film from an aqueous
ferrofluid. J Magn Magn Mater 305:12–10
Ales PC, Milan K, Renata V, Prucek R, SoukupováJ, Krystof V, Hamal P, Zboril R, Kvítek L
(2009) Antifungal activity of silver nanoparticles against Candida spp. Biomaterials 30:6333–
6340
Asghar MA, Zahir E, Shahid SM, Khan MN, Asghar MA, Iqbal J, Walker G (2018) Iron, copper
and silver nanoparticles: green synthesis using green and black tea leaves extracts and evalua-
tion of antibacterial, antifungal and aflatoxin B1 adsorption activity. LWT 90:98–107. https://
doi.org/10.1016/j.lwt201712009
Avellan A, Yun J, Zhang Y, Spielman-Sun E, Unrine JM, Thieme J, Li J, Lombi E, Bland G, Lowry
GV (2019) Nanoparticle size and coating chemistry control foliar uptake pathways, transloca-
tion, and leaf-to-rhizosphere transport in wheat. ACS Nano 13:5291–5305
Bahadory M (2008) Synthesis of noble metal nanoparticles. PhD thesis, pp 86–153
Bamford CV, Nobbs AH, Barbour ME, Lamont RJ, Jenkinson HF (2015) Functional regions of
Candida albicans hyphal cell wall protein Als3 that determine interaction with the oral
bacterium Streptococcus gordonii. Microbiology 161:18–29. https://doi.org/10.1099/
mic0083378-0
338 H. S. El-Beltagi et al.
Banach M, Długosz O (2019) Continuous production of silver nanoparticles and process control. J
Clust Sci 30:541–552. https://doi.org/10.1007/s10876-019-01505-y
Bramhanwade K, Shende S, Bonde S, Gade A, Rai M (2016) Fungicidal activity of Cu
nanoparticles against Fusarium causing crop diseases. Environ Chem Lett 14:229–235.
https://doi.org/10.1007/s10311-015-0543-1
Brown L, Wolf JM, Prados-Rosales R, Casadevall A (2015) Through the wall: extracellular vesicles
in gram-positive bacteria, mycobacteria and fungi. Nat Rev Microbiol 13:620–630. https://doi.
org/10.1038/nrmicro3480
Cai L, Chen JN, Liu ZW, Wang HC, Yang HK, Ding W (2018) Magnesium oxide nanoparticles:
effective agricultural antibacterial agent against Ralstonia solanacearum. Front Microbiol 9:
790. https://doi.org/10.3389/fmicb201800790
Castro ML, Ojeda C, Cirelli A (2013) Advances in surfactants for agrochemicals. Environ Chem
Lett 12:85–95
Chalkidou A, Simeonidis K, Angelakeris M, Samaras T, Martinez-Boubeta C, Balcells L,
Papazisisb K, Dendrinou-Samarae C, Kalogiroua O (2011) In vitro application of Fe/MgO
nanoparticles as magnetically mediated hyperthermia agents for cancer treatment. J Magn Magn
Mater 323:775–780. https://doi.org/10.1016/jjmmm201010043
Chang R, Yu J, Ma X, Anderson D (2011) Polysaccharides as stabilizers for the synthesis of
magnetic nanoparticles. Carbohydr Polym 83(2):640–644
Chatterjee AK, Chakraborty R, Basu T (2014) Mechanism of antibacterial activity of copper
nanoparticles. Nanotechnology 25:135101. https://doi.org/10.1088/0957-4484/25/13/135101
Chen H, Yada R (2011) Nanotechnologies in agriculture: new tools for sustainable development.
Trends Food Sci Technol 22(11):585–594
Chen JN, Peng H, Wang XP, Shao F, Yuan ZD, Han HY (2014) Graphene oxide exhibits broad-
spectrum antimicrobial activity against bacterial phytopathogens and fungal conidia by
intertwining and membrane perturbation. Nanoscale 6:1879–1889. https://doi.org/10.1039/
c3nr04941h
Chen L, Song Y, Tang B, Song X, Yang H, Li B, Zhao Y, Huang C, Han X, Wang S, Li Z (2015)
Aquatic risk assessment of a novel strobilurin fungicide: a microcosm study compared with the
species sensitivity distribution approach. Ecotoxicol Environ Saf 120:418–427. https://doi.org/
10.1016/j.ecoenv.2015.06.027
Chen JN, Sun L, Cheng Y, Lu ZC, Shao K, Li TT, Han H, Hu C (2016a) Graphene oxide-silver
nanocomposite: novel agricultural antifungal agent against Fusarium graminearum for crop
disease prevention. ACS Appl Mater Interfaces 8:24057–24070. https://doi.org/10.1021/
acsami.6b05730
Chen JN, Li SL, Luo JX, Wang RS, Ding W (2016b) Enhancement of the antibacterial activity of
silver nanoparticles against phytopathogenic bacterium Ralstonia solanacearum by stabiliza-
tion. J Nanomater 2016:1–15. https://doi.org/10.1155/2016/7135852
Chen J, Wu L, Lu M, Lu S, Li Z, Ding W (2020) Comparative study on the fungicidal activity of
metallic MgO nanoparticles and macroscale MgO against soilborne fungal phytopathogens.
Front Microbiol 11:1–19. https://doi.org/10.3389/fmicb.2020.00365
Chowdappa P, Gowda S (2013) Nanotechnology in crop protection: status and scope. Pest Manage
Hortic Ecosyst 19(2):131–151
Chowdappa P, Kumar NB, Madhura S, Kumar MS, Myers KL, Fry WE, Cooke DE (2013)
Emergence of 13_A2 blue lineage of Phytophthora infestans was responsible for severe
outbreaks of late blight on tomato in South-West India. J Phytopathol 161(1):49–58
Długosz O, Sochocka M, Ochnik M, Banach M (2021) Metal and bimetallic nanoparticles: flow
synthesis, bioactivity and toxicity. J Colloid Interface Sci 586:807–818. https://doi.org/10.1016/
j.jcis.2020.11.005
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 339
Dubchak S, Ogar A, Mietelski JW, Turnau K (2010) Influence of silver and titanium nanoparticles
on Arbuscular mycorrhiza colonization and accumulation of radiocaesium in Helianthus
annuus. Span J Agric Res 8(1):103–108. https://doi.org/10.5424/sjar/201008S1-1228
Eman ME, Ahmed MA, Okash N, Salwa FM, Samaal ED, Khana MA, Mariam HY (2013)
Antifungal activity of zinc oxide nanoparticles against dermatophytic lesions of cattle. Roma-
nian J Biophys 23:191–202
Fan C, Guo M, Liang Y, Dong H, Ding G, Zhang W, Tang G, Yang J, Kong D, Cao Y (2017)
Pectin-conjugated silica microcapsules as dual-responsive carriers for increasing the stability
and antimicrobial efficacy of kasugamycin. Carbohydr Polym 172:322–331
Gao Y, Xiao Y, Mao K, Qin X, Zhang Y, Li D, Zhang Y, Li J, Wan H, He S (2020)
Thermoresponsive polymer-encapsulated hollow mesoporous silica nanoparticles and their
application in insecticide delivery. Chem Eng J 383:123169
Ghormade V, Deshpande MV, Paknikar KM (2011) Perspectives for nano-biotechnology enabled
protection and nutrition of plants. Biotechnol Adv 29(6):792–803
Gnanasangeetha D, Sarala TD (2013) One pot synthesis of zinc oxide nanoparticles via chemical
and green method. Res J Mater Sci 1:1–8
Gopinatha V, Mubarak A, Priyadarshini S, Priyadharsshini NM, Thajuddin N, Velusamy P (2012)
Biosynthesis of silver nanoparticles from Tribulus terrestris and its antimicrobial activity: a
novel biological approach. Colloids Surf B Biointerfaces 96:69–74
Gotic M, Jurkin T, Music S (2009) From iron (III) precursor to magnetite and vice versa. Mater Res
Bull 44:2014–2021
Gruère GP (2012) Implications of nanotechnology growth in food and agriculture in OECD
countries. Food Policy 37(2):191–198
Hao Y, Cao XQ, Ma CX, Zhang ZT, Zhao N, Ali A, Hou T, Xiang Zhiqian ZJ, Wu S, Xing B,
Zhang Z, Rui Y (2017) Potential applications and antifungal activities of engineered
nanomaterials against gray mold disease agent Botrytis cinerea on rose petals. Front Plant Sci
8:1332. https://doi.org/10.3389/fpls.2017.01332
Heinlaan M, Ivask A, Blinova I, Dubourguier H-C, Kahru A (2002) Toxicity of nanosized and bulk
ZnO, CuO and TiO
2
to bacteria Vibrio fischeri and crustaceans Daphnia magna and
Thamnocephalus platyurus. Chemosphere 71:1308–1316. https://doi.org/10.1016/j.
chemosphere.2007.11.047
Hendy AA, Xing J, Chen X, Chen X-L (2019) The farnesyltransferase β-subunit RAM1 regulates
localization of RAS proteins and appressorium-mediated infection in Magnaporthe oryzae. Mol
Plant Pathol 20:1264–1278
Herd H, Daum N, Jones AT, Huwer H, Ghandehari H, Lehr CM (2013) Nanoparticle geometry and
surface orientation influence mode of cellular uptake. ACS Nano 7:1961–1973. https://doi.org/
10.1021/nn304439f
Hikmah N, Idrus NF, Jai J, Hadi A (2016) Synthesis and characterization of silver-copper core-shell
nanoparticles using polyol method for antimicrobial agent. IOP Conf Ser Earth Environ Sci 36:
012050–012057. https://doi.org/10.1088/1755-1315/36/1/012050
Hussain HI, Yi Z, Rookes JE, Kong LX, Cahill DM (2013) Mesoporous silica nanoparticles as a
biomolecule delivery vehicle in plants. J Nanopart Res 15:1676
Jiang W, Mashayekhi H, Xing B (2009) Bacterial toxicity comparison between nano- and micro-
scaledoxide particles. Environ Pollut 157:1619–1625. https://doi.org/10.1016/j.envpol.2008.
12.025
Johnston CT (2010) Probing the nanoscale architecture of clay minerals. Clay Miner 45(3):245–279
Joshi SM, De Britto S, Jogaiah S, Ito S (2019) Mycogenic selenium nanoparticles as potential new
generation broad spectrum antifungal molecules. Biomolecules 9:419
Judelson HS, Blanco FA (2005) The spores of phytophthora: weapons of the plant destroyer. Nat
Rev Microbiol 3:47–58. https://doi.org/10.1038/nrmicro1064
Kalinska A, Jaworski S, Wierzbicki M, Gołębiewski M (2019) Silver and copper nanoparticles—an
alternative in future mastitis treatment and prevention? Int J Mol Sci 20:1672. https://doi.org/10.
3390/ijms20071672
340 H. S. El-Beltagi et al.
Kamegawa R, Naito M, Miyata K (2018) Functionalization of silica nanoparticles for nucleic acid
delivery. Nano Res 11:5219–5239
Kanhed P, Birla S, Gaikwad S, Gade A, Seabra AB, Rubilarcd O, Duran N, Rai M (2014) In vitro
antifungal efficacy of copper nanoparticles against selected crop pathogenic fungi. Mater Lett
115:13–17
Kaziem AE, Gao Y, Zhang Y, Qin X, Xiao Y, Zhang Y, You H, Li J, He S (2018) α-Amylase
triggered carriers based on cyclodextrin anchored hollow mesoporous silica for enhancing
insecticidal activity of avermectin against Plutella xylostella. J Hazard Mater 359:213–221
Khan MR, Rizvi TF (2014) Nanotechnology: scope and application in plant disease management.
Plant Pathol J 13(3):214–231
Kumar S, Bhanjana G, Sharma A, Sidhu MC, Dilbaghi N (2014) Synthesis, characterization and on
field evaluation of pesticide loaded sodium alginate nanoparticles. Carbohydr Polym 101:1061–
1067
Leung YH, Ng AMC, Xu XY, Shen ZY, Gethings LA, Wong MT, Chan CMN, Guo MY, Ng YH,
DjurišićAB, Lee PKH, Chan WK, Yu LH, Phillips DL, Ma APY, Leung FCC (2014)
Mechanisms of antibacterial activity of MgO: non-ROS mediated toxicity of MgO nanoparticles
towards Escherichia coli. Small 10:1171–1183. https://doi.org/10.1002/smll.201302434
Liang Y, Fan C, Dong H, Zhang W, Tang G, Yang J, Jiang N, Cao Y (2018) Preparation of MSNPs-
chitosan@prochloraz nanoparticles for reducing toxicity and improving release properties of
prochloraz. ACS Sustain Chem Eng 6:10211–10220
Liang Y, Gao Y, Wang W, Dong H, Tang R, Yang J, Niu J, Zhou Z, Jiang N, Cao Y (2020)
Fabrication of smart stimuli-responsive mesoporous organosilica nano-vehicles for targeted
pesticide delivery. J Hazard Mater 389:122075
Liu X, Wu Y, Xie G, Wang Z, Li Y, Li Q (2017a) New green soft chemistry route to Ag-Cu
bimetallic nanomaterials. Int J Electrochem Sci 12:3275–3282. https://doi.org/10.20964/2017.
04.61
Liu BK, Xue YF, Zhang JT, Han B, Zhang J, Suo XY, Mu L, Shi H (2017b) Visible-light-driven
TiO
2
/Ag
3
PO
4
teterostructures with enhanced antifungal activity against agricultural pathogenic
fungi Fusarium graminearum and mechanism insight. Environ Sci Nano 4:255–264. https://doi.
org/10.1039/c6en00415f
Lopes S, Pinheiro C, Soares AMVM, Loureiro S (2016) Joint toxicity prediction of nanoparticles
and ionic counterparts: simulating toxicity under a fate scenario. J Hazard Mater 320:1–9.
https://doi.org/10.1016/j.jhazmat.2016.07.068
Luo PJG, Wang HF, Gu LR, Lu FS, Lin Y, Christensen KA, Yang S-T, Sun Y-P (2009) Selective
interactions of sugar-functionalized single-walled carbon nanotubes with Bacillus Spores. ACS
Nano 3:3909–3916. https://doi.org/10.1021/nn901106s
Mahnaz M, Farideh N, Mansor BA, Mohamad R (2013) Green biosynthesis and characterization of
magnetic iron oxide (Fe
3
O
4
) nanoparticles using seaweed (Sargassum muticum) aqueous
extract. Molecules 18:5954–5964
Makhluf S, Dror R, Nitzan Y, Abramovich Y, Jelinek R, Gedanken A (2005) Microwave-assisted
synthesis of nanocrystalline MgO and its use as a bacteriocide. Adv Funct Mater 15:1708–1715.
https://doi.org/10.1002/adfm.200500029
Malandrakis AA, Kavroulakis N, Chrysikopoulos CV (2019) Use of copper, silver and zinc
nanoparticles against foliar and soil-borne plant pathogens. Sci Total Environ 670:292–299.
https://doi.org/10.1016/j.scitotenv.2019.03.210
Manzano M, Vallet-Regí M (2020) Mesoporous silica nanoparticles for drug delivery. Adv Funct
Mater 30:1902634
Mesterhazy A, Bartok T, Kaszonyi G, Varga M, Toth B, Varga J (2005) Common resistance to
different Fusarium spp causing Fusarium head blight in wheat. Eur J Plant Pathol 112:267–281
Mishra S, Singh HB (2015) Biosynthesized silver nanoparticles as a nanoweapon against
phytopathogens: exploring their scope and potential in agriculture. Appl Microbiol Biotechnol
99(3):1097–1107
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 341
Monalisa P, Nayak PL (2013) Green synthesis and characterization of zero valent iron nanoparticles
from the leaf extract of Azadirachta indica (neem). World J Nano Sci Technol 2(1):06–09
Muneer MBA, Chai PV, Takriff MS, Benamor A, Mohammad AW (2015) Optimization of nickel
oxide nanoparticles synthesis through the sol gel method using box–behnken design. Mater Des
86:948–956
Nam KT, Lee YJ, Krauland EM, Kottmann ST, Belcher AM (2008) Peptide-mediated reduction of
silver ions on engineered biological scaffolds. ACS Nano 2(7):1480–1486
Nandini B, Puttaswamy H, Prakash HS, Adhikari S, Jogaiah S, Nagaraja G (2020) Elicitation of
novel trichogenic-lipid nanoemulsion signaling resistance against pearl millet downy mildew
disease. Biomol Ther 10:25
Nel AE, Maedler L, Velegol D, Xia T, Hoek EMV, Somasundaran P, Klaessig F, Castranova V,
Thompson M (2009) Understanding biophysicochemical interactions at the nano-biointerface.
Nat Mater 8:543–557. https://doi.org/10.1038/nmat2442
Oladipo AA, Olatunji JA, Adewale SO, Abimbola OA (2017) Bio-derived MgO nanopowders for
BOD and COD reduction from tannery wastewater. J Water Process Eng 16:142–148. https://
doi.org/10.1016/j.jwpe.2017.01.003
Ozcelik BK, Ergun C (2014) Synthesis of ZnO nanoparticles by an aerosol process. Ceram Int 40:
7107–7116
Pan XH, Wang YH, Chen Z, Pan DM, Cheng YJ, Liu ZJ, Lin Z, Guan X (2013) Investigation of
antibacterial activity and related mechanism of a series of nano-Mg(OH)
2
. ACS Appl Mater
Interfaces 5:1137–1142. https://doi.org/10.1021/am302910q
Pang L, Gao Z, Feng H, Wang S, Wang Q (2019) Cellulose based materials for controlled release
formulations of agrochemicals: a review of modifications and applications. J Control Release
316:105–115
Parizi MA, Moradpour Y, Roostaei A, Khani M, Negahdari M, Rahimi G (2014) Evaluation of the
antifungal effect of magnesium oxide nanoparticles on Fusarium oxysporum F. sp lycopersici,
pathogenic agent of tomato. Eur J Exp Biol 4:151–156
Peszke J, Dulski M, Nowak A, Balin K, Zubko M, Sułowicz S, Nowak B, Piotrowska-Seget Z,
Talik E, Wojtyniak M, Mrozek-Wilczkiewicz A, Malarz K, Szade J (2017) Unique properties of
silver and copper silica-based nanocomposites as antimicrobial agents. RSC Adv 7:28092–
28104. https://doi.org/10.1039/C7RA00720E
Prasad R (2014) Synthesis of silver nanoparticles in photosynthetic plants. J Nanopart 2014:
963961. https://doi.org/10.1155/2014/963961
Prasad R (2016) Advances and applications through fungal nanobiotechnology. Springer, Cham
Prasad R, Jha A, Prasad K (2018) Exploring the realms of nature for nanosynthesis. Springer
International Publishing, Cham. https://www.springer.com/978-3-319-99570-0
Quoc NB, Bao Chau NN (2017) The role of cell wall degrading enzymes in pathogenesis of
Magnaporthe oryzae. Curr Protein Pept Sci 18:1–16
Raabe RD, Conners IL, Martinez AP (1981) Checklist of plant diseases in Hawaii: including
records of microorganisms, principally fungi, found in the states. Hawaii Institute of Tropical
Agriculture and Human Resources (CTAHR), information text series 022
Rispail N, De Matteis L, Santos R, Miguel AS, Custardoy L, Testillano PS, Risueño MC, Pérez-de-
Luque A, Maycock C, Fevereiro P, Oliva A, Fernández-Pacheco R, Ibarra MR, de la Fuente JM,
Marquina C, Rubiales D, Prats E (2014) Quantum dot and superparamagnetic nanoparticle
interaction with pathogenic fungi: internalization and toxicity profile. ACS Appl Mater
Interfaces 6:9100–9110. https://doi.org/10.1021/am501029g
Rodriguez-Gonzalez V, Dominguez-Espindola RB, Casas-Flores S, Patron-Soberano OA,
Camposeco-Solis R, Lee SW (2016) Antifungal nanocomposites inspired by titanate nanotubes
for complete inactivation of Botrytis cinerea isolated from tomato infection. ACS Appl Mater
Interfaces 8:31625–31637. https://doi.org/10.1021/acsami6b10060
Sangeetha J, Thangadurai D, Hospet R, Purushotham P, Manowade KR, Jogaiah S (2017) Produc-
tion of bionanomaterials from agricultural wastes. In: Ram P, Manoj K, Vivek K (eds)
Nanotechnology: an agricultural paradigm. Springer Nature, Singapore, pp 33–58
342 H. S. El-Beltagi et al.
Shah AT, Ahmad S, Kashif M, Khan MF, Shahzad K, Tabassum S, Mujahid A (2014) In situ
synthesis of copper nanoparticles on SBA-16 silica spheres. Arab J Chem 9:537–541. https://
doi.org/10.1016/jarabjc2014.02013
Shao D, Li M, Wang Z, Zheng X, Lao Y-H, Chang Z, Zhang F, Lu M, Yue J, Hu H, Yan H, Chen L,
Dong W-F, Leong KW (2018) Bioinspired diselenide-bridged mesoporous silica nanoparticles
for dual-responsive protein delivery. Adv Mater 30:1801198
Sharathchandra RG, Yatish NS, Jogaiah S (2016) Aquaporin-based nano biotechnological materials
for water treatment and novel detection technologies for nanoscale emerging pathogens. In:
Sharma SC, Nagabhushana H, Anath Raju KS, Premkumar HB (eds) Current advances in nano
materials. BMSIT, Dayananda Sagar Institutions, Bangalore, India, pp 103–107
Sharma S, Ahmad N, Prakash A, Singh VN, Ghosh AK, Mehta BR (2010a) Synthesis of crystalline
Ag nanoparticles (AgNPs) from microorganisms. Mater Sci Appl 1:1–7
Sharma D, Rajput J, Kaith BS, Kaur M, Sharma S (2010b) Synthesis of ZnO nanoparticals and
study of their antibacterial and antifungal properties. Thin Solid Films 519:1224–1229
Sharma D, Ashaduzzaman M, Golabi M, Shriwastav A, Bisetty K, Tiwari A (2015) Studies on
bacterial proteins corona interaction with saponin imprinted ZnO nanohoneycombs and their
toxic responses. ACS Appl Mater Interfaces 7:23848–23856. https://doi.org/10.1021/acsami.
5b06617
Shekhawat MS, Ravindran CP, Manokari MA (2014) Biomimetic approach towards synthesis of
zinc oxide nanoparticles using Hybanthus enneaspermus (L) F Muell. Trop Plant Res 1:55–59
Shetty HS, Sharada MS, Jogaiah S, Aditya Rao SJ, Hansen M, Jørgensen HJL, Tran LSP (2019)
Bioimaging structural signatures of the oomycete pathogen Sclerospora graminicola in pearl
millet using different microscopic techniques. Sci Rep 9:15175
Sierra-Fernandez A, De la Rosa-Garcia SC, Gomez-Villalba LS, Gomez-Cornelio S, Rabanal ME,
Fort R, Quintana P (2017) Synthesis, photocatalytic, and antifungal properties of MgO, ZnO and
Zn/Mg oxide nanoparticles for the protection of calcareous stone heritage. ACS Appl Mater
Interfaces 9:24873–24886. https://doi.org/10.1021/acsami7b06130
Sophie L, Delphine F, Marc P, Roch A, Robic C, Elst LV, Muller RN (2008) Magnetic iron oxide
nanoparticles: synthesis, stabilization, vectorization, physicochemical characterizations, and
biological applications. Chem Rev 108:2064–2110
Sreeju N, Rufus A, Philip D (2016) Microwave-assisted rapid synthesis of copper nanoparticles
with exceptional stability and their multifaceted applications. J Mol Liq 221:1008–1021. https://
doi.org/10.1016/jmolliq201606080
Stabryla LM, Johnston KA, Millstone JE, Gilbertson LM (2018) Emerging investigator series: it’s
not all about the ion: support for particle specific contributions to silver nanoparticle antimicro-
bial activity. Environ Sci Nano 5:2047–2068. https://doi.org/10.1039/c8en00429c
Sun D, Hussain HI, Yi Z, Siegele R, Cresswell T, Kong L, Cahill DM (2014) Uptake and cellular
distribution, in four plant species, of fluorescently labeled mesoporous silica nanoparticles. Plant
Cell Rep 33:1389–1402
Sun Q, Li JM, Le T (2018) Zinc oxide nanoparticle as a novel class of antifungal agents: current
advances and future perspectives. J Agric Food Chem 6:11209–11220. https://doi.org/10.1021/
acsjafc8b03210
Tan KS, Cheong KY (2013) Advances of Ag, Cu, and Ag–Cu alloy nanoparticles synthesized via
chemical reduction route. J Nanopart Res 15:1537. https://doi.org/10.1007/s11051-013-1537-1
Terzi E, Kartal SN, Yilgor N, Rautkari L, Yoshimura T (2016) Role of various nano-particles in
prevention of fungal decay, mold growth and termite attack in wood, and their effect on
weathering properties and water repellency. Int Biodeterior Biodegradation 107:77–87.
https://doi.org/10.1016/jibiod201511010
Thilagavathi T, Geetha D (2014) Nano ZnO structures synthesized in presence of anionic and
cationic surfactant under hydrothermal process. Appl Nanosci 4:127–134
Tournas VH (2005) Spoilage of vegetable crops by bacteria and fungi and related health hazards.
Crit Rev Microbiol 31(1):33–44
16 Metallic Nanoparticles and Nano-Based Bioactive Formulations... 343
Tryfon P, Antonoglou O, Vourlias G, Mourdikoudis S, Menkissoglu-Spiroudi U, Dendrinou-
Samara C (2019) Tailoring Ca-based nanoparticles by polyol process for use as nematicidals
and pH adjusters in agriculture. ACS Appl Nano Mater 2:3870–3881
Ul Haq I, Ijaz S (2019) Use of metallic nanoparticles and nanoformulations as nanofungicides for
sustainable disease management in plants. In: Prasad R, Kumar V, Kumar M, Choudhary D
(eds) Nanobiotechnology in bioformulations, Nanotechnology in the life sciences. Springer,
Cham, pp 289–316. https://doi.org/10.1007/978-3-030-17061-5_12
Valentin VM, Svetlana SM, Andrew JL, Sinitsyn OV, Dudnik AO, Yaminsky IV, Taliansky ME,
Kalinina NO (2014) Biosynthesis of stable iron oxide nanoparticles in aqueous extracts of
Hordeum vulgare and Rumex acetosa plants. Langmuir 30(20):5982–5988
Venkateswarlu S, Rao Y, Balaji T, Prathimaa B, Jyothi NVV (2013) Biogenic synthesis of Fe
3
O
4
magnetic nanoparticles using plantain peel extract. Mater Lett 100:241–244
Villamizar-Gallardo R, Cruz JFO, Ortíz-Rodriguez OO (2016) Fungicidal effect of silver
nanoparticles on toxigenic fungi in cocoa. Pesq Agropec Bras 51:1929–1936
Vu HT, Keough MJ, Long SM, Pettigrove VJ (2015) Effects of the boscalid fungicide Filan on the
marine amphipod Allorchestes compressa at environmentally relevant concentrations. Environ
Toxicol Chem 35:1130–1137. https://doi.org/10.1002/etc3247
Wang MH, Ma X, Jiang W, Zhou F (2014) Synthesis of doped ZnO nanopowders in alcohol–water
solvent for varistors applications. Mater Lett 121:149–151
Wani A, Shah M (2012) A unique and profound effect of MgO and ZnO nanoparticles on some
plant pathogenic fungi. J Appl Pharm Sci 2:40–44
Wu W, Lei M, Yang S, Zhou L, Liu L, Xiao X, Jiang C, Roy VAL (2015) One-pot route to alloyed
Cu/Ag bimetallic nanoparticles with different mass ratio for catalytic reduction of
4-Nitrophenol. J Mater Chem A 3:3450–3455. https://doi.org/10.1039/C6TA09921A
Xiang Y, Zhang G, Chen C, Liu B, Cai D, Wu Z (2018) Fabrication of a pH-responsively
controlled-release pesticide using an attapulgite-based hydrogel. ACS Sustain Chem Eng 6:
1192–1201
Xiulan W, Lanlan H, Zuliang C, Megharaj M, Naidu R (2013) Synthesis of iron-based nanoparticles
by green tea extract and their degradation of malachite. Ind Crop Prod 51:342–347
Xu C, Cao L, Zhao P, Zhou Z, Cao C, Li F, Huang Q (2018) Emulsion-based synchronous pesticide
encapsulation and surface modification of mesoporous silica nano-particles with carboxymethyl
chitosan for controlled azoxystrobin release. Chem Eng J 348:244–254
Xue JZ, Luo ZH, Li P, Ding YP, Cui Y, Wu QS (2014) A residue-free green synergistic antifungal
nanotechnology for pesticide thiram by ZnO nanoparticles. Sci Rep 4:5408. https://doi.org/10.
1038/srep05408
Zhang X, Cui Z (2009) Synthesis of Cu nanowires via solventhermal reduction in reverse
microemulsion system. J Phys Conf Ser 152:012022. https://doi.org/10.1088/1742-6596/152/
1/012022
Zhao P, Cao L, Ma D, Zhou Z, Huang Q, Pan C (2018a) Translocation, distribution and degradation
of prochloraz-loaded mesoporous silica nanoparticles in cucumber plants. Nanoscale 10:1798–
1806
Zhao RT, Kong W, Sun MX, Yang Y, Liu WY, Lv M, Song S, Wang L, Song H, Hao R (2018b)
Highly stable graphene-based nanocomposite (GO-PEI-Ag) with broad-spectrum, long-term
antimicrobial activity and antibiofilm effects ACS. Appl Mater Interfaces 10:17617–17629.
https://doi.org/10.1021/acsami8b03185
Zhu F, Liu X, Cao L, Cao C, Li F, Chen C, Xu C, Huang Q, Du F (2018) Uptake and distribution of
fenoxanil-loaded mesoporous silica nanoparticles in rice plants. Int J Mol Sci 19:2854
Nano-biotechnology is an emerging and rapidly evolving field of science that
possesses immense potential to revolutionize the sector of wheat crop production.
345
Applications of Nano-Biotechnological
Approaches in Diagnosis and Protection
of Wheat Diseases
17
Charu Lata, Naresh Kumar, Gurpreet Kaur, Ritu Rani, Preeti Pundir,
and Anirudh Singh Rana
Abstract
Wheat (Triticum aestivum) is a major staple food crop, plays a crucial role in food
security, and is grown on an area of 221.6 million hectares (Mha) in multi-
environments throughout the globe. Annual wheat production was recorded at
778.6 million metric tons in the years 2020–2021. Regardless of the abundant
growth of wheat, people are facing food crises in some parts of the world because
of the unavailability of food grains. The ever-growing population of the world is
creating a new challenge for farmers and researchers. By the year 2050, the global
need for agricultural products will have risen by 50%. To make it more challeng-
ing, biotic and abiotic factors become constant reasons for wheat yield losses.
Continuously, the wheat crop suffers from a plethora of diseases (pests, insects,
fungi, and bacteria). To deal with the challenges given above and meet future
food needs, there is a strong need for new and cutting-edge technologies that can
keep wheat farming sustainable and boost wheat production from current crop-
ping systems and changing climates.
C. Lata (*)
ICAR-IIWBR, Regional Station Flowerdale, Shimla, Himachal Pradesh, India
e-mail: charu.sharma@icar.gov.in
N. Kumar · G. Kaur · R. Rani
ICAR-Central Soil Salinity Research Institute, Karnal, Haryana, India
P. Pundir
RPG College, Pilani, Rajasthan, India
A. S. Rana
BITS, Pilani, Rajasthan, India
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_17
The huge applications of nanoparticles in agriculture and other related sectors can
counteract the future challenge of food security. Integration of nano-
biotechnology into wheat farming envisages modernizing the present scenario
of natural resources-based cropping to precision agriculture of advanced systems,
with increased material use efficiency and targeted applications. Real-time sur-
veillance, monitoring, and management of diseases that cause significant yield
loss can be achieved by using nanoparticles inserted inside the wheat plant cells.
Nevertheless, several plant-related, environmental, and health hazards are also
associated with the application of NPs in wheat cropping. Researchers reported
wider applications of nano-biotechnology in wheat farming, and it is being used
for developing a number of precise tool sets (nano-sensors, nano-pesticides,
nano-fertilizers, nano-herbicides, and smart delivery systems for controlled
release of agrochemicals and other NPs). Although the research on nanotechnol-
ogy in wheat disease detection and protection indicated that intervention is still in
its early stages, it has a bright future in the coming era. In the present chapter, we
focused on the versatile roles of nano-biotechnological approaches in the surveil-
lance, detection, monitoring, and protection of wheat diseases.
346 C. Lata et al.
Keywords
Wheat · Nano-biotechnology · Nanoparticles · Food security · Disease diagnosis ·
Protection
17.1 Introduction
Wheat (Triticum aestivum) is the second most-produced food crop after rice, and it
plays an important role in food security due to its 20% contribution to total energy
and protein in the human diet (Lata et al. 2021). Wheat and wheat-based products
could account for 20% of global protein and calorie consumption per capita.
Moreover, wheat is considered the main food source in many countries, and the
global population is estimated to increase from 7.3 billion to 9.7 billion by the year
2050. The global need for agricultural products will have risen by 50% by 2050, as
expected by the UN-FAO. So, the production of wheat has to be doubled to meet the
anticipated requirement (UN 2015). To meet this demand there is a strong need for
the improvement of traditional cultivars along with contemporary best management
practices and innovative technologies that will revolutionize the production of wheat
(Beres et al. 2020). Approximately 80% of poor people in rural areas work in
agriculture as their primary occupation, and they play an important role in improving
the country’s economy by providing food, improved livelihoods, and income to the
rest of the population. The world faces the challenge of meeting the heavy dietary
needs of an ever-increasing population. To achieve this challengeable goal, a
significant increase in rates of genetic gain in grain yield will be obligatory for
crops such as wheat (Triticum aestivum L.). According to records of FAO (2017), the
current rate of gain (ca. 1% p.a.) should be increased by a rate of 30–40% to meet this
demand (Cassman and Grassini 2020). Nevertheless, biotic and abiotic stresses due
to climate change will be an additional challenge to hamper productivity (Scott and
Ron 2020). Biotic stresses, including plant pathogens, pests, weeds, and insects,
cause significant reductions in crop production worldwide, with an estimated global
loss of 20–40% annually. Among the biotic stresses, rust diseases are the major
threat to wheat production (Lata et al. 2021). Stem rust, along with stripe rust, can
cause a 100% loss, while leaf rust results in a 50% loss of wheat yield under
favourable conditions (Bhardwaj et al. 2019). Other significant diseases such as
powdery mildew, spot blotch, Karnal bunt, and wheat blast also impede wheat
production to some extent (Kashyap et al. 2020). In addition, today’s climate change
results in major and regular pests of wheat. Several insects, such as pests, aphids,
borers, termites, and insects like grasshoppers, also caused significant losses of
wheat, pre or post-harvest. Existing pest management strategies are based mainly
on the application of pesticides, such as fungicides, insecticides, and herbicides.
These practices have some advantages like quick action, reliability, and easy avail-
ability, but have some detrimental negative impacts and negative concerns due to
health hazards, the resurgence of the pest population, the problem of groundwater
contamination, food safety, herbicide-resistant weeds, and protection of endangered
species (Yadav et al. 2021). Moreover, it is a rough estimate that during or after
application, 90% of applied pesticides are lost. So, there is a huge demand to develop
attractive technologies in terms of cost-effectiveness, less harmful to the environ-
ment, and high and quick-performing pesticides.
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 347
Wheat production and productivity are vulnerable to biotic stresses by several
means. Wheat production is expected to fall by 6% for every degree Celsius increase
in temperature and will become even more difficult as space and time pass (Asseng
et al. 2015; Templ and Calanca 2020). Furthermore, the prospective weather forecast
predicts an increase in the number of hot days as well as an increase in moderate
temperatures and their effects on global wheat production. One of the major wheat-
producing regions in India and the world is the Indo-Gangetic Plain (IGP). With the
change in climate, yields of wheat will be affected by changes in temperature and
rainfall in this region, as access to irrigation water has also declined. These effects
raise serious concerns about national and international food security (Daloz et al.
2021). Another important cropping system is rice-wheat cropping, a predominant
pattern in South Asia, which is under heat stress and poor soil health. This problem is
predominant due to climate change, over-exploitation of natural resources, high
cropping intensity, and puddling for rice production (Joshi et al. 2007; Jasrotia
et al. 2018). Another possible obstacle to wheat production could be deficiencies
in macro-nutrients (iron, zinc, sulfur, manganese, and boron). This is increasing day
by day because of over-mining of essential plant nutrients, imbalanced fertilization,
burning of crop residues, and similar cropping patterns in various parts of northern
India, Nepal, Pakistan, and Bangladesh (Chatrath 2004). The water crisis has
become alarming for global wheat production due to the depletion of water sources
and the water table going down. Less recharge from monsoon rains makes it a more
serious issue (FAO 2017). Salinity stress is another prevalent abiotic stress for wheat
production globally. Around 20% of cultivated land is salt-affected, and it will reach
50% by 2050, expectedly. If we look at the Indian scenario, about 6.73 Mha are
occupied by salt-affected soils. Salinity stress is an ever-increasing problem for
agriculture throughout the globe that is affecting the most productive crop areas
(Mann et al. 2021). Nevertheless, proper drainage system development and effective
soil reclamation technologies play a crucial role, but the salt stress is a difficult task
to combat. Consequently, to address the aforementioned hurdles in wheat productiv-
ity, there is a great motivation to develop quick-performing and cost-efficient
strategies, which show fewer detrimental impacts on the environment. There is a
need for some advanced technology for quick diagnosis and management of wheat
diseases to achieve the goals of regional and global food security.
348 C. Lata et al.
One of the emerging technologies, nanotechnology or nano-biotechnology, has
led to the progression of new concepts and is visualized as a swiftly developing area
that has great potential to transfigure wheat production and counteract the food
security challenge of the present day, and in the near future (Kashyap et al. 2015).
Nano-biotechnology has significantly advanced in pharmaceutical, medical, and
medicinal sciences but has received relatively less attention for agricultural
applications. There are several fields where nano-biotechnology is devised and
being explored, such as seed germination, transfer of target genes, plant hormone
delivery, nanosensors, water management, nano-barcoding, and controlled release of
pesticides/agrochemicals (Mathivanan 2021). Productivity or the yield of wheat can
be enhanced in two ways. Firstly, by reducing the yield loss caused by several factors
such as biotic and abiotic stress (adverse environmental factors) and secondly, by
developing proper disease management strategies. To improve the production and
productivity of wheat, the applications of nano-biotechnology can be deployed in
both the strategies. Among the different nano-biotechnological approaches, the
nano-biosensors possess enormous potential for the detection of wheat diseases
quickly in the early stages of the wheat crop. Nano-biosensors may help the wheat
crop detect and fight against different pests and pathogens. Further, under disease
management strategies, nano-structured catalysts increase the efficiency and poten-
tial of commercially available insecticides and pesticides, along with a reduction in
the level of doses required for crop plants. Frequently recurring diseases of wheat,
such as, rust diseases, bacterial spot diseases, Karnal bunt, wheat grains infected by
Fusarium, and spot blotch disease, are considered the most important factors that
limit crop productivity. It is only possible to eradicate the root cause of the afore-
mentioned diseases if they can be detected at an early stage of development and can
be diagnosed with plant diseases before the effects of pathogens are truly visible to
them. Various nanoparticles have shown bactericidal, pesticidal, insecticidal, and
herbicidal activities, which can be deployed in disease management strategies for
wheat crops. Hence, nano-biotechnology has immense potential in wheat production
and protection (Fig. 17.1). Although the practical application of nano-biotechnology
in wheat disease diagnosis and management practices is negligible at the moment, it
has great potential in the near future to improve agricultural practices above conven-
tional farming at various stages. In the present chapter, we will highlight the role of
nano-biotechnology in the detection and management practices for wheat diseases
and various applications and their possible potential in wheat crop improvement.
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 349
Potential Roles of
Nano- biotechnology in
wheat crop imrovemet
Nano-Biosensing
of cell
metabolism, genes
and proteins
Yield
enhancement as
Nano- fertilizers
and growth
promoters
Soil quality
improvement
By soil
remediation and
aggregate
stability
Crop Protection
through
New delivery
methods and
Nano- pestisides
Surveillance and
Monitoring, of
Diseases and
pesticides residue
Tar get ed
Delivery of
Pesticides,
macromolecules
and
agrochemicals
Smart delivery
through
Nano-polymers
and precision
applications
Fig. 17.1 Roles of Nano-biotechnology in wheat production and protection
17.2 Nano-Biotechnology Concept and Advancement
Integration of nanotechnology with biology became nano biotechnology. Nano-
biotechnology is an interdisciplinary field of research that involves the submission
of new and emergent approaches. Nano-biotechnology refers to the use of nanotech-
nology to modify living organisms and enable the amalgamation of biological and
non-biological materials. Lynn W. Jelinski, a biophysicist at Cornell University in
the United States, coined the term nano-biotechnology, and the term “nano”refers to
a scale of 1–100 nm (Fig. 17.2). The prefix“nano”is taken from a Greek word which
means “dwarf”. The branch of science in which we deal with the study of characters
of smaller structures than 100 nm (nanometers) is known as “nano-science.”Fur-
thermore, the development and conniving of particles in this nano-size range and
their combination with living cells or products of cells, along with their applications
in a specific area of science are called “Nano-biotechnology”. According to the
definition of the Royal Society, nanotechnology is the “design, characterization,
production, and application of structures, devices, and systems by controlling shape
and size at the nano-meter scale.”
350 C. Lata et al.
108nm
107nm
106nm
105nm
104nm
103nm
100nm
10nm
1nm
0.1nm
Nano Range
Basket ball
Ant
Human
Hair
Red blood cells
Bacterial Cell
Viru s Cell
Glucose Molecule Water
Molecule
Fig. 17.2 Illustration of nano-size ranges relative to generally known materials
17.2.1 Types of Nanoparticles
They hold a unique place in nanoscience and nanotechnology, not only because of
their unique features resulting from their small size but also because they are
prospective building blocks for more sophisticated nanostructures. The particle
materials ranged between 10 and 100 nm and were designed with exclusive
properties (physical, chemical, and biological) that showed differences from their
molecular and bulk counterparts and thus are categorized as nanoparticles (Yang
et al. 2008). Photosynthesis, seedling vigour, root and shoot growth, etc., are all
influenced by the administration of nanoparticles. Plants have to deal with different
disease-causing pathogens in real time and exhibit various stress reactions including
changes in molecular processes and stress-responsive gene expression, to combat the
stress posed by these pathogens (Rejeb et al. 2014). Through various mechanisms,
plants attempt to maintain a balance between their response to stress and the
determinantal effect on their viability (Scott and Ron 2020). The relevance of
nanoparticles stems from the fact that they provide an effective technique for
relaxing this defence mechanism, or in other words, they help plants. In plants, for
disease diagnosis and protection, nanoparticles alone have the potential to combat
several pathogens. Moreover, nanoparticles can be applied directly to foliage, seeds,
and roots of plants for the protection and management of pests and pathogens (such
as fungi, insects, bacteria, and viruses). Several metal nanoparticles (copper, silver,
titanium dioxide, and zinc oxide) are known for their antibacterial and antifungal
properties (Yadav et al. 2015) and have been intensively studied for their antiviral
properties (Worrall et al. 2018). Major nano-materials used in agriculture and
associated sectors include metal dioxides, carbon nano-tubes, quantum dots, zero-
valent metals, dendrimers, and nano-polymers having different types of properties
such as nano-sheets, nano-fibers, nano-wires, nano-emulsions etc. (Punia et al.
2021). We focus on some nanoparticles in this section that have known anti-
pathogenic properties. Recently, quantum dots, nanoparticles made of indium,
cadmium, and silicon with semiconductor properties, were found to aid in the
identification of Phytoplasma aurantifolia. Other nanoparticles, such as zinc oxide,
titanium oxide, and silver nanoparticles, are commonly utilized in plant tissue
culture to limit microbial activity (Singh et al. 2021). Among these, the silver
nanoparticles proved to be more focused due to their exceptional physical, chemical,
and biological properties associated with huge applications. Moreover, its “green
synthesis”made it possible to avoid hazardous by-products (Rafique et al. 2017;
Ibrahim et al. 2020). For the treatment of fungal and bacterial pathogens, silver
nanoparticles have enormous potential for plant disease management. However,
some associated hurdles are also reported with them, such as toxicity, production,
and soil interaction.
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 351
Another popular nanoparticle is chitosan, which has shown some constructive
biological properties like biocompatibility, biodegradability, antimicrobial activity,
non-allergenicity, and less toxic effects on animals. Chitosan nanoparticles exhibit
viral resistance, antimicrobial, and antifungal properties in plant tissues by
protecting them against several viral infections. The application of 1000 and
5000 ppm concentrations of chitosan nanoparticles showed maximum inhibition of
radial mycelial growth of Fusarium head blight disease of wheat (Kheiri et al. 2016).
In another study, it was found that chitosan nanoparticles helped to mitigate possible
oxidative stresses in durum wheat (Picchi et al. 2021). Several metal nanoparticles
(gold, copper, titanium dioxide, etc.) have gained popularity at present due to their
potential and effective role in diagnosis and protective function against plant
diseases (Omar et al. 2021; Satti et al. 2021). Gold nanoparticles have various
applications and are used in a number of biosensors, PCR-variants, barcoding and
genomic technologies. Copper and titanium dioxide nanoparticles are more fre-
quently utilized as fertilizers despite being less explored as disease management
tools. Moreover, aluminium nanoparticles showed insecticidal properties, while
titanium dioxide nanoparticles used as nano-fertilizers provide additional protection
from viruses and bacterium. Under biotic stress, the effects of biosynthesized
titanium oxide were assessed in wheat plants for morphological traits (plant weight,
fresh as well as dry weight, the surface area of leaf, root, and grain yield), physio-
logical traits (membrane stability index, RWC, and concentration of chlorophyll),
and for some non-enzymatic metabolites (soluble sugar, protein, soluble phenol, and
flavonoid content). It was determined that an effective concentration of titanium
oxide can lead to mechanisms for reducing biotic stresses and hence demonstrate the
significance of biosynthesized titanium oxide nanoparticles in combating wheat
fungal diseases, with the broad aim of yield improvement (Satti et al. 2021).
352 C. Lata et al.
Another important class of nanoparticles includes silica nanoparticles, which act
as a novel silica source that can be used to improve plant resistance to various plant
pathogens. It is already established that silica is important for plant nutrition since a
lack of it makes plants weaker and more vulnerable to biotic and abiotic stresses
(Rafiet al. 1997), and it is also the most widely distributed material on our planet,
after oxygen. Silicon is considered to be between essential and non-essential
elements because it is not only required for plant survival but is also required for
plant benefit (Luyckx et al. 2017). It is relatively easy with a controlled shape, size,
and structure, which makes it incredibly suitable as delivery agents or carriers.
Several researchers reported that Si aids in the activation of the host defence system
and has been found to be beneficial in the control of a variety of plant diseases. Si
will improve plant resistance to fungus, bacteria, viruses and nematodes (Khan and
Siddiqui 2020). Si is found to modulate the signalling systems of plants associated
with defence-related genes, genes related to antimicrobial compound synthesis,
genes responsible for structural modification of cell walls, hormones, and genes
related to hypersensitivity responses (Rajput et al. 2021). The significance of
selenium nanoparticles in ameliorating abiotic stresses has already been established
by Soleymanzadeh et al. (2020). They demonstrated that elevated salt tolerance was
afforded by accumulating proline, preserving ionic equilibrium, improving the
antioxidant system, and increasing levels of different phyto-propanoids, resulting
in osmotic adaptations. As selenium particles are showing a significant impact on
abiotic stress management, we may expect similar results for biotic stress
protection too.
One important type of nanoparticle is cerium nanoparticles, which are also known
as nano-ceria. Depending on the exposure concentration, coating, surface charge,
plant species, and growing circumstances, nano-ceria has a wide range of effects on
plant health, both positive and negative (Milenkovićet al. 2019). In the biomedical
industry, cerium oxide nanoparticles are widely applied as antioxidants, which
belong to the nano-ceria family of nanoparticles. Another potential class of
nanoparticles that can be indirectly used for biotic stress amelioration in plants is
zinc oxide-based nanoparticles. Their significant role has already been proven for
abiotic stress tolerance, as evidenced by Adrees et al. (2020). Zinc nanoparticle foliar
exposure increased leaf chlorophyll content, decreased oxidative stress, and
increased leaf superoxide dismutase and peroxidase activities in wheat. These zinc
nanoparticles can improve the overall health of plants under stress as many pathways
of plant biotic and abiotic stress defence mechanisms are interrelated with each
other. These nanoparticles have enormous potential and could be used directly or as
common carriers for plant disease management tools for diagnosis and protection.
The nanoparticles are reported to play a role in wheat disease protection in several
ways and could be utilized as nano-biosensors, carriers for RNAi, and gene targeting
and delivery systems for insecticides, fungicides, and herbicides.
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 353
17.2.2 Nano-Biotechnology: Potential Roles in Wheat Diseases
Management
The most important and major issue is the detection of disease at the right stage of
plant growth for efficient disease management. Generally, it is observed that plant
diseases are actually visible at later stages of infection when it becomes very difficult
to control. Farmers and researchers applied conventional pesticides and fungicides
only after the appearance of symptoms. At this stage, there was a noteworthy loss of
crops. Consequently, to reduce the significant crop losses, it is essential to dissect the
plant disease at an early stage of infection. Farmers, on the other hand, can use nano-
biotechnological tools to quickly diagnose the location of viral, parasitic, and
bacterial sicknesses at early stages for proper disease management and yield loss.
An insightful synchronization between nano-biotechnology and plant pathology
could provide a promising solution to a tough task. The Nano-biotechnology toolkit
helps in the diagnosis and management of wheat diseases in several ways, for
example, the Nano/bio barcode assay, Quantum Dot, Nano-pore sequencing tools,
Bio-nano materials, Nanoparticles, Nano-diagnostic kit, Nano-biosensors.
17.3 Nano-Biotechnological Approaches for Diagnosis of Wheat
Diseases
Successful disease management requires an accurate diagnosis of plant disease and
plant pathogen detection. In the last few decades, the demand for highly sensitive,
rapid, and high throughput assays for plant pathogen detection has increased.
Integrated molecular diagnostics with nanotechnology are now being used for the
identification of plant pathogens (Fig. 17.3). A number of nano-devices and nano-
sensors are used to investigate the DNA sequences to diagnose diseases. Also,
nanotechnology is serving the development of chip-based systems for pathogen
detection. A summary of major nano-biotechnological based approaches and nano-
materials used for disease diagnosis is presented in Table 17.1.
17.3.1 Quantum Dot Nanoparticles-Based Approach
Quantum dots (QDs) are a class of nano-crystals containing luminescent
semiconductors that get excited and radiate light at particular wavelengths
(Edmundson et al. 2014). Khiyami et al. (2014)define QDs as basically inorganic
fluorophores in nature that are used as probes or markers for nucleic acid or protein
detection. Many properties of QDs, such as narrow emission peak, longer
fluorescence lifetime, 10–100 times higher extinction coefficient, and photo-
bleaching resistance, allow them to be multi-coloured quantum dots (Zhao and
Zeng 2015).QD-based nano-sensors are being used in agriculture and allied sectors
due to their advantages in detecting nucleic acid and enzyme activities. The first
report of myco-synthesized semiconductor nano-materials was introduced by
Dameron et al. (1989), where crystallites of cadmium sulphide were produced by
yeast in response to heavy metal cadmium stress. For the biosynthesis of cadmium
sulphide, a number of microbes have been used, but only limited studies have
reported the fluorescent properties (Kashyap et al. 2016). When incubated with the
CdCl
2
and SeCl
4
mixtures, Fusarium oxysporum (a wheat pathogen) produced
highly fluorescent myco-mediated Cadmium sulphide QDs (Syed and Ahmad
2013; Kumar et al. 2007). For possible agricultural applications, carbon quantum
dots feature simple synthesis, high stability, high water solubility, high biocompati-
bility, strong photoluminescence, adjustable surface functions, and low toxicity. Su
354 C. Lata et al.
Nano-
biotechnological
approaches
Metal
nanoparcles
based approach Nanostructured
plaorms based
approach
Nanobiosensor
based approach
Nanodiagnosc
kit based
approach
Nanofabricaon
imaging
approach
Quantum dot
nanoparcles
based approach
Fig. 17.3 Overview of major nano-biotechnological based approaches for diseases diagnosis of
wheat
Approaches Plant pathogen detected Reference
et al. (2018) found carbon nano-dots to be significant in improving the tolerance of
peanuts against drought stress (Su et al. 2018). In the future, these quantum dots will
have significant potential as nano-tools for improving crops under biotic stresses too.
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 355
Table 17.1 An overview of approaches and nano-materials used for plant pathogens detection
Nano-
materials used
Quantum dot
nanoparticles
based
Crystallites of
Cadmium
sulphide
Fusarium oxysporum Kashyap
et al.
(2016)
Crystallites of
Cadmium
sulphide
Tristeza virus Safarnejad
et al.
(2017)
Metal
nanoparticles
based
Gold
nanoparticles
Fusarium oxysporum,Dematophora
necatrix,Alternaria aternata,Sclerotium
rolfsii, and Colletotrichum capsici
Thakur and
Prasad
(2021)
Silver
nanoparticles
Fusarium graminearum,F. avenaceum,
F. poae, and F. sporotrichioides
Yugay
et al.
(2021)
Nanostructured
platforms based
Chitosan
nanoparticles
Fusarium graminearum Kheiri et al.
(2016)
Colloidal gold
nanoparticles
Pseudomonas syringae Lau et al.
(2017)
Nanofabrication
imaging
Silver
nanoparticles
Fusarium graminearum Jian et al.
(2021)
Nano-diagnostic
kit based
Tetraplex
antibody
Fusarium species Lattanzio
et al.
(2012)
17.3.2 Metal Nanoparticles-Based Approach
Metal nanoparticles are being used in biosensors, which allow the use of several
novel signal detections to identify pathogens. For a specific recognition between a
target pathogen and nanomaterials, various strategies such as adhesion-receptor,
antigen-antibody, recognition of complementary DNA sequences, and so on have
been used (Fan et al. 2003). AuNPs offer distinctive physical and chemical
properties i.e. high surface-to-volume ratios, lower detection limits, higher sensitiv-
ity etc. which makes them an excellent component for a wide range of bio-sensing
techniques. Because of its unique qualities, including form, size, and flexibility,
silver has been regarded as the most promising NP in terms of electrical and
antibacterial activities. These Ag nanoparticles have also been shown to prevent
fungal growth. The silver nanoparticles are effective against a broad range of fungal
pathogens such as A. brasiliensis,C. glabratus,P. oxalicum, etc. These
nanoparticles exhibit various mechanisms against pathogenic infection, such as
altered membrane structure, cellular content leakage, dysfunction of mitochondria,
disruption of protein structure, and oxidation of lipids inside the pathogen cell.
356 C. Lata et al.
AuNP consists of two components coated with thio-oligonucleotides. These two
components bind with target DNA and aggregate, leading to the change in colour
from red to blue, which is a well-known property of AuNPs (Kashyap et al. 2016).
Thakur and Prasad (2021) synthesized gold nanoparticles through bacterium Bacil-
lus sonorensis and explored their toxicity potential for plant pathogens such as
Dematophora necatrix,Fusarium oxysporum,Alternaria aternata,Alternaria
mali,Sclerotium rolfsii,and Colletotrichum capsici. It was witnessed that after
1 week of incubation, synthesized AuNPs caused the 70% inhibition in growth of
Fusarium oxysporum.
17.3.3 Nano-Structured Platforms-Based Approach
The employment of nanostructure as a detecting material is a result of the develop-
ment of nanotechnology and biotechnology. The main advantages of nano-structures
are their high surface-to-volume ratio, the possibility of device miniaturization, and
size-dependent electrical properties (Sertova 2015). Also, the main aim of such
nano-structured platforms is the detection of pathogens in less time. Nanomaterials
such as carbon nano-tubes, grapheme, nano-wires and nano-structured metal oxide
play an important role in mycotoxin and pathogen detection. Some of the nano-
structured platforms are based on microscopic fluidics systems that detect pathogens
in real time with high sensitivity. Some platforms use various nanoparticles, which
can be visualized in different colours when they get infected with pathogens
(Bhattacharya et al. 2007). For the first time, Stadler et al. (2010) investigated the
insecticidal activity of nano-structured alumina against two insect pests, namely,
Sitophilus oryzae and Rhyzopertha dominica. These two insects are serious pests in
stored food supplies all over the world. Exposure of these pests to alumina-treated
wheat leads to substantial mortality. So, it can be concluded that compared to
commercially available pesticides, inorganic nano-structured alumina may provide
a cost-effective and dependable option for insect pest control, and such research may
open new doors for nano-particle based pest management solutions. Kheiri et al.
(2016) reported that the application of chitosan and chitosan nanoparticles showed
significant inhibition of mycelial growth and the number of colonies formed against
Fusarium graminearum. Likewise, Lau et al. (2017) developed a nano-structured
electrochemical biosensor to rapidly detect plant pathogen (i.e. Pseudomonas
syringae) DNA with high sensitivity. The assay is based on the rapid electrochemical
assessment of amplified target DNA through gold nanoparticles.
17.3.4 Nanofabrication Imaging Approach
Nanofabrication imaging approach involves the technologies used to diagnose the
different plant pathogens by looking inside or outside the plant tissues. This
approach allows us to accurately adjust the physical and chemical properties of target
materials to prevent toxicity problems. Also, how the pathogens make a way to the
plant tissue and colonize the tissue can be visualized using nano-imaging
technologies with an electron beam and photolithography techniques. González-
Melendi et al. (2008) stated the visualization of carbon-coated magnetic nanoparticle
transport and deposition inside the plant host using imaging methods. Similarly,
Rispail et al. (2014)studied the communication between the quantum dot and super-
paramagnetic nanoparticle with pathogenic fungi F. oxysporum. They visualized the
fungal hyphae incubated with SiO
2
-Magnetic NPs through transmission electron
micrographs. Recently, Jian et al. (2021) reported the antifungal activity and
mechanisms of silver NPs against Fusarium graminearum strains to conclude the
effects on mycotoxin deoxynivalenol production using the nanofabrication imaging
approach. They examined the morphological changes of fungus caused by AgNPs
using SEM, TEM, and fluorescence microscopy and evaluated the potential of silver
NPs for fusarium head blight disease management in the field.
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 357
17.3.5 Nano-Biosensor Based Approach
Nano-biosensors are the result of a collective approach of nanotechnology and
biology. It is an altered form of biosensor that may be explained as a tiny systematic
tool that integrates biological elements with physio-chemical transducers (Turner
2000). Nano-biosensor-based approaches have increased sensitivity, which leads to
a reduced response time to sense diseases in crops. Currently, nano-biosensor-based
approaches are employed to identify the minute quantities of contaminants
i.e. bacteria, viruses, fungi, and their toxins (Kashyap et al. 2016). Additionally,
the on-site detection of pathogens by using these approaches can help in designing
strategies to control the disease spread. They have been significantly used in the
diagnosis of soil diseases caused by various bacteria, fungi, and viruses. It is based
on the differential consumption of oxygen by good and bad bacteria. The quantita-
tive analysis of this oxygen consumption reveals the types of microbes causing
various diseases in the soil. Apart from that, it can also be anticipated whether or not
a soil disease will emerge in the examined soil ahead of time. As a result, it is
important to note that the biosensor provides a unique method for diagnosing soil
conditions using a semi-quantitative approach. These nano-biosensors are
GPS-based for real-time monitoring of diseases.
17.3.6 Nano-Diagnostic Kit-Based Approach
Nano-diagnostic kits are state-of-the-art tools in nano-biotechnology. These are the
lab-in-a-briefcase devices, which include reagents, power supplies, and other
utilities such as microarrays, and provide portable, rapid, and highly accurate
diagnostic tools, allowing for early disease detection and epidemic control. It
involves placing of sensitive measuring devices, required reagents, power supply,
and other features that now take up laboratory space into a parcel no larger or heavier
than a briefcase (Goluch et al. 2006). A briefcase-sized kit is transported to a crop-
growing field to look for diseases that might infect the crop and limit its productivity.
This is a simple and accurate process. Experts can assist farmers in preventing
disease epidemics by using nano-diagnostic kit technology to detect possible haz-
ardous plant diseases swiftly and easily (Pimentel 2009).
358 C. Lata et al.
The application of nano-diagnostic assay for detection of various pathogens is
now a common analytical practice. Fungal plant pathogens such as Fusarium species
can easily be detected using nano-diagnostic assay (Khiyami et al. 2014; Lattanzio
et al. 2012) developed the immunoassay for detection of mycotoxins (T-2/HT-2,
ZEA, DON, FB1/FB2) in wheat, corn, oat, and barley. This nano-diagnostic assay
kit is a 4mycosensor which is fast, low-priced, easily accessible, and appropriate for
the detection of pathogens in cereals.
17.4 Protection/Management of Wheat Diseases Through
Nano-Biotechnological Approaches
A number of organic and inorganic salts have been utilized since the beginning of
agriculture to protect and save the crops from pests, insects, bacterial, and fungal
diseases (Abdollahdokht et al. 2022). Due to their high surface-to-volume ratio,
nanoparticles exhibit unique chemical, physical, and optical properties. Nano-
biotechnology is emerging as a new field in the sector of agriculture with a bunch
of applications. However, it has been a growing science for the past couple of years,
but the focus and continuous research in the exploration of NPs in the management
of plant infection will be increased with the passage of time. Plant disease manage-
ment mainly involves any of these ways: (1) Nanomaterials are used in bio-sensing
devices to make nano-biosensors for the detection of plant diseases at early stages;
(2) Nanoparticles are used directly as pesticides and are applied to plants for disease
control; (3) NPs are used as carriers for other pesticides and molecules, such as
miRNA, for targeted delivery. The effective way for the application of nanomaterials
is the priming of seeds or foliage to control pathogens at the site of entry.
17.4.1 Nanoparticles: Relocation in Wheat Plants
Direct application of NPs and coupling with other formulations with conventional
pesticides results in wheat plants either through roots or foliar parts. After
the migration of nanoparticles in the plant cells, these particles move through the
xylem and phloem and reach different parts of the plant at the site of action. The
entry of nanoparticles into plant cells has been studied by several researchers. As per
their findings, the uptake mechanism of nanoparticles can be predicted (Yang et al.
2008). Nevertheless, the exact mechanisms of entry, absorption, and relocation of
these nanoparticles in the plants of wheat have not been studied so far, but a general
mechanism could be predicted based on literature findings (Fig. 17.4) (Kashyap et al.
2020).
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 359
Direct
Seed Treatment
Root Dip
Foliar Spray
Application Methods Penetration points
Leaf and Stem via-
Epidermis
Cuticle
Stomata
Hydathodes
Lenticeles
Roots via-
Root tips
Root hairs
Lateral root
Cortex etc.
Nano-Materials
Xylem
Phloem
Indirect
Irrigation
Soil Treatment
Effects on plant
Genetic improvement, Detection and monitoring of plant diseases and pests, Biotic
and abiotic stress management, Improvement in nutrients uptake, soil heath
improvement, Improved growth parameters, controlled and targeted release of
other agrochemicals
Fig. 17.4 Predicted route of nanoparticles penetration, uptake, and relocation in the wheat plants
17.4.2 Nanoparticles Towards Protection of Wheat Diseases
Researchers have studied the effects of NPs on various stages of wheat plants and
have concluded the fate of NPs. Germination, emergence, seedling, leaf emergence,
tilering, differentiation, flowering, grain filling, and maturity are the various growth
stages of the wheat plant, varying their behaviour towards nanoparticles. Wheat
disease control with nanoparticles—Conventional wheat disease control methods—
are based on chemical fungicides, pesticides, and insecticides. However, as
nanomaterial science progresses, NPs create a gap in wheat disease control
approaches. Several studies have reported various successful examples of nano-
formulations based on wheat management strategies. In Table 17.2, a list of several
nanoparticles and their modes of action in controlling the different wheat diseases
are given. In the present segment, we briefly discuss the functions and roles of
nanoparticles in the protection of wheat diseases.
It has been clearly demonstrated that among the metallic nanoparticles, silver
nanoparticles are the most effective in activating the antioxidant-based defence
360 C. Lata et al.
Table 17.2 Example of several nanoparticles and their mode of action in controlling the wheat
diseases
Type of nanoparticle Disease Action Reference
Silver nanoparticles Yellow rust Biological control Sabir et al. (2022)
Silver nanoparticles
(AgNPs)
Bacterial and fungal
disease of wheat
Suppress growth and
germination of
pathogen
Mansoor et al.
(2021)
Copper
nanoparticles
(CuNPs)
Several fungal and
bacterial pathogens of
wheat
Antimicrobial activity Banik and Pérez-
de-Luque (2017)
Copper
nanoparticles
(CuNPs)
Bacterial and fungal
pathogen of wheat
Antimicrobial activity
and growth-promoting
behavior
Yasmeen et al.
(2017)
Chitosan-
nanoparticles
(CSNPs)
Several wheat
pathogens
Induces plant defence
responses at the
infection sites
Saharan et al.
(2015),
Abd-Elsalam et al.
(2017)
Copper
nanoparticles
(CuNPs)
Fusarium sp. Fungal growth
inhibition
Viet et al. (2016)
Nano-structured
liquid crystalline
particles (NLCP)
Raphanus
raphanistrum L.
Negative impact on
pathogen growth
Nadiminti et al.
(2016)
Chitosan-
nanoparticles
(CSNPs)
Fusarium head blight
(Fusarium
graminearum)
Agglutination at
penetration sites
Kheiri et al. (2016)
Fe
3
O
4
to ZnO/AgBr Lentil-vascular wilt
and head blight
diseases of wheat
Antifungal activities Hoseinzadeh et al.
(2016)
Copper
nanoparticles
(CuNPs)
Fungal pathogen of
wheat
Antimicrobial activity
and growth-promoting
behaviour
Hafeez et al. (2015)
AgNPs Spot blotch infection
in wheat
Showed strong
antifungal activity at
germination stage
Mishra et al. (2014)
Gold nanoparticles
(AuNPs)
Stem rust (Puccinia
graminis)
Active antifungal
behavior
Jayaseelan et al.
(2013)
AgNPs Fungal diseases of
what
Act as pre-planting
fungicide
Karimi et al. (2012)
AgNPs Karnal bunt (Tilletia
indica)
Active antifungal
behaviour
Singh et al. (2010)
Nano-silica Insects’pest of wheat Absorbed into the
cuticular lipids and
killed insect pest
Barik et al. (2008)
Silicon Larvae of Hessian fly
(Phytophaga
destructor Say)
Less infestation Miller et al. (1960)
mechanisms in plants. Furthermore, because of its green synthesis, it has been an
extensively researched nanoparticle in wheat disease management by researchers.
Green synthesized nanoparticles have a lot of antibacterial power and might be used
instead of toxic fungicides. There are several molecular mechanisms reported for
AgNPs for their antimicrobial activity. These nanoparticles have a high affinity for
membrane-bound targets. Moreover, with surface binding, these NPs also penetrate
inside the bacterial cell. Recently, a study conducted by Sabir et al. (2022)has
highlighted the role of silver nanoparticles in the biological control of yellow rust
disease in wheat. They used Moringa oleifera leaf extract as a reducing and
stabilizing agent for green synthesis of silver nanoparticles. Different concentrations
of silver nanoparticles were applied by foliar spray on wheat plants that were already
inoculated with Puccinia striiformis, which causes stripe rust disease in wheat. They
demonstrated that the foliar application of silver nanoparticles improved morpho-
logical and physiological characters in wheat as well as reduced the non-enzymatic
compounds. Hence, the silver nanoparticles may be used as a potential source for
biological control of yellow rust. Mishra et al. (2014) found the powerful antifungal
behaviour of AgNPs against wheat pathogen Bipolaris sorokiniana (causative agent
of spot blotch infection in wheat). Silver nanoparticles biosynthesized by Serratia
spp. in different nano-size ranges exhibited strong antifungal activity towards
Bipolaris sorokiniana at the germination stage. Greenhouse studies of wheat plants
showed that conidial germination of B. sorokiniana was totally inhibited by the
application of particle and spherical shaped AgNPs (10–20 nm sizes ranged) at
concentrations of 2, 4 and 10 μg/mL, while under control conditions, the germina-
tion was 100%. Silver nanoparticles did not affect the seed germinability when
coated on wheat seeds and provide similar protection like a conventional
pre-planting fungicide under testing (Carboxitiram). Moreover, no harmful effect
was found on soil conditions after the application of AgNPs coating. So, Karimi
et al. (2012) suggested that nano-coating of AgNPs may be considered a potential
pre-planting fungicide due to its comparable effects with conventional pre-planting
fungicide.
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 361
Gold nanoparticles (AuNPs) synthesized through green synthesis act as an active
antifungal agent towards a number of fungal pathogens. AuNPs size ranges between
45 and 75 nm, tested towards Puccinia graminis tritici, fungal agent of economic
important disease of wheat (stem rust) in a concentration (Jayaseelan et al. 2013).
These NPs showed active antifungal behaviour in controlling the stem rust disease of
wheat along with several fungal spp. (Aspergillus niger,Aspergillus flavus, and
Candida albicans). Singh et al. (2010) also documented the effective role of silver
nanoparticles in the detection and management of Tilletia indica, the causal agent of
Karnal bunt disease in wheat plants.
Copper nanoparticles exhibit antifungal activities in many diseases towards
several wheat pathogens. Fungal growth of Fusarium sp. was inhibited up to 94%
by the use of copper nanoparticles in a concentration of 450 ppm under 9 days of
treatment (Viet et al. 2016). In an additional study on wheat published by Banik and
Pérez-de-Luque (2017), the authors revealed the significant antimicrobial activity of
CuNPs towards a number of fungi and bacteria. Hafeez et al. (2015) published the
effect of CuNPs in different concentrations (10–50 ppm and 30 ppm) on the growth
and yield parameters of wheat. Incubation with 30 ppm copper nanoparticles showed
improvement in yield significantly in terms of leaf area, number of grains/spikes, Chl
content, number of spikes/pot, 1000-grain weight, and final grain yield as compared
with the untreated plants. Yasmeen et al. (2017) also reported similar findings that
CuNPs exposure increases the quantity of grains per spike as well as 1000 grain
weights. In addition to these findings, the experimental varieties showed additional
resistance toward diseases.
362 C. Lata et al.
In a greenhouse experiment, it was found that most resistant varieties of wheat
had dark shapes of silicon depositions in their leaf sheaths and contained a compar-
atively intense and grainy covering of silicon. Miller et al. (1960) reported another
interesting factor: wheat varieties containing high amounts of silicon present in
stems showed less infestation by Phytophaga destructor Say larvae (Hessian fly).
Barik et al. (2008) documented the unique properties of nano-silica and found
antifungal activity. Plant-silica has been deployed to develop several nano-pesticides
for plant disease management, including wheat. The mechanism of pest death purely
relies on the fact that insect pests use a number of cuticular lipids, which are taken
from plant cells and prevent death from desiccation by protecting their water barrier.
However, when nano-silica is applied through a foliar application on wheat leaves
and stems, it gets absorbed into the cuticular lipids and kills insect pests.
Nanostructured liquid crystalline particles (NLCP) also showed a negative impact
on Raphanus raphanistrum L. (weed wild radish) under wheat field trials. NLCP
mixed with phytantriol (18% w/w) in a size range of ~250 nm with 0.22 polydisper-
sity index having a zeta potential of 15 mV applied as a nano-formulation. This
nano-formulation minimizes the effect on epicuticular waxes when used as a carrier
to deliver 2,4-D to weeds. Nadiminti et al. (2016) found that there is no significant
change in yields of wheat crops when these nano-formulations are used in low
concentrations of 0.03% and 0.06%. Moreover, the comparison with commercially
available herbicide formulations like Estercide 800 has a similar impact on weeds.
Chitosan-nanoparticles are another effective nanoparticle, and these NPs are
effective against plant pathogen spectra, while being non-toxic to humans and
animals. In a greenhouse study, it was found that wheat plants sprayed with CS
and CSNPs at the stage of anthesis protected the plants against Fusarium
graminearum, causing Fusarium head blight disease in wheat. The poly-cationic
properties of CS and CSNPs disorganized hyphae formation, which directly caused
inhibition of fungal growth as a result of causing membrane permeability and
leakage of cellular contents. CS applied to plant tissues creates its agglutination at
penetration sites; it forms the physical barrier which inhibits the pathogen’s spread in
healthy tissues and prevents the pathogen/disease from spreading in wheat crops
(Kheiri et al. 2016). Chitosan acts as a powerful inducer of signalling cascades
towards the fungal disease of wheat. It induces plant defence responses at the
infection sites and alleviates systemic alert for healthy tissues of plants. These
responses include early signalling events and the synthesis of defence-related
metabolites and proteins such as PR-proteins and phytoalexins to cope with
pathogens (Saharan et al. 2015; Abd-Elsalam et al. 2017). Wheat seed priming
with chitosan and its nano-formulations showed an increase in lignin synthesis and
accumulation in plants, which directly provides disease resistance for fungal
pathogens.
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 363
Nano-formulations of Fe
3
O
4
/ZnO/AgBr was prepared with diverse weight ratios
of Fe
3
O
4
to ZnO/AgBr by using facile microwaved-assisted technique and
investigated for their antifungal activities towards Fusarium oxysporum and Fusar-
ium graminearum causative agent lentil-vascular wilt and head blight diseases of
wheat (Hoseinzadeh et al. 2016). The nano formulations deactivate both fungi in a
short duration of time, about 60–90 min. Moreover, nano-biotechnology produces
bionic plants by setting and inserting nanoparticles inside the plant cells and
organelles. These plants are more responsive towards sensing or imaging objects
and infrared devices and have great potentials in precision farming. NPs integrating
plants show self-power and act as light sources to other communicating devices.
Spherical-shaped silicon dioxide nanoparticles in size ranging between 9.92 and
19.8 nm biosynthesized using saffron extract by Abdelrhim et al. (2021). Authors
introduced these nanoparticles against R. solani to protect wheat seedlings and used
it as a potential alternative therapeutic solution. SiO
2
nanoparticles exhibited a
strong antifungal activity against R. solani and reduced mycelial radial growth up
to 100%. A clear reduction was observed in pre-, post-emergence damping-off, fresh
and dry weight of mycelium, and severities of root rot. Along with this, SiO
2
NPs
showed a positive impact on the growth of wheat seedlings and correlated with
disease suppression. These nanoparticles increased the amount of chlorophylls and
carotenoids (photosynthetic pigments) and salicylic acid, and other defence-related
compounds. SiO
2
NPs enhanced the content of enzymatic (POD, SOD, APX, CAT,
and PPO) and non-enzymatic (phenolics and flavonoids) compounds and alleviated
the oxidative stress by activating the antioxidant defence machinery. Moreover, the
application of SiO
2
NPs enhanced the germination, vigour indexes, and vegetative
growth of wheat seedlings infected with R. solani. Nevertheless, these nanoparticles
have no phytotoxic effect on wheat seedlings (Fig. 17.5).
17.5 Adverse Effects of Nanomaterials
The field of nano-biotechnology has various applications in the detection, diagnosis,
and protection of wheat diseases. Several research teams are collaborating to deter-
mine the role of nano-biotechnology in agriculture and related industries. Neverthe-
less, with the positive effects of NPs, several reports have been found on the negative
behaviour of these NPs on plant growth, animals, humans, soil, water and the
environment. This aspect of nanomaterials is collectively known as nano-toxicology.
It is a sub-discipline of toxicology that attempts to deduce the interaction
mechanisms of a nanostructured material with a living organism, including plants
and animals (Hobson 2016; Paramo et al. 2020). Because of the growing demand for
nanoparticle-based goods in manufacturing, waste management, and water treatment
facilities, these compounds are quite easy to release into the environment. There are
some studies showing the adverse behaviour of nanoparticles on wheat crops.
Karunakaran et al. (2013) found the harmful impacts of copper nanoparticles on soil
nutrients and other soil parameters (soil pH and electrical conductivity). Authors also
reported a minor variation in the amount of macronutrients in NPK and the quantity
of organic matter after application of CuNPs but in a considerable way.
Phytotoxicity and genotoxicity of silver NPs were studied in wheat by Vannini
et al. (2014) and found the alternation in cell proteins and metabolites. CuNPs
showed the toxic effects on wheat and mung beans documented by Lee et al.
(2008). In another study, Dimkpa et al. (2013) found the phototoxic attitude of
CuONPs in wheat, resulting in a reduction in root length. Banik and Pérez-de-Luque
(2017) reported the negative impacts of CuNPs on the germination index, shoot dry
weight, root length, and seed metabolic performance in wheat compared to control.
Application of TiO
2
and ZnONPs showed the inhibition of soil enzyme activity
(catalase, protease, and peroxidase) in a wheat experiment (Du et al. 2011). These
nano-formulations negatively affect the soil quality and health, along with having a
negative impact on the wheat biomass. Therefore, carrying out extensive and
focused research in this direction is strongly required.
364 C. Lata et al.
Fig. 17.5 The influence of silicon dioxide nanoparticles (SiO
2
NPs) on the severity of damping-off
in wheat seedlings infected with R. solani.(a) Healthy (control), R. solani-infected (positive
control), and SiO
2
-treated wheat seedlings; (b) pre-emergence damping-off; (c) post-emergence
damping-off; and (d) root rot severity. Whiskers represent the minimum and highest values, thick,
horizontal lines represent the medians, and boxes represent the interquartile ranges (25th to 75th
percentile of the data). According to Tukey’s honestly significant difference test ( p<0.05; n¼5),
different letters indicate statistically significant differences between treatments, whereas the same
letters imply no significant changes between them (Abdelrhim et al. 2021)
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 365
17.6 Conclusion and Future Perspectives
Wheat diseases could have immense potential in the field of detection, diagnosis, and
protection through nano-biotechnology. The advancement of nanotechnology com-
bined with biotechnological approaches could transform wheat production to the
next level. This improvement in the agricultural sector is directly associated with the
living standards of the developing world in terms of feeding a rapidly growing global
population. As a result, nano-biotechnology has been significantly less explored in
the area of wheat farming as compared to other areas of agriculture such as nano-
fertilizers and pharmaceutical and medicinal sciences. There are several fields where
nano-biotechnology needs more attention and is being explored, for example, field-
level studies in wheat. Nevertheless, wheat farming integrated with nano-
biotechnology has enormous potential to combat the challenges of climate change
associated with food production and sustainability for the world. Moreover, despite
the revolutionizing image of wheat production integrated with the immense potential
of nano-biotechnology, there are several risks associated with this area that should
also be studied. Subsequently, there is a strong need to build focussed and extensive
research efforts in some areas of nano-biotechnology.
•A major challenge in front of researchers coupled with nano-biotechnology is the
firm understanding of the fate and environmental impacts of nanomaterials on
non-targeted crops and animals. Therefore, it is essential to carefully monitor the
impacts of NPs on non-targeted plants and animals. The environmental persis-
tence of NPs should be monitored properly with soil and water studies.
•Wheat plant interactions with nanoparticles vary with several conditions; type of
NPs, stage of development and genotype, time of treatment, and so forth. Hence
permissible limits of nanoparticles’dosage and safety limits should be defined
with experimental validations. That’s why these facts should be scrutinized at the
time of doing experimentation with NPs while setting tolerable limits and
recommendations.
•The study of various non-targeted molecules that are present inside plant cells,
un-related pathways, protein function and gene expression is also required to find
out the interaction of NPs. Furthermore, the study of the correlation between
wheat rhizosphere and experimental NPs should be observed critically to define
the possible positive and negative effects on the wheat-agro-ecosystem. The
associated microbiome has an immense positive correlation with plant growth
and sustainability.
•Cost-effectiveness is another major factor of technology to be popular among the
common man. Because wheat is the principal food crop throughout the globe,
wheat farming integrated with nano-biotechnology should be cost-effective.
Integration of nano-biotechnological approaches with wheat research would be
incomplete without these factors being studied. Therefore, the aforementioned
points should be kept in mind to intend experimentation in this field. Hence,
collaborative and multidisciplinary research would be crucial in devising efficient,
multifunctional, cost-effective, environment-friendly, easily applicable, and quick-
performing nanomaterials. This would help to depict the clear role of NPs in terms of
function, behavior, fate, agro-toxicity, and impacts on non-targeted species.
366 C. Lata et al.
References
Abd-Elsalam KA, Vasil’kov AY, Said-Galiev EE, Rubina MS, Khokhlov AR, Naumkin AV,
Shtykova EV, Alghuthaymi MA (2017) Bimetallic and chitosan nanocomposites hybrid with
trichoderma: novel antifungal agent against cotton soil–borne fungi. Eur J Plant Pathol. https://
doi.org/10.1007/s10658-017-1349-8
Abdelrhim AS, Mazrou YS, Nehela Y, Atallah OO, El-Ashmony RM, Dawood MF (2021) Silicon
dioxide nanoparticles induce innate immune responses and activate antioxidant machinery in
wheat against Rhizoctonia solani. Plants 10(12):2758
Abdollahdokht D, Gao Y, Faramarz S, Poustforoosh A, Abbasi M, Asadikaram G, Nematollahi MH
(2022) Conventional agrochemicals towards nano-biopesticides: an overview on recent
advances. Chem Biol Technol Agric 9(1):1–19
Adrees M, Khan ZS, Ali S, Hafeez M, Khalid S, Ur-Rehman MZ, Afzal H, Khalid H, Shahzad
ASC, Rizwan M (2020) Simultaneous mitigation of cadmium and drought stress in wheat by
soil application of iron nanoparticles. Chemosphere 238:124681
Asseng S, Ewert F, Martre P, Rötter RP, Lobell DB, Cammarano D, Kimball BA, Ottman MJ, Wall
GW, White JW (2015) Rising temperatures reduce global wheat production. Nat Clim Chang 5:
143–147
Banik S, Pérez-de-Luque A (2017) In vitro effects of copper nanoparticles on plant pathogens,
beneficial microbes and crop plants. Span J Agric Res 15(2):e1005
Barik TK, Sahu B, Swain V (2008) Silica nanoparticles-from medicine to pest control. Parasitol Res
103:253–258
Beres BL, Rahmani E, Clarke JM, Grassini P, Pozniak CJ, Geddes CM, Porker KD, May WE,
Ransom JK (2020) A systematic review of durum wheat: enhancing production systems by
exploring genotype, environment, and management (G EM) synergies. Front Plant Sci.
https://doi.org/10.3389/fpls.2020.568657
Bhardwaj SC, Singh GP, Gangwar OP, Prasad P, Kumar S (2019) Status of wheat rust research and
progress in rust management-Indian context. Agronomy 9:892
Bhattacharya S, Jang J, Yang L, Akin D, Bashir R (2007) BioMEMS and nanotechnology-based
approaches for rapid detection of biological entities. J Rapid Methods Autom Microbiol 15:1–
32
Cassman KG, Grassini P (2020) A global perspective on sustainable intensification research. Nat
Sustain 3:262–268
Chatrath R (2004) Breeding strategies for developing wheat varieties targeted for rice-wheat
cropping system of Indo-Gangetic plains of Eastern India. In: Joshi AK, Chand R, Arun B,
Singh G (eds) A compendium of the training program (26–30 December, 2003) on wheat
improvement in eastern and warmer regions of India: conventional and non-conventional
approaches. NATP project, (ICAR). BHU, Varanasi, India
Daloz AS, Rydsaa JH, Hodnebrog Ø, Sillmann J, van Oort B, Mohr CW, Agrawal M, Emberson L,
Stordal F, Zhang T (2021) Direct and indirect impacts of climate change on wheat yield in the
Indo-Gangetic plain in India. J Agric Food Res 4:100132
Dameron CT, Reese RN, Mehra RK, Kortan AR, Carroll PJ, Steigerwald ML, Brus LE, Winge DR
(1989) Biosynthesis of cadmium sulphide quantum semiconductor crystallites. Nature 338:596–
597. https://doi.org/10.1038/338596a0
Dimkpa CO, McLean JE, Martineau N, Britt DW, Haverkamp R, Anderson AJ (2013) Silver
nanoparticles disrupt wheat (Triticum aestivum L.) growth in a sand matrix. Environ Sci
Technol 47:1082–1090
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 367
Du W, Sun Y, Ji R, Zhu J, Wu J, Guo H (2011) TiO
2
and ZnO nanoparticles negatively affect wheat
growth and soil enzyme activities in agricultural soil. Environ Monit Assess 13:822–828
Edmundson MC, Capeness M, Horsfall L (2014) Exploring the potential of metallic nanoparticles
within synthetic biology. New Biotechnol 31:572–578
Fan C, Wang S, Hong JW, Bazan GC, Plaxco KW, Heeger AJ (2003) Beyond superquenching:
hyper-efficient energy transfer from conjugated polymers to gold nanoparticles. Proc Natl Acad
Sci 100:6297–6301
FAO (2017) The future of food and agriculture–trends and challenges. Annu Rep 296:1–180
Goluch ED, Nam JM, Georganopoulou DG, Chiesl TN, Shaikh KA, Ryu KS, Barron AE, Mirkin
CA, Liu C (2006) A bio-barcode assay for on chip attomolar-sensitivity protein detection. Lab
Chip 6(10):1293–1299
González-Melendi P, Fernández-Pacheco R, Coronado MJ, Corredor E, Testillano PS, Risueño
MC, Marquina C, Ibarra MR, Rubiales D, Pérez-de-Luque A (2008) Nanoparticles as smart
treatment-delivery systems in plants: assessment of different techniques of microscopy for their
visualization in plant tissues. Ann Bot 101:187–195. https://doi.org/10.1093/aob/mcm283
Hafeez A, Razzaq A, Mahmood T, Jhanzab HM (2015) Potential of copper nanoparticles to increase
growth and yield of wheat. J Nanosci Adv Technol 1(1):6–11
Hobson DW (2016) Nanotoxicology: the toxicology of nanomaterials and nanostructures. Int J
Toxicol 35:3–4
Hoseinzadeh A, Habibi-Yangjeh A, Davari M (2016) Antifungal activity of magnetically separable
Fe
3
O
4
/ZnO/AgBr nanocomposites prepared by a facile microwave-assisted method. Prog Nat
Sci Mater Int 26:334–340
Ibrahim E, Zhang M, Zhang Y, Hossain A, Qiu W, Chen Y, Wang Y, Wu W, Sun G, Li B (2020)
Green-synthesization of silver nanoparticles using endophytic bacteria isolated from garlic and
its antifungal activity against wheat Fusarium head blight pathogen Fusarium graminearum.
Nanomaterials 10:219
Jasrotia P, Kashyap PL, Bhardwaj AK, Kumar S, Singh GP (2018) Scope and applications of
nanotechnology for wheat production: a review of recent advances. Wheat Barley Res 10:1–14
Jayaseelan C, Ramkumar R, Rahuman AA, Perumal P (2013) Green synthesis of gold nanoparticles
using seed aqueous extract of Abelmoschus esculentus and its antifungal activity. Ind Crop Prod
45:423–429
Jian Y, Chen X, Ahmed T, Shang Q, Zhang S, Ma Z, Yin Y (2021) Toxicity and action mechanisms
of silver nanoparticles against the mycotoxin-producing fungus Fusarium graminearum. J Adv
Res. https://doi.org/10.1016/j.jare.2021.09.006
Joshi AK, Chand R, Arun B, Singh RP, Ortiz R (2007) Breeding crops for reduced-tillage
management in the intensive, rice–wheat systems of South Asia. Euphytica 153:135–151
Karimi N, Minaei S, Almassi M, Shahverdi AR (2012) Application of silver nanoparticles for
protection of seeds in different soils. Afr J Agric Res 7:1863–1869
Karunakaran G, Suriyaprabha R, Manivasakan P, Yuvakkumar R, Rajendran V, Kannan N (2013)
Impact of nano and bulk ZrO
2
, TiO
2
particles on soil nutrient contents and PGPR. J Nanosci
Nanotechnol 13:678–685
Kashyap PL, Xiang X, Heiden P (2015) Chitosan nanoparticle based delivery systems for sustain-
able agriculture. Int J Biol Macromol 77:36–51
Kashyap PL, Rai P, Sharma S, Chakdar H, Kumar S, Pandiyan K, Srivastava AK (2016) Nanotech-
nology for the detection and diagnosis of plant pathogens. In: Nanoscience in food and
agriculture 2. Springer, New York, pp 253–276
Kashyap PL, Kumar S, Jasrotia P, Singh DP, Singh GP (2020) Nanotechnology in wheat production
and protection. In: Dasgupta N, Ranjan S, Lichtfouse E (eds) Environmental nanotechnology,
Environmental chemistry for a sustainable world, vol 4. Springer International Publishing,
Cham, pp 165–194. https://doi.org/10.1007/978-3-030-26668-4_5
Khan MR, Siddiqui ZA (2020) Use of silicon dioxide nanoparticles for the management of
Meloidogyne incognita,Pectobacterium betavasculorum and Rhizoctonia solani disease
complex of beetroot (Beta vulgaris L.). Sci Hortic 265:109211. https://doi.org/10.1016/j.scienta.
2020.109211
368 C. Lata et al.
Kheiri A, Moosawi Jorf SA, Malihipour A, Saremi H, Nikkhah M (2016) Application of chitosan
and chitosan nanoparticles for the control of Fusarium head blight of wheat (Fusarium
graminearum) in vitro and greenhouse. Int J Biol Macromol 93:1261–1272. https://doi.org/
10.1016/j.ijbiomac.2016.09.072
Khiyami MA, Almoammar H, Awad YM, Alghuthaymi MA, Abd-Elsalam KA (2014) Plant
pathogen nano-diagnostic techniques: forthcoming changes? Biotechnol Biotechnol Equip 28:
775–785
Kumar SA, Ansary AA, Ahmad A, Khan MI (2007) Extracellular biosynthesis of CdSe quantum
dots by the fungus, Fusarium oxysporum. J Biomed Nanotechnol 3:190–194
Lata C, Kumar A, Gangwar OP, Prasad P, Adhikari S, Kumar S, Kulshreshtha N, Bhardwaj S
(2021) Multiplex PCR assay for the detection of Lr24 and Lr68 in salt tolerant wheat genotypes.
Cereal Res Commun. https://doi.org/10.1007/s42976-021-00218-1
Lattanzio VM, Nivarlet N, Lippolis V, Della Gatta S, Huet AC, Delahaut P, Granier B, Visconti A
(2012) Multiplex dipstick immunoassay for semi-quantitative determination of Fusarium
mycotoxins in cereals. Anal Chim Acta 718:99–108
Lau HY, Wu H, Wee EJH, Trau M, Wang Y, Botella JR (2017) Specific and sensitive isothermal
electrochemical biosensor for plant pathogen DNA detection with colloidal gold nanoparticles
as probes. Sci Rep 7:38896. https://doi.org/10.1038/srep38896
Lee WM, An YJ, Yoon H, Kweon HS (2008) Toxicity and bioavailability of copper nanoparticles
to the terrestrial plants mung bean (Phaseolus radiatus) and wheat (Triticum aestivum): plant
agar test for water-insoluble nanoparticles. Environ Toxicol Chem 27:1915–1921. https://doi.
org/10.1897/07-481.1
Luyckx M, Hausman JF, Lutts S, Guerriero G (2017) Silicon and plants: current knowledge and
technological perspectives. Front Plant Sci 8:411. https://doi.org/10.3389/fpls.2017.00411
Mann A, Kumar N, Kumar A, Lata C, Kumar A, Meena BL, Mishra D, Grover M, Gaba S,
Parameswaran C, Mantri N (2021) De novo transcriptomic profiling of differentially expressed
genes in grass halophyte Urochondra setulosa under high salinity. Sci Rep 11:5548. https://doi.
org/10.1038/s41598-021-85220-7
Mansoor S, Zahoor I, Baba TR, Padder SA, Bhat ZA, Koul AM, Jiang L (2021) Fabrication of silver
nanoparticles against fungal pathogens. Front Nanotechnol 3:679358. https://doi.org/10.3389/
fnano
Mathivanan S (2021) Perspectives of nano-materials and nano-biosensors in food safety and
agriculture. Novel Nanomater 197. https://doi.org/10.5772/intechopen.95345
MilenkovićI, MitrovićA, Algarra M, Lázaro-Martínez JM, Rodríguez-Castellón E, MaksimovićV,
SpasićSZ, Beškoski VP, RadotićK (2019) Interaction of carbohydrate coated cerium-oxide
nanoparticles with wheat and pea: stress induction potential and effect on development. Plants 8:
478. https://doi.org/10.3390/plants8110478
Miller BS, Robinson RJ, Johnson JA, Jones ET, Ponnaiya BWX (1960) Studies on the relation
between silica in wheat plants and resistance to Hessian fly attack. J Econ Entomol 53:995–999
Mishra S, Singh BR, Singh A, Keswani C, Naqvi AH, Singh HB (2014) Biofabricated silver
nanoparticles act as a strong fungicide against Bipolaris sorokiniana causing spot blotch disease
in wheat. PLoS One 9:e97881
Nadiminti PP, Rookes JE, Dong YD, Sayer C, Boyd BJ, Cahill DM (2016) Nano-structured liquid
crystalline particle assisted delivery of 2,4-dichlorophenoxyacetic acid to weeds, crops and
model plants. Crop Prot 82:17–29
Omar HS, Al Mutery A, Osman NH, Reyad NEHA, Abou-Zeid MA (2021) Genetic diversity,
antifungal evaluation and molecular docking studies of Cu-chitosan nanoparticles as prospec-
tive stem rust inhibitor candidates among some Egyptian wheat genotypes. PLoS One 16:
e0257959
Paramo LA, Feregrino-Pérez AA, Guevara R, Mendoza S, Esquivel K (2020) Nanoparticles in
agroindustry: applications, toxicity, challenges, and trends. Nanomaterials 10(9):1654
17 Applications of Nano-Biotechnological Approaches in Diagnosis... 369
Picchi V, Gobbi S, Fattizzo M, Zefelippo M, Faoro F (2021) Chitosan nanoparticles loaded with
N-acetyl cysteine to mitigate ozone and other possible oxidative stresses in durum wheat. Plants
10:691
Pimentel D (2009) Invasive plants: their role in species extinctions and economic losses to
agriculture in the USA. In: Inderjit (ed) Management of invasive weeds, invading nature,
Springer Series in invasion ecology, vol 5. Springer, Dordrecht, p 17
Punia H, Tokas J, Malik A, Kumar N (2021) Enzymes as nano-additives: a promising alternative for
biofuel production. In: Kumar RP, Bharathiraja B (eds) Nanomaterials. Academic, San Diego,
pp 631–662. https://doi.org/10.1016/B978-0-12-822401-4.00019-2
RafiMM, Epstein E, Falk RH (1997) Silicon deprivation causes physical abnormalities in wheat
(Triticum aestivum L.). J Plant Physiol 151:497–501
Rafique M, Sadaf I, Rafique MS, Tahir MB (2017) A review on green synthesis of silver
nanoparticles and their applications. Artif Cells Nanomed Biotechnol 45:1272–1291
Rajput VD, Minkina T, Feizi M, Kumari A, Khan M, Mandzhieva S, Sushkova S, El-Ramady H,
Verma KK, Singh A, Hullebusch EDV, Singh RK, Jatav HS, Choudhary R (2021) Effects of
silicon and silicon-based nanoparticles on rhizosphere microbiome. Plant Stress Growth Biol
10:791. https://doi.org/10.3390/biology10080791
Rejeb IB, Pastor V, Mauch-Mani B (2014) Plant responses to simultaneous biotic and abiotic stress:
molecular mechanisms. Plants 3:458–475. https://doi.org/10.3390/plants3040458
Rispail N, De-Matteis L, Santos R, Miguel AS, Custardoy L, Testillano PS, Risueño MC, Pérez-de-
Luque A, Maycock C, Fevereiro P (2014) Quantum dot and superparamagnetic nanoparticle
interaction with pathogenic fungi: internalization and toxicity profile. ACS Appl Mater
Interfaces 6:9100–9110
Sabir S, Arshad M, Ilyas N, Naz F, Amjad MS, Malik NZ, Chaudhari SK (2022) Protective role of
foliar application of green-synthesized silver nanoparticles against wheat stripe rust disease
caused by Puccinia striiformis. Green Process Synth 11(1):29–43
Safarnejad MR, Samiee F, Tabatabie M, Mohsenifar A (2017) Development of quantum dot-based
nanobiosensors against citrus tristeza virus (CTV). Sens Transducers 213(6):54
Saharan V, Sharma G, Yadav M, Choudhary MK, Sharma SS, Pal A, Raliya R, Biswas P (2015)
Synthesis and in vitro antifungal efficacy of Cu–chitosan nanoparticles against pathogenic fungi
of tomato. Int J Biol Macromol 75:346–353
Satti SH, Raja NI, Javed B, Akram A, Mashwani ZR, Ahmad MS, Ikram M (2021) Titanium
dioxide nanoparticles elicited agro-morphological and physicochemical modifications in wheat
plants to control Bipolaris sorokiniana. PLoS One 16:e0246880
Scott P, Ron M (2020) Plant signaling in biotic and abiotic stress. J Exp Bot 71(5):1649–1651.
https://doi.org/10.1093/jxb/eraa051
Sertova NM (2015) Application of nanotechnology in detection of mycotoxins and in agricultural
sector. J Cent Eur Agric 16(2):117–130
Singh R, Singh R, Singh D, Mani JK, Karwasra SS, Beniwal MS (2010) Effect of weather
parameters on Karnal bunt disease in wheat in Karnal region of Haryana. J Agrometeorol 12:
99–101
Singh RP, Handa R, Manchanda G (2021) Nanoparticles in sustainable agriculture: an emerging
opportunity. J Control Release 329:1234–1248. https://doi.org/10.1016/j.jconrel.2020.10.051
Soleymanzadeh R, Iranbakhsh A, Habibi G, Zahra AO (2020) Selenium nanoparticle protected
strawberry against salt stress through modifications in salicylic acid, ion homeostasis, antioxi-
dant machinery, and photosynthesis performance. Acta Biol Cracov Ser Bot 62(1):33–42.
https://doi.org/10.24425/abcsb.2019.127751
Stadler T, Buteler M, Weaver DK (2010) Novel use of nanostructured alumina as an insecticide.
Pest Manag Sci: Formerly Pestic Sci 66(6):577–579
Su LX, Ma XL, Zhao KK, Shen CL, Lou Q, Yin DM, Shan CX (2018) Carbon nanodots for
enhancing the stress resistance of peanut plants. ACS Omega 3(12):17770–17777
370 C. Lata et al.
Syed A, Ahmad A (2013) Extracellular biosynthesis of CdTe quantum dots by the fungus Fusarium
oxysporum and their anti-bacterial activity. Spectrochim Acta A Mol Biomol Spectrosc 106:41–
47
Templ B, Calanca P (2020) Critical increase in the occurrence of heat stress during reproductive
growth in Russian wheat beyond 1.5 C global warming. Weather Clim Extremes 30:100281
Thakur RK, Prasad P (2021) Synthesis of gold nanoparticles and assessment of in vitro toxicity
against plant pathogens. Indian Phytopathol. https://doi.org/10.1007/s42360-021-00444-x
Turner AP (2000) Biosensors—sense and sensitivity. Science 290(5495):1315–1317. https://doi.
org/10.1126/science.290.5495.1315
United Nations (2015) World population prospects: the 2015 revision. United Nations Econ Soc Aff
33:1–66
Vannini C, Domingo G, Onelli E, De Mattia F, Bruni I, Marsoni M, Bracale M (2014) Phytotoxic
and genotoxic effects of silver nanoparticles exposure on germinating wheat seedlings. J Plant
Physiol 171:1142–1148
Viet PV, Nguyen HT, Cao TM, Hieu LV (2016) Fusarium antifungal activities of copper
nanoparticles synthesized by a chemical reduction method. J Nanomater 2016:1957612
Worrall EA, Hamid A, Mody KT, Mitter N, Pappu HR (2018) Nanotechnology for plant disease
management. Agronomy 8:285
Yadav A, Kon K, Kratosova G, Duran N, Ingle AP, Rai M (2015) Fungi as an efficient mycosystem
for the synthesis of metal nanoparticles: progress and key aspects of research. Biotechnol Lett
37:2099–2120
Yadav J, Jasrotia P, Kashyap PL, Bhardwaj AK, Kumar S, Singh M, Singh GP (2021)
Nanopesticides: current status and scope for their application in agriculture. Plant Prot Sci
58(1):1–17
Yang W, Peters JI, Williams RO (2008) Inhaled nanoparticles—a current review. Int J Pharm 356:
239–247. https://doi.org/10.1016/j.ijpharm.2008.02.011
Yasmeen F, Raja NI, Razzaq A, Komatsu S (2017) Proteomic and physiological analyses of wheat
seeds exposed to copper and iron nanoparticles. Biochim Biophys Acta Proteins Proteomics
1865:28–42
Yugay Y, Rusapetova T, Mashtalyar D, Grigorchuk V, Vasyutkina E, Kudinova O, Zenkina K,
Trifuntova I, Karabtsov A, Ivanov V, Aseeva T (2021) Biomimetic synthesis of functional silver
nanoparticles using hairy roots of Panax ginseng for wheat pathogenic fungi treatment. Colloids
Surf B Biointerfaces 207:112031
Zhao MX, Zeng EZ (2015) Application of functional quantum dot nanoparticles as fluorescence
probes in cell labeling and tumor diagnostic imaging. Nanoscale Res Lett 10:1–9
Nanomaterials for the Reduction
of Mycotoxins in Cereals 18
Mohamed Amine Gacem and Kamel A. Abd-Elsalam
Abstract
Mycotoxins are secondary metabolites secreted by certain genera of molds.
However, their synthesis is controlled by several biotic and abiotic factors. The
presence of mycotoxins in unprocessed or still processed foodstuffs poses major
economic and health problems. The daily ingestion of food contaminated by
doses higher than the doses recommended by specialized services leads to the
development of several mycotoxicoses, some of which are very serious. Most of
these mycotoxicoses arise from the high oxidative power of mycotoxins in
poisoned living cells. Although recent studies indicate that no food is immune
to these toxins, cereals remain the most contaminated food category due to their
composition rich in complex sugars and nitrogen compounds. This composition
makes cereals a favorable environment for the synthesis of mycotoxins. This
alarming situation forces global organizations and control services to adopt
several strategies to minimize the economic and health damage caused by
mycotoxins and/or their sources of origin. Although conventional methods for
the removal of mycotoxins and toxigenic molds continue to advance, current
research trends aim to create nanoscale structures capable of offering more
promising, cost-effective, and less expensive solutions. Nanostructures based
on carbon, zinc, copper, silver, gold, and iron are the most promising
nanomaterials. Polymeric nanoparticles doped or substituted with substances or
chemical groups are also recommended. Inhibition of mold growth, adsorption of
mycotoxins, and reduction of the toxic effect of mycotoxins in poisoned cells are
M. A. Gacem (*)
Department of Biology, Faculty of Science, University of Amar Tlidji, Laghouat, Algeria
K. A. Abd-Elsalam
Plant Pathology Research Institute, Agricultural Research Center (ARC), Giza, Egypt
#The Author(s), under exclusive license to Springer Nature Singapore Pte
Ltd. 2022
K. A. Abd-Elsalam, H. I. Mohamed (eds.), Cereal Diseases: Nanobiotechnological
Approaches for Diagnosis and Management,
https://doi.org/10.1007/978-981-19-3120-8_18
371
the three main strategies by which nanostructures reduce mycotoxins. The current
chapter deals generically with the main classical techniques and nanomaterials in
the elimination of mycotoxins in cereals.
372 M. A. Gacem and K. A. Abd-Elsalam
Keywords
Aflatoxins · Nanoparticles · Antifungal activity · Wheat · Maize
18.1 Introduction
Nowadays, cereals and cereal by-products are the most consumed food sources by
humans in several countries, and in particular in developing countries. It brings
several nutrients to the diet. They are composed of trace elements such as iron,
copper, manganese, phosphorus, zinc, sodium, potassium, and calcium. Cereals are
also an important source of carbohydrates, dietary fiber, polyunsaturated fatty acids,
and protein. Cereals also contain vitamin B6, thiamin, riboflavin, niacin, and folic
acid (Laskowski et al. 2019). Given the rising standard of living and ever-increasing
demographic exposure, however, it will be very difficult to balance future world
population and food demands in the face of dwindling natural resources and unmet
food security, and an increased need for yield and minimum loss of grain crops is
required (Mannaa and Kim 2017). According to approximations, a population
estimated at more than nine billion by 2050 must be fed, while guaranteeing the
health of humans and the planet (Cole et al. 2018). To meet future global food
demands for cereals, agronomic research and food processing unit operations play a
key role in the success of established strategies. The new strategies granted will
ensure an increase in production, stabilization of yields, and guaranteed crop
protection.
Mycotoxinogenic molds and/or their mycotoxins are the main contaminants of
cereals and their derivatives (Wan et al. 2020). These secondary metabolites are
produced by different genera of phytopathogenic filamentous fungi (Palumbo et al.
2020), some of which are abundantly toxic and cause serious illness in humans and
animals (Bennett and Klich 2003). Among the mycotoxins detected on cereals,
aflatoxins, ochratoxins, fumonisins, deoxynivalenol, and zearalenone are the most
abundant. According to Lee and Ryu, the incidences and maximum levels in raw
cereal grains were 55% and 1642 μg/kg for aflatoxins, 29% and 1164 μg/kg for
ochratoxin A, 61% and 71,121 μg/kg for fumonisins, 58% and 41,157 μg/kg, for
deoxynivalenol, and 46% and 3049 μg/kg for zearalenone (Lee and Ryu 2017).
In the field and during the different stages of growth, the contamination of cereals
by mycotoxins can only occur after an alteration by a fungal flora of the field. In
post-harvest, contamination occurs during transport and long storage periods
(García-Díaz et al. 2020). The storage period remains the determining stage of the
quality of cereals, and the degradation is strongly due to the drop in quality following
the infestation of the fungal flora of storage (Mannaa and Kim 2017). Mycotoxin
biosynthesis is influenced by environmental factors such as climate, pest infestations
(Omotayo et al. 2019), water activity (Aw), temperature, and light and
eco-physiological requirements (Mannaa and Kim 2017; Priesterjahn et al. 2020).
Mycotoxin biosynthesis is also influenced by an optimal pH and carbon to nitrogen
(C:N) ratio (Brzonkalik et al. 2012). Moreover, the proper functioning of enzymatic
pathways and the safety of biosynthetic gene clusters play a crucial role in the
biosynthesis of mycotoxins. It has been reported that the establishment of a good
interconnection between environmental signals and regulations is a determining
point in mycotoxin biosynthesis (Caceres et al. 2020). In addition, the interaction
between fungal species of contaminating mycoflora plays a key role in fungal
incidence and the production of mycotoxins. The production of aflatoxin B
1
by
Aspergillus flavus is stimulated by Fusarium graminearum; however, the
co-presence of Aspergillus flavus considerably reduces the biosynthesis of fumonisin
and deoxynivalenol (Giorni et al. 2019). Species interaction can also lead to
overexpression of mycotoxins, such as overexpression of mycotoxins following
the interaction of Tribolium castaneum and Aspergillus flavus in maize flour (Duarte
et al. 2021).
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 373
Among the various mycotoxins known to date, aflatoxins, ochratoxins,
trichothecenes, zearalenone, fumonisins, and patulin are classified as serious
contaminants from an agro-economic and sanitary point of view. Exposure to
these mycotoxins leads to mycotoxicoses, some of which are serious and irreversible
and can lead to death (Omotayo et al. 2019). Prolonged exposure to mycotoxins,
especially aflatoxins (AFs) and ochratoxin A (OTA), is an important way to increase
the incidence of hepatocellular carcinoma (HCC) (Felizardo and Câmara 2013). In
addition, ochratoxin A (OTA) is considered a powerful mycotoxin implicated in the
development of other types of cancers (Sorrenti et al. 2013). Fumonisins (FBs)
induce liver and kidney tumors, esophageal cancers, and neural tube defects (Wild
and Gong 2010). In animals, zearalenone (ZEA) induces reproductive disorders, as it
is also capable of causing hyperestrogenic syndrome (Rai et al. 2020).
Deoxynivalenol (DON) induces disruption of cell function by preventing protein
synthesis, DON also affects immune function and growth (Pestka and Smolinski
2005).
Reducing the risk of consumer exposure to food contaminated with mycotoxins
relies on two basic strategies. The first strategy aims to prevent pre-harvest contami-
nation, while the second aims to prevent post-harvest mycotoxin production (Guo
et al. 2021a). In pre-harvest, the application of good agricultural practices, the
management of plant diseases (Karlovsky et al. 2016), and the use of chemical
agents such as fungicides, herbicides, and insecticides contribute to the reduction of
toxigenic molds and, therefore, a reduction of mycotoxins biosynthesis (Edwards
and Godley 2010; Lehoczki-Krsjak et al. 2010). Despite the expenses incurred to
achieve the success of prevention strategies, these policies considered are not always
effective in preventing the biosynthesis of mycotoxins. The failures recorded in
pre-harvest prevention involve the intervention of one or more post-harvest
treatments. The appropriate practices and the respect for storage conditions can
reduce and guarantee the health quality of the stored product (García-Díaz et al.
2020). In addition, the storage of cereal raw materials may be preceded by treatments
to eliminate mycotoxins and/or their sources of origin. These treatments are classi-
fied into several categories in which the physical elimination methods are the most
effective, citing as an example, automatic sorting. Food processing unit operations
such as grinding seeds and applying high temperatures also reduce mycotoxin
content. In contrast, processes in food processing units significantly reduce myco-
toxin concentrations but do not eliminate them completely (Milani and Maleki
2014).It is also possible to get rid of mycotoxins with chemical or enzymatic
treatment (Karlovsky et al. 2016).
374 M. A. Gacem and K. A. Abd-Elsalam
Despite the application of several protocols and techniques aimed at preventing,
decontaminating, and detoxifying mycotoxins, these toxins are constantly detected
on cereals and their derivatives, which points to the failure of the methods applied,
and the persistence of health and economic damage. At present, no method is
strongly recommended to completely prevent the contamination of cereals and
their derivatives by mycotoxins (Wan et al. 2020), leaving a big void, which offers
a new platform for nanotechnology research focused on reducing mycotoxins in
cereals. The first part of the current chapter deals generically with the main classical
techniques for the elimination of mycotoxins in cereals. In the second part, the
chapter deals in depth with the detoxification mechanism exerted by the
nanomaterials (NMs) applied during the treatment of mycotoxins, or toxigenic
molds in cereals. Optimization of factors involved in detoxification is also discussed.
18.2 Occurrence of Mycotoxins in Cereals
Despite compliance with agricultural practices and the use of fungicides in fields, no
grain product is immune to contamination by mycotoxinogenic molds and their
mycotoxins. Practices applied in the field and over long storage periods aim to
prevent severe fungal damage and minimize contamination. Contamination can
occur in the field, during harvest due to damaged grain, during maritime transport
due to high humidity, and during long periods of storage. The evolution of
contaminating mycoflora can be exponential following non-compliance with storage
conditions. Spoilage of grains can affect grain derivatives and by-products due to the
stability of mycotoxins and the inability of different processing and detoxification
methods to remove them.
According to published studies species belonging to the genera Aspergillus,
Penicillium,Alternaria,Fusarium, and Claviceps are the main contaminants of
cereals and their by-products (Zhang et al. 2020). Similarly, aflatoxins, fumonisins,
ochratoxins, T-2 toxin, deoxynivalenol, and zearalenone are the most abundant
mycotoxins in this food category. Table 18.1 gives a general overview of
the contamination of cereals or their by-products in different regions of the world.
The detection methods used to reveal the mycotoxins, the percentage incidence, and
the range of contamination are also reported in Table 18.1.
(continued)
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 375
Table 18.1 Worldwide occurrence of mycotoxins in cereals and cereal-based foods
Country Detection method Cereal type Mycotoxin type
Incidence
rate (%)
Max/Range (μg/
kg) Reference
Albania LC-MS/MS Wheat DON 23 1916 Topi et al.
(2020)
Maize FB1, FB2 76 16.97
DON 24 799
T-2 2.2 106
ZEA 4.4 263
China UPLC MS/MS Wheat kernel AOH 31.40 21.10–102.38 Jiang et al.
(2021)
AME 4.90 7.20–40.90
TeA 62.70 13.20–3634.80
Flour AOH 10.00 16.19–33.86
AME 10.00 1.60–2.35
TeA 90.00 10.00–172.00
Spain UPLC MS/MS Oat kernel ZEA 66 28.1–153 ng/g Tarazona
et al. (2021)
HT-2 toxin 47 4.98–439 ng/g
DON 34 19.1–736 ng/g
FB
1
29 63.2–217.4 ng/g
T-2 toxin 24 12.3–321 ng/g
Argentina HPLC Barley AOH 64 712 μg/kg Castañares
et al. (2020)
TeA 37 1522 μg/kg
Vietnam LC-MS/MS Paddy and white
rice
Afs, FBs, ENN-B, ROQC,
STERIG, AME, NIV, OTA, DAS
45 2.3–547 μg/kg Phan et al.
(2021)
Nigeria ELISA Maize AFs 100 3.5–173.3 Ekpakpale
et al. (2021)
Rice 75 1.75–22.8
Zimbabwe Neogen AccuScan Lateral
Flow Device
HPLC
Maize AFs 51.2 ND to 1369 Akello et al.
(2021)
FBs 88.9 ND to 40,000
Sorghum AFs 25.0 ND to 4.3
Table 18.1 (continued)
Country Detection method Cereal type Mycotoxin type
Incidence
rate (%)
Max/Range (μg/
kg) Reference
FBs 31.7 ND to 2800
Poland HPLC with fluorescence
detection (HPLC-FLD)
Cereal products
from organic farms
DON 26.3 199.60 149.82 Mruczyk
et al. (2021)
Brazil HPLC-MS Breakfast cereals FB
1
26.7 105 Mallmann
et al. (2020)
ZEA 14.8 17
DON 10 44
Infant cereals FB
1
27.8 55
ZEA 6.9 3
DON 10.3 36
Poland LC-MS/MS Rye DON 90 354.1 Kosicki et al.
(2020)
T-2 toxin 63 6.63
HT-2 toxin 57 29.8
ZEA 45 10.2
Egypt HPLC Wheat AFB
1
33.33 24.11–62.17 Hathout
et al. (2020)
OTA / <LOD
Lebanon HPLC Wheat AFB
1
65.7 0.04–6.21 Daou et al.
(2021)
OTA 100 0.02–63.3
LC-MS/MS liquid chromatography coupled with tandem mass spectrometry, FBs fumonisins, FB
1
Fumonisins B
1
,FB
2
Fumonisins B
2
,AOH alternariol, AME
alternariol monomethyl ether, TeA tenuazonic acid, UPLC–MS/MS ultra performance liquid chromatography–tandem mass spectrometer, TEN tentoxin, Afs
aflatoxins, ENN-B enniatin B, ROQC roquefortine C, STERIG sterigmatocystine, AME alternariol methylether, NIV nivalenol, OTA ochratoxin A, DAS
diacetoxyscirpenol, ELISA enzyme-linked immunosorbent assay, DON deoxynivalénol, ZEA zearalenone, DAS diacetoxyscirpeno, AFB1 aflatoxin B1
376 M. A. Gacem and K. A. Abd-Elsalam
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 377
18.3 Toxicities of Mycotoxins in Human Organism
Ingestion of mycotoxins is the most common mode of exposure. However, exposure
by inhalation of mycotoxins in the air or by a dermal route is no longer negligible.
Long-term exposure at high doses causes nephrotoxicity, hepatotoxicity, neurotox-
icity, gastrointestinal toxicity, immunotoxicity, genotoxicity, and teratogenicity.
AFB1 is currently considered genotoxic and mutagenic for living cells; the toxin
induces aberrations in DNA (Bárta et al. 1984; Madrigal-Santillánetal.2010) and
leads to decreased cell viability by an increase in fragmented DNA levels (Golli-
Bennour et al. 2010). Human hepatocellular carcinoma (HCC) is linked to a distinct
mutation of TP53 by transversions of G to T in the second guanine of codon
249 (Besaratinia et al. 2009). AFB1 negatively affects the embryonic development
of skeletal muscles (Oznurlu et al. 2012; Gündüz and Oznurlu 2014). In chicks,
AFB1 induces decreased weight, disturbs the biochemical characteristics, and
increases liver weight with perilobular inflammation and vacuolar hepatocyte degen-
eration (Denli et al. 2009). In THP-1 and RAW 264 cell lines, AFB1 affects
macrophage functions, it induces ROS-mediated autophagy (An et al. 2017). The
kidney is an action site for AFB1, in addition, the toxins decreased the rate of
glomerular filtration and tubular reabsorption of glucose (Akao et al. 1971). Another
study in rats demonstrated that repeated administration of AFB1 leads to degenera-
tion of the central and peripheral nervous systems (Ikegwuonu 1983). The majority
of these diseases result from alteration of repair systems and activations of molecules
responsible for inflammation and apoptosis induced by ROS formed after the
intoxication of cells. Table 18.2 and Fig. 18.1 present some toxic effects of
aflatoxins, fumonisins, ochratoxins, deoxynivalenol, and zearalenone.
18.4 Conventional Methods of Managing Mycotoxins in Cereals
In order to reduce the contamination of cereals, strict procedures are applied in the
field just before cultivation, and other procedures continue throughout the stages
which follow the cultivation of cereals (Fig. 18.2); these strategies help to minimize
the appearance of mycotoxins on the harvested products. Good practices include the
right choice of seeds, especially seeds resistant to fungal infections, the choice of
fertilizers and irrigation waters, the selection of fungicides, the prevention of damage
during harvest, the appropriate drying, and good storage practices. Once the con-
tamination of cereals begins to appear, it will become inevitable because mycotoxins
are very stable compounds. Several physical, chemical, and biological techniques
are applied to minimize contamination.
378 M. A. Gacem and K. A. Abd-Elsalam
Table 18.2 Some toxic effects of aflatoxins, fumonisins, ochratoxins, deoxynivalenol, and zearalenone
Mycotoxins
Selected
organism Sex Age Weight
Dose/
administration
route
Exposure
time
Biological
sample Damage References
AFB
1
Mice Male 4 weeks –0.75 mg/kg b.w 15 days Liver AFB
1
induced
oxidative stress and
liver injury
Rajput
et al.
(2021)
AFB
1
Broiler Male 5 weeks 397.35 6.32 g 100 μg/kg 4 weeks Bursa of
Fabricius
AFB
1
decreased the
relative weight of bursa
of Fabricius and
antioxidant enzymes
activities
Guo et al.
(2021b)
AFB
1
Mice Male 6 weeks 35.5 1.53 g 450 μg/kg b.w 28 days Kidney AFB1 induced
oxidative stress, an
increase in apoptotic
cells, and liver injury
Zhao et al.
(2021)
AFB
1
Mice –5–6 weeks –450 μg/kg b.w 28 days Liver AFB
1
induced
oxidative damage and
apoptosis in the livers
Li et al.
(2021a)
AFB
1
Mice Male 6 weeks 23–28 g 0.75 mg/kg 30 days Spleen AFB1 induced
oxidative stress and
splenic apoptosis
Xu et al.
(2019a)
AFB
1
Mice Male 6 weeks 23–28 g Lycopene (5 mg/
kg b.w) + AFB1
(0.75 mg/kg b.w)
30 days Kidney AFB
1
exposure
increased the serum
concentrations of
blood urea nitrogen
and serum creatinine
and caused damage to
the renal structure
Yu et al.
(2018)
AFB
1
AFM
1
Mice Male –18–22 g AFB1 (0.5 mg/
kg) + AFM1
(3.5 mg/kg)
28 days Kidney Aflatoxins activated
oxidative stress and
caused renal damage
Li et al.
(2018)
(continued)
AFB
1
Mice Male 6–8 weeks 18–20 g 10, 20, and 40 μg/
kg b.w. AFB1
i.p. daily + H1N1
virus
15 days Lung and
spleen
AFB
1
exposure
aggravates Swine
influenza virus
replication,
inflammation and lung
damage by activating
TLR4-NFκB signaling
Sun et al.
(2018)
OTA Mice –6 weeks 20 2 g Orally/5 mg/kg b.
w
27 days Kidney OTA increased levels
of serum uric acid and
blood urea nitrogen
OTA induced
degeneration of tubular
epithelial cells
OTA decrease the
levels of antioxidant
enzymes
Li et al.
(2020a)
OTA Mice Male 9 weeks 16–18 g 5 mg/kg b.w 27 days Heart OTA decreased both
body weight and heart
weight
OTA induced a
decrease in heart rate
OTA decreased tissue
concentrations of
antioxidant enzymes
Cui et al.
(2020)
OTA Rats Male 10 weeks 230–270 g Orally/125 and
0.250 mg/kg b.w
3 weeks Liver and
kidney
OTA induced
oxidative stress
Rašićet al.
(2019)
OTA Chicken Male 240 days –1.0 or 2.0 mg/kg 42 days Bursa of
Fabricius
Immunotoxicity Bhatti
et al.
(2018)
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 379
Table 18.2 (continued)
Mycotoxins
Selected
organism Sex Age Weight
Dose/
administration
route
Exposure
time
Biological
sample Damage References
OTA Rats Male 10 weeks 230–270 g Orally/0.125 and
0.250 mg/kgb.w
21 days Kidneys and
liver
OTA induced
oxidative stress and
reduced kidneys
glutathione, and
increased kidneys and
liver malondialdehyde
Rašićet al.
(2018)
OTA Mice Male–21 4g Intraperitoneal
injections/3.5 mg/
kg b.w
–Brain OTA caused a
significant alteration in
the proliferation
process, adecrease in
glial cells and a
significant decrease in
the number of
neuroblasts
Paradells
et al.
(2015)
FBs Mice Female 8 weeks 10 mg/kg b.w 28 days Liver Hepatotoxicity Régnier
et al.
(2019)
FBs Pig Male 28 days –Orally/10 mg/kg 4 weeks Liver and the
jejunum
FBs induced an
increase in weight and
displayed a higher
sphinganine/
sphingosine ratio
Régnier
et al.
(2017)
FBs Turkeys Female 10 weeks
old
–15 mg/kg
FB1 + FB2
14 days Serum Disturbance of
sphingolipid
metabolism
Masching
et al.
(2016)
380 M. A. Gacem and K. A. Abd-Elsalam
ZEA Mice Male 6 weeks 25–30 g Orally/40 mg/kg
b.w
4 weeks Serum ZEA induced an
increase in
pro-inflammatory
factors, including
interleukin-1β(IL-1β),
IL-6, and tumor
necrosis factor-α
AbuZahra
et al.
(2021)
ZEA Gilts 42 days 12.84 0.26 kg Orally/1.04 mg/kg 35 days Small
intestines
ZEA induced villus
injuries of the
duodenum, jejunum
and ileum
Zhang
et al.
(2021a)
ZEA Mice 6–8 weeks 4.5 mg/kg b.w 1 week Colon ZEA induced intestinal
inflammation
Fan et al.
(2018)
DON Pigs Male
and
female
–6.87 0.41 kg Orally/1.3 and
2.2 mg/kg
60 days Cerebral
cortex,
cerebellum,
and
hippocampus
DON induced
destruction of
hippocampal cell
ultrastructure
DON caused oxidative
damage in the cerebral
cortex, cerebellum, and
hippocampus
Wang
et al.
(2020)
DON Chickens 1 day 0, 2.5, 5, and
10 mg DON per
kg die
5 weeks Cecum DON induced an
alteration in cecal
bacterial diversity and
composition
Lucke
et al.
(2018)
DON Chicken Male 1 day 0.27, 1.68 and
12.21 mg/kg
36 days Brain DON caused lipid
peroxidation,
neurotransmitters
secretion and affect the
balance of calcium
homeostasis
Wang
et al.
(2018)
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 381
382 M. A. Gacem and K. A. Abd-Elsalam
Fig. 18.1 Some toxic effects of mycotoxins in human organism
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 383
Fig. 18.2 Some necessary preventative processes before and after harvest and during the storage of
agricultural products. (Reprinted from Gacem MA, Gacem H, Telli A, Ould El Hadj Khelil A
(2020) Chapter 8 - Mycotoxins: decontamination and nanocontrol methods. In: Rai M,
Abd-Elsalam KA (Eds) Nanomycotoxicology, Treating Mycotoxins in the Nano Way, 1st edition.
Academic Press, pp 230–257)
18.4.1 Biological Methods
The detoxification of mycotoxins by biological processes has been the subject of
several studies. So far, these methods are still considered promising approaches due
to the absence of harmful effects. Plants and microorganisms, including bacteria,
yeasts and molds, and their bioactive substances, have an excellent ability to inhibit
the growth of toxigenic molds and reduce the synthesis of mycotoxins. In the case of
microorganisms, some species of the genus Bacillus have the ability to transform
DON into a less toxic compound called de-epoxy DON (DOM-1) (Li et al. 2011). In
another study, Bacillus subtilis designated B. subtilis SG6 isolated from wheat
kernels and plant anthers recorded a significant antifungal effect on the mycelial
growth of F. graminearum, and this mold is one of the agents responsible for yield
and quality losses in wheat and barley. B. subtilis SG6 is able to reduce sporulation
and DON production by F. graminearum (Zhao et al. 2014). In Argentina, in vivo
tests of two species: B. subtilis RC 218 and Brevibacillus sp. RC 263 demonstrated a
significant reduction in the growth of F. graminearum. In comparison with the
control plots, whose contamination reaches 1372 μg/kg of DON, the reduction in
the growth rate of F. graminearum in the assays is accompanied by an absence of
accumulation of DON in the ears of wheat (Palazzini et al. 2016). On peanut kernels,
volatile organic compounds of Streptomyces yanglinensis are able to inhibit mycelial
growth and expression of aflatoxin biosynthesis by Aspergillus flavus and Aspergil-
lus parasiticus (Lyu et al. 2020); the same result was observed in the volatile
compound of Streptomyces philanthi RL-1-178 used as a fumigant to protect
soybean seeds against A. parasiticus and A. flavus (Boukaew and Prasertsan
2020). In A. flavus, volatile compounds of Alcaligenes faecalis N1–4 isolated from
tea rhizosphere soil inhibit the expression of 12 important genes in the aflatoxin
biosynthesis pathway; additionally, complete inhibition of aflatoxin contamination is
recorded for stored peanuts, corn, rice and soybeans (Gong et al. 2019). Besides
Bacillus and Streptomyces,Shewanella algae (strain YM8) is highly effective
against aflatoxin biosynthesis in maize samples stored at different water activity
levels. S. algae also has significant antifungal potential against A. parasiticus,
A. niger,A. alternate,Botrytis cinerea,F. graminearum, and F. oxysporum (Gong
et al. 2015). Meanwhile, the phenolic compounds of Spirulina algae (strain LEB-18)
reduced mycotoxin biosynthesis; an average reduction of 68% has been recorded for
the trichothecene, deoxynivalenol and nivalenol produced by F. graminearum
(Pagnussatt et al. 2014). These results suggest that detoxification by microorganisms
is an effective approach to eliminate the negative effects of mycotoxin (Li et al.
2011). The secondary metabolites of plants have a very active fungicidal power
against toxigenic molds. The essential oil of Ocimum sanctum L. has fungicidal and
antimycotoxinogenic activity on the growth and production of zearalenone (ZEA) of
F. graminearum (Kalagatur et al. 2015). Alternatively, ergosterol has an inhibitory
effect on ZEA and DON produced by F. graminearum and F. culmorum in maize
seed (Perczak et al. 2019). Nowadays, molecular techniques and genetic engineering
also play a key role in the fight against toxigenic molds and their mycotoxins.
Transgenic wheat expressing a barley UDP-glucosyltransferase (HvUGT13248)
exhibited significantly higher resistance to disease and transformed DON to
DON-3-O-glucoside (D3G) (Li et al. 2015), transgenic wheat expressing
UDP-glucosyltransferase also converts nivalenol into the non-toxic nivalenol-3-
O-β-D-glucoside (Li et al. 2017).
384 M. A. Gacem and K. A. Abd-Elsalam
18.4.2 Chemical Methods
Several chemical methods are recommended for the same purpose, eliminate and/or
prevent the appearance of mycotoxins in cereals. These techniques and practices are
strictly applied to prevent their failure, increase production costs, reduce nutritional
value, and prevent the generation of more toxic residues or by-products (Peraica
et al. 2002). Ozone (O
3
) is a powerful antifungal; it is able to destroy the fungal cell.
Cell destruction is accomplished by two main pathways, oxidation of amino acids
and breakdown of cell wall fatty acids. O
3
fumigation is also able to reduce spore
germination and mycotoxin biosynthesis. This reduction is linked to the modifica-
tion of mycotoxins structures by reaction of the functional groups with ozone
(Afsah-Hejri et al. 2020). In wheat, the application of O
3
reduced DON by up to
29% (Piemontese et al. 2018). Ammonia is also a process used in the detoxification
of mycotoxins, and ammonia is capable of completely decomposing OTA, however,
this process causes remarkable changes in the quality of the treated materials, in
particular, color changes and a decrease in nutritional value (Omotayo et al. 2019).
Chemical agents such as acids (sulfuric acid, hydrochloric acid, phosphoric acid, and
acetic acid), salts (sodium chloride and sodium sulfate), and alkaline compounds
(sodium bicarbonate) have an excellent aflatoxin and ochratoxin reduction potential
(Jalili et al. 2010). Lactic acid is very effective in the degradation of AFB1. Even if
the degradation is not complete, a decomposition of 85% is obtained at 80 C during
a treatment of 120 min. The decomposition reaction generates two by-products that
are characterized by a very reduced cytotoxicity on HeLa cells line (Aiko et al.
2016).
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 385
18.4.3 Physical Methods
Among the most applied physical methods, the sorting of cereal grains is a very
effective process in the detoxification of mycotoxins; in maize grains, this process
can eliminate <6% of aflatoxin B1 and <5% of fumonisin B1 (Matumba et al.
2015). The reduction is strongly due to the elimination of inferior raw material.
Mechanical dehulling methods of maize have the capacity to reduce more than 50%
of FBs (Fandohan et al. 2006). In addition to these techniques, grain washing is a
process capable of removing water-soluble mycotoxins (Wan et al. 2020). Irradiation
techniques also have their place in grain detoxification. Electron Beam Irradiation
(EBI) is a non-thermal method of cereal decontamination. It has less harmful effects
on the environment and the nutritional value of detoxified food materials (Mousavi
Khaneghah et al. 2020), in contrast, EBI reduces the germination rate of treated
barley grains (Kottapalli et al. 2006). Gamma-rays also have a strong ability to
destroy ochratoxin A, aflatoxin B
1
,aflatoxin B
2
,aflatoxin G
1
, and aflatoxin G
2
(Di Stefano et al. 2014).
18.5 Nanomaterials as Mycotoxin Detoxification Tools
in Cereals
Nowadays, the elimination and detoxification of mycotoxins have become a chal-
lenge for the food industry. Indeed, a large number of control and prevention
strategies are applied. Despite the success recorded for conventional methods of
detoxification in its early stages, the limitations noted and the requirements
demanded proved the failure of these methods. These methods suffer from
disadvantages, such as the generation of toxic residues for humans and the environ-
ment. Moreover the biological methods require selection and a long period of growth
without neglecting the high cost during their applications. The inability of conven-
tional methods to remove mycotoxins has prompted research to innovate more
potent techniques capable of destroying toxigenic fungal cells and/or blocking
their mycotoxin biosynthetic pathways. In recent years, several studies have reported
the advantage of NMs in the detoxification of mycotoxins; several types of NMs
have been the subject of a fungicide capable of inhibiting toxigenic molds and/or
their toxin. In this part of the chapter, several types of nanomaterials are reported.
386 M. A. Gacem and K. A. Abd-Elsalam
18.5.1 Detoxification by Targeting Mycotoxinogenic Molds
or Adsorption of Mycotoxins
The treatment of corn with zinc oxide nanoparticles (ZnO-NPs) under the experi-
mental conditions, described by Hernández-Meléndez and his team in 2018,
demonstrated that at 100 μg/g of ZnO-NPs, significant inhibition of the growth of
A. flavus and mycotoxin synthesis are recorded. The untreated grains presented a
fungal invasion of 67%; on the other hand, the treated grains presented a moderate
fungal invasion (30%). Aflatoxin production in control and treated grains was 45 ng/
g and 14 ng/g, respectively (Hernández-Meléndez et al. 2018). In a more recent
study, the antiaflatoxinogenic efficacy of ZnO-NPs was 93.80% in stored maize
grains, and this result is recorded in the presence of 1.13 μg/kg of AFB
1
(Yousif et al.
2019). Similar results were observed with 100 μg/mL of ZnO-NPs,. More than
threefold reduction (12 ng/L of AFB
1
) is observed on treated samples compared to
controls (46 ng/L) (Nabawy et al. 2014). It should be noted that the reducing agents
used in the synthesis of ZnO-NPS play a very important role in the efficiency of NPs.
The ZnNPs derived from the reducing agent NaOH exert a large antifungal potential
and high efficiency in DNA disintegration of maize fungal pathogens (Kalia et al.
2021). In a liquid culture medium, ZnO-NPs prepared from Syzygium aromaticum
demonstrated their efficacy in the regression of DON and ZEA of F. graminearum
(Lakshmeesha et al. 2019). Anti-aflatoxigenic activity is highly dependent on reac-
tive oxygen species (ROS) generation, Zn
2+
release, hyphal damage, lipid peroxida-
tion, and antioxidant response (Zhang et al. 2021b).
Silver nanoparticles (Ag-NPs) are also effective in inhibiting AFB
1
synthesis;
Ag-NPs can gain access inside the fungal cell and alter genes responsible for
mycotoxin biosynthesis. Deabes and his team confirmed this principle that Real
Time-polymerase chain reaction (qRT-PCR) proved that Ag-NPs alter O-
methyltransferase gene (omt-A) in the gene cluster responsible for the biosynthesis
of AFB
1
(Deabes et al. 2018). Damage to genes responsible for mycotoxin biosyn-
thetic pathways leads to downregulation or complete blockage of mycotoxin
synthesis.
Copper trace elements are essential in cereal crops. Cu deficiency may be the
cause of higher Fusarium incidence in wheat. The treatment of wheat kernel with
powdered CuO-NPs prepared as a superabsorbent polymer demonstrated that at a
dose of 200 g/ha Cu, the NPs are able to imbibe water and slowly release nutrients.
This result suggests that the Cu uptake capacity of the plants has improved.
CuO-NPs improve the fat, crude fiber and cellulose content of wheat grain. Note
that an absence of DON was recorded on the samples treated with CuO-NPs
(Kolackova et al. 2021). In another study, the ion-exchanged zeolites with Li
+
and
Cu
2+
demonstrated an excellent antifungal effect against A. flavus and inhibition
capacity of AFB
1
(Savi et al. 2017). However, the use of CuO-NPs can be toxic to
agricultural crops; Rajput et al. demonstrated that the application of CuO-NPs cause
toxicity in barley (Hordeum sativum distichum). Harmfulness is characterized by the
formation of electron-dense materials in the intercellular space of cells and a
reduction in root length (Rajput et al. 2018).
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 387
Some polymers are also considered as fungicides, chitosan is among the most
studied polymers, and this compound has very good antifungal and
antimycotoxinogenic activity. When applied alone, chitosan nanoparticles with an
average size of 3.00 0.70 nm are able to inhibit AFB
1
. Chitosan is able to adsorb
AFB
1
by interacting positive charges of the amino group with the negative charges
of the oxygen atoms of the aflatoxins (Cortés-Higareda et al. 2019). Chitosan also
has the ability to incorporate metallic NPs and other fungicides, and the resulting
NMs have an excellent antifungal and antimycotoxigenic potential. Copper-chitosan
nanocomposite-based chitosan hydrogels (Cu-Chit/NCs hydrogel) prepared using a
metal vapor synthesis exhibits an excellent antifungal activity against A. flavus
associated with peanut meal and cotton seeds. The activity depends on the fungal
strain and the concentration of NPs (Abd-Elsalam et al. 2020). Application of these
NPs at different concentrations in maize grains (under laboratory conditions and
incubated at 28 C for 28 days) inhibited F. graminearum growth and DON and
ZEA synthesis. The encapsulation of the essential oil in NPs gives it an excellent
stabilization by increasing the lifetime antifungal activity of CMEO by a gradual
release of antifungal constituents of Ce-CMEO-NPs (Kalagatur et al. 2018). In
another study, Chitosan nano-biopolymer-entrapped Coriandrum sativum essential
oil (Ce-CSEO-NPs) with a size ranging between 57 and 80 nm exerts good antifun-
gal activity against several stored rice contamination molds; complete inhibition is
recorded against A. flavus,A. niger,A. fumigatus,A. sydowii,A. repens,
A. versicolor,A. luchuensis,Alternaria alternata,Penicillium italicum,
P. chrysogenum,P. spinulosum,Cladosporium herbarum,F. poae, and
F. oxysporum Chitosan nanoemulsion showing insignificant inhibition of AFB
1
secretion (13.06%) (Das et al. 2019). Other essential oil encapsulates in Ce-NPs
have also proven to be effective in inhibiting mycotoxin synthesis. Fumigation of
two samples of maize (150 g) with 1.0 and 2.0 μL/mL of Origanum majorana
essential oil encapsulated into chitosan nanoemulsion (Ce-OmEO-NPs) and
inoculated with 10
6
spores/mL of A. flavus demonstrated relevant results. A total
absence of AFB
1
is recorded in the two maize samples after a storage period of
6 months, however, the controls recorded contamination of approximately 26.17 and
25.37 μg/kg (Chaudhari et al. 2020). Propolis, known for its medicinal properties,
can also be incorporated into chitosan. The application of coatings based on chitosan
and propolis on figs under semi-commercial conditions have shown encouraging
results. After 12–15 days of storage of figs infected with spores of A. flavus and
treated with NPs, a decrease in aflatoxin synthesis of <20 ppb is obtained compared
to the control which recorded a level of 250 ppb. The sensory quality was acceptable,
however, the antioxidant activity increased (Aparicio-García et al. 2021).
Carbon-based nanostructures have impressive advantages in the fight against
mycotoxins. Graphene oxide GeO is among one of these promising materials, and
it has excellent adsorption property. In vitro, tests have demonstrated that GeO
(10 μg/mL) is capable of adsorbing AFB
1
, ZEA, and DON. The maximal removal
efficiency was attained at 65% for 25 ng/g DON and 90% for 6 and 0.5 ng/g of ZEA
and AFB
1
, respectively. The adsorption capacity of GeO was 1.69 mg/g, 0.53 mg/g,
0.045 mg/g for DON, ZEA, and AFB1, respectively (Horky et al. 2020). Reduced
graphene oxide-gold nanoparticle (rGO-AuNP) also exhibits good capacity and
selectivity in the adsorption of AFB
1
, AFB
2
, AFG
1
, AFG
2
, AFM
1
and AFM
2
from
wheat and maize samples. The recovery of mycotoxins is related to the concentration
of the nanocomposite, and it increased from 48.5% to 106.6% when the quantity of
rGO-AuNPs increased from 5 to 15 mg. However, a decrease in recoveries is
recorded above 15 mg of rGO-AuNPs (Guo et al. 2017).
388 M. A. Gacem and K. A. Abd-Elsalam
The application of magnetic nanomaterials in the removal of mycotoxins in food
matrices could be attractive. These types of NMs have good adsorption and separa-
tion ability due to magnetic susceptibility (Targuma et al. 2021), and are used in the
detection of mycotoxins in food samples, suggesting their ability in the removal of
mycotoxins. Iron oxide carbon nanocomposites prepared from bagasse with a size
range of 60–300 nm have an excellent capacity in adsorbing AFB
1
, of 200 ppm, and
the equilibrium time was 115 min and 150 min at pH 3 and pH 7, respectively.
According to the researchers, the prepared adsorbent can be used as an alternative to
activated carbon to detoxify poultry feed (Muhammad and Khan 2018). Magnetic
carbon nanocomposites prepared from maize wastes have good capacity in the
removal of AFB
1
. Nearly 90% removal of AFB
1
was achieved, the equilibrium
time depending on pH is 96 min and 180 min at pH 7 and pH 3, respectively (Zahoor
and Khan 2016). In another study performed on oil system with an initial concentra-
tion (0.2 μg/mL) of AFB1, magnetic mesoporous silica prepared from rice husk is
able to adsorb 94.59% of mycotoxin (Li et al. 2020b). Magnetic nano-zeolite
(MZNC) can adsorb mycotoxins better than the natural zeolite. 50 mg of the
nanocomposite removed >99% of Afs, 50% of OTA, 22% of ZEA, and 1.8% of
the DON from the contaminated sample (Karami-Osboo et al. 2020).
18.5.2 Detoxification of Mycotoxins by Photocatalysis
The photocatalytic nature of NMs enabled these materials to be involved in the
degradation of mycotoxins. The process of mycotoxin degradation by photocatalytic
reactions is very encouraging, this process is characterized by its low cost and
respect for the environment. The process of photocatalysis involves a chemical
reaction after absorption of photons, and the reaction is based on the process of
generating pairs of electrons (e
2
) and holes (h
+
) in the NM (photocatalyst) exposed
to light. The electrons and the holes formed lead to reduction and oxidation reactions
of the molecules adsorbed on the surface of the NMs. Along with this process, it is
observed that during photocatalytic degradation, other reactive oxygen species
(ROS) can also form, it is superoxide (O
2
•
), hydroxyl radical (OH
•
), and hydrogen
peroxide (H
2
O
2
) (Murugesan et al. 2021). Formation of ROS species is shown in
Fig. 18.3.
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 389
Fig. 18.3 Formation of ROS Species
He developed a very effective nanomaterial, it is composed of titanium dioxide
(TiO
2
) doped with cerium (Ce) (Ce-TiO
2
). Under ultraviolet irradiation (λ= 254
nm), Ce-TiO
2
nanomaterials improve the photocatalytic activity for DON in aqueous
solution (λ¼254 nm). Different levels of Ce doping on pure TiO
2
demonstrated
different Ce-TiO
2
photocatalytic degradation effects. The degradation rate can reach
96% using 0.5Ce-TiO
2
after 240 min. The exploration of the main ROS active in the
process of DON degradation indicates that the hole plays a crucial role in the
photocatalytic reaction than OH
•
. Moreover, the small CeO
2
particles produced on
the TiO
2
particles caused by Ce doping play a co-catalytic effect on DON degrada-
tion following the generation O
2
•
. The two possible degradation intermediate
products are C
5
H
8
O
3
and C
17
H
18
O
6
(He et al. 2021). A Schematic illustration of
DON degradation under ultraviolet irradiation is shown in Fig. 18.4a. The degrada-
tion of DON in an aqueous solution by the photocatalytic activities of the dendritic-
like α-Fe
2
O
3
under visible light irradiation (λ>420 nm) demonstrated that
dendritic-like α-Fe
2
O
3
could adsorb more DON than that in commercial α-Fe
2
O
3
.
The degradation rate is estimated at 90.3% in 2 h at an initial concentration of 4.0 μg/
mL of DON. During the photoreaction over α-Fe
2
O
3
, the morphology of the
dendritic-like α-Fe
2
O
3
absorbs more sunlight and provides more electrons and the
holes. These lead to the formation of active radicals such as O
2
•
and OH
•
, which
could react with the active site of DON and form two intermediate products (Wang
et al. 2019). In another study, three degradation products were identified, namely
C
15
H
20
O
8
,C
15
H
20
O
7
, and C
15
H
20
O
5
, under simulated sunlight using UCNP@TiO
2
(6 mg/mL). OH
•
,h
+
and O
2
•
are the main ROS produced in the photocatalytic
reaction. The application of UCNP@TiO
2
in the reduction of DON in wheat
demonstrated a decrease in the detoxification compared to that of standard DON.
It may be due to the combination of mycotoxin with starch, protein, and other
macromolecules of wheat. On the other hand, the light cannot be evenly diffused
on the contaminated wheat, which also affects the degradation efficiency (Wu et al.
2020b). The principle and process of photocatalysis reaction between UCNP@TiO
2
390 M. A. Gacem and K. A. Abd-Elsalam
Fig. 18.4 (a) Schematic illustration for the charge separation and transfer of Ce-TiO
2
in the
process of DON degradation under UV light irradiation (Reprinted from He P, Zhao Z, Tan Y,
E H, Zuo M, Wang J, Yang J, Cui S, Yang X (2021) Photocatalytic degradation of deoxynivalenol
using cerium doped titanium dioxide under ultraviolet light irradiation. Toxins 13: 481. Open
and DON are described in Fig. 18.4b. Additionally, the photocatalytic degradation of
DON using graphene/ZnO hybrids in aqueous suspension is described in Fig. 18.4c.
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 391
A recent study investigated the photocatalytic activity of ZnO-NPs in the degra-
dation of AFB
1
in an aqueous solution under UV light. Complete removal of AFB
1
(10 μg/L) by 0.10 mg/mL of NPs has been recorded after 60 min under UV
irradiation. Application of NP in soymilk (5 mg ZnO-NPs to 50 mL soymilk with
10 μg/L of AFB
1
) completely removed AFB
1
(91.53%) after 60 min under UV
irradiation with no significant effect on its overall acceptability, which suggests its
application in liquid foodstuffs (Raesi et al. 2022). Similarly, the study of the effect
of ZnO-NPs on fumonisin accumulation by F. proliferatum both in vitro and in situ
demonstrated a significative result. With ZnO-NPs concentrations of 0.8 and 8 g/L at
25 C, 21 days, and under darkness or photoperiod incubation, a high reduction
(84–98%) occurred after 14 days under photoperiodic incubation. Under the in-situ
assay, the evaluation of the effect of ZnO-NPs on FB
1
,FB
2
, and FB
3
rates on
irradiated maize grains (adjusted to 0.995, 0.98, and 0.97 aW) in darkness at
25 C during 21 days demonstrated a reduction of FBs rates. At 0.8–2 g/kg and
0.98–0.995 aW, ZnO-NPs reduce total FBs accumulation by 71–99%, suggesting
that ZnO-NPs could be applied in maize grains to control phytopathogenic and
toxigenic fungi such as F. proliferatum and to reduce fumonisins accumulation
(Pena et al. 2022). The photocatalytic graphitic carbon nitride (g-C
3
N
4
) could induce
photocatalytic effect on ZEA UV lamp (λ¼254 nm). Under experimental
conditions, g-C3N4 degrades at a rate of 50% of ZEA in real powder samples
(Li et al. 2021b). Patulin degradation in an aqueous solution is also possible by
nitrogen-doped chitosan-TiO
2
nanocomposite under UV; 500 μg/kg was completely
degraded within 35 min. This improved degradation compared to TiO
2
nanoparticles
and chitosan-TiO
2
nanocomposite is linked to the reduction of the average particle
size of TiO
2
nanoparticles due to: (1) the introduction of nitrogen and chitosan, the
structure obtained facilitates the movement of
efrom the structure to the surface,
thereby reducing the probability of recombination with holes; (2) the introduction of
nitrogen and chitosan increase the surface of the nanocomposite which is beneficial
to the adsorption of toxin; (3) the introduction of nitrogen and chitosan improved the
photoresponse ability of TiO
2
nanoparticles and enhanced its photocatalytic activity
(Huang and Peng 2021). Activated carbon-supported TiO
2
catalyst (AC/TiO
2
) has
an excellent efficiency for degradation of AFB
1
under UV–Vis light in comparison
⁄
Fig. 18.4 (continued) Access journal). (b) Principle and process of photocatalytic degradation of
DON using NaYF
4
:Yb, Tm@TiO
2
nanoparticles (Reprinted from Wu S, Wang F, Li Q, Wang J,
Zhou Y, Duan N, Niazi S, Wang Z (2020) Photocatalysis and degradation products identification of
deoxynivalenol in wheat using upconversion nanoparticles@TiO2 composite. Food Chem 323:
126823). (c) Schematic drawing illustrating synthetic route and the mechanism of charge separation
and adsorption-photocatalytic process over graphene/ZnO hybrid photocatalysts under UV light
irradiation (Reprinted from Bai X, Sun C, Liu D, Luo X, Li D, Wang J, Wang N, Chang X, Zong R,
Zhu Y (2017) Photocatalytic degradation of deoxynivalenol using graphene/ZnO hybrids in
aqueous suspension. Appl Catal B 204: 11–20)
with TiO
2
.OH
•
and h
+
play an important role in the degradation of AFB1 (Sun et al.
2019). Magnetic graphene oxide/TiO
2
nanocomposite (MGeO/TiO
2
) is able to
reduce AFB
1
in corn oil, and the quality of the nanocomposite-treated oil was
acceptable after 180 days of storage (Sun et al. 2021). Table 18.3 demonstrates the
efficiency of nanomaterials in the elimination of mycoroxins in food.
392 M. A. Gacem and K. A. Abd-Elsalam
18.6 Factors Affecting Mycotoxin Detoxification by NMs
18.6.1 Effect of Temperature
Temperature plays an essential role in the adsorption and photocatalytic reactions of
mycotoxin detoxification. In most of the cases studied, the rate of elimination of
mycotoxins increases with the rise in temperature, suggesting that this factor
contributes to the photocatalytic degradation of mycotoxins by enhancing the
adsorption and activity of free radicals by increasing their interactions with
mycotoxins (Huang and Peng 2021), AFB
1
removal by magnetic graphene increased
from 81.60% to 95.64% with an increase in temperature from 25 to 60 C (Ji and Xie
2020). However, in the case of magnetic mesoporous silica, a higher temperature can
have a significant effect on the specific surface area and adsorption of AFB
1
.A
temperature greater than or equal to 100 C affects the formation of micelles and
increases the degree of aggregation of silicates, consequently a decrease in the
specific surface and the opening rate of magnetic mesoporous silica (Li et al. 2020b).
18.6.2 Effect of the Nature of the NMs and Their Quantity
The efficiency of mycotoxin elimination by NMs strongly depends on the type of
NM and its nature. This difference in elimination resides in the difference between
the binding patterns established between the NM and the mycotoxin. In addition, in
Raesi’s study, ZnO-NPs demonstrated better AFB
1
removal compared to other
metallic NPs (Fe
2
O
3
, MnO
2
and CuO). High generation of free radicals due to the
higher band gap energy of ZnO-NPs is the reason why these NPs have better
photocatalytic activity. However, the low adsorption of mycotoxins could be highly
reversible and, therefore, a reduction in elimination (Raesi et al. 2022). It is also
reported that ZnO contains a higher photocatalytic activity than TiO
2
due to its high
capacity for generating electrons and holes compared to TiO
2
(Štrbac et al. 2018).
For a better detoxification of mycotoxins, the quantity of NM must be adjusted in an
optimal way; to not waste the NMs and to establish a maximum adsorption, as
demonstrated in the Karami-Osboo study, the percentage of mycotoxins’recovery is
no longer perceptible when the quantity of magnetic zeolite nanocomposite exceeds
50 mg (100 and 150 mg) (Karami-Osboo et al. 2020), similar results are observed in
Raesi’s study. An increase in the concentration of ZnO-NPs beyond 10 mg/mL does
not lead to a significant change in the degradation of AFB
1
(Raesi et al. 2022).
During the photocatalysis of mycotoxins, the increase in the quantity of the
/99
(continued)
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 393
Table 18.3 The effectiveness of some nanomaterials in the elimination of mycotoxins in food
Mycotoxin Nanomaterial Synthesis method
Percentage
of
elimination
Removal
time
Sample
matrix
Detoxification
mechanism References
DON Ce-TiO
2
Sol-gel method. 96 4 h Aqueous
solution
Ultraviolet
light irradiation
He et al.
(2021)
AFB
1
Magnetic graphene oxide/TiO
2
(MGO/TiO
2
) nanocomposite
Hydrothermal
synthesis
96.4 120 min Corn oil Ultraviolet
light irradiation
Sun et al.
(2021)
Patulin
(PAT)
Aerogel doped by sulfur-
functionalized graphene oxide
/ 89 9 h Apple
juice
Adsorption Liu et al.
(2021)
PAT Triethylene tetramine-modified water-
insoluble corn flour caged in magnetic
chitosan resin (TETA-WICF/MCR)
/ 92.86 / Apple
juice
Adsorption Guo et al.
(2020)
Afs
OTA
ZEA
DON
Magnetic zeolite nanocomposite
(MZNC) 50
22
1.8
/ Barley
flour
Adsorption Karami-
Osboo
et al.
(2020)
AFB
1
Magnetic mesoporous silica (MMS) Heat treatment 94.59 2 h Oil system Adsorption Li et al.
(2020b)
DON Upconversion nanoparticles@TiO
2
/ 74.15% o 30 min Aqueous
solution
NIR light Zhou et al.
(2020)
Ustiloxin
A
Wormlike graphitic carbon nitride
(g-C
3
N
4
)
Pyrolysis method 86.1 80 min Aqueous
suspension
Visible light
irradiation
Wu et al.
(2020a)
AFB
1
CdS/WO
3
Hydrothermal method / 100 min Aqueous
solution
Visible light
irradiation
Mao et al.
(2019)
AFB
1
AC/TiO
2
Hydrothermal method 90 30 min Aqueous
solution
Mercury lamp Sun et al.
(2019)
Table 18.3 (continued)
Mycotoxin Nanomaterial Synthesis method
Percentage
of
elimination
Removal
time
Sample
matrix
Detoxification
mechanism References
DON Dendritic-like α-Fe
2
O
3
Hydrothermal method 90.3 2 h Aqueous
solution
Visible light
irradiation
Wang et al.
(2019)
PAT Magnetic multi-walled carbon
nanotube (MWCNT)
/ 88.2 60 min Aqueous
solution
Adsorption Zhang et al.
(2019)
AFB
1
AFB
1
TiO
2
immobilized on a glass support / 99.4
99.2
4 min Peanut oil UV and visible
irradiation
Magzoub
et al.
(2019)
PAT UiO-66(NH
2
)@Au-Cys Heat treatment 87 70 min Apple
juice
Liu et al.
(2019)
DON Upconversion nanoparticles@TiO
2
High-temperature
thermal
decomposition
method
72.8 90 min Wheat Xe lamp
(200–2500 nm)
Wu et al.
(2019)
AFB
1
ZnO-NP / 93.80
96.42
Stored
maize
Sea maize
grain
Yousif
et al.
(2019)
AFB
1
Photocatalytic reactor consisting of a
glass tube coated with TiO
/ 60.41 / Peanut oil UV light Xu et al.
(2019b)
AFB
1
Nanosized g-C
3
N
4
sheets Heat treatment ~70.2% t ~20 min Aqueous
suspension
Visible light
irradiation
Mao et al.
(2018a)
AFB
1
Flower-shaped zinc oxide (ZnO)
nanostructures
1 month Maize
394 M. A. Gacem and K. A. Abd-Elsalam
Simple aqueous
precipitation strategy
at room temperature
Yousif
et al.
(2019)
AFB
1
WO
3
/RGO/g-C
3
N
4
Hydrothermal method
and photocatalytic
reduction
92.4 120 min Aqueous
solution
Visible light
irradiation
Mao et al.
(2018b)
DON Graphene/ZnO hybrid Hydrothermal method 99 30 min Aqueous
suspension
Irradiation of
UV light
Bai et al.
(2017)
DON
ZEA
HT-2
T-2
FB1 and
FB2
Magnetic graphene oxide
nanocomposites
/ 69.57
67.28
57.40
37.17
5.2 h Palm
kernel
cake
Adsorption Pirouz
et al.
(2017)
AFB
1
Sc-doped SrTi
0.7
Fe
0.3
O
3
Complex precursor
route
88.2 2 h Water Visible light Jamil et al.
(2017)
PAT Magnetic Fe
3
O
4
@CTS nanoparticles
were coated with inactivated C. utilis
CICC1769 cells
/ 91.5 15 h Orange
juice
Absorption Ge et al.
(2017)
PAT Chitosan-coated Fe
3
O
4
particles / 99.95 60 min Fruit juice Absorption Luo et al.
(2017)
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 395
photocatalyst (NMs) leads to a continuous elimination of patulin, however, an
excessive concentration of NM results in agglomeration and a dispersion or decrease
of incident light and, therefore a reduction in the rate of mycotoxin elimination
(Huang and Peng 2021). In addition, the accumulation of metal oxide NPs can give
rise to particles of microscopic size and cause a decrease in elimination (Raesi et al.
2022).
396 M. A. Gacem and K. A. Abd-Elsalam
18.6.3 Effect of UV Irradiation
UV light plays a very important role in the detoxification of mycotoxins as this light
participates in the formation of ROS, such as hydroxyl (OH
•
) and superoxide (O
2
•
)
radicals, and therefore, mycotoxin degradation occurs through reactions with ROS
(Raesi et al. 2022). Moreover, during photocatalysis, an increase in the power of UV
light increases the degradation of mycotoxins. This phenomenon is attributed to the
nature of nanocomposites which require more energy in order to increase the
generation of photogenic electrons and holes (Huang and Peng 2021).
18.6.4 Effect of Initial Mycotoxin Concentration
Knowledge of the concentration of mycotoxins in the samples to be detoxified is one
of the key success factors for detoxification. As demonstrated in Raesi’s study,
detoxification efficiency decreases with increasing AFB
1
concentration. 100% and
87.72% of rate elimination are recorded at initial concentrations of 10 and 30 μg/L of
AFB
1
, respectively (Raesi et al. 2022). The correlation between mycotoxin concen-
tration and photocatalytic performance of NMs is related to the adsorption of
mycotoxins on the surface, i.e., the decrease in detoxification may be due to a
confined vacant amount of superficial active sites for adsorption and/or reaction
with toxins. Moreover, increasing the concentration of mycotoxins can lead to the
formation of organic intermediates, as these compounds can defy the adsorption of
active sites (Jamil et al. 2017). During the elimination of AFB
1
by magnetic
graphene and magnetic graphene oxide, an increase in the concentration of the
mycotoxin in the reaction medium leads to the saturation of surfaces of the adsorbent
by the occupation of the available active sites, and this leads to a decrease in the
elimination efficiency of AFB
1
(Ji and Xie 2020).
18.6.5 Effect of pH
The pH of the reaction medium affects several parameters, such as the nature of the
mycotoxins, the localized charges on the surface of the NMs, and the aggregation of
the NMs. Upon detoxification of AFB
1
by Sc-doped SrTi
0.7
Fe
0.3
O
3
in the visible
light, the continuous increase in pH also increases the rate of toxin reduction; during
this reaction, the maximum reduction is obtained at pH 9. Beyond this pH, a
progressive decrease in detoxification is noticed. The reduction in detoxification rate
is explained by the impact of pH on (1) the charge of NM surfaces, as negative
charges on the surface of NMs cause electrostatic repulsion and decrease adsorption,
(2) the rate of adsorption of mycotoxins on the NMs, (3) the generation of ROS. It
should also be noted that the weak detoxification in the acid medium is due to the
strong adsorption of mycotoxins on the NMs. The accumulation of mycotoxins on
the NMs prevents the photoexcitation of the particles by decreasing the access of
visible light to reach the surface of the catalyst (Jamil et al. 2017). In the study by Li
et al., magnetic mesoporous silicas are significantly influenced by changes in
pH. The latter affects the polymerization of the silicate, which has an impact on
the structure of the NMs channel. At pH 11, the unit adsorption capacity and
adsorption rate of AFB
1
were maximal (Li et al. 2020b).
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 397
18.6.6 Effect of Reaction Time
The effects of the reaction time during the preparation of the NMs considerably
influence the structure of the NMs as well as their ability to adsorb mycotoxins. The
preparation of the magnetic zeolite nanocomposite demonstrated that a preparation
time of 24 h was the optimal duration for maximum adoption of AFB
1
. The increase
in time increases the specific surface, the unit adsorption capacity, and the adsorption
rate of AFB1. In addition, the increase in duration improves the stability of NMs and
leads to an increase in adsorption stability (Li et al. 2020a,b). Additionally, adjusting
time during detoxification reactions enhances mycotoxin removal. As demonstrated
by Ji and Xie when removing AFB
1
in oil, the increase in the contact time allows the
superficial sites of the NMs (Magnetic graphene) to be occupied by the toxins and
thereafter, the adsorption becomes progressively slower until saturation (Ji and Xie
2020).
18.7 Conclusion
The contamination of cereals by mycotoxins has become a worldwide concern, and
the deterioration has caused inestimable economic losses without neglecting
the toxicity caused to human and animal health. The alteration is not limited only
to the raw materials but spread through food processing chains. Food scarcity is one
of the major challenges the world is expected to face in the near future due to climate
change, environmental pollution, and population explosion. Faced with these
problems, the main objective of food processing industries is the development of
better food processing, preservation, and storage techniques in order to provide safe
and high-quality food. These challenges have driven researchers and research to
develop effective, healthy, and less expensive technologies capable of destroying
these contaminants and their origins. Despite the high costs incurred and the
numerous research and scientific publications affirming the success of conventional
approaches, these techniques suffer from several drawbacks, in particular, the
generation of toxic residues in foodstuffs, the reduction in the nutritional value of
foodstuff, the impossibility of reducing mycotoxins completely or to acceptable
levels, and being disrespectful to the environment. Other classic techniques are
encouraging, but they only apply to model systems and depend on consumer
confidence and opinion.
398 M. A. Gacem and K. A. Abd-Elsalam
This marked failure of conventional techniques has pushed researchers towards
new, very modern strategies. The new strategies innovated by science are based on
the different structured NMs. Nanoparticles could constitute a new antifungal
ingredient likely to be added in the agri-food sector for the control of toxigenic
fungi and their main associated mycotoxins. Therefore, nanobiotechnology is an
opportunity capable of overcoming the problem and helping to provide high quality,
stable, nutritious, and safe food products. In addition to removing mycotoxins,
nanotechnology can ensure a sustainable future by providing crops with better
growth, nano-fertilizers and nano-pesticides, and improved crop yield.
Currently, the main concerns of food and nutrition scientists and regulatory and
control agencies are the advantages and disadvantages of NMs for the consumer and
his health because there is little information on the absorption, distribution, metabo-
lism, and excretion after oral administration of NMs. It is also essential to test the
toxicity of NMs on human health and the risks related to their exposure, and to test
the toxicity of NMs on the environment. This requires more effort and investment to
achieve the commercialization of cereals treated with nanomaterials.
References
Abd-Elsalam KA, Alghuthaymi MA, Shami A, Rubina MS, Abramchuk SS, Shtykova EV, Yu
Vasil’kov A (2020) Copper-chitosan nanocomposite hydrogels against aflatoxigenic Aspergil-
lus flavus from dairy cattle feed. J Fungi 6:112
AbuZahra HM, Rajendran P, Ismail MB (2021) Zerumbone exhibit protective effect against
zearalenone induced toxicity via ameliorating inflammation and oxidative stress induced apo-
ptosis. Antioxidants 10:1593
Afsah-Hejri L, Hajeb P, Ehsani RJ (2020) Application of ozone for degradation of mycotoxins
in food: a review. Compr Rev Food Sci Food Saf 19:1777–1808
Aiko V, Edamana P, Mehta A (2016) Decomposition and detoxification of aflatoxin B
1
by lactic
acid. J Sci Food Agric 96:1959–1966
Akao M, Kuroda K, Wogan GN (1971) Aflatoxin B1: the kidney as a site of action in the mouse.
Life Sci II 10:495–501
Akello J, Ortega-Beltran A, Katati B, Atehnkeng J, Augusto J, Mwila CM, Mahuku G, Chikoye D,
Bandyopadhyay R (2021) Prevalence of aflatoxin- and fumonisin-producing fungi associated
with cereal crops grown in Zimbabwe and their associated risks in a climate change scenario.
Foods 10:287
An Y, Shi X, Tang X, Wang Y, Shen F, Zhang Q, Wang C, Jiang M, Liu M, Yu L (2017) Aflatoxin
B1 induces reactive oxygen species-mediated autophagy and extracellular trap formation in
macrophages. Front Cell Infect Microbiol 7:53
Aparicio-García PF, Ventura-Aguilar RI, Del Río-García JC, Hernández-López M, Guillén-
Sánchez D, Salazar-Piña DA, Ramos-García ML, Bautista-Baños S (2021) Edible chitosan/
propolis coatings and their effect on ripening, development of Aspergillus flavus, and sensory
quality in fig fruit, during controlled storage. Plants 10:112
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 399
Bai X, Sun C, Liu D, Luo X, Li D, Wang J, Wang N, Chang X, Zong R, Zhu Y (2017)
Photocatalytic degradation of deoxynivalenol using graphene/ZnO hybrids in aqueous suspen-
sion. Appl Catal B 204:11–20
Bárta I, AdámkováM, Markarjan D, Adzigitov F, Prokes K (1984) The mutagenic activity of
aflatoxin B
1
in the Cricetulus griseus hamster and Macaca mulatta monkey. J Hyg Epidemiol
Microbiol Immunol 28:149–159
Bennett JW, Klich M (2003) Mycotoxins. Clin Microbiol Rev 16:497–516
Besaratinia A, Kim SI, Hainaut P, Pfeifer GP (2009) In vitro recapitulating of TP53 mutagenesis in
hepatocellular carcinoma associated with dietary aflatoxin B1 exposure. Gastroenterology 137:
1127–1137
Bhatti SA, Khan MZ, Hassan ZU, Saleemi MK, Khatoon A, Abidin ZU, Hameed MR (2018)
Dietary L-carnitine and vitamin-E; a strategy to combat ochratoxin-A induced immunosuppres-
sion. Toxicon 153:62–71
Boukaew S, Prasertsan P (2020) Efficacy of volatile compounds from Streptomyces philanthi RL-1-
178 as a biofumigant for controlling growth and aflatoxin production of the two aflatoxin-
producing fungi on stored soybean seeds. J Appl Microbiol 129:652–664
Brzonkalik K, Hümmer D, Syldatk C, Neumann A (2012) Influence of pH and carbon to nitrogen
ratio on mycotoxin production by Alternaria alternata in submerged cultivation. AMB Express
2:28
Caceres I, Khoury AA, Khoury RE, Lorber S, Oswald IP, Khoury AE, Atoui A, Puel O, Bailly JD
(2020) Aflatoxin biosynthesis and genetic regulation: a review. Toxins 12:150
Castañares E, Pavicich MA, Dinolfo MI, Moreyra F, Stenglein SA, Patriarca A (2020) Natural
occurrence of Alternaria mycotoxins in malting barley grains in the main producing region of
Argentina. J Sci Food Agric 100:1004–1011
Chaudhari AK, Singh VK, Das S, Deepika, Prasad J, Dwivedy AK, Dubey NK (2020) Improve-
ment of in vitro and in situ antifungal, AFB
1
inhibitory and antioxidant activity of Origanum
majorana L. essential oil through nanoemulsion and recommending as novel food preservative.
Food Chem Toxicol 143:111536
Cole MB, Augustin MA, Robertson MJ, Manners JM (2018) The science of food security. NPJ Sci
Food 2:14
Cortés-Higareda M, Ramos-García ML, Correa-Pacheco ZN, Río-García JCD, Bautista-Baños S
(2019) Nanostructured chitosan/propolis formulations: characterization and effect on the growth
of Aspergillus flavus and production of aflatoxins. Heliyon 5:01776
Cui G, Li L, Xu W, Wang M, Jiao D, Yao B, Xu K, Chen Y, Yang S, Long M, Li P, Guo Y (2020)
Astaxanthin protects ochratoxin A-induced oxidative stress and apoptosis in the heart via the
Nrf2 pathway. Oxidative Med Cell Longev 2020:7639109
Daou R, Joubrane K, Khabbaz LR, Maroun RG, Ismail A, El Khoury A (2021) Aflatoxin B1 and
ochratoxin A in imported and Lebanese wheat and -products. Food Addit Contam Part B
Surveill 14:227–235
Das S, Singh VK, Dwivedy AK, Chaudhari AK, Upadhyay N, Singh P, Sharma S, Dubey NK
(2019) Encapsulation in chitosan-based nanomatrix as an efficient green technology to boost the
antimicrobial, antioxidant and in situ efficacy of Coriandrum sativum essential oil. Int J Biol
Macromol 133:294–305
Deabes MM, Khalil WKB, Attallah AG, El-Desouky TA, Naguib KM (2018) Impact of silver
nanoparticles on gene expression in Aspergillus flavus producer aflatoxin B
1
. Open Access
Maced J Med Sci 6:600–605
Denli M, Blandon JC, Guynot ME, Salado S, Perez JF (2009) Effects of dietary AflaDetox on
performance, serum biochemistry, histopathological changes, and aflatoxin residues in broilers
exposed to aflatoxin B1. Poult Sci 88:1444–1451
Di Stefano V, Pitonzo R, Cicero N, D’Oca MC (2014) Mycotoxin contamination of animal
feedingstuff: detoxification by gamma-irradiation and reduction of aflatoxins and ochratoxin
A concentrations. Food Addit Contam Part A Chem Anal Control Expo Risk Assess 31:2034–
2039
400 M. A. Gacem and K. A. Abd-Elsalam
Duarte S, Magro A, Tomás J, Hilário C, Alvito P, Ferreira RB, Carvalho MO (2021) The interaction
between Tribolium castaneum and mycotoxigenic Aspergillus flavus in maize flour. Insects 12:
730
Edwards SG, Godley NP (2010) Reduction of Fusarium head blight and deoxynivalenol in wheat
with early fungicide applications of prothioconazole. Food Addit Contam Part A Chem Anal
Control Expo Risk Assess 27:629–635
Ekpakpale DO, Kraak B, Meijer M, Ayeni KI, Houbraken J, Ezekiel CN (2021) Fungal diversity
and aflatoxins in maize and rice grains and cassava-based flour (pupuru) from Ondo State,
Nigeria. J Fungi 7:635
Fan W, Lv Y, Ren S, Shao M, Shen T, Huang K, Zhou J, Yan L, Song S (2018) Zearalenone (ZEA)-
induced intestinal inflammation is mediated by the NLRP3 inflammasome. Chemosphere 190:
272–279
Fandohan P, Ahouansou R, Houssou P, Hell K, Marasas WF, Wingfield MJ (2006) Impact of
mechanical shelling and dehulling on Fusarium infection and fumonisin contamination in
maize. Food Addit Contam 23:415–421
Felizardo RJ, Câmara NO (2013) Hepatocellular carcinoma and food contamination: aflatoxins and
ochratoxin A as a great prompter. World J Gastroenterol 19:3723–3725
Gacem MA, Gacem H, Telli A, Ould El Hadj Khelil A (2020) Chapter 8 - Mycotoxins: decontami-
nation and nanocontrol methods. In: Rai M, Abd-Elsalam KA (eds) Nanomycotoxicology,
treating mycotoxins in the nano way, 1st edn. Academic, San Diego, pp 230–257
García-Díaz M, Gil-Serna J, Vázquez C, Botia MN, Patiño B (2020) A comprehensive study on the
occurrence of mycotoxins and their producing fungi during the maize production cycle in Spain.
Microorganisms 8:141
Ge N, Xu J, Li F, Peng B, Pan S (2017) Immobilization of inactivated microbial cells on magnetic
Fe
3
O
4
@CTS nanoparticles for constructing a new biosorbent for removal of patulin in fruit
juice. Food Control 82:83–90
Giorni P, Bertuzzi T, Battilani P (2019) Impact of fungi co-occurrence on mycotoxin contamination
in maize during the growing season. Front Microbiol 10:1265
Golli-Bennour EE, Kouidhi B, Bouslimi A, Abid-EssefiS, Hassen W, Bacha H (2010) Cytotoxicity
and genotoxicity induced by aflatoxin B1, ochratoxin A, and their combination in cultured Vero
cells. J Biochem Mol Toxicol 24:42–50
Gong AD, Li HP, Shen L, Zhang JB, Wu AB, He WJ, Yuan QS, He JD, Liao YC (2015) The
Shewanella algae strain YM8 produces volatiles with strong inhibition activity against Asper-
gillus pathogens and aflatoxins. Front Microbiol 6:1091
Gong AD, Wu NN, Kong XW, Zhang YM, Hu MJ, Gong SJ, Dong FY, Wang JH, Zhao ZY, Liao
YC (2019) Inhibitory effect of volatiles emitted from Alcaligenes faecalis N1-4 on Aspergillus
flavus and aflatoxins in storage. Front Microbiol 10:1419
Gündüz N, Oznurlu Y (2014) Adverse effects of aflatoxin B1 on skeletal muscle development in
broiler chickens. Br Poult Sci 55:684–692
Guo W, Wu L, Fan K, Nie D, He W, Yang J, Zhao Z, Han Z (2017) Reduced graphene oxide-gold
nanoparticle nanoframework as a highly selective separation material for aflatoxins. Sci Rep 7:
14484
Guo C, Han L, Guo M, Li M, Yu L, Yang Y (2020) Synthesis of triethylene tetramine-modified
water-insoluble corn flour caged in magnetic chitosan resin and its adsorption application for
removal of patulin from apple juice. J Food Sci 85:1371–1379
Guo Y, Zhao L, Ma Q, Ji C (2021a) Novel strategies for degradation of aflatoxins in food and feed:
a review. Food Res Int 140:109878
Guo Y, Balasubramanian B, Zhao ZH, Liu WC (2021b) Marine algal polysaccharides alleviate
aflatoxin B1-induced bursa of Fabricius injury by regulating redox and apoptotic signaling
pathway in broilers. Poult Sci 100:844–857
Hathout AS, Abel-Fattah SM, Abou-Sree YH, Fouzy ASM (2020) Incidence and exposure assess-
ment of aflatoxins and ochratoxin A in Egyptian wheat. Toxicol Rep 7:867–873
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 401
He P, Zhao Z, Tan Y, Hengchao E, Zuo M, Wang J, Yang J, Cui S, Yang X (2021) Photocatalytic
degradation of deoxynivalenol using cerium doped titanium dioxide under ultraviolet light
irradiation. Toxins 13:481
Hernández-Meléndez D, Salas-Téllez E, Zavala-Franco A, Téllez G, Méndez-Albores A, Vázquez-
Durán A (2018) Inhibitory effect of flower-shaped zinc oxide nanostructures on the growth and
aflatoxin production of a highly toxigenic strain of Aspergillus flavus link. Materials 11:1265
Horky P, Venusova E, Aulichova T, Ridoskova A, Skladanka J, Skalickova S (2020) Usability of
graphene oxide as a mycotoxin binder: in vitro study. PLoS One 15:0239479
Huang C, Peng B (2021) Photocatalytic degradation of patulin in apple juice based on nitrogen-
doped chitosan-TiO
2
nanocomposite prepared by a new approach. LWT 140:110726
Ikegwuonu FI (1983) The neurotoxicity of aflatoxin B1 in the rat. Toxicology 28:247–259
Jalili M, Jinap S, Son R (2010) The effect of chemical treatment on reduction of aflatoxins and
ochratoxin A in black and white pepper during washing. Food Addit Contam Part A Chem Anal
Control Expo Risk Assess 28:485–493
Jamil TS, Abbas H, Nasr RA, El-Kady AA, Ibrahim MI (2017) Detoxification of aflatoxin B
1
using
nano-sized Sc-doped SrTi
0.7
Fe
0.3
O
3
under visible light. J Photochem Photobiol A Chem 341:
127–135
Ji J, Xie W (2020) Detoxification of aflatoxin B
1
by magnetic graphene composite adsorbents from
contaminated oils. J Hazard Mater 381:120915
Jiang D, Wei D, Li H, Wang L, Jiang N, Li Y, Wang M (2021) Natural occurrence of Alternaria
mycotoxins in wheat and potential of reducing associated risks using magnolol. J Sci Food
Agric 101:3071–3077
Kalagatur NK, Mudili V, Siddaiah C, Gupta VK, Natarajan G, Sreepathi MH, Vardhan BH, Putcha
VL (2015) Antagonistic activity of Ocimum sanctum L. essential oil on growth and zearalenone
production by Fusarium graminearum in maize grains. Front Microbiol 6:892
Kalagatur NK, Nirmal Ghosh OS, Sundararaj N, Mudili V (2018) Antifungal activity of chitosan
nanoparticles encapsulated with Cymbopogon martinii essential oil on plant pathogenic fungi
Fusarium graminearum. Front Pharmacol 9:610
Kalia A, Kaur J, Tondey M, Manchanda P, Bindra P, Alghuthaymi MA, Shami A, Abd-Elsalam KA
(2021) Differential antimycotic and antioxidant potentials of chemically synthesized zinc-based
nanoparticles derived from different reducing/complexing agents against pathogenic fungi of
maize crop. J Fungi 7:223
Karami-Osboo R, Maham M, Nasrollahzadeh M (2020) Synthesised magnetic nano-zeolite as a
mycotoxins binder to reduce the toxicity of aflatoxins, zearalenone, ochratoxin A, and
deoxynivalenol in barley. IET Nanobiotechnol 14:623–627
Karlovsky P, Suman M, Berthiller F, De Meester J, Eisenbrand G, Perrin I, Oswald IP, Speijers G,
Chiodini A, Recker T, Dussort P (2016) Impact of food processing and detoxification treatments
on mycotoxin contamination. Mycotoxin Res 32:179–205
Kolackova I, Gruberova HA, Kratochvil O, Baholet D, Skladanka J, Jancar J, Skarpa P (2021)
Effect of foliar copper-containing superabsorbent polymers on nutritional characteristics and
mycotoxin contamination of wheat kernel. Acta Univ Agric Silvic Mendel Brun 69:71–78
Kosicki R, Twarużek M, Dopierała P, Rudzki B, Grajewski J (2020) Occurrence of mycotoxins in
winter rye varieties cultivated in Poland (2017–2019). Toxins 12:423
Kottapalli B, Wolf-Hall CE, Schwarz P (2006) Effect of electron-beam irradiation on the safety and
quality of Fusarium-infected malting barley. Int J Food Microbiol 110:224–231
Lakshmeesha TR, Kalagatur NK, Mudili V, Mohan CD, Rangappa S, Prasad BD, Ashwini BS,
Hashem A, Alqarawi AA, Malik JA, Abd Allah EF, Gupta VK, Siddaiah CN, Niranjana SR
(2019) Biofabrication of zinc oxide nanoparticles with Syzygium aromaticum flower buds
extract and finding its novel application in controlling the growth and mycotoxins of Fusarium
graminearum. Front Microbiol 10:1244
Laskowski W, Górska-Warsewicz H, Rejman K, Czeczotko M, Zwolińska J (2019) How important
are cereals and cereal products in the average Polish diet? Nutrients 11:679
402 M. A. Gacem and K. A. Abd-Elsalam
Lee HJ, Ryu D (2017) Worldwide occurrence of mycotoxins in cereals and cereal-derived food
products: public health perspectives of their co-occurrence. J Agric Food Chem 65:7034–7051
Lehoczki-Krsjak S, Szabó-Hevér A, Tóth B, Kótai C, Bartók T, Varga M, Farády L, Mesterházy A
(2010) Prevention of fusarium mycotoxin contamination by breeding and fungicide application
to wheat. Food Addit Contam Part A Chem Anal Control Expo Risk Assess 27:616–628
Li XZ, Zhu C, de Lange CF, Zhou T, He J, Yu H, Gong J, Young JC (2011) Efficacy of
detoxification of deoxynivalenol-contaminated corn by Bacillus sp. LS100 in reducing the
adverse effects of the mycotoxin on swine growth performance. Food Addit Contam Part A
Chem Anal Control Expo Risk Assess 28:894–901
Li X, Shin S, Heinen S, Dill-Macky R, Berthiller F, Nersesian N, Clemente T, McCormick S,
Muehlbauer GJ (2015) Transgenic wheat expressing a barley UDP-glucosyltransferase
detoxifies deoxynivalenol and provides high levels of resistance to Fusarium graminearum.
Mol Plant-Microbe Interact 28:1237–1246
Li X, Michlmayr H, Schweiger W, Malachova A, Shin S, Huang Y, Dong Y, Wiesenberger G,
McCormick S, Lemmens M, Fruhmann P, Hametner C, Berthiller F, Adam G, Muehlbauer GJ
(2017) A barley UDP-glucosyltransferase inactivates nivalenol and provides Fusarium Head
Blight resistance in transgenic wheat. J Exp Bot 68:2187–2197
Li H, Xing L, Zhang M, Wang J, Zheng N (2018) The toxic effects of aflatoxin B1 and aflatoxin M1
on kidney through regulating L-proline and downstream apoptosis. Biomed Res Int 2018:
9074861
Li L, Chen Y, Jiao D, Yang S, Li L, Li P (2020a) Protective effect of astaxanthin on ochratoxin
A-induced kidney injury to mice by regulating oxidative stress-related NRF2/KEAP1 pathway.
Molecules 25:1386
Li Y, Wang R, Chen Z, Zhao X, Luo X, Wang L, Li Y, Teng F (2020b) Preparation of magnetic
mesoporous silica from rice husk for aflatoxin B
1
removal: optimum process and adsorption
mechanism. PLoS One 15:0238837
Li X, Lv Z, Chen J, Nepovimova E, Long M, Wu W, Kuca K (2021a) Bacillus amyloliquefaciens
B10 can alleviate liver apoptosis and oxidative stress induced by aflatoxin B1. Food Chem
Toxicol 151:112124
Li L, Xiaoxue S, Yuchong Z, Jin W, Zilong L, Yuxi G, Shuai C, Youjun J, Jinying C (2021b)
Application in photocatalytic degradation of zearalenone based on graphitic carbon nitride.
Luminescence 37:190–198
Liu M, Wang J, Yang Q, Hu N, Zhang W, Zhu W, Wang R, Suo Y, Wang J (2019) Patulin removal
from apple juice using a novel cysteine-functionalized metal-organic framework adsorbent.
Food Chem 270:1–9
Liu M, Wang J, Wang X, Xu J, Xie L, Hu H, Sun J, Yue T, Wang J (2021) Aerogel doped by sulfur-
functionalized graphene oxide with convenient separability for efficient patulin removal from
apple juice. Food Chem 338:127785
Lucke A, Böhm J, Zebeli Q, Metzler-Zebeli BU (2018) Dietary deoxynivalenol contamination and
oral lipopolysaccharide challenge alters the cecal microbiota of broiler chickens. Front
Microbiol 9:804
Luo Y, Zhou Z, Yue T (2017) Synthesis and characterization of nontoxic chitosan-coated Fe
3
O
4
particles for patulin adsorption in a juice-pH simulation aqueous. Food Chem 221:317–323
Lyu A, Yang L, Wu M, Zhang J, Li G (2020) High efficacy of the volatile organic compounds of
Streptomyces yanglinensis 3-10 in suppression of Aspergillus contamination on peanut kernels.
Front Microbiol 11:142
Madrigal-Santillán E, Morales-González JA, Vargas-Mendoza N, Reyes-Ramírez P, Cruz-Jaime S,
Sumaya-Martínez T, Pérez-Pastén R, Madrigal-Bujaidar E (2010) Antigenotoxic studies of
different substances to reduce the DNA damage induced by aflatoxin B1 and ochratoxin
A. Toxins 2:738–757
Magzoub R, Yassin A, Abdel-Rahim A, Gubartallah E, Miskam M, Saad B, Sabar S (2019)
Photocatalytic detoxification of aflatoxins in Sudanese peanut oil using immobilized titanium
dioxide. Food Control 95:206–214
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 403
Mallmann CA, Tyska D, Almeida CAA, Oliveira MS, Gressler LT (2020) Mycotoxicological
monitoring of breakfast and infant cereals marketed in Brazil. Int J Food Microbiol 331:108628
Mannaa M, Kim KD (2017) Influence of temperature and water activity on deleterious fungi and
mycotoxin production during grain storage. Mycobiology 45:240–254
Mao J, Zhang L, Wang H, Zhang Q, Zhang W, Li P (2018a) Facile fabrication of nanosized
graphitic carbon nitride sheets with efficient charge separation for mitigation of toxic pollutant.
Chem Eng J 342:30–40
Mao J, Zhang Q, Li P, Zhang L, Zhang W (2018b) Geometric architecture design of ternary
composites based on dispersive WO3 nanowires for enhanced visible-light-driven activity of
refractory pollutant degradation. Chem Eng J 334:2568–2578
Mao J, Li P, Wang J, Wang H, Zhang Q, Zhang L, Li H, Zhang W, Peng T (2019) Insights into
photocatalytic inactivation mechanism of the hypertoxic site in aflatoxin B
1
over clew-like WO3
decorated with CdS nanoparticles. Appl Catal B 248:477–486
Masching S, Naehrer K, Schwartz-Zimmermann HE, Sărăndan M, Schaumberger S, Dohnal I,
Nagl V, Schatzmayr D (2016) Gastrointestinal degradation of fumonisin B
1
by carboxylesterase
FumD prevents fumonisin induced alteration of sphingolipid metabolism in turkey and swine.
Toxins 8:84
Matumba L, Van Poucke C, Njumbe Ediage E, Jacobs B, De Saeger S (2015) Effectiveness of hand
sorting, flotation/washing, dehulling and combinations thereof on the decontamination of
mycotoxin-contaminated white maize. Food Addit Contam Part A Chem Anal Control Expo
Risk Assess 32:960–969
Milani J, Maleki G (2014) Effects of processing on mycotoxin stability in cereals. J Sci Food Agric
94:2372–2375
Mousavi Khaneghah A, Hashemi Moosavi M, Oliveira CAF, Vanin F, Sant’Ana AS (2020)
Electron beam irradiation to reduce the mycotoxin and microbial contaminations of cereal-
based products: an overview. Food Chem Toxicol 143:111557
Mruczyk K, Mizgier M, Wójciak RW, Cisek-Woźniak A (2021) Comparison of deoxynivalenol
and zearaleone concentration in conventional and organic cereal products in western Poland.
Ann Agric Environ Med 28:44–48
Muhammad Z, Khan FA (2018) Adsorption of aflatoxin B
1
on magnetic carbon nanocomposites
prepared from bagasse. Arab J Chem 11:729–738
Murugesan P, Brunda DK, Moses J, Anandharamakrishnan C (2021) Photolytic and photocatalytic
detoxification of mycotoxins in foods. Food Control 123:107748
Nabawy GA, Hassan AA, Sayed El-Ahl R, Refai M (2014) Effect of metal nanoparticles in
comparison with commercial antifungal feed additives on the growth of Aspergillus flavus
and aflatoxin B
1
production. J Glob Biosci 3:954–971
Omotayo OP, Omotayo AO, Mwanza M, Babalola OO (2019) Prevalence of mycotoxins and their
consequences on human health. Toxicol Res 35:1–7
Oznurlu Y, Celik I, Sur E, OzaydınT,Oğuz H, AltunbaşK (2012) Determination of the effects of
aflatoxin B1 given in ovo on the proximal tibial growth plate of broiler chickens: histological,
histometric and immunohistochemical findings. Avian Pathol 41:469–477
Pagnussatt FA, Del Ponte EM, Garda-Buffon J, Badiale-Furlong E (2014) Inhibition of Fusarium
graminearum growth and mycotoxin production by phenolic extract from Spirulina sp. Pestic
Biochem Physiol 108:21–26
Palazzini JM, Alberione E, Torres A, Donat C, Köhl J, Chulze S (2016) Biological control of
Fusarium graminearum sensu stricto, causal agent of Fusarium head blight of wheat, using
formulated antagonists under field conditions in Argentina. Biol Control 94:56–61
Palumbo R, Crisci A, Venâncio A, Cortiñas Abrahantes J, Dorne JL, Battilani P, Toscano P (2020)
Occurrence and co-occurrence of mycotoxins in cereal-based feed and food. Microorganisms 8:
74
Paradells S, Rocamonde B, Llinares C, Herranz-Pérez V, Jimenez M, Garcia-Verdugo JM,
Zipancic I, Soria JM, Garcia-Esparza MA (2015) Neurotoxic effects of ochratoxin A on the
subventricular zone of adult mouse brain. J Appl Toxicol 35:737–751
404 M. A. Gacem and K. A. Abd-Elsalam
Pena GA, Cardenas MA, Monge MP, Yerkovich N, Planes GA, Chulze SN (2022) Reduction of
Fusarium proliferatum growth and fumonisin accumulation by ZnO nanoparticles both on a
maize based medium and irradiated maize grains. Int J Food Microbiol 363:109510
Peraica M, Domijan AM, JurjevićZ, CvjetkovićB (2002) Prevention of exposure to mycotoxins
from food and feed. Arh Hig Rada Toksikol 53:229–237
Perczak A, Gwiazdowska D, Gwiazdowski R, JuśK, Marchwińska K, Waśkiewicz A (2019) The
inhibitory potential of selected essential oils on Fusarium spp. growth and mycotoxins biosyn-
thesis in maize seeds. Pathogens 9:23
Pestka JJ, Smolinski AT (2005) Deoxynivalenol: toxicology and potential effects on humans. J
Toxicol Environ Health B Crit Rev 8:39–69
Phan LTK, Tran TM, De Boevre M, Jacxsens L, Eeckhout M, De Saeger S (2021) Impact of season,
region, and traditional agricultural practices on aflatoxins and fumonisins contamination in the
rice chain in the Mekong Delta, Vietnam. Toxins 13:667
Piemontese L, Messia MC, Marconi E, Falasca L, Zivoli R, Gambacorta L, Perrone G, Solfrizzo M
(2018) Effect of gaseous ozone treatments on DON, microbial contaminants and technological
parameters of wheat and semolina. Food Addit Contam Part A Chem Anal Control Expo Risk
Assess 35:760–771
Pirouz A, Selamat J, Iqbal S, Mirhosseini H, Karjiban RA, Bakar FA (2017) The use of innovative
and efficient nanocomposite (magnetic graphene oxide) for the reduction on of Fusarium
mycotoxins in palm kernel cake. Sci Rep 7:12453
Priesterjahn EM, Geisen R, Schmidt-Heydt M (2020) Influence of light and water activity on
growth and mycotoxin formation of selected isolates of Aspergillus flavus and Aspergillus
parasiticus. Microorganisms 8:2000
Raesi S, Mohammadi R, Khammar Z, Paimard G, Abdalbeygi S, Sarlak Z, Rouhi M (2022)
Photocatalytic detoxification of aflatoxin B
1
in an aqueous solution and soymilk using nano
metal oxides under UV light: kinetic and isotherm models. LWT 154:112638
Rai A, Das M, Tripathi A (2020) Occurrence and toxicity of a fusarium mycotoxin, zearalenone.
Crit Rev Food Sci Nutr 60:2710–2729
Rajput V, Minkina T, Fedorenko A, Sushkova S, Mandzhieva S, Lysenko V, Duplii N,
Fedorenko G, Dvadnenko K, Ghazaryan K (2018) Toxicity of copper oxide nanoparticles on
spring barley (Hordeum sativum distichum). Sci Total Environ 645:1103–1113
Rajput SA, Shaukat A, Wu K, Rajput IR, Baloch DM, Akhtar RW, Raza MA, Najda A, RafałP,
Albrakati A, El-Kott AF, Abdel-Daim MM (2021) Luteolin alleviates aflatoxin B1-induced
apoptosis and oxidative stress in the liver of mice through activation of Nrf2 signaling pathway.
Antioxidants 10:1268
RašićD, MladinićM, ŽelježićD, Pizent A, StefanovićS, MilićevićD, Konjevoda P, Peraica M
(2018) Effects of combined treatment with ochratoxin A and citrinin on oxidative damage in
kidneys and liver of rats. Toxicon 146:99–105
RašićD, Micek V, KlarićMS, Peraica M (2019) Oxidative stress as a mechanism of combined OTA
and CTN toxicity in rat plasma, liver and kidney. Hum Exp Toxicol 38:434–445
Régnier M, Gourbeyre P, Pinton P, Napper S, Laffite J, Cossalter AM, Bailly JD, Lippi Y, Bertrand-
Michel J, Bracarense APFRL, Guillou H, Loiseau N, Oswald IP (2017) Identification of
signaling pathways targeted by the food contaminant FB1: transcriptome and kinome analysis
of samples from pig liver and intestine. Mol Nutr Food Res 61. https://doi.org/10.1002/mnfr.
201700433
Régnier M, Polizzi A, Lukowicz C, Smati S, Lasserre F, Lippi Y, Naylies C, Laffitte J,
Bétoulières C, Montagner A, Ducheix S, Gourbeyre P, Ellero-Simatos S, Menard S, Bertrand-
Michel J, Al Saati T, Lobaccaro JM, Burger HM, Gelderblom WC, Guillou H, Oswald IP,
Loiseau N (2019) The protective role of liver X receptor (LXR) during fumonisin B1-induced
hepatotoxicity. Arch Toxicol 93:505–517
Savi GD, Cardoso WA, Furtado BG, Bortolotto T, Da Agostin LOV, Nones J, Zanoni ET, Montedo
ORK, Angioletto E (2017) New ion-exchanged zeolite derivatives: antifungal and
antimycotoxin properties against Aspergillus flavus and aflatoxin B
1
. Mater Res Express 4:
085401
18 Nanomaterials for the Reduction of Mycotoxins in Cereals 405
Sorrenti V, Di Giacomo C, Acquaviva R, Barbagallo I, Bognanno M, Galvano F (2013) Toxicity of
ochratoxin A and its modulation by antioxidants: a review. Toxins 5:1742–1766
Štrbac D, Aggelopoulos CA, Štrbac G, Dimitropoulos M, NovakovićM, IvetićT, Yannopoulos SN
(2018) Photocatalytic degradation of naproxen and methylene blue: comparison between ZnO,
TiO
2
and their mixture. Process Saf Environ Prot 113:174–183
Sun Y, Su J, Liu Z, Liu D, Gan F, Chen X, Huang K (2018) Aflatoxin B1 promotes influenza
replication and increases virus related lung damage via activation of TLR4 signaling. Front
Immunol 9:2297
Sun S, Zhao R, Xie Y, Liu Y (2019) Photocatalytic degradation of aflatoxin B1 by activated carbon
supported TiO
2
catalyst. Food Control 100:183–188
Sun S, Zhao R, Xie Y, Liu Y (2021) Reduction of aflatoxin B1 by magnetic graphene oxide/TiO
2
nanocomposite and its effect on quality of corn oil. Food Chem 343:128521
Tarazona A, Gómez JV, Mateo F, Jiménez M, Mateo EM (2021) Potential health risk associated
with mycotoxins in oat grains consumed in Spain. Toxins 13:421
Targuma S, Njobeh PB, Ndungu PG (2021) Current applications of magnetic nanomaterials for
extraction of mycotoxins, pesticides, and pharmaceuticals in food commodities. Molecules 26:
4284
Topi D, BabičJ, Pavšič-VrtačK, Tavčar-Kalcher G, Jakovac-Strajn B (2020) Incidence of
Fusarium mycotoxins in wheat and maize from Albania. Molecules 26:172
Wan J, Chen B, Rao J (2020) Occurrence and preventive strategies to control mycotoxins in cereal-
based food. Compr Rev Food Sci Food Saf 19:928–953
Wang X, Tang J, Geng F, Zhu L, Chu X, Zhang Y, Rahman SU, Chen X, Jiang Y, Zhu D, Feng S,
Li Y, Wu JJ (2018) Effects of deoxynivalenol exposure on cerebral lipid peroxidation, neuro-
transmitter and calcium homeostasis of chicks in vivo. Toxicon 150:60–65
Wang H, Mao J, Zhang Z, Zhang Q, Zhang L, Li P (2019) Photocatalytic degradation of
deoxynivalenol over dendritic-like α-Fe
2
O
3
under visible light irradiation. Toxins 11:105
Wang X, Chen X, Cao L, Zhu L, Zhang Y, Chu X, Zhu D, Rahman SU, Peng C, Feng S, Li Y, Wu J
(2020) Mechanism of deoxynivalenol-induced neurotoxicity in weaned piglets is linked to lipid
peroxidation, dampened neurotransmitter levels, and interference with calcium signaling.
Ecotoxicol Environ Saf 194:110382
Wild CP, Gong YY (2010) Mycotoxins and human disease: a largely ignored global health issue.
Carcinogenesis 31:71–82
Wu S, Wang F, Li Q, Zhou Y, He C, Duan N (2019) Detoxification of DON by photocatalytic
degradation and quality evaluation of wheat. RSC Adv 9:34351–34358
Wu Y, Mao J, Ao C, Sun D, Wang X, Hu Q, Du X, Sheng F (2020a) Facile preparation of wormlike
graphitic carbon nitride for photocatalytic degradation of ustiloxin A. Nanomaterials 10:2256
Wu S, Wang F, Li Q, Wang J, Zhou Y, Duan N, Niazi S, Wang Z (2020b) Photocatalysis and
degradation products identification of deoxynivalenol in wheat using upconversion
nanoparticles@TiO
2
composite. Food Chem 323:126823
Xu F, Wang P, Yao Q, Shao B, Yu H, Yu K, Li Y (2019a) Lycopene alleviates AFB1-induced
immunosuppression by inhibiting oxidative stress and apoptosis in the spleen of mice. Food
Funct 10:3868–3879
Xu C, Ye S, Cui X, Song X, Xie X (2019b) Modelling photocatalytic detoxification of aflatoxin B1
in peanut oil on TiO
2
layer in a closed-loop reactor. Biosyst Eng 180:87–95
Yousif DA, Hussein HZ, Ali AM (2019) Testing the efficiency of zinc oxide nanoparticles, honey,
honey supported by zinc oxide nanoparticles and phylex in degradation of aflatoxin B
1
in stored
sea maize seeds. J Glob Pharma Technol 11:225–235
Yu K, Zhang J, Cao Z, Ji Q, Han Y, Song M, Shao B, Li Y (2018) Lycopene attenuates AFB1-
induced renal injury with the activation of the Nrf2 antioxidant signaling pathway in mice. Food
Funct 9:6427–6434
406 M. A. Gacem and K. A. Abd-Elsalam
Zahoor M, Khan FA (2016) Aflatoxin B1 detoxification by magnetic carbon nanostructures
prepared from maize straw. Desalin Water Treat 57:11893–11903
Zhang Z, Zeng C, Peng B (2019) Adsorption properties of magnetic carbon nanotubes for patulin
removal from aqueous solution systems. Food Control 102:1–10
Zhang X, Li G, Wu D, Liu J, Wu Y (2020) Recent advances on emerging nanomaterials for
controlling the mycotoxin contamination: from detection to elimination. Food Front 1:360–381
Zhang Q, Huang L, Leng B, Li Y, Jiao N, Jiang S, Yang W, Yuan X (2021a) Zearalenone affect the
intestinal villi associated with the distribution and the expression of ghrelin and proliferating cell
nuclear antigen in weaned gilts. Toxins 13:736
Zhang Y, Zhou M, Cheng H, Luo S, Sun Q (2021b) Insight into the substrate-dependent anti-
aflatoxigenic effects of nanosized ZnO film: electron transfer directed oxidative stress
mechanisms. Colloids Surf B Biointerfaces 207:111997
Zhao Y, Selvaraj JN, Xing F, Zhou L, Wang Y, Song H, Tan X, Sun L, Sangare L, Folly YM, Liu Y
(2014) Antagonistic action of Bacillus subtilis strain sg6 on Fusarium graminearum. PLoS One
9:92486
Zhao Y, Wang T, Li P, Chen J, Nepovimova E, Long M, Wu W, Kuca K (2021) Bacillus
amyloliquefaciens B10 can alleviate aflatoxin B1-induced kidney oxidative stress and apoptosis
in mice. Ecotoxicol Environ Saf 218:112286
Zhou Y, Wu S, Wang F, Li Q, He C, Duan N, Wang Z (2020) Assessing the toxicity in vitro of
degradation products from deoxynivalenol photocatalytic degradation by using upconversion
nanoparticles@TiO
2
composite. Chemosphere 238:124648
