Content uploaded by Li-Feng Wang
Author content
All content in this area was uploaded by Li-Feng Wang on Feb 08, 2018
Content may be subject to copyright.
Research article
Physiological and molecular responses to drought stress in rubber tree
(Hevea brasiliensis Muell. Arg.)
Li-feng Wang
*
Danzhou Investigation &Experiment Station of Tropical Crops, Ministry of Agriculture, Rubber Research Institute, Chinese Academy of Tropical Agricultural
Sciences, Danzhou, Hainan 571737, China
article info
Article history:
Received 4 April 2014
Accepted 14 August 2014
Available online 23 August 2014
Keywords:
Antioxidative enzyme
Drought
Hevea brasiliensis
Osmoregulation
Photosynthesis
Reactive oxygen species
abstract
Plant drought stress response and tolerance are complex biological processes. In order to reveal the
drought tolerance mechanism in rubber tree, physiological responses and expressions of genes involved
in energy biosynthesis and reactive oxygen species (ROS) scavenging were systematically analyzed
following drought stress treatment. Results showed that relative water content (RWC) in leaves was
continuously decreased with the severity of drought stress. Wilting leaves were observed at 7 day
without water (dww). Total chlorophyll content was increased at 1 dww, but decreased from 3 dww.
However, the contents of malondialdehyde (MDA) and proline were significantly increased under
drought stress. Peroxidase (POD) and superoxide dismutase (SOD) activities were markedly enhanced at
1 and 3 dww, respectively. Meanwhile, the soluble sugar content was constant under drought stress.
These indicated that photosynthetic activity and membrane lipid integrity were quickly attenuated by
drought stress in rubber tree, and osmoregulation participated in drought tolerance mechanism in
rubber tree. Expressions of energy biosynthesis and ROS scavenging systems related genes, including
HbCuZnSOD,HbMnSOD,HbAPX,HbCAT,HbCOA,HbATP, and HbACAT demonstrated that these genes were
significantly up-regulated by drought stress, and reached a maximum at 3 dww, then followed by a
decrease from 5 dww. These results suggested that drought stress adaption in rubber tree was governed
by energy biosynthesis, antioxidative enzymes, and osmoregulation.
©2014 Elsevier Masson SAS. All rights reserved.
1. Introduction
Water deficit is a major constraint to plant growth and pro-
ductivity (Monclus et al., 2006). Prolonged drought stress leads to
severe problems, such as decrease in water flux, closing of stomata
and reduction in carbon dioxide fixation. Tree can die of both hy-
draulic failure and carbon starvation during drought stress (Zeppel
et al., 2013). Inhibition of photosynthesis and energy dissipation are
common features under drought stress in many plant species,
which reflect as Photosystem II thermostability and electron
transport changes (Zhou et al., 2007; Brestic et al., 2012; Yan et al.,
2013; Zivcak et al., 2014). Plant anti-drought characters are mainly
associated with low transpiration co efficiency and osmotic
adjustment, etc. Osmotic adjustment involves the accumulation
of compatible solutes (low-molecular-weight organic osmolytes),
such as proline, mannitol, sorbitol, fructans, sucrose and oligosac-
charides (Rhodes and Hanson, 1993). These large amounts of
compounds play a key role in maintaining the osmotic equilibrium
and protecting membranes as well as macromolecules (Hoekstra
et al., 2001; Couee et al., 2006). These regulations were related to
abscisic acid (ABA), calcium-dependent protein kinase (CDPK),
NADP-malic enzyme (Shao et al., 2013) and phospholipid signaling
pathways (Zhu, 2002). Overexpression of key genes in these path-
ways, such as DREB transcription factor, enhanced drought toler-
ance in Arabidopsis and Lotus corniculatus (Zhou et al., 2012). In
addition, overexpression of soybean ubiquitin-conjugating enzyme
gene GmUBC2 can enhance drought tolerance by modulating
abiotic stress-responsive genes expression in Arabidopsis (Zhou
et al., 2010). Since drought stress doubtless generates reactive ox-
ygen species (ROS) in chloroplasts and mitochondria (Apel and Hirt,
2004; Asada, 2006), so ROS-scavenging enzymes play important
roles in drought tolerance responses. ROS-scavenging systems
Abbreviations: ACAT, acetyl-CoA C-acetyltransferase; APX, ascorbate peroxidase;
CAT, catalase; CDPK, calcium-dependent protein kinase; COA, a long-chain-fatty-
acyl-CoA reductase; dww, day without water; MDA, malondialdehyde; POD,
peroxidase; ROS, reactive oxygen species; RWC, relative water content; SOD,
superoxide dismutase.
*Tel.: þ86 898 23300459; fax: þ86 898 23300315.
E-mail address: lfngwang@yahoo.com.
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry
journal homepage: www.elsevier.com/locate/plaphy
http://dx.doi.org/10.1016/j.plaphy.2014.08.012
0981-9428/©2014 Elsevier Masson SAS. All rights reserved.
Plant Physiology and Biochemistry 83 (2014) 243e249
included superoxide dismutase (SOD), peroxidase (POD), ascorbate
peroxidase (APX), monodehydroascorbate reductase (NADH),
catalase (CAT), etc. Natural rubber is obtained from para rubber tree
(Hevea brasiliensis Muell. Arg.). Rubber tree originated from the
Amazon basin in South America. This area falling between equator
and 15
S is characterized by a wet equatorial climate (Gonçalves
et al., 2009). The optimal growth conditions of rubber tree are
high temperature around 28 ±2
C and high humidity about
2000e4000 mm rainfall per annum (Webster and Baulkwill, 1989;
Priyadarshan et al., 2005). However, unlike traditional plantations
in south America and southeast Asia, rubber tree planting in these
marginal areas or non-traditional rubber-growing regions, such as
northeastern states of India, south China, north and northeast
Thailand, usually faces abiotic stress like drought, strong winds, and
low temperature, etc. Drought stress results in growth retardation
of both rubber tree seedlings and mature tapping trees, shortening
tapping period, blocking latex flow for low water supply, decreasing
dry latex contents, increasing TPD (tapping panel dryness) occur-
rence, and even causes tree death at severe conditions (Huang and
Pan, 1992).
Many strategies and indices were used for selecting and
breeding drought-tolerant rubber tree clones, such as drought-
tolerant rootstock (Ahamad, 1999), leaves with more epicuticular
waxes (Gururaja Rao et al., 1988), etc. Hydraulic mechanism was
used for explaining drought tolerance mechanism in rubber tree
(Ayutthaya et al., 2011). The development of molecular biological
techniques in rubber tree provides new functional genes to extend
our insights of drought tolerance mechanism. Recently, HbCuZnSOD
and HbMnSOD have been cloned in rubber tree, and over-
expression of HbCuZnSOD in rubber tree clone PB260 conferred
enhanced drought tolerance (Leclercq et al., 2012). These results
indicated that ROS-scavenging enzymes played crucial roles in
drought tolerance mechanisms. Representative genes in mito-
chondria, such as HbAPX, an ascorbate peroxidases gene (Mai et al.,
2009), and HbATP (Chye and Tan, 1992) were cloned. However, in
rubber tree, the functions of most ROS related genes in drought
resistance mechanism were not well identified. In this study, ex-
pressions of 8 genes involved in energy biosynthesis and ROS
scavenging systems were characterized under drought treatment in
seedlings of rubber tree clone GT1. The underlying drought toler-
ance mechanism in rubber tree was discussed.
2. Methods
2.1. Plant material and drought treatment
Rubber tree clone GT1 (original clone breed in Indonesia)
seedlings were grown in the plastic pots in the chamber with
vermiculite and turfy soil (1:3) at the experimental farm of the
Chinese Academy of Tropical Agricultural Sciences in Danzhou city,
Hainan province, China (19
51
0
51N; 109
55
0
63E). In growing sea-
son, the average temperature was about 30
C, precipitation was
about 180 mm, and humidity was around 97.5%. Seedlings with two
growth units of leaves were subjected to progressive drought by
withholding water, and the leaves in dark green stage were
collected at different time points after treatment and used for
following assay.
2.2. Relative water content
The fresh weight, dry weight and saturated weight of treated
leaves were measured. RWC (relative water content) of leaves was
calculated according to formula: 100 [(fresh weightedry weight)/
(saturated weight edry weight)].
2.3. Determination of chlorophyll (Chl) content
Chlorophyll was extracted with 80% ice cold acetone from 0.1 g
leaves samples. The extract was measured spectrophotometrically
at 475, 645 and 663 nm with spectrophotometer (GE Ultrospec™
2100 pro UV/visible, USA), respectively. Specific chlorophyll and
b
-carotene contents were determined according to the reported
method (Lichtenthaler, 1987).
2.4. Measurements of activities of SOD and POD
SOD (EC 1.15.1.1) was prepared by first freezing 0.5 g of leaves
sample in liquid nitrogen to prevent proteolytic activity, followed
by grinding with 5 ml extraction buffer (0.1 M phosphate buffer, pH
7.5, containing 0.5 mM EDTA, and 1 mM ascorbic acid). Brie was
centrifuged for 20 min at 15 000 g and the supernatant was used as
an enzyme. The soluble proteins concentration in the supernatant
were determined using the method of Bradford with bovine serum
albumin (BSA) as standard (Bradford, 1976). The per unit activity of
SOD was estimated by recording the decrease in optical density of
nitro blue tetrazolium (NBT) induced by the enzyme (Dhindsa et al.,
1981). 3 ml of the reaction mixture contained 13 mM methionine,
75
m
M nitroblue tetrazolium chloride, 0.1 mM EDTA, 50 mM
phosphate buffer (pH 7.8), 50 mM sodium carbonate, and 0.1 ml
enzyme solution. The reaction was started by adding 2
m
M ribo-
flavin. The reaction mixtures were illuminated for 15 min at
90
m
mol m
2
s
1
(placing the test tubes under two 15 W fluorescent
lamps). A complete reaction mixture without enzyme, which gave
the maximal colour, was served as the control. The reaction was
stopped by switching off the light and putting the tubes into dark.
A non-irradiated complete reaction mixture was served as a blank.
POD (EC 1.11.1.7) activity was determined with spectropho-
tometer. 0.5 g leaves sample was extracted with 5 ml 100 mM
phosphate buffer (pH 6.0). Homogenate was centrifuged at 4000 g
for 10 min. Reaction mixture was 50 ml 100 mM phosphate buffer
(pH 6.0) with 23 mM guaiacol and 1.8 mM hydrogen peroxide. 1 ml
supernatant was added into 3 ml reaction mixture. The change of
OD was recorded at 470 nm. The per unit activity of enzyme was
defined as the increase of 0.1
D
OD per minute.
2.5. Measurement of malondialdehyde (MDA) content
MDA content was determined by the thiobarbituric acid reac-
tion (Peever and Higgins, 1989). 1.0 g freshleaves sample was ho-
mogenized in 5 ml 0.1% (w/v) trichloroacetic acid (TCA). The
homogenate was centrifuged at 10 000 g for 5 min and 4 ml of 20%
TCA containing 0.5% (w/v) thiobarbituric acid (TBA) were added to
1 ml of the supernatant. The mixture was heated at 95
C for 30 min
and then quickly cooled on ice. The contents were centrifuged at
10 000 g for 15 min and absorbance of the supernatant at 532 and
600 nm was read. After subtracting the non-specific absorbance at
600 nm, the MDA concentration was determined by its extinction
coefficient of 155 mM
1
cm
1
.
2.6. Analysis of soluble sugar content
Soluble sugar content was measured by referring to (Creelman
et al., 1990). Take 0.1 g of leaf samples and put it into centrifuging
tubes with a volume of 10 ml. Add 5 ml of 80% alcohol to the tube
and heat it in water for 30 min at 80
C. Then cool down the tube
and centrifuge it at 1000 g for 10 min. Soluble sugar content was
determined by the phenol-sulfuric acid method.
L.-f. Wang / Plant Physiology and Biochemistry 83 (2014) 243e249244
2.7. Determination of free proline content
Proline was determined following (Bates et al., 1973). Briefly,
0.5e1.0 g leaves was homogenized in 10 ml of 3% sulfosalicylic acid
and the homogenate filtered. The filtrate (2 ml) was treated with
2 ml acid ninhydrin and 2 ml of glacial acetic acid, then with 4 ml of
toluene. Absorbance of the colored solutions was read at 520 nm
with spectrophotometer.
2.8. Gene expression analysis by real-time PCR
Total RNA was extracted from leaves according to the methods
of (Qin, 2013). The quality and concentrations of the extracted RNA
were detected by agarose gel electrophoresis and measured by
a spectrophotometer. First strand cDNA was synthesized from 2
m
g
of total RNA with MMLV reverse transcriptase and random hexamer
primer (Takara) according to the manufacturer's instruction. The
cDNA was diluted 1:20 with nuclease-free water. Aliquots of the
same cDNA sample were used for real-time PCR with primers
designed for the selected genes, and 18S rRNA (Hb18SRNA) was used
as a house-keeping gene (Table 1). The PCR reaction was performed
in a 20
m
L reaction mixture containing 200 nM of each primer,
1SYBER Green PCR Master Mix (Takara), and about 30 ng cDNA.
Real-time RT-PCR was performed using the Bio-RAD CFX96 system
(BioRAD, Hercules, CA, USA). The reactions were carried out as
follows: 3 min at 95
C for denaturation, 10 s at 94
C, 20 s at 60
C,
and 30 s at 72
C for amplification for 45 cycles. The relative
abundance of transcripts was calculated according to the Software
instructions in Bio-RAD CFX96 Manager. The specificity of each
primer pairs was verified by determining the melting curve at the
end of each run and sequencing the amplified bands from gel
electrophoresis.
2.9. Statistical analysis
All data were analyzed with IBM-SPSS analytical software
package version 20.0 (IBM Corporation, USA). One-way ANOVA and
Tukey text were used to assess the different level. P<0.01 (prob-
ability level) was considered significant difference. Figures were
drawn by Origin data analysis and graphing software, OriginPro 9.1
(OriginLab Corporation, USA). For real-time PCR analysis, each
value was the average of two biological replicates tested in tripli-
cate, and for the other analyses, 6 replicate samples tested in
replicate were used.
3. Results
3.1. The effect of drought stress on relative water, chlorophyll, and
b
-carotene contents in the leaves of rubber tree
The relative water content (RWC) is a key indice for drought
stress study. As showed in Fig. 1, the RWC in the seedling leaves of
rubber tree clone GT1 was continuously decreased with the severity
of drought stress. It decreased by almost 20% at 9 day without water
(dww) compared with that at 0 dww. A wilting phenotype was
observed in leaves at 7 dww. Since photosynthesis in plants is
dependent on capturing light energy in the pigment chlorophyll,
and
b
-carotene (
b
-Car) is a pigment which assists in light absorption
and energy dissipation in chloroplasts. So drought tolerance of
rubber tree was tested by evaluating photosynthesis, especially
contents of chlorophylls and
b
-carotene under drought stress. Total
chlorophyll content was significantly increased at 1 dww, but
showed a sharp decrease at 3 dww, and kept a low level until 9 dww.
This variation was associated with both Chl a and Chl b, since sig-
nificant change was observed in Chl a and b during drought stress.
The ratio of Chl a/b was increased until 5 dww, and then decreased
from 7 to 9 dww. Since most Chl a located in the reaction center
chlorophylleprotein complex, and most Chl b located in light har-
vesting chlorophylleprotein complex, the attenuations of Chl a, Chl
Table 1
Information of primers used in this study.
Genes Accession
number
Primer sequences (5
0
e3
0
) Amplification
length (bp)
Amplification
efficiency
Reference
HbCOA AY461413 Forward: GGTGACATGGTGGTGAAT
Reverse: TGAAGTGACGAATGAGGTAA
145 1.872 ±0.0183 (Deng et al., 2012)
HbACAT AF429387 Forward: GAGTATCCAGTTAGGCATCA
Reverse: CTAGTGAATCATGTCCAAGTC
119 1.918 ±0.0099 Direct submission
HbAPX AF457210 Forward: CCAACTGACACCGTTCTT
Reverse: CAGCACCATCCTCTACATC
164 1.815 ±0.0067 (Mai et al., 2009)
HbATP X58498 Forward: GCTTCACGCAGACTATTATC
Reverse: TAGAGGATGGAGATGAGGAA
112 1.809 ±0.0079 (Chye and Tan, 1992)
HbCAT AF151368 Forward: GGTATTGTGGTTCCTGGTAT
Reverse: ATGGTGATTGTTGTGATGAG
153 1.877 ±0.0093 Direct submission
HbCuZnSOD AF457209 Forward: GTCCAACCACCGTAACTG
Reverse: GCCATCATCACCAACATTG
200 1.901 ±0.0109 Direct submission
HbMnSOD L11707 Forward: TGTGCTGTAATGTTGACCTA
Reverse: GTTCACCTGTAAGTAGTATGC
128 1.873 ±0.00139 (Miao and Gaynor, 1993)
HbRbsS M60274 Forward: GCCAAGGAAGTTGAATACC
Reverse: CCAGTAACGACCATCATAGT
123 1.794 ±0.0256 (Chye et al., 1991)
Hb18SRNA AY435212 Forward: GCTCGAAGACGATCAGATACC
Reverse: TTCAGCCTTGCGACCATAC
146 2.062 ±0.011 Direct submission
Fig. 1. Relative water content in rubber tree GT1 seedling leaves after withholding
water Values represent the mean ±SD of 6 replicate samples tested in replicate.
L.-f. Wang / Plant Physiology and Biochemistry 83 (2014) 243e249 245
b, and Chl a/b were resulted by the degradation of chlor-
ophylleprotein complex under severe drought condition. The
b
-Car
content was increased slightly at 1 dww, but quickly decreased from
3 dww (Fig. 2). These results suggested that
b
-Car did not take part in
quenching excess excitedenergy af ter chlorophylleprotein complex
broken down under drought stress in rubber tree.
3.2. The effect of drought stress on membrane oxidation and
osmosis indices
Since MDA, a cytotoxic product of lipid peroxidation is generally
taken as an index of ROS level. Therefore, the change of MDA
content in the leaves of rubber tree was determined to reveal the
level of ROS under drought stress. As showed in Fig. 3, MDA content
in leaves was continuously increased as prolonged drought stress.
However, proline content increased slightly at 1 dww, but dropped
at 3 dww, and then underwent a sudden increase at 9 dww. As for
the soluble sugar content, it reduced by nearly 50% at 1 dww, but
recovered to the untreated level (0 dww) at 3 dww, then decreased
from 5 to 7 dww, and suddenly increased at 9 dww. Under drought
stress condition, the accumulation of MDA usually leads to the
damage of cell membrane in plant and animal. Changes of MDA and
RWC suggested that drought induced osmotic stress response
in rubber tree seedlings. However, the soluble sugar took part in
drought response as we previously found in chilling stress response
(Luo et al., 2012). The plant POD enzyme can decompose hydrogen
peroxide, decrease oxygen radical production, and prevent plant
damaged by peroxide. Under drought stress, POD activity increased
slightly at 1 dww, but experienced a continuous decrease from 3 to
9 dww. The SOD activity increased at 3 dww, but decreased from 5
to 9 dww. These suggested that rubber tree seedling was suscep-
tible to drought stress, and the protection role of physiological
responses only lasted for 3e5 days after withholding water.
3.3. Expressions of key genes involved in energy biosynthesis and
ROS scavenging under drought stress
As showed in Fig. 4, drought stress induced the transcripts of
antioxidative enzyme genes HbAPX,HbCAT,HbCuZnSOD, and
HbMnSOD with nearly the same pattern. Their expressions reached
a maximum (100-fold over the untreated control) at 3 dww after
withholding water. The expression patterns of ROS scavenging
systems related genes were coincided with variations in their
enzyme activities. For instance, the gene expression of HbCuZnSOD
and HbMnSOD were reached their peaks at 3 dww, while SOD
enzyme activities were highest at 3 dww.
Fig. 2. Contents of chlorophylls and
b
ecarotene after withholding water Values
represent the mean ±SD of 6 replicate samples tested in replicate.
Fig. 3. Changes of physiological indices in rubber tree after withholding water Values represent the mean ±SD of 6 replicate samples tested in replicate. Bars with different
uppercase letters show significant differences at the P<0.01 level.
L.-f. Wang / Plant Physiology and Biochemistry 83 (2014) 243e249246
Expressions analyses of energy biosynthesis related genes
revealed that HbCOA,HbRbsS, and HbACAT transcripts were
increased at the first 3 dww, but decreased from 5 dww. HbATP
showed instant response at 1 dww then attenuate its gene
expression from 3 dww. These suggested that these genes involved
in energy biosynthesis and ROS scavenging were response to
drought stress, and drought stress responses were occurred at 3e5
days after withholding water in rubber tree seedling.
4. Discussion
4.1. Short-term drought stress caused leaves dysfunction in rubber
tree seedlings
In the sub-optical rubber tree plantation in China, drought
inhibits rubber tree growth. Research on rubber tree drought
resistance mechanism mainly concentrated in the area of anatomy
and physiological response (Nair et al., 1996). The effect of drought
varied on different physiological metabolism in various growth and
development stages of rubber tree (Devakumar et al., 1988). Tran-
spiration coefficient (Nair et al., 1996), membrane integrity (Reddy,
2000), osmoregulation, laticifer turgor pressure (Ranasinghe and
Milburn, 1995), low solute potential (Ayutthaya et al., 2011) were
found related to drought tolerance in rubber tree. Drought signifi-
cantly reduced the relative growth rate and RWC, and inhibited
photosynthesis in plant seedlings (Li et al., 2011). Our studies found
similar physiological responses in rubber tree seedlings under
drought stress (Figs. 1 and 3). Under stresses conditions, the accu-
mulation of MDA usually leads to the damage of cell membrane in
plant and animal. The increase of MDA content was coincided to
broken down in rubber tree seedlings. Besides of RWC, changes of
chlorophyll contents also indicated that drought reshaped the
structure of chloroplasts, and influenced photosynthesis and
HbRbsS gene expression (Figs. 2 and 5). Similar results were
confirmed by wheat leaves under moderate drought stress, which
found that thylakoid lumen acidification in drought-stressed leaves
could be associated with the activity of an enhanced fraction of PSI.
4.2. Osmoregulation was a physiological response to drought stress
in rubber tree
The accumulation of proline was involved in regulating the os-
motic. The accumulation of proline in leaves of rubber tree seedlings
at later stage after withholding water suggested that rubber tree
seedlings had the ability to regulate the osmotic under drought
stress. Stress situations where soluble sugars are involved, such as
chilling, herbicide injury, or pathogen attack, are related to impor-
tant changes in reactive oxygen species balance (Couee et al., 2006).
Fluctuations of soluble sugar content in rubber tree seedlings under
drought stress suggested that soluble sugar involved in the drought
tolerance. These results were similar with our previous study in
rubber tree seedling under chilling stress. These results suggested
its soluble sugar play an important role in osmoregulation under
drought stress in rubber tree seedlings rather than proline.
4.3. ROS scavenging systems related genes function earlier than
physiological responses under drought stress but limited by ATP
formation
The effect of drought on chloroplasts and mitochondria were
well documented (Bigras, 2005). Changes of chlorophyll contents
and gene expression of HbRbsS indicated that the integrity of
chloroplast had been broken down under drought stress. The
important role of chloroplasts and mitochondria is ATP generation.
HbATP gene encodes the beta subunit of mitochondrial ATP syn-
thase (EC 3.6.3.14), which is the most commonly used “energy
currency”of cells in most organisms. HbCOA encodes a long-chain-
fatty-acyl-CoA reductase (EC 1.2.1.50), which takes part in biosyn-
thesis of secondary metabolites and cuticular wax biosynthesis.
HbACAT encodes an acetyl-CoA C-acetyltransferase (EC 2.3.1.9),
Fig. 4. Expressions of ROS scavenging systems related genes HbAPX,HbCAT,HbCuZnSOD, and HbMnSOD after withholding water Values represent the mean ±SD of two
biological replicates tested in triplicate. Bars with different uppercase letters show significant differences at the P<0.01 level.
L.-f. Wang / Plant Physiology and Biochemistry 83 (2014) 243e249 247
which mainly takes part in fatty acid and amino acid metabolism.
Drought influenced mitochondria function since decreases of
HbATP,HbCOA and HbACAT transcripts were occurred from 3 to
5 dww (Fig. 5.). These suggested that drought induced several
metabolism pathways synchronously but first inhibited energy
formation.
ROS may play two different roles: exacerbating damage or
activating defense responses. The numerous ROS generation
sources and complex scavenging systems provide the flexibility
necessary for these functions (Dat et al., 2000). Mitochondria is
an important place for ROS production in cell (Møller, 2001). The
intimate relationship between antioxidant enzyme activities and
drought stress were found in woody plant in karst habitats in
Southern China. Transcripts of CAT,MnSOD,andCuZnSOD are
likely to reflecting the ability of mitochondria to scavenging ROS
and delaying the aging process. In this study, we found that the
changes of ROS scavenging related genes expressions was tightly
related to the changes of corresponding enzymes activities.
MnSOD is an integral mitochondrial protein known as a first-line
antioxidant defense against superoxide radical anions produced
as by-products of the electron transport chain. In our study,
HbMnSOD gene expression was later than that of HbCuZnSOD
gene expression. These suggested that HbCuZnSOD was more
important for drought resistance in rubber tree clone GT1, which
was similar with previous study in rubber tree clone PB260
(Leclercq et al., 2012).
5. Conclusion
Taken together, these results suggested that rubber tree seedling
was susceptible to drought stress, and the protection role of
physiological and molecular responses only lasted for 3e5 days
after withholding water. Moreover, adaptation to drought stress
was a complex process involved in osmoregulation, antioxidative
enzymes and energy biosynthesis related genes in mitochondria
and chloroplasts in rubber tree seedling.
Acknowledgments
This work was supported by the National Natural Science
Foundation of China (31270643); the Earmarked Fund for Modern
Agro-industry Technology Research System (CARS-34-GW5) and
Natural Science Foundation of Hainan province (310096).
Contributions
Conceived and designed the experiments: LF Wang. Performed
the experiments: LF Wang. Analyzed the data: LF Wang. Wrote the
paper: LF Wang.
References
Ahamad, B., 1999. Effect of rootstock on growth and water use efficiency of Hevea
during water stress. J. Rubber Res. 2, 99e119.
Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and
signal transduction. Annu. Rev. plant biol. 55, 373e399.
Asada, K., 2006. Production and scavenging of reactive oxygen species in chloro-
plasts and their functions. Plant Physiol. 141, 391e396.
Ayutthaya, S.I.N., Do, F.C., Pannangpetch, K., Junjittakarn, J., Maeght, J.-L.,
Rocheteau, A., Cochard, H., 2011. Water loss regulation in mature Hevea brasi-
liensis: effects of intermittent drought in the rainy season and hydraulic regu-
lation. Tree physiol. 31, 751e762.
Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline for
water-stress studies. Plant Soil. 39, 205e207.
Bigras, F.J., 2005. Photosynthetic response of white spruce families to drought
stress. New. For. 29, 135e148.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-
gram quantities of protein utilizing the principle of protein-dye binding. Anal.
Biochem. 72, 248e254.
Brestic, M., Zivcak, M., Kalaji, H.M., Carpentier, R., Allakhverdiev, S.I., 2012. Photo-
system II thermostability in situ: environmentally induced acclimation and
genotype-specific reactions in Triticum aestivum L. Plant physiol. Biochem. PPB/
Soc. francaise De. physiologie Veg. 57, 93e105.
Chye, M.L., Tan, C.T., 1992. Isolation and nucleotide sequence of a cDNA clone
encoding the beta subunit of mitochondrial ATP synthase from Hevea brasi-
liensis. Plant Mol. Biol. 18, 611e612.
Chye, M.L., Tan, S., Tan, C.T., Kush, A., Chua, N.H.i., 1991. Nucleotide sequence of a
cDNA clone encoding the precursor of ribulose-1, 5-bisphosphate carboxylase
Fig. 5. Expressions of energy biosynthesis related genes HbCOA,HbATP,HbRbsS, and HbACAT after withholding water Values represent the mean ±SD of two biological
replicates tested in triplicate. Bars with different uppercase letters show significant differences at the P<0.01 level.
L.-f. Wang / Plant Physiology and Biochemistry 83 (2014) 243e249248
small subunit from Hevea brasiliensis (rubber tree). Plant Mol. biol. 16,
1077 e1078 .
Couee, I., Sulmon, C., Gouesbet, G., El Amrani, A., 2006. Involvement of soluble
sugars in reactive oxygen species balance and responses to oxidative stress in
plants. J. Exp. bot. 57, 449e459.
Creelman, R.A., Mason, H.S., Bensen, R.J., Boyer, J.S., Mullet, J.E., 1990. Water deficit
and abscisic acid cause differential inhibition of shoot versus root growth in
soybean seedlings: analysis of growth, sugar accumulation, and gene expres-
sion. Plant Physiol. 92, 205e214.
Dat, J., Vandenabeele, S., Vranova, E., Van Montagu, M., Inze, D., Van Breusegem, F.,
2000. Dual action of the active oxygen species during plant stress responses.
Cell. Mol. life Sci. : CMLS 57, 779e795.
Deng, L.H., Luo, M.W., Zhang, C.F., Zeng, H.C., 2012. Extraction of high-quality RNA
from rubber tree leaves. Biosci. Biotechnol. Biochem. 76, 1394e1396.
Devakumar, A., Gururaja Rao, G., Rajagopal, R., Sanjeeva Rao, P., George, M.,
Vijayakumar, K., Sethuraj, M., 1988. Studies on soil-plant-atmosphere system in
Hevea: II. Seasonal effects on water relations and yield. Indian J. Nat. Rubber Res.
1, 45 e60.
Dhindsa, R.S., Plumb-Dhindsa, P., Thorpe, T.A., 1981. Leaf senescence: correlated
with increased levels of membrane permeability and lipid peroxidation, and
decreased levels of superoxide dismutase and catalase. J. Exp. bot. 32, 93e101.
Gonçalves, P.d.S., Aguiar, A.T.d.E., Costa, R.B.d., Gonçalves, E.C.P., Scaloppi Júnior, E.J.,
Branco, R.B.F., 2009. Genetic variation and realized genetic gain from rubber
tree improvement. Sci. Agric. 66, 44e51.
Gururaja Rao, G., Devakumar, A., Rajagopal, R., Annamma, Y., Vijayakumar, K.,
Sethuraj, M., 1988. Clonal variations in leaf epicuticular waxes and reflectance:
possible role in drought tolerance in Hevea. Indian J. Nat. Rubb Res. 1, 84e87.
Hoekstra, F.A., Golovina, E.A., Buitink, J., 2001. Mechanisms of plant desiccation
tolerance. Trends Plant Sci. 6, 431e438.
Huang, Z.D., Pan, Y.Q., 1992. Rubber Cultivation Under Climatic Stresses in China.
Elsevier, Amsterdam.
Leclercq, J., Martin, F., Sanier, C., Cl
ement-Vidal, A., Fabre, D., Oliver, G., Lardet, L.,
Ayar, A., Peyramard, M., Montoro, P., 2012. Over-expression of a cytosolic iso-
form of the HbCuZnSOD gene in Hevea brasiliensis changes its response to a
water deficit. Plant Mol. Biol. 80, 255e272.
Li, Y., Zhao, H.X., Duan, B.L., Korpelainen, H., Li, C.Y., 2011. Effect of drought and ABA
on growth, photosynthesis and antioxidant system of Cotinus coggygria seed-
lings under two different light conditions. Environ. Exp. Bot. 71, 107e113.
Lichtenthaler, H.K., 1987. Chlorophylls and carotenoids: Pigments of photosynthetic
biomembranes. Methods Enzymol. 148, 350e382.
Luo, P., He, J.J., Yao, Y.L., Dai, X.H.,Cheng, R.X., Wang, L.F., 2012. Differential responses
of two rubber tree clones to chilling stress. Afr. J. Biotechnol. 11, 13466e13471.
Mai, J., Herbette, S., Vandame, M., Kositsup, B., Kasemsap, P., Cavaloc, E., Julien, J.L.,
Am
eglio, T., Roeckel-Drevet, P., 2009. Effect of chilling on photosynthesis and
antioxidant enzymes in Hevea brasiliensis Muell. Arg. Trees 23, 863e874.
Miao, Z.H., Gaynor, J.J., 1993. Molecular cloning, characterization and expression of
Mn-superoxide dismutase from the rubber tree (Hevea brasiliensis). Plant Mol.
Biol. 23, 267e277.
Møller, I.M., 2001. Plant mitochondria and oxidative stress: electron transport,
NADPH turnover, and metabolism of reactive oxygen species. Annu. Rev. Plant
Biol. 52, 561e591.
Monclus, R., Dreyer, E., Villar, M., Delmotte, F.M., Delay, D., Petit, J.M., Barbaroux, C.,
Le Thiec, D., Brechet, C., Brignolas, F., 2006. Impact of drought on productivity
and water use efficiency in 29 genotypes of Populus deltoides xPopulus nigra.
New. Phytol. 169, 765e777.
Nair, D.B., Dey, S.K., Rajagopal, R., Vijayakumar, K.R., Sethuraj, M.R.,1996. Synergistic
effect of heat and osmotic stress in causing membrane injury in Hevea brasi-
liensis. J. Plant Biol. 39, 177e181.
Peever, T.L., Higgins, V.J., 1989. Electrolyte leakage, lipoxygenase, and lipid peroxi-
dation induced in tomato leaf tissue by specific and nonspecific elicitors from
Cladosporium fulvum. Plant Physiol. 90, 867e875.
Priyadarshan, P.M., Hoa, T.T.T., Huasun, H., de Gonçalves, P.S., 2005. Yielding po-
tential of rubber (Hevea brasiliensis) in sub-pptimal environments. J. Crop
Improv. 14, 221e247.
Qin, B., 2013. The function of Rad6 gene in Hevea brasiliensis extends beyond DNA
repair. Plant physiol. Biochem. PPB/Soc. francaise De. physiologie Veg. 66,
134 e140.
Ranasinghe, M.S., Milburn, J.A., 1995. Xylem conduction and cavitation in Hevea
brasiliensis. J. Exp. bot. 46, 1693e1700.
Reddy, Y., 2000. Effect of moisture stress on stability of membrane integrity in
Hevea brasiliensis across temperature regimes. Indian J. For. 23, 110e111.
Rhodes, D., Hanson, A., 1993. Quaternary ammonium and tertiary sulfonium com-
pounds in higher plants. Annu. Rev. Plant Biol. 44, 357e384.
Shao, H.B., Liu, Z.H., Zhang, Z.B., Chen, Q.J., Chu, L.Y., Brestic, M., 2013. Biological
roles of crop NADP-malic enzymes and molecular mechanisms involved in
abiotic stress. Afr. J. Biotechnol. 10, 4947e4953.
Webster, C.C., Baulkwill, W.J., 1989. Rubber. Longman scientific&technical.
Yan,K.,Shao,H.,Shao,C.,Chen,P.,Zhao,S.,Brestic,M.,Chen,X.,2013.Physio-
logical adaptive mechani sms of plants grown in saline soil and implications
for sustainable saline agriculture in coastal zone. Acta Physiol. Plant. 35,
2867e2878.
Zeppel, M.J., Anderegg, W.R., Adams, H.D., 2013. Forest mortality due to drought:
latest insights, evidence and unresolved questions on physiological pathways
and consequences of tree death. New. phytol. 197, 372e374.
Zhou, Y.H., Lam, H.M., Zhang, J.H., 2007. Inhibition of photosynthesis and energy
dissipation induced by water and high light stresses in rice. J. Exp. Bot. 58,
1207e1217.
Zhou, G.A., Chang, R.Z., Qiu, L.J., 2010. Overexpression of soybean ubiquitin-
conjugating enzyme gene GmUBC2 confers enhanced drought and salt toler-
ance through modulating abiotic stress-responsive gene expression in Arabi-
dopsis. Plant Mol. Biol. 72, 357e367.
Zhou, M.L., Ma, J.T., Zhao, Y.M., Wei, Y.H., Tang, Y.X., Wu, Y.M., 2012. Improvement of
drought and salt tolerance in Arabidopsis and Lotus corniculatus by over-
expression of a novel DREB transcription factor from Populus euphratica. Gene
506, 10e17.
Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev.
Plant Biol. 53, 247e273.
Zivcak, M., Kalaji, H.M., Shao, H.B., Olsovska, K., Brestic, M., 2014. Photosynthetic
proton and electron transport in wheat leaves under prolonged moderate
drought stress. J. Photochem. Photobiol. B Biol. 137, 107e115.
L.-f. Wang / Plant Physiology and Biochemistry 83 (2014) 243e249 249
