Content uploaded by Mingming Zhai
Author content
All content in this area was uploaded by Mingming Zhai on Oct 27, 2021
Content may be subject to copyright.
Pulsed Electromagnetic Fields Promote InVitro
OsteoblastogenesisThrough aWnt /b-Catenin
Signaling-Associated Mechanism
Mingming Zhai,
1#
Da Jing,
1#
ShichaoTong,
1
Ya n W u,
2
PanWang,
1
Zhaobin Zeng,
3
Guanghao Shen,
1
XinWang,
4
Qiaoling Xu,
5
and Erping Luo
1
*
1
Department ofBiomedical Engineering, Fourth Military Medical University, Xi’an, China
2
Institute of Orthopaedics, Xijing Hospital, Fourth Military Medical University,
Xi’an, China
3
Department of Stomatology, General Hospital of Shenyang MilitaryArea Command,
Shenyang, China
4
Department ofPreventive Medicine, FourthMilitary Medical University, Xi’an, China
5
Department of Nursing, Fourth Military Medical University, Xi’an, China
Substantial evidence indicates that pulsed electromagnetic fields (PEMF) could accelerate fracture
healing and enhance bone mass, whereas the unclear mechanism by which PEMF stimulation
promotes osteogenesis limits its extensive clinical application. In the present study, effects and
potential molecular signaling mechanisms of PEMF on in vitro osteoblasts were systematically
investigated. Osteoblast-like MC3T3-E1 cells were exposed to PEMF burst (0.5, 1, 2, or 6 h/day)
with 15.38 Hz at various intensities (5 Gs (0.5mT), 10 Gs (1 mT), or 20 Gs (2 mT)) for 3 consecutive
days. PEMF stimulation at 20 Gs (2 mT) for 2 h/day exhibited most prominent promotive effects
on osteoblastic proliferation via Cell Counting kit-8 analyses. PEMF exposure induced well-
organized cytoskeleton, and promoted formation of extracellular matrix mineralization nodules.
Significantly increased proliferation-related gene expressions at the proliferation phase were
observed after PEMF stimulation, including Ccnd 1 and Ccne 1. PEMF resulted in significantly
increased gene and protein expressions of alkaline phosphatase and osteocalcin at the differentia-
tion phase of osteoblasts rather than the proliferation phase via quantitative reverse transcription
polymerase chain reaction and Western blotting analyses. Moreover, PEMF upregulated gene and
protein expressions of collagen type 1, Runt-related transcription factor 2 and Wnt/b-catenin
signaling (Wnt1, Lrp6, and b-catenin) at proliferation and differentiation phases. Together, our
present findings highlight that PEMF stimulated osteoblastic functions through a Wnt/b-catenin
signaling-associated mechanism and, hence, regulates downstream osteogenesis-associated gene/
protein expressions. Bioelectromagnetics. 37:152–162, 2016. © 2016 Wiley Periodicals, Inc.
Key words: pulsed electromagnetic fields; osteoblasts; osteogenetic; Wnt/b-catenin signaling
INTRODUCTION
Osteoporosis is one of the most common clinical
diseases, characterized by bone mass loss and bone
microarchitecture deterioration, resulting in bone
fragility and an increased risk of fractures [Kanis
et al., 2005]. Traditional pharmacological agents
either promoting bone formation (e.g., parathyroid
hormone, insulin-like growth factor, and growth
hormone) or inhibiting bone resorption (e.g., calcito-
nin, estrogen, and bisphosphonate) exhibit positive
effects on preventing and reversing osteoporosis;
nonetheless high cost and potential side effects (e.g.,
increased risks of hypercalcemia and breast cancer)
might become a non-negligible limitation [Paterson,
1980; Mahavni and Sood, 2001; Musette et al., 2010;
Grant sponsors: National Science Foundation of China; grant
number: 81471806, 31270889; Shaanxi Provincial Natural Sci-
ence Foundation; grant number: 2014JQ4139; Doctoral Thesis
Foundation of the Fourth Military Medical University; grant
number: 4142D83ZC.
Conflicts of interest: None.
#
Co-first author
*Correspondence to: Erping Luo, Department of Biomedical
Engineering, Fourth Military Medical University, No. 169 Changle
West Road, Xi’an, China. E-mail: luoerping@fmmu.edu.cn
Received for review 23 July 2015; Accepted 30 January 2016
DOI: 10.1002/bem.21961
Published online 18 February 2016 in Wiley Online Library
(wileyonlinelibrary.com).
Bioelectromagnetics 37:152^162 (2016)
2016 Wiley Periodicals, Inc.
Rizzoli et al., 2011]. As a consequence, safe and
noninvasive biophysical therapies for osteoporosis
might be more promising in clinical application.
Since the first application of pulsed electro-
magnetic fields (PEMF) by Bassett et al. [1974]
accelerated clinical bone fracture healing, biological
effects of PEMF have gained extensive attention
[Funk et al., 2009]. PEMF were also approved by the
U.S. Food and Drug Administration (FDA) in 1979 as
a safe, noninvasive treatment method [Bassett et al.,
1982] based on the early clinical findings of Bassett
et al. [1977]. Subsequently, substantial evidence has
accumulated to show that PEMF as an alternative
noninvasive method are capable of producing satisfy-
ing therapeutic effects on a wide range of bone
diseases, such as fresh and nonunion fractures [Bassett
et al., 1982; Assiotis et al., 2012] and osteoarthritis
[Thamsborg et al., 2005; Ryang et al., 2013]. Both
experimental and clinical studies have demonstrated
that PEMF stimulation was able to promote potently
osteogenesis, enhance bone mineralization, and
improve skeletal biomechanical properties [Rubin
et al., 1989; Chang and Chang, 2003; Shen and Zhao,
2010; Jing et al., 2010, 2011]. Several in vitro studies
have also demonstrated PEMF capacity in promoting
osteoblastogenesis. Diniz et al. [2002] found that
PEMF with 15.38 Hz pulse burst at 70 Gs (7 mT)
could improve osteoblastic proliferation and enhanced
cellular differentiation. Tsai et al. [2007] found that
cell numbers of osteoblasts significantly increased by
stimulation of PEMF with 7.5 Hz, 1.3 Gs (0.13 mT),
but decreased by PEMF at 3.2 Gs (0.32 mT). Chang
et al. [2004] found that PEMF with 15.38 Hz at 1 Gs
(0.1 mT) could significantly enhance osteoblastic
proliferation, whereas PEMF did not exhibit effects
on the extracellular matrix synthesis. Despite these
positive findings, optimal stimulation parameters and
exact molecular signaling mechanisms of PEMF
therapy on osteoblastogenesis and osteogenesis re-
main elusive, which might be an essential limitation
of extensive clinical application of PEMF.
Canonical wingless-type MMTV integration site
family member 1 (Wnt) signaling has proven to be an
essential signaling pathway mediating bone metabo-
lism and bone quality [Baron and Kneissel, 2013].
Extracellular Wnt proteins can bind to the Frizzled
and Lrp5/6 co-receptors on the cell membrane, and
eventually lead to stabilization of b-catenin in cyto-
plasm and promote more Wnt-targeted gene transcrip-
tion in the cell nucleus. Activation of canonical Wnt
signaling can increase bone formation via multiple
routes, including promoting differentiation of mesen-
chymal stem cells into mature osteoblasts, enhancing
proliferation and mineralization of osteoblasts, and
preventing the osteoblast apoptosis [Krishnan et al.,
2006; Jing et al., 2015]. Canonical Wnt signaling has
also been shown to activate osteogenesis-related
signaling molecules, including alkaline phosphatase
(ALP) and Runx2 [Gaur et al., 2005; Zhang et al.,
2013]. However, the potential role of canonical Wnt
signaling in mediating PEMF-induced enhancement
of osteoblastic activities remains poorly understood.
The present study used a PEMF waveform with
15.38 Hz pulsed burst, which has proven effective in
inhibiting bone loss and promoting bone quality in
osteoporotic animals as previously reported by our
group [Jing et al., 2011, 2014]. First, we explored
optimal magnetic field intensity and exposure dura-
tion on osteoblastic proliferation via Cell Counting
kit-8 (CCK-8) assays. Second, efficiency of PEMF
simulation on osteoblastic microstructure and bone
tissue-like formation were systematically evaluated
via cytoskeletal fluorescence staining and alizarin red
staining. Third, gene and protein expressions of major
osteogenesis-related molecules, including alkaline
phosphatase (ALP), osteocalcin (OCN), collagen type
1 (COL1), and Runt-related transcription factor 2
(Runx2), were also examined for osteoblasts via
quantitative real-time polymerase chain reaction
(qRT-PCR) and Western blotting analyses. Moreover,
gene and protein expressions associated with Wnt/b-
catenin signaling pathway, including Wnt1, Lrp6, and
b-catenin were quantified.
MATERIALS AND METHODS
Reagents
Mouse monoclonal antibodies against Wnt1,
b-catenin, LRP6, Runx2, ALP, and b-tubulin were
obtained from Abcam (Cambridge, MA). Mouse
anti-OCN monoclonal antibody was obtained from
Millipore (Billerica, MA). Horseradish peroxidase
(HRP)-conjugated goat secondary antibodies
and 40,6-diamidino-2-phenylindole (DAPI) were
obtained from Bioworld (Atlanta, GA). CCK-8 was
obtained from Nanjing EnoGene Biotech (Nanjing,
China). Phalloidin-FITC and Alizarin Red S were
obtained from Sigma (St. Louis, MO). Bicincho-
ninic acid (BCA) Protein Assay kit was obtained
from Pierce Chemical (Rockford, IL). TRizol was
obtained from Invitrogen (Carlsbad, CA). FastQuant
RT Kit was obtained from TIANGEN BIOTECH
(Beijing, China). Maxima SYBR Green qPCR was
obtained from Thermo Fisher Scientific (Waltham,
MA). Amersham ECL prime reagent, a-modified
minimal essential medium (a-MEM), penicillin,
streptomycin, and fetal bovine serum (FBS) were
PEMF Promote Ost eogenesis Via Wnt/ b-Catenin 153
Bioelectromagnetics
obtained from GE Healthcare (Pittsburgh, PA). Cell
culture plates were purchased from Corning (New
York, NY). BCIP/NBT ALP color development kit
was purchased from Beyotime (Shanghai, China).
Cell Culture
Mouse osteoblast-like MC3T3-E1 cells were
purchased from American Type Culture Collection
(ATCC, Manassas, VA). MC3T3-E1 cells were cul-
tured in growth medium, which is a-MEM supple-
mented with 100 units/ml penicillin, 100 mg/ml
streptomycin, 10% FBS, and incubated with a water-
saturated atmosphere of 5% CO
2
at 37 8C. To study
gene and protein expression in cellular proliferation
stage, cell suspension was seeded into the central two
wells of a 6-well cell culture plate (1 ml/well) with
growth medium at a density of 1 10
5
cells/ml. After
adhesion, cells were exposed to PEMF for 2 h/day.
After 2-day PEMF stimulation, monolayer cells reach-
ing about 80% confluence were used for the experi-
ment. To investigate osteogenesis-related gene and
protein expressions and ALP staining in the cell
differentiation stage, the cell suspension was seeded
into central two wells of a 6-well cell culture plate
(2 ml/well) at density of 2 10
5
cells/ml. After adhe-
sion, growth medium was replaced by osteoinductive
medium (a-MEM containing 10% FBS, 1% penicil-
lin-streptomycin, 50 mg/ml ascorbic acid, and 4 mM
b-glycerophosphate). Cells were then exposed to
2 h/day PEMF stimulation. ALP staining was per-
formed post 5-day PEMF stimulation, and qRT-PCR
and Western blotting analyses were performed after
7-day PEMF exposure.
PEMF Stimulation
PEMF exposure device (GHY-III, FMMU,
Xi’an, China; China Patent no.ZL02224739.4) was
composed of a pulsed signal generator (current
source) and Helmholz coils assembly with two-coil
array (Fig. 1), which comprises a power supply
circuit, intensity adjustment circuit, protective circuit,
warning circuit, impulsator for producing high/low
frequency modulation pulse, switching power ampli-
fier circuit, output circuit, and display circuit. PEMF
waveform used in the present experiment consisted of
a pulsed burst (burst width, 5 ms; pulse width, 0.2 ms;
pulse wait, 0.02 ms; burst wait, 60 ms; pulse rise,
0.3 ms; pulse fall, 2.0 ms) repeated at 15.38 Hz
(Fig. 1). Interval distance between two coils (20 cm
diameter) were 10 cm, and turn numbers of enamel-
coated copper wire (1.0 mm diameter) was 80. To
monitor waveform and amplitude of the current in the
coils, a resistor of 0.5 Ωwas placed in series with
the coils and voltage drop across the resistor was
observed with an oscilloscope (Agilent Technologies,
Santa Clara, CA) all the time during PEMF exposure
period. In the present study, baseline level of magnetic
field was 0 Gs (0 mT), and determined peak magnetic
field intensity of coils was 5 Gs (0.5 mT), 10 Gs
(1 mT) and 20 Gs (2 mT), respectively. Accuracy for
peak magnetic field measurement was further con-
firmed using a Gaussmeter (Model 455 DSP, Lake
Shore Cryotronics, Westerville, OH) with a transver-
sal Hall Probe (HMFT-3E03-VF). Measured back-
ground electromagnetic field was 0.50 0.02 Gs
(50 2mT). Peak magnetic field exhibited 0.05 Gs
(5 mT), 0.1 Gs (10 mT), and 0.2 Gs (20 mT) fluctu-
ation during daily 2 h PEMF exposure for 5 Gs
(0.5 mT), 10 Gs (1 mT), and 20 Gs (2 mT) peak
magnetic field, respectively. For cell culture plate,
variation of magnetic field between the center and
edges of the plate along the length of the coils
exhibited <0.1 Gs (10 mT), <0.4 Gs (40 mT) and
<0.6 Gs (60 mT) for 5 Gs (0.5 mT), 10 Gs (1 mT), and
20 Gs (2 mT) peak magnetic field, respectively. For
confocal cell culture dish with 35 mm diameter,
variation of magnetic field between center and outside
edge along the length of the coils exhibited <0.05 Gs
(5 mT), <0.2 Gs (20 mT), and <0.4 Gs (40 mT) for
5 Gs (0.5 mT), 10 Gs (1 mT), and 20 Gs (2 mT) peak
magnetic field, respectively. The exposure apparatus
with the same frequency and waveform exhibited
significantly inhibitive effects on bone loss in our
previous in vivo studies [Jing et al., 2010, 2011, 2013,
2014]. An accelerometer (VIB-5, Shanghai Xingsheng
Detecting Instrument, China) was employed to deter-
mine potential mechanical vibrations induced by
electromagnetic stimulation on the exposed cell
culture plate. We did not detect any mechanical
vibratory signals throughout stimulation period via
measurement of accelerometer. The osteoblast-seeded
cell culture plate in the PEMF group was placed in the
Fig. 1. Schematic representation of PEMF generator together
with a Helmh olz coil a ssembly with two -coil array.
154 Zhai et al.
Bioelectromagnetics
center of the coils to maximize uniformity of magnetic
field along axial plane of coils. Cells in the Control
group were placed similarly, but in sham PEMF
stimulation where coils were inactivated. The Helm-
holz coils in the two groups were placed in two
separate incubators, and cells were cultured with a
water-saturated atmosphere of 5% CO
2
at 37 8C all
the time throughout experiment.
CCK-8 Assay
For the proliferation assay, osteoblast suspen-
sions were seeded into the 96-well cell culture plates
with growth medium at density of 1 10
4
cells/ml
with 200 ml per well and allowed to grow for 12 h to
ensure sufficient adhesion and then cells were sub-
jected to PEMF exposure for 2 h/day. After 2 day
PEMF exposure, a CCK-8 kit was used to quantify
osteoblastic proliferation. Each well of the plate was
added with 20 ml CCK-8 solution, and incubated at
37 8C for 2 h. The cell-culture plate was then shaken
for 1 min and optical density (OD) value examined
with a microplate reader at a 450 nm wavelength
(TECAN Infinite M200 Pro, TECAN, Switzerland).
Each well in the 96-well cell culture plate was
regarded as an independent sample for statistical
analysis.
ALP Staining
After 5-day PEMF stimulation, cell culture
plates were washed three times with PBS and fixed
with 4% formaldehyde solution. ALP staining was
then performed using the BCIP/NBT ALP color
development kit [Yan et al., 2014] and images were
observed under an optical microscope (LEICA DM
LA, Leica Microsystems, Heidelberg, Germany). For
each well, five random fields of view were selected
to analyze ALP activity. ImageJ software (National
Institutes of Health, Bethesda, MD) was used to
analyze stains indicating products of enzyme activity
[Schneider et al., 2012]. Each well in the 6-well cell
culture plate was regarded as an independent sample.
Cytoskeleton Staining
Cell morphology and cytoskeletal arrangement
of MC3T3-E1 cells were examined via the F-actin
cytoskeleton stained with fluorescein isothiocyanate
(FITC)-conjugated phalloidin. Cells were cultured in
the confocal cell culture dish (35 mm diameter) with
growth medium for 12 h at density of 1 10
5
cells/ml.
Plates were then exposed to PEMF for 2 h/day. After
2-day PEMF stimulation, cells were fixed in 4%
formaldehyde solution for 5 min, and then permeabi-
lized with 0.1% Triton X-100 for 5 min. Cells were
blocked with 1% bovine serum albumin (BSA) in
phosphate buffer saline (PBS) for 1 h. Samples were
stained with 50 mg/ml FITC for 40 min at room
temperature (RT) in the dark, and subsequently
stained with 50 mg/ml 40,6-diamidino-2-phenylindole
(DAPI) for 5 min to label cell nuclei. Then, samples
were transferred to a confocal laser scanning micros-
copy (FluoView FV 1000, Olympus, Japan) to visual-
ize cytoskeletal microstructure of MC3T3-E1 cells.
Each dish was regarded as an independent sample.
Total RNA Isolation and qRT-PCR
After PEMF exposure, total ribonucleic acid
(RNA) was isolated using TRizol according to
manufacturer’s protocol and quantified using spectro-
photometry (Bio-Rad SmartSpecPlus, Bio-Rad). A
total of 1 mg RNA was reverse-transcribed into cDNA
in 20 ml system with oligo(dT)
18
as a primer using
FastQuant RT Kit according to manufacturer’s
instructions. qRT-PCR was performed on 2 ml cDNA
in a reaction of 20 ml system with Maxima SYBR
Green qPCR using the Bio-Rad CFX96 real-time PCR
detection system (Philadelphia, PA). Primer sequen-
ces utilized in qRT-PCR are shown in Table 1.
Protocol for qRT-PCR reactions consisted of an initial
denaturation at 95 8C for 30 s followed by 40-cycle
denaturation at 95 8C for 15 s, annealing at 55 8C for
15 s, and extension at 55 8C for 15 s. b-actin was used
as an internal control for normalization. Relative
quantity of mRNA was calculated using the 2
DDCt
method. All qRT-PCR reactions were performed in at
least quartic. Each well of the plate was regarded as
an independent sample.
Protein Preparation and Western Blotting
Analysis
After PEMF exposure, cells were washed with
ice-cold PBS and lysed to release whole proteins by
RIPA buffer with 1 mM PMSF. Cell lysates were
transferred into a pre-cooled microfuge tube and
maintained constant agitation for 30 min at 4 8C.
Protein extracts were then centrifuged at 4 8C for
20 min at 12,000 rpm. Protein content of the superna-
tant was collected and protein concentration deter-
mined using BCA Protein Assay kit. Protein extracts
(30 mg per sample) were subjected to electrophoretic
separation by 8% and 10% Tris-glycine SDS-PAGE
respectively and transferred onto PVDF membranes
(Millipore) after mixed with 2 loading buffer and
boiled for 5 min. PVDF membranes were blocked in
Tris Buffered Saline with Tween (TBST; Tris Buffer
Saline, 0.5% Tween-20) containing 5% BSA for 2 h
and incubated overnight at 4 8C with primary anti-
bodies to ALP (1:1000), OCN (1:1000), Runx2
(1:1000), Wnt1 (1:1000), Lrp6 (1:1000), b-catenin
PEMF Promote Ost eogenesis Via Wnt/ b-Catenin 155
Bioelectromagnetics
(1:1000), and b-tubulin (1:3000) in TBST containing
5% BSA. Membranes were then incubated with a
1:3000 dilution of HRP-conjugated goat anti-rabbit or
anti-mouse secondary antibody for 1 h at RT, and then
visualized by an ECL chemiluminescence system (GE
ImageQuant 350, GE Healthcare). Semi-quantitative
analysis was performed using Quantity One Software
(Bio-Rad). b-tubulin was used as an internal control
for normalization. At least three independent experi-
ments were performed. Each well of the plate was
regarded as an independent sample.
Extracellular Matrix (ECM) Mineralization
A 2 ml aliquot of cell suspension was seeded
into the central two wells of a 6-well cell culture plate
at density of 2 10
5
cells/ml. Each well of a 6-well
cell culture plate was regarded as an independent
sample. After cultured overnight, culture medium
was replaced with osteoinductive medium. Cells were
then exposed to PEMF for 2 h/day. After 7-day PEMF
stimulation, ECM mineralization was evaluated using
the Alizarin Red staining [Wang et al., 2014b]. In
brief, after washing with PBS, samples were fixed in
4% formaldehyde solution for 10 min. Calcium depos-
its were stained with 2% Alizarin Red S (pH 8.3). To
quantify nodules, stain was solubilized using 0.5 ml of
5% SDS in 0.5 N HCl for 30 min at RT. Solubilized
stain (0.15 ml) was transferred to a 96-well plate,
and absorbance measured using a microplate reader
at 405 nm (TECAN Infinite M200 Pro, TECAN,
Switzerland).
Statistical Analysis
All data presented here were expressed as
mean standard deviation (SD). Statistical analyses
were performed using computer software Microsoft
SPSS version 13.0 for Windows (SPSS, Chicago,
IL). One-way analysis of variance (ANOVA) with
Turkey post hoc analysis was used for CCK-8
assays to determine difference between each of the
two groups with various PEMF exposure parame-
ters. Differences of qRT-PCR, Western blotting and
ECM mineralization results between the Control
group and PEMF group were examined using a
Student t-test. P<0.05 was considered statistically
significant.
RESULTS
Osteoblastic Proliferation and Morphology
As shown in Figure 2A, PEMF exposure with
5 Gs (0.5 mT), 10 Gs (1 mT), and 20 Gs (2 mT) peak
intensity significantly increased cell number of
osteoblasts as compared with Control group via
CCK-8 assays (P<0.05). Furthermore, cell num-
bers in the 20 Gs (2 mT) PEMF stimulation group
were significantly higher than those in the 5Gs
(0.5 mT) and 10 Gs (1 mT) PEMF exposure groups
(P<0.05). Cell numbers of osteoblasts were signif-
icantly increased after PEMF exposure for 1, 2, and
6h (P<0.05), but not significantly changed after
0.5 h PEMF exposure. Furthermore, 2 h PEMF
TABLE 1. Primer Sequences Utilized in the qRT-PCR
Gene Primer Primer sequence(50-30) Product length
Wnt1 F GGGGAGCAACCAAAGTCG 187
R TGGAGGAGGCTATGTTCACG
b-catenin F GGAAAGCAAGCTCATCATTCT 171
R AGTGCCTGCATCCCACCA
LRP6 F CAGCACCACAGGCCACCAA 227
R TCGAGACATTCCTGGAAGAG
ALP F GTTGCCAAGCTGGGAAGAACAC 121
R CCCACCCCGCTATTCCAAAC
OCN F GTGTGAGCTTAACCCTGC 160
R ACAGGGAGGATCAAGTCC
Runx2 F TGCACCTACCAGCCTCACCATAC 105
R GACAGCGACTTCATTCGACTTCC
Ccnd 1 F GAAGGAGATTGTGCCATC 141
R TTCTTCAAGGGCTCCAGG
Col 1 F GAAAGGCTGGAGAGCGAG 132
R CGGGACCTTGTTCACCTC
Ccne 1 F GCTCCGACCTTTCAGTCC 124
R CAGGGCTGACTGCTATCC
b-actin F GCCAACACAGTGCTGTCT 114
R AGGAGCAATGATCTTGATCTT
156 Zhai et al.
Bioelectromagnetics
exposure exhibited the most prominent promotive
effects on cell proliferation. Representative in vitro
osteoblastic FITC cytoskeleton staining images
(Fig. 2C) show that cells in the PEMF group
displayed well-developed cytoskeleton with higher
fluorescence intensity, more microfilaments, and
thicker stress fibers. In contrast, cells in the Control
group showed lower cell number and poorly orga-
nized cytoskeleton.
ALP Staining
As shown in Figure 3A, ALP staining reveals
that cells cultured in osteoinductive medium in the
PEMF group were more positive than those in
Control. As shown in Figure 3B, quantitative compar-
ison of ALP staining demonstrates that ALP activity
was significantly increased after PEMF stimulation as
compared with the Control group in the differentiation
stage (P<0.05).
Osteoblastogenesis-Related Gene Expressions
Results for osteoblastogenesis-related gene
expressions in MC3T3-E1 cells at the proliferation
stage and differentiation stage are shown in Figure 4.
As compared with the Control group, PEMF stimula-
tion significantly enhanced proliferation-related gene
expressions at the cellular proliferation stage, includ-
ing Ccnd 1 and Ccne 1 (Fig. 4A, P<0.05). PEMF
Fig. 2. Effects of PEMF stimulation on in vitro cellular proliferation and morphologyof MC3T3 -E1
cells. (A) Evaluation foreffects of PEMF (2 h per day) withvariouspeak intensities on osteoblastic
proliferationvia CCK-8 assays.Data arepresentedas mean SD (n¼5). P<0.05 versus Control
group,
#
P<0.05 versus 5 Gs (0.5 mT) PEMF group. ( B) Evaluation for effects of PEMF at 20 Gs
(2 mT) peak intensity with various exposure durations on osteoblastic proliferation via the CCK-8
assays. Data are presented as the mean SD (n¼15). P<0.05 versus Control group,
#
P<0.05
versus 0.5 h PEMF group,
$
P<0.05 versus1 h PEMF group,
&
P<0.05versusthe2hPEMFgroup.
(C) Representative in vitro osteoblastic FITC cytoskeleton staining images in the Control and
PEMFgroups.Scalebar represents 20 mm.
PEMF Promote OsteogenesisVia Wnt/ b-Catenin 157
Bioelectromagnetics
exposure also significantly promoted gene expression
of Runx2, whereas PEMF decreased ALP gene
expressions in the proliferation stage (P<0.05). No
significant difference of OCN gene expression was
observed between Control and PEMF groups in the
proliferation stage. Furthermore, PEMF enhanced
gene expressions of canonical Wnt signaling during
the stage of cellular proliferation, including Wnt1,
Lrp6, and b-catenin (P<0.05). As shown in
Figure 4B, PEMF resulted in significant increases in
osteogenesis-associated gene expressions in the dif-
ferentiation stage, including ALP, OCN, Runx2,
COL1 (P<0.05). Moreover, gene expressions of
canonical Wnt signaling (including Wnt1, Lrp6, and
b-catenin) were also significantly higher in the PEMF
group than those in Control (P<0.05).
Osteoblastogenesis-Related Protein Expressions
Results of in vitro osteoblastogenesis-related
protein expressions via Western blotting analyses are
shown in Figure 5. In the proliferation stage, ALP
protein expression was decreased and OCN protein
expression was not obviously changed by PEMF.
Runx2, Wnt1, Lrp6, and b-catenin protein expressions
were significantly higher in PEMF group than in
Control in the proliferation stage (P<0.05). In the
differentiation stage, significant increases of protein
expressions were found after PEMF exposure, includ-
ing ALP, OCN, Runx2, Wnt1, Lrp6, and b-catenin
(P<0.05).
Extracellular Matrix (ECM) Mineralization
As shown in Figure 6, the ECM mineralization
via Alizarin Red staining revealed increased area of
mineralization with more stained nodules. Quantifica-
tion of the solubilized stain demonstrates that ECM
mineralization was dramatically increased by PEMF
stimulation as compared with Control (P<0.05).
DISCUSSION
As a promising safe and noninvasive approach,
PEMF have proven to be able to promote osteogenesis
both experimentally and clinically [Lohmann et al.,
2003; Thamsborg et al., 2005; Jing et al., 2010;
Rosenberg et al., 2012; Ryang et al., 2013]. However,
optimal stimulation parameters and exact molecular
signaling mechanisms of PEMF therapy on osteoblas-
togenesis and osteogenesis remain poorly understood.
In the present study, our results show that 15.38 Hz
PEMF burst stimulation at 20 Gs (2 mT) for 2 h/day
exhibited the most prominent effects on stimulating
osteoblastic proliferation. Interestingly, this parameter
is the same with the parameter used in our previous in
vivo studies, in which we found obvious efficiency of
PEMF on inhibiting bone loss in osteoporotic rats
[Jing et al., 2011, 2013, 2014]. Furthermore, our
results reveal significant enhancement of PEMF
exposure on in vitro osteoblastic activities and osteo-
genesis through a canonical Wnt signaling-associated
mechanism, implying that canonical Wnt signaling
may act as an essential upstream activator for
osteogenesis. These findings not only provide novel
insights into the scientific and reasonable application
of electromagnetic parameters in promoting osteogen-
esis, but also enrich our basic knowledge of molecular
mechanisms involved in osteoblastic functions in
response to electromagnetic stimulation.
Bone formation involves a battery of response
processes of osteoblasts, including cellular prolifera-
tion, differentiation, and mineralization. First, cell
proliferation is the initial stage of the cell cycle, which
includes the processes of cell growth followed by cell
division. Osteoblastic proliferation is a critical indica-
tion for osteoblastic activities, and also facilitates
enhancement of cellular differentiation and minerali-
zation. Ccnd 1 is synthesized rapidly during the G1
phase of cell cycle, which mediates the subunit of
cyclin-dependent kinases CDK4 and CDK6 so as to
Fig. 3. Effects of PEMF stimulation on ALP of MC3T3-E1 cells via BCIP/NBTstaining. (A) Rep-
resentative optical images (40microscope objective) via BCIP/NBT staining for MC3T3-E1
cells in Control and PEMF groups. (B) Quantitative comparisons of optical density values of
ALP staining in Control and PEMF groups. Values all expressed as mean SD (n¼5).
P<0.05 versus Control group.
158 Zhai et al.
Bioelectromagnetics
regulate the G1 phase transferring into the S-phase
[Harper and Brooks, 2005]. Ccne 1 accumulates at the
G1/S phase boundary and forms a regulatory subunit
of CDK2 required for transition of G1/S phase,
resulting in promotion of cell-cycle progression
[Dulic et al., 1992; Koff et al., 1992]. In the present
investigation, our results show that PEMF promoted
osteoblastic proliferation and also upregulated gene
expressions of Ccnd 1 and Ccne 1. These findings
indicate that PEMF increased the osteoblastic cell
number via potentially shortening the cell cycle,
which leads to acceleration of cell-cycle progression
from the proliferation stage into differentiation and
mineralization stages, and thus accelerating osteogen-
esis. Second, ALP staining and ECM mineralization
are regarded as critical osteoblast-specific markers,
which reflects the degree of osteogenic differentiation
[Chau et al., 2009]. According to our results, ALP
staining reveals that cells in the PEMF group were
more positive than those in the control group, which
reflects osteoblastic differentiation potential. Forma-
tion of ECM nodules in the PEMF group was
significantly higher than the Control at the 7th day.
These results are consistent with previous investiga-
tions by Zhang et al. [2007] and Wang et al. [2014b].
Third, the cytoskeleton has the capacity of maintain-
ing cell morphology and resisting external force, and
thus protecting various intracellular organelles. In
addition, cytoskeleton can also change its own
structure to respond and transduce the external physi-
cal or chemical stimuli so as to initiate intracellular
biochemical events [Thompson et al., 2012]. Our
Fig. 4. Effects of PEMF stimulation on in vitro osteogenesis-related gene expressions of
MC3T3 -E1 cells via qRT-PCR analyses in the cell proliferation and differentiation. Values are
all expressed as mean S.D. (n¼3 -4), and relative expression level of each gene normalized
to b-actin. P<0.05 versus Control group.
PEMF Promote Ost eogenesis Via Wnt/ b-Catenin 159
Bioelectromagnetics
study reveals that PEMF resulted in well-developed
cytoskeletons, characterized by increased number of
microfilaments and thicker stress fibers. The possible
mechanism for the change in cytoskeletal micro-
structure may be associated with change of electric
potential induced by PEMF. Previous investigations
have also proved that external electric field has the
capacity of triggering cytoskeletal deformation [Li
and Kolega, 2002]. It has been shown that cytoskeletal
deformation is one of the earliest events for bone
cells detecting external biophysical stimuli, and
thus modulates intracellular biochemical response
and subsequent osteogenetic activities [Huang et al.,
2004; Klein-Nulend et al., 2012]. Together, our
findings demonstrate that PEMF have the capacity of
regulating osteoblastic cytoskeletal microstructure,
accelerating cell cycle, and promoting osteoblastic
proliferation and mineralization.
ALP, OCN, COL1, and Runx2 are regarded as
essential indicators of osteoblast differentiation. ALP
and OCN are major indicators of osteoblast phenotype
and also play a significant role in bone formation and
mineralization. COL1 is responsible for formation of
large collagen fibers and is also a critical mediator for
bone formation. Runx2 acts as a regulatory factor for
osteoblasttic differentiation and skeletal morphogene-
sis. Runx2 also affects gene and protein expression
of other osteogenesis-related cytokines [Lian et al.,
2004]. In the present investigation, we found that
gene and protein expressions of Runx2 were upregu-
lated not only in the cell proliferation stage, but also
in differentiation stage. Moreover, our results also
show that OCN and COL1 expressions were up-
regulated in the differentiation stage. Increase of
OCN and COL1 expressions might be at least
partially associated with the upregulation of Runx2.
Fig. 6. Effects of PEMF stimulation onextracellular matrix (ECM) mineralization of MC3T3 -E1cells
viaAlizarinRedstaining.(A) Representative optical images (20microscope objective) via
Alizarin Red staining on MC3T 3 -E1 cells in Control and PEMF groups. (B) Quantitative compari-
sons of absorbance values of the solubilized stain in the Control and PEMF groups. Values all
expressed as mean S.D. (n¼5). P<0.05 versusControlgroup.
Fig. 5. Effects of PEMF stimulation on in vitro osteogenesis-related protein expressions of
MC3T3 -E1cellsviaWestern blottinganalyses in cellproliferationand differentiation, including ALP,
OCN, Runx2, Wnt1, Lrp6, and b- catenin. Values are all expressed a s mean S.D. (n¼3-4), and
relative expressionlevel of each gene normalized to b-tubulin.P<0.05 versus Control.
160 Zhai et al.
Bioelectromagnetics
Enhancement of COL1 and OCN transcription is able
to contribute to increased ECM nodules formation
induced by PEMF stimulation. We also show that
ALP gene and protein expressions were downregu-
lated in the osteoblast proliferation stage, but upregu-
lated in differentiation stage by PEMF stimulation.
These results revealed the distinctly regulatory mech-
anism of PEMF on osteoblasts at different maturation
stage. In the proliferation stage of osteoblasts, PEMF
inhibit cell differentiation by downregulating ALP in
order to accelerate the cell cycle to ensure that more
newly divided cells get ready for the subsequent
differentiation and mineralization. In the differentia-
tion stage, PEMF enhance ALP expressions, and
enhance results in acceleration of osteogenetic prog-
ress. These findings were partially consistent with
results of Lohmann et al. [2003], Chang et al. [2004],
and Zhang et al. [2007].
Accumulating evidence has proved that canoni-
cal Wnt signaling plays a key role in mediating bone
remodeling, and eventually regulates bone mass and
bone strength [Macsai et al., 2008; Santos et al.,
2009]. Extracellular Wnt proteins initially bind to the
Frizzled and LRP5/6 co-receptors on the cell mem-
brane, and thus result in stabilization of b-catenin in
cytoplasm and facilitating more Wnt-targeted gene
transcription in the cell nucleus. It has been proved
that activation of canonical Wnt signaling can pro-
mote osteoblastgenesis and enhance osteoblast activ-
ity [Bennett et al., 2005; Gaur et al., 2005; Zhang
et al., 2013]. Canonical Wnt signaling in gene-
knockout-mice, including Wnt, Lrp6, or b-catenin
exhibited abnormal bone remodeling and decreased
bone mass [Bennett et al., 2005; Wang et al., 2014a;
Li et al., 2015]. In the present study, our results show
that gene and protein expressions of canonical Wnt
signaling for in vitro osteoblasts, including Wnt1,
LRP6, and b-catenin, were all significantly enhanced
after PEMF exposure at both proliferation and differ-
entiation stages, demonstrating potential activation of
Wnt/b-catenin signaling pathway induced by PEMF.
Investigations by our group and Zhou et al. [2012]
demonstrate that PEMF promoted overall mRNA
expressions of canonical Wnt signaling in rat long
bones via PCR analyses [Jing et al., 2013]. Thus,
coupled with these in vivo findings, our present study
further confirmed that activation of canonical Wnt
signaling may play a key role in PEMF-induced
enhancement of osteogenesis.
In conclusion, our present study shows the most
prominent effects of 15.38 Hz PEMF burst stimulation
at 20 Gs (2 mT) for 2 h/day on stimulating osteoblastic
proliferation. We also revealed positive efficiency of
PEMF on biological functions of osteoblasts, charac-
terized by improved cytoskeletal microstructure and
increased cellular differentiation and mineralization.
Furthermore, our results also reveal that PEMF can
promote osteogenesis-associated gene and protein
expressions through a canonical Wnt signaling-
associated mechanism. This study enriches our basic
knowledge to osteogenetic activity of PEMF, and may
lead to more efficient and scientific clinical applica-
tion of PEMF in improving osteogenesis and inhibit-
ing osteopenia/osteoporosis.
REFERENCES
Assiotis A, Sachinis NP, Chalidis BE. 2012. Pulsed electromag-
netic fields for the treatment of tibial delayed unions and
nonunions. A prospective clinical study and review of the
literature. J Orthop Surg Res 7:24.
Baron, Kneissel M. 2013. WNT signaling in bone homeostasis
and disease: From human mutations to treatments. Nat Med
19:179–192.
Bassett CA, Pawluk RJ, Pilla AA. 1974. Acceleration of fracture
repair by electromagnetic fields. A surgically noninvasive
method. Ann N Y Acad Sci 238:242–262.
Bassett CA, Mitchell SN, Gaston SR. 1982. Pulsing electromag-
netic field treatment in ununited fractures and failed
arthrodeses. Jama 247:623–628.
Bassett CA, Pilla AA, Pawluk RJ. 1977. A non-operative salvage
of surgically-resistant pseudarthroses and non-unions by
pulsing electromagnetic fields. A preliminary report. Clin
Orthop Relat Res 124:128–143.
Bennett CN, Longo KA, Wright WS, Suva LJ, Lane TF,
Hankenson KD, MacDougald OA. 2005. Regulation of
osteoblastogenesis and bone mass by Wnt10b. Proc Natl
Acad Sci 102:3324–3329.
Chang K, Chang WH. 2003. Pulsed electromagnetic fields prevent
osteoporosis in an ovariectomized female rat model: A
prostaglandin E2-associated process. Bioelectromagnetics
24:189–198.
Chang WH, Chen LT, Sun JS, Lin FH. 2004. Effect of pulse-burst
electromagnetic field stimulation on osteoblast cell activi-
ties. Bioelectromagnetics 25:457–465.
Chau JF, Leong WF, Li B. 2009. Signaling pathways governing
osteoblast proliferation, differentiation and function. Histol
Histopathol 24:1593–1606.
Diniz P, Shomura K, Soejima K, Ito G. 2002. Effects of pulsed
electromagnetic field (PEMF) stimulation on bone tissue
like formation are dependent on the maturation stages of
the osteoblasts. Bioelectromagnetics 23:398–405.
Dulic V, Lees E, Reed SI. 1992. Association of human cyclin E
with a periodic G1-S phase protein kinase. Science
257:1958–1961.
Funk RH, Monsees T, Ozkucur N. 2009. Electromagnetic effects
—From cell biology to medicine. Prog Histochem Cyto-
chem 43:177–264.
Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV,
Komm BS, Javed A, van Wijnen AJ, Stein JL, Stein GS,
Lian JB. 2005. Canonical WNT signaling promotes osteo-
genesis by directly stimulating Runx2 gene expression.
J Biol Chem 280:33132–33140.
Harper JV, Brooks G. 2005. The mammalian cell cycle: An
overview. Methods Mol Biol 296:113–153.
PEMF Promote OsteogenesisVia Wnt/ b-Catenin 161
Bioelectromagnetics
Huang H, Kamm RD, Lee RT. 2004. Cell mechanics and
mechanotransduction: Pathways, probes, and physiology.
Am J Physiol Cell Physiol 287:C1.
Jing D, Cai J, Shen G, Huang J, Li F, Li J, Lu L, Luo E, Xu Q.
2011. The preventive effects of pulsed electromagnetic
fields on diabetic bone loss in streptozotocin-treated rats.
Osteoporos Int 22:1885–1895.
Jing D, Cai J, Wu Y, Shen G, Li F, Xu Q, Xie K, Tang C, Liu J,
Guo W, Wu X, Jiang M, Luo E. 2014. Pulsed electromag-
netic fields partially preserve bone mass, microarchitecture,
and strength by promoting bone formation in hindlimb-
suspended rats. J Bone Miner Res 29:2250–2261.
Jing D, Li F, Jiang M, Cai J, Wu Y, Xie K, Wu X, Tang C, Liu J,
Guo W, Shen G, Luo E. 2013. Pulsed electromagnetic
fields improve bone microstructure and strength in ovariec-
tomized rats through a Wnt/Lrp5/beta-catenin signaling-
associated mechanism. PLoS ONE 8:e79377.
Jing D, Shen G, Huang J, Xie K, Cai J, Xu Q, Wu X, Luo E.
2010. Circadian rhythm affects the preventive role of
pulsed electromagnetic fields on ovariectomy-induced
osteoporosis in rats. Bone 46:487–495.
Jing Z, Wei-Jie Y, Yi-Feng ZG. 2015. Down-regulation of Wt1
activates Wnt/beta-catenin signaling through modulating
endocytic route of LRP6 in podocyte dysfunction in vitro.
Cell Signal 27:1772–1780.
Kanis JA, Borgstrom F, De Laet C, Johansson H, Johnell O,
Jonsson B, Oden A, Zethraeus N, Pfleger B, Khaltaev N.
2005. Assessment of fracture risk. Osteoporos Int
16:581–589.
Klein-Nulend J, Bacabac RG, Bakker AD. 2012. Mechanical
loading and how it affects bone cells: The role of the
osteocyte cytoskeleton in maintaining our skeleton. Eur
Cell Mater 24:278–291.
Koff A, Giordano A, Desai D, Yamashita K, Harper JW,
Elledge S, Nishimoto T, Morgan DO, Franza BR,
Roberts JM. 1992. Formation and activation of a cyclin
E-cdk2 complex during the G1 phase of the human cell
cycle. Science 257:1689–1694.
Krishnan V, Bryant HU, Macdougald OA. 2006. Regulation of
bone mass by Wnt signaling. J Clin Invest 116:1202–1209.
Li C, Wang W, Xie L, Luo X, Cao X, Wan M. 2015. Lipoprotein
receptor-related protein 6 is required for parathyroid
hormone-induced Sost suppression. Ann NY Acad Sci
DOI: 10.1111/nyas.12750 [Epub ahead of print].
Li X, Kolega J. 2002. Effects of direct current electric fields on
cell migration and actin filament distribution in bovine
vascular endothelial cells. J Vasc Res 39:391–404.
Lian JB, Javed A, Zaidi SK, Lengner C, Montecino M, van
Wijnen AJ, Stein JL, Stein GS. 2004. Regulatory controls
for osteoblast growth and differentiation: Role of Runx/
Cbfa/AML factors. Crit Rev Eukaryot Gene Expr 14:1–41.
Lohmann CH, Schwartz Z, Liu Y, Li Z, Simon BJ, Sylvia VL,
Dean DD, Bonewald LF, Donahue HJ, Boyan BD. 2003.
Pulsed electromagnetic fields affect phenotype and con-
nexin 43 protein expression in MLO-Y4 osteocyte-like
cells and ROS 17/2.8 osteoblast-like cells. J Orthop Res
21:326–334.
Macsai CE, Foster BK, Xian CJ. 2008. Roles of Wnt signalling in
bone growth, remodelling, skeletal disorders and fracture
repair. J Cell Physiol 215:578–587.
Mahavni V, Sood AK. 2001. Hormone replacement therapy and
cancer risk. Curr Opin Oncol 13:384–389.
Musette P, Brandi ML, Cacoub P, Kaufman JM, Rizzoli R,
Reginster JY. 2010. Treatment of osteoporosis: Recogniz-
ing and managing cutaneous adverse reactions and drug-
induced hypersensitivity. Osteoporos Int 21:723–732.
Paterson CR. 1980. Vitamin-D poisoning: Survey of causes in 21
patients with hypercalcaemia. Lancet 1:1164–1165.
Rizzoli R, Reginster JY, Boonen S, Breart G, Diez-Perez A,
Felsenberg D, Kaufman JM, Kanis JA, Cooper C. 2011.
Adverse reactions and drug-drug interactions in the man-
agement of women with postmenopausal osteoporosis.
Calcif Tissue Int 89:91–104.
Rosenberg N, Rosenberg O, Soudry M. 2012. Pulsed low intensity
electromagnetic field (PEMF) affects cell cycle of human
osteoblast-like cells in vitro. Am J Biome Eng 2:181–184.
Rubin CT, McLeod KJ, Lanyon LE. 1989. Prevention of osteopo-
rosis by pulsed electromagnetic fields. J Bone Joint Surg
Am 71:411–417.
Ryang WS, Koog YH, Jeong KI, Wi H. 2013. Effects of pulsed
electromagnetic field on knee osteoarthritis: A systematic
review. Rheumatology (Oxford) 52:815–824.
Santos A, Bakker AD, Zandieh-Doulabi B, Semeins CM, Klein-
Nulend J. 2009. Pulsating fluid flow modulates gene
expression of proteins involved in Wnt signaling pathways
in osteocytes. J Orthop Res 27:1280–1287.
Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH image to
ImageJ: 25 years of image analysis. Nat Methods 9:671–
675.
Shen WW, Zhao JH. 2010. Pulsed electromagnetic fields stimula-
tion affects BMD and local factor production of rats with
disuse osteoporosis. Bioelectromagnetics 31:113–119.
Thamsborg G, Florescu A, Oturai P, Fallentin E, Tritsaris K,
Dissing S. 2005. Treatment of knee osteoarthritis with
pulsed electromagnetic fields: A randomized, double-blind,
placebo-controlled study. Osteoarthritis Cartilage 13:575–
581.
Thompson WR, Rubin CT, Rubin J. 2012. Mechanical regulation
of signaling pathways in bone. Gene 503:179–193.
Tsai M, Chang WH, Chang K, Hou R, Wu T. 2007. Pulsed
electromagnetic fields affect osteoblast proliferation and
differentiation in bone tissue engineering. Bioelectromag-
netics 28:519–528.
Wang B, Jin H, Zhu M, Li J, Zhao L, Zhang Y, Tang D, Xiao G,
Xing L, Boyce BF, Chen D. 2014a. Chondrocyte beta-
catenin signaling regulates postnatal bone remodeling
through modulation of osteoclast formation in a murine
model. Arthritis Rheumatol 66:107–120.
Wang J, An Y, Li F, Li D, Jing D, Guo T, Luo E, Ma C. 2014b.
The effects of pulsed electromagnetic field on the functions
of osteoblasts on implant surfaces with different topogra-
phies. Acta Biomaterialia 10:975–985.
Yan J, Zhang C, Zhao Y, Cao C, Wu K, Zhao L, Zhang Y. 2014.
Non-viral oligonucleotide antimiR-138 delivery to mesen-
chymal stem cell sheets and the effect on osteogenesis.
Biomaterials 35:7734–7749.
Zhang X, Zhang J, Qu X, Wen J. 2007. Effects of different
extremely low-frequency electromagnetic fields on osteo-
blasts. Electromagn Biol Med 26:167–177.
Zhang R, Oyajobi BO, Harris SE, Chen D, Tsao C, Deng H,
Zhao M. 2013. Wnt/b-catenin signaling activates bone
morphogenetic protein 2 expression in osteoblasts. Bone
52:145–156.
Zhou J, He H, Yang L, Chen S, Guo H, Xia L, Liu H, Qin Y,
Liu C, Wei X, Zhou Y, He C. 2012. Effects of pulsed
electromagnetic fields on bone mass and Wnt/b-catenin
signaling pathway in ovariectomized rats. Arch Med Res
43:274–282.
162 Zhai et al.
Bioelectromagnetics
