GCEvol234pag47año2016

Full text

Autocrine/paracrine proliferative effect of ovarian GH and IGF-I
in chicken granulosa cell cultures
S. Marisela Ahumada-Solórzano
a
, Carlos G. Martínez-Moreno
a
, Martha Carranza
a
, José Ávila-Mendoza
a
,
José Luis Luna-Acosta
a
, Steve Harvey
b
, Maricela Luna
a
, Carlos Arámburo
a,
⇑
a
Departamento de Neurobiología Celular y Molecular, Instituto de Neurobiología, Campus Juriquilla, Universidad Nacional Autónoma de México, Querétaro 76230, Mexico
b
Dept. Physiology, University of Alberta, Edmonton T6G 2H7, Canada
article info
Article history:
Received 21 January 2016
Revised 5 May 2016
Accepted 8 May 2016
Available online 9 May 2016
Keywords:
Growth hormone
IGF-I
Autocrine/paracrine
Proliferation
Granulosa cells
Extra-pituitary GH
abstract
It is known that growth hormone (GH) and its receptor (GHR) are expressed in granulosa cells (GC) and
thecal cells during the follicular development in the hen ovary, which suggests GH is involved in
autocrine/paracrine actions in the female reproductive system. In this work, we show that the knock-
down of local ovarian GH with a specific cGH siRNA in GC cultures significantly decreased both cGH
mRNA expression and GH secretion to the media, and also reduced their proliferative rate. Thus, we ana-
lyzed the effect of ovarian GH and recombinant chicken GH (rcGH) on the proliferation of pre-hierarchical
GCs in primary cultures. Incubation of GCs with either rcGH or conditioned media, containing predomi-
nantly a 15-kDa GH isoform, showed that both significantly increased proliferation as determined by the
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, proliferating cell nuclear
antigen (PCNA) quantification and (
3
H)-thymidine incorporation (
3
H-T) assays in a dose response fashion.
Both, locally produced GH and rcGH also induced the phosphorylation of Erk1/2 in GC cultures.
Furthermore, GH increased IGF-I synthesis and its release into the GC culture incubation media. These
results suggest that GH may act through local IGF-I to induce GC proliferation, since IGF-I immunoneu-
tralization completely abolished the GH-induced proliferative effect. These data suggest that GH and IGF-
I may play a role as autocrine/paracrine regulators during the follicular development in the hen ovary at
the pre-hierarchical stage.
Ó2016 Elsevier Inc. All rights reserved.
1. Introduction
It has been described that growth hormone (GH) has a critical
role in reproduction; it is required for a proper onset of puberty,
sexual maturation, steroidogenesis and gametogenesis (Hull and
Harvey, 2014). It is also involved in the growth and differentiation
of sexual tissues during development and adulthood (Bartke et al.,
2013). In females, GH is a steroidogenic regulator and is also
related to folliculogenesis and oogenesis in the ovary (Hull and
Harvey, 2001; Sirotkin, 2005). It is now well established that GH
improves ovulation and implantation in mammals (Moreira et al.,
2001; Starbuck et al., 2006). Moreover, anti-apoptotic and prolifer-
ative effects of exogenous GH administration during follicular
development have been documented in vivo and in vitro
(Sirotkin, 2005; Hrabia et al., 2011).
The gene expression of growth hormone (GH) is not confined to
the pituitary gland, since its mRNA and the protein coded by it are
produced in many extrapituitary sites including reproductive tis-
sues in males and females (Harvey et al., 2004; Harvey, 2010;
Luna et al., 2004, 2014; Martínez-Moreno et al., 2011). Testicular
GH is synthesized during the spermatogonial stage, and this gona-
dal production has been associated with the renewal of spermato-
gonias during the early spermatogenesis (Martínez-Moreno et al.,
2014). Testicular actions of GH also include steroidogenic actions,
since its administration in rats promotes Leydig cell maturation
and testosterone production (Kanzaki and Morris, 1999). In the
hen, chicken GH (cGH) and its receptor (cGHR) are highly
expressed in the ovary, oviduct and other secondary sexual struc-
tures, although the function of this local cGH production still is lar-
gely unknown (Hrabia et al., 2008, 2013; Ahumada-Solórzano
et al., 2012; Luna et al., 2014).
The presence of cGH and cGHR in granulosa and thecal cells
strongly suggest their involvement in autocrine and/or paracrine
actions on folliculogenesis and ovulation, particularly modulating
the follicular development and inhibition of follicular atresia
http://dx.doi.org/10.1016/j.ygcen.2016.05.008
0016-6480/Ó2016 Elsevier Inc. All rights reserved.
⇑
Corresponding author at: Instituto de Neurobiología, Campus Juriquilla,
Universidad Nacional Autónoma de México, Querétaro, Qro. 76230, Mexico.
E-mail address: aramburo@unam.mx (C. Arámburo).
General and Comparative Endocrinology 234 (2016) 47–56
Contents lists available at ScienceDirect
General and Comparative Endocrinology
journal homepage: www.elsevier.com/locate/ygcen

(Hrabia et al., 2008; Ahumada-Solórzano et al., 2012; Hrabia,
2015). These GH actions in the female reproductive system occur,
at least partially, through the GHR activation present in steroido-
genic cells (granulosa and thecal cells), which increases the cyto-
chrome P-450 (CYP monooxygenases) gene expression and the
synthesis of progesterone (P4) and estradiol (Kolodziejczyk et al.,
2003; Ahumada-Solórzano et al., 2012; Hrabia, 2015).
In this work we investigated the proliferative effect of locally
produced GH and IGF-I in the development of pre-antral follicles,
particularly in the proliferation of granulosa cells during the follic-
ular growth in the pre-hierarchal stage. It was of interest to deter-
mine if IGF-I acts as a mediator of GH actions in granulosa cell
cultures and also to correlate this local GH production with the
activation of the ERK pathway. The ERK pathway has been involved
in the proliferation of steroidogenic cells during the follicular
growth and it has been described as one of the non-classical path-
ways activated by GH (Sirotkin et al., 2003; Ryan et al., 2008;
Huang et al., 2015). Since the dysregulation of autocrine GH and
the excess of endocrine GH have been associated with the induc-
tion of neoplasms and infertility (Hull and Harvey, 2014; Harvey
et al., 2015), these studies are likely to have physiopathological
implications.
2. Materials and methods
2.1. Animals
Sexually mature, egg-laying Rhode Island hens (25–35 weeks
old) were used in this study. The hens were kept under controlled
conditions in the Institute’s vivarium, with a photoperiod of 13L-
11D and fed daily with 100 g/hen of commercial layer food (45%
carbohydrates, 25% proteins, 20% fat, 10% calcium and other miner-
als, Purina chow, USA) and water ad libitum. All experimental ani-
mals were sacrificed by decapitation (complying with the
Institute’s Bioethical Committee regulations). Animals were used
at the time of the daily oviposition and the follicles at pre-
hierarchical developing stage (3–10 mm) were collected in a saline
solution (0.9% NaCl) containing 1% penicillin-streptomycin.
2.2. Granulosa cell culture
Primary granulosa cell (GC) cultures were established following
the method described by Gilbert et al. (1977) with minor modifica-
tions (Ahumada-Solórzano et al., 2012). In brief, the granulosa cell
layer of follicles was carefully and aseptically removed from the
follicular wall with constant agitation after washing out the yolk;
then washed five times in PBS, and once briefly in incubation
media DMEM/F12 (Sigma, St. Louis, MO, USA) with 7% fetal bovine
serum (FBS, Gibco Invitrogen, Waltham, MA, USA) and 1% primocin
(InvivoGen, San Diego, CA, USA). The GC monolayer was incubated
in a protease solution containing 0.5% collagenase (Worthington,
Lakewood, NJ, USA) and 0.05% trypsin (Sigma, St. Louis, MO, USA)
in PBS. Cells were incubated with constant agitation for 15 min
at 37 °C and then centrifuged at 2000 rpm for 5 min. The super-
natant was discarded and the pellet was resuspended and filtered
through a 40
l
m nylon mesh. Cell number and viability was deter-
mined by trypan blue exclusion. 1 10
6
cells were incubated in
250
l
l of medium for 2 h and then washed with PBS and incubated
with 250
l
l of fresh media 24 h at 37 °C in a humidified 5% CO
2
atmosphere. To determine cell proliferation, cells were initially
synchronized by decreasing the FBS percentage (from 7% to 3%),
for 24 h after the culture stabilization. The cell cultures were
washed with PBS (3) and then the treatments were added.
2.3. Ovarian GH in conditioned media (CM)
Granulosa cell cultures (1 10
6
cells) were incubated in
DMEM/F12 supplemented with 7% FBS without treatments for
24 h. 250
l
l of media was collected from each well and pools of
1 ml were made (from 4-wells). In order to reach measurable
cGH levels, conditioned media (CM) was concentrated from 1 ml
to 100
l
l (10) by lyophilization. cGH quantification in the con-
centrated culture media was determined by ELISA (described
below). The presence of cGH isoforms in the incubation media
was determined by western blotting (described below).
2.4. Treatments
To study its effect on cell proliferation, GC cultures were incu-
bated in the presence of either rcGH (American Cyanamid, Prince-
ton, NJ, USA Lot-100), CM (obtained as mentioned above), or IGF-I
(recombinant human IGF-I, Cat. # 4119-100, Biovision Inc., Milpi-
tas, CA, USA) for 18 h in serum-free M199 medium. To determine
cGH-induced proliferation, GC cultures were treated with 250
l
l
rcGH at 0.1, 1 and 10 nM. For treatments with CM, 2.5
l
l and
25
l
l of concentrated CM was diluted in sterile water to obtain
concentrations of 0.1CM (1:10) and 1CM. For IGF-I studies,
250
l
l rhIGF-I at 10 and 100 nM were employed. Immunoneutral-
ization of cGH (10 nM) or IGF-I (40 nM) in GC cultures was per-
formed by adding either anti-chicken GH (CAP-1, anti-cGH;
Arámburo et al., 1989) at 1:100 dilution or anti-IGF-I (rabbit poly-
clonal
a
-IGF-I (H70): sc-9013, Santa Cruz Biotechnology Inc., Dal-
las, TX, USA) at 1:100 dilution and co-incubated in the presence
of rcGH or CM or IGF-I as corresponded.
2.5. Preparation of cell lysates
Cells were removed by trypsinization (using 0.05% trypsin) for
10 min at 37 °C. Trypsin was neutralized adding 200
l
l FBS per
well. Cells were collected and centrifuged. The cell pellet was
washed with sterile PBS (2) and then lysed by sonication in the
presence of an EDTA-free protease inhibitor cocktail (Mini-
complete, Roche, USA) diluted in 50 mM Tris-HCl buffer (pH 8.0).
Protein concentration was determined by Bradford assay using
bovine serum albumin (BSA) as standard (Bio-Rad, Hercules, CA,
USA).
2.6. cGH ELISA
GH quantification in the cell lysates and concentrated CM was
determined by an indirect enzyme-linked immunosorbent assay
(ELISA) (Martínez-Coria et al., 2002). Briefly, 96-well microliter
plates (Immulon 2HB, Chantully, VA) were coated overnight at
4°C, with 12 ng rcGH in 100
l
l 0.1 M carbonate buffer, pH 10.3.
The plates were washed (5) with TPBS (0.01 M sodium phos-
phate, 0.15 mM NaCl, 0.05% v/v Tween-20) using an automatic
microplate immunowasher (Bio-Rad, Hercules, CA, USA). This
washing procedure was performed after each incubation step. Cell
extracts or serial dilutions of rcGH (1024–0.25 ng/ml) in TPBS con-
taining 1% (w/v) non-fat dry milk were then incubated for 16 h
with 100
l
l primary antibody CAP1 (at a final concentration of
1:100,000; Arámburo et al., 1989). The samples and standards
(100
l
l) were then added to the coated wells and incubated for a
further 2 h at room temperature. HRP-anti-rabbit IgG conjugate
(Bio-Rad, Hercules, CA, USA) was then added (at a dilution of
1:3000 in 1% [w/v] non-fat dry milk in 0.1 M TPBS, pH 7.0) and
incubated for 2 h at room temperature. Bound secondary antibod-
ies were then visualized by reaction with 2,20-amino-di-(3-ethyl
benzothiazoline sulfate) substrate (Roche Diagnostics, USA). The
plates were read 30 min later in an automatic ELISA Microplate
48 S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56

Reader (Bio-Rad, Hercules, CA, USA) at 405 nm. The assay has a
sensitivity of 2 ng/well (20 ng/ml), and inter-assay and intra-
assay coefficients of variation are <4%.
2.7. Chicken IGF-I ELISA
The release of cIGF-I from GCs in culture to the incubation
media was determined using a specific cIGF-I ELISA (MyBioSource,
Cat. MBS739221, San Diego, CA, USA). The cIGF-I ELISA was per-
formed according to manufacturer’s instructions. Briefly, 100
l
l
of standards and samples were added to the appropriate well in
the anti-IGF-I antibody pre-coated micro-titer plate (included in
the assay kit). For negative control, 100
l
l of PBS (pH 7.2) were
added in the blank control well. 50
l
l of conjugate solution
(labeled cIGF-I) were added in each well excluding blank control.
The wells were sealed and incubated for 1 h at 37 °C. The micro-
titer plate was washed in an automatic plate washer (5) with
diluted wash solution (350
l
l/well/wash). After washing, the plate
was dried by tapping it against absorbent paper. 50
l
l of each sub-
strate solution (A and B, provided in the kit) was added to each
well including the blank control wells. The wells were sealed with
a plastic film and incubated for 10–15 min at 37 °C in the dark.
Reaction was stopped by adding 50
l
l of stop solution to each well
including blank control well. Optical Density (O.D.) was measured
at 450 nm using a microplate reader (Bio-Rad, Hercules, CA, USA).
2.8. Determination of cell proliferation
2.8.1. Incorporation of (
3
H)-Thymidine in GCs
(
3
H)-Thymidine (
3
H-T) incorporation was determined in 96-
well culture plates. The cells (50,000/well) were synchronized as
mentioned above and then incubated with either rcGH (0.1, 1
and 10 nM) in M199 (100
l
l) or with CM (0.1,1) treatments,
respectively, for 24 h. Cells were also co-incubated with rcGH
(10 nM) and anti-cGH (CAP1, 1:100) antibody. Then, (
3
H)-
thymidine (0.2
l
Ci/mmol) was added per well and incubated for
another 24 h. Cell cultures were washed 3for 1 min with
200
l
l of 5% trichloroacetic acid (TCA), incubating in the last wash-
ing at 4 °C for 30 min and TCA was discarded. 200
l
l of boiling
0.25 M NaOH were added per well and subsequently transferred
to vials containing 5 ml of scintillation fluid. Finally, the radioactive
thymidine incorporated into DNA was quantified in a liquid scintil-
lation counter Wallac (Perkin-Elmer, USA).
2.8.2. Metabolic activity by the 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (MTT) assay
Cell survival in GC cultures was determined by the MTT assay
(Roche Diagnostic, NY, USA). In this assay, an increase in the num-
ber of living cells is directly correlated with an increase in the total
metabolic activity. This increase directly correlates with the
amount of formazan crystals, as monitored by absorbance. Cell
proliferation was determined after treatments with rcGH (0.1, 1
and 10 nM), IGF-I (10 and 100 nM) and CM (0.1and 1). Cells
were also co-incubated with rcGH (10 nM), CM (1) and IGF-I
(40 nM) and anti-cGH (CAP1, 1:100) or anti-IGF-I (Santa Cruz
Biotechnology) antibodies. The cells (5 10
4
) were grown in 96-
well plates (Costar Corning, NY, USA) in a final volume of 100
l
l
of M199 per well in a humidified atmosphere at 37 °C. The MTT
labeling reagent (10
l
l) was added to each dish (at a final concen-
tration of 0.5 mg/ml) and then incubated for 4 h in a humidified
atmosphere. The resulting formazan crystals were solubilized
using 100
l
l of the solubilization solution (1 g SDS/ml in 0.01
HCl) and the plates were then incubated overnight. Formazan
absorbance was spectrophotometrically quantified at a wavelength
of 570 nm in a microplate reader (Bio-Rad, Hercules, CA, USA).
2.8.3. Proliferating cell nuclear antigen (PCNA) quantification
The experiments for the determination of PCNA were made in
96-well plates according to PCNA ELISA kit manufacturer instruc-
tions (Calbiochem, USA). 5 10
6
cells were lysed using 20
l
lof
the antigen extraction agent (AEA) provided in the kit. Briefly, sam-
ples and PCNA standards (at 200, 100, 50, 25, 12.5, 6.25, 3.125, and
0 ng/ml) were added to each well (50
l
l per well) and incubated
for 2 h. The wells were rinsed (3) with the wash buffer. Diluted
conjugate solution (100
l
l) was added to each well and the plate
was incubated at room temperature for 30 min. The wells were
washed (3) including final wash with distilled water. 100
l
lof
substrate solution was added to each well and incubated in the
dark at room temperature for 30 min. Finally, 100
l
l of stop solu-
tion was added per well and absorbance was measured in an ELISA
reader at 450/595 nm. PCNA concentration in the samples was cal-
culated by interpolation in the standard curve.
2.9. Erk pathway activation
To determine the activation of the Erk pathway, GCs were incu-
bated with rcGH (0.1, 1, and 10 nM) and conditioned media (0.1,
and 1) for 2 h. An increase on the ratio between phosphorylated
Erk1/2 and Erk1/2 was determined by western blotting and densit-
ometry. The cultures were treated with 10 mM U0126 (Cell signal-
ing, Danvers, MA, USA), a specific inhibitor of the Erk1/2
phosphorylation, as negative control.
2.10. Western blotting
Samples (35
l
g total proteins for cells and 3.5
l
l of concen-
trated [10] conditioned media) were analyzed by one-
dimensional sodium dodecyl sulfate–polyacrylamide gel elec-
trophoresis (SDS–PAGE) in 15% gels using the buffer system of
Laemmli et al. (1970) in a mini-Protean II cell (Bio-Rad, Hercules,
CA, USA). Samples were electrophoresed under non-reducing con-
ditions (NRC) in absence of b-mercaptoethanol. After electrophore-
sis, the slabs were equilibrated in cold transfer buffer (25 mM Tris–
HCl, 192 mM glycine, 20% methanol (v/v), and pH 8.3) for 10 min
and electrotransferred (at 200 mA for 1 h) to nitrocellulose mem-
branes (Bio-Rad, Hercules, CA, USA). After transfer, the membranes
were washed with 30 mM Tris, 500 mM NaCl, pH 7.5 (TBS) for
5 min and then blocked with 5% (w/v) non-fat dry milk (Bio-Rad,
Hercules, CA, USA) in TBS for 2 h at room temperature. After wash-
ing the membranes with TTBS (TBS containing 1% [w/v] non-fat dry
milk and 0.05% [w/v] Tween 20) for 15 min, they were incubated
overnight at room temperature with either anti-cGH (CAP1 at 1:
10,000; Arámburo et al., 1989), anti-IGF-I (rabbit polyclonal
a
-
IGF-I [H70] at 1:3000, Santa Cruz Biotechnology, Dallas, TX, USA),
anti-phosphorylated Erk1/2 (pErk1/2) and ERK1/2 (at 1:2000) (Cell
Signaling, USA), or with anti-PCNA (at 1:3000) (Santa Cruz,
Biotechnology Inc., Dallas, TX, USA). The membranes were then
rinsed (3 15 min) in TTBS and incubated for 2 h with a specific
secondary antibody (goat anti-rabbit- or goat anti-mouse-IgG
HRP conjugate, Bio-Rad, Hercules, CA, USA), diluted 1:3000 in TTBS.
GH-IR bands were developed by incubating the membranes in ECL
chemiluminescent reagent (Amersham-Pharmacia, Bucking-
hamshire, UK) for 3–5 min and exposed to Kodak Biomax ML film.
The pErk/Erk1/2 ratio was determined by densitometry. Lumino-
grams were digitalized in a HP scanner. Optic density was deter-
mined using Image Lab Software (Bio-Rad, Hercules, CA, USA).
2.11. GH silencing by small-interfering RNA (siRNA)
GH siRNA, 5
0
-(UUUGGAGUAUCUCUACGGACCGAGG)-3
0
, was
custom made (Thermo-Fisher Scientific, Waltham, MA, USA) fol-
lowing the characterization done previously by Baudet et al.
S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56 49

(2009) (with minor modifications). This siRNA silences cGH exon 4,
which is present in all avian GH variants described to date. A BLAST
analysis using the National Center for Biotechnology Information
indicated that this siRNA will only knockdown GH mRNA from
chicken, turkey, duck and quail (Sanders et al., 2010). siRNA trans-
fections were carried out in 20
l
l final volume per dish containing
siRNA at 50 nM and 0.3
l
l of Lipofectamine RNAi MAX (Thermo-
Fisher Scientific, Waltham, MA, USA). Lipofectamine and siRNAs
were diluted independently in 10
l
l of Opti-MEM media
(Thermo-Fisher Scientific, Waltham, MA, USA) and incubated at
room temperature for 5 min. To produce liposomes, siRNAs and
lipofectamine dilutions were mixed and after 20 min, cell cultures
were exposed to liposomes containing GH siRNA for 48 h. Scramble
siRNA (Thermo-Fischer Scientific, Waltham, MA, USA) was used as
negative control.
2.12. Quantification of GH mRNA expression
Total RNA was extracted from each well adding 1 ml of TRIzol
and using the PureLink RNA mini kit (Ambion, Life Technologies,
Carlsbad, CA, USA) following the manufacturer’s recommenda-
tions. Genomic DNA contaminant was removed with DNase I treat-
ment (Invitrogen) for 15 min at 37 °C. First-strand cDNAs were
synthesized from total RNA (2
l
g) using 100 U of Superscript II
reverse transcriptase (Invitrogen, Life Technologies, Carlsbad, CA,
USA), 0.5
l
g oligo d(T), 0.5
l
g random hexamers and 1 mM dNTPs
for 50 min at 42 °C followed by 15 min at 70 °C.
The GH mRNA quantification was carried out by real time PCR
in a StepOne Thermocycler Real-Time PCR system (Applied Biosys-
tems, Foster, CA, USA) and using LigthCycler FastStart DNA master
Sybr green I (Roche, Mannheim, Germany) in 10
l
l final volume
containing: cDNA 3
l
l (from 1:5 dilution) and 0.5
l
M of each
specific primer (Table 1). Reactions were performed under the fol-
lowing conditions: initial denaturation at 95 °C for 10 min, fol-
lowed by 45 cycles of 95 °C for 10 s, 65 °C for 10 s and 72 °C for
25 s. Dissociation curves were included after each qPCR experi-
ment to ensure primer specificity. Relative abundance of GH mRNA
was calculated using the comparative threshold cycle (CT) method
and employing the formula 2

DD
CT
(Livak and Schmittgen, 2001)
where the quantification is expressed relative to the geometric
mean of SOD and 18SrRNA (Vandesompele et al., 2002). To validate
this method, cDNAs standard curves were prepared using serial
dilutions to obtain the reactions efficiencies for each gene, which
were 2.0 for SOD, 1.96 for 18S-rRNA and 2.2 for GH.
2.13. Data analysis
In all the experiments, values are expressed as mean ± SD. Sig-
nificant differences between groups or treatments were deter-
mined by unpaired Student’s t-test or by one-way ANOVA where
appropriate. Dunnett’s post hoc test was employed when ANOVA
was used to compare experimental groups with controls. P-
values less than 0.05 were determined to be statistically different
(
⁄
, P < 0.05;
⁄⁄
, P < 0.01;
⁄⁄⁄
, P < 0.001). All the experiments were
repeated 3–5 times including quadruplicates per observation.
3. Results
3.1. Locally-produced GH is involved in GC survival
Fig. 1A shows that after 24 h of incubation, cultured GCs were
able to synthesize and release GH into the media (25.2 ± 4.1 ng of
GH/ml). This endogenous cGH production was significantly
reduced to one third in comparison to the CM sample (P < 0.05)
when the cells were transfected with cGH siRNA. Likewise, GH
mRNA content in GCs was also significantly decreased (to around
one tenth of the control, P < 0.001) in cells transfected with cGH
siRNA (Fig. 1B). Extracts from non-cultured (0 h) and cultured
GCs (24 h) (lane 2 and 3, respectively), showed the presence of
one immunoreactive band with an approximate molecular weight
of 22-kDa (monomeric cGH), which exactly corresponded with the
immunoreactivity observed in the lane 1, loaded with rcGH as pos-
itive control (Fig. 1C). The cGH released from cultured GCs to the
incubation media showed an intense immunoreactive band of
15-kDa, although fainter 22-kDa and 26-kDa bands were also pre-
sent (Fig. 1C, Lane 4). Immunoneutralization of endogenous GH
(with anti-GH antibody) and GH gene-silencing (with cGH siRNA)
both resulted in a significant decrease in cell survival by 50% and
60% (P < 0.05 and P < 0.01), respectively, in comparison with the
control, as determined by MTT assay (Fig. 1D).
3.2. cGH increases metabolic activity in GC cultures
Exogenous GH induced a dose-related response in metabolic
activity (as determined by the MTT assay) in GC cultures after
18 h of incubation (Fig. 2A). Thus, metabolic activity in GC cultures
treated with 0.1, 1, and 10 nM rcGH increased by 1.8-, 2.1-, and 3-
fold (P < 0.001), respectively, in comparison with the control with-
out rcGH. Incubations of GC in the presence of diluted (0.1) and
not diluted CM (1) resulted in a significant increase by 1.4-fold
(P < 0.05) and 2.8-fold (P < 0.001), respectively, of the metabolic
activity of GCs in culture (Fig. 2B). On the other hand, the simulta-
neous addition of a specific anti-cGH antibody (1:100) blocked the
stimulatory effect of both rcGH and CM (Fig. 2A and 2B).
3.3. Proliferative effect of cGH on (
3
H)-Thymidine incorporation in GC
cultures
Incubations in the presence of rcGH (1 and 10 nM) increased (by
3.5 and 2.1-fold, respectively) the incorporation of
3
H-T to GCs in
culture; this increase was statistically different (P < 0.001) from
the control, which was incubated without GH (Fig 3A). The co-
incubation of rcGH (1nM) with anti-cGH antibody (diluted 1:100)
blocked this effect. Likewise, GC cultures incubated with CM
(0.1and 1) showed a significant increase of
3
H-T incorporation
(by 4.6 and 5.8-fold, respectively, P < 0.001). Again, the co-
incubation of anti-cGH (at 1:100) with CM (1) resulted in the
abolition of the CM-induced proliferative effect as determined by
3
H-T incorporation (Fig 3B).
3.4. cGH increases PCNA in GC cultures
The administration of rcGH (at 0.1, 1, and 10 nM) induced a
dose-response effect (by 3.9, 5.7 and 8.5-fold, respectively,
P < 0.001) on the PCNA content in GC cultures (Fig 4A), as deter-
mined by ELISA. The presence of PCNA immunoreactivity in cul-
tured GCs incubated in media containing rcGH was confirmed by
the immunodetection of an intense immunoreactive PCNA band
Table 1
Oligonucleotide primer sequences used in this study.
Primer cDNA
target
Synthesis
direction
Product
size (pb)
Sequence
cGHqf GH Forward 128 CGCACCTATATTCCGGAGGAC
cGHqr Reverse GGCAGCTCCATGTCTGACT
cSODqf SOD Forward 146 TTACAGCTCAGGTGTCGCTTC
cSODqr Reverse ACCAAAGTCACGTTTGATGGC
c18Sqf rRNA
18S
Forward 100 CTCTTTCTCGATTCCGTGGGT
c18Sqr Reverse TTAGCATGCCAGAGTCTCGT
50 S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56

of 37.5 kDa (Fig 4B). Cells incubated in media without rcGH (con-
trol) also showed a basal immunoreactive band for PCNA with
lower intensity. Incubations with CM (0.1and 1) resulted in a
significant increase (P < 0.001) on PCNA production (by 2.6 and
5.1, respectively) (Fig 4C), which was also correlated with an
intense PCNA immunoreactive band determined by western blot-
ting (Fig. 4D). The simultaneous addition of the anti-cGH CAP-1
antibody with either 10 nM rcGH or 1CM in the incubation
media, effectively blocked the GH-induced proliferative effect
observed in these cells (Fig 4A and 4C).
3.5. cGH activates the Erk1/2 pathway
Fig. 5 shows that cGH was able to activate the Erk1/2 pathway
in GCs. Phospho-Erk1/2/Erk1/2 immunoreactivity ratio in GC cul-
tures that were incubated (for 2 h) in presence of rcGH (1 and
10 nM) (Fig. 5A) or CM (1)(Fig. 5C) was increased by 3.4-fold
(P < 0.05), 5.6-fold (P < 0.001), and 5.8-fold (P < 0.001), respec-
tively, in comparison with control cultures incubated without
treatments (Fig. 5B and 5D). The incubation of GC cells with rcGH
(10 nM) or CM (1) together with the specific Erk phosphorylation
Fig. 1. Local production and release of ovarian GH in GC cultures. A, Quantification of cGH determined by ELISA in conditioned media collected from GCs cultures (CM) and
transfected with cGH siRNA. cGH was determined in new DMEM-FBS (7%) as negative control. B, GH siRNA effect on GH mRNA content in GC cultures, as determined by qPCR.
Scramble siRNA (siSCRM) was included as negative control. C, Representative immunoblot for cGH in GC extracts and in conditioned media (CM). GH-immunoreactivity in
non-cultured (0 h) (Lane 2) and cultured GCs (24 h) (Lane 3). Recombinant chicken GH (rcGH) was used as positive control (Lane 1). Lane 4 was loaded with 3.5
l
lofCM
(10). D, Relative change (%) in metabolic activity in wild type GC cultures after endogenous GH blockade by specific immunoneutralization or siRNA transfection. Negative
control (C). Bars represent mean ± SD (from 3 to 5 independent experiments by triplicate or quadruplicate). Asterisks represent significant difference (
⁄
, P < 0.05;
⁄⁄
, P < 0.01;
⁄⁄⁄
, P < 0.001) based on one-way ANOVA and Dunett’s post hoc test (panels A and D), and Student’s ttest (panel B).
Fig. 2. GH effect on GC metabolic activity as a correlation for cell proliferation, as determined by MTT assay. A, Cultures were treated with rcGH (0.1, 1 and 10 nM). Specific
immunoneutralization of this effect was observed by co-incubation with 10 nM rcGH and an anti-cGH antibody at 1:100 (rcGH + anti-cGH). Control group without treatment
was incubated only with M199 (C). B, Effect of the local GH contained in conditioned media (CM) in GC proliferation. GCs were incubated in 1:10 diluted CM (0.1) and in CM
(1). Specific immunoneutralization of endogenous GH was performed by adding anti-cGH at 1:100 to CM (1). Units are expressed as relative change (%). Bars represent
mean ± SD (from 5 independent experiment by quadruplicate). Asterisks represent significant difference (
⁄
, P < 0.05;
⁄⁄⁄
, P < 0.001) based on one-way ANOVA and Dunett’s
post hoc test.
S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56 51

inhibitor U0126, blocked the activation of Erk1/2 in comparison
with cells incubated only in presence of rcGH (10 nM) and CM
(1)(Fig. 5B and 5D).
3.6. cGH induces IGF-I synthesis in GC cultures
IGF-I was constitutively produced and released from cultured
GCs (Fig 6A and 6B). After 24 h of incubation in DMEM/F12 supple-
mented with 7% FBS, these cells released 15 ± 3 ng of IGF-I/ml to
the media (CM). Alone, the FBS supplemented to the cell culture
media contains 5 ng of IGF-I/ml (Fig 6A). The IGF-I released to
the media showed a molecular weight of 14-kDa when analyzed
by western blotting (Fig. 6B), similar to that reported as a dimeric
form of IGF-I (Luna-Acosta et al., 2015). As expected, both rcGH
(10 nM) and CM (1) treatments increased (P < 0.001) the IGF-I
content (by 3.1- and 3.4-fold, respectively) in the incubation media
collected from GC cultures in comparison with the untreated con-
trol (Fig. 6C). IGF-I release was significantly reduced when both
exogenous and endogenous GH (rcGH and CM, respectively) were
blocked by GH immunoneutralization (Fig. 6C).
3.7. Proliferative effect of IGF-I in GC cultures
Incubation of cultured GCs with IGF-I (10 and 100 nM) resulted
in a significant (P < 0.001 and P < 0.01) increase of metabolic activ-
ity (by 2.2- and 2.0-fold, respectively). This effect was effectively
prevented by an anti-IGF-I antibody (1:100) in GC cultures simul-
taneously treated with 40 nM IGF-I. The immunoneutralization of
endogenous IGF-I contained in the CM (1) also resulted in a
reduction on the proliferation induced by treatments. A reduced
proliferation rate was also observed in cultures that were incu-
bated with rcGH and anti-IGF-I in comparison with cultures trea-
ted only with rcGH (10 nM) (Fig. 7).
Fig. 3. GH effect on GC proliferation as determined by
3
H-T incorporation. A, Cultures were treated with rcGH (0.1, 1 and 10 nM). Specific immunoneutralization of this effect
was observed by co-incubation with 10 nM rcGH and anti-cGH antibody at 1:100 (rcGH + anti-cGH). Control group without treatment was incubated only with M199 media
(C). B, Effect of the local GH contained in conditioned media (CM) in GC proliferation. GCs were incubated with 1:10 diluted CM (0.1) and CM (1). Specific
immunoneutralization of endogenous GH was performed by adding anti-cGH at 1:100 to CM (1). Units are expressed as relative change (%). Bars represent mean ± SD (from
5 independent experiment by quadruplicate). Asterisks represent significant difference (
⁄⁄⁄
, P < 0.001) based on one-way ANOVA and Dunett’s post hoc test.
Fig. 4. GH effect on GC proliferation as determined by the stimulation of PCNA synthesis by ELISA (A, C) and Western blot (B, D). A, Cultures were treated with rcGH (0.1, 1
and 10 nM). Specific immunoneutralization of this effect was observed by co-incubation with 10 nM rcGH and anti-cGH antibody at 1:100 (rcGH + anti-cGH). Control group
without treatment was incubated only in M199 media (C). B, Representative western blot luminogram for PCNA immunoreactivity in extracts from cells treated with rcGH.
Actin was used as a loading control. C, Effect of the local GH contained in conditioned media (CM) on PCNA content. Specific immunoneutralization of endogenous GH was
performed by adding anti-cGH at 1:100 to CM (1). D, PCNA immunoblots from cells treated with local GH (CM). kDa, kilodaltons; PCNA units in ng/ml by ELISA. Bars
represent mean ± SD (from 3 independent experiment by quadruplicate). Asterisks represent significant difference (
⁄
, P < 0.05;
⁄⁄⁄
, P < 0.001) based on one-way ANOVA and
Dunett’s post hoc test.
52 S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56

Fig. 5. Effect of rcGH and local GH on Erk1/2 activation. A, Immunoblots for phospho-Erk1/2/Erk1/2 in cells treated with rcGH (at 0.1, 1 and 10 nM). Control group without
treatment was incubated only in fresh M199 (C). Specific blockade of Erk1/2 phosphorylation was analyzed by co-incubation of 10 nM rcGH and 10 mM U0126 (rcGH
+ U0126). B, Densitometric analysis was used to determine the pErk1/2/Erk1/2 ratio under the conditions employed. C, pErk1/2 and Erk1/2 immunoreactivity in cells treated
with conditioned media (CM, 0.1and 1) containing locally produced cGH. Control group without treatment was incubated only in fresh M199 (C). Specific blockade of
Erk1/2 phosphorylation was analyzed by co-incubation of 1CM and 10 mM U0126 (CM + U0126). D, Densitometric analysis was used to determine the pErk1/2 and Erk1/2
ratio under the conditions employed. kDa, kilodaltons. Bars represent mean ± SD (from 3 independent experiment by quadruplicate). Asterisks represent significant difference
(
⁄
, P < 0.05;
⁄⁄⁄
, P < 0.001), based on one-way ANOVA and Dunett’s post hoc test.
Fig. 6. Local production of IGF-I in GC cultures. A, IGF-I quantification (ELISA) in media collected from GCs cultures after 24 h of incubation (24 h) and in fresh DMEM/FBS
media (0 h). B, IGF-I immunoreactivity determined by western blotting under both conditions. C, Effect of rcGH and locally produced GH in IGF-I release to the incubation
media. GCs were treated with rcGH (10 nM) and CM (1) to induce IGF-I release. These effects were specifically blocked by an anti-cGH antibody (1:100) (rcGH + anti-cGH)
and (CM + anti-cGH). Bars represent mean ± SD (from 3 independent experiment by quadruplicate). Asterisks show statistical difference (
⁄⁄
, P < 0.01;
⁄⁄⁄
, P < 0.001) based on
one-way ANOVA and Dunett’s post hoc test (panel C) and Student’s ttest (panel A). Units are expressed in kilodaltons (kDa) and nanograms per milliliter of media (ng/ml).
Fig. 7. Proliferative effect of IGF-I in cultured GCs. Cells were treated with IGF-I (at 10 and 100 nM) to induce GC proliferation. Specific immunoneutralization of IGF-I
prevented the proliferative effect induced by exogenous 40 nM IGF-I, 10 nM rcGH or 1CM. Bars represent mean ±SD (from 3 independent experiment by quadruplicate).
Asterisks show statistical difference (
⁄⁄
, P < 0.01;
⁄⁄⁄
, P < 0.001) based on one-way ANOVA and Dunett’s post hoc test.
S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56 53

4. Discussion
In this work, we demonstrate for the first time that locally pro-
duced GH in cultured GCs obtained from ovarian follicles at the
pre-hierarchal stage has autocrine/paracrine proliferative effects
and that this action may be mediated by local IGF-I. Our findings
also show that the Erk pathway in GC is activated by ovarian GH.
The effects of GH in the development of the ovary and its func-
tion have been extensively documented, especially its role as a
modulator on the production of sexual steroids and as a positive
enhancer for ovulation (Ahumada-Solórzano et al., 2012; Hull
and Harvey, 2001, 2014; Hrabia, 2015). It is now accepted that
endocrine GH is critically necessary for a normal follicular develop-
ment during its pre-ovulatory stage in mammals (Kirkwood et al.,
1988; Cecim et al., 1995; Zaczek et al., 2002). Previous in vitro stud-
ies demonstrated that GH induce proliferation in cells obtained
from murine follicular walls and is able to maintain the ultrastruc-
ture of cultured follicular cells and oocytes (Kobayashi et al., 2000;
Zhao et al., 2000, 2001, 2002). Our results are consistent with pre-
vious reports showing that the administration of exogenous GH
promotes proliferation in follicular cells, particularly in steroido-
genic cells during the follicular growth in the pre-ovulatory stage
(Silva et al., 2009).
The extrapituitary production of GH and GHR led to the idea
that this local expression implies autocrine/paracrine actions in
the ovary (Hull and Harvey, 2001; Luna et al., 2014). Previous find-
ings from our group demonstrated that the cGH is produced in GCs
cells, in both ovarian tissue and in cell cultures (Ahumada-
Solórzano et al., 2012) and this local production increased proges-
terone synthesis (in vitro) through the up-regulation of rate-
limiting enzymes expression during the steroid biosynthesis. Inter-
estingly, our results showed that GH is released to the incubation
media in a 15-kDa isoform that possibly was produced by
proteolytic-processing from the GH monomer of 22-kDa present
in extracts prepared from GCs in culture. This bioactive sub-
monomeric GH isoform is present in the pituitary and in many
extrapituitary tissues, including reproductive tracts in both males
and females, and also in the nervous and immune system
(Arámburo et al., 2001; Luna et al., 2005, 2014; Alba-Betancourt
et al., 2011; Harvey et al., 2014). It has been shown that a 15-
kDa GH variant enhanced endothelial cell proliferation in a dose
dependent manner (Arámburo et al., 2001). Also, a similar GH vari-
ant significantly increased cell viability and decreased caspase-3
activity in primary embryonic cerebellar neuron cultures treated
under hypoxia and low glucose (Alba-Betancourt et al., 2013). This
ubiquitous distribution of low molecular GH isoforms, probably
due to post-translational cleavage, strongly suggests a regulated
GH biotransformation. As expected, GH gene silencing by siRNA
resulted in low levels of ovarian GH produced in GC and released
to the incubation media (>80%).
The effect of GH in cell proliferation in cultured GCs was clearly
demonstrated by changes in the metabolic activity (MTT), in the
incorporation of
3
H-T and in the PCNA content. Our results showed
that both the 15-kDa present in the CM and the externally added
rcGH (22-kDa) were able to induce proliferation. The proliferative
actions of GH in GC were completely prevented by immunoneu-
tralization with a specific anti-cGH antibody, demonstrating its
participation as a key regulator of follicular growth. Our results
clearly demonstrate that the GH isoforms contained in the CM
may act as a potent mitogen produced by GCs in culture. Further-
more, the metabolic activity of cultured GCs was strongly
decreased by knocking-down local cGH expression with a specific
siRNA. These findings are consistent with previous reports in mice
showing that GH induces proliferation in GC in culture (Kobayashi
et al., 2000). However, this is the first demonstration that locally
synthesized and secreted GH is able to promote proliferation sim-
ilarly to the endocrine (exogenous) GH. It is known that GH supple-
mentation during the maturation of primordial and immature
follicles promotes cell survival and growth in pre-antral follicles
(Martins et al., 2010). Our results suggest that induction of
autocrine/paracrine GH could be a new strategy to improve follicu-
logenesis, ovulation and fertility in ovary. However, ovarian folli-
cles are highly irrigated structures that are also influenced by
multiple endocrine factors including pituitary GH. The differential
effects, regulation and cross-talk between pituitary and extrapitu-
itary GH remains to be elucidated. There is increasing evidence
involving the disruption of this balance of endocrine and
autocrine/paracrine GH with the appearance of neoplastic pro-
cesses and tumorogenesis (Conway-Campbell et al., 2007;
Nakonechnaya et al., 2013; Harvey et al., 2015).
GCs proliferation is a critical process in follicle development, in
which the Erk pathway has been implicated in promoting cell pro-
liferation and survival (Ryan et al., 2008; Huang et al., 2015). Inhi-
bition of the Erk pathway in rat GC in cultures reduced the
expression of cyclins, which are intimately involved in cell cycle
progression (Kayampilly and Menon, 2004). We demonstrated that
both rcGH (exogenous) and ovarian GH contained in the CM
(endogenous) were able to induce Erk phosphorylation, and this
activation was inhibited by the MEK1 and MEK2 antagonist
U0126. Our findings support the notion that GH and FSH could
work together increasing the Erk pathway activation, since the
FSH-induced superovulation was increased by GH addition
(Semiz and Evirgen, 2009). Interestingly, a dysfunctional regulation
in Erk activation has been associated with pathologies such as
polycystic ovary and ovarian cancer (Sheppard et al., 2013;
Kinross et al., 2011). However, the implications of local GH in these
physiopathological processes are still largely unknown.
Pituitary GH actions in postnatal growth and many other cell
functions during adulthood are regulated by the simultaneous
effect of both, hepatic IGF-I and locally expressed IGF-I (Lucy,
2011; Wang et al., 2013; Wu et al., 2015). Our data showed that
both rcGH and ovarian GH were able to induce the production
and release of IGF-I to the incubation media in GC cultures. The
specific effect of GH on IGF-I secretion was demonstrated by the
addition of a specific antibody against cGH, which completely abol-
ished its release to the incubation media. These findings are sup-
ported by previous reports in pigs and rats, where GH was able
to induce IGF-I expression in GCs (Ptak et al., 2004; Nakamura
et al., 2012). The role of IGF-I as a mediator for GH proliferative
effect on chicken GC cultures was determined by incubations with
exogenous IGF-I and media containing endogenous IGF-I, in both
cases the addition of an antibody against IGF-I resulted in a com-
plete lack of cell proliferation. In addition, it has been described
that IGF-I knockdown completely blocks fertility (Baker et al.,
1996) and in patients with Laron’s syndrome the number of
mature follicles and the pregnancy rate is drastically reduced
(Puche and Castilla-Cortázar, 2012). The involvement of IGF-I in
the follicular development and its dependence on GH remains con-
troversial, since some studies demonstrated that GH acts indepen-
dently to IGF-I (Liu et al., 1998; Bachelot et al., 2002; Slot et al.,
2006). However, there is increasing evidence suggesting that GH
might act through IGFs actions in reproductive tissues (Childs,
2000; Hull and Harvey, 2001, 2014).
GH involvement in follicular growth and ovulation might act
with or without follicle-stimulating hormone (FSH) to promote
the development of the follicles. GH is able to increase FSH-
stimulated granulosa cell differentiation and aromatase activity
in rats (Jia et al., 1986; Hutchinson et al., 1988) and estradiol pro-
duction in human ovaries (Mason et al., 1990; Barreca et al., 2014).
In the GH-deficient mice with reduced ovary size, GH promotes the
development of intermediate-size follicles, rescuing follicles from
atresia and increasing the number of corpus luteus (Jorgensen
54 S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56

et al., 1991; Ozawa et al., 1996). In the chicken ovary, only pre-
hierarchical follicles are susceptible to atresia (follicular atrophy),
whereas the rest of preovulatory follicles under normal physiolog-
ical conditions are resistant to becoming atresic (Johnson, 2000,
2015). These results suggest that GH produced in the pre-
hierarchical GCs might be involved in the selection and survival
of developing follicles, helping them to reach the pre-ovulatory
stage and avoiding atresia. Interestingly, Hrabia et al. (2012)
reported that chicken pre-hierarchal follicles did not increase
estradiol production by IGF-I. Therefore, it is likely that the IGF-I
effects on GC proliferation and chicken follicular development
could act, at least partially, in an estradiol-independent way.
In summary, this work provides evidence that suggest the
involvement of an autocrine/paracrine GH/IGF-I system during
the development of pre-hierarchal follicles in the hen ovary. The
capacity of locally produced GH to induce proliferation through
local IGF-I suggests that GCs proliferation during pre-hierarchical
stages in follicular growth is influenced by both pituitary GH and
ovarian GH.
Acknowledgments
We thank Drs. Carmen Clapp and Gonzalo Martinez de la Esca-
lera for the donation of
3
H-T, as well as Gerardo Courtois (Lab assis-
tant), Ramón Martinez and Omar González Hernández (Computing
Unit), Dr. Anaid Antaramián and MC Adriana González (Proteoge-
nomic Unit, INB), and Gabriel Nava, for technical assistance. This
work was supported by grants from CONACYT (178335) and
PAPIIT-DGAPA-UNAM (IN-206813, IN-206115). S. Marisela
Ahumada-Solórzano received a postdoctoral fellowship (5165)
from the CONACYT grant. José Ávila-Mendoza and José Luis Luna
Acosta are doctoral students enrolled at the Programa en Ciencias
Bioquímicas and Programa de Doctorado en Ciencias Biomédicas,
respectively, at the Universidad Nacional Autónoma de México
(UNAM), and received PhD fellowships from CONACYT (220839
and 200220, respectively). Support was also obtained from the Ale-
jandro Bayón fund, established by CA.
References
Ahumada-Solórzano, S.M., Carranza, M.E., Pedernera, E., Rodríguez-Méndez, A.J.,
Luna, M., Arámburo, C., 2012. Local expression and distribution of growth
hormone and growth hormone receptor in the chicken ovary: effects of GH on
steroidogenesis in cultured follicular granulosa cells. Gen. Comp. Endocrinol.
175, 297–310.
Alba-Betancourt, C., Arámburo, C., Ávila-Mendoza, J., Ahumada-Solórzano, S.M.,
Carranza, M., Rodríguez-Méndez, A.J., Harvey, S., Luna, M., 2011. Expression,
cellular distribution, and heterogeneity of growth hormone in the chicken
cerebellum during development. Gen. Comp. Endocrinol. 170, 528–540.
Alba-Betancourt, C., Luna-Acosta, J.L., Ramírez-Martínez, C.E., Avila-González, D.,
Granados-Ávalos, E., Carranza, M., Martínez-Coria, H., Arámburo, C., Luna, M.,
2013. Neuro-protective effects of growth hormone (GH) after hypoxia-ischemia
injury in embryonic chicken cerebellum. Gen. Comp. Endocrinol. 183, 17–31.
Arámburo, C., Sánchez-García, R., Fenton-Navarro, B., Perera-Marín, J.G., Valverde-
Rodríguez, C., 1989. Desarrollo de un radioinmunoensayo homólogo y
específico para la determinación de hormona del crecimiento del pollo (cGH).
Veterinaria México 20, 397–405.
Arámburo, C., Carranza, M., Reyes, M., Luna, M., Martinez-Coria, H., Berúmen, L.,
Scanes, C.G., 2001. Characterization of a bioactive 15 kDa fragment produced by
proteolytic cleavage of chicken growth hormone. Endocrine 15, 231–240.
Bachelot, A., Monget, P., Imbert-Bolloré, P., Coshigano, K., Kopchick, J.J., Kelly, P.A.,
Binart, N., 2002. Growth hormone is required for ovarian follicular growth.
Endocrinology 143, 4104–4112.
Baker, J., Hardy, M.P., Zhou, J., Bondy, C., Lupu, F., Bellvé, A.R., Efstratiadis, A., 1996.
Effects of an IGF-I gene null mutation on mouse reproduction. Mol. Endocrinol.
10, 903–918.
Barreca, A., Artini, P.G., Cesarone, A., Arvigo, M., D’Ambrogio, G., Genazzani, A.R.,
Giordano, G., Minuto, F., 2014. Interrelationships between follicle stimulating
hormone and the growth hormone – insulin-like growth factor – IGF-binding
proteins axes in human granulosa cells in culture. J. Endocrinol. Invest. 19, 35–
42.
Bartke, A., Sun, L.Y., Longo, V., 2013. Somatotropic signaling: trade-offs between
growth, reproductive development, and longevity. Physiol. Rev. 93, 571–598.
Baudet, M.-L., Rattray, D., Martin, B.T., Harvey, S., 2009. Growth hormone promotes
axon growth in the developing nervous system. Endocrinology 150, 2758–2766.
Cecim, M., Kerr, J., Bartke, A., 1995. Effects of bovine growth hormone (bGH)
transgene expression or bGH treatment on reproductive functions in female
mice. Biol. Reprod. 52, 1144–1148.
Childs, G.V., 2000. Growth hormone cells as co-gonadotropes: partners in the
regulation of the reproductive system. Trends Endocrinol. Metab. 11, 168–175.
Conway-Campbell, B.L., Wooh, J.W., Brooks, A.J., Gordon, D., Brown, R.J., Lichanska,
A.M., Chin, H.S., Barton, C.L., Boyle, G.M., Parsons, P.G., Jans, D.A., Waters, M.J.,
2007. Nuclear targeting of the growth hormone receptor results in
dysregulation of cell proliferation and tumorigenesis. Proc. Natl. Acad. Sci.
104, 13331–13336.
Gilbert, A.B., Evans, A.J., Perry, M.M., Davidson, M.H., 1977. A method for separating
the granulosa cells, the basal lamina and the theca of the preovulatory ovarian
follicle of the domestic fowl (Gallus domesticus). J. Reprod. Fertil. 50, 179–181.
Harvey, S., 2010. Extrapituitary growth hormone. Endocrine 38, 335–359.
Harvey, S., Baudet, M.-L., Murphy, A., Luna, M., Hull, K.L., Arámburo, C., 2004.
Testicular growth hormone (GH): GH expression in spermatogonia and primary
spermatocytes. Gen. Comp. Endocrinol. 139, 158–167.
Harvey, S., Baudet, M.-L., Luna, M., Arámburo, C., 2014. Non-classical signalling of
growth hormone in the chick neural retina? Avian Biol. Res. 7, 48–57.
Harvey, S., Martínez-Moreno, C.G., Luna, M., Arámburo, C., 2015.
Autocrine/paracrine roles of extrapituitary growth hormone and prolactin in
health and disease: an overview. Gen. Comp. Endocrinol. 220, 103–111.
Hrabia, A., 2015. Growth hormone production and role in the reproductive system
of female chicken. Gen. Comp. Endocrinol. 220, 112–118.
Hrabia, A., Paczoska-Eliasiewicz, H.E., Berghman, L.R., Harvey, S., Rzasa, J., 2008.
Expression and localization of growth hormone and its receptors in the chicken
ovary during sexual maturation. Cell Tissue Res. 332, 317–328.
Hrabia, A., Sechman, A., Gertler, A., Rza˛ sa, J., 2011. Effect of growth hormone on
steroid content, proliferation and apoptosis in the chicken ovary during sexual
maturation. Cell Tissue Res. 345, 191–202.
Hrabia, A., Sechman, A., Rzasa, J., 2012. Independent, non-IGF-I mediated, GH action
on estradiol secretion by prehierarchical ovarian follicles in chicken. In vitro
study. Folia Biol. (Krakow) 60, 213–217.
Hrabia, A., Grzegorzewska, A.K., Sechman, A., 2013. Expression and localization of
growth hormone receptor in the oviduct of the laying hen (Gallus domesticus).
Folia Biol. 61, 271–276.
Huang, X., Jin, J., Shen, S., Xia, Y., Xu, P., Zou, X., Wang, H., Yi, L., Wang, Y., Gao, Q.,
2015. Modulation of expression of 17-Hydroxylase/17,20 lyase (CYP17) and
P450 aromatase (CYP19) by inhibition of MEK1 in a human ovarian granulosa-
like tumor cell line. Gynecol. Endocrinol., 1–5
Hull, K.L., Harvey, S., 2001. Growth hormone: roles in female reproduction. J.
Endocrinol. 168, 1–23.
Hull, K.L., Harvey, S., 2014. Growth hormone and reproduction: a review of
endocrine and autocrine/paracrine interactions. Int. J. Endocrinol. 2014,
234014. http://dx.doi.org/10.1155/2014/234014.
Hutchinson, L.A., Findlay, J.K., Herington, A.C., 1988. Growth hormone and insulin-
like growth factor-I accelerate PMSG-induced differentiation of granulosa cells.
Mol. Cell. Endocrinol. 55, 61–69.
Jia, X.C., Kalmijn, J., Hsueh, A.J., 1986. Growth hormone enhances follicle-
stimulating hormone-induced differentiation of cultured rat granulosa cells.
Endocrinology 118, 1401–1409.
Johnson, A.L., 2010. Granulosa cell apoptosis: conservation of cell signaling in an
avian ovarian model system. Biol. Signals Recept. 9, 96–101.
Johnson, A.L., 2015. Ovarian follicle selection and granulosa cell differentiation.
Poult. Sci. 94, 781–785.
Jorgensen, K.D., Svendsen, O., Agergaard, N., Skydsgaard, K., 1991. Effect of human
growth hormone on the reproduction of female rats. Pharmacol. Toxicol.68,
14–20.
Kanzaki, M., Morris, P., 1999. Growth hormone regulates steroidogenic acute
regulatory protein expression and steroidogenesis in Leydig cell progenitors.
Endocrinology 140, 1681–1686.
Kayampilly, P.P., Menon, K.M.J., 2004. Inhibition of extracellular signal-regulated
protein kinase-2 phosphorylation by dihydrotestosterone reduces follicle-
stimulating hormone-mediated cyclin D2 messenger ribonucleic acid
expression in rat granulosa cells. Endocrinology 145, 1786–1793.
Kinross, K.M., Brown, D.V., Kleinschmidt, M., Jackson, S., Christensen, J., Cullinane, C.,
Hicks, R.J., Johnstone, R.W., McArthur, G.A., 2011. In vivo activity of combined
PI3K/mTOR and MEK inhibition in a Kras(G12D);Pten deletion mouse model of
ovarian cancer. Mol. Cancer Ther. 10, 1440–1449.
Kirkwood, R.N., Thacker, P.A., Korchinski, R.S., Laarveld, B., 1988. The influence of
exogenous pituitary growth hormone on the ovulatory response to PMSG and
hCG and the LH response to estradiol benzoate in prepubertal gilts. Domest.
Anim. Endocrinol. 5, 317–322.
Kobayashi, J., Mizunuma, H., Kikuchi, N., Liu, X., Andoh, K., Abe, Y., Yokota, H.,
Yamada, K., Ibuki, Y., Hagiwara, H., 2000. Morphological assessment of the effect
of growth hormone on preantral follicles from 11-day-old mice in an in vitro
culture system. Biochem. Biophys. Res. Commun. 268, 36–41.
Kolodziejczyk, J., Gertler, A., Leibovich, H., Rzasa, J., Gregoraszczuk, E.L., 2003.
Synergistic action of growth hormone and insulin-like growth factor I (IGF-I) on
proliferation and estradiol secretion in porcine granulosa and theca cells
cultured alone or in coculture. Theriogenology 60, 559–570.
Laemmli, U.K., Beguin, F., Gujer-Kellenberger, G., 1970. A factor preventing the
major head protein of bacteriophage T4 from random aggregation. J. Mol. Biol.
47, 69–85.
S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56 55

Liu, X., Andoh, K., Yokota, H., Kobayashi, J., Abe, Y., Yamada, K., Mizunuma, H., Ibuki,
Y., 1998. Effects of growth hormone, activin, and follistatin on the development
of preantral follicle from immature female mice. Endocrinology 139, 2342–
2347.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(Delta Delta C(T)). Method 25, 402–408.
Lucy, M.C., 2011. Growth hormone regulation of follicular growth. Reprod. Fertil.
Dev. 24, 19–28.
Luna, M., Huerta, L., Berumen, L., Martínez-Coria, H., Harvey, S., Arámburo, C., 2004.
Growth hormone in the male reproductive tract of the chicken: heterogeneity
and changes during ontogeny and maturation. Gen. Comp. Endocrinol. 137, 37–
49.
Luna, M., Barraza, N., Berumen, L., Carranza, M., Pedernera, E., Harvey, S., Arámburo,
C., 2005. Heterogeneity of growth hormone immunoreactivity in lymphoid
tissues and changes during ontogeny in domestic fowl. Gen. Comp. Endocrinol.
144, 28–37.
Luna, M., Martínez-Moreno, C.G., Ahumada-Solórzano, M.S., Harvey, S., Carranza, M.,
Arámburo, C., 2014. Extrapituitary growth hormone in the chicken reproductive
system. Gen. Comp. Endocrinol. 203, 60–68.
Luna-Acosta, J.L., Alba-Betancourt, C., Martínez-Moreno, C.G., Ramírez, C., Carranza,
M., Luna, M., Arámburo, C., 2015. Direct antiapoptotic effects of growth
hormone are mediated by PI3K/Akt pathway in the chicken bursa of
Fabricius. Gen. Comp. Endocrinol. 224, 148–159.
Martínez-Coria, H., López-Rosales, L.J., Carranza, M., Berumen, L., Luna, M.,
Arámburo, C., 2002. Differential secretion of chicken growth hormone
variants after growth hormone-releasing hormone stimulation in vitro.
Endocrine 17, 91–102.
Martínez-Moreno, C.G., Palma, L., Carranza, M., Harvey, S., Arámburo, C., Luna, M.,
2011. Cellular and intracellular distribution of growth hormone in the adult
chicken testis. Gen. Comp. Endocrinol. 172, 344–357.
Martínez-Moreno, C.G., López-Marín, L.M., Carranza, M., Giterman, D., Harvey, S.,
Arámburo, C., Luna, M., 2014. Growth hormone (GH) and GH-releasing hormone
(GHRH): co-localization and action in the chicken testis. Gen. Comp. Endocrinol.
199, 38–45.
Martins, F.S., Celestino, J.J.H., Saraiva, M.V.A., Chaves, R.N., Rossetto, R., Silva, C.M.G.,
Lima-Verde, I.B., Lopes, C.A.P., Campello, C.C., Figueiredo, J.R., 2010. Interaction
between growth differentiation factor 9, insulin-like growth factor I and growth
hormone on the in vitro development and survival of goat preantral follicles.
Braz. J. Med. Biol. Res. 43, 728–736.
Mason, H.D., Martikainen, H., Beard, R.W., Anyaoku, V., Franks, S., 1990. Direct
gonadotrophic effect of growth hormone on oestradiol production by human
granulosa cells in vitro. J. Endocrinol. 126, 1–4.
Moreira, F., Orlandi, C., Risco, C.A., Mattos, R., Lopes, F., Thatcher, W.W., 2001. Effects
of presynchronization and bovine somatotropin on pregnancy rates to a timed
artificial insemination protocol in lactating dairy cows. J. Dairy Sci. 84, 1646–
1659.
Nakamura, E., Otsuka, F., Inagaki, K., Miyoshi, T., Matsumoto, Y., Ogura, K.,
Tsukamoto, N., Takeda, M., Makino, H., 2012. Mutual regulation of growth
hormone and bone morphogenetic protein system in steroidogenesis by rat
granulosa cells. Endocrinology 153, 469–480.
Nakonechnaya, A.O., Jefferson, H.S., Chen, X., Shewchuk, B.M., 2013. Differential
effects of exogenous and autocrine growth hormone on LNCaP prostate cancer
cell proliferation and survival. J. Cell Biochem. 114, 1322–1335.
Ozawa, K., Mizunuma, H., Ozawa, H., Ibuki, Y., 1996. Recombinant human growth
hormone acts on intermediate-sized follicles and rescues growing follicles from
atresia. Endocr. J. 43, 87–92.
Ptak, A., Kajta, M., Gregoraszczuk, E.L., 2004. Effect of growth hormone and insulin-
like growth factor-I on spontaneous apoptosis in cultured luteal cells collected
from early, mature, and regressing porcine corpora lutea. Anim. Reprod. Sci.80,
267–279.
Puche, J.E., Castilla-Cortázar, I., 2012. Human conditions of insulin-like growth
factor-I (IGF-I) deficiency. J. Transl. Med. 10, 224.
Ryan, K.E., Glister, C., Lonergan, P., Martin, F., Knight, P.G., Evans, A.C., 2008. Functional
significance of the signal transduction pathways Akt and Erk in ovarian follicles:
in vitro and in vivo studies in cattle and sheep. J. Ovarian Res. 1, 2.
Sanders, E.J., Lin, W.Y., Parker, E., Harvey, S., 2010. Growth hormone expression and
neuroprotective activity in a quail neural retina cell line. Gen. Comp.
Endocrinol. 165, 111–119.
Semiz, O., Evirgen, O., 2009. The effect of growth hormone on ovarian follicular
response and oocyte nuclear maturation in young and aged mice. Acta
Histochem. 111, 104–111.
Sheppard, K.E., Cullinane, C., Hannan, K.M., Wall, M., Chan, J., Barber, F., Foo, J.,
Cameron, D., Neilsen, A., Ng, P., Ellul, J., Kleinschmidt, M., Kinross, K.M., Bowtell,
D.D., Christensen, J.G., Hicks, R.J., Johnstone, R.W., McArthur, G.A., Hannan, R.D.,
Phillips, W.A., Pearson, R.B., 2013. Synergistic inhibition of ovarian cancer cell
growth by combining selective PI3K/mTOR and RAS/ERK pathway inhibitors.
Eur. J. Cancer 49, 3936–3944.
Silva, J.R.V., Figueiredo, J.R., van den Hurk, R., 2009. Involvement of growth hormone
(GH) and insulin-like growth factor (IGF) system in ovarian folliculogenesis.
Theriogenology 71, 1193–1208.
Sirotkin, A.V., 2005. Control of reproductive processes by growth hormone: extra-
and intracellular mechanisms. Vet. J. 170, 307–317.
Sirotkin, A.V., Makarevich, A.V., Kwon, H.B., Kotwica, J., 2003. Involvement of MAP
kinase in the mediation of GH action on ovarian granulosa cells. Mol. Cell
Endocrinol. 205, 193–199.
Slot, K.A., Kastelijn, J., Bachelot, A., Kelly, P.A., Binart, N., Teerds, K.J., 2006. Reduced
recruitment and survival of primordial and growing follicles in GH receptor-
deficient mice. Reproduction 131, 525–532.
Starbuck, M.J., Inskeep, E.K., Dailey, R.A., 2006. Effect of a single growth hormone
(rbST) treatment at breeding on conception rates and pregnancy retention in
dairy and beef cattle. Anim. Reprod. Sci. 93, 349–359.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A.,
Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR
data by geometric averaging of multiple internal control genes. Genome Biol. 3,
34.1–34.11.
Wang, Z., Wang, Z., Liang, Z., Liu, J., Shi, W., Bai, P., Lin, X., Magaye, R., Zhao, J., 2013.
Expression and clinical significance of IGF-I, IGFBP-3, and IGFBP-7 in serum and
lung cancer tissues from patients with non-small cell lung cancer. Onco. Targets
Ther. 6, 1437–1444.
Wu, S., Yang, W., De Luca, F., 2015. Insulin-like growth factor-independent effects of
growth hormone on growth plate chondrogenesis and longitudinal bone
growth. Endocrinology 156, 2541–2551.
Zaczek, D., Hammond, J., Suen, L., Wandji, S., Service, D., Bartke, A., Chandrashekar,
V., Coschigano, K., Kopchick, J., 2002. Impact of growth hormone resistance on
female reproductive function: new insights from growth hormone receptor
knockout mice. Biol. Reprod. 67, 1115–1124.
Zhao, J., van Tol, H.T., Taverne, M.A., van der Weijden, G.C., Bevers, M.M., van den
Hurk, R., 2000. The effect of growth hormone on rat pre-antral follicles in vitro.
Zygote 8, 275–283.
Zhao, J., Taverne, M.A., Van Der Weijden, G.C., Bevers, M.M., Van Den Hurk, R., 2001.
Insulin-like growth factor-I (IGF-I) stimulates the development of cultured rat
pre-antral follicles. Mol. Reprod. Dev. 58, 287–296.
Zhao, J., Taverne, M.A.M., van der Weijden, G.C., Bevers, M.M., van den Hurk, R.,
2002. Immunohistochemical localisation of growth hormone (GH), GH receptor
(GHR), insulin-like growth factor I (IGF-I) and type I IGF-I receptor, and gene
expression of GH and GHR in rat pre-antral follicles. Zygote 10, 85–94.
56 S.M. Ahumada-Solórzano et al. / General and Comparative Endocrinology 234 (2016) 47–56