Israeli Acute Paralysis Virus: Epidemiology, Pathogenesis and Implications for Honey Bee Health

Abstract

Israeli acute paralysis virus (IAPV) is a widespread RNA virus of honey bees that has been linked with colony losses. Here we describe the transmission, prevalence, and genetic traits of this virus, along with host transcriptional responses to infections. Further, we present RNAi-based strategies for limiting an important mechanism used by IAPV to subvert host defenses. Our study shows that IAPV is established as a persistent infection in honey bee populations, likely enabled by both horizontal and vertical transmission pathways. The phenotypic differences in pathology among different strains of IAPV found globally may be due to high levels of standing genetic variation. Microarray profiles of host responses to IAPV infection revealed that mitochondrial function is the most significantly affected biological process, suggesting that viral infection causes significant disturbance in energy-related host processes. The expression of genes involved in immune pathways in adult bees indicates that IAPV infection triggers active immune responses. The evidence that silencing an IAPV-encoded putative suppressor of RNAi reduces IAPV replication suggests a functional assignment for a particular genomic region of IAPV and closely related viruses from the Family Dicistroviridae, and indicates a novel therapeutic strategy for limiting multiple honey bee viruses simultaneously and reducing colony losses due to viral diseases. We believe that the knowledge and insights gained from this study will provide a new platform for continuing studies of the IAPV-host interactions and have positive implications for disease management that will lead to mitigation of escalating honey bee colony losses worldwide.

Full text

Israeli Acute Paralysis Virus: Epidemiology, Pathogenesis
and Implications for Honey Bee Health
Yan Ping Chen
1
*, Jeffery S. Pettis
1
, Miguel Corona
1
, Wei Ping Chen
2
, Cong Jun Li
3
, Marla Spivak
4
,
P. Kirk Visscher
5
, Gloria DeGrandi-Hoffman
6
, Humberto Boncristiani
7
, Yan Zhao
8
,
Dennis vanEngelsdorp
9
, Keith Delaplane
10
, Leellen Solter
11
, Francis Drummond
12
, Matthew Kramer
13
,
W. Ian Lipkin
14
, Gustavo Palacios
15
, Michele C. Hamilton
1
, Barton Smith
1
, Shao Kang Huang
16
,
Huo Qing Zheng
17
, Ji Lian Li
18
, Xuan Zhang
19
, Ai Fen Zhou
20
, Li You Wu
20
, Ji Zhong Zhou
20
,
Myeong-L. Lee
21
, Erica W. Teixeira
22
, Zhi Guo Li
17
, Jay D. Evans
1
1USDA-ARS Bee Research Laboratory, BARC-East Building, Beltsville, Maryland, United States of America, 2Microarray Core Facility, National Institute of Diabetes and
Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland, United States of America, 3USDA-ARS Bovine Functional Genomic Laboratory, BARC-East
Building, Beltsville, Maryland, United States of America, 4Department of Entomology, University of Minnesota, St. Paul, Minnesota, United States of America,
5Department of Entomology, University of California, Riverside, Riverside, California, United States of America, 6USDA-ARS, Carl Hayden Bee Research Center, Tucson,
Arizona, United States of America, 7Department of Biology, University of North Carolina, Greensboro, Greensboro, North Carolina, United States of America, 8USDA-ARS
Molecular Plant Pathology Laboratory, Beltsville, Maryland, United States of America, 9Department of Entomology, University of Maryland, College Park, Maryland, United
States of America, 10 Department of Entomology, University of Georgia, Athens, Georgia, United States of America, 11 Illinois Natural History Survey, University of Illinois,
Urbana, Illinois, United States of America, 12 School of Biology and Ecology, University of Maine, Orono, Maine, United States of America, 13 USDA-ARS Biometrical
Consulting Services, Beltsville, Maryland, United States of America, 14 Center for Infection and Immunity, Mailman School of Public Health, Columbia University, New York,
New York, United States of America, 15 National Center for Biodefense and Infectious Disease, George Mason University, Manassas, Virginia, United States of America,
16 College of Bee Science, Fujian Agriculture and Forestry University, Fuzhou, Fujian, People’s Republic of China, 17 College of Animal Sciences, Zhejiang University,
Hangzhou, Zhejiang, People’s Republic of China, 18 Institute of Apicultural Research, Chinese Academy of Agricultural Science, Beijing, People’s Republic of China,
19 Eastern Bee Research Institute, Yunnan Agricultural University, Kunming, People’s Republic of China, 20 Institute for Environmental Genomics (IEG), University of
Oklahoma, Norman, Oklahoma, United States of America, 21 Sericulture and Apiculture Department, National Academy of Agricultural Science, RDA Suwon, Republic of
Korea, 22 Age
ˆncia Paulista de Tecnologia dos Agronego
´cios/SAA-SP, Pindamonhangaba, Sa
˜o Paulo, Brazil
Abstract
Israeli acute paralysis virus (IAPV) is a widespread RNA virus of honey bees that has been linked with colony losses. Here we
describe the transmission, prevalence, and genetic traits of this virus, along with host transcriptional responses to infections.
Further, we present RNAi-based strategies for limiting an important mechanism used by IAPV to subvert host defenses. Our
study shows that IAPV is established as a persistent infection in honey bee populations, likely enabled by both horizontal
and vertical transmission pathways. The phenotypic differences in pathology among different strains of IAPV found globally
may be due to high levels of standing genetic variation. Microarray profiles of host responses to IAPV infection revealed that
mitochondrial function is the most significantly affected biological process, suggesting that viral infection causes significant
disturbance in energy-related host processes. The expression of genes involved in immune pathways in adult bees indicates
that IAPV infection triggers active immune responses. The evidence that silencing an IAPV-encoded putative suppressor of
RNAi reduces IAPV replication suggests a functional assignment for a particular genomic region of IAPV and closely related
viruses from the Family Dicistroviridae, and indicates a novel therapeutic strategy for limiting multiple honey bee viruses
simultaneously and reducing colony losses due to viral diseases. We believe that the knowledge and insights gained from
this study will provide a new platform for continuing studies of the IAPV–host interactions and have positive implications
for disease management that will lead to mitigation of escalating honey bee colony losses worldwide.
Citation: Chen YP, Pettis JS, Corona M, Chen WP, Li CJ, et al. (2014) Israeli Acute Paralysis Virus: Epidemiology, Pathogenesis and Implications for Honey Bee
Health. PLoS Pathog 10(7): e1004261. doi:10.1371/journal.ppat.1004261
Editor: David S. Schneider, Stanford University, United States of America
Received January 9, 2014; Accepted June 6, 2014; Published July 31, 2014
This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for
any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.
Funding: This research was supported by the USDA-CAP grant (2009-85118-05718). WIL and GP received support from NIH award AI1057158 (Northeast
Biodefense Center-Lipkin) and the Department of Defense. The funders had no role in study design, data collection and analysis, decision to publish, or
preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* Email: judy.chen@ars.usda.gov
Introduction
Honey bees are the most economically valuable pollinators of
agricultural crops worldwide. In the U.S. alone, the value of
agricultural crops pollinated by bees each year is more than $17
billion dollars [1]. In 2006, an enigmatic phenomenon labeled
Colony Collapse Disorder (CCD) was observed in U.S. beekeeping
operations. CCD is defined as an unusually sudden decrease in the
numbers of worker honey bees, without expected signs of disease,
starvation, or reproductive failure [2]. Such rapid declines have
been observed throughout the history of beekeeping, and their
causes often remain enigmatic. Since 2006, colony losses have been
PLOS Pathogens | www.plospathogens.org 1 July 2014 | Volume 10 | Issue 7 | e1004261

noted in beekeeping operations in much of the world [3], posing a
significant threat to the pollination of many agricultural crops [4].
There is no single agent yet identified that causes CCD. Instead,
it appears that CCD results from a combination of factors that
include pathogens/parasites, pesticides, malnutrition, environ-
mental stress, low genetic diversity, and migratory beekeeping
practices. It is also conceivable that synergistic effects of two or
more insults are behind recent declines. To that end, there is some
evidence that interactions between pathogens and neuro-active
pesticides can synergistically affect honey bee mortality, contrib-
uting to colony depopulation [5,6].
An early survey [7] of healthy and CCD-affected colonies in the
U.S. found a significant correlation between CCD-affected colonies
and Israeli acute paralysis virus (IAPV), an RNA virus first identified
in 2004 [8]. The result drew immediately international attention to
the risks of virus infection in honey bees. The role of IAPV in
triggering colony declines, alone or in concert with other factors,
remains a research priority. The parasitic mite Varroa destructor has
long been considered the primary threat to honey bees [9], in part
because this mites serves as a vector of honey bee viruses [10]. For
example, levels of Deformed wing virus (DWV), a common virus that
has killed billions of honey bees across the globe, are greatly increased
following Varroa transmission [11]. A recent study showed that
Varroa mites can also serve as vectors of IAPV; furthermore, the
mite/virus association was shown to reduce host immunity and
promote elevated levels of IAPV replication [12], providing more
evidence for the damaging effects of viruses associated with Varroa
mite infestations.
In this study, we investigated the molecular basis of pathogen-
esis, transmission and genetic diversity of IAPV in honey bees and
evaluated the impacts of IAPV infection on colony losses. We also
determined the global transcriptional profiles of honey bee
responses to viral infection. Finally, we examined the inhibitory
effect of small interfering RNA (siRNA) that targets putative virus-
encoded proteins (VSR) on IAPV replication. The replication of
single-stranded positive-sense RNA viruses results in the synthesis
of complementary negative-stranded RNA, thereby producing
dsRNA replicative intermediates that are attractive targets for
defenses based on RNA interference. To counteract host RNAi
antiviral defense, viruses have evolved strategies to suppress the
antiviral effects of RNAi. A recent study with Cricket paralysis
virus (CrPV) showed that the sequences upstream of a highly
conserved sequence (DVEXNPGP) within the N-terminal region
of CrPV ORF-1 encode a potent suppressor that mutes the RNAi
antiviral defense in Drosophila [13]. As a result, we speculated that
IAPV may possess a similar mechanism to counteract the antiviral
response of hosts. We believe that knowledge gained from this
study will lead to better understanding of the dynamics of virus
disease pathogenesis in honey bees and help mitigate escalating
colony losses worldwide.
Results
IAPV attacks every stage and caste of honey bees and
causes systemic infection in honey bees
Although the bee colonies in this study showed no clinical signs
of infection, IAPV was found widely in surveyed honey bees
colonies. IAPV-positive PCR signal was detected in eggs, larvae,
pupae, adult workers, drones, and queens as well as V. destructor
that fed on the bees (Figure 1A). In addition, IAPV-specific PCR
signal was also detected in royal jelly, honey, pollen, queen feces
and drone semen collected from IAPV positive colonies
(Figure 1B). Strand specific RT-qPCR assays revealed that IAPV
causes systemic infection in honey bees. IAPV replication was
detected in hemolymph, brain, fat body, salivary gland, hypopha-
ryngeal gland, gut, nerve, trachea, and muscle. However, the
relative abundance of negative stranded RNA copies of IAPV in
the different tissues varied significantly. The hemolymph (i.e.,
hemocytes) harbored the lowest level of IAPV among the
examined tissues and therefore was chosen as the calibrator.
The difference in IAPV abundance in other tissues relative to
hemolymph ranged from 2.23- to 167-fold in the following order
from lowest to highest concentration: muscle,fat body,brain,
trachea,salivary gland,hypopharyngeal gland,nerve,gut
Figure 1. Detection of IAPV infection in a representative honey
bee colony. (A) Gel electrophoresis of RT-PCR amplification for specific
detection of IAPV from samples of worker eggs, worker larvae, worker
pupae, adult workers, drones, queens and parasitic mites, Varroa
destructor collected from the same colony. (B) Gel electrophoresis of RT-
PCR amplification for specific detection of IAPV from samples of colony
foods, queen feces, and drone semen. For both A and B, a PCR band of
586 bp indicating the IAPV infection is observed in examined samples.
doi:10.1371/journal.ppat.1004261.g001
Author Summary
The mysterious outbreak of honey bee Colony Collapse
Disorder (CCD) in the US in 2006–2007 has attracted
massive media attention and created great concerns over
the effects of various risk factors on bee health. Under-
standing the factors that are linked to the honey bee
colony declines may provide insights for managing similar
incidents in the future. We conducted this study to
elucidate traits of a key honey bee virus, Israeli acute
paralysis virus. We then developed an innovative strategy
to control virus levels. The knowledge and insights gained
from this study will have positive implications for bee
disease management, helping to mitigate worldwide
colony losses.
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 2 July 2014 | Volume 10 | Issue 7 | e1004261

(Figure 2A). In situ hybridization showed IAPV specific signals
localized in egg, gut, ovaries, and spermatheca of infected queens.
Colony traits and IAPV infection
IAPV was found to be the third most common virus infection
in bee colonies after DWV and Black Queen Cell Virus
(BQCV). Over the 4-year study period, the infection IAPV
detected in the brood was significantly higher than in adult bees
(p,0.001). When we divided our experimental bee colonies into
those with more than ten frames covered with adult workers and
more than six frames filled with brood and food stores (‘strong’)
versus those with fewer than ten frames of adult bees, less than
six combs with brood and small patches of food stores (‘weak’),
we found a measurable difference in IAPV infection levels. The
average rate of IAPV infection per month was 49% for brood
and 19.5% for adults in weak colonies and 26% for brood and
3.25% for adults in strong colonies. The overall rate of IAPV
infection in weak colonies was significantly higher than in the
strong colonies (p,0.01 for brood and p,0.001 for adults).
While no statistically significantseasonalvariationinIAPV
infection was observed in the strong colonies, the infection rate
of IAPV in adult bees in weak colonies increased from spring to
summer and fall and peaked in winter. While strong colonies in
our survey survived through the cold winter months, almost all
weak colonies collapsed before February (Figure 3). While
strong colonies in our survey survived through the cold winter
months, almost all weak colonies collapsed before February
(Figure 3).
High genetic diversity exists between different strains of
IAPV
The complete genomes of IAPV strains collected in the US
states of Maryland, California, and Pennsylvania were obtained by
direct sequencing of overlapping RT-PCR fragments and partial
sequences from both 59UTR and 39UTR and deposited in
GenBank with accession numbers, EU224279, EU218534, and
Figure 2. Relative abundance of negative strand RNA of IAPV genome copies in different tissues of honey bees and in situ
hybridization analysis of queen somatic and germ tissues. (A) The hemolymph harbored the minimal level of IAPV and therefore was chosen
as a calibrator. The concentration of negative strand RNA of IAPV in other tissues was compared with the calibrator and expressed as n-fold change.
The y-axis depicts fold change relative to the calibrator. (B) The slides were not hybridized with DIG-labeled IAPV probe (top row, negative control)
and the slides were hybridized with DIG-labeled IAPV probe (bottom row). Positive signal is dark blue to purple and the negative areas are pink in
color. The infected tissues of queen gut, ovary, spermatheca and queen eggs are indicated by a dark blue/purple color.
doi:10.1371/journal.ppat.1004261.g002
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 3 July 2014 | Volume 10 | Issue 7 | e1004261

EU224280, respectively. Comparison of US, Chinese and
Australian IAPV strains with the first reported Israeli IAPV strain
at the genome level showed a significant genetic divergence among
different strains, providing evidence of quasi-species dynamics in
IAPV populations. The polymorphisms in IAPV were found more
frequently in 59UTR and functional protein coding regions
compared to the capsid protein coding region and 39UTR
(Figure 4A). Phylogenetic analysis using full-length viral genomes
showed that the Australian IAPV strain constitutes the earliest
lineage of the phylogenetic tree. The US strains branch to form a
distinct lineage distantly related to the Israeli and Chinese strains
of IAPV (Figure 4B).
IAPV infection results in more significant changes in gene
expression in adult bees than in brood
The results of microarray analyses yielded a large group of
differentially expressed genes. The principal component analysis
(PCA) mapping showed that the total accumulative variance of the
first three PCs was 78% for adult and 67.4% for brood,
respectively, and suggested that two kinds of experimental
populations (IAPV positive vs IAPV negative) were well separated
for both adults and brood. The cluster analysis showed overall
similar data patterns (Figure S3A and B), indicating that inter-
individual differences had a minimum effect on gene expression
data. The treatment variance (IAPV-infected versus uninfected)
Figure 3. Average prevalence of IAPV infection in a single month. (A) Strong colonies. (B) Weak colonies. For both strong and weak colonies,
the prevalence of IAPV infection in the brood was significantly higher than in adult bees. While strong colonies did not exhibit significant seasonal
variation in IAPV infection, the infection rate of IAPV in adult bees in weak colonies increased from Spring to Summer and Fall and peaked in the
Winter. All strong colonies survived through the cold winter months while the weak colonies collapsed before February.
doi:10.1371/journal.ppat.1004261.g003
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 4 July 2014 | Volume 10 | Issue 7 | e1004261

Figure 4. Genome-wide sequence diversity and phylogenetic relationship of IAPV isolates. (A) A graphical representation of the pair-wise
global alignments of the reference sequence of IAPV (NC_009025), the first complete sequence of IAPV, with other IAPV genome sequences
individually. This figure is retrieved from GenBank and modified. The alignments were pre-computed using the ‘‘band’’ version of the Needleman-
Wunsch algorithm. The top histogram shows the average density of nucleotide changes (excluding gaps, insertions and undetermined nucleotides)
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 5 July 2014 | Volume 10 | Issue 7 | e1004261

was significantly higher than error variance for both adult bees
and brood (both p,0.01) (Figure S3C). This confirmed that
variation among samples was largely due to IAPV and suggested
the good data quality for two ANOVA data analysis in both adults
and brood. The distribution of differentially expressed genes in
both adults and brood are presented by volcano plots (Figure
S3D). All microarray data were deposited in the NCBI public
database with accession number GSE46278.
Overall, the transcriptional response to IAPV infection was
substantially different between adults and brood. There were
2,522 up-regulated and 2,093 down-regulated genes identified in
IAPV-positive adults, but only 825 up-regulated and 525 down-
regulated genes identified in IAPV-positive brood with a very
small fraction of overlapping genes between the two groups
(Figure 5A). Of the up-regulated and down-regulated genes,
overlapping genes between adult and brood were 268 and 68,
respectively. A heat map illustrates the differential expression of
enriched functional genes between adults and brood (Figure 5B).
Of the genes transcriptionally altered by IAPV infection, 2,150
genes identified in adults and 716 genes identified in brood could
be assigned a putative function based on orthology to D.
melanogaster genes. The GO-enriched analysis of the genes that
displayed fold-changes of more than 1.5 (False Discovery Rate
adjusted rvalue#0.05) and had putative D. melanogaster
orthologs by the Database for Annotation, Visualization and
Integrated Discovery (DAVID) revealed major functional clusters
including metabolism, host cell transcription, signal transduction,
cell cycle, hormone synthesis, endocytosis, phagocytosis, autoph-
agy, and innate immune response (Table S1 and S2). The majority
of genes with up-regulated expression were related to the
regulation of signaling transduction and immune response, while
the majority of those with down-regulated expression were
involved with metabolic energy generation. Of the top functional
clusters, genes that were related to immune response functions
were of particular interest in this study.
We examined the integrated networks and pathways of genes
that were up- and down- regulated in response to IAPV infection.
The global canonical pathway analysis of 2,150 genes identified
in adults using the Ingenuity Pathway Knowledge Base led to
identification of five top canonical pathways, including mito-
chondrial dysfunction, TCA cycle II, protein ubiquitination
pathway, eIF2 signaling and c-glutamyl cycle, with mitochondrial
dysfunction (37 molecules, r-value 3.93E-17) as the most
significantly affected pathway. Among five significantly disturbed
canonical pathways, four showed significant up-regulation and
only the c-glutamyl cycle pathway showed significant down-
regulation. The analysis of 716 IAPV regulated genes in brood
identified five top canonical pathways, eIF2 signaling, mitochon-
drial dysfunction, mTOR signaling, TCA cycle II, regulation of
eIF4 and P70S6K signaling, with eIF2 signaling (25 molecules, r-
value 6.15E-16) as the most significantly affected canonical
pathway. All pathways showed significant up-regulation. Among
25 networks identified, one was centered by viral infection in
adults (Figure 6) and contains both up- and down- regulated
genes that are involved in pathways related to host defense
responses such as oxidative phosphorylation, ABC transporter,
endocytosis, phagocytosis, TGF-beta signaling pathway, mTOR
signaling pathway, MAPK signaling pathway, JAK-STAT
pathway, and lysosome.
IAPV infection triggers multiple immune signaling in adult bees.
qRT-PCR confirmation of immune related genes showed the
components of the Janus Kinase/Signal Transducers and Activa-
tors of Transcription (JAK-STAT) pathway including Cbl, STAT,
PIAS, and Hopscotch had #2 fold elevated expression in response
to IAPV infection. The components of Mammalian Target of
Rapamycin (mTOR) signaling pathway including GbL, MO25,
Dmel, and eIF4B had #2 fold elevated expression in response to
IAPV infection. The expression of genes including Pointed, Phi,
and Corkscrew that had functional association with Mitogen-
activated Protein Kinases (MAPK) pathway was upregulated to
2.3-, 2.91- and 1.92-fold respectively, in response to IAPV
infection. The expression of genes EGFR, PastI, Rabenosysn,
and CG1115, involved in endocytosis was also upregulated by 2.1-
, 3.18-, 1.88-, and 3.1- fold, respectively. IAPV infection also
caused the down-regulation of mTOR pathway gene such as
Raptor, MAPK pathway genes, TII and Ras, and endocytosis
gene CG6259 ranging from 22.14 to 23.9 fold. qRT-PCR
analysis of immune related genes in IAPV-infected adults showed
considerable concordance with the normalized microarray data
(Figure 7).
Identification of a putative viral interference protein
The sequence motif of D
I
E
E
NPGP was identified in the N-
terminal region of ORF-1of IAPV and other members of the
Dicistroviridae family infecting honey bees such as KBV, and
ABPV, where the uppercase letters of the sequence motif indicates
residues with absolute sequence conservation (Figure 8A). An
RNAi-mediated knockdown experiment showed that silencing
putative VSR in IAPV genome could effectively inhibit replication
of IAPV and confer significant antiviral activity in honey bees.
Quantification of the titer of negative strand RNA of IAPV
showed that feeding siRNA resulted in a remarkable reduction in
IAPV replication. The bees in Group I (IAPV+siRNA) had the
lowest IAPV titer among four experimental groups at all time
points (days 1, 3, 5 and 7) and this group was therefore chosen as a
calibrator. Compared to the calibrator, Group-II (IAPV), Group
III (IAPV+Varroa+siRNA), and Group IV (IAPV+Varroa)
averaged 4.7860.25, 17.560.56, and 451.562.72 (Mean6SE,
N = 3) folder higher titers of negative strand RNA of IAPV,
respectively. The significant reduction in virus replication
observed in Groups-I and III at day 1 post treatment indicated
that the impact of siRNA on the virus life cycle takes place within
24 hours. There was no significant difference in virus titer among
different time points for each group (r,0.05, ANOVA). The
highest titer of virus replication seen in Group IV challenged by V.
destructor with no siRNA treatment provides additional evidence
for the role of V. destructor in virus transmission and activation in
honey bees (Figure 8B). The antiviral effects of siRNA from this
study (siRNA-
suppressor
) were compared to those of siRNA targeting
the 59Internal Ribosomal Entry Site (IRES) of IAPV (siR-
NA-
59IRES
) that was shown to confer antiviral activity in bees in
our previous study [14]. The virus titer in bees fed siRNA-
59IRES
was 3.360.54, 4.560.33, 3.960.21 and 5.260.67 (Mean6SE,
N = 3) fold higher than the group fed with siRNA-
suppressor
at Day
in all additional sequences per a reference sequence segment. The length of the segment is equal to the length of the reference sequence divided by
the width of its graphical representation (in pixels). The deletions, insertions and differences among the sequences are highlighted in blue, green and
red-violet, respectively. If no significant alignment could be obtained for a particular sequence, no horizontal bar is shown. (B) Phylogenetic tree
showing the relationship of IAPV strains from different geographic locations globally. Numbers at each node represent bootstrap values as
percentages of 500. Individual sequences are labeled with their GenBank accession numbers.
doi:10.1371/journal.ppat.1004261.g004
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 6 July 2014 | Volume 10 | Issue 7 | e1004261

3, Day 5, and Day 7 post treatment, respectively. However, no
significant difference (p valve.0.05) was observed between groups
received dsiRNAs targeting different genomic regions when
Varroa mites were introduced.
Discussion
The association of IAPV with honey bee declines has led to an
increased awareness of the risks of viral infections on bee health. In
this paper, we present a long-term study of the biological and
molecular features of IAPV infection in honey bees. Our results
showed that IAPV is established as a persistent infection in honey
bee population and infects all developmental stages and different
sexes of honey bees. The tissue tropism study showed that IAPv
replicates within all bee tissues but tends to concentrate in gut and
nerve tissues and in the hypopharyngeal glands. The highest titer
of IAPV was observed in gut tissues and, in conjunction with
detection of IAPV in colony food, suggests that food serves as a
Figure 5. An overview of gene expression profiles in IAPV infected adults and brood. (A) Venn graph compares regulated genes between
adult and brood. The intersecting circles indicate overlapping genes between adult and brood. Of 4615 genes with altered expression in IAPV-
positive adult and 1350 genes with altered expression in IAPV-positive brood, the number of overlapping genes between adults and brood was 336.
(B) A heat map illustrates differential expression profiles of up- and down- regulated genes for adults and brood. The number of genes with altered
expression was significantly higher in IAPV infected adult than in IAPV infected brood. The relative levels of gene expression are depicted using a
color scale where blue indicates the lowest and red indicates the highest level of expression. Significantly enriched Gene Ontology (GO) terms of up-
and down regulated gene clusters inducted by IAPV infection (r#0.05) appear on the right side of the heat map.
doi:10.1371/journal.ppat.1004261.g005
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 7 July 2014 | Volume 10 | Issue 7 | e1004261

vehicle for within-colony horizontal transmission. The next highest
titer of IAPV replication was observed in nerve tissue and indicates
tropism of IAPV to the bee nervous system, consistent with
observed pathologies. Specifically, while IAPV-infected bees in our
study remained asymptomatic, infected bees can exhibit shivering
wings and progressive paralysis, typical symptoms of nerve-
function impairment [8]. The third highest titer of IAPV was
identified in hypopharyngeal glands and may explain the presence
of the virus in royal jelly, a product synthesized in these glands and
fed to queens and larvae. Royal jelly, along with nectars shared
among adult workers, thus provide an important route for viral
movement within the colony.
A previous study showed that honey bees became infected
with IAPV after exposure to V. destructor that carried the virus
[12], illustrating vector-mediated horizontal transmission. In
addition, the detection of IAPV in the digestive tracts and feces
of queen bees along with detection of the virus in colony food
supplies suggest a food-borne transmission pathway, arguably
driven by frequent trophallaxis (mouth-to-mouth sharing of
food) between colony members. The detection of IAPV in eggs
and larvae not exposed to V. destructor that serves as a vector to
facilitate the horizontal transmission of the virus to their honey
bee hosts, together with detection of IAPV in queen ovaries
suggests a vertical transmission pathway from queens to their
progeny. Further, the detection of IAPV in drone semen, and in
the spermatheca used to store sperm in queens for fertilizing
eggs, suggests that venereal (sexual) infection is another
plausible mechanism by which this virus is transmitted. We
suspect that IAPV manifests itself in a way similar to the
iflavirus Deformed wing virus.Namely,whencoloniesare
healthy, the virus persists via vertical transmission and exists in a
latent state without perturbing host immunity. When honey bees
Figure 6. Regulated molecules that are involved in host metabolism and immunity. The figure illustrates a network predicted by Ingenuity
Pathway Analysis that is centered by viral infection and associated with molecules involved in host energy metabolism and immunity. Solid and
dashed connecting lines indicate the presence of direct and indirect interactions, respectively. Nodes indicate input of genes into the pathway
analysis and the different symbols indicate gene functions (Legend in bottom left). The intensity of the node color-(red) indicates the degree of up-
regulation while the intensity of the node color-(green) indicates the degree of down-regulation. The numbers shown in each node indicates the fold
change in response to IAPV infection.
doi:10.1371/journal.ppat.1004261.g006
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 8 July 2014 | Volume 10 | Issue 7 | e1004261

live under stressful conditions such as Varroa mite infestation
and overwintering stress, the virus replicates quickly and
becomes more infectious, leading to the death of hosts and
possible collapse of the colony.
RNA viruses are characterized by their quasi-species population
structure, that is, clouds of genetically related variants that
collectively determine pathological characteristics of the population
[15]. Genome analyses of IAPV strains shows several lineages.
Previous genetic analysis of IAPV suggested the existence of at least
three distinct IAPV lineages, two of them present in the US [16]. Our
phylogenetic analysis confirmed this finding but showed a long period
of independent evolution of IAPV strains in different collections.
Genetic variation may account for the difference in virulence
properties and severity of disease manifestations among IAPV strains
andinfact,Cornmanetal.[17]notedanespeciallyhighrateof
nucleotide divergence among IAPV isolates sequenced from heavily
impacted populations. Future studies using a combination of genome
sequencing and single-nucleotide polymorphism analyses based on
sequencing RNA pools (deMiranda et al. 2010, Cornman et al.,
2013), should provide more insights into the evolutionary history,
functional variation, and pathogenicity of this virus.
The rate of IAPV infection in brood was higher than in adult
bees for both strong and weak colonies. IAPV infection triggers a
more profound alteration of gene expression in adult bees than in
brood, shown by the fact that the number of genes with altered
expression was four times higher in adults than in brood. The gene
expression data did not provide obvious clues to the molecular
mechanism(s) underlying the maintenance of the viral latency in
brood. Genes involved in immune response showed no clear trend
in expression in IAPV-positive brood. Genes involved in host
immunity were significantly invoked in IAPV-infected adults,
indicating that IAPV infection triggers active immune responses in
adult bees. The transition of the virus from latency to activation of
host immune response was likely triggered by exogenous stressors
that affect bees at the adult stage. The evidence that mitochondrial
dysfunction was the most significantly affected canonical pathway
in IAPA-infected adults suggests that IAPV likely caused
pathogenesis of energy-related host processes and functions, a
Figure 7. Expression levels of immune-related transcripts in IAPV infected adults. The expression levels of genes that were assigned to
JAK-STAT, mTOR, MAPK and Endocytosis pathways were measured by microarray analysis and further confirmed using TaqMan RT-qPCR. The
expression results obtained from microarray and qRT-PCR analyses showed good alignment.
doi:10.1371/journal.ppat.1004261.g007
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 9 July 2014 | Volume 10 | Issue 7 | e1004261

condition that tends to worsen host nutritional status and impair
host defenses mechanisms [18]. JAK-STAT was reported to be
involved in the control of the viral load in DCV-infected
Drosophila [19]. Components of the JAK-STAT pathway were
up-regulated in response to IAPV infection. Other signaling
cascades such as mTOR and MAPK pathways reported to be
involved in antiviral immune responses [20,21], also showed
expression changes in response to the IAPV infection. However,
components of the Toll and Imd signaling pathways, implicated in
antiviral immunity in insects [22,23] were not up-regulated by
IAPV infection. Toll and Imd are not always linked with antiviral
immunity and, in particular, these pathways were not a factor
during infection of D. melanogaster by Drosophila C virus, a
relatively close relative of IAPV [19], suggesting that different
viruses trigger distinct antiviral responses. Knowing which
pathways respond specifically to viral infections will enable more
targeted pharmacological or genetic control strategies.
Our results show that silencing a putative immune-suppressive
protein encoded by IAPV led to significant reduction in IAPV
replication without detrimental effect on bee hosts. This suggests
that IAPV may also encode an RNAi suppressor. RNAi
technology has been employed in previous work to combat virus
infection in honey bees. The injection and feeding of Remebee, a
dsRNA homologous to IAPV has proven effective in not only
reducing the intensity of IAPV infection in honey bees [24], but
also strengthening honey bee colonies [25]. A recent study showed
that the feeding of siRNA targeting an Internal Ribosomal Entry
Site (IRES) of IAPV required for protein translation could confer
antiviral activity in bees [14]. That feeding siRNAs targeting VSR
in this study led to suppressed IAPV replication reinforces the
Figure 8. IAPV-encoded putative suppressor of RNAi. (A) Highly conserved octamer sequences identified in dicistroviruses. A putative viral
suppressor of RNAi (VSR) is presumably located upstream of DvExNPGP. The cleavage site between the glycine and proline is marked by an arrow. (B)
Quantitative analysis of the effects of silencing putative VSR on IAPV replication. The amount of negative stranded RNA of IAPV was measured by RT-
qPCR, normalized to the corresponding b-actin in the same sample. The data shown represent the mean value for three separate experiments. Error
bars represent the range of fold change.
doi:10.1371/journal.ppat.1004261.g008
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 10 July 2014 | Volume 10 | Issue 7 | e1004261

therapeutic potential of RNAi for treatment of viral diseases in
honey bees, by showing that carefully designed constructs can
temper a potent counter-response to the host immune system.
Further exploration of antiviral effects of putative suppressors of
RNAi of other bee viruses such as KBV and ABPV, which share
the same sequence motif of D
I
E
E
NPGP with IAPV, is warranted.
IAPV has a longstanding presence in managed honey bees [26].
While IAPV is not consistently tied to CCD, its ability to cause
increased mortality in honey bees has been firmly established. Our
results showed that host health status and environmental
conditions indeed play a critical role in IAPV infection dynamics.
While the simultaneous presence of multiple viruses in honey bees
makes Koch’s postulates of disease causality difficult to fulfill [27],
the presence and diversity of viruses in bee colonies has high
predictive value for colony mortality [28]. The negative correla-
tion between the level of IAPV infections and the size of host
populations, in combination with other stress factors, has
significant negative impact on colony survival and is likely a
contributing factor to poor winter survivorship of honey bee
colonies. The present study provides an improved starting point
for continuing studies of the virus-host interactions and for efforts
to formulate strategies to reduce colony losses due to viral diseases.
Materials and Methods
Bee samples
A brood frame containing bee samples of various ages and food
stores was removed from each of three declining colonies colony
selected from each colony maintained in a northern California
queen-breeding operation in Spring. Honey bees (Apis mellifera
ligustica) of different developmental stages and sexes (eggs, larvae,
pupae, workers, adult drones, and queens) and colony foods
(honey, pollen, and royal jelly), as well as parasitic mites, V.
destructor, were sampled for the detection of IAPV infection using
RT-PCR method. Clear fecal material, 20–25 ml per queen, was
collected by isolating queens individually in a 100615 mm petri
dish for approximately 30 minutes to allow them to defecate.
Approximately 20–25 ul of semen was also collected from 25
drones of each colony.
Tissue dissection
To determine the ability of IAVP to spread and replicate within
honey bee hosts, fifteen adult worker bees were collected from
each of the three colonies maintained placed in two USDA Bee
Research Laboratory apiaries in Beltsville, MD and identified to
be IAPV positive and subjected to tissue dissection. Under a
dissecting microscope, each worker was fixed on the wax top of a
dissecting dish with steel insect pins and 10–15 ml of hemolymph
was micropipetted from a small hole made with a sterile needle on
the dorsal thorax. Following hemolymph collection, a dorsal mid-
line cut was made from the tip of the abdomen to the head with
scissors, and tissues including hemolymph, fat body, brain, salivary
gland, hypopharyngeal gland, gut, nerve, trachea, and muscle
were individually removed from each worker. The scissors and
forceps were cleaned between dissections with a cotton pad soaked
with 10% bleach (0.003 sodium hypochlorite) and another soaked
with 70% alcohol, followed by a final rinse in sterile water. To
prevent contamination with hemolymph, all tissues were rinsed
once in 16phosphate-buffered saline (PBS) and twice in nuclease-
free water. The washing solution was changed after each tissue
collection to prevent cross-contamination. The same tissues of
different bees of the same colony were pooled together for
subsequent RNA extraction. All freshly dissected tissues were
immediately subjected to RNA extraction and then stored in
280uC freezer in the presence Invitrogen RNaseOUT Recombi-
nant Ribonuclease Inhibitor until quantitative examination of the
tissue tropism by strand-specific TaqMan quantitative RT-PCR
(RT-qPCR).
Additionally, twenty eggs were also collected from the colonies
identified to be IAPV positive using a fine brush. The eggs were
washed in 5% bleach solution for five minutes then rinsed in sterile
water to eliminate surface contamination of the virus [29]. Queens
from the same IAPV-positive colonies were collected and tissues of
gut, ovaries and spermatheca were excised following the methods
described above. Both eggs and queen tissues were fixed in 4%
paraformaldehyde in 100 mM PBS (pH 7.0), then stored in 70%
ethanol (200 Proof) at 4uC until in situ hybridization (ISH) assays
for localization of the virus.
Virus seasonality
To determine seasonal activities and impacts of IAPV on honey
bee health, samples of adult workers and brood (4
th
and 5
th
instar
mature larvae, prepupae, and white-eyed pupae) of A. mellifera
ligustica were collected from ten bee colonies maintained in
apiaries of the USDA Beltsville Bee Research Laboratory from
March 2008 to February 2012 and were subject to RT-PCR assay
for presence of IAPV. The experimental colonies were divided into
healthy and weak colonies based on the size of adult populations,
amount of sealed brood, and presence of food stores. 20 adult
workers and 20 unsealed brood were collected individually from
each of five strong and five weak colonies every month and
examined for the virus infection individually.
For each colony, the rate of the virus infection and strength of
individual colonies were recorded every month and the infection
rate was calculated based on percentage of tested bees (adult or
brood) that were infected (N =20). The average infection rate each
month for both strong and weak colonies was calculated by
combining the date from five colonies each month and four years
of the same month (N = 564). The infection rates of IAPV were
compared for colony strength (healthy vs. weak), developmental
stages (adult vs. brood) and months of the year. Because the data
are binomial in nature (for each sample, the number of uninfected
of 40 total), analysis was based on a generalized linear mixed
model (because random effects were included), using the logit link
and the R software (R Core Team 2012) with the lme4 package
[30]. The combination of lowest AIC and main effects retention
(i.e. preserve main effects in the model even if not significant as
long as higher order terms involving these main effects were
significant) was used to select a model that captured the important
features of the data.
Total RNA extraction
Invitrogen Trizol reagent was used for isolation of total RNA
from whole bees and bee tissues, as well as from colony foods,
queen feces, drone semen, and Varroa mites, in accordance with
the manufacturer’s instructions. After confirmation of IAPA
positive status by RT-PCR, total RNAs intended for microarray
analysis were further purified with Qiagen RNeasy Microarray
Tissue Mini Kit. RNA integrity was assessed with a 2100
Bioanalyzer system (Agilent Technologies, Palo Alto, CA) and
RNA Lab Chip. Only samples with an RNA integrity number
(RIN) of 6 or more were used [31].
RT-PCR and strand specific RT-qPCR
The Promega one-step access RT-PCR system (Madison, WI)
was used for IAPV detection as previously described [32].
Negative and positive controls (previously identified positive
sample) were included in each run of RT-PCR reaction. The
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 11 July 2014 | Volume 10 | Issue 7 | e1004261

specificity of the amplified products was confirmed by sequence
analysis of PCR products.
RNA samples extracted from different tissues of adult workers
were analyzed for the abundance of negative-stranded RNA, a
replicative intermediate form of positive strand RNA viruses, using
strand-specific reverse transcription coupled with TaqMan quan-
titative PCR (RT-qPCR) [33,34]. For each tissue sample, the first
strand of cDNA was synthesized from total RNA using Superscript
III reverse transcriptase (Invitrogen) with Tag-sense primer, Tag-
IAPV-F1 (59-AGCCTGCGCACGTGG gcggagaatataaggctcag -
3), where the capitalized sequences of Tag were published by Yue
and Genersch [35]. The resulting synthesized cDNAs were then
purified using MinElute PCR purification kit (Qiagen) followed by
MinElute Reaction Clean kit (Qiagen) to remove short fragments
of oligonucleotides and residue of enzymatic reagents to prevent
amplification of non-strand specific products [34]. The resulting
cDNA derived from negative stranded RNA was amplified using
the Platinum Taq High Fidelity Polymerase (Invitrogen) in a 25-ul
reaction containing 2 ml cDNA, 0.25 mM of Tag primer (39-
AGCCTGCGCACCGTGG- 59), 0.25 mM of antisense primer,
IAPV-R1 (59-cttgcaagataagaaaggggg-39), a 0.2 mM TaqMan
probe (59FAM - CGCCTGCACTGTCGTCATTAGTTA -
TAMRA 39), 0.2 mM each dNTP, 1 units of DNA polymerase,
16PCR buffer, and 2 mM MgCl2. qPCR was carried out using a
cycling sequence of 95uC for 2 min followed by 35 cycles of 95uC
for 30 sec, 55uC for 30 sec and 68uC for 1 min, which was then
followed by a final extension of 68uC for 7 min. To normalize the
qPCR result, amplification of a housekeeping gene b-actin was
performed for each sample with a previously reported primer set
and dual-labeled probe [32]. After confirmation of the approximately
equal amplification efficiencies of the RT-qPCR assay for both IAPV
and b-actin (Figure S2), the concentration of IAPV in different tissues
was interpreted using the comparative Ct method (DDCt Method).
The mean value and standard deviations of triplicate measurements
of IAPV in each tissue was normalized using the Ct value
corresponding to the triplicate measurements of endogenous
control, b-actin following the formula: DCt = (Average Ct
DWV
)2
(Average Ct
b-actin
). The hemolymph, with the lowest virus level of
IAPV, was chosen as a calibrator. Each of the normalized target
values was subtracted by the normalized value of the calibrator to
yield DDCt. The concentration of IAPV in each tissue was calculated
using the formula 2
2DDCt
andexpressedasthefold-change.
In situ hybridization
Purified IAPV amplicons from primer pair IAPVF1/R1were
incorporated into a pCR2.1 TA cloning vector (Invitrogen) which has
a T7 site downstream of the insert and the orientation of the inserts
was determined by sequence analysis. Probe complementary of
genomic RNA of IAPV was generated from linearized plasmid using
DIG-RNA Labeling Kit (T7) (Roche Applied Science, Indianapolis,
IN). Eggs and queen tissues, including spermathecae, ovaries and gut,
were subjected to dehydration by successive incubation in ethanol
(70%, 95% and 100%) and xylol (265 min each) and then embedded
in paraffin. Paraffin sections were cut ,3–5 micron thick and
mounted on poly-L-lysinated slides and stored at 4uCovernight.The
sections were then rehydrated through a descending concentration of
ethanol (100%, 95% and 70%), dewaxed in xylol, treated with
proteinase K (10 ug/ml) for 30 minutes, and acetylated with 0.33%
(v/v) acetic anhydride in 0.1 M triethanolamine-HCl (pH 8.0) for ten
minutes prior to hybridization.
The sections were prehybridized in prehybridization solution
(50% formamide, 56SSC, 40 ug/ml salmon sperm) at 58uC for
2 hours and incubated in hybridization buffer with Dig-labeled
IAPV probe solution to a concentration of 100–200 ng/ml probe
in pre-hybridization solution at 58uC overnight. Negative control
reactions included regular dUTP instead of DIG-labeled viral
probe. After hybridization, the sections were washed in low
stringency wash solution (26SSC, 0.1% SDS) at room
temperature for 5 minutes and washed twice in high stringency
wash solution (0.16SSC, 0.1% SDS) at 52uC for 15 minutes, and
finally incubated with alkaline phosphatase (AP)-labeled sheep
anti-DIG antibody conjugate. The hybridization signals were
detected with alkaline phosphatase (AP)-labeled sheep anti-DIG
antibody conjugate (Roche Applied Science). The conjugate
solution was added to the dry sections and incubated at 4uC for
2 hours in a humid chamber. Color development was performed
by adding the buffer solution containing nitroblue tetrazolium
(NBT) and 5-bromo-4-chloro-3-indoyl phosphate (BCIP) to the
tissue sections and incubating for 3–6 hours at room temperature
with protection from light. Dark purple to blue coloring suggested
the presence of the virus where the DIG-labeled probe bound
directly to the viral RNA, while pink staining was shown in
negative controls where no IAPV probe was included.
Whole viral genome sequencing and phylogeny
To determine the levels of genetic diversity of IAPV, the
complete genome sequences of IAPV strains from infected bees
collected in MD, CA, and PA were determined by combining
primer walking and long-range RT-PCR amplification using
Invitrogen SuperScript One-Step RT-PCR System for Long
Templates. The seven overlapping fragments of IAPV were
amplified simultaneously. The sequences of the genome termini
were determined by Invitrogen 39and 59RACE systems. The
primers used to amplify overlapping long RT-PCR fragments and
39and 59-RACE nested PCR were shown in Figure S1. The
information regarding sequences and genomic positions of primers
used in this study is shown in Table 1. Overlapping sequences
were assembled into complete virus genomes using SeqMan
(DNASTAR, Madison, WI, USA).
The entire genome sequences of IAPV isolates from this study,
as well as IAPV strains identified in Australia, China, and Israeli
and previously deposited in GenBank were compared with the first
reported strain of IAPV (GenBank Accession#NC_009025) in
order to get a clear global picture of genetic diversity of IAPV
strains. A phylogenetic tree was generated using all available
complete genome sequences of IAPV. The sequence of KBV
(GenBank Accession#NC_004807) was used as an outgroup to
root the tree. Phylogenetic analysis was conducted in MEGA4
[36]. A tree was built using the Neighbor-Joining method and the
reliability of the phylogenies was assessed by bootstrap replication
(N = 1000 replicates). Node labels correspond to bootstrap support
and those values .50% were regarded as providing evidence of
phylogenetic grouping.
Microarray hybridization and qRT-PCR validation
The global host responses of honey bees to IAPV infection in
both adult and brood stages were investigated using microarray
analysis. Adult worker bees (nurse bees inside the hive) and brood
(4
th
and 5
th
instar larvae prior to capping) were collected from
three colonies that were confirmed by RT-PCR to be infected with
IAPV. The ubiquitous presence of DWV in both IAPV-positive
and IAPV-negative bees was considered to be a background
infection. Total RNAs from 10 IAPV-infected and 10 uninfected
workers as well as 10 IAPV-infected and 10 uninfected brood were
individually reverse transcribed into cDNA using Superscript III
reverse transcriptase (Invitrogen) with random hexamers. The
cDNA was labeled with Cytidine 3 (Cy3) and Cytidine 5 (Cy5),
respectively, and reversed for the dye-swap analysis. The Cy5- or
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 12 July 2014 | Volume 10 | Issue 7 | e1004261

Cy3-labeled cRNA were mixed in the same amount and
hybridized to honey bee oligonucleotide microarray slides
fabricated at the University of Illinois. Slides were hybridized,
washed, dried, and scanned using methods previously described
[37]. The signal intensities were normalized based on the mean
signal intensity across all genes on the arrays. The signal-to-noise
ratio (SNR = ,signal mean – background mean,/,background
standard deviation.] was then calculated for each spot to
discriminate true signals from noise. Only spots with an SNR
equal to or greater than 2.0 were considered positive. All negative,
poor and empty spots were flagged and discarded. The normalized
data were analyzed using Partek Genomics Suite Version 6.4
(Partek Inc., St. Louis, MO). Principal component analysis (PCA)
and hierarchical clustering analysis were conducted with Partek
with default settings. The fold changes of each gene expression in
response to IAPV infection were calculated against the uninfected
samples (negative control). Statistically significant genes were
identified using mixed model analysis of variance (one-way
ANOVA) with the Benjamini & Hochberg false discovery rate
set to #0.05. The genes that displayed fold-changes of more than
1.5 (False Discovery Rate adjusted rvalue#0.05) and had putative
D. melanogaster orthologs were analyzed by
DAVID Bioinformatics Resources 6.7 (http://david.abcc.ncifcrf.
gov), and GO browser and search engine AmiGO (http://www.
geneontology.org) to define identify enriched biological themes in
gene lists of both adult and brood. Additionally, the genes
homologous to the their Drosophila gene counterparts were further
analyzed for canonical pathways, biological functions/diseases, and
functional molecular networks by Ingenuity Pathway Analysis (IGA)
(Ingenuity Systems, Redwood City, CA). The Fisher’s exact test was
used to calculate a r- value to determine the probability that the
association between the gene in the dataset and the predefined
pathways and functional categories in the Ingenuity Pathway
Knowledge Base is due to random chance alone.
A list of 20 genes involved in host immune responses were validated
by SYBR Green real-time qRT-PCR in IAPV infected adult bees.
The primers used in qRT-PCR are included in Table 2. The DDCt
method was chosen for interpretation of gene expression in response
to IAPV infection following the same procedures described above.
The approximately equal amplification efficiencies of the RT-qPCR
assay for housekeeping gene b-actin and target immune genes were
confirmed individually (the slope of normalized Ct vs. log input
RNA#0.1). The data output of each gene was expressed as a fold-
change indicating whether the expression of the target gene in IAPV
infected bees was up-regulated or down-regulated compared to the
expressionofthesamegeneinuninfectedbees.
Effect of silencing putative viral suppressor of RNAi
Complete predicted protein sequences of IAPV (NC_009025.1),
along with other honey bee viruses, including KBV
(NC_004807.1), ABPV (NC_002548.1), CrPV (NC_003924),
and DCV (NC_001834) were retrieved from GenBank and
scanned for the DvExNPGP sequence motif where the upstream
sequences of the DvExNPGP motif was reported to encode a
RNAi suppressor [13]. A DvExNPGP sequence motif was
identified in IAPV and the upstream sequences of the DvExNPGP
motif at the 59terminus of the IAPV genome was therefore
assumed to be a putative IAPV-encoded suppressor (Figure S1).
siRNA corresponding to upstream sequences of DvExNPGP was
designed using online siRNA design tool siDirect version 2.0
(http://sidirect2.rnai.jp/). The sequences of the siRNAs used in
this study are as follows: 59-UACAACUUAUUCAAGAAUCCA-
39and 59- GAUUCUUGAAUAAGUUGUACC-39. The chem-
ically modified, 21-mer, double-stranded and in vivo ready
siRNAs were synthesized in a 250 nmol scale by Ambion Life
Technologies (CA, USA). The impact of siRNA corresponding to
a putative IAPV-encoded VSR on IAPV replication was
investigated by a laboratory cage study as described previously
[38]. Briefly, the frames with emerging brood were removed from
the colonies left untreated for V. destructor for 2–3 moths and
identified with IAPV infection by RT-PCR assay, and newly
emerged bees were collected the following day. Forty bees were
placed in each rearing cage for the assay. A scintillation vial filled
with a 1:1 ratio sucrose-water solution was inverted over the top of
the rearing cup as provision for the caged bees. The caged bees
were divided into four groups: Group-I consisting of siRNA-
treated IAPV-infected bees not exposed to parasitic mites V.
destructor, Group-II consisting of untreated IAPV-infected bees
not exposed to V. destructor, Group-III consisting of treated
IAPV-infected bees challenged by V. destructor, and Group-IV
consisting of untreated IAPV-infected bees challenged by V.
destructor. The Varroa mites used in the study were collected from
a colony that was heavily infested with mites; both honey bees and
mites were shown to be infected with IAPV using RT-PCR assay.
Twelve Varroa mites were introduced to each cage to create 30%
Varroa mite infection. For groups receiving siRNA feeding,
siRNA was mixed with sugar water in the scintillation vials,
resulting in a 50 nM/ul working concentration of siRNA. Ten
Table 1. IAPV primers used in the study.
IAPV (NC_009025) Primers Product Size (bp) Genome Position Reference
IAPV-F1 IAPV-R1 59- gcggagaatataaggctcag-3959- cttgcaagataagaaaggggg-39586 23–608 Di Prisco et al. (2009)
IAPV-F2 IAPV-R2 59- gctcagctaggatgacacg -3959- catgatgccctttgcagag -391781 37–1817 This study
IAPV-F3 IAPV-R3 59- ggatatgccagaagttgatcc -3959- caaagtaacttcatcagtag -392185 1694–3878 This study
IAPV-F4 IAPV-R 59- ctctgcaaagggcatcatg -3959- cattaatgatgagcggcgag -392841 1798–4639 This study
IAPV-F5 IAPV-R5 59- agctggagctacaactggc -3959- atggtaatgtccagcttcgt -392299 4657–6949 This study
IAPV-F6 IAPV-R6 59- taccatgcctggcgattcac -3959- gcaggacattaatgtactatatccag -392821 6608–9428 This study
59-RACE-R1 59-cttgcaagataagaaaggggg-39589–609 This study
59-RACE-R2 59- tcaacaggtcccgggttttc-391062–1082 This study
39-RACE-F1 59- ctacaaggcgaatcacgct -399276–9296 This study
39-RACE-F2 59- gcaggacattaatgtactatatccag -399403–9428 This study
doi:10.1371/journal.ppat.1004261.t001
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 13 July 2014 | Volume 10 | Issue 7 | e1004261

experimental bees along with 3 mites were collected at day 1, day
3, day 5, and day 7 post-treatment. The assay was repeated three
times. The effect of silencing putative VSR on IAPV replication
was analyzed by quantifying the titer of negative-stranded RNA of
IAPV in bees from each group by real time RT-qPCR following
the method described above.
Ethics statement
No specific permits were required for the described studies.
Observations were made in the USDA-ARS Bee Research
Laboratory apiaries, Beltsville, Maryland, USA; therefore, no
specific permissions were required to be obtained for these
locations. The apiaries are the property of the USDA-ARS and
are not privately-owned or protected in any way. Studies involved
the European honey bee (Apis mellifera), which is neither an
endangered nor protected species.
Supporting Information
Figure S1 IAPG Genome Organization and overlapping
PCR fragments spanning the entire viral genome. (A) Like
other members of the dicistroviruses, the genome of IAPV is
monopartite and bicistronic with replicase proteins (Hel, Pro,
RdRp) encoded by a 59-proximal Open Reading Frame (ORF)
and capsid proteins (VP1-4) by a 39-proximal ORF. The position
of the sequence motif, DvExNPGP, is shown. (B) Schematic
diagram indicates the relative locations of overlapping PCR
fragments and cDNA ends. The full-length IAPV genomes were
sequenced using a combination of long-template RT-PCR
amplification and methods for rapid amplification of 59and 39
cDNA ends (59RACE and 39RACE).
(TIF)
Table 2. Primers of immune genes in the study.
Immune Gene GeneBank Accession #Primers Product Size (bp) Reference
Cbl XM_395448.3 F: 59-gaggtaaggacgatcccaca-39
R: 59-ttcgtagcaaattcgtgcag-39
184 This work
Stam XM_623536.2 F: 59-ggataggaggcatgcacagt-39
R: 59-agatggaccacctccaacag-39
238 This work
Stat XM_397181.3 F: 59-attttgcaacacagccacaa-39
R: 59-ggtgcaccatttcctcctaa-39
241 This work
Pias XM_623536.2 F: 59-gcgagttgcgatacaaacaa-39
R: 59-ccagcaaaaccaagaagcat-39
190 This work
Hopscotch XM_001121783 F: 59-ttgtgctcctgaaaatgctg-39
R: 59-aacctccaaatcgctctgtg-39
180 This work
GbL XM_393223.3 F: 59-cgagcctacgcgtcttaatc-39
R: 59-gacccatcgttttgcttcat-39
184 This work
Mo25 XM_393376.3 F: 59-tgcctctgttcggaaagtct-39
R: 59-tgggcaacaacaatatctgc-39
202 This work
eIF4B XM_624287.2 F: 59-tcaaacaaggaatccgacct -39
R: 59-catttacaacagccccacaa -39
186 This work
Dmel XM_392604.3 F: 59-ttttgggctgttttcaacaa-39
R: 59-agctgcaagcaccatttctt-39
186 This work
Raptor XM_624057.2 F: 59-cggaagaggatgattggaaa-39
R: 59-tggatcaacgccaacattta-39
238 This work
Ras XM_395469.3 F: 59-gcgtgtgagtgtcaagctgt-39
R: 59-ccttcaaatccagctcttgc-39
248 This work
Phl XM_396892.2 F: 59-cctgctttatgccaccaagt-39
R: 59-gaacgtggatgcctttgatt-39
167 This work
TII XM_624039.1 F: 59-ctggaattccgcacgtttat-39
R: 59-cagcttcctccgaacttgtc-39
195 This work
Pointed XM_396368.3 F: 59-gaaccgttctacgccgatta-39
R: 59-ctgattctcgtcttggcaca-39
240 This work
Corkscrew XM_003249806 F: 59-ttgctgcttctcttgcttca-39
R: 59-gttctgcttgcattcgttga-3
285 This work
Past1 XM_396463.3 F: 59-ttttgatgcaaaacccatg-39
R: 59-tggacgaaactgcttgtttg-39
211 This work
CG1115 XM_001120612 F: 59-acagcagcagctgaaattga-39
R: 59-ttggataaggaattgcaggaa-3
241 This work
CG6259 XM_392468.3 F: 59-gccgacgaagtacaagaagc-39
R: 59-tttgtggcaaaccaaattca-39
229 This work
Rabenosyn XM_392585.3 F: 59-cgggaatcggtcttacaaaa-39
R: 59-tgttgcgaagcttcttccat-39
229 This work
EGFR XM_003249561 F: 59-gtgaacagtgcgaagacgaa-39
R: 59-ggaacaatacggttcgctgt-39
248 This work
doi:10.1371/journal.ppat.1004261.t002
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 14 July 2014 | Volume 10 | Issue 7 | e1004261

Figure S2 Amplification efficiencies of IAPV and b-actin.
The difference between the Ct value of IAPV and Ct value of b-
actin (DCt) was plotted versus the log of six 10-fold dilutions of
total RNA. The plot of log total RNA input versus DCt has a slope
less than 0.1, indicating that the efficiencies of the two amplicons
were approximately equal. Therefore, the DDCt calculation for
the relative quantitation of IAPV in this study was valid.
(TIF)
Figure S3 Microarray data validation. A) Principal com-
ponent analysis (PCA) scatter plot. PCA analysis of all differentially
regulated genes clearly separates the two different data sets IAPV
positive (IAPV
+
) and IAPA negative (IAPV
2
) for both adults and
brood (4
th
and 5
th
instar larvae, prepupae and white-eyed pupae).
B) Unsupervised hierarchical clustering of gene expression data.
Hierarchical cluster analysis shows the differential expression of
genes in both adults and brood in response to IAPV infection. C)
Variance ratios from ANOVA (error set to 1). For both adults and
brood, variance of treatment (IAPV infected VS. uninfected) was
significantly higher than error (r,0.01). D) Volcano Plot. The
volcano plots show a large group of up and down regulated genes
in response to IAPV infection in adults and brood. Each dot
represents one gene with detectable expression. The horizontal
line marks the threshold (p#0.05, adjusted using the Benjamini &
Hochberg false discovery rate) for defining genes with altered
expression. The vertical lines represent change $1.5 fold in
expression and define genes as up-regulated (right) or down-
regulated (left).
(TIF)
Table S1 Functional annotation clustering of activated
genes in response to IAPV infection in adults.
(XLSX)
Table S2 Functional annotation clustering of activated
genes in response to IAPV infection in brood.
(XLSX)
Author Contributions
Conceived and designed the experiments: YPC JDE. Performed the
experiments: YPC MCH BS SKH HQZ JLL HB XZ AFZ LYW.
Analyzed the data: YPC WPC CJL YZ MK JLL XZ AFZ LYW ZGL.
Contributed reagents/materials/analysis tools: JSP JDE MC MS PKV
GDH DvE KD LS FD WIL GP JZZ MLL EWT. Wrote the paper: YPC.
References
1. Calderone NW (2012) Insect pollinated crops, insect pollinators and US
agriculture: Trend analysis of aggregate data for the period 1992–2009. PLoS
One 7: e37235.
2. VanEngelsdorp D, Underwood R, Caron D, Hayes Jr J (2007) An estimate of
managed colony losses in the winter of 2006–2007: A report commissioned by
the apiary inspectors of America. Am Bee J 147: 599–603.
3. Williams GR, Tarpy DR, Vanengelsdorp D, Chauzat MP, Cox-Foster DL, et al.
(2010) Colony collapse disorder in context. Bioessays 32: 845–846.
4. Aizen MA, Harder LD (2009) The global stock of dom esticated honey bees is
growing slower than agricultural demand for pollination. Curr Biol 19: 915–
918.
5. Pettis JS, Lichtenberg EM, Andree M, Stitzinger J, Rose R, et al. (2013) Crop
Pollination Exposes Honey Bees to Pesticides Which Alters Their Susceptibility
to the Gut Pathogen Nosema ceranae. PLoS One 8: e70182.
6. Alaux C, Brunet JL, Dussaubat C, Mondet F, Tchamitchan S, et al. (2010)
Interactions between Nosema microspores and a neonicotinoid weaken
honeybees (Apis mellifera). Environ Microbiol 12: 774–782.
7. Cox-Foster DL, Conlan S, Holmes EC, Palacios G, Evans JD, et al. (2007) A
metagenomic survey of microbes in honey bee colony collapse disorder. Science
318: 283–287.
8. Maori E, Lavi S, Mozes-Koch R, Gantman Y, Peretz Y, et al. (2007) Isolation
and characterization of Israeli acute paralysis virus, a dicistrovirus affecting
honeybees in Israel: evidence for diversity due to intra-and inter-species
recombination. J Gen Virol 88: 3428–3438.
9. Dietemann V PJ, Anderson D, Charriere J-D, Chejanovsky N, Dainat B, et al.
(2012) Varroa destructor: research avenues towards sustainable control. J Api
Res 51: 125–132.
10. de Miranda JR CY, Ribie` re M, Gauthier L. (2011) Varroa and Viruses. In
Varroa – still a problem in the 21st century? Carreck NL, editor. Cardiff: IBBA.
11–31 p.
11. Martin SJ, Highfield AC, Brettell L, Villalobos EM, Budge GE, et al. (2012)
Global honey bee viral landscape altered by a parasitic mite. Science 336: 1304–
1306.
12. Di Prisco G, Pennacchio F, Caprio E, Boncristiani HF, Evans JD, et al. (2011)
Varroa destructor is an effective vector of Israeli acute paralysis virus in the
honeybee, Apis mellifera. J Gen Virol 92: 151–155.
13. Nayak A, Berry B, Tassetto M, Kunitomi M, Acevedo A, et al. (2010) Cricket
paralysis virus antagonizes Argonaute 2 to modulate antiviral defense in
Drosophila. Nat Struct Mol Biol 17: 547–554.
14. Chen YE, J D. (2012) RNAi in Treating Honey Bee Diseases. Bee Culture 140:
27–29.
15. Lauring AS, Andino R (2010) Quasispecies theory and the behavior of RNA
viruses. PLoS Pathogens 6: e1001005.
16. Palacios G, Hui J, Quan P, Kalkstein A, Honkavuori K, et al. (2008) Genetic
analysis of Israel acute paralysis virus: distinct clusters are circulating in the
United States. J Virol 82: 6209–6217.
17. Cornman RS, Boncristiani H, Dainat B, Chen Y, vanEngelsdorp D, et al. (2013)
Population-genomic variation within RNA viruses of the Western honey bee,
Apis mellifera, inferred from deep sequencing. BMC Genomics 14: 154.
18. West AP, Shadel GS, Ghosh S (2011) Mitochond ria in innate immune
responses. Nat Rev Immunol 11: 389–402.
19. Dostert C, Jouanguy E, Irving P, Troxler L, Galiana-Arnoux D, et al. (2005)
The Jak-STAT signaling pathway is required but not sufficient for the antiviral
response of drosophila. Nat Immunol 6: 946–953.
20. Cao W, Manicassamy S, Tang H, Kasturi SP, Pirani A, et al. (2008) Toll-like
receptor–mediated induction of type I interferon in plasmacytoid dendritic cells
requires the rapamycin-sensitive PI (3) K-mTOR-p70S6K pathway. Nature
Immunology 9: 1157–1164.
21. Takaoka A, Tanaka N, Mitani Y, Miyazaki T, Fujii H, et al. (1999) Protein
tyrosine kinase Pyk2 mediates the Jak-dependent activation of MAPK and Stat1
in IFN-gamma, but not IFN-alpha, signaling. EMBO J 18: 2480–2488.
22. De Gregorio E, Spellman PT, Tzou P, Rubin GM, Lemaitre B (2002) The Toll
and Imd pathways are the major regulators of the immune response in
Drosophila. EMBO J 21: 2568–2579.
23. Zambon RA, Nandakumar M, Vakharia VN, Wu LP (2005) The Toll pathway
is important for an antiviral response in Drosophila. Proc Nat Acad SCI USA
102: 7257–7262.
24. Maori E, Paldi N, Shafir S, Kalev H, Tsur E, et al. (2009) IAPV, a bee-affecting
virus associated with Colony Collapse Disorder can be silenced by dsRNA
ingestion. Ins Mol Biol 18: 55–60.
25. HunterW,EllisJ,VanengelsdorpD,HayesJ,WesterveltD,etal.(2010)Large-scale
field application of RNAi technology reducing Israeli acute paralysis virus disease in
honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathogens 6: e1001160.
26. Chen YP, Evans, J D. (2007) Historical presence of Israeli Acute Paralysis Virus
in the United States. Am Bee J 147: 1027–1028
27. Lipkin WI (2010) Microbe hunting. Microbiol Mol Biol Rev 74: 363–377.
28. Cornman RS, Tarpy DR, Chen Y, Jeffreys L, Lopez D, et al. (2012) Pathogen
webs in collapsing honey bee colonies. PLoS One 7: e43562.
29. Chen YP, Pettis JS, Collins A, Feldlaufer MF (2006) Prevalence and transmission
of honeybee viruses. Appl Environ Microbiol 72: 606–611.
30. Bates D MM, Bolker B (2011) lme4: Linear. mixed-effects models using S4
classes. R package version 0999375–42.
31. Schroeder A, Mueller O, Stocker S, Salowsky R, Leiber M, et al. (2006) The
RIN: an RNA integrity number for assigning integrity values to RNA
measurements. BMC Mol Biol 7: 3.
32. Chen Y, Higgi ns J, Feldlaufer M (2005) Quantitative real-time reverse
transcription-PCR analysis of deformed wing virus infection in the honeybee
(Apis mellifera L.). Appl Environ Microbiol 71: 436–441.
33. Li JL, Cornman RS, Evans JD, Pettis JS, Zhao Y, et al. (2014) Systemic spread
and propagation of a plant-pathogenic virus in European honeybees, Apis
mellifera. MBio 5: e00898–00813.
34. Boncristiani HF, Jr., Di Prisco G, Pettis JS, Hamilton M, Chen YP (2009)
Molecular approaches to the analysis of deformed wing virus replication and
pathogenesis in the honey bee, Apis mellifera. Virol J 6: 221.
35. Yue C, Genersch E (2005) RT-PCR analysis of Deformed wing virus in honeybees
(Apis mellifera) and mites (Varroa destructor). J Gen Virol 86: 3419–3424.
36. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599.
37. Zhou A, He Z, Redding-Johanson AM, Mukhopadhyay A, Hemme CL, et al.
(2010) Hydrogen peroxide-induced oxidative stress responses in Desulfovibrio
vulgaris Hildenborough. Environ Microbiol 12: 2645–2657.
38. Evans JD, Chen, Y. P., di Prisco, G., Pettis, J. S., Williams, V. (2009) Bee cups:
single-use cages for honey bee experiments. J Api Res 300–302.
The Epidemiology and Pathogenesis of Israeli Acute Paralysis Virus
PLOS Pathogens | www.plospathogens.org 15 July 2014 | Volume 10 | Issue 7 | e1004261