Segregation of a new mutation in SLC26A4 and p.E47X mutation in GJB2 within a consanguineous Tunisian family affected with Pendred syndrome

Abstract

Recessive mutations of the SLC26A4 (PDS) gene on chromosome 7q31 can cause sensorineural hearing loss with goiter (Pendred syndrome) or non-syndromic autosomal recessive hearing loss (DFNB4). Furthermore, mutations in the GJB2 gene results in autosomal recessive (DFNB1) and dominant (DFNA3) non-syndromic hearing loss. The aim of the present study was to characterize a family with Pendred syndrome affected by severe to profound HL and presenting goiter.
Affected members underwent detailed audiologic examination and characterization. DNA samples from family members were genotyped with polymorphic microsatellite markers and sequencing of the SLC26A4 and GJB2 genes was performed. A total of 25 families with non-syndromic hearing loss were screened for the common p.E47X mutation in the GJB2 gene by direct dideoxy sequencing.
Genetic microsatellite analysis showed linkage to the 7q22-q31 chromosomal region and mutation analysis revealed a novel frameshift mutation (c.451delG) in the SLC26A4 gene. Screening of the GJB2 gene in one patient, displayed a homozygous p.E47X mutation, together with a heterozygous c.451delG mutation. Screening of 25 families with HL showed frequent segregation of the p.E47X mutation, which was homozygous in five of these families. Haplotype analysis using microsatellite markers and single nucleotide polymorphisms (SNPs) closely flanking the GJB2 gene, revealed the presence of two disease-associated-haplotypes suggesting the presence of at least, two founder effects carrying the p.E47X non-sense mutation in the Tunisian population.
The segregation of both SLC26A4 and GJB2 mutations in the family illustrates once again the unexpected intra-familial genetic heterogeneity in consanguineous families and highlights the difficulty of genetic counselling in such families. In addition, our results disclose the existence of founder effects in the Tunisian population.

Full text

Segregation of a new mutation in SLC26A4 and p.E47X mutation in GJB2 within a
consanguineous Tunisian family affected with Pendred syndrome
Mariem Ben Said
a
, Houria Dhouib
b
, Zeineb BenZina
c
, AbdelMoneem Ghorbel
b
, Felipe Moreno
d
,
Saber Masmoudi
a
, Hammadi Ayadi
a
, Mounira Hmani-Aifa
a,
*
a
Laboratoire de microorganismes et biomole
´cules, Centre de Biotechnologie de Sfax, Sfax, Tunisia
b
Service d’O.R.L., C.H.U.H. Bourguiba de Sfax, Sfax, Tunisia
c
Service d’Ophtalmologie, C.H.U. H. Bourguiba de Sfax, Sfax, Tunisia
d
Unidad de Gene
´tica Molecular, Hospital Ramo
´n y Cajal, Madrid, Spain
1. Introduction
Sensorineural hearing loss (HL) is the most frequent sensory
defect in children, with an incidence of 1 in 1000 in developed
countries [1]. HL is mainly prelingual and recent studies suggest
that more than 75% of childhood HL has a genetic origin including
syndromic (25%) and non-syndromic (NS) (75%) forms. The GJB2
gene was the first DFNB gene to be identified in 1997 [2] and the
most frequent affected locus for autosomal recessive NSHL. It was
originally assigned to chromosome 13q11 by linkage analysis
within Tunisian families with pre-lingual, profound HL [3]. To date,
95 loci for NSHL have been identified and a mutation in GJB2 gene,
in particular c.35delG, is the most common cause of autosomal
recessive (AR) NSHL in many populations (http://davinci.crg.es/
deafness/). In addition, p.E47X is a recurrent mutation in the GJB2
gene which has been described in several populations [4–6].
Pendred syndrome (PS) is characterized by sensorineural HL and
the presence of dilation of the vestibular aqueduct (EVA) with or
without cochlear hypoplasia [7,8]. Most patients with PS display
goiter on clinical examination, which develops in late childhood or
early puberty. In the absence of thyroid dysfunction, patients are
considered to have a NSHL form termed DFNB4. Only two genes
have so far been associated with PS/DFNB4, SLC26A4 in 50% of
affected individuals, and FOXI1is more rare and responsible for PS
International Journal of Pediatric Otorhinolaryngology 76 (2012) 832–836
ARTICLE INFO
Article history:
Received 8 December 2011
Received in revised form 17 February 2012
Accepted 20 February 2012
Available online 18 March 2012
Keywords:
Founder effect
Genetic heterogeneity
Markers
Pendred syndrome
ABSTRACT
Objective:
Recessive mutations of the SLC26A4 (PDS) gene on chromosome 7q31 can cause sensorineural
hearing loss with goiter (Pendred syndrome) or non-syndromic autosomal recessive hearing loss
(DFNB4). Furthermore, mutations in the GJB2 gene results in autosomal recessive (DFNB1) and dominant
(DFNA3) non-syndromic hearing loss. The aim of the present study was to characterize a family with
Pendred syndrome affected by severe to profound HL and presenting goiter.
Methods: Affected members underwent detailed audiologic examination and characterization. DNA
samples from family members were genotyped with polymorphic microsatellite markers and sequencing
of the SLC26A4 and GJB2 genes was performed. A total of 25 families with non-syndromic hearing loss
were screened for the common p.E47X mutation in the GJB2 gene by direct dideoxy sequencing.
Results: Genetic microsatellite analysis showed linkage to the 7q22–q31 chromosomal region and
mutation analysis revealed a novel frameshift mutation (c.451delG) in the SLC 26A4 gene. Screening of the
GJB2 gene in one patient, displayed a homozygous p.E47X mutation, together with a heterozygous
c.451delG mutation. Screening of 25 families with HL showed frequent segregation of the p.E47X
mutation, which was homozygous in five of these families. Haplotype analysis using microsatellite
markers and single nucleotide polymorphisms (SNPs) closely flanking the GJB2 gene, revealed the
presence of two disease-associated-haplotypes suggesting the presence of at least, two founder effects
carrying the p.E47X non-sense mutation in the Tunisian population.
Conclusions: The segregation of both SLC26A4 and GJB2 mutations in the family illustrates once again the
unexpected intra-familial genetic heterogeneity in consanguineous families and highlights the difficulty
of genetic counselling in such families. In addition, our results disclose the existence of founder effects in
the Tunisian population.
ß2012 Elsevier Ireland Ltd. All rights reserved.
* Corresponding author at: Laboratoire de microorganismes et biomole
´cules,
Centre of Biotechnology of Sfax, Route sidi mansour Km 6, BP ‘‘1177’’ 3018 Sfax,
Tunisia. Tel.: +216 74 871 816 1137/216 97 505 600; fax: +216 74 875 818.
E-mail address: hmanimounira@yahoo.fr (M. Hmani-Aifa).
Contents lists available at SciVerse ScienceDirect
International Journal of Pediatric Otorhinolaryngology
journal homepage: www.elsevier.com/locate/ijporl
0165-5876/$ – see front matter ß2012 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.ijporl.2012.02.053

in only 1% of affected individuals, suggesting that additional genes
contributes to genetic heterogeneity. The SLC26A4 gene encodes
pendrin, an iodide–chloride transporter responsible for both NSHL
(DFNB4) and PS.
Here, we report a Tunisian consanguineous family showing
sensorineural HL, goiter and an EVA. Phenotypic heterogeneity was
observed within this family and genetic analysis showed segrega-
tion of the c.451delG mutation in SLC26A4 gene. Furthermore,
mutation analysis of GJB2 gene revealed the presence of the p.E47X
mutation at a homozygous state in one patient (heterozygous for
the c.451delG mutation). This mutation was not detected in 50
unrelated healthy individuals. In addition, frequent segregation of
p.E47X mutation at a homozygous state has been observed in five
out of 25 families. Haplotype analysis suggested the presence of at
least two founder effects for this mutation in Tunisian population.
2. Materials and methods
2.1. Patients and clinical analysis
Six patients (four males and two females; age 9–44 years) from
one Tunisian family were included in this study. Informed consent
was obtained from all participants and from parents of subjects
younger than 18 years of age. The clinical diagnosis of PS was based
on HL, inner ear malformation and the presence of goiter. Air-
conduction pure-tone average (ACPTA) threshold were calculated
in all members to define the severity of HL in relation to the better
hearing ear. Mild HL was defined as 25 dB ACPTA 39 dB,
moderate 40 dB ACPTA 69 dB, severe 70 dB ACPTA 89 dB
and profound HL as ACPTA 90 dB. To investigate EVA, a magnetic
resonance imaging (MRI) was performed and an EVA was
established when the diameter of the vestibular aqueduct was
1.5 mm or larger. The presence of goiter was investigated by
palpation.
Based on the consanguinity displayed by the family, we
assumed the presence of a single HL locus segregating in the
whole family with an autosomal recessive pattern of inheritance.
To explore the frequency of p.E47X mutation and the presence of a
potential founder effect, we studied 25 families from the middle of
Tunisia and one family (St) from southern Tunisia, that has been
reported earlier [9].
2.2. Genotyping
Genomic DNA was extracted from whole blood following a
standard phenol-chloroform method. Three informative fluores-
cent dye-labelled microsatellite markers (D13S175, D7S2459 and
D7S496) were genotyped for family members. We used the True
Allele PCR Premix (Applied Biosystems, USA) according to the
manufacturer’s instructions. Fluorescently labelled alleles were
separated and detected on an ABI PRISM 3100-Avant DNA analyzer
(Applied Biosystems). Genotypes were determined using the
GenScan TM and GenoTyper TM softwares (Applied Biosystems).
2.3. Mutation analysis
The 20 coding exons (numbered from 2 to 21) of the SLC26A4
gene and exon 2 of the GJB2 gene were amplified by polymerase
chain reaction (PCR) from corresponding DNA. All reactions were
carried out in a 25
m
L reaction volume containing 60 ng of genomic
DNA, 2
m
M of each primer, 100
m
M of dNTP, 1.5 mM MgCl
2
, and
1 U of Taq DNA polymerase.
The PCR products were directly sequenced using big dye
terminator sequencing on an ABI 3100-Avant DNA analyzer
(Applied Biosystems, USA).
Using tetra-primer ARMS PCR, we screened 50 normal subjects.
We amplified exon 5 of SLC26A4 gene using either a wild-type
primer F1 (sense, 5
0
GTGAGTTTAATGGTGGGATCTG3
0
)ora
mutant primer F2 (sense, 5
0
GTGAGTTTAATGGTGGGATCTT3
0
)in
combination with the exon 5 antisense primer R
(5
0
AGCACCTGACCTAAAACAACG3
0
). An exon 5 sense primer F (5
0
CAAAGTGCTGCGGTTACAGA3
0
) was used in combination with the
exon 5 antisense primer R as an internal control (Fig. 2). Each PCR
reaction mixture contained 1.5 mM MgCl
2
,50
m
M of dNTP,
0.25 mM primers, and 1.5 units Taq DNA polymerase in a total
volume of 30
m
L. Amplification was performed on a PCR PerkinEl-
mer/Applied Biosystems System programmed for an initial 5 min
denaturation at 95 8C followed by 37 cycles of 40 s at 95 8C, 50 s at
63.5 8C and 60 s at 72 8C, followed by a final 10 min at 72 8C. The
amplicons of 326 bp and 514 bp for the internal control were
separated by electrophoresis through a 1.5% agarose gel.
3. Results and discussion
Subjects from the family were suspected to have PS on the basis
of the association of sensorineural HL and goiter. Phenotypic
heterogeneity was observed in the family, since goiter was present
only in two patients (IV-7 and IV-8), age 44 and 38 years (Fig. 1A).
No palpable thyroid glands were recognized in the other affected
individuals (VI-2, VI-5, V-4, and VI-1). However, as they still are
young (8, 9, 10, and 19 years), they may develop goiter later in life.
All patients suffered from profound HL except patient V-4 who
presented severe HL (Fig. 1B and C). Bilateral EVA was observed in
all patients who underwent MRI scan except patient V-4 (Fig. 1D
and E).
The presence of goiter and EVA in affected individuals
prompted us to investigate the SLC26A4 locus in this family.
Linkage analysis of the whole family using D7S496 and the
intragenic marker D7S2459 (intron 10 of the SLC26A4 gene) was
performed (Fig. 2A). Haplotype analysis revealed linkage to
chromosomal region 7q22-q31. The 20 coding exons (numbered
from 2 to 21) of the SLC26A4 gene were amplified by polymerase
chain reaction (PCR) from corresponding DNA. DNA sequencing of
these amplicons revealed a novel homozygous frame-shift
mutation [c.451delG] in exon 5 (Fig. 2B). This deletion changed
the reading frame and introduced a premature stop codon at amino
acid 152 (p. Val151LeufsX2). All patients except V-4 from our
family were homozygous for this mutation whereas carriers were
heterozygous and non-carriers were homozygous for the normal
sequence. No other sequence variation was detected in any of the
other exons.
Using tetra-primer ARMS PCR, the c.451delG mutation was not
detected in 50 unrelated healthy individuals excluding a common
polymorphism (Fig. 2C). This mutation introduces a premature
stop codon at amino acid 152 ([p.Val151LeufsX2]) resulting in
prematurely truncated protein in the absence of nonsense-
mediated mRNA decay mechanism [10], but this mutation may
lead to an unstable mRNA, which might be degraded by RNA
surveillance mechanisms [11]. To date, around 150 mutations in
SLC26A4 have been reported and all the truncation mutations
tested annihilate pendrin function [12,13].
In the present work, given the consanguinity in our family, we
expected segregation of only one disease causing gene. However,
genetic and molecular analysis of the SLC26A4 gene showed
heterozygosity of the c.451delG mutation in patient V-4 who
presents a severe HL with the absence of both goiter and EVA. In
the absence of other alterations in any of the coding exons of the
SLC26A4, we screened the GJB2 gene as a major cause of NSAR and
sporadic HL [9,14,15]. In the Tunisian population, GJB2 mutations
were found in 17% of familial cases [16] and the most common GJB2
mutation found was 35delG (14.3%). Interestingly, the patient V-4
M.B. Said et al. / International Journal of Pediatric Otorhinolaryngology 76 (2012) 832–836
833

was homozygous for the p.E47X mutation further illustrating the
major contribution of GJB2 gene to HL. Further screening of 25
families with HL showed the presence of p.E47X mutation in five
families, where four of them originated from the same geographi-
cal region (Gafsa) as our family with PS. These findings emphasizes
that p.E47X is the second most frequent mutation causing
recessive HL in the Tunisian population, after the highly frequent
35delG mutation [14,15]. To explain this relatively high frequency
of the p.E47X mutation, we investigated a possible founder effect
in seven GJB2 Tunisian families from different parts of the country
(five families originating from Gafsa, one family from Sfax and one
family from Sidi Bouzid) using three single-nucleotide polymor-
phisms (SNPs) and one microsatellite marker flanking the GJB2
gene (Fig. 3A). This study revealed the presence of two disease-
associated-haplotypes. The first haplotype, C-C-C-110 for SNP1-
SNP2-SNP3-D13S175, is common between our family and four
families originated from the same geographical region (Gafsa)
indicating a founder mutation that has been widely spread in that
region. The second haplotype, C-C-C-102 for SNP1-SNP2-SNP3-
D13S175, was present in the previously reported family ‘‘ST’’ from
[(Fig._1)TD$FIG]
Fig. 1. Phenotypes associated with PS in our family are indicated in Table A. Audiograms of the right ear of deaf individuals with profound hearing loss (B) and severe hearing
loss (C). Hearing loss is bilateral, with a very similar pattern for both ears. Triangles denote bone conduction. MRI of inner ear is shown in unaffected individual IV-1(D) and the
affected VI-2 (E) from our family. Arrows indicate the widened vestibular aqueduct EVA, enlarged vestibular aqueduct; Nd, not done; P, profound; S, severe.
[(Fig._2)TD$FIG]
Fig. 2. (A) Segregation analysis in our family. Haplotypes were constructed assuming a minimal number of recombination events. Black bars indicate the disease associated
haplotypes. (B) Sequence of SLC26A4 exon 5 in patient VI-2, in an unaffected individual IV-1 and a carrier IV-5. (C) Schematic presentation and results of the tetra-primer
ARMS-PCR.
M.B. Said et al. / International Journal of Pediatric Otorhinolaryngology 76 (2012) 832–836
834

the south of Tunisia (Sfax) as well as in family VI originating from
another region (Sidi Bouzid) (Fig. 3B). These results are consistent
with the presence of two founder effects for the p.E47X mutation in
the Tunisian population.
The segregation of SLC26A4 and GJB2 mutations in our family
illustrates again the unexpected intra-familial genetic heteroge-
neity in consanguineous families. This genetic heterogeneity has
been reported in numerous other examples from the Tunisian
population [17,18] as well as in other populations [19,20]. Locus
heterogeneity within the same consanguineous pedigree repre-
sents one of the important pitfalls in the homozygosity mapping
strategy. The success of homozygosity mapping relies on the
assumption that, for a rare recessive disease, all patients in a
consanguineous family will be homozygous for a founder mutation
derived from a common ancestor, a strategy that was successfully
used in mapping genes responsible for HL.
Finally, our results displays the existence of founder effects in
the Tunisian population and exhibit the difficulty of genetic
counselling in consanguineous families where care should be
taken to solely base the risk analysis on the genetic status of the
index patient.
Acknowledgments
We are indebted to the family members for their invaluable
cooperation and for providing the blood samples. We are thankful
to Pr. Peter So
¨derkvist for his critical reading of the paper. This
research was funded by Ministe
`re de L’Enseignement supe
´rieur et
de la Recherche Scientifique, Tunisia and the European Commis-
sion FP6 Integrated Project EUROHEAR, LSHGCT-20054–512063.
References
[1] N.E. Morton, Genetic epidemiology of hearing impairment, Ann. N. Y. Acad. Sci.
630 (1991) 16–31.
[2] D.P. Kelsell, J. Dunlop, H.P. Stevens, N.J. Lench, J.N. Liang, G. Parry, et al., Connexin
26 mutations in hereditary non-syndromic sensorineural deafness, Nature 387
(1997) 80–83.
[3] P. Guilford, S. Ben Arab, S. Blanchard, J. Levilliers, J. Weissenbach, A. Belkahia, et al.,
A non-syndrome form of neurosensory, recessive deafness maps to the pericen-
tromeric region of chromosome 13q, Nat. Genet. 6 (1994) 24–28.
[4] J. Samanich, C. Lowes, R. Burk, S. Shanske, J. Lu, A. Shanske, et al., Mutations in GJB2
GJB6, and mitochondrial DNA are rare in African American and Caribbean His-
panic individuals with hearing impairment, Am. J. Med. Genet. A 143A (2007)
830–838.
[5] V. Dalamon, A. Beheran, F. Diamante, N. Pallares, V. Diamante, A.B. Elgoyhen,
Prevalence of GJB2 mutations and the del(GJB6-D13S1830) in Argentinean non-
syndromic deaf patients, Hear Res. 207 (2005) 43–49.
[6] R. Rabionet, L. Zelante, N. Lopez-Bigas, L. D’Agruma, S. Melchionda, G. Restagno,
et al., Molecular basis of childhood deafness resulting from mutations in the GJB2
(connexin 26) gene, Hum. Genet. 106 (2000) 40–44.
[7] N.C. Cross, S.D. Stephens, M. Francis, M.D. Hourihan, W. Reardon, Computed
tomography evaluation of the inner ear as a diagnostic, counselling and manage-
ment strategy in patients with congenital sensorineural hearing impairment, Clin.
Otolaryngol. Allied Sci. 24 (1999) 235–238.
[8] P.D. Phelps, R.A. Coffey, R.C. Trembath, L.M. Luxon, A.B. Grossman, K.E. Britton,
et al., Radiological malformations of the ear in Pendred syndrome, Clin. Radiol. 53
(1998) 268–273.
[9] F. Denoyelle, D. Weil, M.A. Maw, S.A. Wilcox, N.J. Lench, D.R. Allen-Powell, et al.,
Prelingual deafness: high prevalence of a 30delG mutation in the connexin 26
gene, Hum. Mol. Genet. 6 (1997) 2173–2177.
[10] L.E. Maquat, Nonsense-mediated mRNA decay in mammals, J. Cell Sci. 118 (2005)
1773–1776.
[11] M.R. Culbertson, R.N.A. surveillance unforeseen consequences for gene expres-
sion, inherited genetic disorders and cancer, Trends Genet. 15 (1999) 74–80.
[12] A. Pera, S. Dossena, S. Rodighiero, M. Gandia, G. Botta, G. Meyer, et al.,
Functional assessment of allelic variants in the SLC26A4 gene involved in
Pendred syndrome nonsyndromic E.V.A, Proc. Natl. Acad. Sci. U.S.A. 105 (2008)
18608–18613.
[13] S. Dossena, S. Rodighiero, V. Vezzoli, C. Nofziger, E. Salvioni, M. Boccazzi, et al.,
Functional characterization of wild-type and mutated pendrin (SLC26A4), the
[(Fig._3)TD$FIG]
Fig. 3. Haplotype analysis in seven Tunisian families carrying the p.E47X mutation. Note the high frequency of p.E47X in the center of Tunisia (Gafsa) and the presence of two
disease-associated-haplotypes. The first haplotype, C-C-C-110 for SNP1-SNP2-SNP3-D13S175, is common between our family and four families originating from the same
geographical region (Gafsa). The second haplotype, C-C-C-102, was present in the ST family from the south of Tunisia (Sfax) as well as in family VI originating from another
region (Sidi Bouzid).
M.B. Said et al. / International Journal of Pediatric Otorhinolaryngology 76 (2012) 832–836
835

anion transporter involved in Pendred syndrome, J. Mol. Endocrinol. 43 (2009)
93–103.
[14] Smith RJH, Van Camp G. Nonsyndromic Hearing Loss and Deafness, DFNB1.
University of Washington: GeneReviews, 1993.
[15] N. Hilgert, M.J. Huentelman, A.Q. Thorburn, E. Fransen, N. Dieltjens, M. Mueller-
Malesinska, et al., Phenotypic variability of patients homozygous for the GJB2
mutation 35delG cannot be explained by the influence of one major modifier
gene, Eur. J. Hum. Genet. 17 (2009) 517–524.
[16] S. Masmoudi, A. Elgaied-Boulila, I. Kassab, S. Ben Arab, S. Blanchard, J.E. Bouzouita,
et al., Determination of the frequency of connexin26 mutations in inherited
sensorineural deafness and carrier rates in the Tunisian population using DGGE,
J. Med. Genet. 37 (2000) E39.
[17] S. Ben Arab,M. Hmani, F. Denoyelle, A. Boulila-Elgaied, S. Chardenoux, S. Hachicha,
et al., Mutations of GJB2 in three geographic isolates from northern Tunisia:
evidence for geneticheterogeneity within isolates, Clin. Genet.57 (2000) 439–443.
[18] K. Fendri, M. Kefi, F. Hentati, R. Amouri, Genetic heterogeneity within a consan-
guineous family involving the LGMD 2D and the LGMD 2C genes, Neuromuscul.
Disord. 16 (2006) 316–320.
[19] S. van Soest, L.I. van den Born, A. Gal, G.J. Farrar, L.M. Bleeker-Wagemakers, A.
Westerveld, et al., Assignment of a gene for autosomal recessive retinitis pig-
mentosa (RP12) to chromosome 1q31–q32.1 in an inbred and genetically hetero-
geneous disease population, Genomics 22 (1994) 499–504.
[20] M.G. Miano, S.G. Jacobson, A. Carothers, I. Hanson, P. Teague, J. Lovell, et al., Pitfalls
in homozygosity mapping, Am. J. Hum. Genet. 67 (2000) 1348–1351.
M.B. Said et al. / International Journal of Pediatric Otorhinolaryngology 76 (2012) 832–836
836