Human Mesenchymal Stem Cells seeded in 3D Collagen Matrix Scaffolds as a Therapeutic Alternative in Tissue Regeneration

Full text

A SciTechnol Journal
Research Artıcle
León-Mancilla. J Regen Med 2021, 10:4
All articles published in Journal of Regenerative Medicine are the property of SciTechnol, and is protected by copyright laws.
Copyright © 2021, SciTechnol, All Rights Reserved.
Journal of
Regenerative Medicine
International Publisher of Science,
Technology and Medicine
Human Mesenchymal
Stem Cells seeded in 3D
Collagen Matrix Scaolds as
a Therapeutic Alternative in
Tissue Regeneration
Benjamin León-Mancilla1,5, Moisés Martínez-Castillo1, Rocio
Guerrero-Bustos2, Juan J Montesinos3, Erika Hernández-
Estévez3, Zaira Medina-Avila1, Maria Cristina Piña-Barba4,
Rubén S Argüero5, Gabriela Gutierrez-Reyes1*
Abstract
Human mesenchymal stem cells (hMSCs) are considered an
ideal strategy for tissue engineering and regenerative medicine.
However, their acquisition, administration route, and cell quantity
are true challenges. On the other hand, the collagen scaolds
are a viable option, mimicking the extracellular matrix, utilizing
collagen as the main polymer in 3D supports. The combination
of hMSCs and scaolds could enable the hMSCs to arrive at the
target organ, avoiding the disadvantages of intravenous or intra-
arterial therapy. We obtain and characterize MSCs from human
amniotic membranes and evaluate their dierentiation capacity
in 3D collagen matrix scaolds (CMSs). Their morphology,
multipotency genes by RT-PCR and markers by ow cytometry
were evaluated in in vitro cell cultures. The dierentiation
capacity of AM-hMSCs, seeded with and without CMSs, was
evaluated in media specic for chondrogenic, osteogenic, and
adipogenic lineages. AM-hMSCs were studied up to passage
5 and broblastoid morphology was observed in AM-hMSCs
and BM-hMSCs. sox-2 gene expression was similar in all
passages, whereas oct-4 was upregulated at P2 and P5. Nanog
was upregulated at P1 and P3 versus BM-hMSCs. Membrane
markers displayed CD44, CD73, CD90, and CD105 were positive
in all passage. AM-MSCs were adhered to CMSs, showing
broblastoid morphology in the SEM analyses. The AM-hMSCs,
seeded with and without CMSs, were able to dierentiate into
chondroblasts, osteoblasts, and adipocytes. The CMSs enable
AM-hMSCs stemness preservation, without aecting their
dierentiation capacity. That combination can be a novel strategy
in the tissue regeneration process.
Keywords
Mesenchymal stem cells, Collagen matrix scaolds, Tissue
regeneration, Xenogenic construct
*Corresponding author: Gabriela Gutierrez-Reyes, Liver, Pancreas and
Motility (HIPAM) Laboratory; Unit of Experimental Medicine; School of Medicine,
Universidad Nacional Autónoma de México, UNAM. Hospital General de México,
School of Medicine, Universidad Nacional Autónoma de Mexico (UNAM), Hospital
General de México, Dr. Balmis 148. Doctores, Cuauhtémoc, Mexico City, 06726,
Mexico; E-mail: gabgurey@yahoo.com.mx
Received: June 28, 2021 Accepted: July 19, 2021 Published: July 26, 2021
Introductıon
Chronic noncommunicable diseases, such as cardiovascular
diseases, cancer, renal failure, respiratory diseases, diabetes, and
chronic liver diseases, have been increasing in recent years, aecting
quality of life and life expectancy [1]. Organ transplantation is
usually the only alternative in patients with complications, but only
10% of those patients are transplanted, mainly due to the scarcity of
organ donation and elevated preoperative and postoperative costs
[2,3]. SARS-CoV-2 infection has also become a novel challenge
in solid organ transplantation [4,5]. In 1993, Langer and Vacanti
proposed tissue engineering (TE) and regenerative medicine (RM)
as alternatives to transplantation. e primary components of
TE include the use of cells (with multi or pluripotency), scaolds
(biomaterials), and growth factors. Mesenchymal stem cells (MSCs)
are stem cells of choice in TE [6-8]. e main source of MSCs is bone
marrow, but their procurement involves a complex procedure that is
invasive and painful [9]. e placenta is considered biologic waste.
However, that organ has specic sites for MSCs procurement, such as
the amniotic membrane (AM), umbilical cord blood (UCB), Warthon
gelatin (WG), cotyledons, and amniotic uid. In in vitro studies, AM-
hMSCs have been reported to possess a high capacity to dierentiate
into ectoderm, mesoderm, and endoderm lineages [10,11].
Scaolds used in TE and RM include either natural or
synthetic materials that must have the biologic characteristics of
biocompatibility, biodegradability, and the capacity to induce MSCs
dierentiation into selected lineages, through the incorporation
of specic growth factors [12]. Natural scaolds designed from
collagen have demonstrated synergy with hMSCs in the process of
tissue regeneration [13]. However, collagen scaolds are obtained
through chemical processes involving the tendons, pericardium,
intestine, and dermis [14]. In contrast, our group previously reported
that the collagen matrix scaold (CMS), obtained from bone, taking
advantage of the 3D composition (porous structure), was used as
an experimental scaold. e results showed that the implantation
of CMSs in the urethra and bile duct promoted regeneration and
restored function in preclinical studies [15,16]. Nevertheless, the
combination of MSCs and biomaterials has been suggested as an
excellent option for improving organ damage. ere are no studies
that focus on the interaction of AM-hMSCs and CMSs [17]. us,
we evaluated and characterized the combination of AM-hMSCs and
CMSs in vitro, suggesting their potential as a therapeutic strategy in
the regeneration of several tissues.
Materials and Methods
Patients
To obtain the hMSCs from the amniotic membrane (AM), 30
women, ranging from 20 to 30 years of age that presented with no
clinical complications during the gestation period were included
in the study. e exclusion criteria were systemic infections and
comorbidities (e.g., diabetes, hypertension, and autoimmune
diseases), as well as patients with positive serologic test results for the
hepatitis A, B, and C viruses and HIV. A detailed clinical history of
previous pregnancy conditions (natural childbirth, abortions, and
cesarean sections) was documented. e maternal anthropometric

Citation: León-Mancilla B, Martínez-Castillo M, Guerrero-Bustos R, Montesinos JJ, Hernández-Estévez E, et al. (2021) Human Mesenchymal Stem Cells
seeded in 3D Collagen Matrix Scaolds as a Therapeutic Alternative in Tissue Regeneration. J Regen Med 10:4.
• Page 2 of 9 •
Volume 10 • Issue 4 • 1000190
information included age, height, weight, body mass index (BMI),
alcohol consumption, and smoking habit. e neonatal information
was also registered (sex, Apgar score, and placental weight). All
participants provided written statements of informed consent. e
present study was approved by the research and ethics committees of
the Hospital General de México “Dr. Eduardo Liceaga” (CI/315/15)
and the School of Medicine at the Universidad Nacional Autónoma
de México (DI/115/2015) and was conducted in accordance with the
principles described in the 1975 Declaration of Helsinki.
Isolation of hMSCS from the Placenta
e AM-hMSCs were obtained from placentas from natural
deliveries or cesarean sections, as previously reported [18]. Briey,
a 5-8 cm section was carefully taken from the AM during childbirth.
e samples were washed twice with an antibiotic-antimycotic
(Gibco, Grand Island, NY, USA) in PBS, aer which the AM was
cut into small pieces in 0.05% Trypsin-EDTA (Gibco, Grand Island,
NY, USA), and the tissue was stored at 37°C for 60 min. Enzymatic
digestion was carried out using collagen type II (Gibco, Grand Island,
NY, USA) at 37° for 90 min. Finally, the cells were cultured at 37°C
at 5% CO2 in Dulbecco’s Modied Eagle Medium (DMEM) (Gibco,
Grand Island, NY, USA), supplemented with 10% FBS (Biowest,
France), 1% antibiotic-antimycotic (Gibco, Grand Island, NY, USA),
(3.7 g/L) sodium bicarbonate (Sigma Aldrich, Germany), and (1M)
HEPES (Sigma Aldrich, Germany). Positive control of the bone
marrow (BM) hMSCs was provided by the Mesenchymal Stem Cell
Laboratory of the Oncology Disease Medical Unit of the Instituto
Mexicano del Seguro Social (IMSS) in Mexico.
AM-hMSCs Characterization
Morphology: e morphology of placental AM-hMSCs was
evaluated at dierent culture times. e cells were maintained
until reaching 80 to 90% conuency (approximately 2 weeks). e
trypsinization process was performed, considering it the rst passage
(P1). e cultures from dierent passages (1, 2, 3, 4, and 5) were
viewed, using a Nikon Eclipse TE 2000-S (Tokyo, Japan) inverted
microscope and hMSCs morphology was evaluated by Dierential
Interface Contrast (DIC/Nomarski). Briey, 2x104 cells from passage
3 that had previously been placed in 24-well cell culture clusters
(Corning, New York, USA) with DMEM, were seeded onto sterile
cover glasses (Marienfeld, Germany) (16 mm Ø). e cells were
evaluated aer 15 days of cell culture (Nikon Microphoto FDA,
camera Nikon DMX; Tokyo, Japan). ree independent experiments
were performed for each cell passage.
Multipotential gene expression in AM-hMSCs
To evaluate genes related to MSCs multipotency, we performed
RNA extraction, using a Trizol reagent (ermo Fisher Scientic,
Waltham, MA, USA). AM-hMSCs RNA at passages 1-5 (n=3) were
precipitated by isopropanol (1 mL). e RNA pellet was then collected
and precipitated with 75% ethanol, centrifuged at 12,000 r/min, and
resuspended with (40 µL) of RNase-free water. Aerwards, cDNA
synthesis was performed using Reverse Transcription Polymerase
Chain Reaction (ermo Fisher Scientic, Waltham, MA, USA) for (2
ug) to the total RNA, using the AMPLIQON kit (Odense, Denmark).
Multipotential gene primers were designed, using the NIH
Gen Bank database. e primers used were: sox-2 (167bp),
forward 5´-CCCCCGGCGGCAATAGCA-3´, reverse5-
´TCGGCGCCGGGGAGATACAT-3´; for oct-4 (125bp),
forward 5´-TCGAGAACCGAGTGAGAGG-3´, reverse
5-GAACCACACTCGGACCACA-3´, nanog (481bp) forward
5´TTGTGGGCCTGAAGAAAACTATCC 3´, reverse 5
´CTGCGTCACACCATTGCTATTCTT-3´; and gapdh (598bp),
forward 5´-CTCTTGCTCTCAGTATCCTTG-3´, reverse
5´-GCTCACTGGCATGGCCTTCCG-3´. PCR was carried out with
a Veriti ermal Cycler (ermo Fisher Scientic, Waltham, MA,
USA), maintaining the following conditions: for sox-2: 35 cycles,
denaturation 95°C, annealing at 56.9 °C for 45 s, and extension at 72°C
for 30 s; for oct-4: 35 cycles, denaturation 95°C, annealing at 60°C for
45 s, and extension at 72°C for 30 s; for nanog: 35 cycles, denaturation
95°C, annealing at 57.6 °C for 45 s, and extension at 72°C for 30 s;
and for gapdh as the housekeeping gene: 35 cycles, denaturation 95°C
for 5 s, annealing at 60°C for 45 s, and extension at 72°C for 30 s. e
sox-2 and oct-4 PCR products were separated into 3% (w/v) agarose
gels, whereas the nanog and gapdh products were separated into 1.5%
(w/v) gels, which were stained with ethidium bromide and viewed on
a Kodak UV transilluminator (Rochester, NY, USA).
AM-hMSCs Immunophenotype Characterization
e AM-hMSCs membrane immune markers were analyzed by
ow cytometry. e AM-hMSCs from the dierent cell passages were
trypsinized and adjusted at 4 x 104. e cells were evaluated, using
the human MSCs analysis kit (BD Biosciences, Franklin Lakes, NJ,
USA), following the supplier’s recommendations. Briey, the samples
were incubated for 30 min at room temperature with uorescein
isothiocyanate (FITC)-conjugated anti-CD90, phycoerythrin (PE)-
conjugated anti CD44, peridinin chlorophyll protein (PerCP-Cy
5.5)-conjugated anti-CD105, and allophycocyanin (APC)-conjugated
anti CD73 antibodies, as multipotential markers, whereas negative
immunophenotype markers were determined using phycoerythrin
(PE)-conjugated anti CD34, CD11b, CD45, CD19, and HLA-DR.
The BM-hMSC immunophenotype characterization was used as
a positive control. We analyzed 20,000 events in a FACSCanto II
flow cytometer and the data were processed using the FACSDiva
software package (BD Biosciences, Franklin Lakes, NJ, USA).
Three independent experiments were performed for each cell
passage.
Assays for AM-hMSCs dierentiation specic phenotypes
e dierentiation of AM-hMSCs into chondrogenic, osteogenic,
and adipogenic phenotypes was assessed at day 21. We seeded 4 x
104 cells in culture dishes (3 mm) (Corning Costar, New York, NJ,
USA), using the previously reported specific differentiation media
[19] Differentiation was induced with a chondrogenic medium
(Cambrex Bio Science, NJ, USA) supplemented with transforming
growth factor-β (Cambrex Bio Science, NJ, USA). The osteogenic
and adipogenic media were acquired from Stem Cells Technology
(Vancouver, BC, Canada). The osteogenic medium was
supplemented with ascorbic acid and β-glycerolphosphate and
the adipogenic medium was supplemented with premix ITS (Stem
Cell Technologies Inc., Vancouver, BC, Canada). Finally, the cell
cultures were evaluated using Alcian blue (Sigma-Aldrich, St.
Louis, MO, USA) for the differentiation into the chondrogenic
lineage and the von Kossa stain for the differentiation into
the osteogenic phenotype. The lipid vacuoles were stained
with red-O oil (Sigma-Aldrich, Germany) for the adipogenic
differentiation. Images were obtained by light microscopy, using
Nikon Microphoto FDA, a Nikon DMX camera, and Nikon ACT
software (Tokyo, Japan). Three independent experiments were
performed for each cell passage.

Citation: León-Mancilla B, Martínez-Castillo M, Guerrero-Bustos R, Montesinos JJ, Hernández-Estévez E, et al. (2021) Human Mesenchymal Stem Cells
seeded in 3D Collagen Matrix Scaolds as a Therapeutic Alternative in Tissue Regeneration. J Regen Med 10:4.
• Page 3 of 9 •
Volume 10 • Issue 4 • 1000190
Collagen Matrix Scaold (CMS) obtainment
e biomaterial was obtained from bovine femoral epicondyles,
treated with hydrochloric acid to eliminate mineral components. e
scaolds were physically and chemically characterized, establishing
collagen type I as the main component. e CMSs has open pores
of dierent sizes that facilitate the interchange of uids and other
components, such as growth factor [20] and it can also be designed in
dierent geometries, according to the implanted organ [15,16].
Characterization of the AM-hMSCs seeded in CMSs
To determine the multipotential ability of AM-hMSCs in vitro,
the cells were seeded in CMSs. Before seeding the cells onto the
scaolds (14 mm of diameter and 1 mm of thickness), they were
hydrated for 24 hours in DMEM (1ml) at 37°C in 24-well cell culture
clusters (Corning Costar, New York, NJ, USA). A total of 1x105AM-
hMSCs were added to the CMSs, with DMEM as the control, and
they were then incubated with the abovementioned dierentiation
media (chondrogenic, osteogenic and adipogenic) at days 14 and
21. e media (1 ml) were changed every 3 days. To evaluate the
dierentiation of the AM-hMSCs and their attachment to the CMSs,
the samples were xed in 10% formalin and embedded in paran.
e AM-hMSCs with the CMSs were stained with hematoxylin and
eosin (H&E), and the specic stain of each of the three lineages was
performed with the same technique used in the dierentiation assays.
Images were obtained by light microscopy (Nikon, Tokyo, Japan).
To evaluate the morphology and adhesion of the AM-hMSCs in the
CMSs at days 14 and 21, we employed SEM. In brief, the samples were
washed with sterile PBS and xed with Zamboni xative solution
(Newcomer supply, Middleton, WI, USA) for 24 h. e samples
were then processed [21] and covered with conductive material (Au).
e samples were evaluated utilizing DSM-950 and Evo10 electron
microscopes (Zeiss, Oberkochen, Germany).
Statistical analysis
Comparisons between groups were performed with the one-
way ANOVA analysis and Tukey-Kramer post-hoc test. Data were
expressed as mean ± standard error. A p value < 0.05 was considered
statistically signicant. Statistical analyses were performed using
SPSS 20.0 soware (IBM, Armonk, NY, USA).
Results
Patients
A total of 30 amniotic membranes from female patients were
included. e patients were divided into two age groups (20 to
25-year-olds and 26 to 30-year-olds), as previously reported [22].
Fiy-seven percent of the patients were 20-25 years of age and 43%
were 26-30 years of age. Patient overweight was similar in the two
subgroups, with a BMI of 26.5 kg/m2 for the 20 to 25-year-olds and
26.9 kg/m2 for the 26 to 30-year-olds. e obese 20 to 25-year-olds
had a BMI of 35.4 kg/m2 versus 34 kg/m2 in the 26 to 30-year-olds. We
obtained more placentas via natural delivery (22 patients), compared
with cesarean section (8 patients). e demographic and gynecologic
data are shown in Table 1.
AM-hMSCs morphology and cell culture
e representative portion of the AM was obtained from the
placenta (Figure 1A). e tissue was processed and the MSCs were
maintained in vitro. e attached cells had a circular shape at 2 h of
culture (Figure 1B). Aer 14 days, the culture cells had proliferated
and presented with lamellipodia morphology, as well as triangular,
rhomboidal, and broblast-like morphology types (Figure 1C). e
morphology of the cultured BM-hMSCs at 2 h and at day 14 was
similar to that of the AM-hMSCs (Figure 1D and E). Additionally,
the DIC/Nomarski evaluation revealed the integrity of cell nuclei and
the cytoskeletal arrangement of the AM-hMSCs (Figure 1F-G).
Multipotential Gene Expression in AM-hMSCs
Aer evaluating the AM-hMSC morphology, we determined
the expression of the multipotential genes: sox-2, nanog, and oct-
4. Representative agarose gels revealed the expected sox-2, oct-4,
nanog, and gapdh products at 167pb, 125pb, 481pb, and 598pb,
respectively, in passages P1 to P5 (Figure 2A, C, E, and G). e
densitometric analysis of sox-2 revealed no statistical dierences at
any passage evaluated. However, its relative expression was lower in
the AM-hMSCs, compared with the BM-hMSCs (Figure 2B). On the
other hand, the expression of oct-4 in P2 and P5 of the AM-hMSCs
displayed statistically signicant dierences from the BM-hMSCs
(p< 0.05) (Figure 2D), whereas the expression of nanog was higher in
passages P1 to P3 than in passages P4 and P5, in both the AM-hMSCs
and the BM-hMSCs (p<0.05) (Figure 2F). e expression of gapdh as
a housekeeping gene presented no dierences in P1 to P5 (Figure 2H).
Immunophenotype Characterization of AM-hMSCs
To perform the immunologic characterization of the AM-hMSCs,
we evaluated CD44, CD73, CD90, and CD105 as positive markers of
MSCs and CD34, CD11b, CD45, CD19, and HLA-DR as negative
markers, by FACS. e cytometric analysis revealed that CD44+
presented no dierences in its expression at P1 to P5, in either the AM-
hMSCs or the BM-hMSCs (Figure 3A). e percentage of CD73+ in
the AM-hMSCs from P1 to P5 was approximately 89%, with similar
results in the BM-hMSCs (94%) (Figure 3B). Likewise, the percentage
of CD90+ was maintained at 90% in all the AM-hMSCs passages and
at 96% for the BM-hMSCs (Figure 3C). Interestingly, the CD105+
marker had lower expression in the AM-hMSCs at P1 (60%) and at
P2 to P5 (24%), in comparison with the BM-hMSCs (75%) (p<0.05)
(Figure 3D). e evaluation of the CD34, CD11b, CD45, CD19, and
HLA-DR mixed hematopoietic stem cell markers was less than 14%
in the AM-hMSCs at all passages evaluated and that phenotype was
similar in the BM-hMSCs (Figure 3E). All data are summarized in
Table 2.
Assays for AM-hMSCs dierentiation into specic pheno-
types
Aer evaluating the morphology and genotypic and immunologic
characterizations, we determined the capacity of AM-hMSCs to
dierentiate into chondroblast, osteoblast, and adipocyte lineages. e
results showed that approximately 80% of the AM-hMSCs from P2 to
P5 were positive for the Alcian blue stain, revealing the chondroblast
lineage (Figure 4A). Similarly, 80% of AM-hMSCs were positive for
the von Kossa stain and the osteoblasts showed calcium deposition
and changes in their morphology (Figure 4B). e adipocytes stained
with red-O oil revealed lipid vacuoles in approximately 25% of cells
in all passages (Figure 4C). e percentage of each dierentiation is
shown in Table 3.
Characterization of AM-hMSCs seeded in Collagen Matrix
Scaolds
e SEM results conrmed the broblastoid morphology and
the high capacity of AM-hMSCs to adhere at the rough surface of

Citation: León-Mancilla B, Martínez-Castillo M, Guerrero-Bustos R, Montesinos JJ, Hernández-Estévez E, et al. (2021) Human Mesenchymal Stem Cells
seeded in 3D Collagen Matrix Scaolds as a Therapeutic Alternative in Tissue Regeneration. J Regen Med 10:4.
• Page 4 of 9 •
Volume 10 • Issue 4 • 1000190
BMI (%) Delivery (%)
Patients Age (%) Overweight Obesity Natural Cesarean
30 20-25 (57) 26.5 (23.3) 35.4 (33.3) 13 (43.3) 4 (13.3)
26-30 (43) 26.9 (16.6) 34 (26.6) 9 (30) 4 (13.3)
BMI: Body Mass Index
Table 1: Patient demographic and gynaecologic data overweight.
Figure 1: Obtention and morphology of AM-hMSCs. A. A 5-8 cm AM was selected to obtain AM-hMSCs, umbilical cordon as reference (arrow). B. AM-hMSCs
culture after 2 h of obtention, displays circular shape. C. Culture at 14 d of AM-hMSCs showed lamellipodia (arrowhead), triangle (arrow), rhomboid (asterisk)
and like-broblast morphology. D-E. Culture of BM-hMSCs after 2 h and 14 days of obtention were a positive control. F-G. DIC/Nomarski analysis showed
AM-MSCs nucleus (white arrow) and cytoplasm (black arrow). B-E: 4x. F-G: 20x.
Figure 2: Expression of multipotent genes in AM-hMSC. A-B. sox-2 is present in passage P1 to P5, not show dierent with the BM-MSCs. C-D. oct-4 not show
dierent in all passage and not have dierent with BM-MSCs. E-F. nanog show similar concentration in P1-P3 but dierent in P4-P5 that have dierences
with BM-MSCs. G-H. gapdh used to housekeeping. A: 50bp (DNA step Ladder, Sigma-Aldrich); C, E and G: 100bp (ϕX174DNA, Thermo-Scientic) *p<0.05.
the CMSs (Figure 5A). Additionally, we observed the lamellipodia
morphology of AM-hMSCs at day 14 (Figure 5B). Furthermore, the
AM-hMSCs with CMSs released spherical microvesicles, or perhaps
“exosomes”, at day 21 (Figure 5C).
e dierentiation capacity of AM-hMSCs in the CMSs, with
or without specic dierentiation media, demonstrated that the
distribution and percentage of cells adhered to CMSs were similar at
days 14 and 21. e cells with no dierentiation media were stained
with H&E (Figure 6A and B). e chondrogenic dierentiation of
AM-hMSCs in CMSs showed that approximately 50% of cells were
positive for the Alcian blue stain (Figure 6C and D). Similar behavior
was observed in the osteogenic dierentiation in the CMSs (Figure
6E and F). In the specic medium for adipocyte dierentiation, only
5-7% of cells were positive for the red-O oil stain. ose cells showed
the peripheral nuclei, which are a typical characteristic of that lineage
(Figure 6G and H).
e data obtained in the characterization assays support the
concept that AM-hMSCs conserve viability, adhesive capacity, and
dierentiation capacity. e AM-hMSCs, seeded with and without
CMSs, maintained those properties in the scaolds from the
xenogenic source.

Citation: León-Mancilla B, Martínez-Castillo M, Guerrero-Bustos R, Montesinos JJ, Hernández-Estévez E, et al. (2021) Human Mesenchymal Stem Cells
seeded in 3D Collagen Matrix Scaolds as a Therapeutic Alternative in Tissue Regeneration. J Regen Med 10:4.
• Page 5 of 9 •
Volume 10 • Issue 4 • 1000190
Figure 3: Immunophenotype characterization of AM-hMSCs. A. Percentage of CD44+ not presented dierences in all passage with respect BM. B. CD73+
percentage is similar AM and BM-hMSCs in all passage. C. CD90+ was similar in AM-hMSCs with respect BM-hMSCs in P1 and P3. D. CD105+ was lower
in all passage compared with BM-hMSCs. E. Negative markers were low in all passage in AM-hMSCs and BM-hMSCs. *p<0.05 (BM vs P2-P5 CD105+).
%
Markers P1 P2 P3 P4 P5 MO
CD44 85 ± 15 64 ± 21 76 ± 15 67 ± 12 73 ± 17 96
CD73 94 ± 1 82 ± 10 92 ± 6 88 ± 10 89 ± 7 94
CD90 94 ± 3 88 ± 7 90 ± 5 86 ± 18 87 ± 9 96
CD105 60 ± 18 20 ± 33 28 ± 11 30 ± 38 18 ± 12 74
Negative 6 ± 7 7 ± 5 14 ± 11 7 ± 6 14 ± 20 9
Table 2: Percentage for positive and negative markers in dierent passage.
Negative markers: CD34, CD45, CD11B, CD19, HLA-DR
Three independent experiments were performing for each cell passages.
Figure 4: Dierentiation potential of AM-hMSCs into chondroblasts, osteoblasts and adipocytes. A-a. Formation of proteoglycans in chondroblasts were
stained with Alcian blue. B-b. Calcium depositions in osteoblasts were stained with von Kossa. C-c. In adipocytes the formation of lipids droplets were stained
with oil red O. A-C: 4x, a-c: 20x.
Passage Chondrogenic potential Osteogenic Potential Adipogenic Potential
2 80 ± 10 80 ± 10 30 ± 5
3 70 ± 17 90 ± 8 30 ± 7
4 80 ± 17 80 ± 14 20 ± 10
5 75 ± 15 80 ± 15 15 ± 6
Table 3: AM-hMSCs dierentiation percentage in dierent passage.
Three independent experiments were performing for each cell passage

Citation: León-Mancilla B, Martínez-Castillo M, Guerrero-Bustos R, Montesinos JJ, Hernández-Estévez E, et al. (2021) Human Mesenchymal Stem Cells
seeded in 3D Collagen Matrix Scaolds as a Therapeutic Alternative in Tissue Regeneration. J Regen Med 10:4.
• Page 6 of 9 •
Volume 10 • Issue 4 • 1000190
Figure 5: SEM of AM-hMSCs with CMSs at 14-21 days in vitro conditions. A. The AM-hMSCs showed broblastoid morphology and adhesion to the surface of
CMSs at 14 days. B. The AM-hMSCs showed lamellipodia form (arrow) in contact to CMSs at 14 days. C. Spherical macrovesicles (*) of AM-hMSCs in surface
of CMSs at 21 days. A-B. Electron microscopy DSM-950 (Zeiss). C. Electron microscopy Evo 10 (Zeiss). A: 2000x, B: 5000x, C: 2840x.
Figure 6: Microphotography of CMSs with AM-hMSCs at 14- and 21-days in vitro conditions. The AM-hMSCs seeded in CMSs stain with H&E at 14 days(A)
and 21 days (B). Dierentiation to chondroblast was conrm at 14 days (C) and 21 days (D) with stain Alcian blue. Osteoblast was observed at 14 days (E) and
21 days (F) with stain von Kossa, whereas adipocytes was present onto CMSs in 14 days (G) and 21 days (H) stain with oil red O. A-H: 20x
Discussion
In recent years, hMSCs have been considered an excellent option
for the treatment of several diseases, as well as in the area of tissue
regeneration. e dierentiation capacity of hMSCs is known to be
high, as is their capacity to regulate inammatory processes, through
the production and stimulation of multiple growth factors [5].
However, the protocols for hMSC procurement have not been fully
standardized [23] and the administration routes and required doses
have not been optimal or sucient for reversing or decreasing organ
damage [24].
e placenta is considered biologic waste and there are no ethical
implications for its processing. e mother can donate it, by signing
a statement of informed consent. We described herein a protocol for
hMSCs procurement from the AM, according to ISTC established
criteria, [25] as well as their biologic evaluation, with and without
CMSs.
ere were no dierences in the biologic properties of AM-hMSCs
obtained from natural delivery and cesarean sections. However, in
in vitro cultures, the cells obtained from women ranging from 20-25
years of age displayed better proliferation and adaptation than those
from older women (26 to 30 years of age). at could be correlated
with the results of Alrefaei et al, who reported that MSCs from human
fetal membrane (placenta, umbilical cord, and amniotic membrane)
from older mothers (≥ 39) presented with short telomeres due to high
telomerase activity [26].

Citation: León-Mancilla B, Martínez-Castillo M, Guerrero-Bustos R, Montesinos JJ, Hernández-Estévez E, et al. (2021) Human Mesenchymal Stem Cells
seeded in 3D Collagen Matrix Scaolds as a Therapeutic Alternative in Tissue Regeneration. J Regen Med 10:4.
• Page 7 of 9 •
Volume 10 • Issue 4 • 1000190
Human MSCs from AM and BM were followed from passages P1
to P5, because Oja et al reported that P6 and subsequent passages from
MSCs showed alterations in size, morphology, length of telomeres,
and senescence evaluated in BM-hMSCs [22].
On the other hand, sox-2, oct-4, and nanog genes are well-
established as being responsible for maintaining pluripotency in
embryonic stem cells (ESCs) and MSCs, through self-renewal, and for
suppressing dierentiation-associated genes. e expression of sox-2
and oct-4 in AM-hMSCs showed no dierences at any of the passages
evaluated, suggesting that those cells conserve their stemness.
However, oct-4 expression at P2 and P5 in the AM-hMSCs was higher
than in the BM-hMSCs. We also found that nanog was downregulated
in AM-hMSCs in P4 and P5. Moreover, nanog has been reported to
be able to act independently from sox-2 and oct-4. In 2018, Akberdin
et al suggested that sox-2 and oct-4 act as heterodimers that stimulate
or inhibit pluripotential and dierentiation genes [27]. Additionally,
heterodimers could regulate nanog expression in MSCs derived
from subcutaneous adipose tissue (hASCs). On the other hand,
Pitrone et al demonstrated that knockdown of nanog inhibited the
proliferation of hASCs, arresting the cell cycle in G0/G1 [28]. ere
is recently reported evidence that the expression of pluripotential
genes is variable in spatiotemporal embryonic development and in
the maintenance of MSC stemness. e triad of pluripotent genes in
AM-hMSCs was observed, but future studies are needed to determine
the specic regulatory network of those genes in AM-hMSCs.
e CD44, CD73, CD90, and CD105 surface markers were
evaluated, according to the ISCT guidelines published in 2006 [25]
We found that CD44, CD73, and CD90 in AM-hMSCs were similar
in all the passages, compared with BM-hMSCs, with the exception
of CD105, which displayed low levels in AM-hMSCs. In 2013,
Leyva et al described two subpopulations of AM-hMSCs CD105+
and CD105- with dissimilar osteogenic potential. e CD105- cells
showed stronger expression of secreted protein acidic and were
rich in cysteine (SPARC), which was associated with more eective
calcium deposition than in the CD105+ cells. Additionally, those
authors reported that chondrogenic and adipogenic dierentiation
capacity was not dierent in either CD105+ or CD105- [29]. In
contrast, our results revealed the high capacity for chondrogenic and
osteogenic dierentiation, but less capacity to dierentiate into the
adipogenic lineage. However, we did not sort the AM-hMSCs. Papait
also reported low levels of CD105 (54.88 ± 25.83) in AM-hMSCs
that did not compromise the potential of MSCs [30]. In 2013, Lin
reported that CD105+ expression was underestimated as a MSCs
marker, due to the dierences observed in the initial and late stages
[31]. Furthermore, the variation of supercial antigens expressed in
MSCs was dependent on the source, patient age, and procurement
protocol [32]. It is necessary to continue analyzing the dierence in
adipogenic lineage.
Moraes et al and Uder et al demonstrated that 20-30% of hMSCs
maintained their initial morphology and stemness in vitro [33, 34],
and it is possible that those cells are in a quiescent state. Similarly, we
found that CD44, CD73, CD90, CD105, and HSCs, in approximately
42, 56, 51, 0.1, and 2.7%, respectively, of the AM-hMSCs incubated
in the dierent dierentiation media, conserved the membrane
stemness markers at day 21 (data not shown). It is also possible
that the concentration of growth factors plays an important role
in the percentage of dierentiated cells. Future studies are needed
to determine the ideal concentration of growth factors and other
mediators in the cultures of AM-hMSCs in chondroblast, osteoblast,
and adipocyte dierentiation media.
Collagen type I protein plays an important role in cell
dierentiation by providing biologic signals to induce cell
dierentiation. Collagen has been employed as a gel or sponge to
design scaolds that maintain the self-renewal and multipotential
dierentiation capacity of ESCs and MSCs in vitro for up to 30 days
[10]. Other experiments for evaluating dierent conformations of
collagen type I were conducted with gel or decellularized solid organs
(liver, heart, and kidney) [35]. In particular, MSC-derived extracellular
vesicles (EVs) were encapsulated to increase retention, stability, and
the release of vesicles, in an ischemic kidney mouse model. at
procedure enabled renal tubular epithelial cell proliferation, renal
cell apoptosis inhibition, and angiogenesis enhancement, as well
as brosis amelioration. e decellularization process to obtain
extracellular matrix is time-consuming, requires many reagents, and
a high number of hMSCs or iPSCs are needed to be implanted into
the scaold, in the recellularization process [36].
Porosity (%) and pore size, form, and distribution are the
important physical characteristics of scaolds that promote growth,
adhesion, cytokine-growth factor release, and hMSCs dierentiation.
In 2018, Bonarsevt et al reported that the synthetic scaold poly
(3-hydroxybutyrate) (PHB), with poly (ethylene glycol) (PEG) and
uniform pore size (about 125 µm), did not support MSCs, whereas
scaolds with diverse pore sizes promoted stem cell growth. In the
scaolds with small pores (about 45 µm), MSCs growth was the
lowest and cell growth suppression was only partially related to stem
cell dierentiation [37]. In contrast, our CMSs had heterogeneous
pore sizes (150-350μm) and open pores with high porosity [20]. We
believe those characteristics facilitated the growth and dierentiation
into chondroblasts, osteoblasts, and adipocytes of the AM-hMSCs
with CMSs at days 14 and 21. ose physical characteristics also
enabled the diusion of nutrients, growth factors, oxygen, and other
biologic components that promote angiogenesis and the migration of
native cells toward the scaolds.
Regarding the proliferation and adhesion of hMSCs to the scaold
surface, the need to add bronectin and/or growth factors, such as
Bone Morphogenetic Proteins (BMP) 2 and 7, has been reported [38].
Our results demonstrated that the adhesion of AM-hMSCs to the
CMSs employed required no addition of any biologic component. In
fact, the formation of lamellipodia and production of microvesicles in
the AM-hMSCs in contact with CMSs were observed through SEM.
On the other hand, there is extensive evidence that MSCs do not
induce antigenic reactions in in vitro and in vivo assays [39]. Likewise,
the abovementioned collagen scaolds have inductive and conductive
properties, with no evidence of rejection in the animal models that
have been studied [15,16]. at correlates with our results, in which the
human cells (AM-hMSCs) grew and proliferated in bovine scaolds,
signifying it could be a good xenogenic combination. Currently, we
are evaluating the preliminary studies on CMSs construct and their
implantation in a rat model.
All in all, CMSs possess the physical and chemical characteristics
for their use as biomaterials in tissue engineering, enabling
the proliferation, adhesion, and dierentiation of AM-hMSCs.
Implantation could also stimulate angiogenesis and the bioinduction
of AM-hMSCs dierentiation. ose conditions are associated with
the 3D structure of CMSs that mimic the extracellular matrix and the
natural environment [40-42]. erefore, that construct (CMS plus
AM-hMSCs) oers a promising approach for future applications in
regenerative medicine.

Citation: León-Mancilla B, Martínez-Castillo M, Guerrero-Bustos R, Montesinos JJ, Hernández-Estévez E, et al. (2021) Human Mesenchymal Stem Cells
seeded in 3D Collagen Matrix Scaolds as a Therapeutic Alternative in Tissue Regeneration. J Regen Med 10:4.
• Page 8 of 9 •
Volume 10 • Issue 4 • 1000190
Conclusion
e procurement of human MSCs from amniotic membrane
was easy and safe and the protocol could be employed in tissue
engineering. We demonstrated that human MSCs seeded in xenogenic
collagen matrix scaolds showed adhesion and dierentiation into
chondroblasts, osteoblasts, and adipocytes, in dierentiation media.
e innovative construct described herein, could be a rst step
in developing an excellent alternative in Regenerative Medicine
for patients with chronic diseases that need to recover their health
through organ transplantation.
Conicts of Interest
The authors declare that they have no competing or commercial interest.
Funding Statement
Supported by the National Council for Science and Technology (CONACyT),
grant number SALUD-2016-272579 and PAPIIT-UNAM TA200515.
Acknowledgments
Benjamín León-Mancilla is a doctoral student from the Programa de
Doctorado en Ciencias Biomédicas, Universidad Nacional Autónoma de México
(UNAM) and has receiver a DGAPA fellowship. We greatly appreciate the
technical and ongoing support of MD Julia Antonio, MD Guillermo Ramirez and
MD Martha Zancatl (Gynecology and Obstetric Services, Hospital General de
México), Dr. Armando Pérez T., MS. Evelyn Pulido C., Chem. Verónica Rodríguez
M., Biol. Armando Zepeda R., and Biol. Francisco Pasos N., (Department of
Tissue and Cell Biology, Faculty of Medicine, UNAM); Marco Gudiño Z and
Jaime Sánchez (Unit of Experimental Medicine; School of Medicine, Universidad
Nacional Autónoma de México, UNAM. Hospital General de México) Dr. David
Giraldo G., MS Irma López M.; Biol. Ivonne Sánchez C. (Microscopy Unit, Faculty
of Medicine, UNAM). Dr. Ana Alfaro. (Pathology Service, Hospital General de
México). Tech. Martina Flores., and Chem. Carlos Montoya (Oncology Hospital,
IMSS).
References
1. World Health Organization (WHO) 2020.
2. Contreras AG (2016) Organ Tranplastation in Mexico. Transplantation,
100(10): 2011-2012.
3. Global Observatory on Donation and Transplantation (GODT) 2020.
4. Pereira MR, Mohan S, Cohen DJ, Husain SA, Dube GK, et al. (2020)
COVID-19 in solid organ transplant recipients: Initial report from the US
epicenter. Am J Transplant, 20(7):1800-1808.
5. Zhang H, Dai H, Xie X (2020) Solid organ transplantation during the COVID-19
pandemic. Frontiers in immunology. 11:1392.
6. Langer R, Vacanti J (1993) Tissue Engineering. Science. 260(5110):920-926.
7. Langer R, Langer L, Vacanti J (2014) Principles of Tissue Engineering. 4ed.
Amsterdam: Elsevier.
8. Pham VP (2016) Stem Cell Processing. Switzerland: Springer.
9. Lim J, Razi ZR, Law J, Nawi AM, Idrus RB (2016) MSCs can be dierentially
isolated from maternal, middle and fetal segments of the human umbilical
cord. Cytotherapy, 18(12):1493-1502.
10. Chien CC, Yen BL, Lee FK, Lai TH, Chen YC, et al. (2006) In vitro
dierentiation of human placenta-derived multipotent cells into hepatocyte-
like cells. Stem Cells. 24(7):1759-1768.
11. Montesinos JJ, Flores-Figueroa E, Castillo-Medina S, Flores-Guzman P,
Hernandez-Estevez E, et al. (2009) Human mesenchymal stromal cells
from adult and neonatal sources: comparative analysis of their morphology,
immunophenotype, dierentiation patterns and neural protein expression.
Cytotherapy, 11(2):163-176.
12. Badylak SF (2007) The extracellular matrix as a biologic scaold material.
Biomaterials, 28(25):3587-3593.
13. Freedman BR, Mooney DJ (2019) Biomaterials to mimic and heal connective
tissues. Adv Mater, 31(19):e1806695.
14. Meyer M (2019) Processing of collagen based biomaterials and the resulting
materials properties. Biomed Eng, 18:1-24.
15. Acevedo GC (2011) Xenoimplante de colágena en uretra de perro. Mexico
City: Universidad Nacional Autónoma de México.
16. Montalvo-Jave EE, Mendoza Barrera GE, Valderrama Trevino AI, Pina
Barba MC, Montalvo-Arenas C, et al. (2015) Absorbable bioprosthesis for the
treatment of bile duct injury in an experimental model. Int J Surg, 20:163-169.
17. Mazza G, De Coppi P, Gissen P, Pinzani M (2015) Hepatic regenerative
medicine. J Hepatol, 63(2):523-524.
18. Rodriguez-Fuentes N, Rodriguez-Hernandez AG, Enriquez-Jimenez J,
Alcantara-Quintana LE, Fuentes-Mera L et al. (2013) Nukbone(R) promotes
proliferation and osteoblastic dierentiation of mesenchymal stem cells from
human amniotic membrane. Biochem Biophys Res Commun, 434(3):676-80.
19. Li Y, Wu Q, Wang Y, Li L, Chen F, et al. (2017) Construction of bioengineered
hepatic tissue derived from human umbilical cord mesenchymal stem
cells via aggregation culture in porcine decellularized liver scaolds.
Xenotransplantation, 24(1): 1-15.
20. León-Mancilla BH, Araiza-Téllez MA, Flores-Flores JO, Piña-Barba MC
(2016) Physico-chemical characterization of collagen scaolds for tissue
engineering. J Appl Res Tech. 14:77-85.
21. Vazquez NG, Echeverria O (2000) Introduction to electron microscopy
applied to biological sciences. Mexico City: Economic Culture Fund, 168.
22. Oja S, Komulainen P, Penttila A, Nystedt J, Korhonen M (2018) Automated
image analysis detects aging in clinical-grade mesenchymal stromal cell
cultures. Stem Cell Res Ther, 9: 1-6.
23. Gnecchi M (2016) Mesenchymal stem cells. Methods and protocols. Methods
in molecular biology. 2ed. New York: Humana Press.
24. Nicolas CT, Hickey RD, Chen HS, Mao SA, Lopera HM, et al. (2017) Concise
review: Liver regenerative medicine: From hepatocyte transplantation to
bioarticial livers and bioengineered grafts. Stem Cells, 35(1):42-50.
25. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, et al. (2006)
Minimal criteria for dening multipotent mesenchymal stromal cells. The
International Society for Cellular Therapy position statement. Cytotherapy,
8(4):315-317.
26. Alrefaei GI, Alkarim SA, Abduljabbar HS (2019) Impact of mothers’ age on
telomere length and human telomerase reverse transcriptase expression in
human fetal membrane-derived mesenchymal stem cells. Stem Cells Dev,
28(24):1632-1645.
27. Akberdin IR, Omelyanchuk NA, Fadeev SI, Leskova NE, Oschepkova EA,
et al. (2018) Pluripotency gene network dynamics: System views from
parametric analysis. PLoS One, 13(3):e0194464.
28. Pitrone M, Pizzolanti G, Coppola A, Tomasello L, Martorana S, et al. (2019)
Knockdown of NANOG reduces cell proliferation and Induces G0/G1 cell
cycle arrest in human adipose stem cells. Int J Mol Sci. 20(10): 1-12.
29. Leyva-Leyva M, Barrera L, López-Camarillo C, Arriaga-Pizano L, Orozco-
Hoyuela G, et al. (2013) Characterization of mesenchymal stem cell
subpopulations from human amniotic membrane with dissimilar osteoblastic
potential. Stem Cells Dev, 22(8):1275-1287.
30. Papait A, Vertua E, Magatti M, Ceccariglia S, De Munari S, et al. (2020)
Mesenchymal stromal cells from fetal and maternal placenta possess key
similarities and dierences: Potential implications for their applications in
regenerative medicine. Cells, 9(1): 1-23.
31. Lin CS, Xin ZC, Dai J, Lue TF (2013) Commonly used mesenchymal stem cell
markers and tracking labels: Limitations and challenges. Histol Histopathol,
28(9):1109-16.
32. Naji A, Eitoku M, Favier B, Deschaseaux F, Rouas-Freiss N, et al. (2019)
Biological functions of mesenchymal stem cells and clinical implications. Cell
Mol Life Sci. 76(17):3323-3348.
33. Moraes DA, Sibov TT, Pavon LF, Alvim PQ, Bonadio RS, et al. (2016) A
reduction in CD90 (THY-1) expression results in increased dierentiation of
mesenchymal stromal cells. Stem Cell Res Ther, 7:1-14.
34. Uder C, Bruckner S, Winkler S, Tautenhahn HM, Christ B (2018) Mammalian
MSC from selected species: Features and applications. Cytometry A.
93(1):32-49.

Citation: León-Mancilla B, Martínez-Castillo M, Guerrero-Bustos R, Montesinos JJ, Hernández-Estévez E, et al. (2021) Human Mesenchymal Stem Cells
seeded in 3D Collagen Matrix Scaolds as a Therapeutic Alternative in Tissue Regeneration. J Regen Med 10:4.
• Page 9 of 9 •
Volume 10 • Issue 4 • 1000190
35. Yang W, Xia R., Zhang Y, Zhang H, Bai L (2017) Decellurized liver scaold
for liver regeneration Methods in Molecular Biology, 1577:11-23.
36. Wang RM, Christman KL (2016) Decellularized myocardial matrix hydrogels:
In basic research and preclinical studies. Advanced drug delivery reviews,
96:77-82.
37. Bonartsev AP, Zharkova II, Voinova VV, Kuznetsova ES, Zhuikov VA, et al.
(2018) Poly(3-hydroxybutyrate)/poly(ethylene glycol) scaolds with dierent
microstructure: the eect on growth of mesenchymal stem cells. 3 Biotech,
8(8):1-10.
38. Ramalho L, Nedjari S, Guarino R, Awaja F, Gugutkov (2020) Fibronectin/
thermo-responsive polymer scaold as a dynamic ex vivo niche for
mesenchymal stem cells. J Mater Sci Mater Med, 31(12):129.
39. Fath-Bayati L, Ai J (2020) Assessment of mesenchymal stem cell eect
on foreign body response induced by intraperitoneally implanted alginate
spheres. J biol materials res Part A, 108(1):94-102.
40. Florian B, Michel K, Ste G, Nicole H, Frant M, et al. (2019) MSC
dierentiation on two-photon polymerized, stiness and BMP2 modied
biological copolymers. Biomed Mater. 14: 1-13.
41. Ong CS, Yesantharao P, Huang CY, Mattson G, Boktor J, et al. (2018) 3D
Bioprinting using Stem Cells. Pediatric Research.:1-23.
42. Somaiah C, Kumar A, Mawrie D, Sharma A, Patil SD, et al. (2015) Collagen
Promotes Higher Adhesion, Survival and Proliferation of Mesenchymal Stem
Cells. PLoS One, 10(12):e0145068.
Author Aliations Top
1Liver, Pancreas and Motility (HIPAM) Laboratory; Unit of Experimental
Medicine; School of Medicine, Universidad Nacional Autónoma de México,
UNAM. Hospital General de México
2Department of Gynecology and Obstetric Services, Hospital General de
México. “Dr. Eduardo Liceaga”, Mexico City, Post code 06726, Mexico City,
Mexico
3Department of Oncology Research Unit, Oncology Hospital, Instituto Mexicano
del Seguro Social, National Medical Center, IMSS, Post code 06720, Mexico
City, México
4Department of Materials Research Institute, Universidad Nacional Autónoma
de México, Post code 04950, Mexico City, Mexico
5Department of Surgery, Laboratory Regenerative Medicine, Faculty of
Medicine, Universidad Nacional Autónoma de México, Post code 04950,
Mexico City, Mexico