Melatonin Improves the Quality of Inferior Bovine Oocytes and Promoted Their Subsequent IVF Embryo Development: Mechanisms and Results

Abstract

The inferior oocytes (IOs), which are not suitable for embryo development, occupy roughly one-third or more of the collected immature bovine oocytes. The IOs are usually discarded from the in vitro bovine embryo production process. Improving the quality of the inferior oocytes (IOs) and make them available in in vitro embryo production would have important biological, as well as commercial, value. This study was designed to investigate whether melatonin could improve the quality of IOs and make them usable in the in vitro maturation (IVM) and subsequent (in vitro fertilization) IVF embryo development. The results indicated that: the maturation rate of IOs and their subsequent IVF embryo developments were impaired compared to cumulus-oocyte complexes and melatonin treatment significantly improved the quality of IOs, as well as their IVF and embryo developments. The potential mechanisms are that: (1) melatonin reduced reactive oxygen species (ROS) and enhanced glutathione (GSH) levels in the IOs, thereby protecting them from oxidative stress; (2) melatonin improved mitochondrial normal distribution and function to increase ATP level in IOs; and (3) melatonin upregulated the expression of ATPase 6, BMP-15, GDF-9, SOD-1, Gpx-4, and Bcl-2, which are critical genes for oocyte maturation and embryo development and downregulated apoptotic gene expression of caspase-3.

Full text

molecules
Article
Melatonin Improves the Quality of Inferior Bovine
Oocytes and Promoted Their Subsequent IVF
Embryo Development: Mechanisms and Results
Minghui Yang 1,† , Jingli Tao 1, †, Menglong Chai 1, Hao Wu 1, Jing Wang 1, Guangdong Li 1,
Changjiu He 1,2, Lu Xie 1, Pengyun Ji 1, Yunping Dai 3, Liguo Yang 2and Guoshi Liu 1,*ID
1
National Engineering Laboratory for Animal Breeding, Key Laboratory of Animal Genetics and Breeding of
the Ministry of Agriculture, Beijing Key Laboratory for Animal Genetic Improvement, College of Animal
Science and Technology, China Agricultural University, Beijing 100193, China; Yangmh16@cau.edu.cn (M.Y.);
Taojl16@cau.edu.cn (J.T.); cml313@163.com (M.C.); 18800160525@163.com (H.W.);
caylajingjing@gmail.com (J.W.); 15600911225@cau.edu.cn (G.L.); chungjoe@mail.hzau.edu.cn (C.H.);
luxiecau@163.com (L.X.); jipengyun1989@126.com (P.J.)
2College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, China;
yangliguo2006@foxmail.com
3
College of Biological Sciences, China Agricultural University, Beijing 100193, China; Daiyunping@sina.com
*Correspondence: gshliu@cau.edu.cn; Tel./Fax: +86-10-6273-2735
† These authors contributed equally to this work.
Received: 19 October 2017; Accepted: 21 November 2017; Published: 27 November 2017
Abstract:
The inferior oocytes (IOs), which are not suitable for embryo development, occupy
roughly one-third or more of the collected immature bovine oocytes. The IOs are usually discarded
from the
in vitro
bovine embryo production process. Improving the quality of the inferior oocytes
(IOs) and make them available in
in vitro
embryo production would have important biological,
as well as commercial, value. This study was designed to investigate whether melatonin could
improve the quality of IOs and make them usable in the
in vitro
maturation (IVM) and subsequent
(
in vitro
fertilization) IVF embryo development. The results indicated that: the maturation rate of
IOs and their subsequent IVF embryo developments were impaired compared to cumulus-oocyte
complexes and melatonin treatment significantly improved the quality of IOs, as well as their IVF
and embryo developments. The potential mechanisms are that: (1) melatonin reduced reactive
oxygen species (ROS) and enhanced glutathione (GSH) levels in the IOs, thereby protecting them
from oxidative stress; (2) melatonin improved mitochondrial normal distribution and function to
increase ATP level in IOs; and (3) melatonin upregulated the expression of ATPase 6,BMP-15,GDF-9,
SOD-1,Gpx-4, and Bcl-2, which are critical genes for oocyte maturation and embryo development
and downregulated apoptotic gene expression of caspase-3.
Keywords: melatonin; inferior oocytes maturation; mitochondria; in vitro embryo production
1. Introduction
The increasing importance of
in vitro
production of bovine embryos in commercial cattle breeding
programs demands an improvement of embryo viability [
1
]. Oocytes
in vitro
maturation is one of the
most important steps in the
in vitro
embryo production process, and it is crucial for the success of this
process [
2
,
3
]. In many laboratories, almost half of collected cumulus-oocyte complexes (COCs) were
discarded due to their poor quality. These oocytes are classified as inferior oocytes (IOs). Researchers
have tried intracytoplasmic sperm injection to improve the embryo production efficiency of the IOs [
4
].
Although, this was a viable alternative to increase IVF embryo production of IOs, it is still hard to
popularize it in commercial production. It is the intrinsic quality of the oocyte that determines the
Molecules 2017,22, 2059; doi:10.3390/molecules22122059 www.mdpi.com/journal/molecules

Molecules 2017,22, 2059 2 of 15
proportion of oocytes developing to blastocysts; however, the culture environment has a critical impact
on the development of embryos [
5
–
7
]. As a result, the most effective method to reverse the fate of IOs
should be an improvement of their in vitro developmental environments.
Oxidative stress causes poor quality of the oocytes [
5
] and it is a major culprit responsible for low
efficiency in oocyte maturation and embryo development in several species [
6
]. The role of reactive
oxygen species (ROS) and antioxidants in relation to female reproductive function has been a subject of
recent research interest [
7
,
8
]. Oxidative stress negatively impacts oocyte maturation and antioxidants
protect oocytes from oxidative stress [
9
,
10
]. For example, the antioxidant glutathione (GSH) plays
an important role in the antioxidant system of cells [
11
]. The concentrations of GSH in matured oocytes
are significantly higher than that in the immature oocytes and play an important role for the successful
fertilization [12].
Melatonin is another potent and naturally-occurring antioxidant [
13
]. It is produced not only
in the pineal gland, but also in skin [
14
], neuronal cell [
15
], and in oocytes [
16
]. It improves oocyte
quality and fertilization rates [
17
]. Several studies have shown that the presence of melatonin in
the follicular fluid and its levels positively correlates with oocyte quality and maturation [
18
–
21
].
In human ovarian follicular fluid, melatonin’s concentration was three-fold higher than in serum [
19
].
The concentration of melatonin was higher in the fluid of large follicles than in the fluid of small
follicles in patients undergoing IVF-embryo transfer [
22
]. Melatonin was also detected in porcine
follicular fluid. All of these suggest that melatonin is directly involved in ovarian function in
mammals [
23
]. It was reported that melatonin administration improved oocyte quality [
19
] and
melatonin supplementation during IVM of COCs resulted in a greater proportion of oocytes which
extruded the polar body with relatively low ROS levels in porcine [
24
] and in bovine [
25
] specimens.
Oxidative stress also causes the abnormal mitochondrial distribution and damage in IOs. Melatonin
is also a mitochondrial-targeted antioxidant and it protects the mitochondria by scavenging reactive
oxygen species (ROS), inhibiting the mitochondrial permeability transition pore (MPTP), and activating
uncoupling proteins (UCPs)
[16,26]
. In the current study, the effect of melatonin on mitochondrial
distribution and functions in IOS is also investigated.
The classification of IOs was based on surrounding cumulus cell layers and homogeneity of
ooplasm. The IOs then were selected as a target cells to study the effects and mechanisms of whether,
and how, melatonin improves their quality and maturation. The address was given to the effects of
melatonin at the concentration of 10
−9
M, which is considered as physiological concentration, on ROS,
GSH, oocyte mitochondrial distribution, and function in
in vitro
-matured IOs. In addition, the oocyte
maturation-associated genes, as well as their effects on the
in vitro
production of bovine embryos,
were also investigated.
2. Results
2.1. The Gene Expression Level of Pro-Apoptotic Genes Caspase-3, -9, and Bax (Relative mRNA) in IOs and COCs
The results showed that expressions of pro-apoptosis related gene caspase-3 and Bax in IOs were
significantly higher than that in COCs (p< 0.05), The expression of caspase-9 in IOs was also higher
than that in COCs even it failed to reach the significant difference (p= 0.052) (Figure 1A).
2.2. The Effect of Melatonin on the Nuclear Maturation of Bovine IOs
As shown in Table 1, the MII rate of the IOs + MT (10
−9
M) group (71.4
±
1.88%) was significantly
higher than that in IOs group(59.4
±
3.14%; p< 0.05); however their MII rates were still significantly
lower than that in COCs group (87.9 ±0.64%; p< 0.01).
2.3. The Effects of Melatonin on the ROS and GSH Levels in MII Oocytes
The results showed that the levels of ROS were significantly lower in melatonin-treated IOs
oocytes (0.62
±
0.093) than that in IOs (1.12
±
0.136) (p< 0.05, Figure 2A). Interestingly, melatonin

Molecules 2017,22, 2059 3 of 15
(10
−9
M) treatment led the ROS of IOs to reduce to the similar levels of the COCs control (0.55
±
0.070),
p> 0.05. In contrast, the level of GSH was significantly higher in melatonin treated IOs than that in IOs
(0.59 ±0.069 vs. 0.25 ±0.069, p< 0.05 Figure 2B).
Molecules 2017, 22, 2059 3 of 15
treatment led the ROS of IOs to reduce to the similar levels of the COCs control (0.55 ± 0.070), p > 0.05.
In contrast, the level of GSH was significantly higher in melatonin treated IOs than that in IOs
(0.59 ± 0.069 vs. 0.25 ± 0.069, p < 0.05 Figure 2B).
Figure 1. The relative mRNA expression of caspase-3, -9, and Bax in IOs and COCs. (A) Relative mRNA
expression of caspase-3, -9, and Bax in IOs and COCs. IOs: inferior oocytes; COCs: cumulus-oocyte
complexes. n = 3.
a,b
Values of different superscripts indicate significant difference (p < 0.05). (B)
Nuclear staining after IVM. PB: polar body, scale bar = 20 μm.
Table 1. The effect of melatonin on the nuclear maturation of bovine oocytes.
Groups No. of Oocytes Observed No. of MII Oocytes (%)
IOs 293 174 (59.4 ± 3.14)
Aa
IOs + MT 311 222 (71.4 ± 1.88)
Ab
COCs 421 370 (87.9 ± 0.64)
Bc
a,b,c
Values with different superscripts represent significant difference within the same column
(p < 0.05);
A,B
Values with different superscripts represent highly significant difference within the same
column (p < 0.01), IOs, the inferior bovine oocytes ; MT, melatonin; COCs, cumulus–oocyte complexes.
Figure 2. Effects of melatonin on ROS as well as GSH levels in bovine IOs. (A) Effects of melatonin on
levels of ROS in IOs; A(1–3) the representative images of the H2DCFDA fluorescence staining.
The higher green intensity indicated more ROS; scale bar = 100 μm; A(4): the statistical analysis of the
data from A(1–3); n = 4; (B) Effects of melatonin on levels of GSH in IOs, B(1–3) the representative
images of the GSH fluorescence staining. The higher the blue intensity is the more the GSH; scale
bar = 100 μm; B(4) the statistical analysis of the data from B(1–3); n = 4.
(a,b)
Values of different
superscripts indicate significant difference (p < 0.05).
Figure 1.
The relative mRNA expression of caspase-3,-9, and Bax in IOs and COCs. (
A
) Relative mRNA
expression of caspase-3,-9, and Bax in IOs and COCs. IOs: inferior oocytes; COCs: cumulus-oocyte
complexes. n= 3.
a,b
Values of different superscripts indicate significant difference (p< 0.05); (
B
) Nuclear
staining after IVM. PB: polar body, scale bar = 20 µm.
Table 1. The effect of melatonin on the nuclear maturation of bovine oocytes.
Groups No. of Oocytes Observed No. of MII Oocytes (%)
IOs 293 174 (59.4 ±3.14) Aa
IOs + MT 311 222 (71.4 ±1.88) Ab
COCs 421 370 (87.9 ±0.64) Bc
a,b,c
Values with different superscripts represent significant difference within the same column (p< 0.05);
A,B
Values
with different superscripts represent highly significant difference within the same column (p< 0.01), IOs, the inferior
bovine oocytes ; MT, melatonin; COCs, cumulus–oocyte complexes.
Molecules 2017, 22, 2059 3 of 15
treatment led the ROS of IOs to reduce to the similar levels of the COCs control (0.55 ± 0.070), p > 0.05.
In contrast, the level of GSH was significantly higher in melatonin treated IOs than that in IOs
(0.59 ± 0.069 vs. 0.25 ± 0.069, p < 0.05 Figure 2B).
Figure 1. The relative mRNA expression of caspase-3, -9, and Bax in IOs and COCs. (A) Relative mRNA
expression of caspase-3, -9, and Bax in IOs and COCs. IOs: inferior oocytes; COCs: cumulus-oocyte
complexes. n = 3.
a,b
Values of different superscripts indicate significant difference (p < 0.05). (B)
Nuclear staining after IVM. PB: polar body, scale bar = 20 μm.
Table 1. The effect of melatonin on the nuclear maturation of bovine oocytes.
Groups No. of Oocytes Observed No. of MII Oocytes (%)
IOs 293 174 (59.4 ± 3.14)
Aa
IOs + MT 311 222 (71.4 ± 1.88)
Ab
COCs 421 370 (87.9 ± 0.64)
Bc
a,b,c
Values with different superscripts represent significant difference within the same column
(p < 0.05);
A,B
Values with different superscripts represent highly significant difference within the same
column (p < 0.01), IOs, the inferior bovine oocytes ; MT, melatonin; COCs, cumulus–oocyte complexes.
Figure 2. Effects of melatonin on ROS as well as GSH levels in bovine IOs. (A) Effects of melatonin on
levels of ROS in IOs; A(1–3) the representative images of the H2DCFDA fluorescence staining.
The higher green intensity indicated more ROS; scale bar = 100 μm; A(4): the statistical analysis of the
data from A(1–3); n = 4; (B) Effects of melatonin on levels of GSH in IOs, B(1–3) the representative
images of the GSH fluorescence staining. The higher the blue intensity is the more the GSH; scale
bar = 100 μm; B(4) the statistical analysis of the data from B(1–3); n = 4.
(a,b)
Values of different
superscripts indicate significant difference (p < 0.05).
Figure 2.
Effects of melatonin on ROS as well as GSH levels in bovine IOs. (
A
) Effects of melatonin
on levels of ROS in IOs; A(1–3) the representative images of the H2DCFDA fluorescence staining.
The higher green intensity indicated more ROS; scale bar = 100
µ
m; A(4): the statistical analysis of the
data from A(1–3); n= 4; (
B
) Effects of melatonin on levels of GSH in IOs, B(1–3) the representative images
of the GSH fluorescence staining. The higher the blue intensity is the more the GSH;
scale bar = 100 µm;
B(4) the statistical analysis of the data from B(1–3); n= 4. (a,b) Values of different superscripts indicate
significant difference (p< 0.05).

Molecules 2017,22, 2059 4 of 15
2.4. Effects of Melatonin on the Function of Mitochondria
The results indicated that melatonin (10
−9
M) treatment significantly reduced the massive
clustering distribution rate of mitochondria compared to the non-treated MII-stage IOs
(0.40 ±0.011
vs.
0.27
±
0.021, p< 0.05); There were no significant differences were observed between melatonin-treated
oocytes with COCs control (0.27
±
0.021 vs. 0.21
±
0.014, p> 0.05, Figure 3A). The ATP level
in melatonin-treated IOs oocytes was also higher than that in non-treated IOs (0.90
±
0.018 vs.
0
.79 ±0.024 pmol/per
oocyte, p< 0.05) and it was similar to the ATP level of COCs of controls
(0.90 ±0.018 vs. 0.93 ±0.017 pmol/per oocyte, p> 0.05, Figure 3B).
Molecules 2017, 22, 2059 4 of 15
2.4. Effects of Melatonin on the Function of Mitochondria
The results indicated that melatonin (10
−9
M) treatment significantly reduced the massive
clustering distribution rate of mitochondria compared to the non-treated MII-stage IOs (0.40 ± 0.011 vs.
0.27 ± 0.021, p < 0.05); There were no significant differences were observed between melatonin-treated
oocytes with COCs control (0.27 ± 0.021 vs. 0.21 ± 0.014, p > 0.05, Figure 3A). The ATP level in
melatonin-treated IOs oocytes was also higher than that in non-treated IOs (0.90 ± 0.018 vs. 0.79 ±
0.024 pmol/per oocyte, p < 0.05) and it was similar to the ATP level of COCs of controls (0.90 ± 0.018
vs. 0.93 ± 0.017 pmol/per oocyte, p > 0.05, Figure 3B).
Figure 3. Effects of melatonin on mitochondria distribution and ATP production in MII-stage oocytes.
(A) The state of mitochondria distribution, (mean ± SEM of 87 oocytes). The red fluorescence
represents mitochondria. MD: the representative image of mitochondrial massive clustering
distribution. GD: the representative image of mitochondrial granulated distribution; scale bar = 20 μm; the
bar graph was the statistical analysis of the mitochondrial distribution in oocytes; (B) Cytoplasmic
ATP levels in individual MII bovine oocytes (mean ± SEM of 85 oocytes).
a,b
Values of different
superscripts indicate significant difference (p < 0.05);
A,B
Values of different superscripts indicate
highly significant difference (p < 0.01).
2.5. Effect of Melatonin on Expression of HSP90 in Bovine IOs
As shown in Figure 4, the HSP90 mRNA expression in IOs was significantly lower than that in
COCs control group (p < 0.05), and It appeared that melatonin (10
−9
M ) treatment up-regulated the
HSP90 mRNA level in IOs but this upregulation failed to achieve a significant difference. In contrast,
HSP90 protein expression showed no significant difference among the groups and this indicated post
transcriptional regulation for HSP90 in oocytes.
Figure 4. Effects of melatonin on expression of HSP90 in bovine oocytes. (A) Effects of melatonin on
the levels of HSP90 mRNA; (B) the effects of melatonin on the HSP90 protein levels. B(1) The
representatives of immunofluorescent inmages of HSP90 protein in MII bovine oocytes, scale bar = 25
μm; and B(2) The statistical analysis of the data from B1, HSP90 fluorescence intensity was analyzed
using in MII-stage oocytes (mean ± SEM of 42 oocytes).
a,b
Values of different superscripts indicate
significant difference (p < 0.05).
Figure 3.
Effects of melatonin on mitochondria distribution and ATP production in MII-stage oocytes.
(
A
) The state of mitochondria distribution, (mean
±
SEM of 87 oocytes). The red fluorescence represents
mitochondria. MD: the representative image of mitochondrial massive clustering distribution.
GD: the representative image of mitochondrial granulated distribution; scale bar = 20
µ
m; the bar
graph was the statistical analysis of the mitochondrial distribution in oocytes; (
B
) Cytoplasmic ATP
levels in individual MII bovine oocytes (mean
±
SEM of 85 oocytes).
a,b
Values of different superscripts
indicate significant difference (p< 0.05);
A,B
Values of different superscripts indicate highly significant
difference (p< 0.01).
2.5. Effect of Melatonin on Expression of HSP90 in Bovine IOs
As shown in Figure 4, the HSP90 mRNA expression in IOs was significantly lower than that in
COCs control group (p< 0.05), and It appeared that melatonin (10
−9
M ) treatment up-regulated the
HSP90 mRNA level in IOs but this upregulation failed to achieve a significant difference. In contrast,
HSP90 protein expression showed no significant difference among the groups and this indicated post
transcriptional regulation for HSP90 in oocytes.
Molecules 2017, 22, 2059 4 of 15
2.4. Effects of Melatonin on the Function of Mitochondria
The results indicated that melatonin (10
−9
M) treatment significantly reduced the massive
clustering distribution rate of mitochondria compared to the non-treated MII-stage IOs (0.40 ± 0.011 vs.
0.27 ± 0.021, p < 0.05); There were no significant differences were observed between melatonin-treated
oocytes with COCs control (0.27 ± 0.021 vs. 0.21 ± 0.014, p > 0.05, Figure 3A). The ATP level in
melatonin-treated IOs oocytes was also higher than that in non-treated IOs (0.90 ± 0.018 vs. 0.79 ±
0.024 pmol/per oocyte, p < 0.05) and it was similar to the ATP level of COCs of controls (0.90 ± 0.018
vs. 0.93 ± 0.017 pmol/per oocyte, p > 0.05, Figure 3B).
Figure 3. Effects of melatonin on mitochondria distribution and ATP production in MII-stage oocytes.
(A) The state of mitochondria distribution, (mean ± SEM of 87 oocytes). The red fluorescence
represents mitochondria. MD: the representative image of mitochondrial massive clustering
distribution. GD: the representative image of mitochondrial granulated distribution; scale bar = 20 μm; the
bar graph was the statistical analysis of the mitochondrial distribution in oocytes; (B) Cytoplasmic
ATP levels in individual MII bovine oocytes (mean ± SEM of 85 oocytes).
a,b
Values of different
superscripts indicate significant difference (p < 0.05);
A,B
Values of different superscripts indicate
highly significant difference (p < 0.01).
2.5. Effect of Melatonin on Expression of HSP90 in Bovine IOs
As shown in Figure 4, the HSP90 mRNA expression in IOs was significantly lower than that in
COCs control group (p < 0.05), and It appeared that melatonin (10
−9
M ) treatment up-regulated the
HSP90 mRNA level in IOs but this upregulation failed to achieve a significant difference. In contrast,
HSP90 protein expression showed no significant difference among the groups and this indicated post
transcriptional regulation for HSP90 in oocytes.
Figure 4. Effects of melatonin on expression of HSP90 in bovine oocytes. (A) Effects of melatonin on
the levels of HSP90 mRNA; (B) the effects of melatonin on the HSP90 protein levels. B(1) The
representatives of immunofluorescent inmages of HSP90 protein in MII bovine oocytes, scale bar = 25
μm; and B(2) The statistical analysis of the data from B1, HSP90 fluorescence intensity was analyzed
using in MII-stage oocytes (mean ± SEM of 42 oocytes).
a,b
Values of different superscripts indicate
significant difference (p < 0.05).
Figure 4.
Effects of melatonin on expression of HSP90 in bovine oocytes. (
A
) Effects of
melatonin on the levels of HSP90 mRNA; (
B
) the effects of melatonin on the HSP90 protein levels.
B(1) The representatives of immunofluorescent inmages of HSP90 protein in MII bovine oocytes,
scale bar = 25 µm;
and B(2) The statistical analysis of the data from B1, HSP90 fluorescence intensity
was analyzed using in MII-stage oocytes (mean
±
SEM of 42 oocytes).
a,b
Values of different superscripts
indicate significant difference (p< 0.05).

Molecules 2017,22, 2059 5 of 15
2.6. The Effect of Melatonin on Expressions of GPX-4, SOD-1, and Bcl-2
The gene expressions of GPX-4 and SOD-1 which are anti-oxidative genes were significantly
up-regulated by melatonin (10
−9
M) treatment in IOs (p< 0.05, Figure 5), and their levels after
melatonin treatment were similar to the expression level of COCs group (p> 0.05). Melatonin also
significantly upregulated the expression of anti-apoptotic gene Bcl-2 in IOs (p< 0.05), In contrast,
the gene expression of pro-apoptosis related gene caspase-3 was downregulated by melatonin treatment
in IOs compared to its untreated counterparts (p< 0.05). The expression of Bax, however, was not
significantly influenced by melatonin treatment (p> 0.05).
Molecules 2017, 22, 2059 5 of 15
2.6. The Effect of Melatonin on Expressions of GPX-4, SOD-1, and Bcl-2
The gene expressions of GPX-4 and SOD-1 which are anti-oxidative genes were significantly up-
regulated by melatonin (10
−9
M) treatment in IOs (p < 0.05, Figure 5), and their levels after melatonin
treatment were similar to the expression level of COCs group (p > 0.05). Melatonin also significantly
upregulated the expression of anti-apoptotic gene Bcl-2 in IOs (p < 0.05), In contrast, the gene
expression of pro-apoptosis related gene caspase-3 was downregulated by melatonin treatment in IOs
compared to its untreated counterparts (p < 0.05). The expression of Bax, however, was not
significantly influenced by melatonin treatment (p > 0.05).
Figure 5. Relative expression levels of GPX-4, SOD-1, Bcl-2, Caspase-3 and Bax in MII oocytes.
a,b
Values
of different superscripts indicate significant difference within the expression level of each gene
(p < 0.05). COCs, cumulus-oocyte complexes; IOs, inferior bovine oocytes; MT, melatonin.
2.7. The Effect of Melatonin on Expression of Oocytes Maturation-Related Genes (GDF-9, BMP-15, ATPase
6, and ATPase 8)
The relative expression levels of GDF-9 mRNA in MII oocytes in the IOs + MT (10
−9
M) group
was significantly higher than that in non-treated IOs (p < 0.05, Figure 6), but still lower than that in
COCs control group (p < 0.05). The relative mRNA expression levels of BMP-15 and ATPase 6 in the
IOs group was significantly lower than that in COCs control group (p < 0.05). Melatonin supplement
upregulated their expression compared to the non-treated IOs. There were no significant difference
as to the gene expression of ATPase 8 among the groups (p > 0.05, Figure 6).
2.8. The Effects of Melatonin on IVF Embryo Developmental Potential and Cell Number of Blastocyst
Obtained from IOs
As shown in Table 2, the cleavage rates of the IOs were significantly lower than that of COCs
(66.1 ± 2.64 vs. 90.5 ± 0.60%, p < 0.01), and melatonin(10
−9
M ) supplement improved the cleavage rates
of IOs to 79.8 ± 2.42% which was significantly higher than that in IOs alone (p < 0.05), the similar
results were observed in the blastocyst rate. The blastocyst rates of the IOs was significantly lower
than that of COCs (33.1 ± 0.87% vs. 44.0 ± 0.74%, p < 0.01), and melatonin (10
−9
M) supplement
significantly improved the blastocyst rates of IOs to 38.5 ± 1.11%, (38.5 ± 1.11% vs. 33.1 ± 0.87%,
p < 0.05, Table 2). The data also showed that the blastocyst cell number in IOs significantly lower than
that of COCs control (104.89 ± 3.51 vs. 122.33 ± 3.57, p < 0.01), and melatonin (10
−9
M) treatment
increased the blastocyst cell number of IOs to 115.78 ± 1.714, which was significantly higher than that
of IOs alone (104.89 ± 3.51, p < 0.05. Figure 7, Table 3).
Figure 5.
Relative expression levels of GPX-4,SOD-1,Bcl-2,Caspase-3 and Bax in MII oocytes.
a,b
Values
of different superscripts indicate significant difference within the expression level of each gene
(p< 0.05)
.
COCs, cumulus-oocyte complexes; IOs, inferior bovine oocytes; MT, melatonin.
2.7. The Effect of Melatonin on Expression of Oocytes Maturation-Related Genes (GDF-9, BMP-15, ATPase 6,
and ATPase 8)
The relative expression levels of GDF-9 mRNA in MII oocytes in the IOs + MT (10
−9
M) group
was significantly higher than that in non-treated IOs (p< 0.05, Figure 6), but still lower than that in
COCs control group (p< 0.05). The relative mRNA expression levels of BMP-15 and ATPase 6 in the
IOs group was significantly lower than that in COCs control group (p< 0.05). Melatonin supplement
upregulated their expression compared to the non-treated IOs. There were no significant difference as
to the gene expression of ATPase 8 among the groups (p> 0.05, Figure 6).
2.8. The Effects of Melatonin on IVF Embryo Developmental Potential and Cell Number of Blastocyst
Obtained from IOs
As shown in Table 2, the cleavage rates of the IOs were significantly lower than that of COCs
(66.1 ±2.64
vs. 90.5
±
0.60%, p< 0.01), and melatonin(10
−9
M ) supplement improved the cleavage
rates of IOs to 79.8
±
2.42% which was significantly higher than that in IOs alone (p< 0.05), the similar
results were observed in the blastocyst rate. The blastocyst rates of the IOs was significantly lower
than that of COCs (33.1
±
0.87% vs. 44.0
±
0.74%, p< 0.01), and melatonin (10
−9
M) supplement
significantly improved the blastocyst rates of IOs to 38.5
±
1.11%, (38.5
±
1.11% vs. 33.1
±
0.87%,
p< 0.05,
Table 2). The data also showed that the blastocyst cell number in IOs significantly lower than
that of COCs control (104.89
±
3.51 vs. 122.33
±
3.57, p< 0.01), and melatonin (10
−9
M) treatment
increased the blastocyst cell number of IOs to 115.78
±
1.714, which was significantly higher than that
of IOs alone (104.89 ±3.51, p< 0.05. Figure 7, Table 3).

Molecules 2017,22, 2059 6 of 15
Molecules 2017, 22, 2059 6 of 15
Figure 6. Relative expression levels of BMP-15, GDF-9, ATPase 6 and ATPase 8 in MII oocytes.
a–c
Values of different superscripts indicate significant difference within the expression level of each gene
(p < 0.05). COCs, cumulus–oocyte complexes; IOs, inferior bovine oocytes; MT, melatonin.
Table 2. The effect of melatonin on IVF Embryo Developmental potential of oocytes.
Groups No. of MII
Oocytes
No. of Cleavage
Embryos (%) No. of Blastocysts (%) No. of D8 Hatched
Blastocysts (%)
IOs 215 142 (66.15 ± 2.64)
Aa
47 (33.1 ± 0.87)
Aa
3 (6.4 ± 2.36)
Aa
IOs + MT 228 182 (79.8 ± 2.42)
ABb
70 (38.5 ± 1.11)
ABb
9 (12.9 ± 2.99)
ABa
COCs 369 334 (90.5 ± 0.60)
Bc
147 (44.0 ± 0.74)
Bc
42 (28.6 ± 1.01)
Bb
a,b,c
Values with different superscripts represent significant difference within the same column (p < 0.05);
A,B
Values with different superscripts represent highly significant difference within the same column
(p < 0.01), IOs, inferior bovine oocytes; MT, melatonin; COCs, cumulus–oocyte complexes.
Figure 7. Effects of melatonin on IVF embryo developmental potential and cell number of blastocysts.
(A) Epifluorescence photomicrographs of in vitro-produced bovine blastocysts. COCs, cumulus–oocyte
complexes; IOs, inferior bovine oocytes; MT, melatonin; scale bar = 100 μm. (B) Nuclear staining of
bovine blastocyst after IVF in different groups. Scale bar = 20 μm.
Figure 6.
Relative expression levels of BMP-15, GDF-9, ATPase 6 and ATPase 8 in MII oocytes.
a–c
Values of different superscripts indicate significant difference within the expression level of each
gene (p< 0.05). COCs, cumulus–oocyte complexes; IOs, inferior bovine oocytes; MT, melatonin.
Table 2. The effect of melatonin on IVF Embryo Developmental potential of oocytes.
Groups No. of MII Oocytes No. of Cleavage
Embryos (%)
No. of Blastocysts
(%)
No. of D8 Hatched
Blastocysts (%)
IOs 215 142 (66.15 ±2.64) Aa 47 (33.1 ±0.87) Aa 3 (6.4 ±2.36) Aa
IOs + MT 228 182 (79.8 ±2.42) ABb
70 (38.5
±
1.11)
ABb 9 (12.9 ±2.99) ABa
COCs 369 334 (90.5 ±0.60) Bc 147 (44.0 ±0.74) Bc 42 (28.6 ±1.01) Bb
a,b,c
Values with different superscripts represent significant difference within the same column (p< 0.05);
A,B
Values
with different superscripts represent highly significant difference within the same column (p< 0.01), IOs, inferior
bovine oocytes; MT, melatonin; COCs, cumulus–oocyte complexes.
Molecules 2017, 22, 2059 6 of 15
Figure 6. Relative expression levels of BMP-15, GDF-9, ATPase 6 and ATPase 8 in MII oocytes.
a–c
Values of different superscripts indicate significant difference within the expression level of each gene
(p < 0.05). COCs, cumulus–oocyte complexes; IOs, inferior bovine oocytes; MT, melatonin.
Table 2. The effect of melatonin on IVF Embryo Developmental potential of oocytes.
Groups No. of MII
Oocytes
No. of Cleavage
Embryos (%) No. of Blastocysts (%) No. of D8 Hatched
Blastocysts (%)
IOs 215 142 (66.15 ± 2.64)
Aa
47 (33.1 ± 0.87)
Aa
3 (6.4 ± 2.36)
Aa
IOs + MT 228 182 (79.8 ± 2.42)
ABb
70 (38.5 ± 1.11)
ABb
9 (12.9 ± 2.99)
ABa
COCs 369 334 (90.5 ± 0.60)
Bc
147 (44.0 ± 0.74)
Bc
42 (28.6 ± 1.01)
Bb
a,b,c
Values with different superscripts represent significant difference within the same column (p < 0.05);
A,B
Values with different superscripts represent highly significant difference within the same column
(p < 0.01), IOs, inferior bovine oocytes; MT, melatonin; COCs, cumulus–oocyte complexes.
Figure 7. Effects of melatonin on IVF embryo developmental potential and cell number of blastocysts.
(A) Epifluorescence photomicrographs of in vitro-produced bovine blastocysts. COCs, cumulus–oocyte
complexes; IOs, inferior bovine oocytes; MT, melatonin; scale bar = 100 μm. (B) Nuclear staining of
bovine blastocyst after IVF in different groups. Scale bar = 20 μm.
Figure 7.
Effects of melatonin on IVF embryo developmental potential and cell number of blastocysts.
(
A
) Epifluorescence photomicrographs of
in vitro
-produced bovine blastocysts. COCs, cumulus–oocyte
complexes; IOs, inferior bovine oocytes; MT, melatonin; scale bar = 100
µ
m; (
B
) Nuclear staining of
bovine blastocyst after IVF in different groups. Scale bar = 20 µm.

Molecules 2017,22, 2059 7 of 15
Table 3. The effect of melatonin on Blastocyst cell number of IVF embryos using inferior oocytes.
Groups Cell Number/Blastocyst Pooled SEM
IOs 104.9 Aa 3.51
IOs + MT 115.8 ABb 1.71
COCs 122.3 Bb 3.57
a,b
Values with different superscripts represent significant difference within the same column (p< 0.05);
A,B
Values
with different superscripts represent highly significant difference within the same column (p< 0.01), IOs, inferior
bovine oocytes; MT, melatonin; COCs, cumulus-oocyte complexes.
3. Discussion
In the current study, the effects of melatonin on improving the quality of bovine IOs during their
maturation have been systematically investigated. Previous studies reported that melatonin scavenged
ROS and promoted the
in vitro
maturation rate of oocytes in different species including human [
19
],
porcine [
20
,
24
], mice [
16
], and bovine [
21
,
25
] models. However, these studies were performed by
use of oocytes with good quality and little has been known to the effect of melatonin on the IOs
which were usually discarded from the studies. Identification of the effective methods to improve the
quality of these IOs has significant biological as well as commercial prospects regarding the
in vitro
embryo production.
One of the obstacles for
in vitro
oocyte maturation is its excessively-produced ROS. This ROS
jeopardizes the quality of oocytes and, therefore, hinders the oocyte’s maturation and causes their
apoptosis [
16
]. In this study, we found that the bovine IOs had a relatively high level of ROS and low
level of GSH compared to normal COCs. This might attribute to a poor efficiency of IOs for their
in vitro
maturation (Figure 2A). To combat the negative effects of the excessive ROS and promote the oocyte’s
maturation, the antioxidants are frequently used in the
in vitro
culture system [
27
,
28
]. In this study,
a potent naturally-occurring antioxidant melatonin was selected. Melatonin is present in follicular
fluids in relatively high levels [
18
,
19
,
22
], partially because oocytes have the capacity to synthesize
melatonin per se [
29
]. It was found that melatonin added into the culture medium significantly reduced
the ROS and increased GSH level of the oocytes (Figure 2). Melatonin directly scavenges the ROS.
In addition, it also upregulates mRNA levels of antioxidant enzymes.
Antolin et al. [30]
reported
that melatonin enhanced mRNA levels of both Cu,Zn-SOD and Mn-SOD in cells.
Mayo et al. [31]
investigated the mechanisms by which melatonin upregulated the antioxidant enzyme gene expression;
they found that melatonin-induced synthesis of new proteins of all the three antioxidant enzymes,
i.e., Cu,Zn-SOD, Mn-SOD, and GSH-Px. Our study confirmed that melatonin upregulated the gene
expressions of several antioxidant enzymes (Figure 5).
Melatonin not only reduced ROS level but also improved mitochondrial function (Figure 3).
Mitochondria are a major source of ROS production and they require additional protection
from oxidative stress [
32
,
33
]. Previous studies have demonstrated that melatonin preserves the
optimal mitochondrial function and homeostasis by reducing mitochondria oxidative stress [
34
–
36
].
It is recognized that mitochondria distribution is a dynamic process [
37
], and it is an important
indicator of oocyte quality. For example, a uniform, granulated distribution of active mitochondria
in the process of oocyte maturation and also in the early embryo specific period is essential for the
normal embryo development [
38
–
40
]. Both the mitochondria content and ATP levels are positively
associated with the developmental competence of oocytes, that is, they promote the cytoplasmic
maturation of oocytes and their IVF embryos’ development [
41
,
42
]. In the current study, we observed
that, in IOs, the mitochondria were clustered to one side of the oocytes and melatonin treatment
significantly normalized the mitochondrial distribution and improved their function to produce more
ATP (Figure 3). This phenomenon has never been reported previously.
Another important factor related to the quality of oocytes is HSP90 expression. HSP90 is regarded
as a molecular chaperone. It plays a crucial role in the folding, transporting, and assembling proteins
and, furthermore, it protects the cell under different stress conditions and inhibits apoptosis through

Molecules 2017,22, 2059 8 of 15
several mechanisms [
43
–
45
]. Studies showed that the HSP90 level in bull spermatozoa gradually
declined following the process of freezing-thawing, and might be associated with sperm plasma
membrane integrity and acrosome integrity [
46
]. HSP90 was able to repair chromosome damage
caused by freeze-thawing, and maintain DNA integrity [
47
]. Melatonin was reported to turn on
the production of HSP90 [
48
,
49
]. However, the exact relationship between melatonin and HSP90 on
immature oocytes is essentially unknown. In this study, it was observed that HSP90 mRNA expression
in IOs was significantly lower than that in COCs (p< 0.05); however, melatonin treatment failed to
upregulate HSP90 mRNA expression (Figure 4). It appeared that HSP90 was not involved in the
pathway in which melatonin improved the quality of bovine IOs.
The expression of mitochondrial genes is known to affect the quality, fertilization, and embryo
development of oocytes [
50
]. Additioally, the expression of GDF-9 and BMP-15 is essential for
the development and function of mouse [
51
] and human [
52
] oocytes, and supplementation of
exogenous BMP-15 or GDF-9 during IVM significantly increased the development potential of oocytes
in bovine [
53
] and in mouse [
54
] models. Thus, the expression levels of ATPase 6, ATPase 8, BMP-15,
and GDF-9 mRNA are good indicators of the quality of oocytes. The results showed that, melatonin
(10
−9
M) significantly upregulated relative mRNA expressions of ATPase 6, BMP-15, and GDF-9
of IOs during their IVM (Figure 6), indicating that melatonin significantly improved the quality of
oocytes. Moreover, the apoptosis of oocytes may result from a poor mitochondrial function and excess
ROS under
in vitro
conditions [
55
]. The apoptosis was triggered by caspase-3, which is activated by
cytochrome c release from mitochondria. Bcl-2 can interfere with cytochrome c release and, therefore,
inhibit caspase-3 activation [
56
,
57
]. In the current study, melatonin downregulates caspase-3 while
upregulating Bcl-2 (Figure 5), which is another mechanism by which melatonin improves the quality of
IOs and promotes their maturation and embryo development. The detailed mechanisms are illustrated
in the Figure 8.
Molecules 2017, 22, 2059 8 of 15
gradually declined following the process of freezing-thawing, and might be associated with sperm
plasma membrane integrity and acrosome integrity [46]. HSP90 was able to repair chromosome
damage caused by freeze-thawing, and maintain DNA integrity [47]. Melatonin was reported to turn
on the production of HSP90 [48,49]. However, the exact relationship between melatonin and HSP90
on immature oocytes is essentially unknown. In this study, it was observed that HSP90 mRNA
expression in IOs was significantly lower than that in COCs (p < 0.05); however, melatonin treatment
failed to upregulate HSP90 mRNA expression (Figure 4). It appeared that HSP90 was not involved
in the pathway in which melatonin improved the quality of bovine IOs.
The expression of mitochondrial genes is known to affect the quality, fertilization, and embryo
development of oocytes [50]. Additioally, the expression of GDF-9 and BMP-15 is essential for the
development and function of mouse [51] and human [52] oocytes, and supplementation of exogenous
BMP-15 or GDF-9 during IVM significantly increased the development potential of oocytes in bovine [53]
and in mouse [54] models. Thus, the expression levels of ATPase 6, ATPase 8, BMP-15, and
GDF-9 mRNA are good indicators of the quality of oocytes. The results showed that, melatonin (10
−9
M)
significantly upregulated relative mRNA expressions of ATPase 6, BMP-15, and GDF-9 of IOs during
their IVM (Figure 6), indicating that melatonin significantly improved the quality of oocytes.
Moreover, the apoptosis of oocytes may result from a poor mitochondrial function and excess ROS
under in vitro conditions [55]. The apoptosis was triggered by caspase-3, which is activated by
cytochrome c release from mitochondria. Bcl-2 can interfere with cytochrome c release and, therefore,
inhibit caspase-3 activation [56,57]. In the current study, melatonin downregulates caspase-3 while
upregulating Bcl-2 (Figure 5), which is another mechanism by which melatonin improves the quality of
IOs and promotes their maturation and embryo development. The detailed mechanisms are illustrated
in the Figure 8.
Figure 8. The action pathway connecting the beneficial effect of melatonin on bovine inferior oocytes
and their subsequent IVF embryo development.
4. Materials and Methods
4.1. Chemicals
NaCl, KCl, Na pyruvate, NaHCO
3
, hemicalcium
L
-lactate, bovine serum albumin (BSA),
L
-
glutamine, essential amino acids (EAA), nonessential amino acids (NEAA), NaH
2
PO
4
·H
2
O, MgCl
2
·6H
2
O,
glucose, and medium were purchased from Sigma-Aldrich (St. Louis, MO, USA).
4.2. Animal Studies
All experimental animal protocols were approved and performed in accordance with the
requirements of the Institutional Animal Care and Use Committee at China Agricultural University.
The protocol approving number is XK662.
Figure 8.
The action pathway connecting the beneficial effect of melatonin on bovine inferior oocytes
and their subsequent IVF embryo development.
4. Materials and Methods
4.1. Chemicals
NaCl, KCl, Na pyruvate, NaHCO
3
, hemicalcium L-lactate, bovine serum albumin (BSA),
L-glutamine, essential amino acids (EAA), nonessential amino acids (NEAA), NaH
2
PO
4·
H
2
O,
MgCl2·6H2O, glucose, and medium were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Molecules 2017,22, 2059 9 of 15
4.2. Animal Studies
All experimental animal protocols were approved and performed in accordance with the
requirements of the Institutional Animal Care and Use Committee at China Agricultural University.
The protocol approving number is XK662.
4.3. Oocytes Collection, In Vitro Maturation, Fertilization, and In Vitro Embryo Development
Bovine ovaries were collected from the local abattoir and transported to the laboratory within 4 h.
The cumulus oocyte complexes (COCs) were aspirated from follicles which were 3–8 mm in diameter
using an 18 G needle attached to a 10 mL disposable syringe. Those with at least three layers of
compact cumulus cells were used for IVM. Each group with 50 COCs were washed three times in
0.1% PVA–PBS and then cultured in maturation medium which contained different concentrations of
melatonin in four-well dishes (Nunclon, Roskilde, Denmark) at 38.5 ◦C and 5% CO2.
IVM was performed for 22–24 h in 700
µ
L medium 199 (Gibco BRL, Carlsbad, CA, USA)
supplemented with 10
µ
g/mL follicle stimulating hormone (FSH), 10
µ
g/mL luteinizing hormone
(LH), 10% (v/v) fetal bovine serum (FBS, Hyclone; Gibco BRL, Grand Island, NY, USA), and 10
µ
g/mL
estradiol (E2). Oocyte maturation was based on methods described in a previous study [20].
After maturation, oocytes were washed three times in Brackett and Oliphant (BO) wash
medium [
58
], and aliquoted into groups of 15–20 oocytes and washed three times in BO fertilization
medium consisting of 10 mM caffeine sodium benzoate and 0.5% fatty acid-free BSA, and then
transferred into a 50
µ
L drop of fertilization medium in a Petri dish (Nunclon) and placed under
mineral oil and 5% CO
2
in humidified air at 38.5
◦
C. Frozen semen was thawed at 37
◦
C for 30 s.
The sperm was washed three times by centrifugation at 1800 gfor 5 min in 3 mL BO wash medium.
Then, the sperm motility and concentration were determined. Sperm pellets were re-suspended in BO
wash medium to a volume of 2 mL. Sperm suspension (50
µ
L) was added to each fertilization drop,
giving a total concentration of 10
×
10
6
spermatozoa/mL. Oocytes and sperm were incubated together
under 5% CO2in humidified air at 38.5 ◦C for 8 h before in vitro culture.
Presumptive zygotes were obtained after
in vitro
matured oocytes were fertilized in BO medium,
and 15–20 zygotes were cultured in 60
µ
L CR1aa medium which supplemented with 3 mg/mL BSA
(embryo culture tested fraction V, A-3311) for two days and 6% (v/v) fetal bovine serum (FBS) was
added into the culture medium from day 3 until day 8 by changing half of the media every two days.
The cleavage rate was recorded at 48 h, and blastocyst rate, hatched blastocyst rate, and mean cell
number/blastocyst were observed on day 8.
4.4. Classification and Grouping of the Retrieved Oocytes
The collected oocytes were classified into four categories based on surrounding cumulus cell layers
and homogeneity of ooplasm, as per the criterion established by methods described before [
59
] with
some modifications: grade A (COCs control, with an unexpanded cumulus mass having four or more
layers of cumulus cells surrounding the zona pellucida and with homogenous cytoplasm); grade B
(COCs control with an unexpanded cumulus mass having three to four layers of cumulus cells and
with relative homogenous cytoplasm); grade C (oocytes with an unexpanded cumulus mass having
under three layers of cumulus cells with regular cytoplasm or irregular shrunken cytoplasm) and grade
D + E (oocytes partially denuded or completely denuded of cumulus cells and with irregular shrunken
cytoplasm) (Figure 9). The graded oocytes were further categorized into two groups: Group 1—good
quality which included A and B grade COCs; and Group 2—inferior oocytes which included C and
D + E grade oocytes IOs.
4.5. Assessment of Oocyte Maturation
The MII oocyte phase was determined by evaluating the presence of the first polar body, according
to the method described by Zhao [
60
]. After 23 h IVM, IOs and COCs were denuded of cumulus cells

Molecules 2017,22, 2059 10 of 15
by vortexing in 0.1% (w/v) hyaluronidase for 2–3 min. Then, they were fixed in methanol for 10 min,
mounted on a slide, stained with 10 g/mL Hoechst 33342 and the presence or absence of polar bodies
was determined by epifluorescence microscope (SP2; Leica, Wetzlar, Germany) (Figure 1B).
Molecules 2017, 22, 2059 10 of 15
Figure 9. Classification criteria of GV oocytes. (A) COCs control, with an unexpanded cumulus mass
having four or more layers of cumulus cells surrounding the zona pellucida and with homogenous
cytoplasm; (B) COCs control with an unexpanded cumulus mass having three to four layers of
cumulus cells and with relative homogenous cytoplasm; (C) oocytes with an unexpanded cumulus
mass having under three layers of cumulus cells with regular cytoplasm or irregular shrunken
cytoplasm; (D) oocytes partially denuded of cumulus cells and with irregular shrunken cytoplasm;
and (E) oocytes completely denuded of cumulus cells and with irregular shrunken cytoplasm. C,D
and E were classified as IOs. scale bar = 100 μm.
4.6. Measurement of Reactive Oxygen Species (ROS) and Glutathione (GSH)
The 2,7-dichlorodihydrofluorescein diacetate (H2DCFDA) (Beyotime, Jiangsu, China) and Cell
Tracker Blue CMF2HC molecular probes (Invitrogen Inc, Carlsbad, CA, USA) were used to detect
intracellular ROS and GSH levels, respectively. GV-stage oocytes were collected from bovine ovary
and divided into three groups (IOs, IOs with 10
−9
M melatonin-treated, COCs control) and cultured
for 23 h in maturation medium. Then, MII-stage oocytes were collected and denuded from adherence
of cumulus cells, then they were incubated (in the dark) for 30 min in M2 medium containing
H2DCFDA (10 μM) or Cell Tracker Blue (10 μM), respectively. The MII-stage oocytes were collected
and denuded from the adherence of cumulus cells, and placed in 30 μL M2 droplets, and then the
fluorescence was observed using an epifluorescence microscope. The fluorescence intensity was
analyzed using ImageJ software (version 1.40; National Institutes of Health, Bethesda, MD, USA).
4.7. Oocytes Mitochondrial Distribution Assay
MitoTracker Red CMRox (Life Technologies, Grand Island, NY, USA) was used to detect
mitochondrial distribution. GV-stage oocytes were collected and divided into three groups (IOs,
IOs + MT (10
−9
M), COCs control, respectively). Cells were cultured in maturation medium for 23 h.
Then, MII-stage oocytes were collected and denuded from the adherence of cumulus cells and they
were incubated in PBS medium supplemented with 100 nM dye at 37 °C for 40 min. Oocytes were
then washed and analyzed by epifluorescence microscope (TE300; Nikon, Tokyo, Japan). Oocytes
with a uniform granulated distribution of active mitochondria were scored as granulated distribution
(GD), and the oocytes with a massive clustering distribution of mitochondria were scored as massive
distribution (MD). The images were observed and scored by three independent persons who were
unaware of this study.
4.8. Detection of ATP Levels in Oocytes
MII-stage oocytes were washed with PBS-PVA collected for ATP measurement, ATP levels were
determined using a commercially-available adenosine 5′-triphosphate (ATP) bioluminescent somatic
cell assay kit (FLASC, Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions.
Briefly, oocytes were transferred into a 96-well plate with 45.8 μL ATP assay buffer, then 0.2 μL ATP
Figure 9.
Classification criteria of GV oocytes. (
A
) COCs control, with an unexpanded cumulus mass
having four or more layers of cumulus cells surrounding the zona pellucida and with homogenous
cytoplasm; (
B
) COCs control with an unexpanded cumulus mass having three to four layers of cumulus
cells and with relative homogenous cytoplasm; (
C
) oocytes with an unexpanded cumulus mass having
under three layers of cumulus cells with regular cytoplasm or irregular shrunken cytoplasm; (
D
) oocytes
partially denuded of cumulus cells and with irregular shrunken cytoplasm; and (
E
) oocytes completely
denuded of cumulus cells and with irregular shrunken cytoplasm. C,D and E were classified as IOs.
scale bar = 100 µm.
4.6. Measurement of Reactive Oxygen Species (ROS) and Glutathione (GSH)
The 2,7-dichlorodihydrofluorescein diacetate (H2DCFDA) (Beyotime, Jiangsu, China) and Cell
Tracker Blue CMF2HC molecular probes (Invitrogen Inc, Carlsbad, CA, USA) were used to detect
intracellular ROS and GSH levels, respectively. GV-stage oocytes were collected from bovine ovary and
divided into three groups (IOs, IOs with 10
−9
M melatonin-treated, COCs control) and cultured for
23 h in maturation medium. Then, MII-stage oocytes were collected and denuded from adherence of
cumulus cells, then they were incubated (in the dark) for 30 min in M2 medium containing H2DCFDA
(10
µ
M) or Cell Tracker Blue (10
µ
M), respectively. The MII-stage oocytes were collected and denuded
from the adherence of cumulus cells, and placed in 30
µ
L M2 droplets, and then the fluorescence was
observed using an epifluorescence microscope. The fluorescence intensity was analyzed using ImageJ
software (version 1.40; National Institutes of Health, Bethesda, MD, USA).
4.7. Oocytes Mitochondrial Distribution Assay
MitoTracker Red CMRox (Life Technologies, Grand Island, NY, USA) was used to detect
mitochondrial distribution. GV-stage oocytes were collected and divided into three groups
(IOs, IOs + MT (10
−9
M), COCs control, respectively). Cells were cultured in maturation medium
for 23 h. Then, MII-stage oocytes were collected and denuded from the adherence of cumulus cells
and they were incubated in PBS medium supplemented with 100 nM dye at 37
◦
C for 40 min. Oocytes
were then washed and analyzed by epifluorescence microscope (TE300; Nikon, Tokyo, Japan). Oocytes
with a uniform granulated distribution of active mitochondria were scored as granulated distribution
(GD), and the oocytes with a massive clustering distribution of mitochondria were scored as massive
distribution (MD). The images were observed and scored by three independent persons who were
unaware of this study.

Molecules 2017,22, 2059 11 of 15
4.8. Detection of ATP Levels in Oocytes
MII-stage oocytes were washed with PBS-PVA collected for ATP measurement, ATP levels
were determined using a commercially-available adenosine 5
0
-triphosphate (ATP) bioluminescent
somatic cell assay kit (FLASC, Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s
instructions. Briefly, oocytes were transferred into a 96-well plate with 45.8
µ
L ATP assay buffer, then
0.2
µ
L ATP probe, 2
µ
L ATP converter, and 2
µ
L developer mix were added. The plate was placed at
room temperature for 30 min. ATP levels were measured using a luminometer (Bioluminat Junior,
Berthold, Germany).
4.9. Assessment of Embryo Quality
The quality of blastocysts was assessed by Hoechst 33342 staining for 10 min. After rinsing in 0.1%
PVA-PBS medium, blastocysts were mounted on a clean glass slide, then covered with a coverslip and
examined under an inverted microscope (TE300; Nikon, Tokyo, Japan) equipped with epifluorescence.
4.10. RNA Isolation and Reverse Transcriptional PCR
Fresh immature oocytes were subjected to denuding by pipetting in 0.1% hyaluronidase enzyme
in 0.1% PVA-PBS, whereas matured ones were denuded by pipetting in 0.1% PVA-PBS only. Denuded
oocytes and cumulus cells were washed twice in D-PBS solution. Both embryo collection and
RT-PCR procedures were performed according to the instructions on the Cells-to-cDNATM Kit
(Ambion Company, Grand Island, NY, USA; AM1722). Before the final step of gene expression analysis,
each cDNA sample was first amplified with a pair of primers specific for bovine
β
-actin mRNA
(Table 4) to screen the samples for contamination with genomic DNA. The PCR was run as follows:
initial denaturation at 95
◦
C for 5 min, denaturation at 94
◦
C for 30 s, annealing at Tm (
◦
C) for 45 s,
and then extension at 72
◦
C for 30 s. The above procedures were repeated for 35 cycles with a final
extension at 72 ◦C for 5 min.
Table 4. Primers used in this study.
Genes Primer Sequence(50-30) Tm(◦C) Product Size (bp)
β-Actin Forward:TGACGTTGACATCCGTAAAGACC 60 117
Reverse: GTGCTAGGAGCCAGGGCAG
Gpx-4 Forward: TGTGCTCGCTCCATGCACGA 60 224
Reverse: CCTGGCTCCTGCCTCCCAA
SOD1 Forward: GCTGTACCAGTGCAGGTCCTCA 60 228
Reverse: CATTTCCACCTCTGCCCAAGTC
Caspase-3 Forward: CAGACAGTGGTGCTGAGGATGA 60 211
Reverse: GCTACCTTTCGGTTAACCCGA
Bcl-2 Forward: GACTGACACTGAGTTTGGCTACG 60 152
Reverse: GAGTCCTTTCCACTTCGTCCTG
Bax Forward: GGCTGGACATTGGACTTCCTTC 60 161
Reverse:TGGTCACTGTCTGCCATGTGG
BMP-15 Forward: GAGGCTCCTGGCACATACAGAC 60 134
Reverse:CTCCACATGGCAGGAGAGGT
GDF-9 Forward: CAGAAGCCACCTCTACAACACTG 60 95
Reverse: CTGATGGAAGGGTTCCTGCTG
ATPase6 Forward: GAACACCCACTCCACTAATCCCAAT 60 147
Reverse: GTGCAAGTGTAGCTCCTCCGATT
ATPase8 Forward: CACAATCCAGAACTGACACCAACAA 60 129
Reverse: CGATAAGGGTTACGAGAGGGAGAC
HSP90 Forward: TCATTGGCTATCCCATCACTCT 60 324
Reverse: AATCGTTGGTCAGGCTCTTGTA

Molecules 2017,22, 2059 12 of 15
4.11. Detection of HSP90 in Oocyte via Immunofluorescence
Bovine oocytes were fixed with 4.0% neutral-buffered paraformaldehyde containing 0.3% Triton
X-100 at 37
◦
C for 45 min; nonspecific binding was blocked using PBS supplemented with 0.5%
BSA, 0.1% Triton X-100, and 5% fatal bovine serum (FBS) at 37
◦
C for 1 h, and then antibody of
HSP90 (final concentration 1:200, Abcam, Anti-Hsp90, [AC88] ab13492) was added to PBS containing
0.5% BSA, and 5% FBS, and incubated at 4
◦
C overnight. Oocytes were then washed three times
with PBS containing 0.5% BSA and 0.01% Triton X-100 (15 min per wash) and incubated with goat
anti-mouse IgG-FITC antibody (1:100 dilution, Santa Cruz Bio Inc., Santa Cruz, CA, USA) at 37
◦
C
for 1 h. After washing, the cell nucleus was counterstained with Hoechst 33342 and analyzed by
epifluorescence microscope (SP2; Leica, Wetzlar, Germany). Fluorescence intensity was analyzed using
ImageJ software (version 1.40; National Institutes of Health, Bethesda, MD, USA).
4.12. Statistical Analysis
The data are expressed as the mean values
±
standard error of the mean (SEM). The data were
analyzed using univariate analysis of variance (ANOVA) followed by Duncan
'
s test using SPSS
18.0 statistical software (SPSS Inc., Chicago, IL, USA). The significant difference was set up when
the p< 0.05.
5. Conclusions
In conclusion, melatonin at the 10
−9
M which is the physiological concentration promoted
the maturation rate of bovine IOs, and increased their cleavage, blastocyst, and hatched blastocyst
rates of IVF embryos. A novel mechanism has been observed, that is, melatonin improves to the
normal distribution of mitochondria and preserves the ATP production in IOs. Melatonin exhibited
its anti-oxidative and anti-apoptotic activities and upregulated several gene expressions which are
related to the oocytes’ maturation and embryo development. All these lead to the improvement of
the quality of IOs. The mechanisms are summarized in the Figure 9. As a result, it appeared that
melatonin treatment can serve as an effective method to improve the quality of IOs and this would
have important biological and commercial values in
in vitro
embryo production. The discoveries also
provide an important reference for application of melatonin in human test-tube baby technology.
Acknowledgments:
This work was supported by the National Natural Science Foundation of China (31372306),
and the Beijing dairy industry innovation team (BAIC06-2017).
Author Contributions:
Conceived and designed the experiments: G.L. and M.Y. Performed the experiments:
M.Y., J.T., H.W., J.W., G.L., Y.D., P.J., and L.X. Analyzed the data: M.Y., M.C., C.H., and L.Y. Wrote the paper:
M.Y. and G.L.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Held-Hoelker, E.; Klein, S.L.; Rings, F.; Salilew-Wondim, D.; Saeed-Zidane, M.; Neuhoff, C.; Tesfaye, D.;
Schellander, K.; Hoelker, M. Cryosurvival of
in vitro
produced bovine embryos supplemented with
l-Carnitine and concurrent reduction of fatty acids. Theriogenology 2017,96, 145–152. [CrossRef] [PubMed]
2.
Adona, P.R.; Pires, P.R.; Quetglas, M.D.; Schwarz, K.R.; Leal, C.L. Prematuration of bovine oocytes
with butyrolactone, I: Effects on meiosis progression, cytoskeleton, organelle distribution and embryo
development. Anim. Reprod. Sci. 2008,108, 49–65. [CrossRef] [PubMed]
3.
Lee, J.Y.; Jung, Y.G.; Seo, B.B. Effects of culture media conditions on production of eggs fertilized
in vitro
of
embryos derived from ovary of high grade Hanwoo. J. Anim. Sci. Technol.
2016
,58, 11. [CrossRef] [PubMed]
4.
Ohlweiler, L.U.; Brum, D.S.; Leivas, F.G.; Moyses, A.B.; Ramos, R.S.; Klein, N.; Mezzalira, J.C.; Mezzalira, A.
Intracytoplasmic sperm injection improves
in vitro
embryo production from poor quality bovine oocytes.
Theriogenology 2013,79, 778–783. [CrossRef] [PubMed]

Molecules 2017,22, 2059 13 of 15
5.
Yang, H.W.; Hwang, K.J.; Kwon, H.C.; Kim, H.S.; Choi, K.W.; Oh, K.S. Detection of reactive oxygen species
(ROS) and apoptosis in human fragmented embryos. Hum. Reprod.
1998
,13, 998–1002. [CrossRef] [PubMed]
6. Luberda, Z. The role of glutathione in mammalian gametes. Reprod. Biol. 2005,5, 5–17. [PubMed]
7. Sugino, N. Reactive oxygen species in ovarian physiology. Reprod. Med. Biol. 2005,4, 31–44.
8.
Chen, D.; Li, X.; Liu, X.; Liu, X.; Jiang, X.; Du, J.; Wang, Q.; Liang, Y.; Ma, W. NQO2 inhibition relieves ROS
effects on mouse oocyte meiotic maturation and embryo development. Biol. Reprod. 2017,4, 11–15.
9.
Devine, P.J.; Perreault, S.D.; Luderer, U. Roles of reactive oxygen species and antioxidants in ovarian toxicity.
Biol. Reprod. 2012,86, 27. [CrossRef] [PubMed]
10.
Mishra, A.; Reddy, I.J.; Gupta, P.S.; Mondal, S. L-Carnitine Mediated Reduction in Oxidative Stress
and Alteration in Transcript Level of Antioxidant Enzymes in Sheep Embryos Produced In Vitro.
Reprod. Domest. Anim. 2016,51, 311–321. [CrossRef] [PubMed]
11.
Somfai, T.; Ozawa, M.; Noguchi, J. Developmental competence of
in vitro
-fertilized porcine oocytes after
in vitro
maturation and solid surface vitrification: Effect of cryopreservation on oocyte antioxida tive system
and cell cycle stag. Cryobiology 2007,55, 115–126. [CrossRef] [PubMed]
12.
Xiao, X.; Li, Y. The effect of different concentration DTT or GSH treatment porcine sperm. Anim. Med. Adv.
2007,28, 27–32.
13.
Zhang, H.M.; Zhang, Y. Melatonin: A well-documented antioxidant with conditional pro-oxidant actions.
J. Pineal Res. 2014,57, 131–146. [CrossRef] [PubMed]
14.
Slominski, A.T.; Zmijewski, M.A.; Semak, I.; Kim, T.K.; Janjetovic, Z.; Slominski, R.M.; Zmijewski, J.W.
Melatonin, mitochondria, and the skin. Cell. Mol. Life Sci. 2017,74, 3913–3925. [CrossRef] [PubMed]
15.
Suofu, Y.; Li, W.; Jean-Alphonse, F.G.; Jia, J.; Khattar, N.K.; Li, J.; Baranov, S.V.; Leronni, D.; Mihalik, A.C.;
He, Y.; et al. Dual role of mitochondria in producing melatonin and driving GPCR signaling to block
cytochrome c release. Proc. Natl. Acad. Sci. USA 2017,114, E7997–E8806. [CrossRef] [PubMed]
16.
He, C.; Wang, J.; Zhang, Z.; Yang, M.; Li, Y.; Tian, X.; Ma, T.; Tao, J.; Zhu, K.; Song, Y.; et al. Mitochondria
Synthesize Melatonin to Ameliorate Its Function and Improve Mice Oocyte’s Quality under in Vitro
Conditions. Int. J. Mol. Sci. 2016,17. [CrossRef] [PubMed]
17.
Tamura, H.; Takasaki, A.; Miwa, I.; Taniguchi, K.; Maekawa, R.; Asada, H.; Taketani, T.; Matsuoka, A.;
Yamagata, Y.; Shimamura, K.; et al. Oxidative stress impairs oocyte quality and melatonin protects oocytes
from free radical damage and improves fertilization rate. J. Pineal Res.
2008
,44, 280–287. [CrossRef]
[PubMed]
18.
Brzezinski, A.; Seibel, M.M.; Lynch, H.J.; Deng, M.H.; Wurtman, R.J. Melatonin in human preovulatory
follicular fluid. J. Clin. Endocrinol. Metab. 1987,64, 865–867. [CrossRef] [PubMed]
19.
Nakamura, Y.; Tamura, H.; Takayama, H.; Kato, H. Increased endogenous level of melatonin in preovulatory
human follicles does not directly influence progesterone production. Fertil. Steril.
2003
,80, 1012–1016.
[CrossRef]
20.
Shi, J.M.; Tian, X.Z.; Zhou, G.B.; Wang, L.; Gao, C.; Zhu, S.E.; Zeng, S.M.; Tian, J.H.; Liu, G.S. Melatonin exists
in porcine follicular fluid and improves
in vitro
maturation and parthenogenetic development of porcine
oocytes. J. Pineal Res. 2009,47, 318–323. [CrossRef] [PubMed]
21.
Tian, X.; Wang, F.; He, C.; Zhang, L.; Tan, D.; Reiter, R.J.; Xu, J.; Ji, P.; Liu, G. Beneficial effects of melatonin on
bovine oocytes maturation: A mechanistic approach. J. Pineal Res. 2014,57, 239–247. [CrossRef] [PubMed]
22.
Tamura, H.; Nakamura, Y.; Korkmaz, A.; Manchester, L.C.; Tan, D.X.; Sugino, N.; Reiter, R.J. Melatonin and
the ovary: Physiological and pathophysiological implications. Fertil. Steril.
2009
,92, 328–343. [CrossRef]
[PubMed]
23.
Tamura, H.; Nakamura, Y.; Takiguchi, S.; Kashida, S.; Yamagata, Y.; Sugino, N.; Kato, H. Melatonin directly
suppresses steroid production by preovulatory follicles in the cyclic hamster. J. Pineal Res.
1998
,25, 135–141.
[CrossRef] [PubMed]
24.
Kang, J.; Koo, O.; Kwon, D.; Park, H.; Jang, G.; Kang, S.; Lee, B. Effects of melatonin on
in vitro
maturation
of porcine oocyte and expression of melatonin receptor RNA in cumulus and granulosa cells. J. Pineal Res.
2009,46, 22–28. [CrossRef] [PubMed]
25.
El-Raey, M.; Geshi, M.; Somfai, T.; Kaneda, M.; Hirako, M.; Abdel-Ghaffar, A.E.; Sosa, G.A.; El-Roos, M.E.;
Nagai, T. Evidence of melatonin synthesis in the cumulus oocyte complexes and its role in enhancing oocyte
maturation in vitro in cattle. Mol. Reprod. Dev. 2011,78, 250–262. [CrossRef] [PubMed]

Molecules 2017,22, 2059 14 of 15
26.
Tan, D.X.; Manchester, L.C.; Qin, L.; Reiter, R.J. Melatonin: A Mitochondrial Targeting Molecule Involving
Mitochondrial Protection and Dynamics. Int. J. Mol. Sci. 2016,17. [CrossRef] [PubMed]
27.
Bormann, C.L.; Ongeri, E.M.; Krisher, R.L. The effect of vitamins during maturation of caprine oocytes on
subsequent developmental potential in vitro. Theriogenology 2003,59, 1373–1380. [CrossRef]
28.
Wang, F.; Tian, X.; Zhang, L.; He, C.; Ji, P.; Li, Y.; Tan, D.; Liu, G. Beneficial effect of resveratrol on bovine
oocyte maturation and subsequent embryonic development after
in vitro
fertilization. Fertil. Steril.
2014
,101,
577–586. [CrossRef] [PubMed]
29.
Sakaguchi, K.; Itoh, M.T.; Takahashi, N.; Tarumi, W.; Ishizuka, B. The rat oocyte synthesises melatonin.
Reprod. Fertil. Dev. 2013,25, 674. [CrossRef] [PubMed]
30.
Antolin, I.; Rodriguez, C.; Sainz, R.M.; Mayo, J.C.; Uria, H.; Kotler, M.L.; Rodriguez-Colunga, M.J.;
Tolivia, D.; Menendez-Pelaez, A. Neurohormone melatonin prevents cell damage: Effect on gene expression
for antioxidant enzymes. FASEB J. 1996,10, 882–890. [PubMed]
31.
Mayo, J.C.; Sainz, R.M.; Antoli, I.; Herrera, F.; Martin, V.; Rodriguez, C. Melatonin regulation of antioxidant
enzyme gene expression. Cell. Mol. Life Sci. 2002,59, 1706–1713. [CrossRef] [PubMed]
32.
Castello, P.R.; Drechsel, D.A.; Patel, M. Mitochondria Are a Major Source of Paraquat-induced Reactive
Oxygen Species Production in the Brain. J. Biol. Chem. 2007,282, 14186–14193. [CrossRef] [PubMed]
33.
Izyumov, D.S.; Domnina, L.V.; Nepryakhina, O.K.; Avetisyan, A.V.; Golyshev, S.A.; Ivanova, O.Y.;
Korotetskaya, M.V.; Lyamzaev, K.G.; Pletjushkina, O.Y.; Popova, E.N.; et al. Mitochondria as source of
reactive oxygen species under oxidative stress. Study with novel mitochondria-targeted antioxidants—The
“Skulachev-ion” derivatives. Biochemistry 2010,75, 123–129. [CrossRef] [PubMed]
34.
Jou, M.; Peng, T.; Yu, P.; Jou, S.; Reiter, R.J.; Chen, J.; Wu, H.; Chen, C.; Hsu, L. Melatonin protects
against common deletion of mitochondrial DNA-augmented mitochondrial oxidative stress and apoptosis.
J. Pineal Res. 2007,43, 389–403. [CrossRef] [PubMed]
35.
Ren, L.; Wang, Z.; An, L.; Zhang, Z.; Tan, K.; Miao, K.; Tao, L.; Cheng, L.; Zhang, Z.; Yang, M.; et al. Dynamic
comparisons of high-resolution expression profiles highlighting mitochondria-related genes between
in vivo
and in vitro fertilized early mouse embryos. Hum. Reprod. 2015,30, 2892–2911. [PubMed]
36.
Semak, I.; Naumova, M.; Korik, E.; Terekhovich, V.; Wortsman, J.; Slominski, A. A Novel Metabolic Pathway
of Melatonin: Oxidation by Cytochrome C. Biochemistry 2005,44, 9300–9307. [CrossRef] [PubMed]
37.
Yamochi, T.; Hashimoto, S.; Amo, A.; Goto, H.; Yamanaka, M.; Inoue, M.; Nakaoka, Y.; Morimoto, Y.
Mitochondrial dynamics and their intracellular traffic in porcine oocytes. Zygote
2016
,24, 517–528. [CrossRef]
[PubMed]
38.
Nagai, S.; Mabuchi, T.; Hirata, S.; Shoda, T.; Kasai, T.; Yokota, S.; Shitara, H.; Yonekawa, H.; Hoshi, K.
Correlation of abnormal mitochondrial distribution in mouse oocytes with reduced developmental
competence. Tohoku J. Exp. Med. 2006,210, 137–144. [CrossRef] [PubMed]
39.
Brevini, T.A.; Cillo, F.; Antonini, S.; Gandolfi, F. Cytoplasmic remodelling and the acquisition of
developmental competence in pig oocytes. Anim. Reprod. Sci. 2007,98, 23–38. [CrossRef] [PubMed]
40.
Bavister, B.D.; Squirrell, J.M. Mitochondrial distribution and function in oocytes and early embryos.
Hum. Reprod. 2000,15 (Suppl. S2), 189–198. [CrossRef] [PubMed]
41.
Selesniemi, K.; Lee, H.J.; Muhlhauser, A.; Tilly, J.L. Prevention of maternal aging-associated oocyte
aneuploidy and meiotic spindle defects in mice by dietary and genetic strategies. Proc. Natl. Acad. Sci. USA
2011,108, 12319–12324. [CrossRef] [PubMed]
42.
Thouas, G.A.; Trounson, A.O.; Wolvetang, E.J.; Jones, G.M. Mitochondrial dysfunction in mouse oocytes
results in preimplantation embryo arrest in vitro. Biol. Reprod. 2004,71, 1936–1942. [CrossRef] [PubMed]
43.
Nollen, E.A.; Morimoto, R.I. Chaperoning signaling pathways: Molecular chaperones as stress-sensing ‘heat
shock’ proteins. J. Cell Sci. 2002,115, 2809–2816. [PubMed]
44.
Qiu, X.B.; Shao, Y.M.; Miao, S.; Wang, L. The diversity of the DnaJ/Hsp40 family, the crucial partners for
Hsp70 chaperones. Cell. Mol. Life Sci. 2006,63, 2560–2570. [CrossRef] [PubMed]
45.
Valleh, M.V.; Hyttel, P.; Rasmussen, M.A.; Strobech, L. Insulin-like growth factor 2: A modulator of
anti-apoptosis related genes (HSP70, BCL2-L1) in bovine preimplantation embryos. Theriogenology
2014
,82,
942–950. [CrossRef] [PubMed]
46.
Zhang, X.G.; Hu, S.; Han, C.; Zhu, Q.C.; Yan, G.J.; Hu, J.H. Association of heat shock protein 90 with motility
of post-thawed sperm in bulls. Cryobiology 2015,70, 164–169. [CrossRef] [PubMed]

Molecules 2017,22, 2059 15 of 15
47.
Flores, E.; Cifuentes, D.; Fernandez-Novell, J.M.; Medrano, A.; Bonet, S.; Briz, M.D.; Pinart, E.; Pena, A.;
Rigau, T.; Rodriguez-Gil, J.E. Freeze-thawing induces alterations in the protamine-1/DNA overall structure
in boar sperm. Theriogenology 2008,69, 1083–1094. [CrossRef] [PubMed]
48.
Wei, Y.; Hu, W.; Wang, Q.; Zeng, H.; Li, X.; Yan, Y.; Reiter, R.J.; He, C.; Shi, H. Identification, transcriptional
and functional analysis of heat-shock protein 90s in banana (Musa acuminata L.) highlight their novel role in
melatonin-mediated plant response to Fusarium wilt. J. Pineal Res. 2017,62, e12367f.
49.
Leja-Szpak, A.; Pierzchalski, P.; Goralska, M.; Nawrot-Porabka, K.; Bonior, J.; Link-Lenczowski, P.;
Jastrzebska, M.; Jaworek, J. Kynuramines induce overexpression of heat shock proteins in pancreatic cancer
cells via 5-hydroxytryptamine and MT1/MT2 receptors. J. Physiol. Pharmacol. 2015,66, 711–718. [PubMed]
50.
Hsieh, R.H.; Au, H.K.; Yeh, T.S.; Chang, S.J.; Cheng, Y.F.; Tzeng, C.R. Decreased expression of mitochondrial
genes in human unfertilized oocytes and arrested embryos. Fertil. Steril.
2004
,81 (Suppl. S1), 912–918.
[CrossRef] [PubMed]
51.
Su, Y.; Wu, X.; O’Brien, M.J.; Pendola, F.L.; Denegre, J.N.; Matzuk, M.M.; Eppig, J.J. Synergistic roles of
BMP15 and GDF9 in the development and function of the oocyte-cumulus cell complex in mice: Genetic
evidence for an oocyte-granulosa cell regulatory loop. Dev. Biol. 2004,276, 64–73. [CrossRef] [PubMed]
52.
Wei, L.; Liang, X.; Fang, C.; Zhang, M. Abnormal expression of growth differentiation factor 9 and bone
morphogenetic protein 15 in stimulated oocytes during maturation from women with polycystic ovary
syndrome. Fertil. Steril. 2011,96, 464–468. [CrossRef] [PubMed]
53.
Hussein, T.S.; Thopmson, J.G.; Gilchrist, R.B. Oocyte-secreted factors enhance oocyte developmental
competence. Dev. Biol. 2006,296, 514–521. [CrossRef] [PubMed]
54.
Yeo, C.X.; Gilchrist, R.B.; Thompson, J.G.; Lane, M. Exogenous growth differentiation factor 9 in oocyte
maturation media enhances subsequent embryo development and fetal viability in mice. Hum. Reprod.
2007
,
23, 67–73. [CrossRef] [PubMed]
55.
Miao, Y.; Zhou, C.; Bai, Q.; Cui, Z.; ShiYang, X.; Lu, Y.; Zhang, M.; Dai, X.; Xiong, B. The protective role of
melatonin in porcine oocyte meiotic failure caused by the exposure to benzo(a)pyrene. Hum. Reprod.
2017
,3,
1–12. [CrossRef] [PubMed]
56.
Rosse, T.; Olivier, R.; Monney, L.; Rager, M.; Conus, S.; Fellay, I.; Jansen, B.; Borner, C. Bcl-2 prolongs cell
survival after Bax-induced release of cytochrome C. Nature 1998,391, 496–499. [CrossRef] [PubMed]
57.
Porter, A.G.; Jänicke, R.U. Emerging roles of caspase-3 in apoptosis. Cell Death Differ.
1999
,6, 99–104.
[CrossRef] [PubMed]
58.
Brackett, B.G.; Oliphant, G. Capacitation of rabbit spermatozoa
in vitro
.Biol. Reprod.
1975
,12, 260–274.
[CrossRef] [PubMed]
59.
Chauhan, M.S.; Singla, S.K.; Palta, P.; Manik, R.S.; Madan, M.L.
In vitro
maturation and fertilization, and
subsequent development of buffalo (Bubalus bubalis) embryos: Effects of oocyte quality and type of serum.
Reprod. Fertil. Dev. 1998,10, 173–177. [CrossRef] [PubMed]
60.
Zhao, X.M.; Min, J.T.; Du, W.H.; Hao, H.S.; Liu, Y.; Qin, T.; Wang, D.; Zhu, H.B. Melatonin enhances the
in vitro
maturation and developmental potential of bovine oocytes denuded of the cumulus oophorus.
Zygotzx 2015,23, 525–536. [CrossRef] [PubMed]
Sample Availability: Sample Availability: Not available.
©
2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).