Content uploaded by Linus Shao
Author content
All content in this area was uploaded by Linus Shao on Oct 31, 2021
Content may be subject to copyright.
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Printed in Great Britain
Published by Bioscientifica Ltd.
Journal of
Endocrinology
246:3 247–263
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
-20-0155
RESEARCH
Hyperandrogenism and insulin resistance
modulate gravid uterine and placental
ferroptosis in PCOS-like rats
YuehuiZhang1,*, MinHu2,3,*, WenyanJia1, GuoqiLiu1, JiaoZhang4, BingWang1, JuanLi2,3, PengCui2,5, XinLi2,6,7,
SusanneLager8, AmandaNancySferruzzi-Perri9, YanhuaHan1, SongjiangLiu1, XiaokeWu1, MatsBrännström10,
LinusRShao2 and HåkanBillig2
1Department of Obstetrics and Gynecology, Key Laboratory and Unit of Infertility in Chinese Medicine, First Aliated Hospital, Heilongjiang University of
Chinese Medicine, Harbin, China
2Department of Physiology/Endocrinology, Institute of Neuroscience and Physiology, The Sahlgrenska Academy, University of Gothenburg,
Gothenburg, Sweden
3Department of Traditional Chinese Medicine, The First Aliated Hospital of Guangzhou Medical University, Guangzhou, China
4Department of Acupuncture and Moxibustion, Second Aliated Hospital, Heilongjiang University of Chinese Medicine, Harbin, China
5Department of Gynecology, Shuguang Hospital aliated to Shanghai University of Traditional Chinese Medicine, Shanghai, China
6Department of Gynecology, Obstetrics and Gynecology Hospital of Fudan University, Shanghai, China
7Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, Shanghai, China
8Department of Women’s and Children’s Health, Uppsala University, Uppsala, Sweden
9Centre for Trophoblast Research, Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK
10Department of Obstetrics and Gynecology, Sahlgrenska University Hospital, Sahlgrenska Academy, University of Gothenburg, Gothenburg, Sweden
Correspondence should be addressed to L R Shao: ruijin.shao@fysiologi.gu.se
*(Y Zhang and M Hu contributed equally to this work)
Abstract
Women with polycystic ovary syndrome (PCOS) have hyperandrogenism and insulin
resistance and a high risk of miscarriage during pregnancy. Similarly, in rats, maternal
exposure to 5α-dihydrotestosterone (DHT) and insulin from gestational day 7.5 to
13.5 leads to hyperandrogenism and insulin resistance and subsequently increased
fetal loss. A variety of hormonal and metabolic stimuli are able to trigger dierent
types of regulated cell death under physiological and pathological conditions. These
include ferroptosis, apoptosis and necroptosis. We hypothesized that, in rats, maternal
hyperandrogenism and insulin-resistance-induced fetal loss is mediated, at least in
part, by changes in the ferroptosis, apoptosis and necroptosis pathways in the gravid
uterus and placenta. Compared with controls, we found that co-exposure to DHT and
insulin led to decreased levels of glutathione peroxidase 4 (GPX4) and glutathione,
increased glutathione + glutathione disulde and malondialdehyde, aberrant expression
of ferroptosis-associated genes (Acsl4, Tfrc, Slc7a11, and Gclc), increased iron deposition
and activated ERK/p38/JNK phosphorylation in the gravid uterus. In addition, we
observed shrunken mitochondria with electron-dense cristae, which are key features of
ferroptosis-related mitochondrial morphology, as well as increased expression of Dpp4,
a mitochondria-encoded gene responsible for ferroptosis induction in the uteri of rats
co-exposed to DHT and insulin. However, in the placenta, DHT and insulin exposure only
partially altered the expression of ferroptosis-related markers (e.g. region-dependent
GPX4, glutathione + glutathione disulde, malondialdehyde, Gls2 and Slc7a11 mRNAs,
3
Key Words
fferroptosis
fmitochondria
fgravid uterus
fplacenta
fPCOS
246
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
248
Uterine and placental
ferroptosis in PCOS
Y Zhang, M Hu etal. 246:3
Journal of
Endocrinology
and phosphorylated p38 levels). Moreover, we found decreased expression of Dpp4
mRNA and increased expression of Cisd1 mRNA in placentas of rats co-exposed to DHT
and insulin. Further, DHT + insulin-exposed pregnant rats exhibited decreased apoptosis
in the uterus and increased necroptosis in the placenta. Our ndings suggest that
maternal hyperandrogenism and insulin resistance causes the activation of ferroptosis
in the gravid uterus and placenta, although this is mediated via dierent mechanisms
operating at the molecular and cellular levels. Our data also suggest that apoptosis and
necroptosis may play a role in coordinating or compensating for hyperandrogenism
and insulin-resistance-induced ferroptosis when the gravid uterus and placenta are
dysfunctional.
Introduction
Polycystic ovary syndrome (PCOS) is a complex and
heterogeneous hormone-imbalance gynecological
disorder that is influenced by genetic, environmental,
and metabolic factors (Azziz et al. 2016). This disorder
affects approximately 4–21% of all adolescent and
reproductive-aged women and has a significant impact
on their reproduction (Liznevaetal. 2016). Women with
PCOS often suffer from hyperandrogenism/androgen
excess and insulin resistance (collectively termed; HAIR),
and they are at high risk for miscarriage and obstetric
complications during pregnancy (Bahri Khomami et al.
2019). Therapeutic interventions for different phenotypes
and disease-related pregnancy complications in women
with PCOS present a significant unmet medical need
(Rosenfield & Ehrmann 2016). Although it is thought that
maternal, placental and fetal defects all contribute to the
onset and progression of miscarriage in PCOS patients,
the pathogenesis of the pregnancy loss induced by HAIR
and its precise regulatory mechanisms are still significant
issues to be solved.
Ferroptosis is a recently described, iron-dependent
form of regulated necrosis induced by oxidative stress
and it is distinct from other established forms of cell
death, such as apoptosis and necroptosis (Choi et al.
2019), due to its unique morphological and biochemical
features (Dixon et al. 2012, Tang et al. 2019). Growing
evidence indicates that excessive or impaired ferroptosis
plays a causative role in a variety of pathological
conditions and diseases (Stockwell et al. 2017). It
appears that the outcome of ferroptosis is programmed
cell death, but which specific physiological processes or
pathological conditions and disorders lead to ferroptosis
activation remain poorly explored. The major molecular
mechanisms and signaling pathways that are involved in
the regulation of ferroptosis have been demonstrated in
in vivo and in vitro studies (Li et al. 2020). For example,
suppression of glutathione biosynthesis and subsequent
inhibition or degradation of glutathione peroxidase
4 (GPX4) activity, disturbed balance of iron homeostasis
and activation of the mitogen-activated protein kinase
(MAPK) signaling pathways all contribute to the initiation
and execution of ferroptosis (Xieetal. 2016). In addition
to ferroptosis, the alterations of apoptosis and necroptosis-
mediated signaling pathways have also been proposed as
the critical etiological factors of several human diseases
(Gudipatyetal. 2018). However, little is known about the
role of ferroptosis (Ng et al. 2019) in comparison with
other forms of programmed cell death such as apoptosis
(Spenceretal. 1996) in female reproduction.
Using rats, we have recently demonstrated that HAIR-
induced fetal loss is associated with uterine and placental
defects (Huetal. 2019b, Zhangetal. 2019b). In particular,
we exposed pregnant rats to 5α-dihydrotestosterone
(DHT) and insulin (INS) from gestational day (GD) 7.5
to 13.5 and found that this triggered many features of
PCOS (including HAIR) and lead to fetal loss. The fetal
loss was related to disrupted reactive oxygen species (ROS)
production in the uterus and placenta of rat dams with
induced HAIR. Maternal HAIR-induced fetal loss was
also associated with the inactivation of antioxidative
proteins in the gravid uterus and placenta, namely
nuclear factor erythroid 2-related factor 2 (Nrf2) and
superoxide dismutase 1 (Hu et al. 2019b, Zhang et al.
2019b), which play an inhibitory role in the ferroptosis
pathway (Xieetal. 2016, Tangetal. 2019). Moreover, the
mRNA expression of several other negative regulators of
ferroptosis such as heme oxygenase 1 (Ho1) (Tanget al.
2019) and metallothionein 1G (Mt1g) (Sun et al. 2016)
were downregulated in the gravid uterus after combined
maternal exposure to DHT and INS (Hu et al. 2019b).
Journal of Endocrinology
(2020) 246, 247–263
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
249
Research
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
246:3
Journal of
Endocrinology
Increased circulating ROS levels have been observed in
both non-pregnant and pregnant rodents in which PCOS
features have been induced (Laietal. 2018, Zhang et al.
2019b). Elevated ROS production and decreased anti-
oxidative capacity has been observed in the ovarian
granulosa cells and leukocytes of PCOS patients
(Banulset al. 2017, Laiet al. 2018), and oxidative stress
is proposed to contribute to miscarriage and infertility
in women with PCOS (Agarwalet al. 2012, Schootsetal.
2018). It is, therefore, likely that the promotion of
pathologic oxidative stress and activation of ferroptosis
in the gravid uterus and placenta contribute to HAIR-
induced fetal loss in both animal models and humans.
Mitochondria play a protective role in the regulation
of glutathione-induced ferroptosis (Gao et al. 2019). In
women with PCOS and miscarriage, as well as in pregnant
PCOS-like rodents with fetal loss, there is mounting
evidence for mitochondrial abnormalities and oxidative
damage. For instance, decreased mitochondrial DNA copy
number is associated with the development and severity
of PCOS and several mitochondria-tRNA mutations are
seen in PCOS patients (Agarwalet al. 2012, Zhangetal.
2019a). In addition, aberrant expression of mitochondrial
biogenesis genes, oxidative phosphorylation and
anti-oxidative proteins are found in PCOS patients
who have recurrent miscarriage (Agarwal et al. 2012,
Zhang et al. 2019a), as well as in PCOS-like rodents
(Dingetal. 2019, Huetal. 2019a,b, Zhangetal. 2019b).
On the basis of these preclinical and clinical studies, we
hypothesized that maternal HAIR triggers impairments in
GPX4/glutathione-regulated lipid peroxidation and iron-
associated and mitochondria-mediated ferroptosis in the
gravid uterus and placenta resulting in increased fetal loss
during pregnancy.
The aim of this study was to determine whether
exposure to DHT and INS in pregnant rats (which
induces HAIR/PCOS (Huetal. 2019b, Zhangetal. 2019b))
leads to activation of the ferroptosis cascade, elevated
malondialdehyde (MDA, a marker of oxidative stress),
iron accumulation and perturbed mitochondrial function
in the uterus and placenta. Further, we conducted a
parallel analysis of the expression of genes and proteins
that are involved in necroptosis and apoptosis, two other
programmed cell death pathways that might contribute
to defects in the gravid uterus and the placenta. This
study is the first to report an association between HAIR
and different forms of regulated cell death in the gravid
uterus and placenta in vivo. Our findings indicate that
ferroptosis is one of the potential mechanisms by which
maternal HAIR leads to uterine and placental dysfunction
and at least partially explains the resultant fetal
loss observed.
Materials and methods
Ethics approval
All experiments were conducted in compliance with all
relevant local ethical regulations. Animal experiments
were approved and authorized by the Animal Care and
Use Committee of the Heilongjiang University of Chinese
Medicine, China (HUCM 2015-0112), and followed the
National Institutes of Health guidelines on the care and
use of laboratory animals.
Animals, experimental setting and tissue collection
Adult Sprague–Dawley female (n = 39) and male (n = 21)
rats were obtained from the Laboratory Animal Centre
of Harbin Medical University, Harbin, China. All animals
were health checked daily throughout the experiment and
were maintained in an environmentally controlled and
pathogen-free barrier facility on a standard 12 h light:12 h
darkness cycle at 22 ± 2 °C and 55–65% humidity and with
free access to normal diet and water. Before the experiment,
female rats (n = 9/group) were allowed to acclimatize for a
minimum of 7 days and then were monitored daily by
vaginal lavage to determine the stage of the estrous cycle
(Zhangetal. 2016). Pregnancy was achieved by housing
female rats on the night of proestrus with fertile males
of the same strain at a 2:1 ratio. Confirmation of mating
was defined by the presence of a vaginal plug and this
was considered as GD 0.5. Body weight of the rats was
recorded daily and rats were killed between 08:00 and
09:00 h on GD 14.5. All animal procedures in this study
were performed as described in our previous publications
(Huetal. 2019b, Zhangetal. 2019b).
To induce HAIR, pregnant rats were randomly
assigned to be intraperitoneally injected with DHT (1.66
mg/kg/day, suspended in sesame oil, Sigma-Aldrich)
and/or human recombinant INS (6.0 IU/day, diluted
in sterile saline, Eli Lilly Pharmaceuticals) or an equal
volume of saline and sesame oil as controls on GD 7.5
as previously described (Hu et al. 2019b, Zhang et al.
2019b). This therefore generated the following four study
groups: Control, DHT + INS, DHT, and INS. All animals
were treated for 7 consecutive days. The dose of DHT used
in our rats was chosen to mimic the hyperandrogenic
state in PCOS patients who have approximately
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
250
Uterine and placental
ferroptosis in PCOS
Y Zhang, M Hu etal. 246:3
Journal of
Endocrinology
1.7-fold higher circulating DHT concentrations compared
to healthy controls (Fassnacht et al. 2003, Silfen et al.
2003). The dose of INS was chosen because it induces
metabolic disturbances including peripheral and uterine
insulin resistance in rats (Zhang et al. 2016, 2018). We
have previously shown that rats co-exposed to DHT and
INS during pregnancy had metabolic and endocrine
aberrations (HAIR) at GD 14.5 (Huetal. 2019b, Zhangetal.
2019b) that replicate the changes observed in pregnant
PCOS patients (Sir-Petermannetal. 2002, Maliqueoetal.
2013, Glintborg et al. 2018). The current investigation
used gravid uterine and placental tissues collected from
the same rats exposed to DHT and/or INS used in our
previous study (Zhangetal. 2019b), in which circulating
levels of androgens (testosterone, androstenedione,
dehydroepiandrosterone, and DHT), glucose tolerance
and fasting insulin, as well as fetal viability (litter size
and fetal loss per litter) were reported. Briefly these data
showed that rats co-exposed to DHT and INS had increased
androgen levels (testosterone, androstenedione, and
DHT) and worse insulin sensitivity, as well as decreased
litter size, with a corresponding increase in the percentage
of litters showing fetal loss. In addition, there was no
effect of DHT and/or insulin on maternal body weight
gain (Supplementary Fig. 1, see section on supplementary
materials given at the end of this article). On GD 14.5,
tissues, including the maternal uterus and placenta, as
well as fetuses were dissected. These were then either fixed
for morphological and immunohistochemical analyses
or immediately frozen in liquid nitrogen and stored at
−70 °C for quantitative real-time PCR (qPCR) and Western
blot analyses. Only viable conceptuses (fetuses and
placentas) were analyzed further.
Detailed description of the methods including
the primers (Table 1) and qPCR analysis, Western blot
analysis, GPX4 immunostaining, Perls’ histochemical
reaction, transmission electron microscopy (TEM), and
quantification of glutathione, MDA and mitochondrial
open reading frame of the 12S rRNA-c (MOTS-c) used in
this study are provided in Supplementary files.
Data processing, statistical analysis, and graphical
representations
No statistical methods were used to pre-determine the
sample size. Data are presented as the means ± s.e.m., and
the sample size (n) is listed in the figure legends and
indicates the number of animals in each experiment.
Statistical analyses were performed using SPSS version
24.0 for Windows (SPSS Inc.). The normal distribution
of the data was tested with the Shapiro–Wilk test.
Differences between groups were analyzed by one-way
ANOVA followed by Tukey’s post-hoc test for normally
distributed data or the Kruskal–Wallis test for skewed data
(Supplementary Table 1). Body weight data were analyzed
by one-way ANOVA with repeated measures. Data were
not corrected for multiple testing. All P-values less than
0.05 were considered statistically significant.
Results
Because we were most interested in how HAIR induces
changes in ferroptosis as opposed to apoptosis and
necroptosis in gravid uterine and placental tissues, we have
mainly described the observations in DHT + INS-exposed
pregnant rats vs control pregnant rats subsequently.
Dierential regulation of GPX4 in the gravid uterus
and placenta exposed to DHT and INS
GPX4 is present in the cytoplasm, mitochondria and
nucleus of mammalian cells (Conrad et al. 2007).
Hence, we initially performed Western blot and
immunohistochemical analyses to characterize the
tissue and intracellular localization of GPX4 protein
in rat uterine and placental tissues. In the Western blot
analysis, the ~20-kDa band represents the cytosolic and
mitochondrial GPX4 protein in the rat testis, epididymis,
and ovary (Supplementary Fig. 2), as well as non-pregnant
and pregnant uteri (Supplementary Fig. 3A and Fig. 1A),
whereas the ~34-kDa band represents the nuclear GPX4
protein in the testis (Supplementary Fig. 2). Further
immunohistochemical studies showed that, while
positive immunostaining for cytosolic GPX4 was mainly
observed in luminal and glandular epithelial cells, GPX4
immunostaining was additionally localized to the nucleus
of stromal cells and myometrial smooth muscle cells in
non-pregnant rats (Supplementary Fig. 3B). In control
pregnant rats, GPX4 was localized to both the cytosol and
nucleus of different cells within the decidua, myometrium
and placenta (Fig. 1B1, B2, B3, and B4).
Although the significance of mitochondrial and
nuclear GPX4 remains to be determined (Forcina &
Dixon 2019), cytosolic GPX4 has been identified as a
central regulator of ferroptosis (Stockwelletal. 2017). We
thus evaluated GPX4 expression (Fig. 1A) and localization
(Fig. 1B, C, D, E, and F) in the gravid uterus and placenta
in rats exposed to DHT and INS. The Western blot
analysis revealed a significant decrease in uterine GPX4
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
251
Research
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
246:3
Journal of
Endocrinology
abundance in DHT + INS-exposed pregnant rats (Fig.
1A). Consistent with this, there appeared to be weaker
immunoreactivity of GPX4 in the cytosolic compartments
of decidualized stromal and smooth muscle cells in the
uterus of DHT + INS-exposed pregnant rats (Fig. 1C1
and C2). Although there was no significant difference
in uterine GPX4 abundance by Western blot analysis in
pregnant rats treated alone with DHT or INS (Fig. 1A),
the number of cytosolic and/or nuclear GPX4-positive
uterine cells was decreased when compared to controls
using immunostaining (Fig. 1D1, D2 and E2). Similarly,
while GPX4 protein abundance was unchanged in the
placenta of DHT + INS-exposed pregnant rats by Western
blot analysis (Fig. 1A), cytosolic GPX4 immunoreactivity
appeared to be lower in the junctional and labyrinth zones
in DHT + INS-exposed pregnant rats when examined by
immunohistochemistry (Fig. 1C3 and C4). In particular,
GPX4 immunostaining was no longer localized to the
nuclei of spongiotrophoblast, glycogen, cytotrophoblast
and syncytiotrophoblast cells of DHT + INS-exposed
Table 1 Primer sequences used for qPCR measurement.
Gene Primer sequence (5′-3′)Reference sequence Product size (bp)
Slc1a5 Forward TCGGGACCTCTTCTAGCTCT NM_175758.3 90
Reverse TGAACCGGCTGATGTGTTTG
Acsl4 Forward CTCCTGCTTTACCTACGGCT NM_053623.1 97
Reverse ACAATCACCCTTGCTTCCCT
Gls2 Forward GGCCAAGTCAAACCCAGATC NM_001270786.1 153
Reverse TAGTCGGTGCCTAAGGTGC
Cs Forward AGTGCCAGAAACTGCTACCT NM_130755.1 117
Reverse GTGAGAGCCAAGAGACCTGT
Gclc Forward AAGCCATAAACAAGCACCCC NM_012815.2 116
Reverse CGGAGATGGTGTGTTCTTGTC
Gss Forward ATGCCGTGGTGCTACTGATT NM_012962.1 107
Reverse TCTTCGGCGGATTACATGGA
Tfrc Forward AGGCTCCTGAGGGTTATGTG NM_022712.1 204
Reverse AGATGAGGACACCAATTGCA
Ireb2 Forward TGTTTGAAGAAGCCGACCTG NM_022863.2 97
Reverse ACTCCCCACCCAAGAATTCC
Slc7a11 Forward GTGCCCGGATCCAGATTTTC NM_001107673.2 270
Reverse TGATGGCCATAGAGATGCAGA
Cisd1 Forward GCTAAAGAGAGTCGCACCAAAG NM_001106385.2 113
Reverse CGGCAATACACGGCCTTATC
Dpp4 Forward GGCTGGTGCGGAAGATTTA NM_012789.1 135
Reverse GACCTGTTCGGGTTTCCTATC
Bcl2 Forward TTGCAGAGATGTCCAGTCAG NM_016993.1 125
Reverse GAACTCAAAGAAGGCCACAATC
Bcl-xl Forward GGTGGTTGACTTTCTCTCCTAC NM_031535.2 116
Reverse TCTCCCTTTCTGGTTCAGTTTC
Bax Forward GATGGCCTCCTTTCCTACTTC NM_017059.2 96
Reverse CTTCTTCCAGATGGTGAGTGAG
Bak Forward GATCGCCTCCAGCCTATTTAAG NM_053812.1 115
Reverse CAGGAAGCCAGTCAAACCA
Casp3 Forward GACTGGAAAGCCGAAACTCT NM_012922.2 97
Reverse TGCCATATCATCGTCAGTTCC
Mlkl Forward GGAACTGCTGGATAGAGACAAG XM_008772570.2 117
Reverse CTGATGTTTCCGTGGAGTGT
Ripk1 Forward CAGGTACAGGAGTTTGGTATGG NM_001107350.1 108
Reverse TGTATGGCATGGTGGGTATG
Ripk3 Forward ACTGAGAGGAGAGGAAAGGAAG NM_139342.1 107
Reverse CTGGAGGGTAGAGTATGTGGAA
Gapdh Forward TCTCTGCTCCTCCCTGTTCTA NM_017008.4 121
Reverse GGTAACCAGGCGTCCGATAC
Acsl4, acyl-CoA synthetase long-chain family member 4; Bak, bcl-2 homologous antagonist killer; Bax, bcl-2-like protein 4; Bcl2, b-cell lymphoma 2; Bcl-xl,
b-cell lymphoma-extra large; Casp3, caspase 3; Cisd1, CDGSH iron sulfur domain 1; Cs, citrate synthase; Dpp4, dipeptidylpeptidase 4; Gapdh,
glyceraldehyde-3-phosphate dehydrogenase; Gclc, glutamate-cysteine ligase catalytic subunit; Gls2, glutaminase 2; Gss, glutathione synthetase; Ireb2, iron
responsive element binding protein 2; Mlkl, mixed lineage kinase domain like pseudokinase; Ripk1, receptor interacting serine/threonine kinase 1; Slc1a5,
solute carrier family 1 member 5; Slc7a11, solute carrier family 7 member 11; Tfrc, transferrin receptor.
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
252
Uterine and placental
ferroptosis in PCOS
Y Zhang, M Hu etal. 246:3
Journal of
Endocrinology
pregnant rats compared to controls (Fig. 1C3 and
C4). While cytosolic GPX4 immunoreactivity was
decreased in both spongiotrophoblasts and glycogen
cells, nuclear GPX4 immunoreactivity was absent in
spongiotrophoblasts cells in pregnant rats treated with
DHT alone (Fig. 1D3) and INS alone (Fig. 1E3). Similar
to that of controls (Fig. 1B4), GPX4 immunoreactivity
was found in the placental labyrinth zone in pregnant
rat placentas exposed to DHT or INS alone (Fig. 1D4 and
F4). No obvious GPX4 immunostaining was evident in
the uterine and placental tissue sections using the same
concentration of isotype-matched rabbit IgG instead of
the primary GPX4 antibody (Fig. 1F1, F2, F3, and F4).
Dierential regulation of glutathione content in the
gravid uterus and placenta exposed to DHT and INS
GPX4 uses glutathione as a substrate in its peroxidase
reaction cycle (Conradetal. 2007) and glutathione depletion
is one of the key triggers for ferroptosis (Xieet al. 2016,
Stockwelletal. 2017). Therefore, we measured the levels of
glutathione and glutathione + glutathione disulfide in the
gravid uterus and placenta in rats exposed to DHT and INS.
As shown in Fig. 2A, co-exposure of rats to DHT and INS
decreased glutathione levels in the gravid uterus, but not
in the placenta, while increased glutathione + glutathione
disulfide levels were detected in both tissues.
Figure1
Regulation and localization of GPX4 protein in pregnant rats exposed to DHT and/or INS at GD 14.5. Western blot analysis of GPX4 protein expression in
the uterus and placenta (A, n = 9/group). In all plots, values are expressed as means ± s.e.m. Statistical P values for selected comparisons are indicated as
**P < 0.01. Histological analysis by GPX4 immunostaining in the gravid uterus (Mt and Md) and placenta (Jz and Lz) (B1–F4). A negative control was
performed by using the same concentration of isotype-matched rabbit IgG instead of the primary antibody. Only minimal cytoplasmic background
staining was observed (F, and F1–4). Tissue sections were counterstained with methyl green. Images are representative of 8−10 tissue replicates per
group. Mt, mesometrial triangle; SA, spiral artery; Md, mesometrial decidua; Jz, junctional zone (maternal side); Gc, glycogen cells; Sp, spongiotrophoblast
cells; Lz, labyrinth zone (fetal side); Cy, cytotrophoblast; Sy, syncytiotrophoblast; Mv, maternal blood vessel; Fv, fetal blood vessel. Small (100 μm) and big
(50 μm) scale bars are indicated in the photomicrographs. DHT, 5α-dihydrotestosterone; INS, insulin.
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
253
Research
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
246:3
Journal of
Endocrinology
Alterations in glutathione and glutathione + glutathione
disulfide levels were found in the gravid uterus in pregnant
rats exposed to INS alone and levels of glutathione were
lower in both the uterus and placenta in pregnant rats
treated with DHT alone (Fig. 2A).
Alterations in ferroptosis-related gene expression in
the gravid uterus and placenta with DHT and INS
Next, we examined whether maternal exposure to DHT
and INS alters the expression of pro-ferroptosis (Slc1a5,
Acsl4, Gls2, Cs, Tfrc and Ireb2) or anti-ferroptosis (Slc7a11,
Gclc, and Gss) genes (Dai et al. 2020) in the uterus and
placenta. In pregnant DHT + INS-exposed rats, uterine
Acsl4, Slc7a11 and Gclc mRNAs were decreased, while Tfrc
mRNA was increased (Fig. 2B). In comparison with the
control uterus, maternal exposure to DHT alone decreased
Cs, Ireb2, Slc7a11, Gclc and Gss mRNA expression, whereas
exposure to INS alone increased Gls2 and Tfrc mRNAs
and decreased Slc7a11 mRNA expression (Fig. 2B). qPCR
analysis also showed that Gls2 mRNA expression was
increased and Slc7a11 mRNA expression was decreased
in the placenta after maternal co-exposure to DHT and
INS. In comparison with the control placenta, exposure
to DHT alone decreased Cs, Slc7a11 and Gss mRNA
expression, whereas exposure to INS alone decreased Gclc
and Gss mRNAs in parallel to increased Tfrc and Slc7a11
mRNA expression (Fig. 2B).
Alterations in MDA levels in the gravid uterus and
placenta with DHT and INS
Given that one of the key consequences of ferroptosis
is elevated lipid peroxidation (Dixon et al. 2012,
Figure2
Alteration of glutathione,
glutathione + glutathione disulde, ferroptosis-
related gene expression, and MDA in pregnant
rats exposed to DHT and/or INS at GD 14.5. ELISA
analysis of glutathione (the reduced state),
glutathione + glutathione disulde, and MDA in
the uterus and placenta (A, n = 8/group). qPCR
analysis of uterine and placental genes involved in
modulating ferroptosis (B, n = 7−8/group). In all
plots, values are expressed as means ± s.e.m.
Statistical P values for selected comparisons
are indicated as *P < 0.05, **P < 0.01, and
***P < 0.001. DHT, 5α-dihydrotestosterone;
INS, insulin.
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
254
Uterine and placental
ferroptosis in PCOS
Y Zhang, M Hu etal. 246:3
Journal of
Endocrinology
Tangetal. 2019), we next examined the impact of DHT and
INS on the levels of MDA, a marker of lipid peroxidation
(Gaweletal. 2004), in the gravid uterus and placenta. As
shown in Fig. 2C, maternal co-exposure to DHT and INS
resulted in increased MDA levels in both the gravid uterus
and placenta. However, there were no significant changes
in MDA levels between the DHT-exposed rats or the
INS-exposed rats and control rats.
Alterations in intracellular iron deposition in the
gravid uterus and placenta with DHT and INS
Because disturbed iron transport and impaired metabolism
within cells/tissues results in ferroptosis (Galaris etal. 2019),
whether chronic exposure to DHT and INS can modulate
tissue iron deposition was also examined. Perls’
histochemical reaction showed specific cytoplasmic
and granular iron storage in rat uterine epithelial and
decidualized stromal cells on GD 6, which is prior to the
induction of HAIR (Supplementary Fig. 3A1 and A2).
As compared to control pregnant rats (Fig. 3A1, A2, A3
and Supplementary Fig. 4B1, B2), iron accumulation was
increased in the external muscle layer, the mesometrial
triangle, as well as in the decidua of DHT + INS-exposed
pregnant rats (Fig. 3B1, B2, B3 and Supplementary Fig.
4B3, B4). Similarly, a significant increase in iron storage
in the mesometrial triangle was also observed in DHT-
exposed rat dams (Fig. 3C1 and C2). In the mesometrial
Figure3
Iron deposition in the uterus and placenta of
pregnant rats exposed to DHT and/or INS at GD
14.5. Gravid uterine and placental tissues from
pregnant rats treated with vehicle (A1–5),
DHT + INS (B1–5), DHT (C1–5), or INS (D1–5) are
shown. The sections were stained by DAB-
enhanced Perls’ staining for iron accumulation.
Yellow arrowheads indicate iron-positive staining.
Images are representative of eight tissue
replicates per group. Mt, mesometrial triangle;
Md, mesometrial decidua; Jz, junctional zone
(maternal side); Lz, labyrinth zone (fetal side).
Scale bars (100 μm) are indicated in the
photomicrographs. DHT, 5α-dihydrotestosterone;
INS, insulin.
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
255
Research
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
246:3
Journal of
Endocrinology
decidua, granular and cytoplasmic iron-positive staining
was absent in the DHT-exposed rats (Fig. 3C3) but was
barely detectable in the INS-exposed rats (Fig. 3C3 and
D3). However, no iron-positive staining was found in
the placental junctional zone in any of the experimental
groups (Fig. 3A4, B4, C4, and D4), while intense iron-
positive staining was consistently detected in immature
erythrocytes within the placental labyrinth zone in all
experimental groups (Fig. 3A5, B5, C5 and D5). These
results indicate that the amount of deposited iron was
elevated, especially in the gravid uterus, following
exposure to DHT and/or INS.
Alterations in the MAPK signaling pathway in the
gravid uterus and placenta with DHT and INS
Taking into consideration that the MAPK signaling
pathway, including ERK, p38, and c-JUN NH2-terminal
kinase (JNK), is involved in the execution of ferroptosis
in other cells (Xie et al. 2016), we evaluated whether
co-exposure to DHT and INS may be linked to activation
of the MAPK signaling pathway in the gravid uterus
and placenta. As shown in Fig. 4A, in the gravid uterus,
maternal DHT + INS exposure resulted in an increased
abundance of phosphorylated ERK1/2 (p-ERK1/2) and
decreased total ERK1/2, which subsequently resulted in an
increased p-ERK1/2:ERK1/2 ratio. Moreover, both p-JNK
and total JNK protein abundance were increased, whereas
the p-JNK:JNK ratio remained unchanged in the gravid
uterus of DHT + INS-exposed rats (Fig. 4A). Additionally,
a similar increase in p-p38 protein abundance and the
p-p38:p38 ratio was observed in both the gravid uterus
(Fig. 4A) and placenta (Fig. 4B) after maternal co-exposure
to DHT and INS. These results indicate that both ERK1/2
and JNK signaling are only activated in the gravid
uterus, whereas p38 signaling is activated in both the
gravid uterus and placenta after maternal co-exposure to
DHT and INS.
Figure4
Changes in the expression of proteins involved in
the ferroptosis-related MAPK signaling pathway in
pregnant rats exposed to DHT and/or INS at GD
14.5. Western blot analysis of ERK, p38, and JNK
protein expression and their phosphorylated
forms in the uterus and placenta (n = 9/group). In
all plots, values are expressed as means ± s.e.m.
Statistical P values for selected comparisons
are indicated as *P < 0.05, **P < 0.01, and
***P < 0.001. DHT, 5α-dihydrotestosterone;
INS, insulin.
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
256
Uterine and placental
ferroptosis in PCOS
Y Zhang, M Hu etal. 246:3
Journal of
Endocrinology
Changes in mitochondrial morphology are associated
with changes in mitochondria-encoded gene and
protein expression in the gravid uterus and placenta
with DHT and INS
By TEM (Fig. 5 and Supplementary Fig. 5), we found
shrunken mitochondria with numerous electron-dense
cristae or absent cristae in the gravid uterus of DHT + INS-
exposed rats (Fig. 5B1 arrows) compared to controls (Fig.
5A1). Further, mitochondria were swollen and collapsed
with poorly defined tubular cristae in the gravid uterus
of rat exposed to DHT and/or INS (Fig. 5B1, C1, and
D1). Our TEM findings of the uterus in DHT + INS rats
are consistent with ferroptosis-related mitochondrial
morphology (Dixonet al. 2012, Xieet al. 2016, Liet al.
2020). Treatment with DHT or INS also reduced the
number of mitochondrial cristae in the uterus (Fig. 5C1
and D1). Ultrastructural analysis of the placenta showed
that mitochondria in the trophoblast of the junctional
zone were significantly affected by maternal exposure to
DHT and/or INS (Fig. 5A2, B2, C2, and D2). For instance,
mitochondria showed blebbing, few or no tubular
cristae and decreased electron density in all treatment
groups (Fig. 5B2, C2, and D2). However, there was little
mitochondrial damage observed in the trophoblast of the
placental labyrinth zone in all treatment groups compared
to controls (Fig. 5A3, B3, C3, and D3).
Based on these morphological observations, the
expression of known mitochondria-encoded genes
(Cisd1, an anti-ferroptosis gene and Dpp4, a pro-
ferroptosis gene (Stockwell et al. 2017, Tang et al.
2019)) and protein (MOTS-c, an enhancer of insulin
sensitivity (Kimetal. 2017)) were analyzed by qPCR and
ELISA. In the pregnant rat uterus, DHT + INS-exposure
decreased Cisd1 mRNA expression, increased Dpp4
mRNA expression and decreased the MOTS-c protein
level (Fig. 5E and F upper panel). In contrast, we found
significantly higher uterine Cisd1 and Dpp4 mRNA
expression in INS-exposed pregnant rats (Fig. 5E upper
panel), but unchanged uterine MOTS-c protein levels in
DHT-exposed pregnant rats compared to controls (Fig.
5F upper panel). In the placenta, Cisd1 mRNA expression
was increased and Dpp4 mRNA expression was decreased
in DHT + INS-exposed pregnant rats compared to
controls (Fig. 5E lower panel). A decrease in placental
Dpp4 mRNA expression was also observed in INS-
exposed pregnant rats (Fig. 5E lower panel). However,
there was no significant difference in MOTS-c protein
levels in the placenta between any of the experimental
groups (Fig. 5F lower panel).
Aberrant regulation of necroptosis-related and
anti-/pro-apoptosis-related gene and protein
expression in the gravid uterus and placenta with
DHT and INS
Different types of cell death are seen in uterine and
placental tissue during healthy and pathological
pregnancy (Welsh 1993, Sharp et al. 2010). To extend
our observations on the effect of maternal DHT and INS
treatment on ferroptosis and mitochondrial impairment,
we analyzed the expression of necroptosis (Mlkl, Ripk1
and Ripk3), anti-apoptosis (Bcl2 and Bcl-xl) and pro-
apoptosis (Bax, Bak, Casp3 and cleaved caspase-3) mRNAs
and proteins (Xieetal. 2016, Choietal. 2019, Tangetal.
2019) in the gravid uterus and placenta. As shown in Fig.
6A, DHT + INS-exposure significantly decreased uterine
Ripk1 mRNA expression, while uterine Mlkl and Ripk3
mRNAs were increased by DHT and/or INS exposure when
compared to control pregnant rats (Fig. 6A upper panel).
Furthermore, co-exposure to DHT and INS increased
Bcl-xl and Bax mRNA expression in the gravid uterus,
with similar increases in these genes seen in DHT-exposed
and/or INS-exposed pregnant rats compared to controls
(Fig. 6B upper panel). Gravid uterine Bcl2 mRNA expression
was not altered by co-exposure to DHT and INS; however,
it was increased by DHT and decreased by INS when
compared to control pregnant rats. In DHT + INS-exposed
pregnant rats, Casp3 mRNA expression and cleaved
caspase-3 protein abundance were decreased in the gravid
uterus (Fig. 6B upper panel and C). In contrast, in the
placenta we found that both Ripk1 and Ripk3 mRNAs were
increased in DHT + INS-exposed pregnant rats compared
to controls (Fig. 6A lower panel). Furthermore, maternal
co-exposure to DHT and INS increased placental Bcl-xl, Bax
and Bak mRNA expression (Fig. 6B lower panel). Of note,
placental Bcl2 mRNA expression was also increased in
DHT + INS-exposed rats and most significantly increased in
the INS alone exposure. However there was no significant
effect of the DHT alone exposure on placental Bcl2 mRNA
level. There were, however, no changes in Casp3 mRNA
expression or cleaved caspase-3 protein abundance in
the placenta (Fig. 6B lower panel and C). Lastly, similar
increases in placental Bcl-xl, Bax, Bak and Casp3 mRNAs
were seen in DHT-exposed and/or INS-exposed pregnant
rats compared to controls (Fig. 6B lower panel).
Discussion
Because PCOS patients frequently suffer from miscarriage
and infertility (Bahri Khomamietal. 2019), it is important
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
257
Research
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
246:3
Journal of
Endocrinology
Figure5
Electron microscopy and mitochondria-mediated ferroptosis-related gene and protein expression in pregnant rats exposed to DHT and/or INS at GD
14.5. Mitochondrial ultrastructural defects in the uterus (A1, B1, C1, and D1, mesometrial decidua) and placenta (junctional (A2, B2, C2, and D2) and
labyrinth zones (A3, B3, C3, and D3)). Images are representative of two tissue replicates. Md, mesometrial decidua; Jz, junctional zone (maternal side); Lz,
labyrinth zone (fetal side). Red asterisks indicate mitochondria, and white arrows indicate shrunken mitochondria with electron-dense cristae. Scale bars
(500 nm) are indicated in the photomicrographs. qPCR analysis of mitochondrial genes involved in modulating ferroptosis (E, n = 8/group). ELISA analysis
of MOTS-c content (F, n = 8/group). In all plots, values are expressed as means ± s.e.m. Statistical P values for selected comparisons are indicated as
*P < 0.05, **P < 0.01, and ***P < 0.001. DHT, 5α-dihydrotestosterone; INS, insulin.
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
258
Uterine and placental
ferroptosis in PCOS
Y Zhang, M Hu etal. 246:3
Journal of
Endocrinology
to understand the molecular mechanisms through which
HAIR affects tissues such as the gravid uterus and placenta.
Until now, there have been no reports exploring the
relationship between PCOS and regulated cell death in
the uterus and placenta. Our results thus fill an important
clinically relevant knowledge gap by experimentally
demonstrating that maternal HAIR can cause the
activation of ferroptosis in the gravid uterus and placenta,
although this is mediated through different molecular
and cellular mechanisms. We propose that alterations in
the ferroptosis pathway in the uterus and placenta due to
maternal HAIR likely contribute to impaired fetal survival
seen in experimental animal models and future work is
required to assess whether this is also the case in women
with PCOS.
In mammals, GPX4 plays a major role in antioxidant
defense by regulating responses to oxidative stress.
Furthermore, loss of function of GPX4 protein and
depletion of GSH levels are the key mechanisms for
triggering ferroptosis (Dixon et al. 2012, Stockwell et al.
2017). In vivo knockout studies have shown that mice
lacking the entire GPX4 gene experience early embryonic
lethality (Imai et al. 2003) and that GPX4-deficient
male mice are infertile (Schneideretal. 2009). Although
the presence of GPX4 has been shown in uteri from
cows (Ramos et al. 2015, Baithalu et al. 2017) and pigs
(Dalto et al. 2015), the localization and physiological
role of GPX4 has not been demonstrated in human and
rodent reproductive tissues, including the uterus. Here,
we show that GPX4 is widely expressed in the non-
pregnant and pregnant rat uteri, including decidualized
stromal cells. The data presented showing the differential
cellular GPX4 localization in the uterus is consistent with
variations in the compartmentalization of GPX4 between
the cytosol and nucleus in different cells (Conrad et al.
2007). Furthermore, GPX4 is down-regulated in the
gravid uterus by maternal exposure to DHT and INS.
Correspondingly, the levels of glutathione are decreased
and glutathione+glutathione disulfide levels are increased
in the uterus by DHT and INS co-exposure. Taken together,
these results suggest that maternal HAIR disrupts the
GPX4-glutathione regulatory axis and can result in the
induction of ferroptosis in the uterus during pregnancy.
The finding that glutathione levels in the uterus were
lowest in the INS-only treated rats which also showed a
non-significant reduction in GPX4 suggests that other
signaling pathways and factors such as the transcription
factors Nrf1 and Nrf2 (Lu 2009) might be altered by the
treatments and contribute to the resultant changes in
glutathione status and should be investigated for causality
in the future (also in the placenta of DHT and/or INS-
exposed dams). Indeed, we have previously found altered
abundance of antioxidants in the uterus of pregnant rats
exposed to DHT and/or INS (Huetal. 2019b, Zhangetal.
2019b). Consistent with previous work on the human
placenta (Mistry et al. 2008, 2010), the present study
Figure6
The regulatory pattern of necroptosis-related and pro-/anti-apoptosis-related gene and protein expression in pregnant rats exposed to DHT and/or INS
at GD 14.5. qPCR analysis of Mlkl, Ripk1, Ripk3, Bcl2, Bcl-xl, Bax, Bak, and Casp3 mRNA in the uterus and placenta (A and B, n = 8/group). Western blot
analysis of cleaved caspase-3 protein expression in the uterus and placenta (C, n = 9/group). In all plots, values are expressed as means ± s.e.m. Statistical
P values for selected comparisons are indicated as *P < 0.05, **P < 0.01, and ***P < 0.001. DHT, 5α-dihydrotestosterone; INS, insulin.
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
259
Research
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
246:3
Journal of
Endocrinology
shows that the GPX4 protein is highly expressed in the rat
placenta during pregnancy. Although analysis of whole
placental homogenates showed no significant change
in GPX4 levels, immunolocalization revealed a loss of
GPX4 in specific cell types in the placenta (the glycogen
and spongiotrophoblast cells) in response to maternal
co-exposure to DHT and INS. The more minor alterations
in GPX4 abundance, combined with the high levels of
glutathione + glutathione disulfide and absence of changes
in glutathione levels in the placenta, suggest that maternal
HAIR induces ferroptosis to a lesser extent in the placenta
compared to the gravid uterus. GPX4 is known to protect
cells/tissues against lipid peroxidation by inhibiting
lipid-associated hydroperoxides (Conrad et al. 2007).
In addition, genetically ablating or inducing decreased
GPX4 expression leads to the activation of ferroptosis
(Friedmann Angelietal. 2014, Chenetal. 2015). Together,
our data therefore suggest that HAIR-induced ferroptosis is
mediated by both dysregulation of GPX4 expression and
aberrant increases in lipid peroxidation. The induction of
uterine and placental ferroptosis by maternal exposure to
DHT and INS may be a novel mechanism contributing
to the malfunction of those tissues and hence impaired
fetal development during pregnancy. However, how
maternal HAIR-mediated uterine and placental ferroptosis
compromises the growth and development of the fetus
is not clear at this time and should be the subject of
future investigations. Moreover, future work should be
employed to assess whether the activation of ferroptosis,
lipid peroxidation and poor fetal outcomes by maternal
HAIR may be preventable by antioxidant administration.
Iron can serve as an essential signaling molecule
that modulates diverse physiological processes and
iron homeostasis is required for the normal growth
and development of the placenta and fetus during
pregnancy (Cao & Fleming 2016, Ng et al. 2019). By
Perls’ histochemical reaction, we found a considerable
proportion of uterine epithelial and decidualized stromal
cells stained positively for iron storage on GD 6. These
data are consistent with a previous report showing the
cellular expression of ferritin heavy chain, a component
of the multi-subunit iron-binding protein ferritin, in
the uterus during early pregnancy (Zhu et al. 1995). An
extensive body of evidence indicates that, while iron
deficiency is linked to abnormal pregnancy (Ng et al.
2019) and increased risk of fetal death (Guoet al. 2019),
iron overload is associated with the manifestation of
PCOS (Escobar-Morreale 2012). Previous findings by
Kim and colleagues indicate that increased circulating
iron levels are associated with metabolic abnormalities,
including HAIR in PCOS patients (Kim et al. 2014).
Several studies have demonstrated that, in addition to
its antioxidative property, Ho1 is a critical regulator for
mobilization of intracellular pools of free iron (Poss &
Tonegawa 1997, Kovtunovychetal. 2010). More recently,
we have demonstrated that maternal co-exposure to
DHT and INS suppresses Ho1 mRNA expression in the
gravid uterus, but not in the placenta (Hu et al. 2019b,
Zhangetal. 2019b). While the uptake of transferrin-bound
iron, a major maternal iron source for placental transfer,
is mainly mediated through iron import proteins such as
transferrin receptor 1 (TFR1, TFRc) (Cao & Fleming 2016),
a specific ferroptosis marker (Fengetal. 2020), our results
show that combined exposure to DHT and INS increases
Tfrc mRNA expression in association with increased iron
deposition in the gravid uterus. Further, we have provided
ultrastructural evidence that shrunken mitochondria
with numerous electron-dense cristae, a key feature of
ferroptosis-related mitochondrial morphology, are present
in the gravid uterus. However, the placentas of the same
animals exhibited increased mRNA expression of Cisd1, a
mitochondrial iron export factor, and no change in Tfrc
mRNA or iron accumulation. Ferroptosis can be induced
by excessive accumulation of free iron in tissues and cells
(Galariset al. 2019) and our findings support the notion
that, in response to exposure to DHT and INS, aberrant
iron accumulation and activation of ferroptosis occurs
in the gravid uterus but not in the placenta. Given the
fact that whether or not mitochondria are involved in
ferroptosis is still under debate (Gaoet al. 2019), further
investigations are needed to determine which cellular
compartments contribute to the defective utilization
of iron and increased ferroptosis observed in the gravid
uterus under conditions of HAIR.
Given that aberrant accumulation of intracellular
iron induces oxidative stress (Galaris et al. 2019) and
subsequently results in multiple modes of cell death
(Leiet al. 2019), it is not surprising that, in addition to
ferroptosis, apoptosis (a non-inflammatory form of cell
death) and necroptosis (a pro-inflammatory form of cell
death) may also be involved in HAIR-induced fetal loss in
pregnant rats. Indeed, pregnant rats co-exposed to DHT
and INS exhibited decreased Casp3 mRNA expression and
cleaved caspase-3 protein abundance in the uterus, but
not in the placenta, even though selectively increased
expression of anti-apoptotic genes (Bcl-xl) and pro-
apoptotic genes (Bax) was observed in both tissues. We
suspect that suppression of apoptosis might serve as a
compensatory mechanism to protect against increased
ferroptosis in order to maintain homeostasis of the gravid
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
260
Uterine and placental
ferroptosis in PCOS
Y Zhang, M Hu etal. 246:3
Journal of
Endocrinology
uterus after exposure to DHT and INS. This is supported by
studies assessing the interaction and interplay of different
cell death pathways in cancer research (Riegman et al.
2019). Ferroptosis and necroptosis are two different forms
of regulated necrosis (Xie et al. 2016, Choi et al. 2019).
Necroptosis requires mitochondrial ROS generation and
is primarily regulated by the RIPK1, RIPK3 and MLKL
proteins (Choiet al. 2019). We found that, in DHT+INS-
exposed pregnant rats, the level of ROS (Zhang et al.
2019b) and expression of Ripk1 and Ripk3 mRNAs was
increased in the placenta. Therefore, it is tempting to
speculate that the activation of necroptosis in response
to PCOS-related HAIR might serve to counteract the
ferroptosis pathway in the placenta. Of note, we also
found that maternal hyperandrogenism and insulin
resistance resulted in decreased ROS concentration in
the uterus ((Hu et al. 2019b) and this study). Given the
time-dependent regulation of uterine ROS levels in
normal rats during early-mid pregnancy (Huetal. 2019b),
it is possible that DHT + INS-induced ROS generation
and accumulation might not be sustained in the gravid
uterus on GD 14.5. Additionally, both ferroptosis and
necroptosis might intersect and crosstalk with HAIR-
induced oxidative damage and subsequently result in
increased fetal loss. It remains to be determined whether
HAIR-induced pregnancy loss is due to increased iron-
mediated uterine ferroptosis or to necroptosis-related
defects in the placenta, or both. There is evidence that
different forms of programmed cell death, including
ferroptosis, apoptosis, and necroptosis, may coexist under
the physiological condition and disease state (Choiet al.
2019, Riegmanetal. 2019). However, due to the limited
commercial antibodies available for rat tissues, we are
not able to extend the study to assess whether there is
co-existence of ferroptosis and apoptosis in the gravid
uterus and placenta in our experimental rats.
In this study, we found that some pro-ferroptosis genes
such as Acsl4, Tfrc and Dpp4 were oppositely regulated
in the uterus by co-exposure to DHT and INS. However,
several anti-ferroptosis genes, including Slc7a11, Gcls,
and Cisd1, were downregulated in the gravid uterus after
co-exposure to DHT and INS. These results suggest that
the suppression of anti-ferroptosis gene transcription
might play a dominant role in promoting ferroptosis
in this tissue under conditions of HAIR. Compared to
the gravid uterus, the placenta showed a distinct profile
of ferroptosis-related gene changes in response to the
combined DHT and INS exposure. For example, the
combined exposure increased Cisd1 mRNA expression
and decreased Dpp4 mRNA expression in the placenta,
which was opposite to that observed in the gravid
uterus. Furthermore, we often observed contrasting
expression patterns of pro- and anti-ferroptosis genes
in the gravid uterus and placenta with exposure to DHT
or INS alone compared to the combined exposure. We
do not know the exact reason for these inconsistencies;
however, we do know the ontogeny of changes we
observed and how these relate to the development of
HAIR as the expression of ferroptosis-related genes and
proteins was only assessed at one gestational age when
the pregnant rats already displayed HAIR (Hu et al.
2019b, Zhang et al. 2019b). In addition, components
of HAIR may have acted synergistically or through
separate pathways to bring about divergent effects on
gene expression and signaling pathways and regulate
the ferroptosis process in the gravid uterus and placenta.
Overall, our findings demonstrate the complexity and
challenges in establishing direct roles and patterns
linking individual pro-/anti-ferroptosis genes to the
ferroptosis pathway in the gravid uterus and placenta
in response to maternal DHT and/or INS in vivo. Future
work should therefore investigate the tissue-specific
and time-dependent changes in ferroptosis-related gene
expression in the uterus and placenta during the maternal
hormonal manipulation.
In comparison to the single exposure groups (DHT
or INS), specific changes within the maternal uterus and
placenta appeared to be driven by hyperandrogenism,
insulin resistance, or both (co-exposure to DHT and INS).
Experiments utilizing gene and pathway inhibitors in
decidual and trophoblast cells would be beneficial for
exploring the causality of changes observed regarding
ferroptosis and iron metabolism in the future. Work is
also required to assess whether elevated ferroptosis in
the uterus contributes to placental dysfunction in rat
dams with HAIR due to DHT and INS, a key area that
would additionally be aided by a time-course analysis.
Moreover, it is also possible that HAIR may activate
pathways within the uterus which serve to protect and
block the propagation of ferroptosis in placental tissue,
as opposed or in addition to intrinsic pathways operating
within the placenta itself. The gravid uterus and placenta
are composed of multiple cell types, each with their
distinct gene/protein expression program and likely
sensitivity to the DHT and INS treatment. Future work
should additionally undertake analyses of the ferroptosis
and apoptosis pathways in dissected placental zones or
isolated cell types from the gravid uterus and placenta
from rats treated with DHT and/or INS. Nonetheless, the
concomitant presence of different forms of regulated cell
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
261
Research
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
246:3
Journal of
Endocrinology
death would be expected to disrupt uterine and placental
function and play a role in the fetal loss observed in
DHT + INS-exposed pregnant rats.
Recently, Zhang and colleagues reported that oxidative
stress-induced ferroptosis contributes to the pathogenesis
of preeclampsia (Zhang et al. 2020). In particular, they
found decreased GPX4, glutathione, and SLC7A11 protein
levels and increased MDA content in the preeclamptic
placenta in humans and rats (Zhangetal. 2020). Together
with our work, these findings support the notion that the
ferroptosis pathway is involved in the pathogenesis of
female reproductive disorders.
In summary, our findings suggest maternal
co-exposure to DHT and INS alters the ferroptosis pathway
in the gravid uterus and placenta; however, this occurs via
different regulatory mechanisms and signaling pathways.
For instance, in contrast to the placenta, increased
ferroptosis in the gravid uterus in response to DHT and
INS was related to decreased GPX4 and glutathione
abundance, altered expression of ferroptosis-associated
genes (Acsl4, Tfrc, Slc7a11, and Gclc), increased MDA
and iron deposition, upregulation of the ERK/p38/JNK
pathway and mitochondrial Dpp4 expression, as
well as the appearance of typical ferroptosis-related
mitochondrial morphology. In addition, DHT and INS
were associated with reduced activation of apoptosis in
the uterus and increased necroptosis in the placenta.
Both the maternal uterus and placenta play essential
roles in embryo implantation and support fetal growth
and development during pregnancy (Schatz et al. 2016,
Sharma et al. 2016). Therefore, while the present study
improves our understanding of the impact of HAIR on
regulated cell death in specific tissues during pregnancy,
more preclinical and clinical studies are needed to further
investigate the molecular and functional connectivity
between the maternal decidua, placenta and fetus in PCOS.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/
JOE-20-0155.
Declaration of interest
The authors declare that there is no conict of interest that could be
perceived as prejudicing the impartiality of the research reported.
Funding
This study was nanced by grants from the Swedish Medical Research
Council (grant number 10380), the Swedish state under the agreement
between the Swedish government and the county councils – the ALF-
agreement (grant number ALFGBG-147791), Jane and Dan Olsson’s
Foundation, the Knut and Alice Wallenberg Foundation, and the Adlerbert
Research Foundation to HB and LRS as well as the National Natural Science
Foundation of China (Grant No. 81774136), the Project of Young Innovation
Talents in Heilongjiang Provincial University (Grant No.UNPYSCT-2015121),
the Scientic Research Foundation for Postdoctoral Researchers of Heilong
Jiang Province, the Project of Science Foundation by Heilongjiang University
of Chinese Medicine, and the Project of Excellent Innovation Talents by
Heilongjiang University of Chinese Medicine to YZ. The Guangzhou Medical
University High-level University Construction Talents Fund (grant number
B185006010046) supported MH. ANSP is supported by a Royal Society
Dorothy Hodgkin Research Fellowship.
Author contribution statement
LRS performed study design and supervision. YZ, MH, WJ, GL, JZ, BW, PC,
XL, YH, LS, XW, and LRS conducted the study. YZ, MH, WJ, GL, JZ, BW, JL, XL,
and LRS performed data collection. YZ, MH, JL, and LRS performed data
analysis. SL, ANSP, LS, MB, LRS, and HB performed data interpretation. YZ,
MH, and LRS drafted the manuscript. SL, ANSP, MB, LRS, and HB revised
the manuscript. YZ, MH, LRS, and HB take responsibility for the integrity of
the data analysis. All authors have read and approved the nal version of
the manuscript.
Acknowledgements
The funders had no role in the design, data collection, analysis, decision to
publish, or preparation of the manuscript.
References
AgarwalA, Aponte-MelladoA, PremkumarBJ, ShamanA & GuptaS
2012 The effects of oxidative stress on female reproduction: a
review. Reproductive Biology and Endocrinology 10 49. (https://doi.
org/10.1186/1477-7827-10-49)
AzzizR, CarminaE, ChenZ, DunaifA, LavenJS, LegroRS, LiznevaD,
Natterson-HorowtizB, TeedeHJ & YildizBO 2016 Polycystic ovary
syndrome. Nature Reviews: Disease Primers 2 16057. (https://doi.
org/10.1038/nrdp.2016.57)
Bahri KhomamiM, JohamAE, BoyleJA, PiltonenT, SilagyM,
AroraC, MissoML, TeedeHJ & MoranLJ 2019 Increased maternal
pregnancy complications in polycystic ovary syndrome appear to
be independent of obesity – a systematic review, meta-analysis,
and meta-regression. Obesity Reviews 20 659–674. (https://doi.
org/10.1111/obr.12829)
BaithaluRK, SinghSK, KumaresanA, MohantyAK, MohantyTK,
KumarS, KerkettaS, MaharanaBR, PatbandhaTK, AttupuramN,
etal. 2017 Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and
without uterine infection. Animal Reproduction Science 177 79–87.
(https://doi.org/10.1016/j.anireprosci.2016.12.008)
BanulsC, Rovira-LlopisS, Martinez de MaranonA, VesesS, JoverA,
GomezM, RochaM, Hernandez-MijaresA & VictorVM 2017
Metabolic syndrome enhances endoplasmic reticulum, oxidative
stress and leukocyte-endothelium interactions in PCOS. Metabolism:
Clinical and Experimental 71 153–162. (https://doi.org/10.1016/j.
metabol.2017.02.012)
CaoC & FlemingMD 2016 The placenta: the forgotten essential
organ of iron transport. Nutrition Reviews 74 421–431. (https://doi.
org/10.1093/nutrit/nuw009)
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
262
Uterine and placental
ferroptosis in PCOS
Y Zhang, M Hu etal. 246:3
Journal of
Endocrinology
ChenL, HambrightWS, NaR & RanQ 2015 Ablation of the ferroptosis
inhibitor glutathione peroxidase 4 in neurons results in rapid motor
neuron degeneration and paralysis. Journal of Biological Chemistry 290
28097–28106. (https://doi.org/10.1074/jbc.M115.680090)
ChoiME, PriceDR, RyterSW & ChoiAMK 2019 Necroptosis: a crucial
pathogenic mediator of human disease. JCI Insight 4 e128834.
(https://doi.org/10.1172/jci.insight.128834)
ConradM, SchneiderM, SeilerA & BornkammGW 2007 Physiological
role of phospholipid hydroperoxide glutathione peroxidase in
mammals. Biological Chemistry 388 1019–1025. (https://doi.
org/10.1515/BC.2007.130)
DaiC, ChenX, LiJ, ComishP, KangR & TangD 2020 Transcription
factors in ferroptotic cell death. Cancer Gene Therapy [epub]. (https://
doi.org/10.1038/s41417-020-0170-2)
DaltoDB, RoyM, AudetI, PalinMF, GuayF, LapointeJ & MatteJJ 2015
Interaction between vitamin B6 and source of selenium on the
response of the selenium-dependent glutathione peroxidase system
to oxidative stress induced by oestrus in pubertal pig. Journal of Trace
Elements in Medicine and Biology 32 21–29. (https://doi.org/10.1016/j.
jtemb.2015.05.002)
DingY, JiangZ, XiaB, ZhangL, ZhangC & LengJ 2019 Mitochondria-
targeted antioxidant therapy for an animal model of PCOS-IR.
International Journal of Molecular Medicine 43 316–324. (https://doi.
org/10.3892/ijmm.2018.3977)
DixonSJ, LembergKM, LamprechtMR, SkoutaR, ZaitsevEM,
GleasonCE, PatelDN, BauerAJ, CantleyAM, YangWS, etal. 2012
Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell
149 1060–1072. (https://doi.org/10.1016/j.cell.2012.03.042)
Escobar-MorrealeHF 2012 Iron metabolism and the polycystic ovary
syndrome. Trends in Endocrinology & Metabolism 23 509–515. (https://
doi.org/10.1016/j.tem.2012.04.003)
FassnachtM, SchlenzN, SchneiderSB, WudySA, AllolioB & ArltW
2003 Beyond adrenal and ovarian androgen generation: increased
peripheral 5 alpha-reductase activity in women with polycystic ovary
syndrome. Journal of Clinical Endocrinology & Metabolism 88
2760–2766. (https://doi.org/10.1210/jc.2002-021875)
FengH, SchorppK, JinJ, YozwiakCE, HoffstromBG, DeckerAM,
RajbhandariP, StokesME, BenderHG, CsukaJM, etal. 2020
Transferrin receptor is a specific ferroptosis marker. Cell Reports 30
3411–3423.e7. (https://doi.org/10.1016/j.celrep.2020.02.049)
ForcinaGC & DixonSJ 2019 GPX4 at the crossroads of lipid homeostasis
and ferroptosis. Proteomics 19 e1800311. (https://doi.org/10.1002/
pmic.201800311)
Friedmann AngeliJP, SchneiderM, PronethB, TyurinaYY, TyurinVA,
HammondVJ, HerbachN, AichlerM, WalchA, EggenhoferE, etal.
2014 Inactivation of the ferroptosis regulator Gpx4 triggers acute
renal failure in mice. Nature Cell Biology 16 1180–1191. (https://doi.
org/10.1038/ncb3064)
GalarisD, BarboutiA & PantopoulosK 2019 Iron homeostasis and
oxidative stress: an intimate relationship. Biochimica et Biophysica
Acta. Molecular Cell Research 1866 118535. (https://doi.org/10.1016/j.
bbamcr.2019.118535)
GaoM, YiJ, ZhuJ, MinikesAM, MonianP, ThompsonCB & JiangX 2019
Role of mitochondria in ferroptosis. Molecular Cell 73 354–363.e3.
(https://doi.org/10.1016/j.molcel.2018.10.042)
GawelS, WardasM, NiedworokE & WardasP 2004 Malondialdehyde
(MDA) as a lipid peroxidation marker. Wiadomosci Lekarskie 57
453–455.
GlintborgD, JensenRC, BentsenK, SchmedesAV, BrandslundI, KyhlHB,
BilenbergN & AndersenMS 2018 Testosterone levels in third
trimester in polycystic ovary syndrome: odense child cohort. Journal
of Clinical Endocrinology & Metabolism 103 3819–3827. (https://doi.
org/10.1210/jc.2018-00889)
GudipatySA, ConnerCM, RosenblattJ & MontellDJ 2018
Unconventional ways to live and die: cell death and survival in
development, homeostasis, and disease. Annual Review of Cell &
Developmental Biology 34 311–332. (https://doi.org/10.1146/annurev-
cellbio-100616-060748)
GuoY, ZhangN, ZhangD, RenQ, GanzT, LiuS & NemethE 2019 Iron
homeostasis in pregnancy and spontaneous abortion. American
Journal of Hematology 94 184–188. (https://doi.org/10.1002/ajh.25341)
HuM, ZhangY, GuoX, JiaW, LiuG, ZhangJ, CuiP, LiJ, LiW, WuX,
etal. 2019a Perturbed ovarian and uterine glucocorticoid receptor
signaling accompanies the balanced regulation of mitochondrial
function and NFkappaB-mediated inflammation under conditions of
hyperandrogenism and insulin resistance. Life Sciences 232 116681.
(https://doi.org/10.1016/j.lfs.2019.116681)
HuM, ZhangY, GuoX, JiaW, LiuG, ZhangJ, LiJ, CuiP, Sferruzzi-
PerriAN, HanY, etal. 2019b Hyperandrogenism and insulin
resistance induce gravid uterine defects in association with
mitochondrial dysfunction and aberrant ROS production. American
Journal of Physiology – Endocrinology & Metabolism 316 E794–E809.
(https://doi.org/10.1152/ajpendo.00359.2018)
ImaiH, HiraoF, SakamotoT, SekineK, MizukuraY, SaitoM, KitamotoT,
HayasakaM, HanaokaK & NakagawaY 2003 Early embryonic
lethality caused by targeted disruption of the mouse PHGPx gene.
Biochemical & Biophysical Research Communications 305 278–286.
(https://doi.org/10.1016/s0006-291x(03)00734-4)
KimJW, KangKM, YoonTK, ShimSH & LeeWS 2014 Study of circulating
hepcidin in association with iron excess, metabolic syndrome, and
BMP-6 expression in granulosa cells in women with polycystic
ovary syndrome. Fertility & Sterility 102 548–554.e2. (https://doi.
org/10.1016/j.fertnstert.2014.04.031)
KimSJ, XiaoJ, WanJ, CohenP & YenK 2017 Mitochondrially derived
peptides as novel regulators of metabolism. Journal of Physiology 595
6613–6621. (https://doi.org/10.1113/JP274472)
KovtunovychG, EckhausMA, GhoshMC, Ollivierre-WilsonH &
RouaultTA 2010 Dysfunction of the heme recycling system in heme
oxygenase 1-deficient mice: effects on macrophage viability and tissue
iron distribution. Blood 116 6054–6062. (https://doi.org/10.1182/
blood-2010-03-272138)
LaiQ, XiangW, LiQ, ZhangH, LiY, ZhuG, XiongC & JinL 2018
Oxidative stress in granulosa cells contributes to poor oocyte quality
and IVF-ET outcomes in women with polycystic ovary syndrome.
Frontiers of Medicine 12 518–524. (https://doi.org/10.1007/s11684-017-
0575-y)
LeiP, BaiT & SunY 2019 Mechanisms of ferroptosis and relations with
regulated cell death: a review. Frontiers in Physiology 10 139. (https://
doi.org/10.3389/fphys.2019.00139)
LiJ, CaoF, YinHL, HuangZJ, LinZT, MaoN, SunB & WangG 2020
Ferroptosis: past, present and future. Cell Death & Disease 11 88.
(https://doi.org/10.1038/s41419-020-2298-2)
LiznevaD, SuturinaL, WalkerW, BraktaS, Gavrilova-JordanL & AzzizR
2016 Criteria, prevalence, and phenotypes of polycystic ovary
syndrome. Fertility & Sterility 106 6–15. (https://doi.org/10.1016/j.
fertnstert.2016.05.003)
LuSC 2009 Regulation of glutathione synthesis. Molecular Aspects of
Medicine 30 42–59. (https://doi.org/10.1016/j.mam.2008.05.005)
MaliqueoM, LaraHE, SanchezF, EchiburuB, CrisostoN & Sir-
PetermannT 2013 Placental steroidogenesis in pregnant women with
polycystic ovary syndrome. European Journal of Obstetrics, Gynecology,
and Reproductive Biology 166 151–155. (https://doi.org/10.1016/j.
ejogrb.2012.10.015)
MistryHD, KurlakLO, WilliamsPJ, RamsayMM, SymondsME &
Broughton PipkinF 2010 Differential expression and distribution
of placental glutathione peroxidases 1, 3 and 4 in normal and
preeclamptic pregnancy. Placenta 31 401–408. (https://doi.
org/10.1016/j.placenta.2010.02.011)
MistryHD, WilsonV, RamsayMM, SymondsME & Broughton PipkinF
2008 Reduced selenium concentrations and glutathione peroxidase
activity in preeclamptic pregnancies. Hypertension 52 881–888.
(https://doi.org/10.1161/HYPERTENSIONAHA.108.116103)
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
https://doi.org/10.1530/JOE-20-0155
https://joe.bioscientifica.com © 2020 Society for Endocrinology
Published by Bioscientifica Ltd.
Printed in Great Britain
263
Research
Y Zhang, M Hu etal. Uterine and placental
ferroptosis in PCOS
246:3
Journal of
Endocrinology
NgSW, NorwitzSG & NorwitzER 2019 The impact of iron overload
and ferroptosis on reproductive disorders in humans: implications
for preeclampsia. International Journal of Molecular Sciences 20 3283.
(https://doi.org/10.3390/ijms20133283)
PossKD & TonegawaS 1997 Heme oxygenase 1 is required for
mammalian iron reutilization. PNAS 94 10919–10924. (https://doi.
org/10.1073/pnas.94.20.10919)
RamosRS, OliveiraML, IzaguirryAP, VargasLM, SoaresMB, MesquitaFS,
SantosFW & BinelliM 2015 The periovulatory endocrine milieu
affects the uterine redox environment in beef cows. Reproductive
Biology and Endocrinology 13 39. (https://doi.org/10.1186/s12958-015-
0036-x)
RiegmanM, BradburyMS & OverholtzerM 2019 Population dynamics in
cell death: mechanisms of propagation. Trends in Cancer 5 558–568.
(https://doi.org/10.1016/j.trecan.2019.07.008)
RosenfieldRL & EhrmannDA 2016 The pathogenesis of polycystic ovary
syndrome (PCOS): the hypothesis of PCOS as functional ovarian
hyperandrogenism revisited. Endocrine Reviews 37 467–520. (https://
doi.org/10.1210/er.2015-1104)
SchatzF, Guzeloglu-KayisliO, ArlierS, KayisliUA & LockwoodCJ 2016
The role of decidual cells in uterine hemostasis, menstruation,
inflammation, adverse pregnancy outcomes and abnormal uterine
bleeding. Human Reproduction Update 22 497–515. (https://doi.
org/10.1093/humupd/dmw004)
SchneiderM, ForsterH, BoersmaA, SeilerA, WehnesH, SinowatzF,
NeumullerC, DeutschMJ, WalchA, Hrabe de AngelisM, etal. 2009
Mitochondrial glutathione peroxidase 4 disruption causes male
infertility. FASEB Journal 23 3233–3242. (https://doi.org/10.1096/
fj.09-132795)
SchootsMH, GordijnSJ, ScherjonSA, van GoorH & HillebrandsJL 2018
Oxidative stress in placental pathology. Placenta 69 153–161. (https://
doi.org/10.1016/j.placenta.2018.03.003)
SharmaS, GodboleG & ModiD 2016 Decidual control of trophoblast
invasion. American Journal of Reproductive Immunology 75 341–350.
(https://doi.org/10.1111/aji.12466)
SharpAN, HeazellAE, CrockerIP & MorG 2010 Placental apoptosis in
health and disease. American Journal of Reproductive Immunology 64
159–169. (https://doi.org/10.1111/j.1600-0897.2010.00837.x)
SilfenME, DenburgMR, ManiboAM, LoboRA, JaffeR, FerinM, LevineLS
& OberfieldSE 2003 Early endocrine, metabolic, and sonographic
characteristics of polycystic ovary syndrome (PCOS): comparison
between nonobese and obese adolescents. Journal of Clinical
Endocrinology & Metabolism 88 4682–4688. (https://doi.org/10.1210/
jc.2003-030617)
Sir-PetermannT, MaliqueoM, AngelB, LaraHE, Perez-BravoF &
RecabarrenSE 2002 Maternal serum androgens in pregnant women
with polycystic ovarian syndrome: possible implications in prenatal
androgenization. Human Reproduction 17 2573–2579. (https://doi.
org/10.1093/humrep/17.10.2573)
SpencerSJ, CataldoNA & JaffeRB 1996 Apoptosis in the human female
reproductive tract. Obstetrical & Gynecological Survey 51 314–323.
(https://doi.org/10.1097/00006254-199605000-00023)
StockwellBR, Friedmann AngeliJP, BayirH, BushAI, ConradM, DixonSJ,
FuldaS, GasconS, HatziosSK, KaganVE, etal. 2017 Ferroptosis: a
regulated cell death nexus linking metabolism, redox biology, and
disease. Cell 171 273–285. (https://doi.org/10.1016/j.cell.2017.09.021)
SunX, NiuX, ChenR, HeW, ChenD, KangR & TangD 2016
Metallothionein-1G facilitates sorafenib resistance through inhibition
of ferroptosis. Hepatology 64 488–500. (https://doi.org/10.1002/
hep.28574)
TangD, KangR, BergheTV, VandenabeeleP & KroemerG 2019 The
molecular machinery of regulated cell death. Cell Research 29
347–364. (https://doi.org/10.1038/s41422-019-0164-5)
WelshAO 1993 Uterine cell death during implantation and early
placentation. Microscopy Research & Technique 25 223–245. (https://
doi.org/10.1002/jemt.1070250305)
XieY, HouW, SongX, YuY, HuangJ, SunX, KangR & TangD 2016
Ferroptosis: process and function. Cell Death & Differentiation 23
369–379. (https://doi.org/10.1038/cdd.2015.158)
ZhangH, HeY, WangJX, ChenMH, XuJJ, JiangMH, FengYL & GuYF
2020 miR-30-5p-mediated ferroptosis of trophoblasts is implicated in
the pathogenesis of preeclampsia. Redox Biology 29 101402. (https://
doi.org/10.1016/j.redox.2019.101402)
ZhangJ, BaoY, ZhouX & ZhengL 2019a Polycystic ovary syndrome and
mitochondrial dysfunction. Reproductive Biology and Endocrinology:
RB&E 17 67. (https://doi.org/10.1186/s12958-019-0509-4)
ZhangY, MengF, SunX, SunX, HuM, CuiP, VestinE, LiX, LiW, WuXK,
etal. 2018 Hyperandrogenism and insulin resistance contribute to
hepatic steatosis and inflammation in female rat liver. Oncotarget 9
18180–18197. (https://doi.org/10.18632/oncotarget.24477)
ZhangY, SunX, SunX, MengF, HuM, LiX, LiW, WuXK, BrännströmM,
ShaoR, etal. 2016 Molecular characterization of insulin resistance
and glycolytic metabolism in the rat uterus. Scientific Reports 6 30679.
(https://doi.org/10.1038/srep30679)
ZhangY, ZhaoW, XuH, HuM, GuoX, JiaW, LiuG, LiJ, CuiP, LagerS,
etal. 2019 Hyperandrogenism and insulin resistance-induced fetal
loss: evidence for placental mitochondrial abnormalities and elevated
reactive oxygen species production in pregnant rats that mimic the
clinical features of polycystic ovary syndrome. Journal of Physiology
597 3927–3950. (https://doi.org/10.1113/JP277879)
ZhuLJ, BagchiMK & BagchiIC 1995 Ferritin heavy chain is a
progesterone-inducible marker in the uterus during pregnancy.
Endocrinology 136 4106–4115. (https://doi.org/10.1210/
endo.136.9.7649119)
Received in final form 28 May 2020
Accepted 25 June 2020
Accepted Manuscript published online 25 June 2020
Downloaded from Bioscientifica.com at 10/31/2021 03:48:54PM
via free access
