Content uploaded by Armin Sadeghi
Author content
All content in this area was uploaded by Armin Sadeghi on Sep 28, 2020
Content may be subject to copyright.
Content uploaded by Majid Ahmadi
Author content
All content in this area was uploaded by Majid Ahmadi on Sep 14, 2020
Content may be subject to copyright.
Received: 14 July 2020
|
Revised: 12 August 2020
|
Accepted: 31 August 2020
DOI: 10.1002/jcp.30047
ORIGINAL RESEARCH ARTICLE
Th17 and Treg cells function in SARS‐CoV2 patients
compared with healthy controls
Armin Sadeghi
1,2
|Safa Tahmasebi
3
|Arshad Mahmood
4
|Maria Kuznetsova
5
|
Hamed Valizadeh
1,2
|Ali Taghizadieh
1,2
|Masoud Nazemiyeh
1,2
|
Leili Aghebati‐Maleki
6
|Farhad Jadidi‐Niaragh
7
|Sanaz Abbaspour‐Aghdam
8
|
Leila Roshangar
8
|Haleh Mikaeili
1,2
|Majid Ahmadi
8
1
Tuberculosis and Lung Disease Research
Center of Tabriz University of Medical
Sciences, Tabriz, Iran
2
Department of Internal Medicine, School of
Medicine, Tabriz University of Medical
Sciences, Tabriz, Iran
3
Department of Immunology, Healthy Faculty,
Tehran University of Medical Sciences,
Tehran, Iran
4
School of Management, Universiti Sains
Malaysia, Penang, Malaysia
5
Department of Propaedeutics of Dental
Diseases, I.M. Sechenov First Moscow State
Medical University (Sechenov University),
Moscow, Russia
6
Immunology Research Center, Tabriz
University of Medical Sciences, Tabriz, Iran
7
Department of Immunology, Tabriz
University of Medical Sciences, Tabriz, Iran
8
Stem Cell Research Center, Tabriz University
of Medical Sciences, Tabriz, Iran
Correspondence
Haleh Mikaeili, Department of Internal
Medicine, School of Medicine, Tabriz
University of Medical Sciences, Tabriz, Iran.
Email: mikaiili@hotmail.com
Majid Ahmadi, Stem Cell Research Center,
Tabriz University of Medical Sciences,
Tabriz, Iran.
Email: Ahmadi.m@tbzmed.ac.ir
Funding information
Tabriz University of Medical Sciences,
Grant/Award Number: 65235
Abstract
In the course of the coronavirus disease 2019 (COVID‐19), raising and reducing
the function of Th17 and Treg cells, respectively, elicit hyperinflammation and
disease progression. The current study aimed to evaluate the responses of Th17
and Treg cells in COVID‐19 patients compared with the control group. Forty
COVID‐19 intensive care unit (ICU) patients were compared with 40 healthy
controls. The frequency of cells, gene expression of related factors, as well as the
secretion levels of cytokines, were measured by flow cytometry, real‐time poly-
merase chain reaction, and enzyme‐linked immunosorbent assay techniques, re-
spectively. The findings revealed a significant increase in the number of Th17 cells,
the expression levels of related factors (RAR‐related orphan receptor gamma
[RORγt], IL‐17, and IL‐23), and the secretion levels of IL‐17 and IL‐23 cytokines in
COVID‐19 patients compared with controls. In contrast, patients had a remarkable
reduction in the frequency of Treg cells, the expression levels of correlated factors
(Forkhead box protein P3 [FoxP3], transforming growth factor‐β[TGF‐β], and
IL‐10), and cytokine secretion levels (TGF‐βand IL‐10). The ratio of Th17/Treg
cells, RORγt/FoxP3, and IL‐17/IL‐10 had a considerable enhancement in patients
compared with the controls and also in dead patients compared with the improved
cases. The findings showed that enhanced responses of Th17 cells and decreased
responses of Treg cells in 2019‐n‐CoV patients compared with controls
had a strong relationship with hyperinflammation, lung damage, and disease
pathogenesis. Also, the high ratio of Th17/Treg cells and their associated factors in
COVID‐19‐dead patients compared with improved cases indicates the critical role
of inflammation in the mortality of patients.
KEYWORDS
COVID‐19, Th17, Th17/Treg cells ratio, Treg
J Cell Physiol. 2020;1–11. wileyonlinelibrary.com/journal/jcp © 2020 Wiley Periodicals LLC
|
1
1|INTRODUCTION
In late 2019, the novel severe acute respiratory syndrome cor-
onavirus 2 (SARS‐CoV2) originated from Wuhan, China, and was
introduced to the world by the World Health Organization (WHO),
namely coronavirus disease 2019 (COVID‐19; F. Wu, Zhao, et al.,
2020;Y.‐C. Wu, Chen, & Chan, 2020). The SARS‐CoV2, as the third
zoonotic coronavirus, belongs to the β‐coronavirus cluster,
which includes the Middle East respiratory syndrome coronavirus
(MERS‐CoV) and SARS‐CoV (Zhou et al., 2020). Due to the rapid
spread and human‐to‐human transmission of the novel coronavirus
(2019‐nCoV), it has become a serious crisis around the world. Hence,
to manage this pandemic, the SARS‐CoV2 immunopathogenesis
needs to be better understood (Ghaebi, Osali, Valizadeh, Roshangar,
& Ahmadi, 2020)
By recognizing the immunological mechanisms involved in the
disease, appropriate diagnostic and therapeutic methods can be
employed to diagnose and treat COVID‐19 infected patients, effi-
ciently (Tahmasebi, Khosh, & Esmaeilzadeh, 2020). Transmission of
SARS‐CoV2 generally occurs through the respiratory system dro-
plets, and close personal contact. There has been a high risk of
contracting the SARS‐CoV2 in middle‐aged and older adults, as well
as individuals with underlying diseases (Riou & Althaus, 2020; Zhou
et al., 2020). In brief, from a clinical point of view, 2019‐nCoV elicits
a series of pathogenesis from cold‐like infection to lethal sickness,
severe respiratory infections like acute respiratory disease syndrome
(ARDS), and damage to various organs, including the nervous system,
liver, kidneys, and gastrointestinal system (Lu et al., 2020; Yin &
Wunderink, 2018). The clinical symptoms that characterize the
COVID‐19, mainly include fever, dry cough, respiratory problems,
and pneumonia, which are caused by inflammation and alveolar da-
mage (Q. Li, Guan, et al., 2020).
Immunologically, a decreased frequency of lymphocytes, espe-
cially T CD4
+
and CD8
+
cells brings lymphopenia, imbalance of the
immune system, and hyperinflammation due to the increased levels
of inflammatory cytokines. They are important paraclinical symp-
toms, identified as the main causes of respiratory damage and death
in novel coronavirus disease (Wan et al., 2020). It should be noted
that among the immune cells, natural killer (NK) cells, macrophages,
and neutrophils in innate immune responses, as well as T cells (CD4
+
and CD8
+
) and B cells in adaptive immune responses, play principal
roles in defending against the SARS‐CoV2. However, the con-
tamination of immune cells by virus and their alterations in the
course of the disease disturb the balance of the immune system,
which results in severe inflammation and disease progression (Lin,
Lu, Cao, & Li, 2020; Shi et al., 2020).
In intracellular infections, such as viral infections, the immune
system shifts the T cell responses toward the Th1 and Th17 pheno-
types, which in turn counteract the infection by producing the in-
flammatory factors. In infections, Th17 cells are differentiated by
RAR‐related orphan receptor γt(RORγt) transcription factor and
interleukin‐23 (IL‐23), which play an antiviral role by inducing the
production of inflammatory cytokines, including IL‐17, TNF‐α, and
IL‐6 (Annunziato et al., 2007; Harrington et al., 2005). In contrast to
the mentioned inflammatory cells, regulatory T (Treg) cells are known
as immune system‐regulating cells that have anti‐inflammatory effects
and involve in maintaining the immune system balance by producing
anti‐inflammatory cytokines, such as IL‐10, IL‐35, and TGF‐β.The
FoxP3 transcription factor has a role in development and differ-
entiation of Tregs (Ahmadi et al., 2017; Braitch et al., 2009).
Accordingly, in 2019‐nCoV cases, antiviral activity and in-
flammatory responses are the responsibility of neutrophils, macro-
phages, Th1, and Th17 cells. It is noteworthy that these cells,
especially T cells, provoke a cytokine storm by producing large
amounts of inflammatory cytokines, including IL‐1β,IL‐2, 8, and 12,
TNF‐α, IFN‐γ,G‐CSF, GM‐CSF, (monocyte chemotactic protein‐1
[MCP‐1], macrophage inflammatory protein‐1A [MIP‐1A], and IP‐10
(Wan et al., 2020). In turn, cytokine storm leads to hyperinflamma-
tion, disease progression, and respiratory system injury (Jose
& Manuel, 2020). On the other hand, it has been reported that the
lack of Treg cells and Th2 cells, as well as the imbalance of Th17/Treg
cell ratio, alter the immune responses toward inflammatory pheno-
type and disease progression in COVID‐19 infected patients (Li,
Geng, Peng, Meng, & Lu, 2020c; Prompetchara, Ketloy, & Palaga,
2020). The current study aimed to investigate the inflammatory
condition in COVID‐19 patients admitted to the intensive care unit
(ICU) in comparison with healthy controls by measuring the number
of Th17 and Treg cells, their relevant transcription factors (RORɣt
and FoxP3, respectively), Th17 cell cytokines (IL‐17 and IL‐23), and T
reg cell cytokines (IL‐10 and TGF‐β).
2|MATERIALS AND METHODS
2.1 |Study design and patients
In the present study, 40 COVID‐19 patients admitted into the ICU of
Imam Reza Hospital of Tabriz University of Medical Sciences (TUMS),
who were confirmed to be positive for SARS‐CoV2 by real‐time
polymerase chain reaction (RT‐PCR), were evaluated in comparison
with 40 healthy controls without underlying diseases. The patient
and control groups were randomly selected, and both were between
20 and 80 years old. Of note, written informed consent was obtained
from all included patients and healthy controls. This study was ap-
proved by the Research Ethics Committee of Tabriz University of
Medical Sciences (IR. TBZMED. REC.1399.011).
According to the inclusion criteria of the current study, 2019‐
nCoV patients who were confirmed in terms of clinical criteria,
etiological characteristics, positive RT‐PCR testing and were willing
to cooperate in the study were included. In contrast, based on the
exclusion criteria of the current study, COVID‐19 patients with a
historyofchronicdiseasessuchasinfectiousdiseases(chronic
hepatitis B or C, chronic brucellosis, and HIV), cancers (leukemia
and lymphoma), and allergic disorders were excluded. The demo-
graphic information and clinical features of the patients are given in
Table 1.
2
|
SADEGHI ET AL.
2.2 |Blood sampling, PBMCs isolation, and cell
culture
From each patient and healthy individual, 8 ml of whole blood was
collected by heparinized syringes for cellular and molecular tests.
The peripheral blood mononuclear cells (PBMCs) were separated by
the density‐gradient method using the standard Ficoll (lymphosep)
1.077 g/ml (Biosera) and then centrifuged (25 min, 450 g), which was
followed by twice washing with phosphate buffer saline (PBS; Sigma‐
Aldrich). Thereafter, separated PBMCs were cultured in a culture
medium consisting of 10% heat‐inactivated fetal bovine serum,
100 U/ml penicillin, 10 ng/ml of PMA, and 200 mM L‐glutamine
(eBioscience). PBMCs in the culture medium were incubated for
48 hr at 37°C and 5% CO
2
. Finally, the cultured cells were subjected
to cell count by flow cytometry and gene expression by RT‐PCR.
Also, supernatants of isolated cells were employed to measure the
secretion levels of cytokines by enzyme‐linked immunosorbent assay
(ELISA).
2.3 |Cell separation and flow cytometry
The frequency of Th17 and Treg cells of ICU‐admitted COVID‐19
patients and healthy controls were assessed by the flow cytometry
technique. To detect the Th17 and Treg cells, CD4
+
T cells were
separated from cultured PBMCs by magnetic‐activated cell sorting
(MACS; Miltenyi Biotec). For this purpose, to robust the intracellular
staining of IL‐17A, the PBMCs were triggered by 25 ng/ml of PMA
along with 1 μg/ml of ionomycin and then, incubated for 4 hr in the
presence of 1.7 μg/ml monensin (all from eBioscience). To detect
the Th17 cells, incubation of PBMCs with allophycocyanin
(APC)‐conjugated anti‐CD4 was conducted at 4°C for 15 min, and
subsequent staining was applied by phycoerythrin (PE)‐conjugated
anti‐IL‐17A (eBioscience). Moreover, the detection of Tregs was
performed by the incubation of cultured PBMCs with the fluorescein
isothiocyanate (FITC)‐labeled anti‐human CD4, PE‐labeled anti‐
human CD25, and PerCP‐Cy5.5‐conjugated anti‐human CD127
(eBioscience) for 15 min at 4°C. In the current study, PE and FITC
mouse IgG1, κ‐isotype control were considered as isotype controls.
Afterward, cell count analysis was done by the FACSCalibur flow
cytometer with FlowJo software (Becton Dickinson).
2.4 |RNA extraction and cDNA synthesis
Real‐time PCR was conducted to quantify the expression profiles of
factors related to Th17 cells (RORɣt, IL‐17, and IL‐23) and Treg cells
(FoxP3, IL‐10, and TGF‐β) in cultured PBMCs of COVID‐19 and
control groups using the SYBR Green approach, along with the re-
levant forward and reverse primers. Accordingly, total RNA
was extracted from isolated cells exploiting RNX‐PLUS Solution
(SinaClon), which is followed by complementary DNA (cDNA)
synthesis utilizing the random hexamer primer and Revert Aid™re-
verse transcriptase (Thermo Fisher Scientific). Thereafter, the real‐
time PCR was performed to assay the gene expression as follow
steps: First of all, DNA was denaturated in the denaturation phase at
95°C for 10 s, which was repeated for 40 cycles. Then, the cycles
were continued to the annealing phase at 60°C for 30 s, and exten-
sion phase at 72°C for 20 s. To plot the standard curves, the six
TABLE 1 Subjects' clinical and laboratory information
COVID‐19
patients
(n= 40)
Healthy
control
group (n= 40) pvalue
Age (years) 21–73
(54.2 ± 9.1)
21–71
(52.4 ± 8.5)
Sex NS
Men 28 (70%) 28 (80%)
Women 12 (30%) 12 (20%)
Current smoking 10 (25%) 11 (27.5%) NS
Fever 40 (100%) 0 _
<37.3°C 3 (7.5%)
37.3–38.0°C 21 (52.5%)
38.1–39.0°C 11 (27.5%)
>39.0°C 4 (10%)
Cough 23 (57.5%) 0 _
Headache 7 (17.5%) 0 _
Dyspnea 12 (30%) 0 _
White blood cell count,
×10
9
/L
.0001
<4 11 (27.5%) 4 (10%)
4–10 20 (50%) 31 (77.5%)
>10 9 (22.5%) 5 (12.5%)
Lymphocyte count, ×10
9
/L .0001
<1.0 32 (80%) 18 (45%)
≥1.0 8 (20%) 22 (55%)
Platelet count, ×10
9
/L .0001
<100 25 (62.5%) 9 (22.5%)
≥100 15 (37.5%) 31 (77.5%)
Creatinine, μmol/L .0001
≤133 37 (92.5%) 2 (5%)
>133 3 (7.5%) 39 (95%)
Lactate
dehydrogenase,
U/L
.0001
≤245 23 (57.5%) 4 (10%)
>245 17 (42.5%) 38 (90%)
Bilateral involvement
of chest
radiographs
19 (95%) 0 _
Abbreviations: FoxP3, forkhead box P3; IL, interleukin; RORɣt, retinoic
acid‐related orphan receptor ɣ; TGF‐β, transforming growth factor β.
SADEGHI ET AL.
|
3
standards were provided from 10‐fold serial dilutions of genes con-
centrated samples. Moreover, to confirm the amplification, 2%
agarose gel and Biosystems (Seqlab)were employed for Electro-
phoresis analysis and DNA sequencing. The β‐actin molecule was
considered as a housekeeping gene to compare the gene expression
of target genes. Eventually, the comparative C
t
method using the
2
CΔΔ
t
‐
formula was utilized to analyze the data and compare the
relative expression of target genes with β‐actin. The sequences of
primers have been listed in Table 2.
2.5 |Detection of cytokine profile by ELISA
Th17 cell‐secreted cytokines (IL‐17 and IL‐23), as inflammatory cy-
tokines, and Treg cell‐secreted cytokines (IL‐10 and TGF‐β), as anti‐
inflammatory cytokines, were measured by an ELISA kit (MyBio-
Source) using the supernatant of cultured PBMCs. In short, the ELISA
process was done as follow steps: coating the ELISA plate by adding
100 μl of coating antibody with overnight incubation, washing by PBS
containing 0.05% Tween‐20, incubating with a blocking buffer on a
shaker for an hour, pouring 100 μl samples and standards, incubating
for an hour, washing, adding 100 μl of a biotinylated antibody, in-
cubating for an hour, pouring 100 μl of the avidin–biotin–peroxidase
complex, incubating for 30 min, adding 100 μl of tetra-
methylbenzidine (TMB) substrate, incubating for 30 min, stopping
the reaction and reading. The absorbance values were read by a
Medgenix ELISA reader (BP‐800; Biohit) at 450 nm.
2.6 |Statistical analysis
SPSS PC Statistics Software (version 19.0; SPSS Inc.) was used out
for statistical analysis. Accordingly, the unpaired t‐test and the
Mann–Whitney Utest compared the normally and abnormally
distributed data between the healthy controls, and 2019‐nCoV
ICU‐admitted patients, respectively. The mean ± SD describes the
descriptive data. Moreover, the Shapiro–Wilk test controlled the
data appropriateness to normal ranges. Additionally, p< .05 was
described as statistically significant. GraphPad Prism (version 7.00
for Windows; GraphPad Software; www.graphpad.com) was applied
to plot the graphs.
3|RESULTS
3.1 |Frequency of Th17 cells in controls and
COVID‐19 patients
The flow cytometry technique also analyses the circulating propor-
tion of circulating Th17 (CD4
+
IL‐17A
+
) cells in PBMCs of 2019‐nCoV
patients and the controls to compare the alteration of Th17 cells in
both groups. Based upon this, findings illustrated that the frequency
of Th17 cells was considerably built up in COVID‐19 patients than
controls (6.767 ± 2.831 vs. 3.306 ± 1.628, p< .0001; Figure 1a,b).
3.2 |Frequency of Treg cells in controls and
COVID‐19 patients
To determine the alteration of the peripheral Treg cell population
(CD4
+
CD25
+
CD127
−
cells) in both healthy controls and COVID‐19
patients, the frequency of Tregs was quantified in PBMCs by flow
cytometry analysis. Based on the obtained results, we found that the
number of circulating Treg cells was meaningfully reduced in patients
in comparison with the control group (3.08 ± 1.613 vs. 4.741 ± 2.052,
p< .0001; Figure 2a,b).
3.3 |Measurement of the RORɣt and FoxP3
expression levels
Due to the alterations in the number and the relevant factors of T cell
subsets in COVID‐19 patients, the expression levels of Th17 and Treg
transcription factors (RORɣt and FoxP3, respectively) were also mea-
sured by Real‐time PCR. Considering the results, we found that gene
expression of RORɣt transcription factor had a significant increase in
COVID‐19 patients than controls (2.018 ± 0.830 vs. 0.992 ± 0.086,
p= .0001) (Figure 1c). In contrast, the gene expression of FoxP3 had a
remarkable decrease in patients compared with healthy individuals
(0.518 ± 0.291 vs. 1.001 ± 0.714, p< .0001; Figure 2c).
3.4 |Assessment of cytokine expression profile
To compare the alteration of cytokines in COVID‐19 patients and
controls, the expression levels of cytokines associated with Th17
TABLE 2 Primer sequence
Gene Primer Sequence
RORγtForward ACTCAAAGCAGGAGCAATGGAA
Reverse AGTGGGAGAAGTCAAAGATGGA
FoxP3 Forward TCATCCGCTGGGCCATCCTG
Reverse GTGGAAACCTCACTTCTTGGTC
TGF‐βForward CGACTACTACGCCAAGGA
Reverse GAGAGCAACACGGGTTCA
IL‐10 Forward CAT CGA TTT CTT CCC TGT GAA
Reverse TCTTGGAGCTTATTAAAGGCATTC
IL‐17 Forward CATAACCGGAATACCAATACCAAT
Reverse GGATATCTCTCAGGGTCCTCATT
IL‐23 Forward GGACAACAGTCAGTTCTGCTT
Reverse CACAGGGCTATCAGGGAGC
β‐Actin Forward AGAGCTACGAGCTGCCTGAC
Reverse AGCACTGTGTTGGCGTACAG
4
|
SADEGHI ET AL.
cells (IL‐17 and IL‐23) and Treg cells (IL‐10 and TGF‐β) were assessed
by real‐time PCR. On one hand, the results demonstrated that the
mean cytokine expression of IL‐17 and IL‐23 cytokines was notably
escalated in patients when compared with controls (3.867 ± 2.383,
p< .0001, and 3.172 ± 1.240, p< .0001). On the other hand, notice-
able downregulation of IL‐10 and TGF‐βcytokines was detected in
the patient group compared with controls (0.376 ± 0.274, p< .0001
and 0.417 ± 0.297, p< .0001, respectively; Figure 3).
3.5 |The cytokine secretion levels in serum and
supernatant of cultured PBMCs
To examine the changes in secretion levels of cytokines between
patients and healthy subjects, the levels of IL‐17, IL‐23, IL‐10, and
TGF‐βcytokines were measured in serum samples and the super-
natant of PBMCs by ELISA. According to obtained results, we found
that due to the decrease in the level of Tregs in SARS‐CoV2 patients,
the mean secretion levels of the relevant cytokines, including IL‐10
and TGF‐βwere significantly reduced in patients rather than controls
in both the serum sample (17.35 ± 11.13 vs. 33.81 ± 21.87, p= .0005
and 37.64 ± 27.6 vs. 100.7 ± 57, p< .0001, respectively) and super-
natant of PBMCs (392.5 ± 235.6 vs. 812.6 ± 519.7, p= .0001 and
130.2 ± 82.83 vs. 229.5 ± 82.28, p< .0001, respectively) (Figure 4a,b).
By contrast, considering the elevated number of Th17 cells in
COVID‐19 patients, the mean secretion levels of IL‐17 and IL‐23
cytokines were strongly grown in both serum (27.35 ± 11.78 vs.
18.38 ± 7.775, p= .0012 and 41.69 ± 21.26 vs. 25.58 ± 13.37,
p= .0031, respectively) and the supernatant of cultured PBMCs
(179.0 ± 74.45 vs. 101.8 ± 53.46, p= .0001 and 0.417 ± 0.297 vs.
0.376 ± 0.274, p= .0001, respectively) of patients than that in heal-
thy individuals (Figure 4c,d).
3.6 |Th17/Treg ratios in COVID‐19 patient and
control groups
The ratios of Th17/Treg cells, their main cytokines, and transcription
factors were compared in both patient and control groups. As a re-
sult, the ratio of Th17/Treg cells was found greater in COVID‐19
infected patients when compared with the control group
(1.338 ± 0.544 vs. 0.706 ± 0.364, p< .0001). Additionally, the ex-
pression ratios of RORɣt/FoxP3 transcription factors and IL‐17/IL‐10
cytokines were markedly increased in COVID‐19 patients than in
healthy subjects (2.269 ± 1.241 vs. 0.512 ± 0.351, p< .0001 and
1.771 ± 1.23 vs. 0.51 ± 0.39, p< .0001, respectively; Figure 5).
3.7 |Th17/Treg cell ratio in COVID‐19 improved
and dead patients
To investigate the effects of Th17 and Treg cells, the imbalance of
the immune system, and the resulting inflammation in COVID‐19
mortality, we assessed the expression ratios of Th17/Treg cells, and
their associated cytokines and transcription factors in both 2019‐
nCoV improved and dead patients. Hence, we found that the ex-
pression ratios of all Th17/Treg cells (1.638 ± 0.592 vs.
1.189 ± 0.462, p= .023), IL‐17/IL‐10 cytokines (2.26 ± 0.564 vs.
1.76 ± 1.13, p= .017), and RORɣt/Foxp3 transcription factors
(2.501 ± 0.744 vs. 2.263 ± 1.241, p= .028) were notably higher in
dead patients when compared with improved cases (Figure 6).
4|DISCUSSION
With regard to the rapid outbreak of novel SARS‐CoV2 in the world
that originated from Wuhan, China, for rapid diagnosis and treat-
ment of infected patients, more knowledge of the viral
FIGURE 1 The number of Th17 cells and the expression level of
RORɣt in 2019‐nCoV patients and healthy subjects. (a) The counting
of the Th17 cells was done according to the representative dot plots
shown, which indicates the percentage of Th17 cells (CD4
+
IL‐17
+
).
(b) According to the flow cytometric results, the frequency of Th17
cells was considerably upregulated in 2019‐nCoV infected patients in
comparison with healthy subjects (p< .0001). (c) In comparison to
healthy controls, significant elevation was found in the expression
level of RORɣt in 2019‐nCoV patients based on Real‐time PCR
findings (p= .0001). Patients group, n= 40; control group, n= 40.
Results were presented as mean ± SD;p< .05 was described as
statistically significant. Th, T helper; ROR, RAR‐related orphan
receptors; 2019‐nCoV; 2019‐novel coronavirus
SADEGHI ET AL.
|
5
immunopathogenesis is required (Tahmasebi et al., 2020;Y.‐C. Wu,
Chen, et al., 2020). Inflammation caused by COVID‐19 elicits a range
of disorders from a mild cold‐like infection to severe ARDS and da-
mage to other organs, including the liver, kidneys (Taghizadieh,
Mikaeili, Ahmadi, & Valizadeh, 2020), nervous system, and gastro-
intestinal tract. Human‐to‐human transmission of the virus from in-
fected patients or asymptomatic carriers causes the disease and is
characterized by serious symptoms such as fever, cough, shortness of
breath, and severe pneumonia, which mostly lead to death in patients
(Abdulamir & Hafidh, 2020; Riou & Althaus, 2020). It is important to
note that the risk of disease development and severe infection is
greater in older individuals and people with underlying diseases such
as hypertension, cardiovascular diseases, diabetes, autoimmunities,
immunodeficiencies, cancers, and viral infections (Q. Li, Guan, et al.,
2020; Stebbing et al., 2020).
ARDS caused by inflammatory responses led to the respiratory
dysfunction in 2019‐nCov disease. This is justified by the fact
that viral immunopathogenesis is initiated by the penetration of
SARS‐CoV2 into the alveolar epithelium of the lungs, which express
the virus receptor, termed as Angiotensin‐converting enzyme 2
(ACE2). Thereafter, it can result in viral infection in the lungs and
other organs by entering the bloodstream. Following the entry of the
virus and its binding to the receptor, innate, and adaptive immune
responses are induced to defend against the infection. By the im-
mune system activation, antiviral responses are generated through
the immune cells and their produced inflammatory factors (G. Li, Fan,
et al., 2020; X. Li, Geng, Peng, Meng, & Lu, 2020).
As cytotoxic T cell (CTLs) and T helper (Th) cells, particularly Th1
and Th17 cells are the main defense against intracellular infections
like viral infections, so in COVID‐19, CTLs and Th1/17 cells strongly
fight the virus by secreting the perforin/granzyme and inflammatory
cytokines, respectively. Th cells also induce the activation of B cells,
macrophages, and neutrophils against the virus by secretingcytokines
(Liu, Du, et al., 2020;Tay,Poh,Rénia,MacAry,&Ng,2020). In the
course of the disease, inflammatory cytokines (IL‐1β,IL‐6, IL‐8, IL‐17,
G‐CSF, GM‐CSF, TNF‐α,IFN‐γ,IP‐10, and MCP‐1) are produced due to
the imbalance of the immune system, uncontrolled immune responses,
reduction of T regs and upregulation of inflammatory Th1 and Th17
cells. These inflammatory cytokines elicit the cytokine storm or cy-
tokine release syndrome (CRS), which results in severe inflammation
and respiratory system injury in infected patients (Huang et al., 2020;
Mehta et al., 2020). In most autoimmune and inflammatory diseases,
the disturbance balance of the Th17/Treg cells, the predominance of
the inflammatory responses of Th1 and Th17 cells, and the dysfunc-
tion of the regulatory T cells are the reasons for disease progression
(Dolati et al., 2018; Severson & Hafler, 2010).
FIGURE 2 Frequency of Treg cells and FoxP3 expression in COVID‐19 patients and healthy subjects. (a) The enumeration of the Treg cell
population was performed based on the representative dot plots shown, which demonstrates the percentage of Treg cells
(CD4
+
CD25
+
CD127
−
). (b) Flow cytometric findings indicated the meaningful reduction of Treg frequency in patients compared with controls
(p< .0001). (c) According to real‐time PCR analysis, a remarkable smaller expression level of the FoxP3 transcription factor was detected in
COVID‐19 patients compared with controls (p< .0001). Patients group, n= 40; control group, n= 40. Results were presented as mean ± SD;
p< .05 was described as statistically significant. COVID‐19, coronaviruses disease‐2019; FoxP3, forkhead box P3; Treg, regulatory T
6
|
SADEGHI ET AL.
Accordingly, the current study was aimed to investigate the al-
terations of the Th17 and Treg cells and their relevant factors, in-
cluding transcription factors (RORγt and Foxp3) and the main
cytokines (IL‐17, IL‐23, IL‐10, and TGF‐β) in 40 COVID‐19 patients
and 40 healthy controls. Also, to investigate the effect of in-
flammatory responses in pathogenesis and disease progression, we
compared the expression ratios of Th17/Treg cells, IL‐17/IL‐10
cytokines, and RORγt/FoxP3 transcription factors between
SARS‐CoV2 infected patients and healthy subjects and also between
two groups of dead and improved COVID‐19 patients. As mentioned,
Th17 and Treg cells are among the most important cells known in
COVID‐19 patients. The role of Th17 cells is well known in in-
flammatory and autoimmune diseases (Harrington et al., 2005). In
this regard, to examine the inflammatory responses of Th17 cells in
SARS‐CoV2 patients, the frequency of these cells was assessed by
flow cytometry. Based on the results, we observed that the number
of Th17 cells was noticeably higher in novel coronavirus infected
patients than in the healthy control group. Due to the importance of
the RORγt transcription factor and Th17 cell‐related cytokines (IL‐17
and IL‐23) that differentiate and mediate the inflammatory re-
sponses, respectively (Eghbal‐Fard et al., 2019), the gene expression
and protein secretion levels of the mentioned factors were evaluated
by Real‐time PCR and ELISA techniques, respectively. The findings
illustrated that the expression levels of RORγt, IL‐17, and IL‐23
factors were strongly enhanced in patients compared with healthy
individuals. Additionally, the secretion levels of IL‐17 and IL‐23 cy-
tokines were notably higher in patients. IL‐17 is introduced as an
inflammatory and multifocal cytokine that leads to inflammatory
responses, whereas, IL‐23 is a modulatory cytokine that has a role in
the differentiation and expansion of TH17 cells. Th17 cells are dif-
ferentiated from Th0 and expanded by RORγt, IL‐6, and IL‐23 fac-
tors. It can be suggested that Th17 cells can cause inflammatory
responses in SARS‐CoV2 patients by producing the pro‐inflammatory
cytokines (IL‐17 [A to F)] IL‐21, IL‐22, and IL‐26; Annunziato et al.,
2007), along with the inflammatory cytokines secreted by Th1 cells.
This inflammation leads to respiratory system injury and other organ
failures in the course of the disease.
Also, as mentioned previously, the T reg cells are reduced in
autoimmune and inflammatory diseases, which cause disease pro-
gression (Riou & Althaus, 2020). Therefore, the frequency of Treg
cells was also measured, and the results showed a momentous de-
crease in the number of Tregs in 2019‐nCoV patients compared with
controls. Accordingly, we designed the study to compare the al-
terations in Tregs and related factors (FoxP3, IL‐10, and TGF‐β)
between the patient and control groups, as well. The results showed
that the number of Tregs in patients was remarkably decreased
compared with controls. Besides this, a considerable reduction in the
expression levels of FoxP3 transcription factor and IL‐10 and TGF‐β
cytokines and also the secretion levels of the mentioned cytokines
were detected in COVID‐19 patients. Treg cells
(CD4+CD25+FoxP3+) are the immune system regulators that char-
acterized by expressing the CTLA4, CD95 (Fas), and TNFR family
proteins. Tregs inhibit the overactivation of T cells and maintain the
immune system balance, tolerance, and hemostasis during the au-
toimmune and inflammatory diseases (Pette et al., 1990). In this
context, FoxP3 as a transcription factor of Tregs is induced by TGF‐β,
which mediates the differentiation and development of Treg cells
from naive CD4+ T cells. IL‐10, TGF‐β, and IL‐35 are the main anti‐
inflammatory cytokines of Tregs that play principal roles in sup-
pressing the immune responses and inflammation (Kulkarni et al.,
1993; Lee, Severin, & Lovett‐Racke, 2017). Based on these data, in-
flammation can be considered as the main cause of disease patho-
genesis due to the high frequency of Th17 cells and their relevant
factors (RORγt, IL‐17, and IL‐23) as well as the low number of Tregs
and their factors (FoxP3, IL‐10, and TGF‐β), in 2019‐nCoV patients.
In this regard, some other studies support these findings. Accord-
ingly, in a study by Qin et al. (2020), different subsets of T cells were
examined in a cohort of 452 patients with laboratory‐confirmed
2019‐nCoV in Wuhan, China. The findings showed the increased
levels of naive Th cells and decreased levels of Tregs (mainly induced
Tregs), in severe COVID‐19 patients, which suggested the important
role of Th and Treg cells in disease progression and immune system
regulation, respectively. Furthermore, recent studies have high-
lighted that the enhanced migration of neutrophils and inflammatory
responses of Th17 cells play substantial roles in inflammation,
pneumonia, and edema in COVID‐19 patients; whereas, Tregs are
downregulated in the course of the disease (Hoe et al., 2017;Wu&
Yang, 2020). On the other hand, given that the IL‐17 cytokine can
FIGURE 3 The cytokine expression levels of Treg and Th17 cells
in COVID‐19 patients and controls. The gene expression analysis
revealed the considerable enhancement in the expression levels of
IL‐10 and TGF‐β, the anti‐inflammatory cytokines of Tregs, in
COVID‐19 patients compared with healthy subjects (p< .0001 and
p< .0001, respectively). In contrast, results showed that IL‐17 and
IL‐23, the inflammatory cytokines of Th17 cells, were significantly
downregulated in the patient groups than controls (p< .0001 and
p< .0001, respectively). Patients group, n= 40; control group, n= 40.
Results were presented as mean ± SD.p< .05 was described as
statistically significant. COVID‐19, coronaviruses disease‐
2019; FoxP3, forkhead box P3; IL, interleukin; ROR, RAR‐related
orphan receptors; TH, T helper; Treg, regulatory T
SADEGHI ET AL.
|
7
induce pulmonary eosinophilic and allergic responses, it can cause
inflammation in SARS‐CoV2 disease by recruiting the eosinophils
into the lungs (Al‐Ramli et al., 2009; Cheung, Wong, & Lam, 2008). In
another investigation conducted by Liu, Zhang, et al. (2020), it was
found that inflammatory cytokines, including IL‐2, 4, 7, 10, 12,
and 17, IFN‐γ, IFN‐α2, M‐CSF, G‐CSF, and IP‐10 were built up in
COVID‐19 ICU patients compared with non‐ICU cases, which were
associated with lung injury. Some of these cytokines, such as IL‐1β
and TNF‐α, induce the responses of Th17 and Th1 cells. Thereby, it
has been suggested that Th17 cells play a prominent role in the
FIGURE 4 The secretion levels of cytokines in serum samples and supernatant of cultured PBMCs in COVID‐19 patients and control
individuals. (a) The secretion levels of IL‐10 and TGF‐βin the serum sample of patients were noticeably lower than controls (p= .0005 and
p<.0001, respectively). (b) A significant downregulation was found in the secretion levels of IL‐10 and TGF‐βcytokines in PBMCs' supernatant
of patients than the control group (p= .0001 and p< .0001, respectively). (c) Both IL‐17 and IL‐23 inflammatory cytokines were greatly
increased in the serum samples of COVID‐19 patients compared with healthy subjects (p= .0012 and p= .0031, respectively). (d) In the patient
group, there was a remarkable elevation in the secretion levels of IL‐17 and IL‐23 cytokines in the supernatant of PBMCs compared with the
control group (p= .0001 and p= .0008, respectively). Patients group, n= 40; control group, n= 40. Results were presented as mean ± SD;p< .05
was described as statistically significant. COVID‐19, coronaviruses disease‐2019; IL, interleukin; PBMC, peripheral blood mononuclear cell;
TGF‐β, transforming growth factor‐β
FIGURE 5 The expression ratio of Th17/Treg cells and their related factors in COVID‐19 cases and healthy controls. (a) In comparison
between patients and controls, the expression ratio of IL‐17/IL‐10 cytokines and RORɣt /FoxP3 transcription factors were notably higher in
COVID‐19 patients (p< .0001 and p< .0001, respectively). (b) According to obtained results, the expression ratio of Th17/Treg cells was
increased in patients when compared with controls (p< .0001). Patients group, n= 40; control group, n= 40. Results were presented as
mean ± SD.p< .05 was described as statistically significant. COVID‐19; coronaviruses disease‐2019; FoxP3, forkhead box P3; IL, interleukin;
ROR, RAR‐related orphan receptors; Th, T helper; Treg, regulatory T
8
|
SADEGHI ET AL.
disease inflammation by producing the IL‐17, IL‐21, IL‐22, and GM‐
CSF cytokines.
Moreover, Xu et al. (2020) documented the elevated levels of
CCR6+ Th17 cells in SARS‐CoV2 patients with severe conditions,
which were involved in cytokine storm and inflammation, further
supporting our findings. In another investigation, Huang et al. found
that the intensive‐care COVID‐19 patients had boosted in-
flammatory cytokine levels like IL‐17 compared with non‐intensive‐
care patients. Therefore, the hypothesis was suggested that cytokine
inhibition could reduce inflammation, improve the patient outcomes,
and reduce the mortality rate (Antalis et al., 2019; Huang et al., 2020;
Ma, Yao, Peng, & Chen, 2019). Furthermore, the results of studies on
SARS and MERS coronaviruses evidenced the raised levels of Th17
cells and IL‐17‐related pathways in the mentioned diseases that had
inflammatory roles in disease progression (Faure et al., 2014; Josset
et al., 2013). Also, higher levels of IL‐17 cytokine and decreased
levels of IFN‐γand IFN‐αcytokines have been reported, as in-
flammatory responses in MERS‐CoV patients (Faure et al., 2014).
Some related studies have shown a close correlation between the
severity of the MERS‐CoV, SARS‐CoV, and SARS‐CoV2 diseases and
the grown levels of Th17 cells and their relevant cytokines, including
IL‐1, IL‐6, IL‐15, IL‐17, IFN‐γ, and TNF‐α(Liu, 2019; Mahallawi,
Khabour, Zhang, Makhdoum, & Suliman, 2018).
In conclusion, based on the results of our study, as well as
supporting studies on MERS‐CoV, SARS‐CoV, and SARS‐CoV2, it can
be suggested that the elevated levels of Th17 cells and their asso-
ciated factors (RORγt, IL‐17, and IL‐23), the decreased frequency of
Treg cells and their relevant factors (FoxP3, TGF‐β, and IL‐10), and
imbalanced ratios of Th17/Treg cells may play a critical role in in-
creasing the inflammatory responses and the disease pathogenesis in
COVID‐19 patients. Accordingly, among these responses, an im-
paired respiratory system can be strongly related to the hyperin-
flammation, eosinophilic responses, allergic disorders, and CRS
derived from the function of Th17 cells.
ACKNOWLEDGMENTS
This study was supported by the Tuberculosis and Lung Disease
Research Center of Tabriz University of Medical Sciences, Tabriz,
Iran (Grant Number: 65235).
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
AUTHOR CONTRIBUTIONS
Conceptualization, patient selection, writing—original draft: Armin
Sadeghi. Conceptualization, writing—original draft: Safa Tahmasebi.
Revised article and final edition: Arshad Mahmood and Maria
Kuznetsova. Conceptualization, introducing, and selecting patients: Leili
Aghebati‐Maleki and Hamed Valizadeh. Conceptualization, data cura-
tion: Ali Taghizadieh.Conceptualization, data curation: Masoud
Nazemiye. Formal analysis: Farhad Jadidi‐Niaragh. Investigation: Sanaz
Abbaspour‐Aghdam. Investigation: Leila Roshangar. Supervision,
Validation, review & editing: Haleh Mikaeili. Supervision, validation, re-
view and editing: Majid Ahmadi.
DATA AVAILABILITY STATEMENT
Data supporting the findings in this study are immediately available
upon reasonable request.
ORCID
Leila Roshangar http://orcid.org/0000-0001-5329-0951
Majid Ahmadi http://orcid.org/0000-0001-9845-9140
REFERENCES
Abdulamir, A. S., & Hafidh, R. R. (2020). The possible immunological
pathways for the variable immunopathogenesis of COVID‐19
infections among healthy adults, elderly and children. Electronic
Journal of General Medicine,17(4), 1–4.
Ahmadi, M., Abdolmohammadi‐Vahid, S., Ghaebi, M., Aghebati‐Maleki, L.,
Dolati, S., Farzadi, L., …Yousefi, M. (2017). Regulatory T cells
FIGURE 6 The expression ratio of Th17/Treg cells and their related factors in COVID‐19 improved and dead patients. (a) A significant
increase in the expression ratios of both IL‐17/IL‐10 cytokines and RORɣt/FoxP3 transcription factors were detected in COVID‐19 dead
patients compared with the improved cases (p= .017 and p= .028, respectively). (b) The COVID‐19 dead patients have a considerably higher
ratio of Th17/Treg cells than improved patients (p= .023). Patients group, n= 40; control group, n= 40. Results were presented as mean ± SD.
p< .05 was described as statistically significant. COVID‐19, coronaviruses disease‐2019; FoxP3, forkhead box P3; IL, interleukin;
ROR, RAR‐related orphan receptors; TH, T helper; Treg, regulatory T
SADEGHI ET AL.
|
9
improve pregnancy rate in RIF patients after additional IVIG
treatment. Systems Biology in Reproductive Medicine,63(6), 350–359.
Al‐Ramli, W., Préfontaine, D., Chouiali, F., Martin, J. G., Olivenstein, R.,
Lemière, C., & Hamid, Q. (2009). TH17‐associated cytokines (IL‐17A
and IL‐17F) in severe asthma. Journal of Allergy and Clinical
Immunology,123(5), 1185–1187.
Annunziato, F., Cosmi, L., Santarlasci, V., Maggi, L., Liotta, F., Mazzinghi, B.,
…Frosali, F. (2007). Phenotypic and functional features of human
Th17 cells. Journal of Experimental Medicine,204(8), 1849–1861.
Antalis, E., Spathis, A., Kottaridi, C., Kossyvakis, A., Pastellas, K.,
Tsakalos, K., …Tsiodras, S. (2019). Th17 serum cytokines in relation
to laboratory‐confirmed respiratory viral infection: A pilot study.
Journal of Medical Virology,91(6), 963–971.
Braitch, M., Harikrishnan, S., Robins, R., Nichols, C., Fahey, A., Showe, L., &
Constantinescu, C. (2009). Glucocorticoids increase CD4+
CD25high cell percentage and Foxp3 expression in patients with
multiple sclerosis. Acta Neurologica Scandinavica,119(4), 239–245.
Cheung, P. F., Wong, C. K., & Lam, C. W. (2008). Molecular mechanisms
of cytokine and chemokine release from eosinophils activated by
IL‐17A, IL‐17F, and IL‐23: Implication for Th17 lymphocytes‐
mediated allergic inflammation. The Journal of Immunology,180(8),
5625–5635.
Dolati, S., Ahmadi, M., Rikhtegar, R., Babaloo, Z., Ayromlou, H.,
Aghebati‐Maleki, L., …Yousefi, M. (2018). Changes in Th17 cells
function after nanocurcumin use to treat multiple sclerosis.
International Immunopharmacology,61,74–81.
Eghbal‐Fard, S., Yousefi, M., Heydarlou, H., Ahmadi, M., Taghavi, S.,
Movasaghpour, A., …Aghebati‐Maleki, L. (2019). The imbalance of
Th17/Treg axis involved in the pathogenesis of preeclampsia.
Journal of Cellular Physiology,234(4), 5106–5116.
Faure, E., Poissy, J., Goffard, A., Fournier, C., Kipnis, E., Titecat, M., …
Dessein, R. (2014). Distinct immune response in two MERS‐CoV‐
infected patients: Can we go from bench to bedside? PLOS One,9(2),
e88716.
Ghaebi, M., Osali, A., Valizadeh, H., Roshangar, L., & Ahmadi, M. (2020).
Vaccine development and therapeutic design for 2019‐nCoV/SARS‐
CoV‐2: Challenges and chances. Journal of Cellular Physiology.
https://doi.org/10.1002/jcp.29771
Harrington, L. E., Hatton, R. D., Mangan, P. R., Turner, H., Murphy, T. L.,
Murphy, K. M., & Weaver, C. T. (2005). Interleukin 17–producing
CD4+ effector T cells develop via a lineage distinct from the T
helper type 1 and 2 lineages. Nature Immunology,6(11), 1123–1132.
Hoe, E., Anderson, J., Nathanielsz, J., Toh, Z. Q., Marimla, R., Balloch, A., &
Licciardi, P. V. (2017). The contrasting roles of Th17 immunity in
human health and disease. Microbiology and Immunology,61(2),
49–56.
Huang, C., Wang, Y., Li, X., Ren, L., Zhao, J., Hu, Y., …Gu, X. (2020). Clinical
features of patients infected with 2019 novel coronavirus in Wuhan,
China. The Lancet,395(10223), 497–506.
Jose, R. J., & Manuel, A. (2020). COVID‐19 cytokine storm: The interplay
between inflammation and coagulation. The Lancet Respiratory
Medicine,8, e46–e47.
Josset, L., Menachery, V. D., Gralinski, L. E., Agnihothram, S., Sova, P.,
Carter, V. S., …Katze, M. G. (2013). Cell host response to infection
with novel human coronavirus EMC predicts potential antivirals and
important differences with SARS coronavirus. mBio,4(3),
e00165–00113.
Kulkarni, A. B., Huh, C.‐G., Becker, D., Geiser, A., Lyght, M., Flanders, K. C.,
…Karlsson, S. (1993). Transforming growth factor beta 1 null
mutation in mice causes excessive inflammatory response and early
death. Proceedings of the National Academy of Sciences,90(2),
770–774.
Lee, P. W., Severin, M. E., & Lovett‐Racke, A. E. (2017). TGF‐βregulation
of encephalitogenic and regulatory T cells in multiple sclerosis.
European Journal of Immunology,47(3), 446–453.
Li, G., Fan, Y., Lai, Y., Han, T., Li, Z., Zhou, P., …Liu, X. (2020). Coronavirus
infections and immune responses. Journal of Medical Virology,92(4),
424–432.
Li, Q., Guan, X., Wu, P., Wang, X., Zhou, L., Tong, Y., …Wong, J. Y. (2020).
Early transmission dynamics in Wuhan, China, of novel
coronavirus–infected pneumonia. New England Journal of Medicine,
382, 1199–1207.
Li, X., Geng, M., Peng, Y., Meng, L., & Lu, S. (2020). Molecular immune
pathogenesis and diagnosis of COVID‐19. Journal of Pharmaceutical
Analysis,10, 102–108.
Lin, L., Lu, L., Cao, W., & Li, T. (2020). Hypothesis for potential
pathogenesis of SARS‐CoV‐2 infection–A review of immune
changes in patients with viral pneumonia. Emerging Microbes &
Infections,9(1), 727–732.
Liu, Y. (2019). Novel coronavirus (2019‐nCoV) infections trigger an ex-
aggerated cytokine response aggravating lung injury.
Liu, Y., Du, X., Chen, J., Jin, Y., Peng, L., Wang, H. H., …Zhao, Y. (2020).
Neutrophil‐to‐lymphocyte ratio as an independent risk factor for
mortality in hospitalized patients with COVID‐19. Journal of
Infection,81,e6–e12.
Liu, Y., Zhang, C., Huang, F., Yang, Y., Wang, F., Yuan, J., …Zhao, D. (2020).
Elevated plasma level of selective cytokines in COVID‐19 patients
reflect viral load and lung injury. National Science Review,7, 1003–1011.
Lu, R., Zhao, X., Li, J., Niu, P., Yang, B., Wu, H., …Zhu, N. (2020). Genomic
characterisation and epidemiology of 2019 novel coronavirus:
Implications for virus origins and receptor binding. The Lancet,
395(10224), 565–574.
Ma, W. T., Yao, X. T., Peng, Q., & Chen, D. K. (2019). The protective and
pathogenic roles of IL‐17 in viral infections: friend or foe? Open
Biology,9(7), 190109.
Mahallawi, W. H., Khabour, O. F., Zhang, Q., Makhdoum, H. M., &
Suliman, B. A. (2018). MERS‐CoV infection in humans is associated
with a pro‐inflammatory Th1 and Th17 cytokine profile. Cytokine,
104,8–13.
Mehta, P., McAuley, D. F., Brown, M., Sanchez, E., Tattersall, R. S., &
Manson, J. J. (2020). COVID‐19: Consider cytokine storm syndromes
and immunosuppression. The Lancet,395(10229), 1033–1034.
Pette, M., Fujita, K., Kitze, B., Whitaker, J., Albert, E., Kappos, L., &
Wekerle, H. (1990). Myelin basic protein‐specific T lymphocyte lines
from MS patients and healthy individuals. Neurology,40(11), 1770.
Prompetchara, E., Ketloy, C., & Palaga, T. (2020). Immune responses in
COVID‐19 and potential vaccines: Lessons learned from SARS and
MERS epidemic. Asian Pacific Journal of Allergy and Immunology,
38(1), 1–9.
Qin, C., Zhou, L., Hu, Z., Zhang, S., Yang, S., Tao, Y., …Wang, W. (2020).
Dysregulation of immune response in patients with COVID‐19 in
Wuhan, China. Clinical Infectious Diseases.
Riou, J., & Althaus, C. L. (2020). Pattern of early human‐to‐human
transmission of Wuhan 2019 novel coronavirus (2019‐nCoV),
December 2019 to January 2020. Eurosurveillance,25(4), 2000058.
Severson, C., & Hafler, D. A. (2010). T‐cells in multiple sclerosis. Results
and Problems in Cell Differentiation,51,75–98.
Shi, Y., Tan, M., Chen, X., Liu, Y., Huang, J., Ou, J., & Deng, X. (2020).
Immunopathological characteristics of coronavirus disease 2019
cases in Guangzhou. China. medRxiv.
Stebbing, J., Phelan, A., Griffin, I., Tucker, C., Oechsle, O., Smith, D., &
Richardson, P. (2020). COVID‐19: Combining antiviral and anti‐
inflammatory treatments. The Lancet Infectious Diseases,20(4),
400–402.
Taghizadieh, A., Mikaeili, H., Ahmadi, M., & Valizadeh, H. (2020). Acute
kidney injury in pregnant women following SARS‐CoV‐2 infection: A
case report from Iran. Respiratory Medicine Case Reports,30, 101090.
Tahmasebi, S., Khosh, E., & Esmaeilzadeh, A. (2020). The outlook for
diagnostic purposes of the 2019‐novel coronavirus disease. Journal
of Cellular Physiology.1–19. Advance online publication.
10
|
SADEGHI ET AL.
Tay, M. Z., Poh, C. M., Rénia, L., MacAry, P. A., & Ng, L. F. (2020). The
trinity of COVID‐19: Immunity, inflammation and intervention.
Nature Reviews Immunology,20(6), 363–374.
Wan, S., Yi, Q., Fan, S., Lv, J., Zhang, X., Guo, L., …Yi, Z. (2020).
Characteristics of lymphocyte subsets and cytokines in peripheral
blood of 123 hospitalized patients with 2019 novel coronavirus
pneumonia (NCP). MedRxiv.
Wu, D., & Yang, X. O. (2020). TH17 responses in cytokine storm of
COVID‐19: An emerging The outlook for diagnostic purposes of
thetarget of JAK2 inhibitor Fedratinib. Journal of Microbiology,
Immunology and Infection,53, 368–370.
Wu, F., Zhao, S., Yu, B., Chen, Y.‐M., Wang, W., Song, Z.‐G., …Pei, Y.‐Y.
(2020). A new coronavirus associated with human respiratory
disease in China. Nature,579(7798), 265–269.
Wu, Y.‐C., Chen, C.‐S., & Chan, Y.‐J. (2020). The outbreak of COVID‐19:
An overview. Journal of the Chinese Medical Association,83(3),
217–220.
Xu, Z., Shi, L., Wang, Y., Zhang, J., Huang, L., Zhang, C., …Wang, F. S.
(2020). Pathological findings of COVID‐19 associated with acute
respiratory distress syndrome. The Lancet,8(4), 420–422.
Yin, Y., & Wunderink, R. G. (2018). MERS, SARS and other coronaviruses
as causes of pneumonia. Respirology,23(2), 130–137.
Zhou, P., Yang, X.‐L., Wang, X.‐G., Hu, B., Zhang, L., Zhang, W., …Huang,
C.‐L. (2020). A pneumonia outbreak associated with a new
coronavirus of probable bat origin. Nature,579(7798), 270–273.
How to cite this article: Sadeghi A, Tahmasebi S, Mahmood A,
et al. Th17 and Treg cells function in SARS‐CoV2 patients
compared with healthy controls. J Cell Physiol. 2020;1–11.
https://doi.org/10.1002/jcp.30047
SADEGHI ET AL.
|
11
