Content uploaded by Leo H. Koole
Author content
All content in this area was uploaded by Leo H. Koole on Aug 02, 2023
Content may be subject to copyright.
Sander Croes
Staphylococcus aureus biofilm
ISBN/EAN 978-94-6159-136-4
© Sander Croes, Maastricht
All rights reserved. No part of this thesis may be reproduced, stored in a retrieval system or transmitted in any form
or by any means, electronic or mechanical, including photocopy, without prior written permission of the publisher
and copyright owner, or where appropriate, the publisher of the articles.
Cover design: Jona van Breemen
Printed by: Datawyse | Universitaire Pers Maastricht
Staphylococcus aureus biofilm
Proefschrift
ter verkrijging van de graad van doctor
aan de Universiteit Maastricht,
op gezag van de Rector Magnificus,
prof. mr. G.P.M.F. Mols,
volgens het besluit van het College van Decanen,
in het openbaar te verdedigen
op vrijdag 27 april 2012 om 12.00 uur
door
Sander Croes
geboren op 26 september 1978 te Gouda
UNIVERSITAIRE
PERS MAASTRICHT
U
P
M
Promotores
Prof. dr. C.A. Bruggeman
Prof. dr. C. Neef
Copromotor
Dr. E.E. Stobberingh
Beoordelingscommissie
Prof. dr. H.A.J. Struijker – Boudier (voorzitter)
Dr. D.C.J. J. Bergmans
Prof. dr. D.M. Burger (Radboud Universiteit Nijmegen)
Prof. dr. K.M.L. Leunissen
Contents
Chapter 1 General introduction and outline of the thesis 7
Chapter 2 Staphylococcus aureus biofilm formation at the physiologic glucose 27
concentration depends on the S. aureus lineage
Chapter 3 Unpredictable effects of rifampicin as adjunctive agent in elimination of 43
rifampicin-susceptible and -resistant Staphylococcus aureus grown in biofilm
Chapter 4 Hydrophilic surface coatings with embedded biocidal silver nanoparticles 57
and sodium heparin for central venous catheters
Chapter 5 Antimicrobial hydrophilic biomaterials for surface coatings 73
Synergy of embedded silver particles and heparin
Chapter 6 Large-scale evaluation of mutations in norA gene and its promoter leading to 93
overexpression of the multidrug efflux pump NorA in Staphylococcus aureus
Chapter 7 Inhibition of membrane-transporters as a potential approach against 107
Staphylococcus aureus biofilm is hampered by adaptation to nutrient availability
Chapter 8 Diminished in vitro antibacterial activity of oxacillin against clinical isolates 121
of borderline oxacillin resistant Staphylococcus aureus
Chapter 9 General discussion 13
Chapter 10 Summary 149
Nederlandse samenvatting 155
List of abbreviations 163
Dankwoord 167
Curriculum vitae 173
List of publications 175
5
7
CHAPTER 1
General introduction and outline of the thesis
Chapter 1
8
General introduction
9
Introduction
The biofilm mode of growth
Several characteristics of bacteria contribute to their survival strategy in the human host.
They have the ability to persist intracellulary within several types of non-professional
phagocytic cells1, specifically neutrophils2. Adhesins like fibronectin-binding protein A and
B (fnbpA/B) have been shown indispensable for adhesion to and internalization by these
cells1,3. The intracellular survival of Staphylococcus aureus relies on protective antioxidants2
such as catalase4, staphyloxanthin5 and the eponymous golden carotenoid pigment6,7.
Especially the small colony variants (SCVs) have been associated with intracellular survival,
probably due to their decreased metabolic activity and enhanced expression of adhesins8.
Other protection mechanisms of micro-organisms to circumvent host defenses and thera-
peutic intervention involve: (i), the expression of efflux pumps9,10; (ii), the (hy-
per)production of antibiotic degrading enzymes like beta-lactamases11; (iii), the formation
of capsular polysaccharides (CPs)12,13 – functioning as important cell wall components that
can resist uptake and killing by phagocytes14 – and the inhibition of antibody- and com-
plement-mediated phagocytosis15; (iv), the release of virulence factors15; (v), the modifica-
tion or genetic diversification of antibiotic target proteins such as penicillin-binding pro-
teins (PBPs)16; and (vi), the biofilm mode of growth.
During the last decade convincing evidence showed that the capability of bacteria to
form biofilm is of unprecedented importance in order to protect themselves against the
host immune system and antibiotics. Very likely, bacteria strike back by a mixture of strate-
gies, which could act synergistically. It is believed that conventional resistance mecha-
nisms also contribute to the success of biofilm communities17. For example, in case of
mucosal infections it has been noticed that biofilm aggregates attach to the epithelium to
reside in the mucus layer or sequestrate into intracellular aggregates for persistence18.
Demonstrated intracellular localisation of bacteria inside dysfunctional leucocytes en-
closed within a biofilm highlights the relevance of additionally employed strategies by
bacteria to limit the efficacy of antibiotics19. Another example of a mixed protection system
is the identification of a biofilm specific efflux pump in Pseudomonas aeruginosa17,20. How-
ever, the observation that the acquisition of plasmids bearing genes encoding for particu-
lar classes of beta-lactamases might lead to a reduced capacity to form biomass21, suggests
that gaining certain resistance genes could suppress other survival opportunities. Never-
theless, high levels of beta-lactamases entrapped within the biofilm matrix have been
observed due to secretion or lysis of biofilm-resident cells22,23.
Biofilm formation represents a protected mode of growth that allows bacterial cells to
stay alive in both hostile natural environments as in the human host24, and enables them
to disperse and colonize new niches whenever needed. Biofilm embedded bacteria are
therefore often causative for recurrent and persistent (or chronic) infections25. Biofilm are
mostly adhered to surfaces, including those from natural origin such as oral, respiratory,
corneal or urogenital epithelium. These tissues seem to be more prone to bacterial adher-
ence when altered or damaged26. Embedded micro-organisms on any surface constitute
Chapter 1
10
profound implications for the host, because the sessile micro-organisms that are surviving
in these matrix-enclosed aggregates are recalcitrant to antibiotic treatment and demon-
strate persistence in spite of sustained host defences18. Another critical issue of biofilm-
based infections is that biofilm can contain both multiple bacteria and fungi25,27. It is be-
lieved that micro-organisms inside these polymicrobial or multispecies communities gain a
fitness advantage28, possibly via the facilitation of microevolutionary processes and mutual
horizontal gene transfer29. However, model simulations suggest that within-species coop-
eration could enhance or disfavour the ability to compete with other species30. A known
negative interaction involves a subset of Staphylococcus epidermidis which can inhibit S.
aureus nasal colonization and consequently biofilm formation by secreting the serine
protease Esp31. Nevertheless, both species cooperated in biofilm infected arthroplasties32.
Biofilm formation has not only been demonstrated for S. aureus, but also for numerous
other pathogens. This thesis focuses on monospecies biofilm formation by S. aureus.
The development of biofilm is thought to consist of four consecutive stages: (i), initial
attachment to a foreign body or tissue; (ii), accumulation of extracellular polymeric sub-
stances and aggregation; (iii), biofilm maturation including expansion and channel forma-
tion; and (iv), dispersal. Dispersal involves the release of microbes from the biofilm, which
might start all over again the vicious cycle33.
Initial interactions with a surface are believed to occur via non-specific physiochemical
forces such as charge, van der Waals forces and hydrophobic interactions34. Initial adher-
ence has also been attributed to bacterial surface proteins35,36. Microbial surface compo-
nents recognizing adhesive matrix molecules (MSCRAMMs), surface-anchored adhesins
like, among others, fibronectin binding protein A and B (fnbpA/B)37,38, fibrinogen binding
protein (fbpA)39, clumping factor A and B (clfA/B)40, bone sialoprotein-binding protein
(bbp)41, serine-aspartate repeat-containing proteins C, D and E (sdrC/D/E)42, elastin-binding
protein (ebpS)43, collagen-binding adhesin (cna)44, biofilm-associated protein (bap)45,46,
laminin binding protein (eno)47 and other adhesins like staphylococcal protein A (spa)48,
autolysin adhesion protein (aaa)49, extracellular matrix binding homologue (ebh)50, ex-
tracellular fibrinogen-binding protein (efb)51, extracellular matrix binding protein (emp)51
and extracellular adherence protein (Eap)52 are utilized to initiate initial adherence or ag-
gregation and strongly adhere to surfaces with a conditioning film of environmental pro-
teins like fibrinogen, fibronectin, collagen and platelets48,52–54. Also non-proteinaceous
adhesions, comprising PIA (polysaccharide intercellular adhesin) and wall teichoic and
lipoteichoic acids, are able to participate in adherence55. Continued growth of bacterial
cells on a surface leads to the development of mature biofilm colonies containing tightly
packed cells gathered into pillar- and mushroom-shaped masses and surrounded by an
extracellular polymeric substance (EPS) matrix18,56. In case of S. aureus, the accumulated
extracellular material could consists of a combination of (i) selfproduced Poly-ß(1,6)-N-
acetyl-D-glucosamine (PNAG), also referred as slime or PIA57; (ii), extracellular DNA (eDNA)58
originated from a “sacrification” procedure called autolysis59–61; (iii), proteins34,62 (e.g. sur-
face protein G, SasG)63,64; (iv), cell wall teichoic acids34; (v), lipids65, and (vi), other substances
taken from the environment65. There is also some evidence that S. aureus can alternate the
General introduction
11
composition of the matrix, depending upon the extracellular niche66. Enzymes necessary to
synthesize PIA are normally not abundantly present67 due to generally low expression
levels of S. aureus encoded icaADBC within a biofilm66. Consequently, polysaccharide inde-
pendent S. aureus biofilm do also exist33,68. The embedded bacteria in matrix structures are
interspersed with fluid-filled channels which act as a primitive circulatory system, allowing
for the exchange of nutrients, oxygen and waste products with their environment34. As a
consequence of continuous adaptation to: (i), gradients in acidity; (ii), oxygen deficiency;
(iii), concentrations of bacterial extruded signalling molecules and waste materials; and (iv),
gradients in nutrient availability from the outer to the inner clusters of the interior of the
biofilm18,69, numerous micro-environments exist within the biofilm with bacterial cells in
fluctuating physiological states70. As a result of carbohydrate consumption during the
maturation phase, a stationary phase-like dormancy can be created71 due to nutrient
depleted zones and/or enhanced metabolic metabolites in the depths of the biofilm. Con-
sequently this may encourage the emergence of persister cells29,72, which mediates antibi-
otic resistance in biofilm embedded bacteria. Therefore, limited penetration of nutri-
ents73,74 and starvation29, rather than restricted antibiotic diffusion75–78, may contribute to
generalized resistance or tolerance to antibiotics18. The metabolically inactive cells are
especially located in the deeper interior of the biofilm. Although the matrix may not inhibit
the penetration of antibiotics into the biofilm altogether, it may retard the rate of penetra-
tion enough to induce the expression of a variety of genes within the biofilm that mediate
resistance. This would lead to species or antibiotic resistance specific related processes
such as the accumulation of antibiotic-degrading enzymes or the upregulation of efflux
pumps17. Whereas planktonic cells are considered rather as a homogeneous population,
biofilm cells are complex communities displaying structural, chemical and biological het-
erogeneity69.
Bacteria in biofilm also coordinate behaviour by cell–to–cell communication using se-
creted chemical signals, often referred as quorum sensing18,79,80. Although most of the
known quorum sensing signals are species specific, inter-species signalling has also been
discovered81. The opposite, quorum quenching, a process in which bacteria secrete en-
zymes that degrade the quorum-sensing signals of heterologous species has been de-
scribed as well30,81. The S. aureus quorum-sensing system is encoded by the accessory gene
regulator (agr) locus82 and the communication molecules that it produces and senses are
autoinducing peptides (AIPs)83, also referred as autoinducers or pheromones14,34. AIPs are
encoded by agrD and processed by agrB34,84. Upon reaching a critical concentration, AIPs
activate the two-component agrA-agrC system. The response regulator of this system,
agrA~P activates promoters P2 and P3 to transcribe RNAII encoding agrBDCA and the
effector molecule RNAIII, respectively85. RNAIII inhibits the expression of genes encoding
MSCRAMMs84,86, and stimulates the expression of genes encoding extracellular enzymes
and toxins82, and as a consequence the activated agr system downregulates biofilm forma-
tion in general34. It is clear that RNAIII is an important determinant of virulence. Activation
of the agr quorum sensing system is thought to be dependent on cell density84. Quorum
sensing might be essential for aggregation and biofilm maturation87, involving processes
as proliferation, accumulation and intercellular adhesion34. It definitely plays a crucial role
during the final stage of the biofilm lifecycle. This phase involves the detachment of cells
Chapter 1
12
via their own quorum sensing molecules initiated active dispersal56, which allows them to
colonize new locations and to reinitiate the biofilm developmental process88. Dispersal is
principally mediated via a functional and activated agr system34. Three distinct modes of
biofilm dispersal have been discerned: erosing, sloughing or clumping and swarming or
seeding dispersal56. Another form of shifting to a new habitat is ‘surface dispersal’, in which
biofilm structures move across surfaces89. Furthermore, cell-division-mediated dispersal
has been described56. Detachment can be caused by external perturbations, such as in-
creased fluid shear or by internal biofilm processes90. These processes occur in response to
the release of AIPs and the transcription of RNAIII83,85 and include the release of detach-
ment factors such as glucosidases, (extracellular) proteases (ECP)91–93 and deoxyribonucle-
ases , which are endogenous enzymatic degradation factors. Independently of
56 agr, the
staphylococcal accessory regulator (sarA) counteracts the production of ECPs (e.g. a metal-
loprotease aureolysin (aur), the two cysteine proteases staphopain A and B (sspB and scpA)
and the V8 serine protease (sspA))83 and nucleases94,95. Since ECPs also seem to play a role
in autolysis inhibition68,96, besides the suggested enhancement of MSCRAMM downregula-
tion92,96, the interplay between agr and sarA and its homologues is decisive for the switch
between biofilm formation (the adhesive phenotype) and dispersal97. During activation of
agr (the more invasive phenotype), toxin release is upregulated by RNAIII82 in conjunction
with the influence of sarA98. Another dispersal approach which also depends on the AIPs is
the release of surfactant-like molecules, the phenol soluble modulins (PSMs)34. The RNAIII
encoded δ-hemolysin (PSMγ, hld)84 and the hla-encoded α-toxin (α-hemolysin)99 belong
both to the PSMs and have strong surfactant properties100–102. Apart from that, like other
secreted exotoxins such as Panton-Valentine leukocidin (PVL), the alpha-type PSMs are
considered virulence determinants in the host-pathogen interrelationship. They induce
pore formation-mediated cytolysis of neutrophils and cause an inflammatory mediator
release103,104. Furthermore, it has been suggested that PSMα1–4 have a role in the interfer-
ence with competing colonizing pathogen105, contributing to the proposed competitive
ecological advantage of community-associated MRSA (CA-MRSA) lineages like
USA300106,107.
Elucidating the physiologies of biofilm-associated bacteria is necessary for our under-
standing of pathogenesis and to clarify the recalcitrance of these bacteria compared with
the resistance exhibited by their planktonic counterparts.
Clinical manifestation and implications of bacterial biofilm
Staphylococci are ubiquitous commensals of the skin and mucous membranes of humans.
S. aureus and the coagulase-negative staphylococci (CoNSs), in particular S. epidermidis, are
among the most leading causes of nosocomial infections108. Infections due to S. epidermidis
typically are more subacute or even chronic and emerge particularly among predisposed
or immunocompromised patients109. In contrast, the virulent pathogen S. aureus causes
more acute infections associated with the colonization of tissue or bone (marrow), such as
endocarditis or osteomyelitis, which may lead to sepsis. However, S. aureus is also a com-
mon cause of foreign-body-associated infections and, occasionally, S. epidermidis may
cause native valve endocarditis110. Nevertheless, biofilm formation is now recognized as
causing or exacerbating numerous chronic infections. It is estimated that approximately
General introduction
13
80% of all bacterial infections are biofilm mediated66,75, with periodontitis, colitis, vaginitis,
urethritis, conjunctivitis, chronic otitis media, chronic wound infections, recurrent urinary
tract infections (UTI), recurrent tonsillitis, dental caries and cavities, chronic rhinosinusitis,
cystic fibrosis associated pneumonia and device-related infections being just a summa-
rized list of common examples of biofilm-associated infections25,111. Difficulty in identifying
in vivo biofilm infections has led to the formulation of diagnostic criteria, which are dis-
played in Box 1.
Box 1. Diagnostic criteria for biofilm infections
criteria18,194
(1) Pathogenic bacteria are associated* with a surface.
(2) Direct examination of infected tissue demonstrates aggregated cells in cell clusters encased in a matrix,
which may be of bacterial and host origin.
(3) Infection is confined to a particular site in the host.
(4) Recalcitrance to antibiotic treatment despite demonstrated susceptibility of planktonic bacteria**
(5) Culture-negative result in spite of clinically documented high suspicion of infection (since localized
bacteria in a biofilm may be missed in a conventional blood sample or aspirate).
(6) Ineffective host clearance evidenced by the location of bacterial cell clusters (macrocolonies) in discrete
areas in the host tissue associated with host inflammatory cells.
*
**
The term ‘associated’ allows the inclusion of aggregates not necessarily firmly attached.
Since antibiotic susceptibility of planktonic cultures can only be tested upon positive culture from a
clinical specimen, it is suggested that in the absence of culture, recalcitrance to antibiotic therapy may be
inferred from the presence of live bacterial cells in the biofilm from in situ viability staining or reverse
transcription polymerase chain reaction (RT-PCR).
From a mature biofilm, individual cells or aggregates can detach. Upon dispersal, bacteria
disseminate via the blood stream, which is thought to lead to an extensive dissemination
of bacteria. For this reason bacteraemia is frequently associated with metastatic spread of
bacteria and particularly hard to treat circumstances. One of the measurements taken is
often the removal of the offending device/ foreign body, especially in case of intravascular
indwelling catheters. However, in case of implantable devices like hip or knee prostheses,
pacemakers or heart valves, removal is complicated and therefore appropriate treatment
options are greatly warranted. Various compounds ranging from chemical compounds like
efflux pump inhibitors112,113, N-acetylcysteine114, biocides115 including triclosan116 and chito-
san117,118 to more natural substances such as traditional Chinese medicine119, honey (propo-
lis)120,121, 3’-5’-cyclic diguanylic acid or abbreviated c-di-GMP (a signalling molecule ob-
tained from other biofilm producing pathogens)90,122, vaccines directed against PNAG33,123
or MSCRAMMs124, antibodies to quorum sensing molecules125, and maggot excretions126,127
have been tested successfully in vitro against S. aureus biofilm. Yet, there is a lack of ran-
domized clinical trials to demonstrate the efficacy of these agents for biomaterial-related
infections in vivo. In contrast to the absence of clinical trials for agents against biofilm-
contaminated devices, there is a wide variety of investigations going-on to search for the
based on the modified Parsek–Singh
Chapter 1
14
most appropriate way to modify biomaterials128 in such a manner that biofilm formation
could be prevented.
Prevention of biofilm formation
Biofilm formation can occur on natural tissue and on indwelling devices. Since biofilm
starts with attachment to a (a)biotic surface, prevention of initial adherence is the most
logical approach to prohibit biofilm formation. The ultimate goal is to obtain biomaterials
with anti-biofouling features which are fully refractory to microbial adhesion129. Modifica-
tion of biomaterials involves, in most circumstances, impregnation, surface antifouling
conditioning (by coating, e.g. through dipping, sputtering, spraying or solvent casting
procedures130), physico-chemical surface modification, polymer-brushes131,132 or the utiliza-
tion of micro-nanotopologies133. Ideally, drug-eluting carriers, drug-delivery or leaching
matrices with preferably controlled release should be manufactured134. Incorporation or
attachment of antiseptics132,135,136, antibiotics135,137,138, precious pure metals132,139–142, hepa-
rin132,135,143,144 and/or antimicrobial peptides145,146 has been applied. For instance, a com-
monly used impregnation for central venous catheters (CVCs) in clinical practice with the
intention to reduce bacterial colonization is the combination of chlorhexidine and silver-
sulfadiazine136,147,148. Prolonged application of CVCs and tip malpositioning are among risk
factors associated with the occurrence of catheter-related bloodstream infections (CRBSIs)
as a consequence of catheter colonization and/or exit-site contamination149,150. It is esti-
mated that almost 30–60% of all nosocomial bacteraemia originate from some sort of
(intra)vascular access device2,151. The incidence of CRBSIs can be as high as two to seven
episodes/cases per 1000 central line/catheter days in Western countries152, while the occur-
rence in developing countries is much higher (up to 40–60 episodes)153. In attempts to
reduce the incidence of CRBSIs, antiseptic or antibiotic impregnated or external and/or
lumen coated CVCs were introduced. Incorporation of antibiotics or antiseptics like chlor-
hexidine could be criticized since these might encourage the emergence of resistant mi-
cro-organisms137,154 or could induce anaphylaxis155. CRBSIs are related with (asymptomatic)
thrombogenic occlusion150, which might result in serious complications such as embolisa-
tion. Thrombus formation starts by enclosure of the CVC with a fibrin sheath149,156, which
promotes adherence of bacteria, concurrently150. Finally, these adhered bacteria might
enhance the thrombogenic cascade and may become embedded by a partially self pro-
duced exopolysaccharide matrix (biofilm formation), and consequently become exceed-
ingly difficult to eradicate afterwards.
Prevention of thrombotic complications by prescribing anticoagulant prophylaxis is
currently not recommended157,158, since it is often contraindicated due to the risk of major
bleeding in thrombocytopenic and renal impaired patients. Furthermore, there is absence
of consensus due to limited evidence whether it exerts a beneficial effect at all. Strict fol-
lowing hygiene protocols, adherence to aseptic techniques and using sterile barrier pre-
cautions during insertion of CVCs are among the best available preventive measurements
to reduce the number of CRBSIs150, but inadequate for full prevention. Also the application
of lock (flush) solutions with (antibiotics, taurolidine159–161, chelators like citrate162 or
EDTA163,164) or without (saline, heparin)165,166 antimicrobial substances has been advocated,
although the latter one is surrounded by concerns about increased risk of bleeding, induc-
General introduction
15
tion of thrombocytopenia166,167 and promotion of biofilm generation168. It is evident that
improvement in the biomaterial itself leads to better biocompatibility. In order to reduce
the necessity for early removal of CVCs, the surfaces/interfaces should be practically non-
thrombogenic and must exhibit strong anti-adhesive or biocidal capacities simultaneously.
Disintegration of the biofilm matrix
Under circumstances where biofilm formation could not be prevented, biofilm have to be
destructed. For this reason, other treatment modalities beside the prevention strategy of
modification of biomaterials are greatly warranted to combat biofilm associated infections.
It is believed that disintegrating agents to obtain passive dispersal should be combined
with antimicrobial compounds to overcome the risk of colonization of new niches after
chemically stimulated dispersal. Since no single mechanism of dispersal utilized by all
bacteria exists, the development of a successful disintegrating agent is rather complex.
Some classes of agents that may have clinical utility are: (i), biofilm-matrix-degrading or
dispersing enzymes91,169–172; (ii), quorum-sensing interferants81,90,94,173–175 such as quorum
quenching antibodies176; (iii), (bio)surfactants177,178; and (iv), small molecule inhibi-
tors90,125,179 of, for instance, bacterial diguanylate cyclases56. It remains to be seen whether
any of these agents will have clinical applications. Probably, combinations are necessary to
ensure significant reductions in biomass, since many agents act very specifically against
only one matrix component, e.g. DNase I disrupts established biofilm due to digestion of
eDNA57,180, while Dispersin B hydrolyzes PIA57,90. Intrapleural administered DNase is under
clinical investigation in pleural biofilm-associated infections181. Aerosolized recombinant
human DNase (dornase alfa) has already proven its value in cystic fibrosis (CF) patients182
due to improvement of airway mucociliary clearance by reducing the viscosity and adhe-
siveness of infected bronchial secretions183,184. The only substances actually intravenously
used in the clinical setting to date are antibiotics, in particular rifampicin185 combined with
another agent. In relation to monotherapy, somehow paradoxically, adjuvant induced
hyperthermia has been shown in vitro to enhance the antimicrobial effect of various anti-
biotics on staphylococcal biofilms186. Rifampicin could not be used as a single agent due to
rapid resistance development as a consequence of commonly occurring point mutations
in rpoB187. Although efficacy of rifampicin in combination therapy against clinically pre-
sumed biofilm infections has been reported188,189, the clinical outcome remains contradic-
tory190,191 and rifampicin resistant mutants have emerged during treatment as adjunctive
agent192. Consequently, the biofilm was incompletely sterilized. So far, it is unclear whether
these rifampicin induced resistant subpopulations would be responsible for persistant or
on the long term reoccurring infections. It appeared that low-level rifampicin resistant
mutants have a fitness advantage over their parental rifampicin susceptible strains in
vivo193, which illustrates the risk of rifampicin exposure even more.
The development of appropriate anti-biofilm approaches must take into account at
least the following66: (i), unique accumulation molecules (e.g. proteinaceous vs. polysac-
charide); (ii), the development of persister cells, and (iii), the metabolic heterogeneity that
is inherent to growth in a biofilm.
Chapter 1
16
Outline of the thesis
Research in the field of biofilm physiology, development and function has just started to
begin. Extended knowledge of S. aureus resistance mechanisms and virulence factors
involved in the capability to form biofilm, may contribute to the design and implementa-
tion of preventive strategies that could minimize the prevalence of biofilm-associated
infections or could lead to novel ways to disassembly existing mature biofilm.
Chapter 2 focuses on the genetic background of S. aureus in relation to the capability
to produce biomass at different glucose concentrations on polystyrene surfaces. Recently,
links were made to match strong biofilm producers with agr subtype195,196, methicillin
susceptibility197, type of infection198, isolation site199 or pathogenic invasive potential of
colonizing or commensal strains200. However, the genetic background was not taken into
consideration.
Currently, in daily clinical practice, there are no definitive methods for the diagnosis of
a biofilm infection, except clinical suspicion and clinical presentation. When immediate
removal (and replacement) of the infected indwelling device or implant is unwanted, ri-
fampicin is simply added to standard (empirically) initiated antibiotic treatment in concor-
dance with therapeutical guidelines and recommendations189,191,201,202. However, the ra-
tionale behind the supposed working mechanism remains obscure and rifampicin-
resistant subpopulations emerge during treatment192. Possibly, the use of rifampin as an
adjunct in biofilm-associated infections is based on the ability to penetrate into biofilms
and a presumed activity against dormant bacteria.
It could be speculated that rifampicin-resistant isolates emerge inside the biofilm when
the companion agent does not penetrate as quickly as rifampicin is expected to do. There-
fore, it is essential to know whether rifampicin is able to destruct the matrix of biofilm-
embedded rifampicin-resistant strains, e.g. through pore-formation. Chapter 3 deals with
the efficacy of rifampicin against rifampin-susceptible and isogenic rifampin-resistant
methicillin-susceptible S. aureus (MSSA) strains. The effects on the biofilm matrix and on
viability were assessed with an in vitro static biofilm assay.
Since there are still no compounds suitable for intravenous application on the market
that effectively destruct preformed mature biofilm it is essential to prevent biofilm forma-
tion. This demands substantial improvements in biomaterials properties used for foreign
bodies to hinder initial adherence of micro-organisms and/or substances from the envi-
ronment. It is known that bacterial adhesion and thrombus formation are interrelated150.
For this reason we aimed to develop coatings for central venous catheters that are both
anti-microbial, in the sense that they prohibit adhesion of bacteria, and anti-thrombogenic
as well. The anti-thrombogenic features of the engineered new hydrophilic coating con-
taining sodium heparin and silver particles are essentially examined in chapter 4. The
antimicrobial characteristics are further explored in chapter 5. In this chapter the silver
content and the hydrophilicity of the coating were also taken into account.
It is evident that multiple resistance mechanisms of micro-organisms are involved in
their protection against environmental stresses and threats and thus their general survival
General introduction
17
strategy. Bacterial cells embedded in biofilm are far more resistant to antimicrobial agents
than their planktonic counterparts. It is questioned whether this could be solely attributed
to the penetration barrier formed by the matrix. It is likely that the observed dormancy of
bacteria in the deeper parts of the biofilm hinders the killing by antibiotics that require an
active life-cycle turnover. Still, it is believed that both principles do not fully clarify the
recalcitrance to eradication via the host immune system in combination with antibiotic
therapy. It has been suggested that other conventional resistance mechanisms ultimately
contribute to this phenomenon. A few of these mechanisms are scrutinized in the last
experimental chapters. Enhanced extrusion of toxic substances from the cytosol via
upregulation of efflux pumps has been suggested. Chapter 6 focuses on mutations in the
(promoter region of the) norA gene, associated with the hyperexpression of the NorA efflux
pump, in relation to the genetic background of S. aureus. Our findings that certain genetic
backgrounds were strongly correlated with mutations associated with the capability to
augment the expression of norA moved us to perform biofilm experiments with efflux
pumps inhibitors directed against NorA transmembrane transporters among several dis-
tinct clonal lineages. Chapter 7 comprises this study that was undertaken to unravel the
recent observation that efflux pump inhibitors like reserpine or thioridazine could prevent
biomass formation by a single tested strain of S. aureus. According to recent suggestions,
enhanced extrusion of wastes mediated via upregulation of efflux pumps could offer a
survival advantage to the biofilm embedded bacterium17,112,203. It also had to be seen
whether efflux pump inhibitors could have any influence on mature biofilm.
Another observation is the entrapment and accumulation of beta-lactamases inside
the biofilm matrix22,23. A subset of S. aureus strains that could be potentially more prone to
beta-lactamase induction during penetration of a beta-lactam into the biofilm are the
borderline oxacillin-resistant S. aureus (BORSA). These strains could not be differentiated
from their fully susceptible counterparts by routine automatic susceptibility testing and
will also not be isolated whenever screened for the mecA gene. Consequently they will be
initially exposed to a beta-lactam antibiotic.
In an attempt to unravel whether planktonic BORSA could be killed with a standard
beta-lactam, such as oxacillin, various BORSA isolates were tested in a time-kill experiment.
Alternatives like vancomycin, linezolid and daptomycin were also taken into account.
Chapter 8 describes the pharmacodynamic analysis of all time-kill experiments comparing
the EC50 and Emax values of the different antibiotics. Upon oxacillin exposure, the survival
behaviour of pBORa53-like plasmid-containing BORSA204 was intentionally compared with
non-methicillinase producing BORSA with oxacillin MICs ≥ 4 mg/L.
Finally, a general discussion (chapter 9) is presented in which the findings of all studies
are put into perspective and in which recommendations for further investigations are
discussed. A brief overview of our findings regarding S. aureus biofilm formation, preven-
tion and disassembly can be found in the summary (chapter 10).
Chapter 1
18
References
1. Shinji H, Yosizawa Y, Tajima A, et al. Role of fibronectin-binding proteins A and B in in vitro cellular infections
and in vivo septic infections by Staphylococcus aureus. Infect Immun 2011;79:2215–23.
2. Thwaites GE, Gant V. Are bloodstream leukocytes Trojan Horses for the metastasis of Staphylococcus aureus?
Nat Rev Microbiol 2011;9:215–22.
3. Garzoni C, Kelley WL. Staphylococcus aureus: new evidence for intracellular persistence. Trends Microbiol
2009;17:59–65.
4. Das D, Bishayi B. Staphylococcal catalase protects intracellularly survived bacteria by destroying H2O2 pro-
duced by the murine peritoneal macrophages. Microb Pathog 2009;47:57–67.
5. Olivier AC, Lemaire S, Van Bambeke F, Tulkens PM, Oldfield E. Role of rsbU and staphyloxanthin in phagocytosis
and intracellular growth of Staphylococcus aureus in human macrophages and endothelial cells. J Infect Dis
2009;200:1367–70.
6. Liu GY, Essex A, Buchanan JT, et al. Staphylococcus aureus golden pigment impairs neutrophil killing and pro-
motes virulence through its antioxidant activity. J Exp Med 2005;202:209–15.
7. Lan L, Cheng A, Dunman PM, Missiakas D, He C. Golden pigment production and virulence gene expression are
affected by metabolisms in Staphylococcus aureus. J Bacteriol 2010;192:3068–77.
8. Vaudaux P, Francois P, Bisognano C, et al. Increased expression of clumping factor and fibronectin-binding
proteins by hemB mutants of Staphylococcus aureus expressing small colony variant phenotypes. Infect Immun
2002;70:5428–37.
9. Poole K. Efflux-mediated antimicrobial resistance. J Antimicrob Chemother 2005;56:20–51.
10. Li XZ, Nikaido H. Efflux-mediated drug resistance in bacteria: an update. Drugs 2009;69:1555–623.
11. Gal Z, Kovacs P, Hernadi F, et al. Investigation of oxacillin-hydrolyzing beta-lactamase in borderline methicillin-
resistant clinical isolates of Staphylococcus aureus. Chemotherapy 2001;47:233–8.
12. O’Riordan K, Lee JC. Staphylococcus aureus capsular polysaccharides. Clin Microbiol Rev 2004;17:218–34.
13. Sadykov MR, Mattes TA, Luong TT, et al. Tricarboxylic acid cycle-dependent synthesis of Staphylococcus aureus
Type 5 and 8 capsular polysaccharides. J Bacteriol 2010;192:1459–62.
14. Zhao L, Xue T, Shang F, Sun H, Sun B. Staphylococcus aureus AI-2 quorum sensing associates with the KdpDE
two-component system to regulate capsular polysaccharide synthesis and virulence. Infect Immun
2010;78:3506–15.
15. DeLeo FR, Diep BA, Otto M. Host defense and pathogenesis in Staphylococcus aureus infections. Infect Dis Clin
North Am 2009;23:17–34.
16. Yoshida R, Kuwahara-Arai K, Baba T, Cui L, Richardson JF, Hiramatsu K. Physiological and molecular analysis of a
mecA-negative Staphylococcus aureus clinical strain that expresses heterogeneous methicillin resistance. J An-
timicrob Chemother 2003;51:247–55.
17. Hoiby N, Bjarnsholt T, Givskov M, Molin S, Ciofu O. Antibiotic resistance of bacterial biofilms. Int J Antimicrob
Agents 2010;35:322–32.
18. Hall-Stoodley L, Stoodley P. Evolving concepts in biofilm infections. Cell Microbiol 2009;11:1034–43.
19. Murillo O, Pachon ME, Euba G, et al. Intracellular antimicrobial activity appearing as a relevant factor in antibi-
otic efficacy against an experimental foreign-body infection caused by Staphylococcus aureus. J Antimicrob
Chemother 2009;64:1062–6.
20. Zhang L, Mah TF. Involvement of a novel efflux system in biofilm-specific resistance to antibiotics. J Bacteriol
2008;190:4447–52.
21. Gallant CV, Daniels C, Leung JM, et al. Common beta-lactamases inhibit bacterial biofilm formation. Mol Micro-
biol 2005;58:1012–24.
22. Bagge N, Hentzer M, Andersen JB, Ciofu O, Givskov M, Hoiby N. Dynamics and spatial distribution of beta-
lactamase expression in Pseudomonas aeruginosa biofilms. Antimicrob Agents Chemother 2004;48:1168–74.
General introduction
19
23. Ciofu O, Beveridge TJ, Kadurugamuwa J, Walther-Rasmussen J, Hoiby N. Chromosomal beta-lactamase is
packaged into membrane vesicles and secreted from Pseudomonas aeruginosa. J Antimicrob Chemother
2000;45:9–13.
24. Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: from the natural environment to infectious dis-
eases. Nat Rev Microbiol 2004;2:95–108.
25. Burmolle M, Thomsen TR, Fazli M, et al. Biofilms in chronic infections - a matter of opportunity - monospecies
biofilms in multispecies infections. FEMS Immunol Med Microbiol 2010;59:324–36.
26. Ricciuto J, Heimer SR, Gilmore MS, Argueso P. Cell surface O-glycans limit Staphylococcus aureus adherence to
corneal epithelial cells. Infect Immun 2008;76:5215–20.
27. Harriott MM, Noverr MC. Candida albicans and Staphylococcus aureus form polymicrobial biofilms: effects on
antimicrobial resistance. Antimicrob Agents Chemother 2009;53:3914–22.
28. Francolini I, Donelli G. Prevention and control of biofilm-based medical-device-related infections. FEMS Immu-
nol Med Microbiol 2010;59:227–38.
29. Bordi C, de Bentzmann S. Hacking into bacterial biofilms: a new therapeutic challenge. Ann Intensive Care
2011;1:19.
30. Mitri S, Xavier JB, Foster KR. Social evolution in multispecies biofilms. Proc Natl Acad Sci U S A 2011;108 Suppl
2:10839–46.
31. Iwase T, Uehara Y, Shinji H, et al. Staphylococcus epidermidis Esp inhibits Staphylococcus aureus biofilm forma-
tion and nasal colonization. Nature 2010;465:346–9.
32. Stoodley P, Conti SF, DeMeo PJ, et al. Characterization of a mixed MRSA/MRSE biofilm in an explanted total
ankle arthroplasty. FEMS Immunol Med Microbiol 2011;62:66–74.
33. Pflumm M. Caught on film. Nat Med 2011;17:650–3.
34. Heilmann C, Götz F. Cell-Cell communication and biofilm formation in gram-positive bacteria. In: Krämer R,
Jung K, eds. Bacterial signaling. Weinheim: Wiley-VCH Verlag GmbH & Co; 2010.
35. Klemm P, Vejborg RM, Hancock V. Prevention of bacterial adhesion. Appl Microbiol Biotechnol 2010;88:451–9.
36. Thanassi DG. The long and the short of bacterial adhesion regulation. J Bacteriol 2011;193:327–8.
37. Burke FM, McCormack N, Rindi S, Speziale P, Foster TJ. Fibronectin-binding protein B variation in Staphylococ-
cus aureus. BMC Microbiol 2010;10:160.
38. O’Neill E, Pozzi C, Houston P, et al. A novel Staphylococcus aureus biofilm phenotype mediated by the fi-
bronectin-binding proteins, FnBPA and FnBPB. J Bacteriol 2008;190:3835–50.
39. Cheung AI, Projan SJ, Edelstein RE, Fischetti VA. Cloning, expression, and nucleotide sequence of a Staphylococ-
cus aureus gene (fbpA) encoding a fibrinogen-binding protein. Infect Immun 1995;63:1914–20.
40. Walsh EJ, Miajlovic H, Gorkun OV, Foster TJ. Identification of the Staphylococcus aureus MSCRAMM clumping
factor B (ClfB) binding site in the alphaC-domain of human fibrinogen. Microbiology 2008;154:550–8.
41. Persson L, Johansson C, Ryden C. Antibodies to Staphylococcus aureus bone sialoprotein-binding protein
indicate infectious osteomyelitis. Clin Vaccine Immunol 2009;16:949–52.
42. Sabat A, Melles DC, Martirosian G, Grundmann H, van Belkum A, Hryniewicz W. Distribution of the serine-
aspartate repeat protein-encoding sdr genes among nasal-carriage and invasive Staphylococcus aureus strains.
J Clin Microbiol 2006;44:1135–8.
43. Dreisbach A, Hempel K, Buist G, Hecker M, Becher D, van Dijl JM. Profiling the surfacome of Staphylococcus
aureus. Proteomics 2010;10:3082–96.
44. Ymele-Leki P, Ross JM. Erosion from Staphylococcus aureus biofilms grown under physiologically relevant fluid
shear forces yields bacterial cells with reduced avidity to collagen. Appl Environ Microbiol 2007;73:1834–41.
45. Trotonda MP, Manna AC, Cheung AL, Lasa I, Penades JR. SarA positively controls bap-dependent biofilm forma-
tion in Staphylococcus aureus. J Bacteriol 2005;187:5790–8.
46. Cucarella C, Solano C, Valle J, Amorena B, Lasa I, Penades JR. Bap, a Staphylococcus aureus surface protein
involved in biofilm formation. J Bacteriol 2001;183:2888–96.
47. Nemati M, Hermans K, Devriese LA, Maes D, Haesebrouck F. Screening of genes encoding adhesion factors and
biofilm formation in Staphylococcus aureus isolates from poultry. Avian Pathol 2009;38:513–7.
Chapter 1
20
48. Merino N, Toledo-Arana A, Vergara-Irigaray M, et al. Protein A-mediated multicellular behavior in Staphylococ-
cus aureus. J Bacteriol 2009;191:832–43.
49. Heilmann C, Hartleib J, Hussain MS, Peters G. The multifunctional St aphylococcus aureus autolysin aaa mediates
adherence to immobilized fibrinogen and fibronectin. Infect Immun 2005;73:4793–802.
50. Clarke SR, Harris LG, Richards RG, Foster SJ. Analysis of Ebh, a 1.1-megadalton cell wall-associated fibronectin-
binding protein of Staphylococcus aureus. Infect Immun 2002;70:6680–7.
51. Harraghy N, Homerova D, Herrmann M, Kormanec J. Mapping the transcription start points of the Staphylococ-
cus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for ex-
pression of these genes. J Bacteriol 2008;190:447–51.
52. Thompson KM, Abraham N, Jefferson KK. Staphylococcus aureus extracellular adherence protein contributes to
biofilm formation in the presence of serum. FEMS Microbiol Lett 2010;305:143–7.
53. Campoccia D, Speziale P, Ravaioli S, et al. The presence of both bone sialoprotein-binding protein gene and
collagen adhesin gene as a typical virulence trait of the major epidemic cluster in isolates from orthopedic im-
plant infections. Biomaterials 2009;30:6621–8.
54. Vergara-Irigaray M, Valle J, Merino N, et al. Relevant role of fibronectin-binding proteins in Staphylococcus
aureus biofilm-associated foreign-body infections. Infect Immun 2009;77:3978–91.
55. Heilmann C. Adhesion mechanisms of staphylococci. Adv Exp Med Biol 2011;715:105–23.
56. Kaplan JB. Biofilm dispersal: mechanisms, clinical implications, and potential therapeutic uses. J Dent Res
2010;89:205–18.
57. Boles BR, Horswill AR. Staphylococcal biofilm disassembly. Trends Microbiol 2011.
58. Das T, Sharma PK, Busscher HJ, van der Mei HC, Krom BP. Role of extracellular DNA in initial bacterial adhesion
and surface aggregation. Appl Environ Microbiol 2010;76:3405–8.
59. Rice KC, Bayles KW. Molecular control of bacterial death and lysis. Microbiol Mol Biol Rev 2008;72:85–109, table
of contents.
60. Rice KC, Mann EE, Endres JL, et al. The cidA murein hydrolase regulator contributes to DNA release and biofilm
development in Staphylococcus aureus. Proc Natl Acad Sci U S A 2007;104:8113–8.
61. Ranjit DK, Endres JL, Bayles KW. Staphylococcus aureus CidA and LrgA proteins exhibit holin-like properties. J
Bacteriol 2011;193:2468–76.
62. Kogan G, Sadovskaya I, Chaignon P, Chokr A, Jabbouri S. Biofilms of clinical strains of Staphylococcus that do
not contain polysaccharide intercellular adhesin. FEMS Microbiol Lett 2006;255:11–6.
63. Corrigan RM, Rigby D, Handley P, Foster TJ. The role of Staphylococcus aureus surface protein SasG in adherence
and biofilm formation. Microbiology 2007;153:2435–46.
64. Geoghegan JA, Corrigan RM, Gruszka DT, et al. Role of surface protein SasG in biofilm formation by Staphylo-
coccus aureus. J Bacteriol 2010;192:5663–73.
65. Flemming HC, Wingender J. The biofilm matrix. Nat Rev Microbiol 2010;8:623–33.
66. Fey PD. Modality of bacterial growth presents unique targets: how do we treat biofilm-mediated infections?
Curr Opin Microbiol 2010;13:610–5.
67. Izano EA, Amarante MA, Kher WB, Kaplan JB. Differential roles of poly-N-acetylglucosamine surface polysaccha-
ride and extracellular DNA in Staphylococcus aureus and Staphylococcus epidermidis biofilms. Appl Environ Mi-
crobiol 2008;74:470–6.
68. Boles BR, Thoendel M, Roth AJ, Horswill AR. Identification of genes involved in polysaccharide-independent
Staphylococcus aureus biofilm formation. PLoS One 2010;5:e10146.
69. Stewart PS, Franklin MJ. Physiological heterogeneity in biofilms. Nat Rev Microbiol 2008;6:199–210.
70. Rani SA, Pitts B, Beyenal H, et al. Spatial patterns of DNA replication, protein synthesis, and oxygen concentra-
tion within bacterial biofilms reveal diverse physiological states. J Bacteriol 2007;189:4223–33.
71. Sjollema J, Rustema-Abbing M, van der Mei HC, Busscher HJ. Generalized relationship between numbers of
bacteria and their viability in biofilms. Appl Environ Microbiol 2011;77:5027–9.
72. Lewis K. Persister cells. Annu Rev Microbiol 2010;64:357–72.
73. Stewart PS. Diffusion in biofilms. J Bacteriol 2003;185:1485–91.
74. Nadell CD, Xavier JB, Foster KR. The sociobiology of biofilms. FEMS Microbiol Rev 2009;33:206–24.
General introduction
21
75. Davies D. Understanding biofilm resistance to antibacterial agents. Nat Rev Drug Discov 2003;2:114–22.
76. Jefferson KK, Goldmann DA, Pier GB. Use of confocal microscopy to analyze the rate of vancomycin penetration
through Staphylococcus aureus biofilms. Antimicrob Agents Chemother 2005;49:2467–73.
77. Stewart PS, Davison WM, Steenbergen JN. Daptomycin rapidly penetrates a St aphylococcus epidermidis biofilm.
Antimicrob Agents Chemother 2009;53:3505–7.
78. Singh R, Ray P, Das A, Sharma M. Penetration of antibiotics through Staphylococcus aureus and Staphylococcus
epidermidis biofilms. J Antimicrob Chemother 2010;65:1955–8.
79. Novick RP, Geisinger E. Quorum sensing in staphylococci. Annu Rev Genet 2008;42:541–64.
80. Yarwood JM, Bartels DJ, Volper EM, Greenberg EP. Quorum sensing in Staphylococcus aureus biofilms. J Bacte-
riol 2004;186:1838–50.
81. Choudhary S, Schmidt-Dannert C. Applications of quorum sensing in biotechnology. Appl Microbiol Biotechnol
2010;86:1267–79.
82. Queck SY, Jameson-Lee M, Villaruz AE, et al. RNAIII-independent target gene control by the agr quorum-
sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus . Mol Cell
2008;32:150–8.
83. Boles BR, Horswill AR. Agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog 2008;4:e1000052.
84. Tsompanidou E, Sibbald MJ, Chlebowicz MA, et al. Requirement of the agr locus for colony spreading of Staphy-
lococcus aureus. J Bacteriol 2011;193:1267–72.
85. Felden B, Vandenesch F, Bouloc P, Romby P. The Staphylococcus aureus RNome and its commitment to viru-
lence. PLoS Pathog 2011;7:e1002006.
86. Dunman PM, Murphy E, Haney S, et al. Transcription profiling-based identification of Staphylococcus aureus
genes regulated by the agr and/or sarA loci. J Bacteriol 2001;183:7341–53.
87. Irie Y, Parsek MR. Quorum Sensing and Microbial Biofilms In: Romeo T, ed. Bacterial Biofilms. Berlin Heidelberg:
Springer-Verlag 2008:67–84.
88. Parsek MR, Greenberg EP. Sociomicrobiology: the connections between quorum sensing and biofilms. Trends
Microbiol 2005;13:27–33.
89. Hall-Stoodley L, Stoodley P. Biofilm formation and dispersal and the transmission of human pathogens. Trends
Microbiol 2005;13:7–10.
90. Landini P, Antoniani D, Burgess JG, Nijland R. Molecular mechanisms of compounds affecting bacterial biofilm
formation and dispersal. Appl Microbiol Biotechnol 2010;86:813–23.
91. Marti M, Trotonda MP, Tormo-Mas MA, et al. Extracellular proteases inhibit protein-dependent biofilm forma-
tion in Staphylococcus aureus. Microbes Infect 2009;12:55–64.
92. Lauderdale KJ, Boles BR, Cheung AL, Horswill AR. Interconnections between Sigma B, agr, and proteolytic
activity in Staphylococcus aureus biofilm maturation. Infect Immun 2009;77:1623–35.
93. Dubin G. Extracellular proteases of Staphylococcus spp. Biol Chem 2002;383:1075–86.
94. Beenken KE, Mrak LN, Griffin LM, et al. Epistatic relationships between sarA and agr in Staphylococcus aureus
biofilm formation. PLoS One 2010;5:e10790.
95. Weiss EC, Spencer HJ, Daily SJ, Weiss BD, Smeltzer MS. Impact of sarA on antibiotic susceptibility of Staphylo-
coccus aureus in a catheter-associated in vitro model of biofilm formation. Antimicrob Agents Chemother
2009;53:2475–82.
96. Houston P, Rowe SE, Pozzi C, Waters EM, O’Gara JP. Essential role for the major autolysin in the fibronectin-
binding protein-mediated Staphylococcus aureus biofilm phenotype. Infect Immun 2011;79:1153–65.
97. Beenken KE, Dunman PM, McAleese F, et al. Global gene expression in Staphylococcus aureus biofilms. J Bacte-
riol 2004;186:4665–84.
98. Andrey DO, Renzoni A, Monod A, Lew DP, Cheung AL, Kelley WL. Control of the Staphylococcus aureus toxic
shock tst promoter by the global regulator SarA. J Bacteriol 2010;192:6077–85.
99. Ingavale S, van Wamel W, Luong TT, Lee CY, Cheung AL. Rat/MgrA, a regulator of autolysis, is a regulator of
virulence genes in Staphylococcus aureus. Infect Immun 2005;73:1423–31.
Chapter 1
22
100. Cassat J, Dunman PM, Murphy E, et al. Transcriptional profiling of a Staphylococcus aureus clinical isolate and its
isogenic agr and sarA mutants reveals global differences in comparison to the laboratory strain RN6390. Micro-
biology 2006;152:3075–90.
101. Tsang LH, Cassat JE, Shaw LN, Beenken KE, Smeltzer MS. Factors contributing to the biofilm-deficient pheno-
type of Staphylococcus aureus sarA mutants. PLoS One 2008;3:e3361.
102. Queck SY, Khan BA, Wang R, et al. Mobile genetic element-encoded cytolysin connects virulence to methicillin
resistance in MRSA. PLoS Pathog 2009;5:e1000533.
103. Yamaki J, Synold T, Wong-Beringer A. Anti-virulence potential of TR-700 and clindamycin on clinical isolates of
Staphylococcus aureus producing phenol-soluble modulins. Antimicrob Agents Chemother 2011.
104. Hongo I, Baba T, Oishi K, Morimoto Y, Ito T, Hiramatsu K. Phenol-soluble modulin alpha 3 enhances the human
neutrophil lysis mediated by Panton-Valentine leukocidin. J Infect Dis 2009;200:715–23.
105. Joo HS, Cheung GY, Otto M. Antimicrobial activity of community-associated methicillin-resistant Staphylococ-
cus aureus is caused by phenol-soluble modulin derivatives. J Biol Chem 2011;286:8933–40.
106. David MZ, Daum RS. Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and
clinical consequences of an emerging epidemic. Clin Microbiol Rev 2010;23:616–87.
107. Cheung GY, Wang R, Khan BA, Sturdevant DE, Otto M. Role of the accessory gene regulator agr in community-
associated methicillin-resistant Staphylococcus aureus pathogenesis. Infect Immun 2011;79:1927–35.
108. Wisplinghoff H, Bischoff T, Tallent SM, Seifert H, Wenzel RP, Edmond MB. Nosocomial bloodstream infections in
US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis
2004;39:309–17.
109. Ziebuhr W, Hennig S, Eckart M, Kranzler H, Batzilla C, Kozitskaya S. Nosocomial infections by Staphylococcus
epidermidis: how a commensal bacterium turns into a pathogen. Int J Antimicrob Agents 2006;28 Suppl 1:S14–
20.
110. Duah M. Daptomycin for methicillin-resistant Staphylococcus epidermidis native-valve endocarditis: a case
report. Ann Clin Microbiol Antimicrob 2010;9:9.
111. Percival S, Thomas JG, Williams D. An introduction to the world of microbiology and biofilmology. In: Percival S,
Cutting K, eds. Microbiology of wounds. Boca Raton: Taylor & Francis group; 2010:1–58.
112. Kvist M, Hancock V, Klemm P. Inactivation of efflux pumps abolishes bacterial biofilm formation. Appl Environ
Microbiol 2008;74:7376–82.
113. Liu Y, Yang L, Molin S. Synergistic activities of an efflux pump inhibitor and iron chelators against Pseudomonas
aeruginosa growth and biofilm formation. Antimicrob Agents Chemother 2010;54:3960–3.
114. Aslam S, Trautner BW, Ramanathan V, Darouiche RO. Combination of tigecycline and N-acetylcysteine reduces
biofilm-embedded bacteria on vascular catheters. Antimicrob Agents Chemother 2007;51:1556–8.
115. Tote K, Horemans T, Vanden Berghe D, Maes L, Cos P. Inhibitory effect of biocides on the viable masses and
matrices of Staphylococcus aureus and Pseudomonas aeruginosa biofilms. Appl Environ Microbiol 2010;76:3135–
42.
116. Darouiche RO, Mansouri MD, Gawande PV, Madhyastha S. Antimicrobial and antibiofilm efficacy of triclosan
and DispersinB combination. J Antimicrob Chemother 2009;64:88–93.
117. Peng ZX, Tu B, Shen Y, et al. Quaternized chitosan inhibits icaA transcription and biofilm formation by Staphy-
lococcus on a titanium surface. Antimicrob Agents Chemother 2010;55:860–6.
118. Martinez LR, Mihu MR, Tar M, et al. Demonstration of antibiofilm and antifungal efficacy of chitosan against
candidal biofilms, using an in vivo central venous catheter model. J Infect Dis 2010;201:1436–40.
119. Wang Y, Wang T, Hu J, et al. Anti-biofilm activity of TanReQing, a Traditional Chinese Medicine used for the
treatment of acute pneumonia. J Ethnopharmacol 2011;134:165–70.
120. Alandejani T, Marsan J, Ferris W, Slinger R, Chan F. Effectiveness of honey on Staphylococcus aureus and Pseu-
domonas aeruginosa biofilms. Otolaryngol Head Neck Surg 2009;141:114–8.
121. Merckoll P, Jonassen TO, Vad ME, Jeansson SL, Melby KK. Bacteria, biofilm and honey: a study of the effects of
honey on ‘planktonic’ and biofilm-embedded chronic wound bacteria. Scand J Infect Dis 2009;41:341–7.
General introduction
23
122. Karaolis DK, Rashid MH, Chythanya R, Luo W, Hyodo M, Hayakawa Y. c-di-GMP (3’-5’-cyclic diguanylic acid)
inhibits Staphylococcus aureus cell-cell interactions and biofilm formation. Antimicrob Agents Chemother
2005;49:1029–38.
123. Harro JM, Peters BM, O’May GA, et al. Vaccine development in Staphylococcus aureu s: taking the biofilm pheno-
type into consideration. FEMS Immunol Med Microbiol 2010;59:306–23.
124. Brady RA, O’May GA, Leid JG, Prior ML, Costerton JW, Shirtliff ME. Resolution of Staphylococcus aureus biofilm
infection using vaccination and antibiotic treatment. Infect Immun 2011;79:1797–803.
125. Lynch AS, Abbanat D. New antibiotic agents and approaches to treat biofilm-associated infections. Expert Opin
Ther Pat 2010;20:1373–87.
126. van der Plas MJ, Jukema GN, Wai SW, et al. Maggot excretions/secretions are differentially effective against
biofilms of Staphylococcus aureus and Pseudomonas aeruginosa. J Antimicrob Chemother 2008;61:117–22.
127. Cazander G, van de Veerdonk MC, Vandenbroucke-Grauls CM, Schreurs MW, Jukema GN. Maggot excretions
inhibit biofilm formation on biomaterials. Clin Orthop Relat Res 2010;468:2789–96.
128. Contreras-Garcia A, Bucio E, Brackman G, Coenye T, Concheiro A, Alvarez-Lorenzo C. Biofilm inhibition and
drug-eluting properties of novel DMAEMA-modified polyethylene and silicone rubber surfaces. Biofouling
2011;27:123–35.
129. Bruellhoff K, Fiedler J, Moller M, Groll J, Brenner RE. Surface coating strategies to prevent biofilm formation on
implant surfaces. Int J Artif Organs 2010;33:646–53.
130. De Nardo L, Fare S, Di Matteo V, et al. New heparinizable modified poly(carbonate urethane) surfaces diminish-
ing bacterial colonization. J Mater Sci Mater Med 2007;18:2109–15.
131. Fundeanu I, van der Mei HC, Schouten AJ, Busscher HJ. Microbial adhesion to surface-grafted polyacrylamide
brushes after long-term exposure to PBS and reconstituted freeze-dried saliva. J Biomed Mater Res A
2010;94:997–1000.
132. Knetsch ML, Koole LH. New strategies in the development of antimicrobial coatings: the example of increasing
usage of silver and silver nanoparticles. Polymers 2011;3:340–66.
133. Montanaro L, Campoccia D, Arciola CR. Advancements in molecular epidemiology of implant infections and
future perspectives. Biomaterials 2007;28:5155–68.
134. Hetrick EM, Schoenfisch MH. Reducing implant-related infections: active release strategies. Chem Soc Rev
2006;35:780–9.
135. Gilbert RE, Harden M. Effectiveness of impregnated central venous catheters for catheter related blood stream
infection: a systematic review. Curr Opin Infect Dis 2008;21:235–45.
136. Maaskant JM, De Boer JP, Dalesio O, Holtkamp MJ, Lucas C. The effectiveness of chlorhexidine-silver sulfadiaz-
ine impregnated central venous catheters in patients receiving high-dose chemotherapy followed by periph-
eral stem cell transplantation. Eur J Cancer Care (Engl) 2009;18:477–82.
137. Falagas ME, Fragoulis K, Bliziotis IA, Chatzinikolaou I. Rifampicin-impregnated central venous catheters: a meta-
analysis of randomized controlled trials. J Antimicrob Chemother 2007;59:359–69.
138. Casey AL, Mermel LA, Nightingale P, Elliott TS. Antimicrobial central venous catheters in adults: a systematic
review and meta-analysis. Lancet Infect Dis 2008;8:763–76.
139. Grass G, Rensing C, Solioz M. Metallic copper as an antimicrobial surface. Appl Environ Microbiol 2011;77:1541–
7.
140. Khoo X, O’Toole GA, Nair SA, Snyder BD, Kenan DJ, Grinstaff MW. Staphylococcus aureus resistance on titanium
coated with multivalent PEGylated-peptides. Biomaterials 2010;31:9285–92.
141. Yasuyuki M, Kunihiro K, Kurissery S, Kanavillil N, Sato Y, Kikuchi Y. Antibacterial properties of nine pure metals: a
laboratory study using Staphylococcus aureus and Escherichia coli. Biofouling 2010;26:851–8.
142. Stevens KN, Croes S, Boersma RS, et al. Hydrophilic surface coatings with embedded biocidal silver nanoparti-
cles and sodium heparin for central venous catheters. Biomaterials 2010;32:1264–9.
143. Lange D, Elwood CN, Choi K, Hendlin K, Monga M, Chew BH. Uropathogen interaction with the surface of
urological stents using different surface properties. J Urol 2009;182:1194–200.
144. Riedl CR, Witkowski M, Plas E, Pflueger H. Heparin coating reduces encrustation of ureteral stents: a preliminary
report. Int J Antimicrob Agents 2002;19:507–10.
Chapter 1
24
145. Costa F, Carvalho IF, Montelaro RC, Gomes P, Martins MC. Covalent immobilization of antimicrobial peptides
(AMPs) onto biomaterial surfaces. Acta Biomater 2011;7:1431–40.
146. Gao G, Lange D, Hilpert K, et al. The biocompatibility and biofilm resistance of implant coatings based on
hydrophilic polymer brushes conjugated with antimicrobial peptides. Biomaterials 2011;32:3899–909.
147. Wang H, Huang T, Jing J, et al. Effectiveness of different central venous catheters for catheter-related infections:
a network meta-analysis. J Hosp Infect 2010;76:1–11.
148. Hockenhull JC, Dwan KM, Smith GW, et al. The clinical effectiveness of central venous catheters treated with
anti-infective agents in preventing catheter-related bloodstream infections: a systematic review. Crit Care Med
2009;37:702–12.
149. Baskin JL, Pui CH, Reiss U, et al. Management of occlusion and thrombosis associated with long-term indwelling
central venous catheters. Lancet 2009;374:159–69.
150. Boersma RS, Jie KS, Verbon A, van Pampus EC, Schouten HC. Thrombotic and infectious complications of
central venous catheters in patients with hematological malignancies. Ann Oncol 2008;19:433–42.
151. Crnich CJ, Maki DG. The Role of Intravascular Devices in Sepsis. Curr Infect Dis Rep 2001;3:496–506.
152. Zingg W, Cartier-Fassler V, Walder B. Central venous catheter-associated infections. Best Pract Res Clin Anaes-
thesiol 2008;22:407–21.
153. Rosenthal VD. Central line-associated bloodstream infections in limited-resource countries: a review of the
literature. Clin Infect Dis 2009;49:1899–907.
154. McGee DC, Gould MK. Preventing complications of central venous catheterization. N Engl J Med
2003;348:1123–33.
155. Jee R, Nel L, Gnanakumaran G, Williams A, Eren E. Four cases of anaphylaxis to chlorhexidine impregnated
central venous catheters: a case cluster or the tip of the iceberg? Br J Anaesth 2009;103:614–5.
156. Shivakumar SP, Anderson DR, Couban S. Catheter-associated thrombosis in patients with malignancy. J Clin
Oncol 2009;27:4858–64.
157. Debourdeau P, Kassab Chahmi D, Le Gal G, et al. 2008 SOR guidelines for the prevention and treatment of
thrombosis associated with central venous catheters in patients with cancer: report from the working group.
Ann Oncol 2009;20:1459–71.
158. Bayston R, Fisher LE, Weber K. An antimicrobial modified silicone peritoneal catheter with activity against both
Gram-positive and Gram-negative bacteria. Biomaterials 2009;30:3167–73.
159. Bradshaw JH, Puntis JW. Taurolidine and catheter-related bloodstream infection: a systematic review of the
literature. J Pediatr Gastroenterol Nutr 2008;47:179–86.
160. Shah CB, Mittelman MW, Costerton JW, et al. Antimicrobial activity of a novel catheter lock solution. Antimicrob
Agents Chemother 2002;46:1674–9.
161. Jurewitsch B, Jeejeebhoy KN. Taurolidine lock: the key to prevention of recurrent catheter-related bloodstream
infections. Clin Nutr 2005;24:462–5.
162. Solomon LR, Cheesbrough JS, Ebah L, et al. A randomized double-blind controlled trial of taurolidine-citrate
catheter locks for the prevention of bacteremia in patients treated with hemodialysis. Am J Kidney Dis
2010;55:1060–8.
163. Raad, II, Fang X, Keutgen XM, Jiang Y, Sherertz R, Hachem R. The role of chelators in preventing biofilm forma-
tion and catheter-related bloodstream infections. Curr Opin Infect Dis 2008;21:385–92.
164. Sherertz RJ, Boger MS, Collins CA, Mason L, Raad, II. Comparative in vitro efficacies of various catheter lock
solutions. Antimicrob Agents Chemother 2006;50:1865–8.
165. Deeb EN, DiMattia PE. Letter: Standardization of heparin-lock maintenance solution. N Engl J Med
1976;294:448.
166. Mitchell MD, Anderson BJ, Williams K, Umscheid CA. Heparin flushing and other interventions to maintain
patency of central venous catheters: a systematic review. J Adv Nurs 2009;65:2007–21.
167. Raad I, Bodey GP, Sr. Novel antimicrobial catheter lock solution: a new direction in which chelators replace
heparin. Crit Care Med 2011;39:875–6.
168. Shanks RM, Sargent JL, Martinez RM, Graber ML, O’Toole GA. Catheter lock solutions influence staphylococcal
biofilm formation on abiotic surfaces. Nephrol Dial Transplant 2006;21:2247–55.
General introduction
25
169. Kokai-Kun JF, Chanturiya T, Mond JJ. Lysostaphin eradicates established Staphylococcus aureus biofilms in
jugular vein catheterized mice. J Antimicrob Chemother 2009;64:94–100.
170. Wu JA, Kusuma C, Mond JJ, Kokai-Kun JF. Lysostaphin disrupts Staphylococcus aureus and Staphyl ococcus
epidermidis biofilms on artificial surfaces. Antimicrob Agents Chemother 2003;47:3407–14.
171. Tetz GV, Artemenko NK, Tetz VV. Effect of DNase and antibiotics on biofilm characteristics. Antimicrob Agents
Chemother 2009;53:1204–9.
172. Kaplan JB. Therapeutic potential of biofilm-dispersing enzymes. Int J Artif Organs 2009;32:545–54.
173. Brackman G, Cos P, Maes L, Nelis HJ, Coenye T. Quorum sensing inhibitors increase the susceptibility of bacte-
rial biofilms to antibiotics in vitro and in vivo. Antimicrob Agents Chemother 2011;55:2655–61.
174. Cirioni O, Ghiselli R, Minardi D, et al. RNAIII-inhibiting peptide affects biofilm formation in a rat model of staphy-
lococcal ureteral stent infection. Antimicrob Agents Chemother 2007;51:4518–20.
175. Njoroge J, Sperandio V. Jamming bacterial communication: new approaches for the treatment of infectious
diseases. EMBO Mol Med 2009;1:201–10.
176. Kaufmann GF, Park J, Mayorov AV, Kubitz DM, Janda KD. Generation of quorum quenching antibodies. Methods
Mol Biol 2011;692:299–311.
177. Rivardo F, Turner RJ, Allegrone G, Ceri H, Martinotti MG. Anti-adhesion activity of two biosurfactants produced
by Bacillus spp. prevents biofilm formation of human bacterial pathogens. Appl Microbiol Biotechnol
2009;83:541–53.
178. Karatan E, Watnick P. Signals, regulatory networks, and materials that build and break bacterial biofilms. Micro-
biol Mol Biol Rev 2009;73:310–47.
179. Sintim HO, Smith JA, Wang J, Nakayama S, Yan L. Paradigm shift in discovering next-generation anti-infective
agents: targeting quorum sensing, c-di-GMP signaling and biofilm formation in bacteria with small molecules.
Future Med Chem 2010;2:1005–35.
180. Mann EE, Rice KC, Boles BR, et al. Modulation of eDNA release and degradation affects Staphylococcus aureus
biofilm maturation. PLoS One 2009;4:e5822.
181. Rahman NM, Phil D, Maskell NA, et al. Intrapleural use of tissue plasminogen activator and DNase in pleural
infection. N Engl J Med 2011;365:518–26.
182. Konstan MW, VanDevanter DR, Rasouliyan L, et al. Trends in the use of routine therapies in cystic fibrosis: 1995–
2005. Pediatr Pulmonol 2010;45:1167–72.
183. McCoy K, Hamilton S, Johnson C. Effects of 12-week administration of dornase alfa in patients with advanced
cystic fibrosis lung disease. Pulmozyme Study Group. Chest 1996;110:889–95.
184. Rubin BK. Mucolytics, expectorants, and mucokinetic medications. Respir Care 2007;52:859–65.
185. Tupin A, Gualtieri M, Roquet-Baneres F, Morichaud Z, Brodolin K, Leonetti JP. Resistance to rifampicin: at the
crossroads between ecological, genomic and medical concerns. Int J Antimicrob Agents 2010;35:519–23.
186. Hajdu S, Holinka J, Reichmann S, Hirschl AM, Graninger W, Presterl E. Increased temperature enhances the
antimicrobial effects of daptomycin, vancomycin, tigecycline, fosfomycin, and cefamandole on staphylococcal
biofilms. Antimicrob Agents Chemother 2010;54:4078–84.
187. Zavasky DM, Sande MA. Reconsideration of rifampin: a unique drug for a unique infection. Jama
1998;279:1575–7.
188. Zimmerli W, Widmer AF, Blatter M, Frei R, Ochsner PE. Role of rifampin for treatment of orthopedic implant-
related staphylococcal infections: a randomized controlled trial. Foreign-Body Infection (FBI) Study Group.
Jama 1998;279:1537–41.
189. Forrest GN, Tamura K. Rifampin combination therapy for nonmycobacterial infections. Clin Microbiol Rev
2010;23:14–34.
190. Nguyen HM, Graber CJ. Limitations of antibiotic options for invasive infections caused by methicillin-resistant
Staphylococcus aureus: is combination therapy the answer? J Antimicrob Chemother 2010;65:24–36.
191. Perlroth J, Kuo M, Tan J, Bayer AS, Miller LG. Adjunctive use of rifampin for the treatment of Staphylococcus
aureus infections: a systematic review of the literature. Arch Intern Med 2008;168:805–19.
192. Riedel DJ, Weekes E, Forrest GN. Addition of rifampin to standard therapy for treatment of native valve infective
endocarditis caused by Staphylococcus aureus. Antimicrob Agents Chemother 2008;52:2463–7.
Chapter 1
26
193. Yu J, Wu J, Francis KP, Purchio TF, Kadurugamuwa JL. Monitoring in vivo fitness of rifampicin-resistant Staphylo-
coccus aureus mutants in a mouse biofilm infection model. J Antimicrob Chemother 2005;55:528–34.
194. Parsek MR, Singh PK. Bacterial biofilms: an emerging link to disease pathogenesis. Annu Rev Microbiol
2003;57:677–701.
195. Cafiso V, Bertuccio T, Santagati M, et al. agr-Genotyping and transcriptional analysis of biofilm-producing
Staphylococcus aureus. FEMS Immunol Med Microbiol 2007;51:220–7.
196. Kawamura H, Nishi J, Imuta N, et al. Quantitative analysis of biofilm formation of methicillin-resistant Staphylo-
coccus aureus (MRSA) strains from patients with orthopaedic device-related infections. FEMS Immunol Med Mi-
crobiol 2011.
197. O’Neill E, Pozzi C, Houston P, et al. Association between methicillin susceptibility and biofilm regulation in
Staphylococcus aureus isolates from device-related infections. J Clin Microbiol 2007;45:1379–88.
198. Grinholc M, Wegrzyn G, Kurlenda J. Evaluation of biofilm production and prevalence of the icaD gene in methi-
cillin-resistant and methicillin-susceptible Staphylococcus aureus strains isolated from patients with nosocomial
infections and carriers. FEMS Immunol Med Microbiol 2007;50:375–9.
199. Smith K, Perez A, Ramage G, Lappin D, Gemmell CG, Lang S. Biofilm formation by Scottish clinical isolates of
Staphylococcus aureus. J Med Microbiol 2008;57:1018–23.
200. Jain A, Agarwal A. Biofilm production, a marker of pathogenic potential of colonizing and commensal staphylo-
cocci. J Microbiol Methods 2009;76:88–92.
201. Darouiche RO. Treatment of infections associated with surgical implants. N Engl J Med 2004;350:1422–9.
202. Baddour LM, Wilson WR, Bayer AS, et al. Infective endocarditis: diagnosis, antimicrobial therapy, and manage-
ment of complications: a statement for healthcare professionals from the Committee on Rheumatic Fever, En-
docarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, and the Councils on Clinical
Cardiology, Stroke, and Cardiovascular Surgery and Anesthesia, American Heart Association: endorsed by the
Infectious Diseases Society of America. Circulation 2005;111:e394–434.
203. Martinez JL, Sanchez MB, Martinez-Solano L, et al. Functional role of bacterial multidrug efflux pumps in micro-
bial natural ecosystems. FEMS Microbiol Rev 2009;33:430–49.
204. Massidda O, Montanari MP, Mingoia M, Varaldo PE. Borderline methicillin-susceptible Staphylococcus aureus
strains have more in common than reduced susceptibility to penicillinase-resistant penicillins. Antimicrob
Agents Chemother 1996;40:2769–74.
27
CHAPTER 2
Staphylococcus aureus biofilm formation at the physiologic
glucose concentration depends on the S. aureus lineage
Sander Croes1, 2
Ruud H. Deurenberg1
Marie-Louise L. Boumans1
Patrick S. Beisser1
Cees Neef2
Ellen E. Stobberingh1
1 Department of Medical Microbiology, Maastricht University Medical Center, Maastricht, the Netherlands
2 Department of Clinical Pharmacy and Toxicology, Maastricht University Medical Center, Maastricht, the Netherlands
BMC Microbiology. 2009; 9: 229
Chapter 2
28
Abstract
Background
Since bacteria embedded in biofilms are far more difficult to eradicate than planktonic
infections, it would be useful to know whether certain Staphylococcus aureus lineages are
especially involved in strong biofilm formation. For this reason, in vitro biofilm formation of
228 clinical S. aureus isolates of distinct clonal lineages was investigated.
Results
At 0.1% glucose, more than 60% of the S. aureus strains associated with multilocus se-
quence typing (MLST) clonal complex (CC)8 produced large amounts of biomass, com-
pared to 0–7% for various other clonal lineages. Additionally, S. aureus bloodstream iso-
lates associated with MLST CC8 and CC7 had similar biofilm forming capacities as their
commensal counterparts. Furthermore, strong biofilm formation could not be attributed to
a specific accessory gene regulator (agr) genotype, as suggested previously. The agr geno-
types were strictly associated with the clonal lineages. Moreover, strong biofilm formation
was not related to slime formation. Congo red agar (CRA) screening is therefore not useful
as a qualitative screening method for biofilm formation.
Conclusion
The adherence to polystyrene surfaces under physiologic glucose concentration (0.1%)
was dependent on the clonal lineage. Strains associated with MLST CC8 were markedly
more often classified as strong biofilm former at glucose concentrations of 0%, 0.1% and
0.25%.
The present study reveals that the MLST CC8 associated genetic background was a predis-
posing factor for strong biofilm formation in vitro, under all tested glucose concentrations.
Staphylococcus aureus biofilm formation in relation to the genetic background
29
Background
One of the defense mechanisms of Staphylococcus aureus is the capacity to form biofilms.
Bacteria embedded in biofilms are often difficult to eradicate with standard antibiotic
regimens and inherently resistant to host immune responses1, 2. As a result, treatment of
many chronic S. aureus biofilm related infections, including endocarditis, osteomyelitis and
indwelling medical device infections is hindered3. Biofilm formation is a multistep process,
starting with transient adherence to a surface. Subsequently, specific bacterial adhesins,
referred to as microbial surface components recognizing adhesive matrix molecules (MS-
CRAMMS) promote the actual attachment4. Next, during the accumulation phase, bacteria
stick to each other and production of extracellular polymeric substances (EPS) and/or
incorporation of host derived components, such as platelets, takes place, resulting in a
mature biofilm. In circumstances of nutrient deprivation, or under heavy shear forces,
detachment of bacteria appears through autonomous formation of autoinducing peptides
(AIP)5, with release and dispersal of bacteria as a consequence. It has been shown that
expression of the accessory gene regulator (agr) locus, encoding a quorum-sensing sys-
tem, results in expression of surfactant-like molecules, such as δ-toxin6, contributing to the
detachment.
Essential for biofilm development in S. aureus is the regulatory genetic locus staphylo-
coccal accessory regulator (sarA), which controls the intracellular adhesin (ica) operon and
agr regulated pathways7. It has been suggested that biofilm formation in methicillin-
resistant S. aureus (MRSA) is predominantly regulated by surface adhesins, which are re-
pressed under agr expression, while biofilm formation in methicillin-susceptible S. aureus
(MSSA) is more dependent on cell to cell adhesion by the production of icaADBC-encoded
polysaccharide intercellular adhesin (PIA), also referred as poly-N-acetylglucosamine
(PNAG) or slime8. However a clear role for the ica locus of S. aureus is not as evident as that
of Staphylococcus epidermidis9.
In general, the presence of glucose represses the agr system through the generation of
a low pH10, 11. So far, biofilm development in physiologic glucose-supplemented medium (1
g/L), corresponding to normal blood glucose levels12, has not been investigated. Biofilm
formation often occurs on medical devices, like catheters and heart valves, which are in
direct contact with normal (floating) blood. Furthermore, since it has been shown that the
regulatory pathways for biofilm formation vary between strains8, the question arose
whether these strain-to-strain differences could be attributed to different clonal lineages.
The aim of the present study was to examine the contribution of the genetic back-
ground of both MRSA and MSSA to biofilm formation under physiologic glucose concen-
tration. MRSA associated with the five major multilocus sequence typing (MLST) clonal
complexes (CCs), i.e. CC5, CC8, CC22, CC30 and CC4513 and MSSA with the same MLST CCs,
and also CC1, were included in this study, since it has been suggested that these lineages
possess the ability to become MRSA14. The results were compared with those obtained
with lineages normally not related to MRSA, i.e. CC7, CC12, CC15, CC25 and CC12115. Fur-
Chapter 2
30
thermore, the aim was to evaluate whether slime production is indicative for strong biofilm
formation in S. aureus.
Methods
Bacterial strains
S. aureus strains (72 MRSA and 156 MSSA) investigated were isolated during 2005 to 2008
in the Maastricht University Medical Center, a tertiary 715-bed hospital, and originate from
surveillance cultures (commensal flora) from individual patients, recovered from nasal
swabs. MRSA and/or MSSA strains associated with MLST CC1, CC5, CC8, CC22, CC30, CC45,
CC7, CC12, CC15, CC25 and CC121, were randomly selected from our institutional collec-
tion (Table 1). All MRSA strains were tested positive for the MRSA-specific mecA gene, by
real-time PCR34. Additionally, 26 MSSA blood stream isolates from individual patients and
associated with either MLST CC8 or CC7 were tested. These isolates were considered inva-
sive.
Characterization of the genetic background
Typing of the spa locus was carried out as described previously19. The spa types were as-
signed through the Ridom SpaServer (http://spaserver.ridom.de) and clustered into spa-
CCs using the algorithm based upon repeat pattern (BURP) with Ridom StaphType 1.4
using the default settings35, 36. Although, spa typing alone sometimes lacks discriminatory
power, due to related spa repeat patterns within different clonal lineages and the emer-
gence of homoplasies among spa sequences37, it has been shown that spa typing/BURP
results are often in agreement with results obtained by MLST36, 38. Therefore, the associated
MLST CCs were allocated through the SpaServer. To confirm the association between MLST
and spa typing, in combination with BURP, MLST was performed on a representative set of
16 strains of each major spa type and associated MLST CC39, 40.
Phenotypic detection of slime producing ability onto Congo red agar
MRSA (n=72), MSSA with MRSA associated MLST CCs (n=75), i.e. CC1, CC5, CC8, CC22, CC30
and CC45, and MSSA with MSSA associated MLST CCs (n=81), i.e. CC7, CC12, CC15, CC25
and CC121, were cultured on Congo red agar (CRA) plates, either consisting of trypticase
soy or brain heart infusion agar (both from Becton Dickinson) with 0.8 g/L Congo red (Pro-
labo, Leuven, Belgium) and without or with 5% sucrose (Merck, Darmstadt, Germany).
Colony morphology and color were evaluated after incubation at 37°C for 24 h. Colonies
with a dry crystalline (rough) morphology were considered deviant and slime producing
positive16, smooth round colonies were classified as low-slime producers.
Staphylococcus aureus biofilm formation in relation to the genetic background
31
Table 1. Distribution of spa types and associated MLST CCs among S. aureus strains included in this study
associated
MLST CC
ST
No. of
MRSA
strains
No. of
MSSA
strains
agr
geno-
type
spa types MRSA strains
(No.)
spa types MSSA strains
(No.)
1 ST1 NA# 16 III NA# t127 (15), t1787
5 ST5/ST5 15 15 II
t002 (4), t003, t041, t045,
t447 (8)
t002 (12), t179, t311,
t2212
8 ST8/ST1411a 26 15 I t008 (12), t052 (6), t064,
t068 (5), t303, t622
t008a (10), t190, t648, t701
(2), t2041
22 ST22/ST22 10 15 I
t223 (10) t005 (9), t223, t474, t790,
t1433,
t1629, t2681
30 ST36/ST714b 10 15 III t012 (7), t253 (2), t1820 t012 (2), t021b (4), t238,
t300, t318 (2), t438, t1130,
t1504, t2572, t2854
45 ST45/ST45 11 15 I
t038 (8), t445 (2), t740 t015 (2), t026, t050, t065,
t102, t230 (3), t583, t589,
t620 (2),
t772 (2)
7 ST7 - 15 I - t091 (15)
12 ST12 - 10 II - t060, t156 (2), t160 (5),
t213, t771
15 ST15 - 15 II - t084 (11), t085, t491 (2),
t1716
25 ST25 - 10 I - t078 (4), t081, t087, t258,
t353,
t1671, t1898
121 ST720c - 15 IV - t159 (2), t171c (4), t284,
t408 (4), t645 (2), t659,
t2213
Total 72 156
# not available
Boldface indicates spa types on which multilocus sequence typing analysis was performed (ST, sequence type).
a The strain spa typed as t008 had ST1411, a double locus variant of ST8 at the gmk and tpi locus.
b The strain spa typed as t021 had ST714, a single locus variant of ST30 at the arcc locus.
c The strain spa typed as t171 had ST720, a single locus variant of ST121 at the yqil locus.
Detection of biofilm biomass with crystal violet staining
The polystyrene crystal violet adherence assay was carried out as described previously41,
with some modifications. Briefly, overnight cultures in Trypticase Soy Broth (TSB) without
dextrose (Becton Dickinson, Le pont de Claix, France) were diluted until 108 CFU/mL in TSB
containing 0%, 0.1%, 0.25% and 0.5% glucose. Individual wells of polystyrene, flat-
bottomed 96-well plates (Greiner Bio-One, Frickenhausen, Germany) were filled with 100-
L aliquots of the cultures. As a negative control, uninoculated medium was used. S. aureus
ATCC 25923 and one clinical S. aureus isolate from our collection, known to form fully es-
tablished biofilms (A590 values within the highest range and stable) as observed during a
Chapter 2
32
pilot experiment, were added to each plate as reference standard17 and positive control,
respectively. After 4 h of adhesion at 37°C on a rocking platform at 25 oscillations min-1, the
medium containing non-adhered cells, was replaced by 100 L fresh broth and the plates
were further incubated for 24 h. Next, the wells were washed three times with 200 L 0.9%
NaCl. Biofilms were fixed at 60°C during 1 h. Subsequently, 100 l crystal violet solution
(0.3% wt/vol) was added to all wells. After 15 min., the excess crystal violet was rinsed off
by placing the plates under running tap water. Finally, after drying the plates, bound crys-
tal violet was released by adding 100 L 70% (vol/vol) ethanol with 10% isopropyl alcohol
(vol/vol). Absorbance was measured spectrophotometrically at 590 nm (A590) and was
proportional to biofilm biomass. All assays were performed in triplicate, and repeated on
three occasions. The intra- and interday coefficients of variation for the assay were 14%
and 23%, respectively. To obtain a threshold A590 value for which strong biofilm formation
commences, the A590 values of all strains at the different glucose concentrations were
sorted in ascending order and divided into quartiles. The distribution of A590 values in the
lower three quartiles was similar at glucose concentrations of 0%, 0.1% and 0.25% and
therefore used to determine the cut-off value (two standard deviations above the mean
A590 value). The threshold A590 value was 0.374. Bacteria with A590 values above this value
were considered strong biofilm formers.
% of strians with a dry crystalli ne colony morphology
0
10
20
30
40
50
60
70
80
90
100
**
**
% of strians with a dry crystalline colony morphology
0
10
20
30
40
50
60
70
80
90
100 CC1
CC5
CC8
CC22
CC30
CC45
CC7
CC12
CC15
CC25
CC121
A
**
B
Figure 1. Congo red agar screening of S. aureus isolates. CRA screening for S. aureus with a dry crystalline
colony morphology, which was considered indicative for slime formation. In the left panel (A), the black bar
(not visible, 0%) represents MRSA (n=72), the dark grey bar represents MSSA with MRSA associated MLST
CCs (n=75) and the light grey bar represents MSSA with MSSA associated MLST CCs (n=81). Asterisks denote
statistically significant difference P < 0.01 (A) and statistically significant difference of individual CCs versus
all other associated MLST CCs (B) P < 0.01.
Determination of the agr type
The agr types of all S. aureus isolates were determined by a real-time multiplex PCR assay,
as described previously42.
Staphylococcus aureus biofilm formation in relation to the genetic background
33
Statistical analysis
SPSS version 15.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analyses. Chi-square
analysis was used for comparison of the prevalence of strong biofilm formation or slime
formation between the specified groups. Mann-Whitney U analysis was used to compare
the A590 values between groups of strong biofilm formers. A P value of < 0.05 was consid-
ered to be statistically significant.
% of strains of the specified group defined as strong biofilmformer
0
10
20
30
40
50
60
70
80
90
100
0% 0.1% 0.25% 0.5% glucose
**
**
**
**
**
*
Figure 2. Quantification of strong biofilm formation in MSSA and MRSA. Quantification of strains of the
specified group defined as strong biofilm former at different glucose concentrations. Black bars represent
MRSA, dark grey bars represent MSSA with MRSA associated MLST CCs and light grey bars represent MSSA
with MSSA associated MLST CCs. Asterisks denote statistically significant difference, (*) P < 0.05 and (**) P <
0.01.
Results
Characterization of the genetic background
The spa types and associated MLST CCs of all tested strains are shown in Table 1. The re-
sults of spa typing/BURP and MLST were in accordance for a representative set of 16 strains
of each major spa type and associated MLST CC.
Phenotypic detection of slime producing ability onto Congo red agar
The different Congo red agar (CRA) screening methods described in the literature were
evaluated16–18. The choice of the agar medium, either brain heart infusion or trypticase soy,
did not influence the morphology. The majority of S. aureus strains (91%) displayed colo-
nies with a normal morphology (smooth round colonies), indicating that most strains were
low-slime producers. Without sucrose, all colonies were colored (bright) red to bordeaux
Chapter 2
34
red, irrespective of the agar medium used. Addition of sucrose to both agar media resulted
in more dark colonies and made the dry crystalline morphology harder to recognize. With
sucrose, all colonies on brain heart infusion agar with Congo red were colored red to bor-
deaux red, while strains on trypticase soy agar with Congo red displayed mostly purple to
black colonies. Nuances in color were not corresponding to differences in morphology.
Absorbance at 590 nm
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
0% 0.1% 0.25% 0.5%
**
**
Glucose concentration
**
**
**
**
Figure 3. Biomass quantification of MSSA and MRSA. Absorbance (A590) of the crystal violet stained biofilm
matrix for strong biofilm formers (with A590 above the threshold value of 0.374, represented by the
horizontal dashed line) at different glucose concentrations. Boxplots at the left show MRSA, in the middle
MSSA with MRSA associated MLST CCs and at the right MSSA with MSSA associated MLST CCs. The lower
and higher boundary of the box indicates the 25th and 75th percentile, respectively. The line within the box
marks the median. Whiskers above and below the box indicate the 90th and 10th percentiles. Open circles
indicate the 95th and 5th percentiles. Asterisks denote statistically significant difference, (*) P < 0.05 and (**)
P < 0.01.
MSSA strains showed more often a deviant, dry crystalline (rough) morphology (slime
producing positive) than MRSA isolates, 14% (22 of 156) and 0%, respectively. A significant
distinction in slime formation was observed between MRSA and MSSA with MSSA associ-
ated MLST CCs, i.e. CC7, CC12, CC15, CC25 and CC121, and with MRSA associated MLST
CCs, i.e. CC1, CC5, CC8, CC22, CC30 and CC45 (P < 0.01), as shown in Figure 1A. MSSA asso-
ciated with MLST CC121 had the highest prevalence of a deviant morphology, 67% (10 of
15) (Figure 1B).
Detection of biofilm biomass with crystal violet staining
Under physiologic glucose (0.1%) concentration, 13% (n=30) of all strains formed a strong
biofilm and all these strains were MRSA or had a MRSA associated MLST CC. MRSA and
MSSA with MRSA associated MLST CCs, i.e. CC1, CC5, CC8, CC22, CC30 and CC45, were
significantly more capable than MSSA with MSSA associated MLST CCs, i.e. CC7, CC12,
CC15, CC25 and CC121, to form strong biofilms in the presence of 0.1% glucose (P < 0.01),
Staphylococcus aureus biofilm formation in relation to the genetic background
35
but not at glucose concentrations of 0.25% and 0.5% (Figure 2). The higher the glucose
concentration, the more strains produced biofilm above the A590 threshold value and were
consequently classified as strong biofilm former. At glucose concentrations of 0.25% and
0.5%, the amount of biomass of the biofilms of strong biofilm forming strains was still
significantly more for MRSA compared to MSSA irrespective of the MLST CCs (P < 0.01)
(Figure 3). Of all strains classified as strong biofilm producers, MRSA and MSSA associated
with MLST CC8 produced the most biomass under all tested glucose concentrations (Fig-
ure 4A and 4B). Strains defined as strong biofilm formers and associated with MLST CC5,
CC25 and CC30 approached approximately the same level of biomass at the following
glucose concentrations, i.e. CC5 at 0.25%, CC25 at 0.5% and CC30 at 0.5% glucose, respec-
tively.
Glucose concentration
0% 0. 1% 0.25% 0.5%
Absorbance at 590 nm
0.0
0.5
1.0
1.5
2.0
2.5
CC1
CC5
CC8
CC22
CC30
CC45
CC7
CC12
CC15
CC25
CC121
Glucose concentration
0% 0.1% 0.25% 0.5%
% of strains of the specified group
defined as strong biofilm former
0
10
20
30
40
50
60
70
80
90
100
*
*
**
A
#
**
#
#
*
#
#
0% 0.1% 0.25% 0.5%
Absorbance at 590 nm
0.0
0.5
1.0
1.5
2.0
2.5
CC1-S
CC5-R
CC5-S
CC8-R
CC8-S
CC22-R
CC22-S
CC30-R
CC30-S
CC45-R
CC45-S
*
0% 0.1% 0.25% 0.5%
% of strains of the specified group
defined as strong biofilm former
0
10
20
30
40
50
60
70
80
90
100
D
*
Glucose concentration
Glucose concentration
B
C
Figure 4. Biomass formation related to the genetic background of S. aureus. Absorbance (A590) of the crystal
violet stained biofilm matrix of strong biofilm forming S. aureus strains in relation to different associated
MLST CCs (A) and of strong biofilm forming strains associated with MLST CC1, CC5, CC8, CC22, CC30 and
CC45 (B). R in the legend represents MRSA and S represents MSSA. Quantification of strains of the specified
genetic background defined as strong biofilm former at different glucose concentrations, (C) and (D).
Asterisks denote statistically significant difference, (B) and (D), and statistical significant difference of
individual CCs versus all other associated MLST CCs, (A) and (C), except #, (*) P < 0.05 and (**) P < 0.01.
Chapter 2
36
The main contributors to the higher prevalence of MRSA and MSSA with MRSA associated
MLST CCs to produce strong biofilms at 0.1% glucose were MLST CC8 isolates, approxi-
mately 60% (26 of 41), (Figure 4C), especially with a tendency towards MRSA (Figure 4D).
Additionally, blood stream isolates of MSSA associated with MLST CC8 and MLST CC7
were included in the study, to address the question whether the isolation site is an (addi-
tional) predisposing factor for strong biofilm formation. MSSA associated with MLST CC7
are one of the main clonal lineages among blood stream isolates in our hospital19. No
differences in the ability to produce strong biofilms were observed between bloodstream
isolates and isolates of commensal origin among MSSA associated with MLST CC8 and CC7
(Figure 5A and 5B). Furthermore, no significant differences in slime-forming ability were
observed (Figure 5C).
Glucose concentration
0% 0.1% 0.25% 0.5%
% of strains of the specified group
defined as strong biofilm former
0
10
20
30
40
50
60
70
80
90
100 CC8-S-BSI
CC8-S-C
CC7-S-BSI
CC7-S-C
A
0% 0.1% 0.25% 0.5%
Absorbance at 590 nm
0.0
0.5
1.0
1.5
2.0
2.5 CC8-S-BSI
CC8-S-C
CC7-S-BSI
CC7-S-C
Glucose concentration
% of strains with a dry crystalline
colony morphology
0
10
20
30
40
50
60
70
80
90
100 CC8-S-BSI
CC8-S-C
CC7-S-BSI
CC7-S-C
4
2
77
11 11
2
6
14
15
1014
0000
BC
Figure 5. Biofilm formation in Staphylococcus aureus isolates of bloodstream infections and commensal
origin. Biofilm formation between S. aureus isolates of the same clonal lineage from blood stream infections
(CC8 n=15, CC7 n=11) and of commensal origin (CC8 n=15, CC7 n=15), no significant differences were found
(A). S in the legend represents MSSA, BSI represents bloodstream isolates and C represents commensal
isolates. Number on each bar refers to number of isolates. Absorbance (A590) of the crystal violet stained
biofilm matrix of strong biofilm formers at different glucose concentrations (B). CRA screening for colonies
with a dry crystalline morphology (C).
Correlation between slime formation and development of biofilm biomass
In order to investigate whether slime production is indicative for strong biofilm formation,
the correlation between these two characteristics was addressed. Phenotypic detection of
slime production on CRA was not related to the quantitative detection of strong biofilms,
measured by crystal violet staining, which was used as a gold standard. The sensitivity and
specificity of the CRA method for S. aureus was approximately 9% and 90%, respectively
(Table 2). Only a part of the slime producing strains surpassed the A590 threshold value for
strong biofilm formation, namely 5%, 15%, 45% and 90% at 0%, 0.1%, 0.25 and 0.5% glu-
cose, respectively.
Staphylococcus aureus biofilm formation in relation to the genetic background
37
Table 2. Correlation between slime formation (Congo red agar screening) and development of biofilm
biomass (crystal violet staining).
Glucose Sensitivity Specificity PPV NPV CRA+ /
CV+
CRA- /
CV+
CRA+ /
CV-
CRA- /
CV-
(%) (%) (%) (%) (%) Number of S. aureus strains
0
6.3 91.0 5.0 92.8 1 15 19 193
0.1
9.7 91.3 15.0 86.5 3 28 17 180
0.25
11.6 93.0 45.0 63.5 11 76 9 132
0.5
8.3 80.0 90.0 3.9 18 200 2 8
(PPV) positive predictive value, (NPV) negative predictive value, (CRA) Congo red agar screening, (CV) crystal violet
staining
Distribution of agr types
Clonal lineages MLST CC7, CC8, CC22, CC25 and CC45 harbored agr-I, all CC5, CC12 and
CC15 were characterized by agr-II, while all CC1 and CC30 were detected as agr-III. Fur-
thermore, CC121 isolates carried agr-IV (Table 1). No consistent relationship was found
between agr genotype and the ability to produce biofilm.
Discussion
In vitro quantification of biofilm formation in distinct clonal lineages of S. aureus was per-
formed to investigate whether there were differences in the capacity to form fully estab-
lished biofilms. This study revealed that at 0.1% glucose, enhanced biofilm formation of S.
aureus was strongly associated with MLST CC8 and observed in 60% of these isolates, while
it varied between 0–7% for the other clonal lineages tested.
A higher percentage of MSSA (14%) than MRSA (0%) was found positive for slime pro-
ducing ability, in concordance to the more important role of PIA/PNAG in MSSA than in
MRSA biofilm development8. Addition of sucrose to CRA did not influence slime formation,
suggesting that slime formation was carbohydrates independent. The results were consis-
tent with previous findings in MRSA and MSSA isolates of O’Neill et al. In MSSA isolates
increased ica expression and PIA/PNAG production (as determined with PIA/PNAG im-
munoblot) was correlated with 4% NaCl-induced biofilm formation, but not with glucose-
induced biofilm production8. In addition, in MRSA, ica operon transcription was more
potently activated by NaCl than by glucose, but did not result in PIA/PNAG formation8.
Since it has recently been suggested that, in general, PIA/PNAG is a minor matrix compo-
nent of S. aureus biofilms5, 9, and thus possibly hardly detectable by CRA screening, a low
prevalence of slime producing strains was expected. Knobloch et al. and Mathur et al. re-
Chapter 2
38
ported a positive CRA assay result in only 4–5% of the S. aureus strains tested, in relative
accordance with the results of this study, while Grinholc et al. mentioned 47% and 69% for
MRSA and MSSA, respectively16–18. Jain et al. reported differences between blood stream
isolates and commensal S. aureus isolates with regard to positive CRA screening, 75% and
20%, respectively20. The variations could be due to differences in genetic backgrounds of
the strains used, or to differences in interpretation of the colonies. The definition of slime-
forming strains used by Grinholc et al. and Jain et al. was based on the color of the colonies
and not on the morphology. Furthermore, they both found a high consistency (96% and
91%, respectively) between CRA screening and biofilm biomass crystal violet staining17, 20.
In contrast, both in this study, as well in the studies by Knobloch et al., Rode et al., and
Mathur et al.16, 18, 21, no correlation was found between slime producing MRSA and MSSA
isolates and an enhanced tendency to form large amounts of biomass. These studies
strongly suggest that CRA screening forms no alternative for crystal violet staining to de-
tect biofilm formation. Probably, the cell to cell adhesion, stimulated by the formation of
PIA/PNAG, is less efficient than the expression of surface adhesins, in their contribution to
produce more biomass.
As described before, the agr genotypes were strictly associated with the clonal line-
ages22, 23. However, exceptions have been observed24–27 which might be due to interstrain
recombination and intrastrain rearrangements28. The association between agr genotypes
and the genetic background explains the absence of a relationship between the enhanced
ability to form biofilm and specific agr genotype(s). Although, there was a tendency that
the agr-I genotype was associated with an enhanced capacity to form strong biofilms (data
not shown), this was a reflection of the biofilm-forming capacity of strains associated with
MLST CC8. In contrast to our results, Cafiso et al. described a link between agr-II genotype
and the capacity to form strong biofilms, since all strains with agr-II genotype were associ-
ated with strong biofilm formation at 0.25% glucose. However, the genetic background
was not taken into consideration29. Our findings revealed that strains associated with MLST
CC5, CC12 and CC15 (all harboring agr-II) were classified as strong biofilm formers in only
21%, 9% and 53% of the cases at 0.25% glucose, respectively. Furthermore, the agr-II geno-
type encompass diverse strains, not including strains associated with MLST CC822, 23.
Biofilm formation was induced by increasing glucose concentrations up to 0.5% in
both MRSA and MSSA isolates, which is entirely consistent with previously reported data8,
21. However, MRSA produced significantly more biomass than MSSA with MSSA associated
MLST CCs, under all tested glucose conditions. Especially strains associated with MLST CC8
contributed to this phenomenon. Furthermore, MSSA with MRSA associated MLST CCs
were also capable to produce more biomass than MSSA with MSSA associated MLST CCs at
0.1% glucose. Variations in biofilm forming capacities in clonal lineages of S. aureus could
be explained by unique combinations of surface-associated and regulatory genes23 or by
different expression levels of genes that regulate the different phases of biofilm formation.
Since this study showed that the biofilm formation on polystyrene surfaces was the
strongest for the MLST CC8 associated genetic background, further studies with other
material or tissue are warranted. Recently, differences in adhesion to human airway epithe-
lial cells have been observed between strains belonging to MLST CC8 and CC5, the latter
demonstrating a generally lower adherence in both representatives of MRSA and MSSA30.
Staphylococcus aureus biofilm formation in relation to the genetic background
39
An enhanced ability to adhere and invade these cells has also been shown for MRSA asso-
ciated with the Brazilian/Hungarian clone, which belongs to MLST CC815, compared to a
population of MSSA with an unknown genetic background31. Furthermore, strains associ-
ated with the same clone were not included among our MLST CC8 isolates, but were pre-
viously classified as strong biofilm producers and designated superior in their ability to
produce biofilm compared to isolates associated with the Pediatric clone (MLST CC5)32.
To analyse possible other predisposing factors besides the MLST CC8 associated ge-
netic background, bloodstream and commensal isolates of the same clonal lineage were
compared. The biofilm forming capacity between MSSA bloodstream and commensal
isolates, associated with MLST CC8 and CC7, was similar and consistent with the findings of
Smith et al., who compared the biofilm forming capacity of Scottish clinical S. aureus strains
collected from different isolation sites33. In contrast, Jain et al. described more frequently
strong biofilm formers among S. aureus bloodstream isolates than commensal20. A possible
explanation might be that all bloodstream isolates came from patients with peripheral
intravenous devices, while this was not an inclusion criterion in the study by Smith et al. .
Peripheral or central line intraluminal colonization might be associated with strains that
easily attach to (catheter) surfaces and as a consequence these strains could be dominant
in leading to bloodstream infections.
Conclusions
In summary, the present study reveals that the MLST CC8 associated genetic background
was a predisposing factor for strong biofilm formation in vitro, under all tested glucose
concentrations, i.e. 0%, 0.1%, 0.25% and 0.5%. At physiologic glucose concentration (0.1%),
0–7% of S. aureus from various clonal lineages were defined as strong biofilm former, com-
pared to 60% for the S. aureus associated MLST CC8.
Chapter 2
40
References
1. Patel R. Biofilms and antimicrobial resistance. Clin Orthop Relat Res 2005:41–7.
2. Leid JG, Shirtliff ME, Costerton JW, Stoodley AP. Human leukocytes adhere to, penetrate, and respond to
Staphylococcus aureus biofilms. Infect Immun 2002;70:6339–45.
3. Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science
1999;284:1318–22.
4. Foster TJ, Hook M. Surface protein adhesins of Staphylococcus aureus. Trends Microbiol 1998;6:484–8.
5. Boles BR, Horswill AR. Agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog 2008;4:e1000052.
6. Vuong C, Saenz HL, Gotz F, Otto M. Impact of the agr quorum-sensing system on adherence to polystyrene in
Staphylococcus aureus. J Infect Dis 2000;182:1688–93.
7. O’Gara JP. ica and beyond: biofilm mechanisms and regulation in Staphylococcus epidermidis and Staphylococ-
cus aureus. FEMS Microbiol Lett 2007;270:179–88.
8. O’Neill E, Pozzi C, Houston P, et al. Association between methicillin susceptibility and biofilm regulation in
Staphylococcus aureus isolates from device-related infections. J Clin Microbiol 2007;45:1379–88.
9. Izano EA, Amarante MA, Kher WB, Kaplan JB. Differential roles of poly-N-acetylglucosamine surface polysaccha-
ride and extracellular DNA in Staphylococcus aureus and Staphylococcus epidermidis biofilms. Appl Environ Mi-
crobiol 2008;74:470–6.
10. Regassa LB, Novick RP, Betley MJ. Glucose and nonmaintained pH decrease expression of the accessory gene
regulator (agr) in Staphylococcus aureus. Infect Immun 1992;60:3381–8.
11. O’Neill E, Pozzi C, Houston P, et al. A novel Staphylococcus aureus biofilm phenotype mediated by the fi-
bronectin-binding proteins, FnBPA and FnBPB. J Bacteriol 2008;190:3835–50.
12. Guyton AC, Hall JE, eds. Textbook of medical physiology. 10th ed. Philadelphia: W.B. Saunders company; 2001.
13. Deurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of
methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect 2007;13:222–35.
14. Noto MJ, Kreiswirth BN, Monk AB, Archer GL. Gene acquisition at the insertion site for SCCmec, the genomic
island conferring methicillin resistance in Staphylococcus aureus. J Bacteriol 2008;190:1276–83.
15. Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol 2008;8:747–63.
16. Knobloch JK, Horstkotte MA, Rohde H, Mack D. Evaluation of different detection methods of biofilm formation
in Staphylococcus aureus. Med Microbiol Immunol 2002;191:101–6.
17. Grinholc M, Wegrzyn G, Kurlenda J. Evaluation of biofilm production and prevalence of the icaD gene in methi-
cillin-resistant and methicillin-susceptible Staphylococcus aureus strains isolated from patients with nosocomial
infections and carriers. FEMS Immunol Med Microbiol 2007;50:375–9.
18. Mathur T, Singhal S, Khan S, Upadhyay DJ, Fatma T, Rattan A. Detection of biofilm formation among the clinical
isolates of Staphylococci: an evaluation of three different screening methods. Indian J Med Microbiol
2006;24:25–9.
19. Nulens E, Stobberingh EE, van Dessel H, et al. Molecular characterization of Staphylococcus aureus bloodstream
isolates collected in a Dutch University Hospital between 1999 and 2006. J Clin Microbiol 2008;46:2438–41.
20. Jain A, Agarwal A. Biofilm production, a marker of pathogenic potential of colonizing and commensal staphylo-
cocci. J Microbiol Methods 2009;76:88–92.
21. Rode TM, Langsrud S, Holck A, Moretro T. Different patterns of biofilm formation in Staphylococcus aureus
under food-related stress conditions. Int J Food Microbiol 2007;116:372–83.
22. Monecke S, Slickers P, Ehricht R. Assignment of Staphylococcus aureus isolates to clonal complexes based on
microarray analysis and pattern recognition. FEMS Immunol Med Microbiol 2008;53:237–51.
23. Lindsay JA, Moore CE, Day NP, et al. Microarrays reveal that each of the ten dominant lineages of Staphylococ-
cus aureus has a unique combination of surface-associated and regulatory genes. J Bacteriol 2006;188:669–76.
24. Holtfreter S, Grumann D, Schmudde M, et al. Clonal distribution of superantigen genes in clinical Staphylococ-
cus aureus isolates. J Clin Microbiol 2007;45:2669–80.
Staphylococcus aureus biofilm formation in relation to the genetic background
41
25. Luczak-Kadlubowska A, Sulikowska A, Empel J, et al. Countrywide molecular survey of methicillin-resistant
Staphylococcus aureus strains in Poland. J Clin Microbiol 2008;46:2930–7.
26. Layer F, Ghebremedhin B, Konig W, Konig B. Heterogeneity of methicillin-susceptible Staphylococcus aureus
strains at a German University Hospital implicates the circulating-strain pool as a potential source of emerging
methicillin-resistant S. aureus clones. J Clin Microbiol 2006;44:2179–85.
27. Peacock SJ, Moore CE, Justice A, et al. Virulent combinations of adhesin and toxin genes in natural populations
of Staphylococcus aureus. Infect Immun 2002;70:4987–96.
28. Wright JS, 3rd, Traber KE, Corrigan R, Benson SA, Musser JM, Novick RP. The agr radiation: an early event in the
evolution of staphylococci. J Bacteriol 2005;187:5585–94.
29. Cafiso V, Bertuccio T, Santagati M, et al. agr-Genotyping and transcriptional analysis of biofilm-producing
Staphylococcus aureus. FEMS Immunol Med Microbiol 2007;51:220–7.
30. Karauzum H, Ferry T, de Bentzmann S, et al. Comparison of adhesion and virulence of two predominant hospi-
tal-acquired methicillin-resistant Staphylococcus aureus clones and clonal methicillin-susceptible S. aureus iso-
lates. Infect Immun 2008;76:5133–8.
31. Amaral MM, Coelho LR, Flores RP, et al. The predominant variant of the Brazilian epidemic clonal complex of
methicillin-resistant Staphylococcus aureus has an enhanced ability to produce biofilm and to adhere to and in-
vade airway epithelial cells. J Infect Dis 2005;192:801–10.
32. de Miranda OP, Silva-Carvalho MC, Ribeiro A, et al. Emergence in Brazil of methicillin-resistant Staphylococcus
aureus isolates carrying SCCmecIV that are related genetically to the USA800 clone. Clin Microbiol Infect
2007;13:1165–72.
33. Smith K, Perez A, Ramage G, Lappin D, Gemmell CG, Lang S. Biofilm formation by Scottish clinical isolates of
Staphylococcus aureus. J Med Microbiol 2008;57:1018–23.
34. Donker GA, Deurenberg RH, Driessen C, Sebastian S, Nys S, Stobberingh EE. The population structure of Staphy-
lococcus aureus among general practice patients from the Netherlands. Clin Microbiol Infect 2009;15:137–43.
35. Friedrich AW, Witte W, Harmsen D, et al. SeqNet.org: a European laboratory network for sequence-based typing
of microbial pathogens. Euro Surveill 2006;11:E060112 4.
36. Strommenger B, Kettlitz C, Weniger T, Harmsen D, Friedrich AW, Witte W. Assignment of Staphylococcus
isolates to groups by spa typing, SmaI macrorestriction analysis, and multilocus sequence typing. J Clin Micro-
biol 2006;44:2533–40.
37. Nubel U, Roumagnac P, Feldkamp M, et al. Frequent emergence and limited geographic dispersal of methicil-
lin-resistant Staphylococcus aureus. Proc Natl Acad Sci U S A 2008;105:14130–5.
38. Ruppitsch W, Indra A, Stoger A, et al. Classifying spa types in complexes improves interpretation of typing
results for methicillin-resistant Staphylococcus aureus. J Clin Microbiol 2006;44:2442–8.
39. Deurenberg RH, Vink C, Oudhuis GJ, et al. Different clonal complexes of methicillin-resistant Staphylococcus
aureus are disseminated in the Euregio Meuse-Rhine region. Antimicrob Agents Chemother 2005;49:4263–71.
40. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of
methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol 2000;38:1008–
15.
41. Peeters E, Nelis HJ, Coenye T. Comparison of multiple methods for quantification of microbial biofilms grown in
microtiter plates. J Microbiol Methods 2008;72:157–65.
42. Francois P, Koessler T, Huyghe A, et al. Rapid Staphylococcus aureus agr type determination by a novel multiplex
real-time quantitative PCR assay. J Clin Microbiol 2006;44:1892–5.
43
CHAPTER 3
Unpredictable effects of rifampicin as adjunctive agent in
elimination of rifampicin-susceptible and -resistant
Staphylococcus aureus grown in biofilm
Sander Croes1, 2
Patrick S. Beisser1
Cees Neef2
Cathrien A. Bruggeman1
Ellen E. Stobberingh1
1 Department of Medical Microbiology, School for Public Health and Primary Care (CAPHRI), Maastricht University
Medical Center, Maastricht, the Netherlands
2 Department of Clinical Pharmacy and Toxicology, Maastricht University Medical Center, Maastricht, the Netherlands
Antimicrobial Agents and Chemotherapy. 2010; 54(9): 3907–12
Chapter 3
44
Abstract
The use of rifampicin as adjunct in biofilm-associated infections is based on the ability to
penetrate into biofilms and a presumed activity against dormant bacteria. Yet, its efficacy
remains contradictory and rifampicin-resistant strains frequently emerge during therapy.
Therefore, the efficacy against rifampicin-susceptible and isogenic rifampicin-resistant
methicillin-susceptible Staphylococcus aureus (MSSA) strains was evaluated.
Biofilms were generated under static conditions using MSSA with various genetic
backgrounds. Oxacillin alone or with rifampicin at various concentrations were subse-
quently added and after 24h biomass and viable cell counts were determined.
Upon rifampicin addition, inter-strain variations in viable count change, ranging from a
tendency towards antagonism to synergy, were observed among all strains tested, irre-
spective of the genetic backgrounds of the strains. Similar variations were observed in
changes in biomass. The decrease in viable count upon rifampicin addition was negatively
correlated to formation of large amounts of biomass, since strains embedded by more
biomass showed a diminished reduction in viable count.
Rifampicin (1 g/mL) as adjunct to oxacillin achieved greater reductions in biomass
produced by most rifampicin-susceptible isolates, ranging from 17 to 54% compared to
4% for oxacillin alone. In contrast, rifampicin had no additional value in reduction of bio-
mass of isogenic rifampicin-resistant mutants. At subinhibitory concentrations of rifam-
picin (0.008 g/mL), none of the strains tested yielded an extra reduction in biomass ≥
40%.
In conclusion, the effect of rifampicin as adjunct on biomass and viable count was un-
predictable and the use of rifampicin against biofilm containing rifampicin-resistant strains
seems unwarranted.
Rifampicin and Staphylococcus aureus biofilm formation
45
Introduction
Bacteria embedded in biofilm are often hard to eradicate, which will often result in failure
of antibiotic therapy. Biofilm can appear and persist on implanted or indwelling devices.
Adherence to bone or natural tissue can also occur. As a consequence of biofilm formation,
foreign body infections are a risk factor for persistent bacteremia1.
Staphylococcus aureus biofilm infected devices often require removal in combination
with antimicrobial therapy2. Even if an infection seems to be cured, a subset of bacteria can
survive within the partly unremoved biofilm and remanifest after several years. These are
the so-called low-grade infections3. The ideal antibiotic should be able to diffuse properly
into biofilms, eradicate dormant bacteria and kill phagocytized S. aureus, since foreign-
body infections were associated with intracellular S. aureus4,5. Rifampicin meets these crite-
ria partially 6. Rifampicin penetrates biofilms adequately7 and improves the diffusion of a
companion agent through the biofilm 8. It also reduces the adherence of bacteria to sur-
faces6. Furthermore, rifampicin addition eliminates intrinsic rifampicin-resistant Pseudomo-
nas aeruginosa (MIC 32 g/mL) from biofilms9. Therefore, it could be hypothesized that the
presence of rifampicin leads to biofilm matrix disintegration. However, rifampicin can not
be used alone due to the rapid emergence of resistance10 and it is not as effective as pre-
sumed against slow growing bacteria7,11. An alternative approach for S. aureus biofilm-
associated infections is the addition of rifampicin to a companion drug. In clinical practice,
rifampicin addition has occasionally demonstrated to be beneficial in terms of clinical or
bacteriological cure rates12, especially for prosthetic device-related infections5,13,14. How-
ever, its effect remains poorly defined since the number of supporting human studies is
limited and most of them are underpowered5,13–15. Moreover, recently performed in vitro
studies have demonstrated antagonistic effects after addition of rifampicin in experimental
foreign-body infection and endocarditis models16,17.
Exposure to combination therapy including rifampicin frequently results in the emer-
gence of rifampicin-resistant subpopulations, which might hinder clearance of the infec-
tion18. This is probably due to the fact that the pharmacokinetics of the companion drug
were different from that of rifampicin. Preferable, the companion drug needs to penetrate
easily through diverse layers of a biofilm to prevent the development of rifampicin resis-
tance. But, although some antibiotics penetrate adequately through biofilms, bacteria may
be protected from killing by thickening of the cell wall7. A high bacterial load is another
causative reason for rapid resistance development19. To overcome the emergence of resis-
tance it is recommended that rifampicin should be initiated after the companion drug has
been administered for 2 to 5 days, to reduce the high density of the initial burden20, or at
least until a substantial reduction in bacterial load has been achieved18,21.
Since inter-strain variability in response to rifampicin addition might be responsible for
contradictory results obtained by various authors, the aim of the present study was to
elucidate whether this variability does exist for strains between and within the S. aureus
genetic backgrounds associated with multilocus sequence type (MLST) CC5, CC8 and
CC30. Furthermore, since rifampicin-resistant mutants emerge during therapy and rifam-
Chapter 3
46
picin is used for a hypothesized destruction of the biofilm matrix, we evaluated whether
continuation of exposure to rifampicin is useful against biofilms containing rifampicin-
resistant methicillin-susceptible S. aureus (MSSA). In addition, we examined whether a
potential effect was also present at a subinhibitory concentration.
Materials and methods
Bacterial strains
As part of an ongoing surveillance of S. aureus carriers, seventeen MSSA isolates from indi-
vidual patients, recovered from nasal swabs in the Maastricht University Medical Center, a
tertiary 715-bed hospital, were evaluated. The isolates were randomly selected from a
group of MSSA associated with MLST CC5 (n=6), CC8 (n=5) and CC30 (n=6) and a rifampicin
MIC of 0.016 g/mL (Table 1). All three lineages possess the ability to become methicillin-
resistant S. aureus (MRSA) by acquisition of a Staphylococcal Cassette Chromosome mec
(SCCmec) element and belong to pandemic lineages, CC30 in Europe and CC8 in the USA22.
This study was restricted to MSSA isolates, since the prevalence of MRSA is still low in the
Netherlands23 and the Scandinavian countries24.
Table 1. Characteristics of S. aureus strains and rifampicin-resistant mutants included in this study.
associated
MLST CC ST
No. of
isolates
No. of
mutants
Oxacillin
MIC (g/mL)
Rifampicin MIC (g/mL)
/ Disk diffusion
spa types
(No.)
RSS RRM RSS RRM RSS RRM
5 ST5 6 6 0.125 – 0.5 0.125 – 0.5 0.016 / S > 4 / R t002 (6)
8 ST1411a 5 5 0.125 – 0.5 0.125 – 0.5 0.016 / S > 4 / R t008a (5)
30 ST714b 6 6 0.125 – 0.5 0.125 – 0.5 0.016 / S > 4 / R t021b (2), t012 (2),
t238 (1), t1130 (1)
RSS, rifampicin susceptible strain ; RRM, rifampicin resistant mutant
Boldface indicates spa types on which multilocus sequence typing analysis was performed (ST, sequence type).
a The strain spa typed as t008 had ST1411, a double locus variant of ST8 at the gmk and tpi locus.
b The strain spa typed as t021 had ST714, a single locus variant of ST30 at the arcC locus.
Characterization of the genetic background
Real-time amplification of the spa locus, followed by sequencing, was performed as de-
scribed before25. The spa types were assigned through the Ridom SpaServer
(http://spaserver.ridom.de) and clustered into spa-CCs using the algorithm based upon
repeat pattern (BURP) with Ridom StaphType 1.5 using the default settings26. Since it has
been shown that spa typing/BURP, yields results consistent with typing results obtained by
MLST26,27, the associated CCs, as determined with MLST, were allocated through the Ridom
SpaServer. To confirm the association between MLST and spa typing, in combination with
Rifampicin and Staphylococcus aureus biofilm formation
47
BURP, MLST was performed on one isolate of each major spa type and associated MLST CC,
as described previously25,28.
Isolation of rifampicin-resistant mutants
Selective rifampicin containing (16 g/mL = 1000 × MIC) 5% sheep blood agar plates
(Oxoid CM0331, Wesel, Germany) were seeded with 100 L of a suspension of approxi-
mately 109 CFU/mL of MSSA and incubated overnight at 37°C. The colonies that appeared
on these plates were picked, purified and cultured overnight on plates containing rifam-
picin (16 g/mL). Afterwards, rifampicin-resistant mutants were kept frozen at -20°C, until
further examination. Prior to each test, mutants were plated on non-antibiotic containing
blood agar plates (Oxoid PB5039A, Basingstoke, UK).
Susceptibility testing
Susceptibility testing of the parent strains was performed using a micro-dilution technique
according to the CLSI guidelines29. Prior and after each experiment, rifampicin resistance of
the rifampicin-resistant mutants was confirmed using a disk diffusion method (Neo-
Sensitabs 30 g, Rosco Diagnostica A/S, Taastrup, Denmark) on Mueller-Hinton II agar
plates (Becton Dickinson Ref:221177, USA), according to the manufacturer’s recommenda-
tions and the CLSI breakpoints30. Rifampicin susceptibility of the rifampicin-susceptible
isolates was likewise determined.
Biofilm formation in microtiter plates and detection of biomass and viable count
MSSA were allowed to establish biofilms during 24h in 96-well (biomass) and 24-well (vi-
able count) flat-bottomed non-tissue culture treated polystyrene microtiter plates (Greiner
Bio-One, Frickenhausen, Germany and Becton Dickinson, Le Pont de Claix, France, respec-
tively) at 37°C on a rocking platform at 25 oscillations min-1. Individual wells were filled
with 100 L (biomass) and 800 L (viable count) of an overnight culture which was diluted
until 108 CFU/mL in Trypticase Soy Broth (TSB) without dextrose (Becton Dickinson, Le Pont
de Claix, France), respectively, and supplemented with 0.1% glucose. After 24h biofilm
formation, growth medium with planktonic cells was discarded and replaced by fresh
broth containing antibiotics, except for controls, where medium was added only. Oxacillin
(Sigma-Aldrich, Zwijndrecht, the Netherlands) was added at 2 and 4 × MIC (six replicates
per concentration). Furthermore, rifampicin (Sigma-Aldrich) at ½ (0.008 g/mL) and 62½ ×
MIC (1 g/mL) was added to oxacillin. Oxacillin was also tested alone. The plates were
incubated for an additional 24h. Subsequently, the wells were washed three times with
200 L (biomass) and 1.6 mL NaCl 0.9% (viable count), respectively.
Similar concentrations of rifampicin were used when the rifampicin-resistant mutants
were tested: a rifampicin concentration of 1 g/mL was considered clinically achievable in
serum. The subinhibitory concentration (½ × MIC) was used to reveal whether a low con-
centration affects the ability to form biomass and influences bacterial replication and/or
killing.
Chapter 3
48
Biomass formation in 96-well plates was quantified using the crystal violet adherence
assay, carried out as described previously25 and performed in six fold. Biofilms grown in 24-
wells plates were dispersed with a disposable cell scraper, adjusted to 1 mL, diluted and
plated on blood agar plates to determine the number of CFU per well. Viable count ex-
periments were repeated once. The intra- and interday coefficients of variation for the
biomass assay were 10% and 15%, respectively.
Synergy for the viable count measurements was defined as a decrease of ≥ 2-log10 CFU
per well with a combination of two antimicrobials versus the most active single agent.
Antagonism was defined as an increase of ≥ 1-log10 CFU per well with the combination
compared with the least active single agent.
% of isolates
0
10
20
30
40
50
60
70
80
90
100 Antagonism (A)
> 40% increase (B)
Tendency towards
antagonism (A)
> 20% increase (B)
Indifference (A)
Indifference (B)
Tendency towards
synergism (A)
> 20% decrease (B)
Synergism (A)
> 40% decrease (B)
A
% of isolates
0
10
20
30
40
50
60
70
80
90
100
2
15
11
11
8
7
15 13
1
3
P < 0.01
P < 0.05
7
7
2
14
3
4
6
22
13
42
3
8
00
RIF-R
0.008 µg/mL1 µg/mL
RIF-S
RIF-S RIF-S
RIF-R
RIF-R
RIF-R RIF-S
0.008 µg/mL
1 µg/mL
P < 0.01
B
Figure 1. Categorization of the effect of rifampicin as adjunctive agent on S. aureus biofilm. Categorization
of rifampicin-susceptible (RIF-S) isolates and rifampicin-resistant (RIF-R) mutants for viable count of biofilm-
embedded bacteria (A) and biomass (B) measurements. The effect was expressed as the difference between
oxacillin alone and oxacillin in combination with rifampicin and subsequently categorized. The adjunctive
use of rifampicin was evaluated at 0.008 g/mL and 1 g/mL, respectively. The number of strains tested are
specified per category in each bar. An extra reduction of ≥ 1-log10 CFU per well (including synergism) upon
rifampicin and oxacillin exposure was considered a positive outcome. Similarly, an extra decrease in
biomass of > 20% in the presence of rifampicin, compared to oxacillin alone, was considered positive. All
positive outcomes were clustered and are shown with slope striped patterns. Grey or white filled bars
display a negative outcome and were clustered as well.
Statistical analysis
SPSS version 15.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analyses. ANOVA with
Bonferroni correction was used to compare individual runs of the biomass experiments.
Chi-square analysis was used for comparison of the prevalence of defined categories be-
tween the specified groups. Mann-Whitney U analysis was used to compare biomass val-
ues and changes in viable count. A P value of ≤ 0.05 was considered to be statistically
significant.
Rifampicin and Staphylococcus aureus biofilm formation
49
RIF-S
CC5 CC8 CC30 BF35 CC5 CC8 CC30
Change in Log10 CFU/well
-4
-3
-2
-1
0
1OXA
OXA+RIF
RIF-S
CC5 CC8 CC30 BF35 CC5 CC8 CC30
Relative change in biomass vs . control (%)
-60
-50
-40
-30
-20
-10
0
10
20
30
40
50
60
70
80
90
280
290
300 OXA
OXA+RIF
RIF-R RIF-R
AB
-BF35
P < 0.05
P < 0.05
Figure 2. The effect of rifampicin as adjunctive agent on S. aureus biofilm per clonal lineage. Change in
viable count (A) or biomass of biofilm-embedded bacteria (B) caused by oxacillin (OXA) combined with
rifampicin (RIF) at 1 g/mL, compared with control (dark grey filled bars). The effects of oxacillin alone at 2 ×
MIC are also shown (light grey filled bars). The results of the biomass experiments with BF35 were excluded,
since BF35 showed a totally different outcome than the other isolates associated with MLST CC8. Error bars
indicate standard error of the mean. The abbreviations RIF-S and RIF-R represent rifampicin-susceptible
isolates and rifampicin-resistant mutants, respectively.
Results
Rifampicin as adjunct against rifampicin-susceptible isolates
Following biofilm formation under static conditions, we examined the inter-strain variabil-
ity of rifampicin addition to oxacillin on biomass and viable count among genetically re-
lated biofilm-embedded MSSA strains. Rifampicin as an adjunctive agent at 1 g/mL (62½
× MIC) reduced the viable count of these isolates and the amount of biomass formed gen-
erally more than oxacillin alone at 2 × MIC. Increased bacterial killing of ≥ 1 log10 CFU per
well compared to oxacillin was observed in 10 out of 17 isolates, of which four demon-
strated synergism (Figure 1A). However, inter-strain variability in response to rifampicin
was found since an increase in viable count was observed with four other isolates. Beside
that, an additional decrease in biomass of 20% or more was noticed in 15 out of 17 isolates
(Figure 1B), whereas one strain showed an increase in biomass. This isolate (BF35), associ-
ated with MLST CC8, demonstrated an increase of approximately 300% in biomass forma-
tion upon addition of rifampicin at 62½ × MIC to oxacillin (Figure 2B). This increase was
accompanied by less effective killing of bacterial cells: –1.04 log10 versus an average of
–2.69 log10 for the other rifampicin-susceptible isolates associated with MLST CC8 (Figure
2A). Contrary to this observation, the relative change in biomass of the rifampicin-
susceptible isolates was independent on the genetic background (Figure 2B) when rifam-
picin was used as adjunctive agent at 62½ × MIC. However, rifampicin addition led to a
smaller decline in CFU per well (–1.52 log10) against a few isolates associated with MLST
Chapter 3
50
CC5 compared to CC8 (–2.69 log10) (except isolate BF35) and CC30 (–2.43 log10) (Figure 2A),
but there was a tendency that the former were embedded by more biomass (Figure 3 and
4C).
Absorbance at 590 nm
0.00.20.40.60.81.01.21.4
Additional change in Log10 CFU/well
-4
-3
-2
-1
0
1
S
S
S
S
S
S
R
RR
R
R
S
S
SR
R
R
R
R
R
S
SS
S
S
R
RS
S
R
R
R
R
S
Figure 3. The additional change in viable count (Log10 CFU per well) of biofilm-embedded bacteria in the
presence of rifampicin (1 g/mL) as an adjunct to oxacillin (2 × MIC), compared to the change with oxacillin
alone. The dashed horizontal line indicates the distinction between increase (upper panel) and decrease
(lower panel) in viable count. The dotted line represents the threshold values for a synergistic effect of
rifampicin. The amount of biomass (absorbance at 590 nm) of the controls is represented on the x-axis. The
dashed vertical line indicates the previously defined threshold value for strong biomass formation. The
symbol fillings of all tested strains associated with MLST CC8 (circles), CC5 (triangles downwards) and CC30
(squares) represent the change in biomass upon addition of oxacillin in combination with rifampicin.
Unfilled and filled symbols indicate an increase and decrease in biomass compared to control, respectively.
The abbreviations S and R represent rifampicin-susceptible isolates and rifampicin-resistant mutants,
respectively.
To evaluate the concentration of the companion agent, we evaluated the effect on bio-
mass of 2 × MIC oxacillin compared with 4 × MIC oxacillin, both combined with rifampicin
at 0.008 and 1 g/mL. No differences in relative change in biomass were observed be-
tween these two oxacillin concentrations (data not shown).
A subinhibitory concentration of rifampicin was tested to assess whether rifampicin
augments biofilm formation, as described for various antibiotics against different bacterial
species31,32. In general, compared to oxacillin alone, addition of rifampicin at 0.008 g/mL
(½ × MIC) to oxacillin neither triggered biomass formation, nor enhanced the reduction in
biomass (Figure 1B). Moreover, compared to rifampicin at 1 g/mL, the number of isolates
without any effect on viable count increased from 3 to 8 out of 17 isolates (Figure 1A).
Rifampicin and Staphylococcus aureus biofilm formation
51
Rifampicin as adjunct against rifampicin-resistant mutants
Besides a direct antimicrobial effect on RNA polymerase10, we hypothesized that rifampicin
exercises an anti-biofilm effect by causing matrix degradation, thereby improving the
diffusion of the companion agent. Therefore, we evaluated whether rifampicin was also
able to destruct biofilms of rifampicin-resistant strains. Although we observed a synergistic
bacterial killing effect for one isolate, when rifampicin was added at 1 g/mL to oxacillin
(Figure 1A), 7 out of 17 rifampicin-resistant mutants showed a slight increase in viable
count (Figure 1A). Most rifampicin-resistant mutants (13 out of 17) showed indifference at
0.008 g/mL rifampicin. Although the viable count of some mutants associated with MLST
CC5 and CC8 was reduced slightly more in the presence of rifampicin, compared with
oxacillin alone (Figure 2A), the amount of biomass was rather unaltered (Figure 2B and 3).
Overall, biomass was not affected by the presence of rifampicin in both concentrations: 15
out of 17 rifampicin-resistant mutants showed an indifferent effect when rifampicin was
added to oxacillin (Figure 1B).
Viable Count / Biomass
0
50x106
100x106
150x106
200x106
250x106
CFU/biofilm
0
20x106
40x106
60x106
80x106
100x106
CC5
CC8
CC30
A
Absorbance at 590 nm
0.0
0.2
0.4
0.6
0.8
P < 0.05
P < 0.05
P < 0.05
P < 0.05
P < 0.05 P < 0.05
RIF-S RIF-R RIF-S RIF-R RIF-S RIF-R
BC
Figure 4. The amount of biomass (absorbance at 590 nm) produced during 48h (A), the number of colony
forming units (CFU) per biofilm (B) and the number of viable micro-organisms per biomass (C), per genetic
background, in the absence of antibiotics. Error bars represent standard error of the mean. The
abbreviations RIF-S and RIF-R represent rifampicin-susceptible isolates and rifampicin-resistant mutants,
respectively.
Effect of rifampicin in relation to biomass formation
Some strains associated with MLST CC8 or CC5, including both rifampicin-susceptible
isolates and rifampicin-resistant mutants, possessed an absorbance value above a previ-
ously defined threshold value of strong biomass formation at 0.1% glucose25 (Figure 3).
When strong biomass formation was taken into account, the viable counts of both rifam-
picin-susceptible and rifampicin-resistant strains embedded by large amounts of biomass,
were hardly affected by rifampicin addition to oxacillin. Additional changes in viable count
were generally less than 1-log10 CFU per well (Figure 3). On the other hand, compared to
strains with the highest amounts of biomass, half of all low biomass-producers (irrespec-
tive of the clonal lineage) showed a substantially larger additional reduction in viable
count (up to 3-log10) upon rifampicin addition. However, mutants associated with MLST
Chapter 3
52
CC30, which were also low biomass-producing strains, showed approximately 20% en-
hanced biomass formation in the presence of rifampicin (Figure 2B and 3). Consequently,
these bacteria became more embedded upon rifampicin addition, resulting in rather no
difference in effect on viable count, compared to oxacillin alone (Figure 2A and 3).
Discussion
Medical device associated infections such as orthopedic implant-related infections and
prosthetic valve endocarditis or infections due to contaminated intravenous lines have
been associated with bacteria embedded in biofilm12,13,15. In clinical practice, rifampicin is
used as additional therapy in foreign body-related infections due to S. aureus2. Since con-
tradictory results of rifampicin as adjunctive agent for the treatment of S. aureus biofilm
related infections have been reported5,13, we performed in vitro studies and demonstrated
that eradication with rifampicin in combination with oxacillin displays inter-strain variabil-
ity, both for rifampicin-susceptible isolates and rifampicin-resistant mutants.
Both the concentration of the adjunctive agent and the companion agent are essential
for the outcome of the combination. A dose depending effect of the companion drug have
been described for beta-lactams and fluoroquinolones16,33, but was not observed with
oxacillin in our experiment. Similar results were obtained with oxacillin at 2 and 4× MIC.
Furthermore, the reduction in the amount of biomass at 0.008 g/mL of rifampicin added
to oxacillin at 2× MIC was similar as for oxacillin alone, both for rifampicin-susceptible S.
aureus isolates and rifampicin-resistant mutants. Apparently, subinhibitory concentrations
of rifampicin were not sufficient to improve biofilm disintegration. In general, rifampicin at
0.008 g/mL did not induce biomass formation in contrast to what has been described for
subinhibitory concentrations of certain antibiotics and various (subsets of) bacterial spe-
cies31,32. However, a possible inducible effect of a subinhibitory concentration of rifampicin
could not be ruled out, since it was previously demonstrated that a particular subinhibitory
concentration (range) could be responsible for induction31. To prevent exposure of bacte-
ria to subinhibitory concentrations of rifampicin, in clinical practice a high-dosage regimen
(such as twice daily 600 mg) of rifampicin should be recommended, taking in considera-
tion the potential risks against the assumed benefits, which will be discussed below.
When rifampicin at 1 g/mL was used as an adjunct to oxacillin, an additional biomass
reduction ≥ 20% was observed for 15 out of 17 rifampicin-susceptible S. aureus isolates ,
whereas only 10 out of 17 showed a reduction in viable count of more than 1-log10 CFU per
well compared to the most active single agent. It is likely that the outer parts were mainly
destructed by the antibiotics, resulting in a decrease in biomass, whereas the majority of
bacteria located at the centre of the biofilm was less effected by rifampicin.
Environmental triggers, including subinhibitory antibiotic concentrations, can specifi-
cally activate biomass formation of certain bacterial species, for example by influencing
the production of exopolysaccharides or by disturbing the expression of signal transduc-
tion molecules that regulate cell surface adhesiveness31,32,34,35. Although the multiples of
the MIC used for oxacillin and rifampicin were not subinhibitory for planktonic bacteria,
Rifampicin and Staphylococcus aureus biofilm formation
53
they might be the optimal subinhibitory concentration for bacteria embedded in biofilm
to stimulate biomass formation. Due to the relatively strong biomass forming capacity of
strain BF35 probably no high antibiotic levels inside the biofilm could be achieved, result-
ing in stimulation of biomass formation by oxacillin or rifampicin. It needs to be elucidated
whether this observation is a rare example, or representative for other strong biomass
producing strains.
In contrast to the rifampicin-susceptible parent isolate of BF35, the rifampicin-resistant
mutant did not induce biomass upon rifampicin exposure. For unknown reasons, the ri-
fampicin-resistant mutants of strains associated with CC30 showed the opposite, i.e. stimu-
lation of biomass formation by rifampicin, whereas this was not observed for the corre-
sponding rifampicin-susceptible isolates. Killing of embedded S. aureus was impaired in
most cases in which biomass formation was stimulated by rifampicin or oxacillin.
Inter-strain variability of responses to rifampicin addition might be clarified by differences
in composition of biofilm matrices. Factors such as differences in expression of certain
surface adhesins36 and dissimilarities in release of genomic DNA37,38, are the main causes of
variations in composition.
Overall, rifampicin was significantly less successful in achieving additional changes to
the effect of oxacillin alone on biomass (P < 0.01) and viable count (P < 0.05) of biofilms of
rifampicin-resistant mutants. After oxacillin and rifampicin exposure, no decrease in bio-
mass of these mutants was observed and only 3 out of 17 displayed (a tendency towards) a
synergistic effect on reducing the viable count, while the opposite was found for 7 out of
17 mutants. These results might suggest that continuation of rifampicin use in case of
rifampicin-resistant mutants should not be recommended. Long-lasting persistent infec-
tions may be attributed to the emergence of resistant subpopulations, which unfortu-
nately could not always be detected by routine susceptibility testing.
Beside the disadvantage of the emergence of rifampicin-resistant isolates and the un-
predictable outcome of the adjunctive use of rifampicin, it is necessary to take other disad-
vantages of the use of rifampicin into consideration, which include hepatotoxicity5 and
drug-interactions18. A novel rifampicin derivate was developed to overcome poor clinical
tolerance and important drug interactions due to induction of the cytochrome p450 sys-
tem, especially CYP3A and CYP2C39. However, this compound has not been extensively
investigated and is not yet commercially available. Other compounds active against dor-
mant bacteria are under investigation11.
In conclusion, based on current knowledge summarized in reviews5,12–14, adding rifam-
picin to standard antimicrobials warrants a careful risk-benefit assessment for the individ-
ual patient since its efficacy is uncertain, severe side effects and important drug-
interactions which can not be waved aside are known and rifampicin-resistant mutants can
emerge. The unpredictable outcome of rifampicin tested in vitro against S. aureus biofilm
emphasizes the need for controlled clinical trials of sufficient power to provide firm an-
swers. Furthermore, it seems prudent to omit rifampicin administration at the moment
that resistant mutants are observed or suspected, since rifampicin demonstrated to be
inefficacious against biofilms of rifampicin-resistant mutants in vitro.
Chapter 3
54
Acknowledgements
We are grateful to K. Prange, M.L.L. Boumans and P.H. Terporten for technical assistance,
critically reading the manuscript and help with the statistics, respectively.
Rifampicin and Staphylococcus aureus biofilm formation
55
References
1. Hawkins C, Huang J, Jin N, Noskin GA, Zembower TR, Bolon M. Persistent Staphylococcus aureus bacteremia: an
analysis of risk factors and outcomes. Arch Intern Med 2007;167:1861–7.
2. Darouiche RO. Treatment of infections associated with surgical implants. N Engl J Med 2004;350:1422–9.
3. Schafer P, Fink B, Sandow D, Margull A, Berger I, Frommelt L. Prolonged bacterial culture to identify late pe-
riprosthetic joint infection: a promising strategy. Clin Infect Dis 2008;47:1403–9.
4. Murillo O, Pachon ME, Euba G, et al. Intracellular antimicrobial activity appearing as a relevant factor in antibi-
otic efficacy against an experimental foreign-body infection caused by Staphylococcus aureus. J Antimicrob
Chemother 2009;64:1062–6.
5. Nguyen HM, Graber CJ. Limitations of antibiotic options for invasive infections caused by methicillin-resistant
Staphylococcus aureus: is combination therapy the answer? J Antimicrob Chemother;65:24–36.
6. Saginur R, Stdenis M, Ferris W, et al. Multiple combination bactericidal testing of staphylococcal biofilms from
implant-associated infections. Antimicrob Agents Chemother 2006;50:55–61.
7. Zheng Z, Stewart PS. Penetration of rifampin through Staphylococcus epidermidis biofilms. Antimicrob Agents
Chemother 2002;46:900–3.
8. Dunne WM, Jr., Mason EO, Jr., Kaplan SL. Diffusion of rifampin and vancomycin through a Staphylococcus
epidermidis biofilm. Antimicrob Agents Chemother 1993;37:2522–6.
9. Ghani M, Soothill JS. Ceftazidime, gentamicin, and rifampicin, in combination, kill biofilms of mucoid Pseudo-
monas aeruginosa. Can J Microbiol 1997;43:999–1004.
10. Zavasky DM, Sande MA. Reconsideration of rifampin: a unique drug for a unique infection. JAMA
1998;279:1575–7.
11. Ooi N, Miller K, Randall C, Rhys-Williams W, Love W, Chopra I. XF-70 and XF-73, novel antibacterial agents active
against slow-growing and non-dividing cultures of Staphylococcus aureus including biofilms. J Antimicrob Che-
mother;65:72–8.
12. Zimmerli W, Widmer AF, Blatter M, Frei R, Ochsner PE. Role of rifampin for treatment of orthopedic implant-
related staphylococcal infections: a randomized controlled trial. Foreign-Body Infection (FBI) Study Group.
JAMA 1998;279:1537–41.
13. Perlroth J, Kuo M, Tan J, Bayer AS, Miller LG. Adjunctive use of rifampin for the treatment of Staphylococcus
aureus infections: a systematic review of the literature. Arch Intern Med 2008;168:805–19.
14. Forrest GN, Tamura K. Rifampin combination therapy for nonmycobacterial infections. Clin Microbiol Rev
2010;23:14–34.
15. Samuel JR, Gould FK. Prosthetic joint infections: single versus combination therapy. J Antimicrob Chemo-
ther;65:18–23.
16. Murillo O, Pachon ME, Euba G, et al. Antagonistic effect of rifampin on the efficacy of high-dose levofloxacin in
staphylococcal experimental foreign-body infection. Antimicrob Agents Chemother 2008;52:3681–6.
17. Miro JM, Garcia-de-la-Maria C, Armero Y, et al. Addition of gentamicin or rifampin does not enhance the effec-
tiveness of daptomycin in treatment of experimental endocarditis due to methicillin-resistant Staphylococcus
aureus. Antimicrob Agents Chemother 2009;53:4172–7.
18. Riedel DJ, Weekes E, Forrest GN. Addition of rifampin to standard therapy for treatment of native valve infective
endocarditis caused by Staphylococcus aureus. Antimicrob Agents Chemother 2008;52:2463–7.
19. Svensson E, Hanberger H, Nilsson M, Nilsson LE. Factors affecting development of rifampicin resistance in
biofilm-producing Staphylococcus epidermidis. J Antimicrob Chemother 1997;39:817–20.
20. Baddour LM, Wilson WR, Mandell GL, Bennett JE, Dolin R. Infections of prosthetic valves and other cardiovascu-
lar devices. Oxford: Churchill Livingstone Elsevier; 2005.
21. Cosgrove SE, Fowler VG, Jr. Optimizing therapy for methicillin-resistant Staphylococcus aureus bacteremia.
Semin Respir Crit Care Med 2007;28:624–31.
22. Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol 2008;8:747–63.
Chapter 3
56
23. Rijnders MI, Deurenberg RH, Boumans ML, Hoogkamp-Korstanje JA, Beisser PS, Stobberingh EE. Flucloxacillin,
still the empirical choice for putative Staphylococcus aureus infections in intensive care units in the Netherlands.
J Antimicrob Chemother 2009;64:1029–34.
24. Skov R, Gudlaugsson O, Hardardottir H, et al. Proposal for common Nordic epidemiological terms and defini-
tions for methicillin-resistant Staphylococcus aureus (MRSA). Scand J Infect Dis 2008;40:495–502.
25. Croes S, Deurenberg RH, Boumans ML, Beisser PS, Neef C, Stobberingh EE. Staphylococcus aureus biofilm forma-
tion at the physiologic glucose concentration depends on the S. aureus lineage. BMC Microbiol 2009;9:229.
26. Strommenger B, Kettlitz C, Weniger T, Harmsen D, Friedrich AW, Witte W. Assignment of Staphylococcus
isolates to groups by spa typing, SmaI macrorestriction analysis, and multilocus sequence typing. J Clin Micro-
biol 2006;44:2533–40.
27. Ruppitsch W, Indra A, Stoger A, et al. Classifying spa types in complexes improves interpretation of typing
results for methicillin-resistant Staphylococcus aureus. J Clin Microbiol 2006;44:2442–8.
28. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of
methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol 2000;38:1008–
15.
29. Clinical and Laboratory Standards Institute. M100-S19. Performance Standards for Antimicrobial Susceptibility
Testing. CLSI, Wayne, PA 2009.
30. Clinical and Laboratory Standards Institute. M2-A10. Performance standards for antimicrobial disk susceptibility
tests. CLSI, Wayne, PA 2009.
31. Hoffman LR, D’Argenio DA, MacCoss MJ, Zhang Z, Jones RA, Miller SI. Aminoglycoside antibiotics induce bacte-
rial biofilm formation. Nature 2005;436:1171–5.
32. Nucleo E, Steffanoni L, Fugazza G, et al. Growth in glucose-based medium and exposure to subinhibitory
concentrations of imipenem induce biofilm formation in a multidrug-resistant clinical isolate of Acinetobacter
baumannii. BMC Microbiol 2009;9:270.
33. Van der Auwera P, Klastersky J, Thys JP, Meunier-Carpentier F, Legrand JC. Double-blind, placebo-controlled
study of oxacillin combined with rifampin in the treatment of staphylococcal infections. Antimicrob Agents
Chemother 1985;28:467–72.
34. O’Neill E, Pozzi C, Houston P, et al. Association between methicillin susceptibility and biofilm regulation in
Staphylococcus aureus isolates from device-related infections. J Clin Microbiol 2007;45:1379–88.
35. Jefferson KK, Pier DB, Goldmann DA, Pier GB. The teicoplanin-associated locus regulator (TcaR) and the intercel-
lular adhesin locus regulator (IcaR) are transcriptional inhibitors of the ica locus in Staphylococcus aureus. J Bac-
teriol 2004;186:2449–56.
36. Vergara-Irigaray M, Valle J, Merino N, et al. Relevant role of fibronectin-binding proteins in Staphylococcus
aureus biofilm-associated foreign-body infections. Infect Immun 2009;77:3978–91.
37. Rice KC, Bayles KW. Molecular control of bacterial death and lysis. Microbiol Mol Biol Rev 2008;72:85–109.
38. Rice KC, Mann EE, Endres JL, et al. The cidA murein hydrolase regulator contributes to DNA release and biofilm
development in Staphylococcus aureus. Proc Natl Acad Sci U S A 2007;104:8113–8.
39. Trampuz A, Murphy CK, Rothstein DM, Widmer AF, Landmann R, Zimmerli W. Efficacy of a novel rifamycin
derivative, ABI-0043, against Staphylococcus aureus in an experimental model of foreign-body infection. Antim-
icrob Agents Chemother 2007;51:2540–5.
57
CHAPTER 4
Hydrophilic surface coatings with embedded biocidal silver
nanoparticles and sodium heparin for central venous catheters
Kris N.J. Stevens1
Sander Croes2
Rinske S. Boersma3
Ellen E. Stobberingh2
Cees van der Marel4,
Frederik H. van der Veen1,
Menno L.W. Knetsch1
Leo H. Koole1
1 Department of Biomedical Engineering/Biomaterials Science, Maastricht University, Maastricht, the Netherlands.
2 Department of Medical Microbiology, Maastricht University Medical Center, Maastricht, the Netherlands.
3 Department of Internal Medicine (Hematology), Maastricht University Medical Center, Maastricht, the Netherlands.
4 Philips Research – MiPlaza Materials Analysis, High Tech Campus, Eindhoven, the Netherlands.
Biomaterials. 2011; 32(5): 1264–9
Chapter 4
58
Abstract
Central venous catheters (CVCs) have become indispensable in the treatment of neonates
and patients undergoing chemotherapy or hemodialysis. A CVC provides easy access to
the patient’s circulation, thus enabling facile monitoring of hemodynamic parameters,
nutritional support, or administration of (cytostatic) medication. However, complications
with CVCs, such as bacterial bloodstream infection or thromboembolism, are common.
Bloodstream infections, predominantly caused by Staphylococcus aureus, are notoriously
difficult to prevent and treat. Furthermore, patients receiving infusion therapy through a
CVC are at risk for deep-vein thrombosis, especially of the upper limbs. Several recent
clinical trials have shown that prophylactic anticoagulation (low-molecular-weight heparin
or vitamin K antagonists) is not effective. Here, we report on the systematic development
of a new bifunctional coating concept that can –uniquely– be applied to make CVC sur-
faces antimicrobial and antithrombogenic at the same time. The novel coating consists of a
moderately hydrophilic synthetic copolymer of N-vinylpyrrollidinone (NVP) and n-butyl
methacrylate (BMA), containing embedded silver nanoparticles (AgNPs) and sodium hepa-
rin. The work demonstrates that the AgNPs strongly inhibit adhesion of S. aureus (reference
strain and clinical isolates). Surprisingly, heparin not only rendered our surfaces practically
non-thrombogenic, but also contributed synergistically to their biocidal activity.
Hydrophilic surface coating with silver and sodium heparin
59
Introduction
Central venous catheters (CVCs) are used ubiquitously during treatment of critically ill
cancer patients. According to recent estimates, more than 5 million cancer patients in the
US require central venous access each year1. A similar estimate was made for Europe. CVCs
offer important advantages, such as facile sustained administration of cytostatic or pain-
killing medication, infusion of stem cells, continuous measurement of hemodynamic pa-
rameters, or sustained nutritional support. However, application of CVCs is associated with
a significant risk for adverse effects, particularly bloodstream infection2-5 and thromboem-
bolism6-10. In the US, approximately 80,000 CVC-related nosocomial bloodstream infections
occur annually. The associated extra cost is in the range of $300 million to $2.3 billion per
year, and the attributable mortality is around 20%. On an average, survivors usually remain
one extra week in the intensive care unit, or 2–3 additional weeks in the hospital.
Hence, prevention of CVC-related complications is of paramount importance. Regard-
ing infection, preventive strategies include the use of (i), a maximum sterile barrier during
CVC insertion; (ii), innovative catheter hubs, and (iii), chlorhexidine-containing cutaneous
antiseptics2-5,11. Moreover, strict adherence to evidence based protocols for hygiene and
sterility proved highly successful11. Prevention of thrombotic complications is mostly at-
tempted through administration of anticoagulants during treatment6-10. Despite all efforts,
it is evident that there is a need for improved biomaterials for the manufacture of safer
catheters. Engineering into this direction must focus of the catheter’s surface, which must
have broad-spectrum antimicrobial activity as well as excellent blood compatibility. We
describe the systematic development of new bifunctional surface coatings that –uniquely–
meet these requirements.
Materials and methods
Formulation
Six different coating solutions were prepared as follows: (i), 600 mL of 10 % solution of the
hydrophilic copolymer (SS) in NMP was equally divided over six 500-mL glass bottles. (ii),
Sodium heparin (3 × 1.5 g, purchased from Celsus Laboratories, Cincinatti, OH, USA) was
dissolved (mechanical stirring) in formamide (75 mL). The solution was split into three
equal parts, and these were mixed with three of the SS solutions as indicated in Table 1.
(iii), Silver nanoparticles, AgNPs, (Ag6V or Ag4E; 3.0 g, purchased from Metalor SA, Neuchâ-
tel, Switzerland; Ag6V and Ag4E differed with respect to the hydrophilic surface coating
used for their stabilization) were dispersed in NMP and mixed with two of the SS solutions
as follows: Coating #1 (SS): SS solution (100 mL) + NMP (50 mL). Coating #2 (SS-Hep): SS
solution (100 mL) + NMP (25 mL) + 1.5 g heparin dissolved in formamide (25 mL). Coating
#3 (SS-Ag6V): SS solution (100 mL) + NMP (50 mL) + nanosilver (1.5 g). Coating #4 (SS-
Ag6V-Hep): SS solution (100 mL) + NMP (25 mL) + nanosilver (1.5 g) + 1.5 g heparin dis-
solved in formamide (25 mL). Coating #5 (SS-Ag4E): SS solution (100 mL) + NMP (50 mL) +
Chapter 4
60
nanosilver (1.5 g). Coating #6 (SS-Ag4E-Hep): SS solution (100 mL) + NMP (25 mL) +
nanosilver (1.5 g) + 1.5 g heparin dissolved in formamide (25 mL). Coatings had a thickness
of 3.0 µm, and differed only with respect to the embedded species. Fabrication of the
specimens involved three consecutive steps: (i) formulation of coating suspensions
through mixing of the NVP/BMA copolymer (designated SS) + AgNPs suspended in N-
methylpyrrolidone and/or sodium heparin dissolved in formamide; (ii) application of the
coating onto a long (approximately 300 m) and thin (178 µm diameter) stainless steel wire
in a continuous process; (iii), coiling of the coated wire around a rotating mandril of 600
µm diameter12–14.
Table 1. Atomic concentrations (percentages) measured by XPS. All data represent averages of two
independent measurements
Number Coating SS solution
(mL)
NMP
(mL)
Nanosilver
(g)
Formamide
(mL)
Sodium heparin
(g)
1 SS 100 50 - - -
2 SS-Hep 100 25 - 25 1.5
3 SS-Ag6V 100 50 1.5 - -
4 SS-Ag6V-Hep 100 25 1.5 25 1.5
5 SS-Ag4E 100 50 1.5 - -
6 SS-Ag4E-Hep 100 25 1.5 25 1.5
Methods and equipment
The platelet-stabilizing anticoagulant mixture, citrate-theophilline-adenosine-dipyrida-
mole (CTAD) was purchased from Becton-Dickinson (Alphen a/d Rijn), the Netherlands).
Brain Heart infusion broth and Mueller-Hinton agar were from Oxoid BV (Badhoevedorp,
the Netherlands). The lactate dehydrogenase (LDH) assay was performed using the Cyto-
Tox 96 Non-Radioactive Cytotoxicity Assay from Promega Benelux BV (Leiden, the Nether-
lands). Platelet activation was quantified with the Assachrom ß-TG linked immunosorbent
assay (ELISA), obtained from Roche Diagnostics Nederland BV (Almere, the Netherlands).
Fluorescence tracings were recorded on a SpectraMax M2 spectrofluorometer (Molecular
Devices, Sunnyvale, CA, USA). Absorbances were measured on an ELx808 Absorbance
Microplate Reader (BioTek Instruments Inc., VT, USA). Sputter coating for electron micros-
copy was performed with a Sputter Coater 108/SE (Cressington Scientific Instruments Ltd.,
Watford, UK). Scanning electron microscopy was performed with a Philips XL30 instrument
(Philips, Eindhoven, the Netherlands). X-ray Photoelectron Spectroscopy measurements
were carried out in a Quantera SXM instrument from Ulvac-PHI (Q2). During the measure-
ments, the angle between the axis of the analyzer and the sample surface was 45o. The
information depth is then appr. 6 nm. The measurements have been performed using
monochromatic AlKα radiation in High Power mode (100 Watt, measuring spot 100 μm,
scanned over 1400 μm x 500 μm).
Experiments with bacteria
Overnight cultures were prepared by inoculation of a bacterial colony into 10 mL growth
medium (37 g/L heart infusion broth). From this culture, a bacterial suspension of 107
Hydrophilic surface coating with silver and sodium heparin
61
CFU/mL was prepared in 0.9 % NaCl. Coated coils (length 30 mm) were incubated at 37 oC
for 60 min in 1.5 mL bacterial suspension, in a shaking incubator. The samples were subse-
quently transferred to a fresh volume of 1.5 mL 0.9 % NaCl, and vortexed for 1 s. Vortexing
resulted in detachment of loosely adhered bacteria. Then, the samples were transferred
again to fresh volumes of 1.5 mL of 0.9 % NaCl, and left for 4 h under continuous shaking.
Subsequently, the catheter samples were carefully removed, washed in 0.9 % NaCl, and
rolled over a Mueller-Hinton blood agar plate (38g/L Mueller-Hinton agar, 5 % defibrinated
sheep blood). Plates were incubated overnight and photographed and evaluated on the
next day. The six sample groups were subjected to these tests in three-fold.
Thrombin generation experiments
Freshly prepared human platelet-rich blood plasma (PRP) was used in the thrombin gen-
eration assays. There were two donor groups: a first group consisting of five healthy male
volunteers (ages 22, 23, 24, 25, and 51 years), who were non-smokers and non-users of any
drugs that could possibly influence hemostasis. The second group consisted of a cohort of
nine patients who were under treatment in the Maastricht University Medical Center.
These patients all received high-dose cytostatic medication through a central venous
catheter; patient data are summarized in Table 2.
Table 2. Data on patients and/or blood donors
Informed consent was obtained in accordance with the Declaration of Helsinki, and the
study was approved by the Maastricht University Medical Center ethical committee. The
volunteers each donated approximately 40 mL blood through venipuncture. The collec-
tion tubes contained citrate for anticoagulation (end-concentration 0.013 M citrate). The
patients donated 20 mL blood each. In these cases, Vacutainers containing citrate for anti-
coagulation were used. PRP was isolated through centrifugation (200g, 15 min, room tem-
perature). PRP was carefully transferred into new tubes and kept at 37 oC until further use.
Patient Age
(gender)
Length (m) /
mass (kg)
Specified malignancy Thrombocyte
counts
(109/mL)†
Leukocyte
Counts
(109/mL)‡
1 50 (f) 1.64 / 47 AML* 134 1.4
2 61 (m) 1.72 / 64 Histiocytic sarcoma 52 0.2
3 61 (f) 1.58 / 53 AML 145 3.0
4 60 (m) 1.85 / 104 AML 51 1
5 58 (f) 1.63 / 69 Amyloidosis 107 10.5
6 66 (m) 1.83 / 65 MGUS + C1-esterase deficiency 281 4.5
7 76 (m) 1.75 / 60 Mantle cell NHL** 120 0.8
8 44 (m) 1.80 / 77 AML 252 6.2
9 55 (m) 1.72 / 109 Multiple myeloma 27 1.5
*AML = acute myeloid leukemia
**NHL = non-Hodgkin’s lymphoma
†Normal thrombocyte concentration: 150 – 450 x 109 / L
‡Normal leukocyte concentration: 4.5 – 10 x 109 / L
Patient #5 was the only patient receiving anticoagulant medication (low-molecular–weight heparin) at the time
of blood sampling.
Chapter 4
62
Thrombin generation experiments were done according to a one-donor-on-one-day
scheme. On such an experimental day, 30 thrombin generation curves were measured (6
experimental coatings, each experiment in five-fold). The experiments were done in four
consecutive steps: (i), Five pieces of 25 mm were cut out of each of the six different coils.
Then, each piece was cut further into five approximately equal pieces, and these were
transferred into one single well of a 96 well plate, (ii), The fluorogenic substrate for throm-
bin, Z-Gly-Gly-Arg-AMC (a product of Bachem Holding AG (Bubendorf, Switzerland; ref. I-
1140) was added to the citrated PRP to a final concentration of 400 µM. Then, the PRP was
“recalcified” through adding CaCl2 stock solution (0.5 M) up to a final concentration of 20
mM Ca2+. Consequently the mechanism for intrinsic (i.e. biomaterial-surface-induced)
coagulation is no longer inhibited, (iii), The PRP was then rapidly distributed over the wells;
200 µL was transferred into each well. All pieces of the coiled wire were submersed in PRP.
Wells without coil-samples served as controls. (iv), Fluorescence tracings were recorded at
37 oC. Wavelengths of excitation and measuring were 368 and 460 nm, respectively. Data
were collected every 30 s; the plate was gently shaken for 2 s prior to each measurement.
The fluorescence intensity was converted into nanomolar concentrations of thrombin. This
technique resulted in a thrombin generation curve for each well.
Statistical analysis
Data were analyzed with a one-way analysis followed by a Bonferroni correction for de-
termining differences between groups. Differences were considered as statistically signifi-
cant with P < 0.05.
Table 3. Atomic concentrations (percentages) measured by XPS. All data represent averages of two
independent measurements.
Entry Surface C1s N1s O1s Ag3d S2p (-SO3H)
1 SS 79.7 4.6 14.4 - 0.21
2 SS-Hep 78.6 4.3 14.5 - 0.43
3 SS-Ag6V 80.4 4.2 12.6 0.22 0.21
4 SS-Ag6V-Hep 79.2 5.0 14.2 0.11 0.42
5 SS-Ag4E 79.3 6.6 13.0 0.15 0.24
6 SS-Ag4e-Hep 78.9 5.3 14.6 0.19 0.35
Results
Samples and sample characterization
The continuous coating process afforded a huge inventory of virtually identical specimens
for every formulation. This approach distinguishes this study from other investigations on
biomaterial surface coatings obtained through dipping or spraying, which are discontinu-
ous methods that generally introduce substantial noise in subsequent experimental data.
Specimens were first studied with X-ray photoelectron spectroscopy (XPS). Figure 1B
shows a representative wide-scan spectrum. Data were collected with a spot size of only
100 µm at two positions per specimen, i.e., on the top of two individual windings. The
Hydrophilic surface coating with silver and sodium heparin
63
information depth was approximately 6 nm. Figure 1C shows narrow-scan XPS spectra of
SS-Ag4E-Hep (sulfur and silver lines). The apparent atomic concentrations are compiled in
Table 3.
A
B
C
Figure 1. XPS spectra of surface coating SS-Ag4E-Hep, containing silver nanoparticles and heparin. (A)
Photograph of a typical specimen. Note the coiled structure. (B) Wide-scan XPS spectrum of the typical
specimen SS-Hep-Ag4E. A small spot size (100 µm) was used, which enabled scanning on the top of one of
the specimen’s windings. The signal intensity is reported in counts per second (CPS) (C) Narrow-scan X-ray
photoelectron spectra of the outermost layer of the SS-Ag4E-Hep surface; left: Ag3d doublet due to surface-
exposed AgNPs, right: S2p peak due to the SO3H groups of heparin.
All duplicate measurements were in good agreement. As expected, only specimens #3–#6
expose silver at their surface. The specimens containing heparin (#2, #4 and #6) show
clearly elevated concentrations of sulfur (-SO3H; 167.9 ± 0.1 eV) at their surfaces (0.43, 0.42
and 0.35% respectively, vs. 0.21, 0.21 and 0.24% for specimens #1, #3, and #5). Hence, XPS
confirms the presence of heparin at the surface of #2, #4 and #6. To the best of our knowl-
edge, this is the first example of the use of XPS to verify the presence of heparin in the
outermost regions of biomaterial surface coatings. The presence of sulfur traces in speci-
Chapter 4
64
mens #1, #3, and #5 can be attributed to the binding layer of poly(ethersulfone), which is
routinely used in the continuous coating procedure.
Samples and sample characterization
The system used for systematic comparison of the effects of embedded AgNPs and/or
heparin is shown in Figure 1A. Fabrication of the specimens involved three consecutive
steps: (i) formulation of coating suspensions through mixing of the NVP/BMA copolymer
(designated SS) + AgNPs suspended in N-methylpyrrolidone and/or sodium heparin dis-
solved in formamide; (ii) application of the coating onto a long (approximately 300 m) and
thin (178 µm diameter) stainless steel wire in a continuous process; (iii), coiling of the
coated wire around a rotating mandril12–14. Note that the continuous coating process af-
forded a huge inventory of virtually identical specimens for every formulation. This ap-
proach distinguishes this study from other investigations on biomaterial surface coatings
obtained through dipping or spraying, which are discontinuous methods that generally
introduce substantial noise in subsequent experimental data. Note furthermore that two
different types of AgNPs were used (designated Ag6V and Ag4E); these AgNPs differed
with respect to the hydrophilic surface coating used for their stabilization.
Biocidal activity
The roll-plate method according to Maki et al.15 was used to assess adherence of the refer-
ence strain Staphylococcus aureus ATCC 29213 to the different coatings. This technique
visualizes bacterial colonies on each roll track, provided that bacterial adhesion occurred
during the incubation phase. Our cylindrical specimens were convenient to use in this
assay, and data-reproducibility was excellent. Virtually no bacteria could be found on the
agar plates for SS-Ag6V, SS-Ag6V-Hep, SS-Ag4E, and SS-Ag4E-Hep, whereas bacteria were
abundantly present on the agar plates for SS and SS-Hep (Figure 2 and Figure 3A, B and C).
These data confirm the strong antibacterial activity of the AgNPs Ag6V and Ag4E. Further-
more, it appeared that heparin exerts a pronounced antibacterial effect by itself (compare
SS and SS-Hep). The antimicrobial effects of AgNPs and heparin are additive: it is clear that
much less bacteria adhered to the SS-Ag6V-Hep surface than to SS-Ag6V alone. Analo-
gously, SS-Ag4E-Hep has less adhered bacteria (if any are present at all) than SS-Ag4E. At
first sight, we were puzzled by this heparin effect; several recent papers pointed out that
heparin per se has no antibacterial effects16, and even that heparin may promote biofilm
formation, especially for S. aureus17,18. Interestingly, recent work of Schmidtchen et al. may
explain our observations in terms of an indirect effect of heparin: proteins carrying struc-
tural characteristics that impart affinity for heparin (positive charges and consensus re-
gions such a the Cardin motif or the Weintraub motif), also have antimicrobial proper-
ties19,20. For example, heparin-binding plasma proteins such as fibronectin, vitronectin,
protein-C inhibitor and von Willebrand factor are biocidal for Gram-positive and Gram-
negative bacteria. Thus, if incubation of our coatings in plasma first leads to adsorption of
proteins with an affinity for heparin, then these proteins introduce biocidal activity at the
coating’s surface in turn.
Hydrophilic surface coating with silver and sodium heparin
65
1 2 3 4
SS
SS-Hep
SS-Ag6V
SS-Ag6V-Hep
SS-Ag4E
SS-Ag4E-Hep
Figure 2. Bacterial colonies that developed on the sheep-blood columbia agar plates (roll-
plate method according to Maki et al.15). Experiments were done with six different coatings
(one per column), and in four-fold (four rows). The specimens were carefully rolled from the
right side to the left side of the dishes, thereby releasing bacteria that generated visible
colonies afterwards. Note the presence of many colonies for the SS coating, compared to the
SS-Hep coating. Bactericidal effects of the AgNPs are clearly visible.
Chapter 4
66
Next to S. aureus ATCC 29213, we studied two clinical isolates (MRSA BF110 and MSSA
BF45), i.e., S. aureus bacteria that were isolated from patients with a catheter-associated
bloodstream infection. The biocidal effects of our materials on the clinical isolates (BF110
and BF145) were, in fact, stronger than those found for the reference strain (Figure 3D).
A
B
C
SS
SS-Hep
SS-Ag6V
SS-Ag6V-Hep
SS-Ag4E
SS-Ag4E-Hep
Colony-forming units / cm2
0
10
20
30
40
50
60
70
ATCC 29213
MRSA BF110
MSSA BF45
D
#
#
#
*
****
***
Figure 3. Roll-plate analysis carried out in agar-covered Petri dishes. In each dish, two identical specimens
were rolled horizontally from one end of the Petri dish to the other end. Colonies were allowed to grow for
24 h. Specimens were not removed. (A) Enlarged view of the abundant growth of bacterial colonies that
were transferred from the SS specimen to the agar. (B) Same experiment, carried out with SS-Hep.
Compared to SS, less colonies are found, showing that heparin exerts a significant biocidal effect by itself.
(C) Same experiment with SS-Ag4E-Hep, showing the combined antimicrobial effect of heparin and AgNPs.
Note the presence of the specimens at the top of A, B, and C. (D) Quantitative data of the roll-plate analysis.
Data are expressed as mean ± SE. *P < 0.05, **P < 0.01, ***P < 0.001 SS-Ag4E-Hep or SS-Ag6V-Hep versus SS-
Ag4E or SS-Ag6V without heparin, respectively; #P < 0.001 SS-Hep versus SS only.
In vitro assessment of blood compatibility: the thrombin generation assay
The six different surfaces were subjected to a thrombin generation assay12,13. Platelet-rich
blood plasma (PRP) was used from five healthy volunteer donors and from nine patients
undergoing high-dose chemotherapy against a hematological malignancy in the Maas-
tricht University Medical Center (Table 2). We measured so-called thrombin generation
curves ([thrombin] vs. time) in six-fold for every specimen-PRP combination. Thrombin lag
times, i.e. time elapsing between the moment of recalcification and the moment at which
[thrombin] becomes > 2 nM, were abstracted from all curves12,13. Note that the assay
measures intrinsic activation of the coagulation system: the biomateral’s surface is the only
trigger for thrombin formation (i.e., the assay uses no tissue factor or any other procoagu-
lant agent). As we advocated previously, the thrombin lag time is a valuable measure of
Hydrophilic surface coating with silver and sodium heparin
67
the thrombogenicity of the biomaterial under investigation12,13. The longer the lag time,
the higher the level of blood compatibility in vitro. Figure 4A compiles lag times measured
for our heparin-free specimens in contact with PRP from volunteer donors and patients.
Thrombin lag time (min)
0 4 8 12162024
D1
D2
D3
D4
D5
P1
P2
P3
P4
P5
P6
P7
P8
P9
SS
SS-Ag6V
SS-Ag4E
A
Thrombocyte count (1 09 / L)
0 50 100 150 200 250 300
Thrombin lag time (min)
6
8
10
12
14
16
18
20
22
SS
SS-Ag6V
SS-Ag4E
B
Figure 4. Thrombin generation in PRP from nine patients (abbreviated as P) on high-dose chemotherapy
against a hematological malignancy and from five healthy volunteer donors (abbreviated as D) Thrombin
lag times measured for coatings SS (black, lower bars), SS-Ag6V (light grey, middle bars), and SS-Ag4E (dark
grey, upper bars) (A). Averaged thrombin lag times for the nine patients (viz. Figure 4A) plotted vs.
thrombocyte counts. Thrombin lag times were measured for SS (black dots), SS-Ag6V (white triangles), and
SS-Ag4E (black squares) (B).
The volunteer data show a clear donor-dependency, which is in agreement with previous
findings12. All heparin-containing specimens, for volunteer donor PRP and patient-derived
PRP, had lag times > 60 min, revealing that the anticoagulant activity of heparin is by no
means neutralized or significantly compromised by the AgNPs. The thrombin lag times
measure for the patients also show considerable spreading. Data measured for patients #3,
#6, #7 and #8 compare well with those of the volunteers, others were somewhat longer
with appr. 20 min max. Taken together, all thrombin generation lag times are grossly simi-
lar, despite the fact that most patients show clear leukopenia and/or thrombocytopenia
(Table 2). This reflects, albeit from an unusual point of view, that the regulation mechanism
of the blood coagulation system manages to maintain hemostatic balance, even under
conditions of severe illness and high-dose chemotherapy. Closer inspection of the patient
data showed that one of the patients (#5) received low-molecular-weight heparin at the
time of blood sampling. For the other eight patients, the thrombin lag times appeared to
correlate inversely with the thrombocyte counts (r2 = 0.76; Figure 4B). A similar but weaker
correlation (r2 = 0.45) was found between the thrombin lag times and the leukocyte counts
of these patients. This may point out that patients with normal or close-to-normal platelet
(and leukocyte) concentrations are likely to be at the largest risk for catheter-associated
thrombus formation. Clinical testing of this hypothesis falls outside the scope of this study
Chapter 4
68
but is certainly worthwhile: if true, then simple thrombocyte counting would provide an
indication whether or not to provide prophylactic anticoagulation during the catheter-
based treatment period (e.g. through (subcutaneous) administration of low-molecular-
weight heparin).
In vitro assessment of blood compatibility: thrombocyte adherence
Adhesion of blood platelets to the six experimental coatings was studied further with PRP
from healthy donors #2 and #3. The SS surface had the largest density of adherent platelets
(LDH assay, appr. 20,000/cm coil). Inclusion of heparin (SS-Hep) or AgNPs (SS-Ag6V) re-
duced this number to appr. 6,000/cm coil and 5,000/cm coil, respectively. The combination
of heparin and AgNPs (Ag6V) reduced the density of adhered platelets further (down to
appr. 2,000/ cm coil). Remarkably, the use of Ag4E nanoparticles per se (SS-Ag4E) already
reduced the density of adhered platelets to approximately 2,000/cm coil. No further effect
due to inclusion of heparin (SS-Hep-Ag4E) could be observed.
Scanning electron microscopy showed that platelets on the SS surface were mostly dis-
crete with partly spread morphology. Small pseudopodia by which they attach to the
surface were observed. It was very difficult to discern platelets on the three heparin-
containing surfaces. On the other hand, adherent platelets could be found easily on the
two coatings that contain merely AgNPs (SS-Ag6V and SS-Ag4E). These platelets were
mostly associated with distorted morphologies as was observed previously12,21,22.
Discussion
Hydrophilic surface coatings for medical devices have drawn widespread attention during
the last years. Adherent hydrophilic coatings provide catheters and guidewires with a
“slippery-when-wet” lubricious surface, and this is extremely important for indwelling
catheters, but also for delicate interventional procedures, such as percutaneous translu-
minal coronary angioplasty (PTCA) and super-precise embolization of solid tumors. New
developments are focused on embedding of active components in hydrophilic surface
coatings. This principle can lead to controlled release of active agents from the device’s
surface, and/or to exposure of active molecules at the device’s surface. The combination of
hydrophilic coatings with heparin can lead to anticoagulant and lubricious surfaces.
Research on drug-containing hydrophilic surface coatings requires a highly accurate
and reproducible coating protocol. Obviously, variations of the coating quality (thickness,
adherence, etc.) would generate substantial experimental noise, which could easily ob-
scure effects of active constituents of the coating. Our extrusion-like coating procedure to
apply NVP/BMA copolymers as uniform thin layers on thin metallic wires generates a plat-
form of precisely defined experimental coatings. These can be used in detailed compara-
tive studies. For instance, the hydrophilic nature of the materials can be tuned through the
composition: the molar ratio NVP (hydrophilic):BMA (hydrophobic) determines parameters
like contact angle, aqueous swelling ratio, etc. NVP/BMA coatings can be engineered such
that the bio-active compound is either slowly released upon immersion in an aqueous
Hydrophilic surface coating with silver and sodium heparin
69
medium, or remains immobilized at the coating’s surface. This principle has already led to
the development of, e.g., new devices for controlled delivery of drugs to the tear film of the
eye, and heparin releasing/exposing guidewires for intravascular use featuring an excellent
level of blood compatibility 13,24,25.
Here, we studied NVP/BMA coating formulations in which silver nanoparticles and so-
dium heparin were co-embedded, with the aim to develop coatings for medical devices
that effectively combine antimicrobial AND antithrombogenic features. Our data reveal
that AgNPS and heparin can be combined effectively. Interestingly, synergetic effects of
heparin and nanosilver were observed: (i), heparin enhances the biocidal activity of the
AgNPs, and (ii), no lysis of contacting thrombocytes occurs.; rupture of platelets was ob-
served previously with NVP/BMA coatings that merely contain embedded AgNPs23. In
addition, it is clear that our methodology can readily be scaled-up and transformed into an
industrial procedure. We anticipate that this work can provide the basis for the develop-
ment of safer central venous catheters. There is a clear unmet need for biomaterials and
surfaces that combine excellent biocidal properties with zero or close-to-zero throm-
bogenicity in vivo. Improved CVCs will, next to other measures to prevent infection and
thromboembolism, help to improve treatment of many critically ill patients, and to reduce
health care cost, especially when prolonged hospitalization can be prevented indeed.
Conclusion
Copolymers of NVP and BMA generate a platform of biocompatible coatings for medical
devices. The hydrophilic nature of these materials can be tuned through the composition;
the molar ratio NVP (hydrophilic): BMA (hydrophobic) determines parameters like contact
angle, aqueous swelling ratio, etc. Furthermore, it has been established that the hydro-
phobic constituent is responsible for the adherence of the coating to the underlying sub-
strate (polyethersulfone).
The NVP/BMA coatings offer number of interesting options. Firstly, they can be applied
onto long wires or tubes in a precisely controlled extrusion-type procedure. Secondly,
biologically active species can be embedded in the coatings. The NVP/BMA coatings can
be engineered such that the bio-active compound is either slowly released upon immer-
sion in an aqueous medium, or remains immobilized at the coating’s surface. This principle
has led to the development of, e.g., new devices for controlled delivery of drugs to the tear
film of the eye, and heparin releasing/exposing guidewires for intravascular use featuring
an excellent level of blood-compatibility.
Now, we have identified NVP/BMA coating formulations that effectively combine bio-
cidal and anticoagulant features. This combination of bioactivities was obtained after
embedding both silver nanoparticles and sodium heparin in the NVP/BMA coatings. Silver
nanoparticles are known to have a strong biocidal effect against a wide range of microor-
ganisms. Noteworthy, the presence of heparin in the coating has two very beneficial ef-
fects: (i), heparin enhances the biocidal activity of the AgNPs, and (ii), no lysis of contacting
thrombocytes occurs (this was observed previously with NVP/BMA coatings that merely
Chapter 4
70
contain embedded AgNPs). To the best of our knowledge, no other biocompatible coat-
ings that feature both biocidal and non-thrombogenic behavior have been described so
far. In addition, it is clear that our methodology can readily be scaled-up and transformed
into an industrial procedure.
We anticipate that this work can potentially provide the basis for the development of
safer central venous catheters. Regarding CVCs, there is a clear unmet need for biomate-
rials and surfaces that combine excellent biocidal properties with zero or close-to-zero
thrombogenicity in vivo. Improvement of CVCs is a particularly important objective, since
complications due to infection and thrombosis are common and hazardous for many
patients. Improved CVCs will, next to other measures to prevent infection and throm-
boembolism, help to improve treatment of many critically ill patients and to reduce health
care cost, especially when prolonged hospitalization can indeed be prevented.
Hydrophilic surface coatings for medical devices featuring both biocidal and non-
thrombogenic behavior can be prepared. The methodology as described in this work can
be scaled-up and transformed into an industrial procedure. This work may help to realize
the goal of manufacturing catheters and other medical devices that combine excellent
biocidal properties with zero or close-to-zero thrombogenicity in vivo.
Acknowledgements
Part of this work was financed within the framework of the Bioterials Program, a 4-year
private-public joint effort of the Dutch Ministry of Economic Affairs, the Province of Dutch
Limburg, DSM Research BV (Geleen, the Netherlands), Maastricht University Medical Cen-
ter, and Maastricht University. Bioterials ran in the period April 2005-April 2009. This study
was also supported by the Deutsche Forschungsgemeinschaft through the
Graduiertenkolleg “BioInterfaces – Detektion und Steuerung Grenzflächeninduzierter,
Biomolekularer und Zellulärer Funktionen” (GRK 1035/2). The Universities of Aachen, Liège
and Maastricht cooperate within this Graduiertenkolleg.
Hydrophilic surface coating with silver and sodium heparin
71
References
1. Frasca D, Dahyot-Fizelier C, Mimoz O. Prevention of central venous catheter-related infection in the intensive
care unit. Crit Care 2010;14:212–20.
2. Sabatier C, Ferrer R, Valles J. Treatment strategies for central venous catheter infections. Expert Opin Pharmaco-
ther 2009;10:2231–43.
3. Geffers C, Gastmeier A, Schwab F, Groneberg K, Ruden H, Gastmeier P. Use of central venous catheter and
peripheral venous catheter as risk factors for nosocomial bloodstream infection in very-low-birth-weight in-
fants. Infect Control Hosp Epidemiol 2010;31:395–401.
4. McGee DC, Gould MK. Preventing complications of central venous catheterization. N Engl J Med
2003;348:1123–33.
5. Casey AL, Mermel LA, Nightingale P, Elliott TS. Antimicrobial central venous catheters in adults: a systematic
review and meta-analysis. Lancet Infect Dis 2008;8:763–76.
6. Verso M, Agnelli G. Venous thromboembolism associated with long-term use of central venous catheters in
cancer patients. J Clin Oncol 2003;21:3665–75.
7. Khorana AA. Cancer and thrombosis: implications of published guidelines for clinical practice. Ann Oncol
2009;20:1619–30.
8. Yukisawa S, Fujiwara Y, Yamamoto Y, et al. Upper-extremity deep vein thrombosis related to central venous
port systems implanted in cancer patients. Br J Radiol 2010;83:850–3.
9. Couban S, Goodyear M, Burnell M, et al. Randomized placebo-controlled study of low-dose warfarin for the
prevention of central venous catheter-associated thrombosis in patients with cancer. J Clin Oncol
2005;23:4063–9.
10. Schroeder AR, Axelrod DM, Silverman NH, Rubesova E, Merkel E, Roth SJ. A continuous heparin infusion does
not prevent catheter-related thrombosis in infants after cardiac surgery. Pediatr Crit Care Med 2010;11:489–95.
11. Mermel LA, Allon M, Bouza E, et al. Clinical practice guidelines for the diagnosis and management of intravascu-
lar catheter-related infection: 2009 Update by the Infectious Diseases Society of America. Clin Infect Dis
2009;49:1–45.
12. Stevens KN, Crespo-Biel O, van den Bosch EE, et al. The relationship between the antimicrobial effect of cathe-
ter coatings containing silver nanoparticles and the coagulation of contacting blood. Biomaterials
2009;30:3682–90.
13. Aldenhoff YB, Hanssen JH, Knetsch ML, Koole LH. Thrombus formation at the surface of guide-wire models:
effects of heparin-releasing or heparin-exposing surface coatings. J Vasc Interv Radiol 2007;18:419–25.
14. Aldenhoff YB, Knetsch ML, Hanssen JH, Lindhout T, Wielders SJ, Koole LH. Coils and tubes releasing heparin.
Studies on a new vascular graft prototype. Biomaterials 2004;25:3125–33.
15. Maki DG, Weise CE, Sarafin HW. A semiquantitative culture method for identifying intravenous-catheter-related
infection. N Engl J Med 1977;296:1305–9.
16. Sauer K, Steczko J, Ash SR. Effect of a solution containing citrate/Methylene Blue/parabens on Staphylococcus
aureus bacteria and biofilm, and comparison with various heparin solutions. J Antimicrob Chemother
2009;63:937–45.
17. Shanks RM, Donegan NP, Graber ML, et al. Heparin stimulates Staphylococcus aureus biofilm formation. Infect
Immun 2005;73:4596–606.
18. Diskin CJ, Stokes TJ, Dansby LM, Radcliff L, Carter TB. Heparin and biofilm: is this the risk factor for catheter-
related sepsis? Am J Kidney Dis 2008;52:197–8; author reply 8.
19. Malmsten M, Davoudi M, Schmidtchen A. Bacterial killing by heparin-binding peptides from PRELP and throm-
bospondin. Matrix Biol 2006;25:294–300.
20. Andersson E, Rydengard V, Sonesson A, Morgelin M, Bjorck L, Schmidtchen A. Antimicrobial activities of hepa-
rin-binding peptides. Eur J Biochem 2004;271:1219–26.
Chapter 4
72
21. Stevens KN, Knetsch ML, Sen A, Sambhy V, Koole LH. Disruption and activation of blood platelets in contact
with an antimicrobial composite coating consisting of a pyridinium polymer and AgBr nanoparticles. ACS Appl
Mater Interfaces 2009;1:2049–54.
22. Sambhy V, MacBride MM, Peterson BR, Sen A. Silver bromide nanoparticle/polymer composites: dual action
tunable antimicrobial materials. J Am Chem Soc 2006;128:9798–808.
23. Agarwal A, Weis TL, Schurr MJ, et al. Surfaces modified with nanometer-thick silver-impregnated polymeric
films that kill bacteria but support growth of mammalian cells. Biomaterials 2010;31:680–90.
24. Pijls RT, Hanssen HH, Nuijts RM, Daube GW, Koole LH. In vivo tolerance and kinetics of a novel ocular drug
delivery device. J Control Release 2006;116:e47–9.
25. Pijls RT, Cruysberg LP, Nuijts RM, Dias AA, Koole LH. Capacity and tolerance of a new device for ocular drug
delivery. Int J Pharm 2007;341:152–61.
73
CHAPTER 5
Antimicrobial and anti-thrombogenic features combined in
hydrophilic surface coatings for skin-penetrating catheters.
Synergy of co-embedded silver particles and heparin
Sander Croes1,2
Ellen E. Stobberingh1
Kris N.J. Stevens3
Menno L.W. Knetsch3
Leo H. Koole3
1 Department of Medical Microbiology, School for Public Health and Primary Care (CAPHRI), Maastricht University
Medical Center, Maastricht, the Netherlands
2 Department of Clinical Pharmacy and Toxicology, Maastricht University Medical Center, Maastricht, the Netherlands
3 Department of Biomedical Engineering/Biomaterials Science, Maastricht University, Maastricht, the Netherlands
ACS Applied Materials & Interfaces. 2011; 3(7): 2543–50
Chapter 5
74
Abstract
Percutaneous (skin-penetrating) catheters such as central venous catheters (CVCs), are
used ubiquitously in the treatment of critically ill patients, although it is known that the
risks for serious complications, particularly bloodstream infection and thromboembolism,
are high. Materials science and engineering offer important new perspectives regarding
further improvement of CVCs. A promising approach is the use of synthetic biocompatible
hydrogel coatings with both silver particles and heparin embedded therein. Such formula-
tions combine the well-known broad-spectrum antimicrobial features of silver with the
anticoagulant activity of immobilized heparin. Previous work revealed that heparin aug-
ments antimicrobial activity of silver, while maintaining its anticoagulant function. This
study set out to investigate the synergy of heparin and silver in more detail. Exit-challenge
tests, experiments on bacterial killing and adherence, as well as in vitro challenge tests with
three S. aureus strains (one reference strain, and two clinical isolates) consistently showed
the synergistic effect. In addition, the impact of changing the coating’s hydrophilicity, and
changing the silver concentration in the coatings, were examined. The experimental re-
sults, taken together and combined with data from the literature, point out that synergy of
heparin and silver is best explained by binding of Ag+ ions to heparin within the swollen
coating, followed by release of heparin-Ag+ complexes upon immersion of the coatings in
an aqueous environment such as blood. Possible implications of this work regarding the
development of improved/safer CVCs are briefly discussed.
Hydrophilic surface coating with silver and sodium heparin
75
Introduction
Central venous catheters (CVCs) play a key-role in the treatment of critically ill patients. For
example, CVCs are commonly applied for intravenous delivery of cytostatic agents, blood
transfusion, hemodialysis, blood sampling, parenteral nutrition or plasmapheresis. Yet, the
use of CVCs is associated with a high incidence of serious complications, particularly blood
stream infection1–6. Especially indigenous microorganisms such as coagulase-negative
staphylococci (CoNSs) and the more virulent Stahylococcus aureus are involved7, 8. Infec-
tions mostly occur from the port of entry along the CVCs surface8. Another important
source of complications with CVCs is thromboembolism4, 9–11, due to imperfect blood-
compatibility of the blood-contacting interface of the CVC12, 13.
Biomaterials science and engineering can contribute to further technical improve-
ments of CVCs. Evidently, such endeavors must concentrate on the CVC surface. Ideally, the
surface should inhibit bacterial adhesion and feature perfect or near-perfect hemocom-
patibility. In our previous work, we have reported on new synthetic hydrophilic biomate-
rials with both silver particles and heparin embedded therein14. These materials were ap-
plied as thin surface coatings, with the obvious aim to exploit both the broad-spectrum
antimicrobial activity of silver15–17 and heparin’s inhibitory effect on the intrinsic coagula-
tion pathway. Our experiments revealed an unexpected synergistic effect: coatings con-
taining both silver particles and heparin were much more effective in preventing bacterial
adhesion, compared to coatings containing merely silver or heparin.
The objective of the present study was to further explore this synergy by: (i), examining
different Staphylococcus aureus strains, including clinical isolates; (ii), studying the effect of
silver particles and heparin on bacterial killing, and by performing exit-site and in vitro
challenge tests; (iii), studying the effect of the hydrophilicity of the coating matrix; (iv),
studying the effect of the silver content of the coating.
Materials and Methods
Materials
Hydrophilic SlipSkin® (SS) coating biomaterials were purchased from INterface BIOmate-
rials BV (Geleen, the Netherlands). Two versions were used: copolymer SS90:10, prepared
from N-vinyl-2-pyrrolidinone (NVP) and n-butylmethacrylate (BMA) in a molar ratio 90:10,
and the less hydrophilic copolymer SS70:30, prepared from NVP and BMA in a molar ratio
70:30. Sodium heparin was supplied by Celsus Laboratories (Cincinatti, OH, USA). Silver
particles were purchased from Metalor SA (Neuchâtel, Switzerland). Two different types
were used: Ag4E (stabilized by polyethylene glycol, PEG), and Ag6V (stabilized with polyvi-
nylpyrrolidone, PVP). All experiments were done with Ag4E, in some cases parallel experi-
ments with Ag6V were done as well. Data on Ag6V are described in the Supporting Infor-
mation. Commercial silver-impregnated catheters were purchased from Vygon BV (Valken-
swaard, the Netherlands). The Vygon® Multicath Expert 2 lumen catheter (ref. 8157.207)
Chapter 5
76
was used throughout this work for benchmark referencing. The active antimicrobial con-
stituent is the silver-based agent AgION, which is not just a surface coating, but is incorpo-
rated into the material from which the tube is made.
Table 1. Composition of the seven solutions that were used in the preparation of the specimens for this
study. Ag, refers to Ag4E silver particles
No.
Coating
SS90:10 / SS70:30
[mL]
Ag
[g]
NMP
[mL]
Sodium-Heparin
[g]
Formamide
[mL]
1 SS90:10 100 - 50 - -
2 SS90:10-Hep 100 - 25 1.5 25
3 SS90:10-Ag 100 1.5 50 - -
4 SS90:10-Ag-Hep 100 1.5 25 1.5 25
5 SS70:30-Ag 100 1.5 50 - -
6 SS70:30-Ag-Hep 100 1.5 25 1.5 25
7 SS70:30-Ag2×-Hep 100 3.0 25 1.5 25
Formulation
Seven different coating solutions were prepared as is compiled in Table 1. First, 400 mL of a
10% solution of SS90:10 in N-methylpyrrolidone (NMP) was prepared. This solution was
split into four equal parts. Secondly, 300 mL of a 10 % solution of SS70:30 in NMP was
prepared; this solution was split into three equal parts. Thirdly, sodium heparin (6.00 g) was
dissolved in 100 mL of formamide. This solution was split into four equal parts and these
were mixed with two of the SS90:10 solutions (#s 2 and 4, Table 1) and two of the SS70:30
solutions (#s 6 and 7, Table 1). Fourthly, Ag4E silver particles (3.00 g) were dispersed in
NMP (100 mL) through mechanical stirring, split into two equal parts, and combined with
SS90:10 solution #3 and SS70:30 solution #5. Analogously, 3.00 g silver was dispersed in
NMP (50 mL), split into two equal parts and combined with SS90:10 solution #4 and
SS70:30 solution #6. Finally, silver (3.00 g) was dispersed in NMP (25 mL) and combined
with SS70:30 solution #7. Note that in this case a double content of silver was achieved.
Analogously to the procedure described above for the Ag4E silver particles, two differ-
ent coating solutions were prepared with Ag6V silver particles (with and without sodium
heparin), as is compiled in Table 2.
All coating solutions were used in MCTec BV’s procedure for the continuous and pre-
cisely controlled application of thin adherent polymer coatings on long metallic wires, as
described previously18. Stainless steel wires with a diameter of 178 µm were used. The
thickness of the coatings was 3–4 µm. Coated wires were coiled, using a rotating mandril
of 600 µm diameter.
Hydrophilic surface coating with silver and sodium heparin
77
Table 2. Composition of the two solutions with Ag6V silver particles (with or without heparin) that were used
in the preparation of the specimens for this study.
No.
Coating
SS90:10
[mL]
Ag6V
[g]
NMP
[mL]
Sodium-Heparin
[g]
Formamide
[mL]
1 SS90:10-Ag 100 1.5 50 - -
2 SS90:10-Ag-Hep 100 1.5 25 1.5 25
Bacterial strains
The Staphylococcus aureus reference strain ATCC 29213, and two clinical S. aureus isolates
(coined BF110 and D107) were tested. BF110 (meticillin-resistant, MRSA), previously shown
to be a strong biomass producer19, with the genetic background associated with multilo-
cus sequence typing (MLST) clonal complex (CC)8. D107 (meticillin-susceptible, MSSA), was
obtained from a patient with a CVC-related bloodstream-infection.
Exit site challenge
An in vitro method was adopted that determines the ability of antimicrobial coatings to
prevent migration of bacteria along the external surface of a CVC after cutaneous coloniza-
tion and invasion of the insertion site. Coils (30 mm length) were inserted half into 35-mm
thick solidified 28 g/L nutrient (Oxoid) agar, which was in advance poured into containers
(4 cm diameter). Afterwards, the surrounding surface of the insertion site was inoculated
with S. aureus ATCC 29213, 106 CFU/mL using a swab, mimicking the circumstances in
which an insertion site on the skin is adequately disinfected before entrance of a CVC and
the cutaneous port of entry later becomes re-colonized. To mimic not properly disinfected
skin surface, coils were also inserted after inoculation of the agar surface, as described
previously.20 Migration of bacteria down the coils along the abluminal coating surface was
assessed visually for up to seven days during incubation at 37°C.
Bacterial killing
Coils were segmented into 30-mm long test-samples by cutting under aseptic conditions.
The length of the Vygon® catheter pieces was corrected for external and internal surface
area. The specimen parts were added separately to 10-mL NaCl 0.9% tubes containing a
bacterial inoculum of 106 CFU/mL and incubated at 37°C. At t = 0, 2, 4, 8, 12, 24, 48 and 72 h
samples of 100 L were drawn to count viable bacteria. The lower limit of detection was
2.73 log10 CFU/mL, using a spiralplater (Eddy Jet; IUL Instruments, Barcelona, Spain) as part
of the enumeration procedure.
Bacterial adherence
Specimen pieces of 30 mm were separately exposed to bacterial suspensions to assess
adherence of ATCC 29213, BF110 and D107 to the different coating surfaces. The length of
Chapter 5
78
the Vygon® catheter pieces was corrected for external surface area. To mimic infusion
through and/or flushing of CVC prior to colonization or infection, a part of the specimens
was pre-washed in Milli-Q water or plasma (Sanquin, Amsterdam, the Netherlands). The
duration of pre-wash varied between 0 and 72 h. The bacterial exposure time (105, 106 or
107 CFU/mL in 1.5 mL NaCl 0.9%) varied between 1 and 8 h at 37°C. The inoculum was
maintained at the same level by replacement of the inoculum each hour and was checked
before and after each replacement.
Non-adhered bacteria were removed by vortexing each specimen for 1 s in fresh 1.5
mL NaCl 0.9% and transferring it to another tube with 1.5 mL NaCl 0.9%, which was kept in
a shaking incubator at 37°C for 4h. Subsequently, specimens were rolled over Mueller-
Hinton agar plates containing 5% defibrinated sheep blood, according to a roll-plate assay
described previously.21 After overnight incubation at 37°C, the numbers of CFU per cm2 of
each roll track (33 cm2) were determined.
In vitro challenge
In order to determine which coating provided the best anti-adhesive properties over a
prolonged period of time, a repeating set-up of the adherence assay was used in which
exposure to S. aureus ATCC 29213 (105 CFU/mL NaCl 0.9% at 37°C) was alternated with roll-
plate assessment.21 The series was terminated after 25 challenges.
Statistical analysis
SPSS version 16.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analyses. Independ-
ent t-tests were used to compare bacterial adherence data. A P value of ≤ 0.05 was consid-
ered to be statistically significant.
Figure 1. Scanning electron micrograph of a typical specimen, showed the coiled structure.
Results
Specimens
Preparation of the coiled specimens proceeded smoothly; Figure 1 shows a typical exam-
ple. The advantage of this procedure is that numerous identical specimens can be pro-
duced. Reproducibility is an important issue, especially in comparative studies of surface
coatings.
Hydrophilic surface coating with silver and sodium heparin
79
Figures 2A and B show scanning electron micrographs of the silver particles (Ag4E). Note
that these particles are microparticles rather than nanoparticles, since their smallest di-
mension is appr. 1 m. Figures 2C – F show light-microscopic images of our wires prior to
coiling: SS90:10 (C), SS90:10-Hep (D), SS90:10-Ag (E), and SS90:10-Ag-Hep (F). Note the
alignment of the rod-shaped silver particles at the wire’s surface (E and F).
Figure 2. Scanning electron micrographs of the silver particles Ag4E, which were used throughout this work
(A,B). Light-microscopic images of the coated wires SS90:10 (C), SS90:10-Hep (D), SS90:10-Ag (E), and
SS90:10-Ag-Hep (F). Note that (i), the wires in C-F were photographed prior to coiling; (ii), the extrusion-like
coating procedure results in some alignment of the silver particles in the direction of the wire (E,F).
A B
C
E F
D
Chapter 5
80
Figure 3. Exit site challenge. First signs of ATCC 29213 migration extending along the coating surfaces of
SS90:10 (A) and SS90:10-Hep (B), observed 24 h after inoculation of the surrounding agar surface at the
insertion site, respectively. (C) No migration of ATCC 29213 along the coating surface (existing of SS90:10-
Ag-Hep) was observed over 168 h. (D) Growth of inserted bacteria at the surface of SS90:10. (E) Vertical
movement and/or growth of bacteria directed away from the coating surface (SS90:10-Ag-Hep) through the
agar, when specimens were inserted after inoculation of the insertion site.
Exit site challenge
The set-up of this test essentially mimics the situation in which the insertion site on the
skin is first disinfected, and later becomes invaded by bacteria after cutaneous recoloniza-
tion. For the SS90:10 and SS90:10-Hep coatings, clear bacterial migration along the speci-
mens was observed after 24 h (Figure 3A,B). Growth extended further down the coiled
wires within 72 h. Coatings SS90:10-Ag and SS90:10-Ag-Hep did not show bacterial migra-
tion under the same conditions, indicating that the silver particles effectively inhibit
movement and growth of bacteria. Still no bacterial invasion was noticed after 168 h of
incubation (Figure 3C). Changing the matrix into the less hydrophilic version (SS70:30)
influenced the outcome of the test. The surfaces SS70:30-Ag and SS70:30-Ag-Hep pre-
vented bacterial migration within 48 h, but some signs of migration were observed after 72
h. The test was also performed in such a way that the agar surface was first inoculated with
S. aureus ATCC 29213, as described previously.20 Essentially, this would mimic the situation
in which the skin surface was not properly disinfected before insertion.
For all specimens, it was observed that bacteria were transferred with the specimen
into the agar. Subsequently, bacterial growth occurred in all cases, but there was a clear
distinction between the reference coatings (SS90:10 and SS90:10-Hep) on one hand, and
the silver-containing coatings on the other hand. The reference coatings showed bacterial
growth along their surfaces (Figure 3D), whereas the silver-containing coatings directed
A B C D E
Hydrophilic surface coating with silver and sodium heparin
81
bacterial growth more away from the specimens, i.e. perpendicular to their surfaces (Figure
3E).
Time (h)
0 1020304050607080
Log10 CFU mL-1
0
1
2
3
4
5
6
7
SS90:10
SS90:10-Hep
SS90:10-Ag4E
SS90:10-Ag4E-Hep
SS70:30-Ag4E
SS70:30-Ag4E-Hep
SS70:30-Ag4E2x-Hep
Vygon
Time (h)
0 1020304050607080
Log10 CFU mL-1
0
1
2
3
4
5
6
7
ATCC 29213 BF110
Time (h)
0 1020304050607080
Log10 CFU mL-1
0
1
2
3
4
5
6
7
D107
AB
C
Figure 4.
Antibacterial activity of different coating compositions (containing Ag4E silver particles and/or heparin)
over time against inocula of 106 CFU/mL S. aureus (A) ATCC 29213, (B) BF110 and (C) D107. Error bars
indicate standard errors (SE).
Bacterial killing
Figure 4 shows data on survival of bacteria of the S. aureus reference strain ATCC 29213
(Figure 4A), and the clinical isolates BF110 and D107 (Figure 4B,C) upon incubation with
the different test coatings, up to 72 h. Figure 4A reveals that SS90:10 and SS90:10-Hep did
not influence the survival of ATCC 29213. Incorporation of silver (SS90:10-Ag) resulted in
killing of a substantial portion of the bacteria, such that the number of bacteria dropped
with 2–3 orders of magnitude. Embedding the same amount of silver in the less hydro-
philic matrix (SS70:30) did not introduce a major difference. Strikingly, introduction of
Chapter 5
82
silver and heparin led to almost complete killing of ATCC 29213 within 72 h. This effect was
independent of the coating’s hydrophilicity (SS90:10 vs. SS70:30). Doubling of the amount
of silver (in SS70:30-Ag2x-Hep) reduced the viable count similarly. Noteworthy, the com-
mercial Vygon® catheter, which is claimed to have an antibacterial surface22, had no impact
on the survival of ATCC 29213 within 72 h.
Time (h)
0 1020304050607080
Log10 CFU mL-1
0
1
2
3
4
5
6
7
Time (h)
0 1020304050607080
Log10 CFU mL-1
0
1
2
3
4
5
6
7
ATCC 29213 BF110
Time (h)
0 1020304050607080
Log10 CFU mL-1
0
1
2
3
4
5
6
7
SS90:10
SS90:10-Hep
SS90:10-Ag6V
SS90:10-Ag6V-Hep
D107
AB
C
Figure 4-S. Antibacterial activity of different coating compositions (containing Ag6V silver particles and/or
heparin) over time against inocula of 106 CFU/mL S. aureus (A) ATCC 29213, (B) BF110 and (C) D107. Error
bars indicate standard errors (SE).
The experiments with the S. aureus clinical isolates BF110 and D107 led to highly similar
bacterial time-kill curves. Again, no variation in bacterial counts occurred upon incubation
with SS90:10 or SS90:10-Hep. Furthermore, combining silver particles and heparin
(SS90:10-Ag-Hep) substantially improved the bactericidal activities, achieving practically
Hydrophilic surface coating with silver and sodium heparin
83
complete kill (99.99%) within 24–48 h. Although eradication of the reference strain seemed
independent of the amount of embedded silver and the coating hydrophilicity, substantial
differences were seen regarding the clinical isolates BF110 and D107. Compared to
SS90:10-Ag-Hep, SS70:30-Ag-Hep reduced the viable count of these isolates more slowly.
However, whenever a double amount of silver particles was incorporated in the less hy-
drophilic coating (SS70:30-Ag2x-Hep), similar reductions in viable count of BF110 were
obtained as with SS90:10-Ag-Hep. Moreover, the fastest killing of D107 was observed with
SS70:30-Ag2x-Hep, which exceeded even the eradication time of SS90:10-Ag-Hep. No bac-
tericidal effect was noticed when testing the Vygon® catheter pieces.
As shown in Figure 4-S, highly similar antimicrobial effects were realized for the PVP-
stabilized silver particles. Generally, the biocidal effects of PEG-stabilized silver particles
were slightly stronger than those of their PVP-stabilized counterparts.
CFU cm-2
0
10
20
30
40
50
60
70
80
1h
2h
4h
8h
Normalized effect score
0
15
30
45
60
75
1h
2h
4h
8h
A
B
**
*
**
*
SS90:10
SS90:10-Ag
SS90:10-Ag-Hep
SS70:30-Ag
SS70:30-Ag-Hep
SS70:30-Ag2x-Hep
**
SS90:10
SS90:10-Ag
SS90:10-Ag-Hep
SS70:30-Ag-Hep
SS70:30-Ag2x-Hep
SS70:30-Ag
Figure 5. Adherence of S. aureus ATCC 29213 to different specimens during incubation for 1–8 h in 105
CFU/mL (A). The same data expressed as normalized effect score (B). Adherence was assessed by roll-plate
analysis. Asterisks denote statistically significant difference, (*) P < 0.05 and (**) P < 0.01.
Chapter 5
84
CFU cm-2
0
10
20
30
40
50
60
70
80
No prewash
12h MQ
24h MQ
72h MQ
Normalized effect score
0
5
10
15
20
25
No prewash
12h MQ
24h MQ
72h MQ
A
B
*
SS90:10
SS90:10-Ag
SS90:10-Ag-Hep
SS70:30-Ag
SS70:30-Ag-Hep
SS70:30-Ag2x-Hep
*
*
SS90:10
SS90:10-Ag
SS90:10-Ag-Hep
SS70:30-Ag
SS70:30-Ag-Hep
SS70:30-Ag2x-Hep
Figure 6. Adherence of S. aureus ATCC 29213 to different specimens during incubation for 1 h in 106
CFU/mL after pre-wash of the specimens with milliQ water (MQ) for 12–72 h (A). The same data expressed as
normalized effect score (B). Adherence was assessed by roll-plate analysis. Asterisks denote statistically
significant difference, (*) P < 0.05 and (**) P < 0.01.
Bacterial adherence
Adherence to different specimens was examined after various washing periods and incu-
bation times. Figure 5A shows data on the adherence of ATCC 29213 to different speci-
mens after incubation in a constant inoculum of 105 CFU/mL for 1, 2, 4 or 8 h. The adher-
ence to the SS90:10-coating was influenced by the incubation time; the longer the expo-
sure the more adherence of ATCC 29213 was seen. Considerably more bacteria adhered to
this coating compared to the other ones, which occurred already from on-set. Initial ad-
Hydrophilic surface coating with silver and sodium heparin
85
herence was much lower for coatings containing both (Ag4E) silver particles and heparin
compared to silver particles alone. There was also a difference in initial adherence when
the hydrophilicity of the coating was taken into account. The more hydrophilic coatings
SS90:10-Ag and SS90:10-Ag-Hep adhered less bacteria compared to SS70:30-Ag and
SS70:30-Ag-Hep, respectively. Especially the difference in initial adherence between the
SS90:10-Ag and SS70:30-Ag coatings is noteworthy.
A
B
CFU cm-2
0
10
20
30
40
50
60
70
80
90 No prewash
1h MQ
12h MQ
1h HP
12h HP
Normalized effect score
0
15
30
45
60
75
No prewash
1h MQ
12h MQ
1h HP
12h HP
[**]
*
*
*
*
*
SS90:10
SS90:10-Ag
SS90:10-Ag-Hep
SS90:10-Hep
SS90:10
SS90:10-Hep
SS90:10-Ag
SS90:10-Ag-Hep
Figure 7. Adherence of S. aureus ATCC 29213 to different specimens during incubation for 1 h in 107
CFU/mL after pre-wash of the specimens with milliQ water (MQ) for 1–12 h or with human plasma (HP) for
1–12 h (A). The same data expressed as normalized effect score (B). Adherence was quantified by roll-plate
analysis. Asterisks denote statistically significant difference, (*) P < 0.05 and (**) P < 0.01. Asterisks between
brackets denote statistically significant difference of individual conditions versus all other circumstances
(except SS90:10).
However, there was a tendency that the anti-adhesive effects on bacteria of the SS90:10-
silver containing coatings deteriorated more quickly than their counterparts. The quicker
reduction in anti-adhesive efficacy of the more hydrophilic coatings became more obvious
when the data was presented as a normalized effect score, whereby the adherence within
Chapter 5
86
1 h was set to an arbitrary value of 1.0 (Figure 5B). Although this relative increase was more
pronounced for the more hydrophilic matrixes, absolute adherence was sustained at a
slightly lower level for SS90:10-Ag-Hep compared to SS70:30-Ag-Hep. No influence of
more embedded silver was observed since adherence to SS70:30-Ag-Hep and SS70:30-
Ag2x-Hep was maintained at a similar level.
Challenge number
02468101214161820222426
CFU cm-2
0
10
20
30
40
50
60
70
80
90
100
SS70:30-Ag
SS70:30-Ag-Hep
SS70:30-Ag2x-Hep
Vygon®
Challenge number
0 2 4 6 8 101214161820222426
CFU cm-2
0
10
20
30
40
50
60
70
80
90
100
SS90:10-Ag
SS90:10-Ag-Hep
SS90:10
SS90:10-Hep
AB
Figure 8. In vitro challenge results of all specimens with Ag4E silver particles. The roll-plate assay was used
to assess adherence (CFU/cm2) of ATCC 29213 after each challenge, consisting of incubation in 105 CFU/mL
during 1 h at 37°C and removement of non-adhered bacteria afterwards. Error bars indicate standard errors
(SE). The detection limit was approximately 80–100 CFU/cm2.
Bacterial adhesion to the different matrixes was also assessed after preceding washing
periods. This essentially mimics the situation whereby a CVC is routinely used for a certain
period of time and later becomes contaminated with bacteria. As shown in Figure 6A, even
after 72 h pre-wash, adherence of ATCC 29213 was more pronounced when only silver
particles (without heparin) were incorporated in the coating. Pre-wash with milliQ water
seemed to have no effect on the adherence of ATCC 29213 to the less hydrophilic coatings
SS70:30-Ag and SS70:30-Ag-Hep. On the other hand, the anti-adhesive features of the
coatings SS90:10–Ag and SS90:10-Ag-Hep declined when pre-wash was extended (Figure
6B). Remarkably, while the effect of pre-washing was negligible for the coatings having
SS70:30 as the matrix, SS70:30-Ag2x-Hep displayed a tendency towards more adherence of
ATCC 29213 when a longer pre-wash program was applied.
To explore whether fouling a (thin) film of human plasma proteins would influence
bacterial adherence to the specimens, milliQ water as a washing fluid was replaced by
drug-free human plasma from healthy volunteer blood donors. It appeared that plasma
incubated specimens containing heparin in its coating layer, i.e. SS90:10-Hep and SS90:10-
Ag-Hep, displayed increased adherence of ATCC 29213 (Figure 7A,B). Still, adherence with
SS90:10-Ag-Hep was far below the level achieved with the reference coatings SS90:10 and
at the same level as the coating containing silver particles alone, SS90:10-Ag. The coatings
Hydrophilic surface coating with silver and sodium heparin
87
without heparin, i.e. SS90:10-Ag, lost repulsion activity when pre-washed during 12 h with
milliQ water in the same order as when plasma was used. Surprisingly, there was a ten-
dency for these specimens that pre-wash in plasma during 12 h resulted in less adherence
of ATCC 29213 in comparison with 1 h pre-wash in plasma.
Challenge number
02468101214161820222426
CFU cm-2
0
10
20
30
40
50
60
70
80
90
100
SS90:10-Ag6V
SS90:10-Ag6V-Hep
SS90:10
SS90:10-Hep
Figure 8-S. In vitro challenge results of all specimens with Ag6V silver particles. The roll-plate assay was
used to assess adherence (CFU/cm2) of ATCC 29213 after each challenge, consisting of incubation in 105
CFU/mL during 1 h at 37°C and removementy of non-adhered bacteria afterwards. Error bars indicate
standard errors (SE). The detection limit was approximately 80–100 CFU/cm2.
In vitro challenge
Upon multiple challenges, bacterial adherence to all specimens containing silver particles
gradually increased over time, but remained relatively low, especially for the ones with
heparin (Figure 8). In contrast, soon after the first few challenges, roll-plate analysis of
SS90:10 and SS90:10-Hep displayed a strong rise in the number of adhered bacteria. Al-
ready after 4–5 challenges the limit of detection, i.e. 100 CFU/cm2, was exceeded (Figure
8A). After eight challenges it was estimated that specimens SS90:10 and SS90:10-Hep
achieved a maximum of adhered cells of approximately 230 CFU/cm2 (data not shown).
However, it has to be noticed that during the first four challenges it was clear that speci-
mens containing heparin alone, SS90:10-Hep, demonstrated anti-adhesive properties on
interaction with ATCC 29213. From the beginning, bacterial adherence to the Vygon®
catheter segments was excessive compared to all silver-containing specimens. After the
last challenge, adherence to the Vygon® segments was approximately six times more
compared to all silver-containing specimens. Whereas SS90:10-Ag and SS90:10-Ag-Hep
demonstrated low adherence from the on-set, SS70:30-Ag and Vygon® catheter segments
Chapter 5
88
showed initially a higher adherence, while its anti-adhesive capacities improved soon
thereafter (Figure 8B).
Compared to matrixes with both heparin and silver particles in them, adherence to sil-
ver-containing specimens remained slightly higher over multiple challenges. This observa-
tion was independent of the coating’s hydrophilicity. The less hydrophilic coating with the
double amount of silver particles, SS70:30-Ag2x-Hep, displayed more decline in its anti-
adhesive capacities than the one with the reference content, SS70:30-Ag-Hep.
Discussion
Our experimental data confirm that embedding of silver particles in hydrophilic surface
coatings is a feasible strategy toward biocidal surfaces for medical devices such as cathe-
ters23. The experiments on bacterial killing and adhesion showed strong synergistic effects,
if silver particles and heparin were co-embedded in the coating. This is the key message of
this work. The effect was found with three different S. aureus strains: a reference strain
(ATCC 29213) and two clinical isolates.
The observed more-than-additive effect of silver particles and heparin on bacterial kill-
ing and adhesion clearly asks for an explanation. First, it is important to consider the
mechanistic background of the antimicrobial activity of surfaces containing silver. It is well-
known that silver particles expose Ag+ ions at their periphery24. Furthermore, it is essential
to realize that all our media contained chloride ions, and that the solubility of AgCl in aque-
ous media is extremely low. Hence, dissolution of Ag+ ions from the silver particles does –
most probably– not play a major role in the observed biocidal effects. In our earlier work
(see chapter 4), we have corroborated this through a series of titration experiments, using
the soluble silver salt AgNO3. We found that dissolved Ag+ ions only start to become bio-
cidal if their concentration exceeds 100 nM25. We hypothesized, therefore, that antimicro-
bial effects of our silver-containing surfaces can be attributed to collisions of bacteria with
the surface. During such a collision, transfer of Ag+ ions can occur from the silver particles
surface to the bacterium’s membrane, e.g. by binding to negatively charged phospatidyl
serine moieties. These membrane-bound Ag+ ions can subsequently induce rupture of the
bacterial wall, eventually killing the bacterium. In essence, this mechanism is heterogene-
ous, as the critical step is collision between suspended bacteria and a solid surface that
exposes Ag+ ions at its surface.
The question now is how this mechanism will change if heparin is introduced in the
surface coating, next to the silver particles. Clearly, collisions and transfer of Ag
+ ions as
described above can still occur. But in addition, there is release of heparin molecules from
the coating’s surface occurring, especially if the matrix is hydrophilic26. Heparin molecules,
escaping from the coating can drag silver ions with them; affinity of heparin for monova-
lent cations is well documented27. So, in essence there is now a second mechanism by
which Ag+ ions can reach the bacterium, based on dissolved heparin molecules working as
a carrier for Ag+ ions. This second mechanism is homogeneous, and heparin/Ag+ complexes
could bind to the outer surface of bacteria, or be internalized.
Hydrophilic surface coating with silver and sodium heparin
89
The present experimental data can not be used to prove our hypothesis right or wrong,
but it is obvious that most of our observations are in line with it. Bacterial killing with the
coatings SS90:10-Ag-Hep, SS70:30-Ag-Hep and SS70:30-Ag2x-Hep against inocula of S.
aureus was much stronger, in comparison with counterpart coatings that contained only
silver particles or heparin (Figure 4). Analogously, adherence of S. aureus ATCC 29213 was
much lower for the coatings containing both silver particles and heparin (Figure 5); pre-
washing with MQ water or with human blood plasma did not change this picture (Figures.
6, 7). The in vitro challenge tests also pointed out that the coatings SS90:10-Ag-Hep,
SS70:30-Ag-Hep and SS70:30-Ag2x-Hep outperformed their counterparts containing either
silver particles or heparin. Interestingly, the adherence tests allowed us to compare the
long term effects between SS90:10-Ag-Hep and SS70:30-Ag-Hep coatings (up to 72 h pre-
wash). These coatings differ only regarding the hydrophilicity of the matrix. The less hy-
drophilic material SS70:30 is expected to have slower release of embedded heparin (and
consequently augmented co-transport of silver particles), and –hence– a more sustained
antimicrobial effect. This is exactly what is seen in Figure 6.
Conclusions
In summary, we found that embedding of silver particles in SlipSkin (NVP/BMA) hydrophilic
surface coatings leads to pronounced antimicrobial effects in experiments with three
strains of S. aureus (one reference strain and two clinical isolates). Heparin potentiates the
biocidal activity of the silver particles. A tentative explanation for this effect of heparin is
based on two premises: (i) the observed biocidal effects of silver per se relate to a collision
mechanism, and (ii) silver ions are transported by heparin molecules that are released from
the coating’s surface. This works shows for the first time that it is possible to design surface
coatings with strong antimicrobial and antithrombogenic features. Most probably, rational
design of such coatings becomes possible if the mechanistic details are explored further.
We expect that this work will open a new route to safer (percutaneous) blood-contacting
medical devices such as CVCs, which have become indispensable in the treatment of criti-
cally ill patients.
Acknowledgements
Financial support of the Deutsch Forschungsgemeinschaft (DFG) is gratefully acknowl-
edged. DFG supported this study through the Graduiertenkolleg “BioInterface” (#1035), in
which the Rheinisch-Westfälische Technische Hochschule Aachen, and the Universities of
Liège and Maastricht cooperate.
Chapter 5
90
References
1. Hockenhull JC, Dwan KM, Smith GW, et al. The clinical effectiveness of central venous catheters treated with
anti-infective agents in preventing catheter-related bloodstream infections: a systematic review. Critical care
medicine 2009;37:702–12.
2. Rosenthal VD. Central line-associated bloodstream infections in limited-resource countries: a review of the
literature. Clin Infect Dis 2009;49:1899–907.
3. Crnich CJ, Maki DG. The Role of Intravascular Devices in Sepsis. Current infectious disease reports 2001;3:496–
506.
4. McGee DC, Gould MK. Preventing complications of central venous catheterization. N Engl J Med
2003;348:1123–33.
5. Frasca D, Dahyot-Fizelier C, Mimoz O. Prevention of central venous catheter-related infection in the intensive
care unit. Critical care (London, England) 2010;14:212.
6. Mermel LA, Allon M, Bouza E, et al. Clinical practice guidelines for the diagnosis and management of intravascu-
lar catheter-related infection: 2009 Update by the Infectious Diseases Society of America. Clin Infect Dis
2009;49:1–45.
7. Gilbert RE, Harden M. Effectiveness of impregnated central venous catheters for catheter related blood stream
infection: a systematic review. Current opinion in infectious diseases 2008;21:235–45.
8. Walz JM, Memtsoudis SG, Heard SO. Analytic reviews: prevention of central venous catheter bloodstream
infections. Journal of intensive care medicine 2010;25:131–8.
9. Debourdeau P, Kassab Chahmi D, Le Gal G, et al. 2008 SOR guidelines for the prevention and treatment of
thrombosis associated with central venous catheters in patients with cancer: report from the working group.
Ann Oncol 2009;20:1459–71.
10. Baskin JL, Pui CH, Reiss U, et al. Management of occlusion and thrombosis associated with long-term indwelling
central venous catheters. Lancet 2009;374:159–69.
11. Verso M, Agnelli G. Venous thromboembolism associated with long-term use of central venous catheters in
cancer patients. J Clin Oncol 2003;21:3665–75.
12. Boersma RS, Jie KS, Verbon A, van Pampus EC, Schouten HC. Thrombotic and infectious complications of
central venous catheters in patients with hematological malignancies. Ann Oncol 2008;19:433–42.
13. Wang H, Huang T, Jing J, et al. Effectiveness of different central venous catheters for catheter-related infections:
a network meta-analysis. The Journal of hospital infection 2010;76:1–11.
14. Stevens KNJ, Croes S, Boersma RS, et al. Hydrophilic surface coatings with co-embedded biocidal silver
nanoparticles and sodium heparin for central venous catheters. Biomaterials 2011;32:1264–69.
15. Kim JS, Kuk E, Yu KN, et al. Antimicrobial effects of silver nanoparticles. Nanomedicine 2007;3:95–101.
16. Rai M, Yadav A, Gade A. Silver nanoparticles as a new generation of antimicrobials. Biotechnology advances
2009;27:76–83.
17. Bayston R, Vera L, Mills A, Ashraf W, Stevenson O, Howdle SM. In vitro antimicrobial activity of silver-processed
catheters for neurosurgery. The Journal of antimicrobial chemotherapy 2010;65:258–65.
18. Hanssen HH, Wetzels GM, Benzina A, van der Veen FH, Lindhout T, Koole LH. Metallic wires with an adherent
lubricious and blood-compatible polymeric coating and their use in the manufacture of novel slippery-when-
wet guidewires: possible applications related to controlled local drug delivery. Journal of biomedical materials
research 1999;48:820–8.
19. Croes S, Deurenberg RH, Boumans ML, Beisser PS, Neef C, Stobberingh EE. Staphy lococcus aureus biofilm forma-
tion at the physiologic glucose concentration depends on the S. aureus lineage. BMC microbiology 2009;9:229.
20. Bayston R, Fisher LE, Weber K. An antimicrobial modified silicone peritoneal catheter with activity against both
Gram-positive and Gram-negative bacteria. Biomaterials 2009;30:3167–73.
21. Maki DG, Weise CE, Sarafin HW. A semiquantitative culture method for identifying intravenous-catheter-related
infection. The New England journal of medicine 1977;296:1305–9.
Hydrophilic surface coating with silver and sodium heparin
91
22. Trogolo JA. Protecting devices with silver-based antimicrobials. MD&DI magazine 2010;32:52–8.
23. Casey AL, Mermel LA, Nightingale P, Elliott TS. Antimicrobial central venous catheters in adults: a systematic
review and meta-analysis. The Lancet infectious diseases 2008;8:763–76.
24. Lok CN, Ho CM, Chen R, et al. Silver nanoparticles: partial oxidation and antibacterial activities. J Biol Inorg
Chem 2007;12:527–34.
25. Stevens KN, Crespo-Biel O, van den Bosch EE, et al. The relationship between the antimicrobial effect of cathe-
ter coatings containing silver nanoparticles and the coagulation of contacting blood. Biomaterials
2009;30:3682–90.
26. Aldenhoff YB, Hanssen JH, Knetsch ML, Koole LH. Thrombus formation at the surface of guide-wire models:
effects of heparin-releasing or heparin-exposing surface coatings. J Vasc Interv Radiol 2007;18:419–25.
27. Rudd TR, Guimond SE, Skidmore MA, et al. Influence of substitution pattern and cation binding on conforma-
tion and activity in heparin derivatives. Glycobiology 2007;17:983–93.
93
CHAPTER 6
Large-scale evaluation of mutations in norA gene and its
promoter leading to overexpression of the multidrug efflux
pump NorA in Staphylococcus aureus
Petra F.G. Wolffs1
Sander Croes1,2
Ruud H. Deurenberg1
D. van Leerdam1
Erik Beuken1
Ellen E. Stobberingh1
1 Department of Medical Microbiology, School for Public Health and Primary Care (CAPHRI), Maastricht University
Medical Center, Maastricht, the Netherlands
2 Department of Clinical Pharmacy and Toxicology, Maastricht University Medical Center, Maastricht, the Netherlands
Submitted for publication
Chapter 6
94
Introduction
To date, at least seven genes have been described in the chromosome of Staphylococcus
aureus which encode multidrug efflux pumps (EPs): i.e. mdeA, mepA, norA, norB, norC, sdrM
and sepA1, 2, 3, 4, 5, 6. In addition, many other efflux pumps located on plasmids have been
described as well, such as qacA/B, qacC, qacD and qacG7, 8, 9. NorA has been one of the most
well described EPs in S. aureus. Studies have shown that NorA is a protein containing
twelve transmembrane segments, that uses proton motive force to export diverse drugs
such as ethidium bromide, quaternary ammonium compounds and hydrophilic fluoroqui-
nolones such as norfloxacin and ciprofloxacin3, 10, 11, 12. Mutations in the promoter and the
norA gene itself as well as mutations in mgrA, encoding a regulatory gene, are known to
affect the expression of norA11, 13. An increase in expression is linked to an increased resis-
tance to its substrates such as ciprofloxacin3. NorA-related fluoroquinolone resistance is
however low as compared to resistance caused by mutations in topoisomerase or gyrase
genes, but there is evidence suggesting that norA mediated low-level resistance predis-
poses to development of high-level resistance14.
Several studies have been published describing different mutations which were asso-
ciated with an increased expression of norA. Noguchi et al. published an overview of se-
quences of norA and its promoter of 20 strains, including five reference strains11. The au-
thors discerned three main alleles: norA wt, norA1199 and norAII3, 15. Most publications
however, only investigated a limited number of strains, often providing even more limited
or no gene expression data and to our knowledge, no studies have been performed look-
ing at the link between the sequence of norA (and linked to that, overexpression of norA)
and the genetic background of S. aureus. The goal of this study was to investigate a large
group of S. aureus isolates, with different genetic backgrounds, both methicillin suscepti-
ble S. aureus (MSSA) and methicillin resistant S. aureus (MRSA), with respect to sequence
and expression of norA.
Materials and Methods
Bacterial strains
The S. aureus strains (72 MRSA and 156 MSSA) investigated were isolated during 2005 to
2008 in the Maastricht University Medical Center, a tertiary 715-bed hospital, and originate
from surveillance cultures (commensal flora) from individual patients, recovered from nasal
swabs16. MRSA and/or MSSA strains associated with MLST CC1, CC5, CC8, CC22, CC30,
CC45, CC7, CC12, CC15, CC25 and CC121, were randomly selected from our institutional
collection. All MRSA strains were tested positive for the MRSA-specific mecA gene, by real-
time PCR17. Antibiotic susceptibility data for an extensive panel of antibiotics including a.o.
methicillin, oxacillin, ciprofloxacin, moxifloxacin, gentamicin, clindamycin, linezolid and
vancomycin for the different strains was obtained by routine broth micro dilution suscep-
tibility testing, according to CLSI guidelines.
norA overexpression in Staphylococcus aureus
95
Table 1. Primers used for sequencing of (promoter) norA, grlA and gyrA.
Primer Sequence Tm (°C)
NorAF4 GTCCGCTAAAAGTTTCATATGATTG 63
NorAF2 CAAATGTAGCAATGTTGTGAATAC 55
NorAF3 TTCACCAAGCCATCAAAAGC 53
NorAR2 TGGCATACGATGTGAAACTTC 55
NorAR3 TTGCAATTCATGCTAAATATCC 51
NorAR4 TTAATGAATTAGGTATGTGGATTGC 61
NorA LongF AGCGAGATGTCCGCTAAAAG 55
NorA LongR TAACGCACCTGCGATTAAAG 53
GyrF TCGTGCATTGCCAGATGTTCG 59
GyrR TCGAGCAGGTAAGACTGACGG 61
GrlF TGCCAGATGTTCGTTCGTGATGGT 67
GrlR TCGAGCAGGTAAGACTGACGG 61
Characterization of the genetic background
Typing of the spa locus was carried out as described previously18. The spa types were as-
signed through the Ridom SpaServer http://spaserver.ridom.de and clustered into spa-CCs
using the algorithm based upon repeat pattern (BURP) with Ridom StaphType 1.4 using
the default settings19, 20. Although, spa typing alone sometimes lacks discriminatory power,
due to related spa repeat patterns within different clonal lineages and the emergence of
homoplasies among spa sequences21, it has been shown that spa typing/BURP results are
often in agreement with results obtained by MLST20, 22. Therefore, the associated MLST CCs
were allocated through the SpaServer. To confirm the association between MLST and spa
typing, in combination with BURP, MLST was performed on a representative set of 16
strains of each major spa type and associated MLST CC23, 24.
norA, grlA and gyrA sequencing
For norA sequencing purposes, a number of PCRs were implemented. A dedicated PCR
developed by Couto et al., was used for sequencing of the norA promoter and the start of
the norA coding region25. A PCR amplifying a 1500bp amplicon covering most of the pro-
moter and the norA gene was developed as part of this study. Within this amplicon, addi-
tional primers were developed for sequencing of internal regions (Table 1).
Briefly, the procedure was comprised of suspension of one colony picked from a blood
agar plate in 100 L of ultrapure water. Of this 1 L was added to the PCR mixture. This
mixture contained 0.4 M of each primer, 0.2 units HotStarTaq Plus DNA polymerase (Qia-
gen, Venlo, the Netherlands) 1× accompanying reaction buffer and 100 M of each dNTP.
The PCR protocol consisted of an initial denaturation step of 5 min. at 95°C, followed by 40
cycles of 30sec. at 95°C, 30sec. at 50°C and 2 min. at 72°C. After PCR, amplicons were puri-
fied using PCRapace spin columns (Invitek GmbH, Berlin, Germany). Subsequently se-
quence reactions were performed using 0.1 M of each primer, 1 L of 1.1 BigDye Termina-
Chapter 6
96
tor reaction mix (Applied Biosystems, Carlsbad, CA, USA), 1.5 L accompanying sequencing
buffer and 1 L of purified amplicon (in a final volume of 10 L). Readout of the sequences
was performed on a 3730 DNA sequencer (Applied Biosystems).
Ultimately, the different norA promoter sequences were aligned and compared to the
three previously described norA alleles: norA wt33, norA119914 and norAII21. Afterwards, the
different sequences were grouped, with each group carrying an identical norA promoter,
and named after the most resembling allele.
Table 2. Overview of 24 strains which have been further investigated regarding norA expression of different
promotor sequence groups and mutations in gyrase and topoisomerase.
S.
aureus
strain
Relative
norA
expression
CC
Sequence
norA
promotor
norA promoter –
10 region
MIC
cipro
(mg/L)
(CLSI)
Topo-
isomerase
(GrlA
codon 80)
Topo-
isomerase
(GrlA
codon 84)
DNA gyrase
(GyrA
codon 84)
DNA gyrase
(GyrA
codon 88)
3 1 5 A (WT) ataCAATata 0.25 TCC(Ser) GAA (Glu) TCA (ser) GAA (G lu)
137 0.5 5 A (WT) ataCAATata 0.25 TCC(Ser) GAA (Glu) TCA (ser) GAA (Glu)
140 0.9 5 A (WT) ataCAATata 0.25 TCC(Ser) GAA (Glu) TCA (ser) GAA (Glu)
29 11.8 5 B ataCAATataG(∆11bp) 16
TTC (Phe) GAA (Glu) GCA (Glu) GAA (Glu)
11 1.5 22 C ataCAAT ata 0.25 TCC(Ser) GAA (Glu) TCA (ser) G AA (Glu)
55 1.7 22 C ataCAAT ata 0.25 TCC(Ser) GAA (Glu) TCA (ser) G AA (Glu)
135 14.6 5 D ataCAAT(CAAT)ata 256
TAC (Tyr) GGA (Gly) TTA (Leu) AAA (Lys)
139 32.1 5 D ataCAAT(CAAT)ata 256
TAC (Tyr) GGA (Gly) TTA (Leu) AAA (Lys)
82 2.2 8 F ataCAATata 128
TTC (Phe) AAA (Lys) GTA (Val) GAA (Glu)
69 1.9 45 I ataCAATata 0.25 TCC(Ser) GAA (Glu) TCA (ser) GAA (Glu)
108 3.0 8 I ataCAATata 0.25 TCC(Ser) GAA (Glu) TCA (ser) GAA (Glu)
95 5.0 45 K ataCAATataGAAG 256
TTC (Phe) GAA (Glu) TTA (Leu) GAA (Glu)
100 37.6 45 K ataCAATataGAAG 256
TTC (Phe) GAA (Glu) TTA (Leu) GAA (Glu)
101 46.0 45 K ataCAATataG AAG 256
TTC (Phe) GAA (Glu) TTA (Leu) GAA (Glu)
102 23.6 45 L ataCAATataGAAG 512
TTC (Phe) GAA (Glu) TTA (Leu) GAA (Glu)
16 43.0 30 N ataCAAT (ATCAAT)ata 128
TTC (Phe) GAA (Glu) TTA (Leu) GAA (Glu)
17 56.1 30 N ataCAAT (ATCAAT)ata 128
TTC (Phe) GAA (Glu) TTA (Leu) GAA (Glu)
90 81.2 30 N ataCAAT(ATCAAT)ata 128
TTC (Phe) GAA (Glu) TTA (Leu) GAA (Glu)
158 2.4 30 O ataCAATata 0.25 TCC(Ser) GAA (Glu) TCA (ser) GAA (Glu)
160 2.2 30 O ataCAATata 0.5 TCC(Ser) GAA (Glu) TCA (ser) GAA (Glu)
179 13.5 30 P ataCAATata 0.5 TCC(Ser) GAA (Glu ) TCA (ser) GAA (Glu)
207 1.1 121 Q ataCAATata 0.25 TCC(Ser ) GAA (Glu) TCA (ser) GAA (Glu)
212 2.2 121 Q ataCAATata 0.25 TCC(Ser ) GAA (Glu) TCA (ser) GAA (Glu)
209 1.3 121 R ataCAATataGAAG 0.5 TCC(Ser) GAA (Glu) TCA (ser) GAA (Glu)
norA expression studies
Saturated overnight cultures of S. aureus strains (n=24) were diluted 1:20 in Mueller-Hinton
(MH) and incubated for 1 hour at 37°C with constant shaking. 100 L culture of each sam-
ple was pelleted (in triplicate) by centrifugation, the pellet was resuspended in 40 L of cell
suspension buffer (50 mM Tris, 50 mM EDTA; pH 8), 2 L of RNase-inhibitor (Applied Biosys-
tems) and 10 L lysosthaphin solution (1 mg/mL) (Sigma) were added, mixed and incu-
bated at 37°C until visible lysis of the cells (typically 5–10 min.) occurred. The lysate was
extracted twice with phenol/CHCl3 (1:1) and once with CHCl3. Nucleic acids were ethanol
precipitated, air-dried dissolved in DEPC treated water. Genomic DNA was removed by
incubating the sample with 1–2 units of DNaseI (Fermentas GmbH) for 30 min. After DNase
I digestion, the sample was extracted with phenol/CHCl3, precipitated and dissolved in 50
L DEPC treated water.
norA overexpression in Staphylococcus aureus
97
Quantitative RT-PCR was performed using the Bio-Rad iScriptTM One-Step RT-PCR kit
according to the supplier’s instruction with primers NorAF3 and NorAR2 (Table 1) and
primers for 16S rDNA, which was used as a housekeeping reference gene25. In summary,
the template was diluted 1:100 for norA detection and 1:10000 for the endogenous control
(16S rDNA). Amplification conditions were as follow: cDNA was synthesised at 42°C for 20
min. After a denaturing step at 95°C for 5 min., DNA was amplified in 42 cycles (95°C for 30
sec.; 50°C for 30 sec.; 72°C for 30 sec.) followed by a melting curve analysis (MyiQTM Single-
Color Real-Time detection system, Bio-rad). Negative controls and controls for genomic
DNA contamination were included. Quantification (comparative Ct method26) was per-
formed using strain 3 as a reference strain (wild type for norA, grlA and gyrA genes).
Results
norA expression of different norA promotor sequence groups
After sequencing of the norA promoter of 228 S. aureus isolates, the promoter sequences
were aligned and 18 sequence groups, named A-R, could be differentiated (Figure 1, Table
2). Each group consisted of strains with identical sequences; i.e. when a point mutation was
found, a new sequence group was designated. The sequences were compared to three
reference sequences of the three known norA alleles as described by Noguchi et al.11. The
results show that sequence groups resembling all three known alleles were present in our
collection. From the different promotor sequence groups A-R, 21 strains were selected for
further investigation (Table 2). The selection of these strains was based on two points: i)
from each sequence group consisting of > two strains, two strains were investigated, and
ii) from each group containing mutations within the region -15 to +7, at least one strain
was investigated. From each of the 21 strains, the expression of norA was monitored. Simi-
lar to earlier studies, a change of expression of ≥ 4-fold was considered to be a significant
change27. Table 2 shows that representatives from six groups (B, D, K, L and N and P) dem-
onstrated an increased expression of norA up to maximally ~80-fold. Representatives from
all other groups showed an expression similar to a randomly chosen reference wt strain
(i.e. strain 3). Interestingly, norA overexpression was seen within each of the three norA
alleles (Figure 2).
For further analysis, all samples in each sequence group were assumed to have a simi-
lar expression profile. This assumption was tested by random choice of three more repre-
sentative strains of respectively group A, K and N (in italics in Table 2). The norA expression
of these strains confirmed our previous findings.
As high-level resistance to fluoroquinolones is traditionally a result of mutations in gyrase
and topoisomerase, mutations in gyrA and grlA were monitored as part of this study. The
results revealed that 22 of the 23 strains which were further investigated and representing
groups B, D, K, L and N also showed mutations in these genes which are known to lead to
resistance to fluoroquinolones (Table 2). Only the single strain representing group P
showed mutations in group norA and no mutations in grlA and gyrA.
Chapter 6
98
A TTCTCCTTTTTCCAACACTAGTAGTATAGTATGATTACTTTTTTGCAATTTCATATGATC
B ------------------------------------------------------------
C ---G--------T-----------------------------------------------
D --------------*---------------------------------------------
E --------------*---------------------------------------------
F --------------*---------------------------------------------
G --------------*---------------------------------------------
H ---G--------T-*---------------------------------------------
I ---G--------T-----------------------------------------------
J ---G--------T-----------------------------------------------
K ---G--------T-----------------------------------------------
L ---G--------T-----------------------------------------------
M ---G--------T-*---------------------------------------------
N ------------T-----------------------------------------------
O ------------T-----------------------------------------------
P ------------T-----------------------------------------------
Q ------------T-----------------------------------------------
R ------------T-----------------------------------------------
A AATCCCCTTTATTTTAATATGTCATTAATTATACAATTAAA-TGGAAAATAGTGATAATT
B ------------------------------------------------------------
C ------------------------------------------------------------
D ------------------------------------------------------------
E -----------C------------------------------------------------
F ------------------------------------------------------------
G -----------------------------------------A------------------
H ------------------------------------------------------------
I ------------------------------------------------------------
J ------------------------------------------------------------
K ------------------------------------------------------------
L ------------------------------------------------------------
M ------------------------------------------------------------
N ------------------------------------------------------------
O ------------------------------------------------------------
P ------------------------------------------------------------
Q ------------------------------------------------------------
R ------------------------------------------------------------
-35 -10 ↓
A ACAAAGAAAAAA-TATTGTCAAATGTAGCAATGTTGTAATACAA------TATAGAAACT
B -------------------------------------------------------*****
C ------------------------------------------------------------
D --------------------------------------------TCAA------------
E ------------------------------------------------------------
F ------------------------------------------------------------
G ------------------------------------------------------------
H ------------------------------------------------------------
I --------------------------------A---------------------------
J --------------------------------A---------------------------
K --------------------------------A------------------------G--
L --------------------------------A--------T---------------G--
M --------------------------------A---------------------------
N ------------A-------------------------------TATCAA----------
O ------------A-----------------------------------------------
P ------------A------------------------G----------------------
Q ------------A---------T---------A---------------------------
R ------------A---------T---------A------------------------G--
Figure 1: to be continued on the next page
norA overexpression in Staphylococcus aureus
99
A TTTTACGAATATTTAGCATGAATTGCAATCTGTCGTGGAAAAGAAGAATAACAGCTTTAA
B ******------------------------------------------------------
C ------------------------------------------------------------
D ------------------------------------------------------------
E ------------------------------------------------------------
F A-----------------------------------------------------------
G ------------------------------------------------------------
H ------------------------------------------------------------
I ---------------------------------------------A-----------G--
J ---------------------------------------------A-----------G--
K ---------------------------------------------A-----------G--
L ---------------------------------------------A-----------G--
M ---------------------------------------------A-----------G--
N -----------------------------T------------------------A-----
O -----------------------------T------------------------A-----
P -----------------------------T------------------------A-----
Q ---------------------------------------------A--------------
R ---------------------------------------------A--------------
Start
A GCATGACATGGAGAAAAAA-GAGGTGAGCATATGAATAAACAGATTTTTGTCTTATATTTT
B -------------------------------------------------------------
C -------------------------------------------------------------
D -------------------------------------------------------------
E -------------------------------------------------------------
F -------------------------------------------------------------
G -------------------------------------------------------------
H -------------------------------------------------------------
I -AG-----A-T-------------------A-----------------G--A---------
J -AG-----A-T-------------------A-----------------G--A---------
K -AG-----A-T-------------------A-----------------G--A---------
L -AG-----A-T-------------------A-----------------G--A---------
M -AG-----A-T-------------------A-----------------G--A---------
N -A-----------------------------------------------------------
O -A-----------------------------------------------------------
P -A-----*-----------------------------------------------------
Q -AG-----A-T-------------------A-----------------G--T---------
R -AG-----A-T-------------------A-----------------G--T---------
A AATATTTTCTTGATTTTTTTAGGTATCGGTTTAGTAATACCAGTCTTGCCTGTTTATTTA
B ------------------------------------------------------------
C ------------------------------------------------------------
D ------------------------------------------------------------
E ------------------------------------------------------------
F ------------------------------------------------------------
G ------------------------------------------------------------
H ------------------------------------------------------------
I -----------A------------------C----G-----------A------------
J -----------A-----------A------C----G-----------A------------
K -----------A------------------C----G-----------A------------
L -----------A------------------C----G-----------A------------
M -----------A------------------C----G-----------A------------
N ------------------------------------------------------------
O ------------------------------------------------------------
P ------------------------------------------------------------
Q -----------A--A---------------C----G-----------A------------
R -----------A--A---------------C----G-----------A------------
Figure 1: to be continued on the next page
Chapter 6
100
A AAAGATTTGGGATTAACTGGTAGTGATTTAGGGTTACTTG
B ----------------------------------------
C ----------------------------------------
D ----------------------------------------
E ----------------------------------------
F ----------------------------------------
G ----------------------------------------
H ----------------------------------------
I -----------G----------------------------
J -----------G----------------------------
K -----------G----------------------------
L -----------G----------------------------
M -----------G----------------------------
N ----------------------------------------
O ----------------------------------------
P ----------------------------------------
Q -----------G----------------------------
R -----------G----------------------------
Figure 1. Alignment of part of norA and its promoter. 18 different groups can be distinguished (A-R; norA
overexpressing types as in bold and underlined). The -35 and -10 regions are marked and underlined. The
transcription initiation site is marked with an arrow.
wt NorAII NorA1199
%
0
10
20
30
40
50
60
70
80
90
100
overexpression
wt expression
Figure 2. Distribution of the norA overexpressing S. aureus strains per norA allele.
Antibiotic susceptibility and norA overexpression
Of all 228 strains, resistance to the fluoroquinolones ciprofloxacin and moxifloxacin as well
as to methicillin was investigated in relation to overexpression of norA. The results showed
that there was a 95% correlation between strains in the norA overexpressing sequence
groups (B, D, K, L, N and P) (n=20) also showing resistance to methicillin and ciprofloxacin.
Only strain 179 in sequence group P was susceptible to both methicillin and ciprofloxacin.
Regarding moxifloxacin, three overexpression strains were still susceptible to moxifloxacin,
norA overexpression in Staphylococcus aureus
101
but the other 84% was shown to be resistant to this antibiotic. For other antibiotics (such
as vancomycin, gentamycin, clindamycin, linezolid, imipenem and rifampicin) no correla-
tion with norA overexpression was found (data not shown).
A
CC1 CC 5 CC 7 CC8 C C12 CC15 CC22 CC25 CC30 CC45 CC121
%
0
10
20
30
40
50
60
70
80
90
100
norA1199
norAII
wt
B
CC1 CC5 CC7 CC8 CC12 CC15 CC22 CC25 CC30 CC45 CC121
%
0
10
20
30
40
50
60
70
80
90
100
overexpression
wt expression
Figure 3. (A) Distribution of the different MLST associated clonal complexes (CCs) per norA allele of the
different examined S. aureus isolates. (B) The distribution of norA overexpressing strains per associated
MLST-CC.
norA sequence and genetic background
All strains were spa-typed after which associated MLST clonal complexes (CC’s) were de-
termined. Figure 3A shows the distribution of the different norA alleles within the different
clonal lineages. Results show that with a maximum exception of one strain, the different
CC’s all contain only 1 norA allele. Figure 3B shows the distribution of the norA overex-
Chapter 6
102
pressing strains over the different CC’s. From the results, it is clear that norA overexpressing
strains are only found in MLST associated CC’s 5, 30 and 45. Specifically, these strains had
spa-types t002 and t311 (CC5), t012 and t2854 (CC30) and t038 and t740 (CC45).
Discussion
Initial studies have shown that overexpression of the chromosomally encoded efflux pump
NorA leads to resistance to a.o. fluoroquinolones, ethidium bromide and various biocides3.
In several studies mutations in the norA gene and its promoter were presented, which are
suspected to lead to overexpression of norA11, 25, 28, 29, 30. However, most studies describe
incidental findings of these mutations, with often a limited number of investigated strains
or isolates. In this study we investigated a collection of 228 S. aureus strains, for mutations
in the promoter of norA. Results showed that all three described alleles of norA were found
within our collection. Notably, the norA allele was strongly correlated with the genetic
background of S. aureus: i.e. all MLST associated CC30 strains except one contained a norAII
allele, whereas CC45 and CC121 had the norA1199 allele. All other CC’s within the collec-
tion (CC1, 5, 7, 8, 12, 15, 22 and 25), except one exception in CC5, all contained the wt norA
allele. To our knowledge, the norA allele has not been linked to the genetic background of
S. aureus before. However, for example reference strain JCM2413 which was analysed by
Noguchi et al. and shown to contain norAII, belongs to CC30, which is in agreement with
our findings11.
Looking at the norA sequences in more detail, we showed that within our collection, 16
different sequences could be distinguished. These sequences contained several previously
described mutations, such as the T388→A mutation30 and the insertions downstream of
the -10 region in groups D and N31, but also new mutations such as the A→G mutation at
the site of the start of transcription. Notably, the previously reported flqB mutation was not
found in any of the 228 strains28, 32, 33. In spite of the respectable number of studies report-
ing data regarding the sequence of norA and its promoter, only few studies combine this
with data on the actual expression of the norA gene. In our study, we showed that strains
with six norA sequence types demonstrated an increased expression of norA up to maxi-
mally ~80-fold. Both sequence types D and N showed an insert immediately downstream
of the -10 region. Our overexpression data (between 15 and 80-fold) for those groups were
in agreement with those previously reported by DeMarco et al. (4.8–50.6 fold) for strains
with AAT or CAAT insertions downstream of the -10 region27 and by Kosmidis et al. with an
~19-fold increase of expression for strains with an ATCAAT insertion at the same locus31.
Our expression data were however markedly higher than for example the 4–5-fold increase
in expression measured for strain TS69 with an TACAAT insert downstream of the -10 re-
gion11. This is likely due to the difference in technique used for gene expression measure-
ments, but could also be contributed to growth conditions at the time of expression
measurements. As recommended by Kaatz et al., we performed our experiments at mid-
exponential phase34. Sequence types K and L also showed norA overexpression (on aver-
age ~30-fold). Interestingly, the difference between for example group I, which expresses
norA overexpression in Staphylococcus aureus
103
norA at a wt level, and K is only one bp in the entire investigated area: i.e. A→G mutation at
the site of the start of transcription. However, as the strain in group R contained this muta-
tion and expressed norA at a wt level, future studies will have to reveal what the exact
impact of this mutation on norA expression is. norA expression is known to be also regu-
lated by mgrA and norG13, 32, 35. Finally, group P (consisting of only one strain) showed an
increased norA expression of around 13-fold. This strain was very similar to strains in group
O, however the strain in group P contained a.o. a A→G mutation 2 bp upstream of the -10
region. To our knowledge this mutation has not been described before and similar to the
mutation at the transcription start site, future studies will have to determine the impact of
this mutation on the norA expression.
Our study clearly showed that overexpression of norA was associated with sequence
types of all three known norA alleles. But, the overexpressing strains were limited to a few
clonal lineages, and within the MLST associated clonal complexes to a few spa-types (spa-
types between brackets): i.e. 5 (t002 and t311), 30 (t012 and t2854) and 45 (t038 and t740).
These MLST associated clonal complexes are known to be associated with methicillin resis-
tant S. aureus (MRSA)36, and coincidentally, all the overexpressing strains, except for strain
179 in group P, found in our study were found to be resistant to methicillin. This is mostly
in agreement with earlier results from DeMarco et al., showing that the majority of the
clinical isolates with efflux-related resistance in that study were MRSAs37. A potential limita-
tion of our study was that all strains were collected in one geographical region/center
(although spread over a period of three years) and thus a relatively large homogeneity
between the strains in a clonal complex can be expected. Future studies will have to in-
clude strains collected from a larger geographical area.
NorA has long been associated with low-level resistance to hydrophilic fluoroqui-
nolones3. In addition, high-level resistance to fluoroquinolones is caused by mutations in
the genes encoding gyrase and topoisomerase (reviewed in37) and it has been suggested
that low-level norA-mediated resistance predisposes to high-level resistance14. In our
study, all but one strain (strain 179, group P) overexpressing norA showed high-level resis-
tance but also contained known mutations in the genes encoding gyrase and topoisom-
erase leading to this high-level expression. Strain 179 was the only norA overexpressing
strain that was not resistant to fluoroquinoles with a ciprofloxacin MIC of 0.5 mg/L. How-
ever, previous studies demonstrated that strains overexpressing norA showed an increase
in substrate MICs (amongst which fluoroquinolones) between 2 and 16-fold25, 38. As from
our data it cannot be excluded that the ciprofloxacin MIC of strain 179 has been raised
slightly, more work will have to be performed to further clarify the impact of norA overex-
pression on fluoroquinolone MIC. Consequently, future work will also have to confirm
expression data on a protein level.
In conclusion, our study has for the first time indicated that there seems to be a rela-
tion between the genetic background of S. aureus and the norA allele. Analysing 228
MSSA/MRSA strains from different genetic backgrounds revealed 16 different norA se-
quence types related to all three known norA alleles. Within the three norA alleles, six se-
quence types were associated with norA overexpression. Within the norA overexpressing
strains, several novel mutations were found, especially in the -10 promoter region. These
norA overexpressing strains were in this study in 95% found in MRSA strains from distinct
Chapter 6
104
genetic backgrounds. All but one of the overexpressing strains were resistant to the
fluoroquinolone ciprofloxacin, but all of these strains also contained mutations in genes
encoding gyrase and topoisomerase, which are known to lead to fluoroquinolone resis-
tance. Understanding the relationship between the genetic background of S. aureus, norA
evolution, its overexpression and its contribution to resistance to its substrates such as
hydrophilic fluoroquinolones, will ultimately contribute to the control of the emergence of
antimicrobial resistant strains.
norA overexpression in Staphylococcus aureus
105
References
1. Huang J, O’Toole PW, Shen W, Amrine-Madsen H, Jiang X, Lobo N, Palmer LM, Voelker L, Fan F, Gwynn MN,
McDevitt D. Novel chromosomally encoded multidrug efflux transporter MdeA in Staphylococcus aureus. An-
timicrob Agents Chemother 2004;48:909–17.
2. Kaatz GW, McAleese F, Seo SM. Multidrug resistance in Staphylococcus aureus due to overexpression of a novel
multidrug and toxin extrusion (MATE) transport protein. Antimicrob Agents Chemother 2005;49:1857–64.
3. Kaatz GW, Seo SM, Ruble CA. Efflux-mediated fluoroquinolone resistance in Staphylococcus aureus. Antimicrob
Agents Chemother 1993;37:1086–94.
4. Narui K, Noguchi N, Wakasugi K, Sasatsu M. Cloning and characterization of a novel chromosomal drug efflux
gene in Staphylococcus aureus. Biol Pharm Bull 2002;25:1533–6.
5. Truong-Bolduc QC, Dunman PM, Strahilevitz J, Projan SJ, Hooper DC. MgrA is a multiple regulator of two new
efflux pumps in Staphylococcus aureus. J Bacteriol 2005;187:2395–405.
6. Truong-Bolduc QC, Strahilevitz J, Hooper DC. NorC, a new efflux pump regulated by MgrA of Staphylococcus
aureus. Antimicrob Agents Chemother 2006;50:1104–7.
7. Heir E, Sundheim G, Holck AL. The qacG gene on plasmid pST94 confers resistance to quaternary ammonium
compounds in staphylococci isolated from the food industry. J Appl Microbiol 1999;86:378–88.
8. Littlejohn TG, DiBerardino D, Messerotti LJ, Spiers SJ, Skurray RA. Structure and evolution of a family of genes
encoding antiseptic and disinfectant resistance in Staphylococcus aureus. Gene 1991;101:59–66.
9. Tennent JM, Lyon BR, Midgley M, Jones IG, Purewal AS, Skurray RA. Physical and biochemical characterization of
the qacA gene encoding antiseptic and disinfectant resistance in Staphylococcus aureus. J Gen Microbiol
1989;135:1–10.
10. Kaatz GW, Seo SM. Inducible NorA-mediated multidrug resistance in Staphylococcus aureus. Antimicrob Agents
Chemother 1995;39:2650–5.
11. Noguchi N, Okada H, Narui K, Sasatsu M. Comparison of the nucleotide sequence and expression of norA genes
and microbial susceptibility in 21 strains of Staphylococcus aureus. Microb Drug Resist 2004;10:197–203.
12. Paulsen IT, Brown MH, Skurray RA. Proton-dependent multidrug efflux systems. Microbiol Rev 1996;60:575–608.
13. Truong-Bolduc QC, Ding Y, Hooper DC. Posttranslational modification influences the effects of MgrA on norA
expression in Staphylococcus aureus. J Bacteriol 2008;190:7375–81.
14. Markham PN, Neyfakh AA. Inhibition of the multidrug transporter NorA prevents emergence of norfloxacin
resistance in Staphylococcus aureus. Antimicrob Agents Chemother 1996;40:2673–4.
15. Yoshida H, Bogaki M, Nakamura S, Ubukata K, Konno M. Nucleotide sequence and characterization of the
Staphylococcus aureus norA gene, which confers resistance to quinolones. J Bacteriol 1990;172:6942–9.
16. Croes S, Deurenberg RH, Boumans ML, Beisser PS, Neef C, Stobberingh EE. Staphylococcus aureus biofilm forma-
tion at the physiologic glucose concentration depends on the S. aureus lineage. BMC Microbiol 2009;9:229.
17. Donker GA, Deurenberg RH, Driessen C, Sebastian S, Nys S, Stobberingh EE. The population structure of Staphy-
lococcus aureus among general practice patients from the Netherlands. Clin Microbiol Infect 2009;15:137–43.
18. Nulens E, Stobberingh EE, van Dessel H, Sebastian S, van Tiel FH, Beisser PS, Deurenberg RH. Molecular charac-
terization of Staphylococcus aureus bloodstream isolates collected in a Dutch University Hospital between 1999
and 2006. J Clin Microbiol 2008;46:2438–41.
19. Friedrich AW, Witte W, de Lencastre H, Hryniewicz W, Scheres J, Westh H. A European laboratory network for
sequence-based typing of methicillin-resistant Staphylococcus aureus (MRSA) as a communication platform be-
tween human and veterinary medicine--an update on SeqNet.org. 2008; Euro Surveill 13.
20. Strommenger B, Kettlitz C, Weniger T, Harmsen D, Friedrich AW, Witte, W. Assignment of Staphylococcus
isolates to groups by spa typing, SmaI macrorestriction analysis, and multilocus sequence typing. J Clin Micro-
biol 2006;44:2533–40.
Chapter 6
106
21. Nubel U, Roumagnac P, Feldkamp M, Song JH, Ko KS, Huang YC, Coombs G, Ip M, Westh H, Skov R, Struelens
MJ, Goering RV, Strommenger B, Weller A, Witte W, Achtman M. Frequent emergence and limited geographic
dispersal of methicillin-resistant Staphylococcus aureus. Proc Natl Acad Sci U S A 2008;105:14130–5.
22. Ruppitsch W, Indra A, Stoger A, Mayer B, Stadlbauer S, Wewalka G, Allerberger F. Classifying spa types in com-
plexes improves interpretation of typing results for methicillin-resistant Staphylococcus aureus. J Clin Microbiol
2006;44:2442–8.
23. Deurenberg RH, Vink C, Oudhuis GJ, Mooij JE, Driessen C, Coppens G, Craeghs J, de Brauwer E, Lemmen S,
Wagenvoort H, Friedrich AW, Scheres J, Stobberingh EE. Different clonal complexes of methicillin-resistant
Staphylococcus aureus are disseminated in the Euregio Meuse-Rhine region. Antimicrob Agents Chemother
2005;49:4263–71.
24. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of
methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol 2000;38:1008–
15.
25. Couto I, Costa SS, Viveiros M, Martins M, Amaral L. Efflux-mediated response of Staphylococcus aureus exposed
to ethidium bromide. J Antimicrob Chemother 2008;62:504–13.
26. Plaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research
2001;29.
27. DeMarco CE, Cushing LA, Frempong-Manso E, Seo SM, Jaravaza TA, Kaatz GW. Efflux-related resistance to
norfloxacin, dyes, and biocides in bloodstream isolates of Staphylococcus aureus. Antimicrob Agents Chemo-
ther 2007;51:3235–9.
28. Fournier B, Truong-Bolduc QC, Zhang X, Hooper DC. A mutation in the 5’ untranslated region increases stability
of norA mRNA, encoding a multidrug resistance transporter or Staphylococcus aureus. J Bacteriol
2001;183:2367–71.
29. Kaatz GW, Seo SM, Foster TJ. Introduction of a norA promoter region mutation into the chromosome of a
fluoroquinolone-susceptible strain of Staphylococcus aureus using plasmid integration. Antimicrob Agents
Chemother 1999;43:2222–4.
30. Schmitz FJ, Hertel B, Hofmann B, Scheuring S, Verhoef J, Fluit AC, Heinz HP, Kohrer K, Jones ME. Relationship
between mutations in the coding and promoter regions of the norA genes in 42 unrelated clinical isolates of
Staphylococcus aureus and the MICs of norfloxacin for these strains. J Antimicrob Chemother 1998;42:561–3.
31. Kosmidis C, DeMarco CE, Frempong-Manso E, Seo SM, Kaatz GW. In silico genetic correlations of multidrug
efflux pump gene expression in Staphylococcus aureus. Int J Antimicrob Agents 2010;36:222–9.
32. Kaatz GW, Thyagarajan RV, Seo SM. Effect of promoter region mutations and mgrA overexpression on transcrip-
tion of norA, which encodes a Staphylococcus aureus multidrug efflux transporter. Antimicrob Agents Chemo-
ther 2005;49:161–9.
33. Ng EY, Trucksis M, Hooper DC. Quinolone resistance mediated by norA: physiologic characterization and rela-
tionship to flqB, a quinolone resistance locus on the Staphylococcus aureus chromosome. Antimicrob Agents
Chemother 1994;38:1345–55.
34. Kaatz GW, Seo SM. Effect of substrate exposure and other growth condition manipulations on norA expression.
J Antimicrob Chemother 2004;54:364–9.
35. Truong-Bolduc QC, Hooper DC. The transcriptional regulators NorG and MgrA modulate resistance to both
quinolones and beta-lactams in Staphylococcus aureus. J Bacteriol 2007;189:2996–3005.
36. Deurenberg RH, Stobberingh EE. The evolution of Stahylococcus aureus. Infect Genet Evol 2008.
37. Hooper DC. Fluoroquinolone resistance among Gram-positive cocci. Lancet Infect Dis 2002;2:530–8.
38. Huet AA, Raygada JL, Mendiratta K, Seo SM, Kaatz GW. Multi drug efflux pump overexpression in Staphylococ-
cus aureus after single and multiple in vitro exposures to biocides and dyes. Microbiology 2008;151:3144–53.
107
CHAPTER 7
Inhibition of membrane-transporters as a potential approach
against Staphylococcus aureus biofilm is hampered by
adaptation to nutrient availability
Sander Croes1, 2
Petra F.G. Wolffs1
Cees Neef2
Cathrien A. Bruggeman1
Ellen E. Stobberingh1
1 Department of Medical Microbiology, School for Public Health and Primary Care (CAPHRI), Maastricht University
Medical Center, Maastricht, the Netherlands
2 Department of Clinical Pharmacy and Toxicology, Maastricht University Medical Center, Maastricht, the Netherlands
Submitted for publication
Chapter 7
108
Abstract
Biofilm-embedded bacteria are often causative for persistent infections. Recently, inhibi-
tion of efflux pumps was considered as a manner to influence biomass formation of
Staphylococcus aureus. The impact of efflux pump inhibitors (EPIs) was more pronounced
to prevent biofilm formation than to reduce pre-existing mature biomass. The ineffective-
ness of EPIs against the latter might be due to a penetration barrier of EPIs into the biofilm
layers.
We exposed different clonal lineages to EPIs in the presence of 0.1% or 1% glucose to
determine the effect on mature biofilm and biomass prevention. Our data confirm that at
0.1% glucose the EPI thioridazine effectively prevented biomass formation of strains par-
ticularly associated with multilocus sequence typing (MLST) clonal complex (CC)8, while at
1% glucose comparable results were obtained with strains associated with MLST CC30 and
CC45. Reserpine was inferior to thioridazine in prevention of biomass accumulation. Re-
markably, MLST CC8-associated strains elevated biomass production upon exposure to
both EPIs at 1% glucose. We presume that EPIs have a non-specific affinity for a variety of
transporters, including nutrient-importers. Blocking these importers at 0.1% glucose would
result in suppression of biomass formation, especially among strains with a high carbohy-
drate uptake capacity. Conversion of abundantly imported amounts of carbohydrates, at
1% glucose, to acetate, would theoretically result in intracellular acidification. Concerning
strains associated with MLST CC8 we hypothesized that blocking the efflux of acidic me-
tabolites promotes – instead of prevents – biomass formation, while influx of glucose is not
much affected.
Inhibition of membrane transporters during Staphylococcus aureus biofilm growth
109
Introduction
The native functions of trans-membrane transporters, such as efflux pumps, of bacteria like
Staphylococcus aureus have not been fully unravelled yet. For multi drug resistance (MDR)
pumps, extrusion of excessive amounts of (toxic) substances as part of intracellular waste
management, is probably the most likely one1, 2. These substances are often acidic by-
products, originated from decomposition of metabolic pathways3, 4. Another function
includes the protection against toxic substances from the environment, which were in-
fluxed or diffused across the permeable cell wall. Besides the efflux mechanisms, trans-
membrane transporters are also necessary to facilitate import of essential nutrients as
glucose and amino acids3, 5, 6 or to maintain electrolyte and pH homeostasis 2–4, 7.
The expression of various trans-membrane transporters is positively (AbcA) or nega-
tively (NorA, NorC and Tet38) regulated by the multiple gene regulator (mgrA)8–11, except
that of the NorB efflux pump, which is repressed by phosphorylated mgrA11. Besides, mgrA
is involved in the repression of biofilm formation12. On one hand, this is the resultant of
mgrA-induced upregulation of the accessory gene regulator (agr)12, consequently ending
up in (i) hindering microbial surface components recognizing adhesive matrix molecules
(MSCRAMM) expression and (ii) improving the release of detachment factors or surfactant-
like molecules such as phenol-soluble modulins (PSM) and hla-encoded α-toxin (α-
hemolysin)13. On the other hand, mgrA inhibits cidA-related cell lysis triggered extracellular
DNA (eDNA) release and stimulates the repression of autolysis by lrgAB12.
From several points of view it has been postulated that efflux pumps are up-regulated
during the transition from planktonic cells into sessile encapsulated ones1, 14. First, the
principle behind the well-known (remaining) recalcitrance of biofilm to normal concentra-
tion of antibiotics might be partly attributed to enhanced extrusion mechanisms1, 15. Sec-
ond, due to the cramped conditions in a biofilm, cells inside a biofilm need to exploit an
efficient efflux system for endogenous waste products2. Third, cell autolysis and thus eDNA
release is affected by AbcA transporters16. Another ATP-binding cassette (ABC) transporter,
the graRS-regulated vraFG efflux pump, is required for citrate-stimulated cell-to-cell inter-
actions17. Finally, involvement of transporters in quorum sensing related extrusion of sig-
nalling molecules, also referred as autoinducers, has also been mentioned2, 15, 18.
Although efflux pumps might play a vital role during biofilm development, their sug-
gested overexpression does not fit with the mgrA repressor function of biomass formation
and the opposite regulation on different efflux pumps, depending on the phosphorylation
state of mgrA. Presumably, other regulators, such as arlRS, sigB, rsbU, graRS and norG, con-
tribute in a crucial manner to the expression of efflux pumps10, 11, 15, 17. Nevertheless, it has
been recently demonstrated that efflux pump inhibitors (EPI) were effective in the preven-
tion of biomass development1. However, so far, EPIs were only tested against a limited
number of strains and the effects of EPIs on mature S. aureus biofilms were unexplored.
Therefore, we conducted a study in which we exposed mature biofilm of methicillin-
susceptible S. aureus (MSSA) (n=9) and methicillin-resistant S. aureus (MRSA) (n=15) of
Chapter 7
110
different clonal lineages to the EPIs thioridazine and reserpine. In addition, we assessed the
capacity of the EPIs to prevent biomass formation of the same isolates.
Materials and Methods
Bacterial strains
As part of an ongoing surveillance of S. aureus nasal carriers, nine MSSA and fifteen MRSA
strains from individual patients in the Maastricht University Medical Center, a tertiary 715-
bed hospital, were evaluated (Table 1). The isolates were randomly selected from a group
of MSSA and MRSA with distinct globally disseminated genetic backgrounds. The selected
isolates were associated with multilocus sequence typing (MLST) clonal complex (CC)8,
CC22, CC30 and CC45.
Characterization of the genetic background
Real-time amplification of the spa-locus, followed by sequencing, was performed as de-
scribed earlier19. The spa-types were assigned through the Ridom SpaServer
(http://spaserver.ridom.de) and clustered into spa-CCs using the algorithm based upon
repeat pattern (BURP) with Ridom StaphType 1.5 using default settings20. As spa-
typing/BURP yields results consistent with typing outcomes obtained by MLST20, 21, the
associated MLST CCs were allocated through the Ridom SpaServer. To confirm the associa-
tion between MLST and spa typing, in combination with BURP, MLST was performed on
one isolate of each major spa type or associated MLST CC, as described previously19, 22.
Susceptibility testing efflux pump inhibitors
The susceptibility of the strains to the EPIs was tested using a micro-dilution technique23. In
the biofilm experiments, the concentrations of EPIs used were between one-quarter and
one-half the MICs in planktonic cultures. Thioridazine and reserpine (Sigma Aldrich,
Zwijndrecht, the Netherlands) were used as EPIs24–26. Reserpine is often used as benchmark
compound during the development of novel EPIs15, 27, 28. The highest final concentration of
organic solvent for the EPIs, dimethyl sulphoxide (DMSO), which caused no inhibition of
bacterial growth was <1% v/v.
Biofilm formation
To find out the effect of EPIs on the destruction of mature biofilms, the S. aureus strains
were allowed to establish biofilms during 24 h in 96-well flat-bottomed non-tissue culture
treated polystyrene microtiter plates (Greiner Bio-One, Frickenhausen, Germany) at 37°C
on a rocking platform at 25 oscillations min-1. Individual wells were filled with 100 L of an
overnight culture (108 CFU/mL in Trypticase Soy Broth (TSB) without dextrose) (Becton
Dickinson, Le Pont de Claix, France), and supplemented with 0.1% or 1% glucose. After 24
h biomass formation, growth medium with planktonic cells was discarded and replaced by
fresh broth containing EPIs at ¼ - ½ × planktonic MIC, except for controls, where medium
Inhibition of membrane transporters during Staphylococcus aureus biofilm growth
111
and/or organic solvent (DMSO) were added only. The plates were incubated for an addi-
tional 24 h. Subsequently, the wells were washed three times with 200 L NaCl 0.9%, and
the amount of biomass was quantified.
Table 1. Overview of S. aureus strains included in this study.
S. aureus
strain
associated
MLST CC
spa type MSSA (S) or
MRSA (R)
mecA
BF82 8 t008 R +
BF106 8 t052 R +
BF109 8 t052 R +
BF110 8 t052 R +
BF111 8 t052 R +
BF143 8 t008 R +
BF144 8 t008 R +
BF11 22 t223 R +
BF55 22 t005 S -
BF151 22 t223 R +
BF153 22 t223 R +
BF236 22 t1433 S -
BF237 22 t005 S -
BF238 22 t005 S -
BF244 22 t005 S -
BF87 30 t012 R +
BF88 30 t012 R +
BF246 30 t483 S -
BF254 30 t021 S -
BF92 45 t445 S -
BF94 45 t038 R +
BF98 45 t038 R +
BF256 45 t230 S -
BF265 45 t772 R +
In order to examine prevention of biomass formation by the EPIs, the experiments were
carried out by adding the EPIs from onset to the growth medium. After 24 h of biomass
formation in the presence of EPIs, planktonic cells were removed and the amount of bio-
mass was determined.
Biomass formation was quantified using the crystal violet adherence assay19 and per-
formed in six fold. Influence of EPIs on biofilm formation was calculated as follows:
100%
A
AA
control
590
DMSO
590
DMSO EPI
590 ×
⎟
⎟
⎠
⎞
⎜
⎜
⎝
⎛−
+
Chapter 7
112
Statistical analysis
SPSS version 16.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. After verify-
ing that the assumption of normality was met, a paired two-tailed sampled t test for the
independent experiments was used. P < 0.05 was considered statistically significant.
Results
Prevention of biomass formation
Biofilm formation was prevented when S. aureus strains associated with MLST CC8 were
grown in the presence of 0.1% glucose plus thioridazine (0–24 h) from onset. Similar results
were obtained with reserpine (Figure 1). However, at 1% glucose the opposite was noticed
with both compounds separately, i.e. enhanced biomass formation compared to control
(Figure 1 and 2A).
Influence of EPIs on biofilm formation (%)
-100
-80
-60
-40
-20
0
20
40
60
80
100
BF82
BF144
BF143
BF110
BF111
BF109
BF106
0.1 %
0-24h
(T)
0.1 %
0-24h
(R)
1 %
0-24h
(R)
1 %
0-24h
(T)
Figure 1. Prevention of biomass formation by strains associated with MLST CC8 upon exposure to the efflux
pump inhibitors thioridazine (T) and reserpine (R) at 0.1% and 1% glucose.
In addition, S. aureus strains from other clonal lineages were tested. Both at 0.1% and 1%
glucose concentration, reserpine exposure from 0–24 h did not prevent biomass formation
by strains associated with MLST CC22, CC30 and CC45. Moreover, it promoted biomass
formation at 1% glucose (CC22 and CC45). In contrast to strains associated with MLST CC8,
Inhibition of membrane transporters during Staphylococcus aureus biofilm growth
113
thioridazine (0–24 h) inhibited biomass formation similarly (CC45) or slightly more (CC30
and CC22) at a glucose concentration of 1% instead of at 0.1% (Figure 2B, C and D).
Influence of EPIs on biofilm formation (%)
-60
-40
-20
0
20
40
60
A590
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
Thioridazine
Reserpine
Influence of EPIs on biofilm formation (%)
-60
-40
-20
0
20
40
60
A590
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
Thioridazine
Reserpine
Influence of EPIs on biofilm formation (%)
-60
-40
-20
0
20
40
60
A590
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
Thioridazine
Reserpine
Influence of EPIs on biofilm formation (%)
-60
-40
-20
0
20
40
60
A590
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
Thioridazine
Reserpine
AB
CD
0.1 %
0-24h
0-24h
1 %
0-24h
0-24h
1 %
24-48h
0-48h
0.1 %
24-48h
0-48h
glucose
EPI
A590
0.1 %
0-24h
0-24h
1 %
0-24h
0-24h
1 %
24-48h
0-48h
0.1 %
24-48h
0-48h
glucose
EPI
A590
0.1 %
0-24h
0-24h
1 %
0-24h
0-24h
1 %
24-48h
0-48h
0.1 %
24-48h
0-48h
glucose
EPI
A590
0.1 %
0-24h
0-24h
1 %
0-24h
0-24h
1 %
24-48h
0-48h
0.1 %
24-48h
0-48h
glucose
EPI
A590
**
**
**
*
**
**
***
*
*
**
** **
*
**
Figure 2. Influence of thioridazine and reserpine on biofilm formation by S. aureus strains associated with
MLST (A) CC8, (B) CC22, (C) CC30 and (D) CC45, displayed as bar plots. Indicated above each bar plot is the
percentage of glucose present in the growth medium, the period of exposure to the efflux pump inhibitors
(EPIs) and the time frame of biomass formation (A590). EPIs were added from onset (0–24h) when prevention
of biomass formation was examined, while exposure started later on (24–48h) during monitoring of mature
biofilm destruction. The A590 values of the controls in the absence of EPIs and/or solvents, which are directly
proportional to the amount of biomass produced, are also shown (line plots with symbols: •). Asterisks denote
statistically significant difference (**) P < 0.01, (*) P < 0.05, as determined by a paired two-tailed t-test for the
independent experiments).
Chapter 7
114
Destruction of existing (mature) biofilm matrix
Addition of reserpine during 24–48 h to a 24 h pre-developed biofilm did not reduce the
amount of biomass produced, but augmented biomass formation of several strains, inde-
pendent of the tested clonal lineages and especially at 0.1% glucose. Compared to reser-
pine, thioridazine was somewhat more successful in destruction of mature biofilms.
Against mature biofilms of strains associated with MLST CC8, thioridazine added during
24–48 h achieved a reduction (~ 12%) at 0.1%, but not at 1% glucose (Figure 2A).
However, this reduction in biomass was far beyond the level achieved by thioridazine
when testing prevention of biomass accumulation (~ 39%). Thioridazine did not have the
capability to destruct mature biofilms at 0.1% glucose of the other clonal lineages (associ-
ated with MLST CC22, CC30 and CC45). However, in contrast to our observations with
strains associated with CC8, the other clonal lineages showed more pronounced reduc-
tions in biomass at 1% glucose (Figure 2B, C and D).
The amount of biomass formed by strains associated with MLST CC8 increased more
quickly at 0.1% glucose compared to the other clonal lineages, as could be deduced from
the higher A590-values: 0.78 vs. an average of 0.46 during 0–48 h (Figure 2). At 1% glucose
within 24 h, strains associated with CC30 and CC45 demonstrated a considerable increase
in the amount of biomass produced (A590-values of 3.52 and 2.03 after 24 h, respectively).
After 48 h the amount of biomass produced by strains associated with MLST CC22 was
(still) the lowest (A590-value of 1.97 vs. an average of 2.79). Linked to the impression that
biofilm maturation was the fastest for CC8 and the slowest for CC22, it was noticeable that
thioridazine was able to prevent biomass formation at 0.1% glucose of the former and
could destruct pre-formed biomass at 1% glucose of the latter.
Discussion
Various serious persistent infections have been associated with biofilm embedded micro-
organisms attached to indwelling devices. Eradication of biofilm by antibiotics is difficult
and leads often to surgical removal of the foreign body. Attempts to prevent biofilm for-
mation, such as by anti-adhesive coatings or catheter lock solutions are under broad-
scaled investigation29, 30. Still, under particular circumstances biofilm formation could so far
not be prevented. Therefore, an innovative concept for the development of a new class of
agents to prevent biomass formation and eradicate existing biofilm is of paramount im-
portance.
This study demonstrated that the EPIs thioridazine and reserpine did not fully meet this
criterion, especially regarding the inefficient destruction of mature biofilms. We observed
that the glucose availability was important for the effects of EPIs on the prevention of
biomass formation. At 0.1% glucose thioridazine was only able to reduce biomass forma-
tion of strains associated with MLST CC8, while at 1% glucose it only partly diminished
biomass formation of the other clonal lineages CC22, CC30 and CC45. Differences in the
genetic background may have accounted for these divergent results. Taken together,
Inhibition of membrane transporters during Staphylococcus aureus biofilm growth
115
thioridazine prevented biomass formation more effectively than reserpine, independent of
the glucose availability.
Based on the assumption that various efflux pumps might be overexpressed during
the biofilm mode of growth, EPIs were put forward as potential anti-biofilm agents1. In-
deed, we observed that both thioridazine and reserpine were able to prevent biomass
formation at 0.1% glucose of strains associated with MLST CC8, as shown earlier for S.
aureus 8325–4 (spa-type t211, MLST CC8)1. However, the opposite was observed when the
glucose concentration was raised to 1%, to simulate circumstances with large amounts of
nutrients. The inability to prevent biomass formation at 1% glucose, with even stimulation
of biomass formation as a consequence, suggest that glucose availability and/or metabo-
lism influences the outcome. Based on data from the literature we propose the following
model for biofilm-associated pathways (Figure 3), which enabled us to obtain premises to
support our observations.
When rapidly catabolizable carbon sources are abundantly present (as is in the pres-
ence of 1% glucose), it is known that the tricarboxylic acid (TCA) cycle is repressed31. As a
consequence this is followed by the accumulation of acetate and/or lactate. As proposed
in Figure 3, increasing concentrations of acetate and lactate enhance (by intracellular pH
lowering) the catabolite control protein A (ccpA) triggered polysaccharide intracellular
adhesin (PIA) formation and cidA related eDNA release3. Thus, blocking the efflux of acetate
might stimulate biofilm formation of strains associated with MLST CC8, as observed at 1%
glucose concentration. The reduction in biomass formation by EPIs at a lower glucose (~
0.1 – 0.3%) concentration has previously been attributed to the accumulation of waste
products1, resulting in toxification. However, this does not clarify our results at 1% glucose.
Another explanation for the observations at 0.1% might be that EPIs have affinity for other
membrane-based transporters, besides efflux pumps. Inhibition of glucose-influx by EPIs
might prohibit biomass accumulation. A deficiency in intracellular amount of glucose
would lead to TCA cycle activation, enhancement of TCA cycle intermediates c.q. metabo-
lites and consequently inhibition of icaABCD and upregulation of the mgrA biofilm-
repressor function12 via activated graRS (Figure 3). Although graRS might also upregulate
rot32, which acts as a negative transcription regulator of α-toxin and protease expression
and as a positive regulator on certain MSCRAMMs33, we expect that graRS exerts a stronger
effect on mgrA than rot. This expectation is based on a transcriptome analysis32 and a de-
scribed negative feedback on rot via mgrA and agr34 and is in agreement with the pre-
sented data as well. We presume that due to an excessive amount of glucose at 1%, more
competition exist for the transporter, resulting in an incomplete inhibition of the glucose
importer function by the EPI.
Furthermore, we observed that the EPIs in the presence of 0.1% glucose were less ef-
fective in destruction of pre-existing established biofilms, compared to prevention of bio-
mass production. This could be clarified by different assumptions. First, the recalcitrance to
antibiotics is explained by a penetration barrier caused by the densely adherent biofilm
matrix35, consisting of proteins, eDNA and/or PIA. It is plausible that such a diffusion prob-
lem also exist for EPIs, resulting in subinhibitory concentrations locally present inside the
biofilm. Such concentrations are then below the minimum biofilm eradication concentra-
tion (MBEC). Subinhibitory concentrations of certain antibiotics and probably also other
Chapter 7
116
compounds were able to augment biomass formation of all different types of bacteria36, 37.
Additionally, it has been shown that after a shift to (semi)-anaerobic conditions, the
amount of lactate accumulates since the conversion of pyruvate into acetyl-CoA requires
oxygen31. As shown in Figure 3, (partially) blocking lactate extrusion would improve acidifi-
cation leading to increased ccpA expression and thus biomass expansion. Cells inside ma-
ture biofilms surrounded by a nutrient depleted environment might also start to produce
autoinducing peptides (AIP), as part of quorum sensing intercellular communication2.
Reducing the extrusion of AIP by EPIs would prohibit dispersal and result in the conserva-
tion of biomass, with consequently more biomass compared to control.
Figure 3. Simplified overview of (postulated) biofilm related pathways in S. aureus. It is clearly noticeable
that the multiple gene regulator mgrA plays a central role as a regulator of transmembrane transporters,
capsular polysaccharide formation and biomass formation. Abbreviations – agr: accessory gene regulator;
ccpA: catabolite control protein A; ECP: extracellular proteases; eDNA: extracellular DNA; MSCRAMMs:
microbial surface components recognizing adhesive matrix molecules; PIA: polysaccharide intracellular
adhesin; PSM: phenol-soluble modulin; sarA: staphylococcal accessory regulator; spoVG: stage V sporulation
protein G; rot: repressor of toxins.
Interestingly, at 1% glucose, differences between prevention of biofilm formation and
destruction of established biofilms by EPIs were also observed. Compared to the elevated
Inhibition of membrane transporters during Staphylococcus aureus biofilm growth
117
biomass forming capacity of strains associated with MLST CC8 provoked by the EPIs during
the prevention period (0–24 h), the inducible effect of EPIs (24–48 h) on mature biofilms
was less pronounced (Figure 2A). Probably, after 24h of biomass formation in the presence
of high glucose concentration, the cells are trying to counteract the produced large
amounts of lactic acid, acetic acid and formic acid by upregulating urease activity (Figure
3). This would result in ammonium and/or ammonia formation8, 38. Excess of ammonia is
normally expelled since it is toxic for bacterial cells. Thus, blocking the extrusion of ammo-
nia would break down biomass. In addition, at the post-exponential biofilm phase, (intra-
cellular) glucose is almost completely consumed and oxygen becomes limited in the dee-
per layers of the biofilm39, 40. As a survival strategy, (some) TCA cycle enzymes could get
upregulated due to oxygen limitation and/or a too-high acidification to permit better
metabolism and/or consumption of excreted fermentation products7, 17, 31, 39. Thus blocking
the influx of previously excreted fermentation products like acetate31 would reduce the
intracellular acetate concentration more quickly in order to create more TCA intermedia-
tes, and consequently depletes biomass.
The influence of thioridazine and reserpine on biomass was slightly different for strains
belonging to the clonal lineages associated with MLST CC22, CC30 and CC45, which were
not previously tested1. These variations might be attributed to other biomass-related
metabolic changes or different expression levels of membrane-based transporters. We
confirmed that the amount of biomass produced during a certain time period depends on
the genetic backgrounds19, indicating that nutrient import capacities are variable as also
the rate of metabolic alterations. However, the effects of EPIs on biomass of strains associ-
ated with the related MLST lineages CC30 and CC4541 were practically similar.
In general, the glucose and oxygen availability within microbial biofilm communities is
changing over time, which concomitantly modifies the TCA cycle activity of the embedded
bacteria. As a result, based on fluctuations in indirect mgrA stimulation by TCA cycle inter-
mediates17, 32, the expression of efflux pumps and other trans-membrane transporters of
these bacteria changes. Therefore, it was not surprising that inhibition of trans-membrane
transporters by EPIs as a tool to hinder biofilm formation was only effective under certain
circumstances, depending on the environmental glucose availability and the already pre-
existing amount of biomass. Since the latter differed per clonal lineage and variations
among their trans-membrane transporters are likely, the genetic background of the strain
is of importance in whether an EPI could be a valuable tool to prevent biomass formation
or to eradicate mature biofilm.
In summary, we demonstrated with in vitro experiments that at 0.1% glucose the EPIs
thioridazine and reserpine were predominantly able to prevent biomass accumulation of
strains associated with MLST CC8, while at 1% glucose almost the same was achieved with
thioridazine only for strains associated with MLST CC30 and CC45. Destruction of mature
biofilms was in general ineffective. Only biofilm produced by strains associated with MLST
CC22 were slightly affected. Based on biofilm-related pathways described in the literature,
we discussed our findings regarding the inconsistent and inefficient anti S. aureus biofilm
characteristics of EPIs.
Chapter 7
118
References
1. Kvist M, Hancock V, Klemm P. Inactivation of efflux pumps abolishes bacterial biofilm formation. Appl Environ
Microbiol 2008;74:7376–82.
2. Martinez JL, Sanchez MB, Martinez-Solano L, et al. Functional role of bacterial multidrug efflux pumps in micro-
bial natural ecosystems. FEMS Microbiol Rev 2009;33:430–49.
3. Seidl K, Muller S, Francois P, et al. Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus.
BMC Microbiol 2009;9:95.
4. Cotter PD, Hill C. Surviving the acid test: responses of gram-positive bacteria to low pH. Microbiol Mol Biol Rev
2003;67:429–53, table of contents.
5. Zhu Y, Weiss EC, Otto M, Fey PD, Smeltzer MS, Somerville GA. Staphylococcus aureus biofilm metabolism and
the influence of arginine on polysaccharide intercellular adhesin synthesis, biofilm formation, and pathogene-
sis. Infect Immun 2007;75:4219–26.
6. Law CJ, Maloney PC, Wang DN. Ins and outs of major facilitator superfamily antiporters. Annu Rev Microbiol
2008;62:289–305.
7. Fuchs S, Pane-Farre J, Kohler C, Hecker M, Engelmann S. Anaerobic gene expression in Staphylococcus aureus. J
Bacteriol 2007;189:4275–89.
8. Luong TT, Dunman PM, Murphy E, Projan SJ, Lee CY. Transcription Profiling of the mgrA Regulon in Staphylo-
coccus aureus. J Bacteriol 2006;188:1899–910.
9. Truong-Bolduc QC, Strahilevitz J, Hooper DC. NorC, a new efflux pump regulated by MgrA of Staphylococcus
aureus. Antimicrob Agents Chemother 2006;50:1104–7.
10. Truong-Bolduc QC, Hooper DC. The transcriptional regulators NorG and MgrA modulate resistance to both
quinolones and beta-lactams in Staphylococcus aureus. J Bacteriol 2007;189:2996–3005.
11. Truong-Bolduc QC, Hooper DC. Phosphorylation of MgrA and its effect on expression of the NorA and NorB
efflux pumps of Staphylococcus aureus. J Bacteriol 2010;192:2525–34.
12. Trotonda MP, Tamber S, Memmi G, Cheung AL. MgrA represses biofilm formation in Staphylococcus aureus.
Infect Immun 2008;76:5645–54.
13. Ingavale S, van Wamel W, Luong TT, Lee CY, Cheung AL. Rat/MgrA, a regulator of autolysis, is a regulator of
virulence genes in Staphylococcus aureus. Infect Immun 2005;73:1423–31.
14. Liu Y, Yang L, Molin S. Synergistic activities of an efflux pump inhibitor and iron chelators against Pseudomonas
aeruginosa growth and biofilm formation. Antimicrob Agents Chemother 2010;54:3960–3.
15. Li XZ, Nikaido H. Efflux-mediated drug resistance in bacteria: an update. Drugs 2009;69:1555–623.
16. Schrader-Fischer G, Berger-Bachi B. The AbcA transporter of Staphylococcus aureus affects cell autolysis. Antim-
icrob Agents Chemother 2001;45:407–12.
17. Shanks RM, Meehl MA, Brothers KM, et al. Genetic evidence for an alternative citrate-dependent biofilm forma-
tion pathway in Staphylococcus aureus that is dependent on fibronectin binding proteins and the GraRS two-
component regulatory system. Infect Immun 2008;76:2469–77.
18. Brackman G, Cos P, Maes L, Nelis HJ, Coenye T. Quorum sensing inhibitors increase the susceptibility of bacte-
rial biofilms to antibiotics in vitro and in vivo. Antimicrob Agents Chemother 2011; 55:2655-61.
19. Croes S, Deurenberg RH, Boumans ML, Beisser PS, Neef C, Stobberingh EE. Staphylococcus aureus biofilm forma-
tion at the physiologic glucose concentration depends on the S. aureus lineage. BMC Microbiol 2009;9:229.
20. Strommenger B, Kettlitz C, Weniger T, Harmsen D, Friedrich AW, Witte W. Assignment of Staphylococcus
isolates to groups by spa typing, SmaI macrorestriction analysis, and multilocus sequence typing. J Clin Micro-
biol 2006;44:2533–40.
21. Ruppitsch W, Indra A, Stoger A, et al. Classifying spa types in complexes improves interpretation of typing
results for methicillin-resistant Staphylococcus aureus. J Clin Microbiol 2006;44:2442–8.
Inhibition of membrane transporters during Staphylococcus aureus biofilm growth
119
22. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of
methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol 2000;38:1008–
15.
23. Clinical and Laboratory Standards Institute. M100-S19. Performance standards for antimicrobial susceptibility
testing. CLSI, Wayne, PA 2009.
24. Couto I, Costa SS, Viveiros M, Martins M, Amaral L. Efflux-mediated response of Staphylococcus aureus exposed
to ethidium bromide. J Antimicrob Chemother 2008;62:504–13.
25. Kaatz GW, Moudgal VV, Seo SM, Kristiansen JE. Phenothiazines and thioxanthenes inhibit multidrug efflux
pump activity in Staphylococcus aureus. Antimicrob Agents Chemother 2003;47:719–26.
26. Hendricks O, Butterworth TS, Kristiansen JE. The in-vitro antimicrobial effect of non-antibiotics and putative
inhibitors of efflux pumps on Pseudomonas aeruginosa and Staphylococcus aureus. Int J Antimicrob Agents
2003;22:262–4.
27. Frempong-Manso E, Raygada JL, DeMarco CE, Seo SM, Kaatz GW. Inability of a reserpine-based screen to
identify strains overexpressing efflux pump genes in clinical isolates of Staphylococcus aureus. Int J Antimicrob
Agents 2009;33:360–3.
28. Brincat JP, Carosati E, Sabatini S, et al. Discovery of novel inhibitors of the NorA multidrug transporter of Staphy-
lococcus aureus. J Med Chem 2011;54:354–65.
29. Walz JM, Memtsoudis SG, O. Heard S. Prevention of central venous catheter bloodstream infections. J Intensive
Care Med 2009:1–8.
30. Casey AL, Mermel LA, Nightingale P, Elliott TS. Antimicrobial central venous catheters in adults: a systematic
review and meta-analysis. Lancet Infect Dis 2008;8:763–76.
31. Somerville GA, Said-Salim B, Wickman JM, Raffel SJ, Kreiswirth BN, Musser JM. Correlation of acetate catabolism
and growth yield in Staphylococcus aureus: implications for host-pathogen interactions. Infect Immun
2003;71:4724–32.
32. Herbert S, Bera A, Nerz C, et al. Molecular basis of resistance to muramidase and cationic antimicrobial peptide
activity of lysozyme in staphylococci. PLoS Pathog 2007;3:981–94.
33. Li D, Cheung A. Repression of hla by rot is dependent on sae in Staphylococcus aureus. Infect Immun
2008;76:1068–75.
34. Hsieh HY, Tseng CW, Stewart GC. Regulation of Rot expression in Staphylococcus aureus. J Bacteriol
2008;190:546–54.
35. Singh R, Ray P, Das A, Sharma M. Penetration of antibiotics through Staphylococcus aureus and Staphylococcus
epidermidis biofilms. J Antimicrob Chemother 2010;65:1955–8.
36. Wang Q, Sun FJ, Liu Y, Xiong LR, Xie LL, Xia PY. Enhancement of biofilm formation by subinhibitory concentra-
tions of macrolides in icaADBC-positive and -negative clinical isolates of Staphylococcus epidermidis. Antimicrob
Agents Chemother 2010;54:2707–11.
37. O’Toole GA, Stewart PS. Biofilms strike back. Nat Biotechnol 2005;23:1378–9.
38. Resch A, Rosenstein R, Nerz C, Gotz F. Differential gene expression profiling of Staphylococcus aureus cultivated
under biofilm and planktonic conditions. Appl Environ Microbiol 2005;71:2663–76.
39. Gaupp R, Schlag S, Liebeke M, Lalk M, Gotz F. Advantage of upregulation of succinate dehydrogenase in
Staphylococcus aureus biofilms. J Bacteriol 2010;192:2385–94.
40. Leibig M, Liebeke M, Mader D, Lalk M, Peschel A, Gotz F. Pyruvate formate lyase acts as a formate supplier for
metabolic processes under anaerobiosis in Staphylococcus au reus. J Bacteriol 2011;193:952–62.
41. Feil EJ, Cooper JE, Grundmann H, et al. How clonal is Staphylococcus aureus? J Bacteriol 2003;185:3307–16.
121
CHAPTER 8
Diminished in vitro antibacterial activity of oxacillin against
clinical isolates of borderline oxacillin resistant Staphylococcus
aureus
Sander Croes1, 2
Patrick S. Beisser1
Peter H. Terporten1
Cees Neef2
Ruud H. Deurenberg1
Ellen E. Stobberingh1
1 Department of Medical Microbiology, Maastricht University Medical Center, Maastricht, the Netherlands
2 Department of Clinical Pharmacy and Toxicology, Maastricht University Medical Center, Maastricht, the Netherlands
Clinical Microbiology and Infection. 2010; 16(7): 979–85
Chapter 8
122
Abstract
Since it is unknown whether β-lactam antimicrobial agents can be used effectively against
borderline oxacillin-resistant Staphylococcus aureus (BORSA) with oxacillin MIC ≥ 4 mg/L,
the in vitro bactericidal activity and pharmacodynamic effect of oxacillin against clinical
BORSA isolates was evaluated. Time-kill experiments with oxacillin were performed and
compared with those of vancomycin, daptomycin and linezolid against BORSA with oxacil-
lin MIC ≥ 4 mg/L and BORSA with oxacillin MIC ≤ 2 mg/L. Furthermore, the effect of β-
lactamase production and plasmid profile analysis were used to clarify responses to oxacil-
lin.
The oxacillin killing activity was attenuated against BORSA compared to ATCC 29213,
since the pharmacodynamic parameters revealed that the potency of oxacillin was mark-
edly reduced (approximately 10×) against BORSA with oxacillin MIC ≥ 4 mg/L. pBORa53-
like plasmid containing BORSA with oxacillin MIC ≤ 2 mg/L showed markedly more re-
growth.
In conclusion, oxacillin displayed non-effective eradication of either (i) BORSA that pos-
sesses oxacillin MIC ≥ 4 mg/L or (ii) β-lactamase hyperproducing BORSA (MIC ≤ 2 mg/L).
Further investigation into β-lactam dosing strategies against different BORSA strains is
warranted in order to avoid putative therapy failure.
Antimicrobial activity of oxacillin, vancomycin, linezolid and daptomycin against BORSA
123
Introduction
In addition to methicillin-sensitive (MSSA) and -resistant S. aureus (MRSA), borderline ox-
acillin-resistant S. aureus (BORSA) have been described. BORSA strains exhibit oxacillin MIC
values enclosing the European Committee on Antimicrobial Susceptibility Testing (EU-
CAST) oxacillin break-point of >2 mg/L, since BORSA strains with oxacillin MIC below or
above the break-point have been described1, 2. BORSA strains lack the MRSA-specific mecA
gene on the Staphylococcal Cassette Chromosome mec (SCCmec), and, consequently, do
not express the low-affinity penicillin-binding protein (PBP)2a or 2’. The borderline pheno-
type has been attributed to (i) the hyperproduction of blaZ-encoded penicillinase and/or
(ii) the production of an inducible, plasmid-mediated, membrane-bound methicillinase2–5
and/or (iii) different modifications in the PBPs 1, 2 and 4 genes, due to spontaneous amino
acid substitutions in the transpeptidase domain2, 6, 7. Unfortunately, a single trait that dif-
ferentiates BORSA strains from susceptible or resistant S. aureus isolates has not yet been
identified. Outbreaks of BORSA infections were reported at an estimated incidence of 5%8,
9. Treatment of early experimental endocarditis and in vitro data suggest efficacy of β-
lactamase-resistant penicillins against BORSA strains with oxacillin MIC of 2 mg/L by en-
hancement of the dosage10, 11. Whether BORSA with higher oxacillin MIC (≥ 4 mg/L) can be
treated effectively with β-lactamase-resistant penicillins is unknown.
The aim of the present study was to examine the antibacterial activity of oxacillin com-
pared to vancomycin, daptomycin and linezolid, against three mecA-negative BORSA iso-
lates, M002, M008 and M015, with oxacillin MIC ≥ 4 mg/L and compared with two BORSA,
M007 and VU94, with oxacillin MIC ≤ 2 mg/L, using time-kill analysis.
Materials and methods
Bacterial strains
S. aureus ATCC 29213 and VU94 were used as MSSA and BORSA reference strain, respec-
tively4, 12. BORSA M015, which was investigated in more detail, was a clinical isolate from a
patient admitted to the Maastricht University Medical Center. Fourteen other BORSA iso-
lates, including M002, M007 and M008, were isolates from general practice patients.
VU94 and M007 were BORSA with oxacillin MIC ≤ 2 mg/L and M002, M008 and M015
were BORSA with oxacillin MIC ≥ 4 mg/L. The S. aureus protein A (spa) types were t3033,
t078, t127, t002 and t091, respectively, associated with multilocus sequence typing (MLST)
clonal complexes (CC)25, CC25, CC1, CC5 and CC7. The remaining eleven strains were
subjected only to susceptibility testing, using the Phoenix system as well as a microdilution
technique. All BORSA strains were tested positive for the S. aureus-specific femA gene and
negative for the MRSA-specific mecA gene13. ATCC 29213 and 25923 served as positive and
negative β-lactamase producing controls, respectively14, 15.
Chapter 8
124
Antibiotics
Daptomycin and linezolid were kindly supplied by the manufacturers (Novartis, Basel,
Switzerland and Pfizer, Groton, CT, respectively). Oxacillin and vancomycin were purchased
(Sigma-Aldrich, Zwijndrecht, the Netherlands). Prior to each experiment stock solutions
were prepared.
Susceptibility testing
Susceptibility testing was performed by microdilution techniques according to CLSI guide-
line16. Daptomycin MICs were determined using E-test-strips (AB Biodisk, Solna, Sweden).
Additionally, oxacillin MICs were determined using the Phoenix system (Becton Dickinson,
Sparks, MD). Tolerance was defined as a MBC/MIC ratio ≥ 3217.
Time-Kill experiments
Time-Kill studies were done according to Isenberg’s guidelines18 and performed in Brain
Heart Infusion (BHI) broth (Oxoid, Basingstoke, Hampshire, England). When testing dapto-
mycin, Mueller-Hinton broth II (BBLTM, Becton Dickinson, Le pont de Claix, France) was
supplemented with calcium (50 mg/L)19. Bacteria from an overnight culture were grown
until late logarithmic phase and diluted to 1×106 CFU/mL. Antibiotics were added (100 L
per 10 mL medium) to obtain concentrations of ½, 1, 2, 4 and 8× MIC. Samples were taken
at t=0, 2, 4, 6, 8, 10, 24 and 48 h of incubation at 37°C, serially diluted (10–1 to 10–6) to mini-
mize carryover effects, plated (37.3 L) using a spiralplater (Eddy Jet, IUL instruments,
Barcelona, Spain) and incubated at 37°C for 18–24 h. CFU were counted with a colony
counter (Flash & Go, IUL instruments). The lower limit of detection was 2.73 log10 CFU/mL.
Experiments with M015 and ATCC 29213 were carried out in duplicate to eightfold to test
reproducibility. Bactericidal activity (99.9% kill) was defined as a ≥ 3-log10 CFU/mL decrease
in colony count at 24 h compared to the initial inoculum.
Isolation and restriction of plasmid DNA
To analyse the presence of β-lactamase encoding plasmids, such as pBORa53, plasmid
DNA was isolated and digested with HindIII, essentially as described previously20.
Beta-lactamase quantitation
The crude β-lactamase was prepared as described previously21. Oxacillin was used as the
inducer at a concentration of 0.375 mg/L. Uninduced cultures were also included. ATCC
29213 and 25923 were induced with 0.125 and 0.0625 mg/L oxacillin (½× MIC), respec-
tively. The specific activity was calculated by dividing the total activity by the protein con-
tent.
Antimicrobial activity of oxacillin, vancomycin, linezolid and daptomycin against BORSA
125
Statistical analysis
Differences between concentration profiles in log10 CFU/mL at 24 h were assessed by
analysis of variance with Tukey’s test for multiple comparisons, using SPSS 14.0. A P value
of < 0.05 was considered statistically significant.
Determination of pharmacodynamic parameters
An uncomplicated εmax-model can describe the change in CFU over time during the initial
phase of cell killing, using the growth rate constant (λ) in the absence of antibiotic pressure
and on the concentration depending kill rate constant (ε), as shown in Equation 1.
N
CC
C
dt
dN ×
⎟
⎟
⎠
⎞
⎜
⎜
⎝
⎛
+
−=
γ
γ
γ
ε
ε
λ
50
max
(1)
The maximum kill rate constants εmax (h-1) and concentration necessary to achieve half of
the maximum kill rate εC50 (mg/L) were obtained as described previously22.
However, this model can be inaccurate to estimate pharmacodynamic parameters
since effect-time profiles are often not log-linear over a longer period of time. In order to
cover the overall effect over 24 h, the log difference viable count was used as the differ-
ence between growth in the presence and absence of an antibiotic. For each concentra-
tion, the effect (E) was defined as the area under the curve (AUC0–24) of the log difference
curves (Equation 2), equal to the area between the curves (ABC0–24), and calculated via the
trapezoidal rule method in Prism 4.0 (GraphPad Inc) .
(
)
()
[]
240
1010 −
−antibioticrolgrowthcont CFULogCFULogAUC (2)
The maximum effect (Emax) was determined by fitting the data to the Hill equation. To carry
out a parellel line assay23, the logarithms of E/Emax-E were plotted against the logarithm of
the concentration (mg/L) according to the Hill plot (Equation 3)24.
()
[
]
[]
K
C
Log
E
E
E
Log +
=
−
γ
max
/
(3)
The EC50 represents the concentration at which 50% of the maximum effect is obtained and
is therefore considered as a potency marker. The EC50 is equal to 10-K/γ.
Chapter 8
126
Results
Susceptibility testing
Similar MICs of daptomycin and vancomycin were observed for BORSA with a MIC oxacillin
≥ 4 mg/L (M002, M008 and M015) or ≤ 2 mg/L (M007 and VU94) (Table 1). Tolerance to
oxacillin was noted for M002 and M00817. Persisters were observed when determining the
MBC of M01525. All BORSA, including eight isolates with oxacillin MICs of 4 and 8 mg/L,
tested on the Phoenix system were classified as susceptible for oxacillin (as shown for five
strains in Table 1).
Table 1. In vitro activity and pharmacodynamic parameters of oxacillin, vancomycin, daptomycin and
linezolid against BORSA.
MIC
(mg/L)
MIC b
(mg/L)
MBC
(mg/L)
Time to 99.9% kill
(h) Emax γ EC50
(mg/L) γ΄ c εmax,o/i d
(h-1)
εC50
(mg/L) γ
Bacterial
strains and
antibiotics a
2¯
MIC
4¯
MIC
8¯
MIC I e II e
29213 OXA 0.25 ND 0.5 21.36 18.31 15.09 121.03 2.28 0.20 0.94 / 2.00 0.19 1.66
M015 OXA 4 2 8† 26.61 27.38 25.59 95.88 1.85 2.01
2.20 0.52 / 1.50 2.22 2.59
M008 OXA 4 0.5 >64 44.32 47.96 44.30 80.22 2.29 1.89 0.75 / 1.93 1.58 2.05
M002 OXA 8 2 >64 NA NA NA 89.04 1.57 1.92 0.74 / 1.88 1.89 2.60
VU94 OXA 0.75 0.5 1 NA NA NA 100.40 1.67 0.42 1.06 / 2.05 0.31 2.03
M007 OXA 2 0.5 4 NA NA 18.89 75.02 2.07 0.61 0.75 / 1.67 0.49 2.94
29213 DAP 1 ND N D 4.92 3.63 2.10 176.52 0.85 0.66 2.05 / 2.82 0.57 0.88
M015 DAP 0.5 ND ND 9.15 6.82 6.10 131.47 1.64 0.26
1.05 1.18 / 1.82 0.14 1.55
M008 DAP 0.5 ND ND 7.42 5.21 4.39 147.40 1.09 0.21 1.28 / 2.02 0.24 1.42
M002 DAP 0.75 ND ND 4.03 4.88 3.48 147.80 1.03 0.08 1.27 / 2.10 0.29 1.36
VU94 DAP 0.75 ND ND 5.76 5.73 5.39 147.90 1.40 0.33 1.39 / 2.09 0.49 1.47
M007 DAP 0.75 ND ND 5.61 5.12 4.64 142.80 1.79 0.41 1.04 / 1.89 0.28 1.40
29213 LZD 4 ND ND NA NA NA 82.54 5.36 1.79 0.53 / 1.59 1.32 3.27
M015 LZD 1 ND ND NA 32.49 27.63 99.68 1.98 0.73
2.16 0.71 / 1.69 0.80 1.02
29213 VAN 1 ND ND NA 24.36 24.24 98.82 4.31 1.48 0.66 / 1.72 0.57 6.51
M015 VAN 1 ND ND NA 22.01 22.20 100.07 3.58 1.60 4.13 0.56 / 1.54 0.62 5.82
M008 VAN 1 ND ND NA 22.52 29.18 97.45 4.37 1.37 0.83 / 2.01 0.95 6.58
M002 VAN 1 ND ND NA 17.24 16.12 114.80 3.98 1.28 1.01 / 2.16 0.87 3.04
VU94 VAN 1 ND ND NA 21.97 20.00 102.20 2.83 1.34 0.84 / 1.84 0.63 5.85
M007 VAN 1 ND ND NA 20.85 17.24 103.90 4.14 1.83 0.77 / 1.69 1.27 3.92
a DAP, daptomycin; LZD, linezolid; OXA, oxacillin; VAN, vancomycin
b MIC values determined with the Phoenix system
c common sigmoidicity coefficients for strains ATCC 29213 and BORSA M015 when concentration-effect lines were
forced to be in parallel
d observed (o) and intrinsic (i) maximum kill rate constants (εmax,i = εmax,o + λ); the generation times (gt = t / ((log2)-1 ×
log (Nt/N0)) and λ = ln2/gt) were in BHI or CAMHB (DAP): 0.70 and 0.90; 0.70 and 0.99; 0.65 and 1.08; 0.61 and 0.83;
0.75 and 0.81 and 0.58 and 0.93 (h) for respectively ATCC 29213, VU94, M015, M002, M007 and M008.
e method I, effect expressed as the ABC0–24; method II, effect expressed as the kill rate (ε)
† persisters detected up to 64 mg/L
ND, not determined
NA, not achieved within 48 h
Antimicrobial activity of oxacillin, vancomycin, linezolid and daptomycin against BORSA
127
Time-Kill experiments
ATCC 29213 and all BORSA showed similar growth characteristics: there were no conside-
rable differences in the effects of vancomycin, linezolid and daptomycin (Figure 1, Table 1).
The EC50 and εC50 were in the same size of order, except for vancomycin. Regrowth was
especially observed with vancomycin, even at 2× MIC for all strains.
Concentration (mg/L)
0246816
ABC0-24
0
20
40
60
80
100
120
140
M002
M007
M008
M015
VU94
ATCC 29213
Concentration (mg/L)
02468
ABC0-24
0
20
40
60
80
100
120
140
Concentration (mg/L)
02468
ABC0-24
0
20
40
60
80
100
120
140
160
180
200
AB
C
M002
M007
M008
M015
VU94
ATCC 29213
M002
M007
M008
M015
VU94
ATCC 29213
Figure 1. The pharmacodynamic effect, expressed as the difference in log viable count over a time period of
24 h, and denoted by the area between the curves (ABC0–24), versus the concentration in mg/L for (A)
oxacillin, (B) vancomycin and (C) daptomycin against BORSA strains M002, M007, M008, M015 and VU94
and MSSA ATCC 29213.
Oxacillin was significant less effective at 4 and 8× MIC against M015, compared to ATCC
29213, in reducing the bacterial viable counts over 24 h (P < 0.05 and P < 0.001), as was the
time to achieve 99.9% killing at 2, 4 and 8× MIC (5–10 h longer) (Table 1). This was consis-
tent with the lower εmax. Both, M002, M008 and M015 did not achieve 99.9% kill within 24
h, even not at 8× MIC. The maximum effect of oxacillin was considerably reduced for all
BORSA compared to ATCC 29213 (Figure 1A). Furthermore, markedly regrowth at 2 and 4×
MIC was observed with BORSA M007 and VU 94 (oxacillin MIC ≤ 2 mg/L), while no re-
growth was seen with BORSA with oxacillin MIC ≥ 4 mg/L (M002, M008 and M015) (Figure
2).
Chapter 8
128
Time (h)
0 1020304050
Log10 CFU/mL
0
2
4
6
8
10
Time (h)
0 1020304050
Log10 CFU/mL
0
2
4
6
8
10
AB
Figure 2. Antibacterial activity of oxacillin (OXA) against (A) S. aureus ATCC 29213 (white symbols and dotted
lines) versus the average data of BORSA strains M002, M008 and M015 (MIC OXA ≥ 4 mg/L) (black symbols
and straight lines) and (B) S. aureus ATCC 29213 (white symbols and dotted lines) versus the average data of
BORSA strains M007 and VU94 (MIC OXA ≤ 2 mg/L) (black symbols and straight lines) at concentrations
corresponding to ½× (circles), 1× (triangles downwards), 2× (squares), 4× (diamonds) and 8×MIC (triangles
upwards) in comparison to growth controls (hexagon). Error bars represent standard errors of the mean.
Beta-lactamase activity and plasmid profile analysis
The β-lactamase activity and plasmid profile analysis were performed to clarify the diffe-
rences in regrowth observed with oxacillin between BORSA M007 and VU94, and BORSA
M002, M008 and M015, at the same multiples of the MIC. Although, BORSA M015, M008
and M002, with oxacillin MIC ≥ 4 mg/L, showed a twice as high induction ratio than BORSA
M007 and VU94, with oxacillin MIC ≤ 2 mg/L, the latter produced considerably higher
amounts of β-lactamase after induction (Figure 3A). The four plasmid DNA fragments of
BORSA M007 and VU94 were similar in size to that of plasmid pBORa53 (Figure 3B), pre-
viously described as a pBW15-like β-lactamase plasmid26. In the other BORSA, pMW2-like
plasmids were identified, a penicillinase-encoding plasmid27.
Pharmacodynamic comparison
For each antibiotic a potency ratio was calculated between ATCC 29213 and M015, using
the parellel line assay23. The difference in potency is visualized by the horizontal shift of the
concentration-effect curve (Figure 4). Oxacillin was approximately 10× more potent
against ATCC 29213 than against M015. The same result was found for the other BORSA,
M002 and M008 with oxacillin MIC ≥ 4 mg/L. These strains showed similar concentration –
effect profiles (Figure 1A), resulting in consistent EC50. On the other hand, the potency
estimates for ATCC 29213 versus M007 and VU94 were 2× and 3×, respectively.
Antimicrobial activity of oxacillin, vancomycin, linezolid and daptomycin against BORSA
129
M007
VU94
M002
M008
M015
ATCC 29213
ATCC 25923
Nitrocefin hydrolyzing b-lactamase
specific activity (nmol/(mg x min))
0
2000
4000
6000
8000
10000
12000
Induction ratio
0
10
20
30
40
50
60
70
80
90
100
Induced
Uninduced
Induction ratio
AB
pBORa53
pBORa53
pMW2
pMW2
pMW2
M007 VU94 M002 M008 M015
12345
Figure 3. (A) The effect of β-lactamase induction by oxacillin on the nitrocefin-hydrolyzing activities of BORSA
strains. (B) BORSA M007 and VU94, contain a BORSA-related, pBORa53-like plasmid. The image shows an
ethidium bromide-stained agarose gel containing HindIII-digested plasmids from M007 (lane 1), VU94 (lane
2), M002 (lane 3), M008 (lane 4) and M015 (lane 5). The HindIII-digested DNA fragment sizes predicted from
the plasmids pBORa53 (GenBank Accession Nr. AY917098) and pMW2 (Genbank Accession Nr. AP004832) are
indicated on the left- and right-hand side, respectively.
Discussion
This study revealed that oxacillin was not effective to eradicate, in vitro, neither BORSA with
MIC oxacillin ≥ 4 mg/L, nor BORSA with MIC oxacillin ≤ 2 mg/L. Actual concentrations of
oxacillin to eradicate in vitro BORSA with oxacillin MIC ≥ 4 mg/L (M002, M008 and M015)
were notably higher than can be attained with normal dosing strategies, while M007 and
VU94 (MIC oxacillin ≤ 2 mg/L), showed early regrowth with oxacillin, possibly due to a
pBORa53-like plasmid related hyperproduction of β-lactamases.
The change in killing rate over time is a reflection of the influence of (i) degradation of
antibiotics, (ii) adaptation and (iii) heterogeneous subpopulations28. Consequently, re-
growth can occur. Furthermore, the growth rate is not constant over time, since the repli-
cation of microorganisms is influenced by the amount of nutrients in the medium. There-
fore, an alternative method, which incorporates all available time-kill data, was used to
obtain concentration-effect parameters. In contrast to the method of Tsuji et al.29, who
used the log ratio based on the proportion between growth or killing in the absence and
presence of an antibiotic, our method is based on the absolute difference between these
characteristics.
Because the kill rates were obtained from the log linear initial phase of the survival
curve, εmax was affected only minimally by regrowth. In contrast, the reduced efficacy as a
result of regrowth was manifested in Emax, since the variation of the survival curve over a
longer period of time was taken into account. This might clarify the discrepancy between
EC50 and εC50 values (Table 1). The vancomycin effect is overestimated by the εC50.
Chapter 8
130
Log concentration (mg/L)
-1.0 -0 .5 0.0 0.5 1.0 1.5
Log (E/(Emax-E))
-2
0
2
4
6
DAP M015
LZD M015
OXA M015
VAN M015
VAN M015
LZD M015
OXA M015
DAP M015
Log concentration (mg/L)
-1.0 -0.5 0.0 0.5 1.0 1.5
Log (E/(Emax-E))
-2
0
2
4
6
DAP ATCC 29213
LZD ATCC 29213
OXA ATCC 29213
VAN ATCC 29213
DAP ATCC 29213
LZD ATCC 29213
OXA ATCC 29213
VAN ATCC 29213
Log concentration (mg/L)
-1.0 -0 .5 0.0 0.5 1.0 1.5
Log (E/(Emax-E))
-2
0
2
4
6
OXA ATCC 29213
OXA M015
OXA ATCC 29213
OXA M015
MIC DAP MIC VAN / LZDMIC OXA
Log concentration (mg/L)
-1.0 -0.5 0.0 0.5 1.0 1.5
Log (E/(Emax-E))
-2
0
2
4
6
VAN ATCC 29213
VAN M015
Log concentration (mg/L)
-1.0 -0.5 0.0 0.5 1.0 1.5
Log (E/(Emax-E))
-2
0
2
4
6
DAP ATCC 29213
DAP M015
Log concentration (mg/L)
-1.0 -0.5 0.0 0.5 1.0 1.5
Log (E/(Emax-E))
-2
0
2
4
6
LZD ATCC 29213
LZD M015
DAP M015
DAP ATCC 29213
MIC M015 MIC ATCC 29213
MIC ATCC 29213 MIC M015 MIC ATCC 29213 / M015
VAN M015
VAN ATCC 29213
MIC OXA MIC VAN / DAPMIC LZD
AB
CD
EF
LIN ATCC 29213
LIN M015
MIC ATCC 29213
MIC M015
Figure 4. The logarithm of (E/Emax-E) versus the logarithm of the concentration in mg/L for S. aureus ATCC
29213 (solid lines) and BORSA M015 (dashed lines). The corresponding EC50 were determinated from the
points where the dotted horizontal line (y = 0) intersects the different concentration-effect curves. The
differences in potency are visualized by the left or right shift of the curves. The corresponding Hill
coefficients (γ΄) are equal to the slopes of the curves. The dotted vertical lines indicate the MIC of the
represented antibiotics. The abbreviations DAP, OXA, LZD and VAN represent daptomycin and oxacillin,
linezolid and vancomycin, respectively.
The decreased EC50 for oxacillin against BORSA with oxacillin MIC ≥ 4 mg/L (M002, M008
and M015) is accompanied by a reduction in Emax. Usually, target site alterations are reflec-
ted by a reduced Emax. BORSA resistance mechanisms have been related, among others, to
target site alterations, such as amino acid substitutions in PBP2, which might explain the
reduced Emax2, 6. Upregulation of β-lactamases could be responsible for the increased EC50.
However, the production of β-lactamases by these strains was only slightly enhanced after
induction, compared to ATCC 29213 (Figure 3A). Although the data do not allow to esta-
blish a specific mechanism, other resistance mechanisms, that have not been elucidated so
far, might be involved. On the other hand, VU94, and particularly M007 (BORSA with oxacil-
Antimicrobial activity of oxacillin, vancomycin, linezolid and daptomycin against BORSA
131
lin MIC ≤ 2 mg/L and both belonging to the predominant MLST CC25 lineage2), showed a
considerably higher production of β-lactamases, after induction. This is in accordance with
the plasmid profile analysis, since pBW15-like plasmids, such as pBORa53, are associated
with an inducible hyperproduction of β-lactamases. These plasmids encode very likely for
methicillinase15. Two β-lactamases have been detected in the membrane of VU94 pre-
viously, and one of them being a methicillinase4. For this reason, VU94 and M007 were
probably able to hydrolyze oxacillin very efficiently, with regrowth within 12 h as a conse-
quence at 4× and 8× MIC, respectively. This indicates the need for high dosing strategies of
penicillinase-resistant penicillins for β-lactamase hyperproducing BORSA. Unfortunately,
oxacillin in combination with a β-lactamase inhibitor is not commercially available.
Although, oxacillin against BORSA with oxacillin MIC ≥ 4 mg/L (M002, M008 and M015)
reduced the bacterial counts at 4× and 8× MIC, the actual concentrations, i.e. 16–32 mg/L,
were high. Concentrations above 4× MIC are considered clinically effective for time-
dependent antibiotics, such as oxacillin28. For β-lactams, the pharmacodynamic index that
correlates best with clinical outcome is the time (t) that serum concentrations of the un-
bound fraction exceeds the MIC (t>MIC) and values of 40–50% or greater are considered
necessary for effective treatment of S. aureus infections30. Therefore, it is very unlikely that
for a drug with a high protein binding affinity (94%) and an unfavourable EC50, a free
plasma concentration of ≥ 4–8 mg/L (corresponding to the MIC of M002, M008 and M015)
for approximately 50% of the dosing interval (t>MIC) can be attained with current dosage
strategies (IV 1–12 g/24 h).
A recent case report highlights the fact that patients infected with non-β-lactamase
producing BORSA, with oxacillin MIC ≥ 4 mg/L, and treated with β-lactams may lead to
treatment failure31. The case report describes a patient with endocarditis, due to BORSA
with oxacillin MIC ≥ 4 mg/L, who failed to respond to cloxacillin. This confirms our findings
that treatment of infections caused by such BORSA with β-lactams is full of risk.
Since this study showed that BORSA with oxacillin MICs ≥ 4 mg/L are difficult to eradi-
cate in vitro with β-lactam antibiotics, it is important to identify BORSA isolates by routine
susceptibility testing. However, sixteen BORSA, including eight isolates with oxacillin MICs
of 4 and 8 mg/L, tested with the Phoenix system were all considered MSSA. Apparently,
this method is not suitable to differentiate between fully susceptible S. aureus strains and
BORSA. BORSA isolates will thus be missed by routine susceptibility testing and as a conse-
quence, the (empiric) antibiotic therapy choice, i.e. oxacillin, is not useful for the eradica-
tion.
In summary, out of the four antibiotics tested, oxacillin was, in vitro, non-effective
against both BORSA with oxacillin MIC ≥ 4 mg/L and pBORa53-like plasmid containing
BORSA with oxacillin MIC ≤ 2 mg/L. Further investigation into β-lactam dosing strategies
against different BORSA strains is warranted in order to avoid treatment options consistent
for MRSA infections.
Acknowledgements
We thank Dr. I. Szabó (University of Debrecen, Hungary) for kindly providing S. aureus
VU94.
Chapter 8
132
References
1. Nelson L, Cockram CS, Lui G, et al. Community case of methicillin-resistant Staphylococcus aureus infection.
Emerg Infect Dis 2006;12:172–4.
2. Nadarajah J, Lee MJ, Louie L, et al. Identification of different clonal complexes and diverse amino acid substitu-
tions in penicillin-binding protein 2 (PBP2) associated with borderline oxacillin resistance in Canadian Staphylo-
coccus aureus isolates. J Med Microbiol 2006;55:1675–83.
3. Massidda O, Montanari MP, Varaldo PE. Evidence for a methicillin-hydrolysing beta-lactamase in Staphylococcus
aureus strains with borderline susceptibility to this drug. FEMS Microbiol Lett 1992;71:223–7.
4. Keseru JS, Gal Z, Barabas G, Benko I, Szabo I. Investigation of beta-Lactamases in clinical isolates of Staphylococ-
cus aureus for further explanation of borderline methicillin resistance. Chemotherapy 2005;51:300–4.
5. Varaldo PE. The ‘borderline methicillin-susceptible’ Staphylococcus aureus. J Antimicrob Chemother 1993;31:1–
4.
6. Hackbarth CJ, Kocagoz T, Kocagoz S, Chambers HF. Point mutations in Staphylococcus aureus PBP 2 gene affect
penicillin-binding kinetics and are associated with resistance. Antimicrob Agents Chemother 1995;39:103–6.
7. Tomasz A, Drugeon HB, de Lencastre HM, Jabes D, McDougall L, Bille J. New mechanism for methicillin resis-
tance in Staphylococcus aureus: clinical isolates that lack the PBP 2a gene and contain normal penicillin-binding
proteins with modified penicillin-binding capacity. Antimicrob Agents Chemother 1989;33:1869–74.
8. Balslev U, Bremmelgaard A, Svejgaard E, Havstreym J, Westh H. An outbreak of borderline oxacillin-resistant
Staphylococcus aureus (BORSA) in a dermatological unit. Microb Drug Resist 2005;11:78–81.
9. Thomsen MK, Rasmussen M, Fuursted K, et al. Clonal spread of Staphylococcus aureus with reduced susceptibil-
ity to oxacillin in a dermatological hospital unit. Acta Derm Venereol 2006;86:230–4.
10. Hirano L, Bayer AS. Beta-Lactam-beta-lactamase-inhibitor combinations are active in experimental endocarditis
caused by beta-lactamase-producing oxacillin-resistant staphylococci. Antimicrob Agents Chemother
1991;35:685–90.
11. Pefanis A, Thauvin-Eliopoulos C, Eliopoulos GM, Moellering RC, Jr. Activity of ampicillin-sulbactam and oxacillin
in experimental endocarditis caused by beta-lactamase-hyperproducing Staphylococcus aureus. Antimicrob
Agents Chemother 1993;37:507–11.
12. Barg N, Chambers H, Kernodle D. Borderline susceptibility to antistaphylococcal penicillins is not conferred
exclusively by the hyperproduction of beta-lactamase. Antimicrob Agents Chemother 1991;35:1975–9.
13. Donker GA, Deurenberg RH, Driessen C, Sebastian S, Nys S, Stobberingh EE. The population structure of Staphy-
lococcus aureus among general practice patients from the Netherlands. Clin Microbiol Infect 2009.
14. Pitkala A, Salmikivi L, Bredbacka P, Myllyniemi AL, Koskinen MT. Comparison of tests for detection of beta-
lactamase-producing staphylococci. J Clin Microbiol 2007;45:2031–3.
15. Massidda O, Montanari MP, Mingoia M, Varaldo PE. Borderline methicillin-susceptible Staphylococcus aureus
strains have more in common than reduced susceptibility to penicillinase-resistant penicillins. Antimicrob
Agents Chemother 1996;40:2769–74.
16. Performance Standards for Antimicrobial Susceptibility Testing-Seventh Edition: Approved Standard M7-A7.
Wayne, PA, USA: Clinical and Laboratory Standards Institute; 2007.
17. Sherris JC. Problems in in vitro determination of antibiotic tolerance in clinical isolates. Antimicrob Agents
Chemother 1986;30:633–7.
18. Isenberg HD. Tests to assess bacterial activity - Time-kill assay. In: Hindler J, ed. Clinical Microbiology Procedures
Handbook. Washington, D.C.: American Society for Microbiology; 1992:14–20.
19. Lamp KC, Rybak MJ, Bailey EM, Kaatz GW. In vitro pharmacodynamic effects of concentration, pH, and growth
phase on serum bactericidal activities of daptomycin and vancomycin. Antimicrob Agents Chemother
1992;36:2709–14.
20. Ausubel FM, Brent R., Kingston, R.E., Moore D.D., Seidman, J.G., Smith, J.A., Struhl, K. Current protocols in mo-
lecular biology. New York, NY: John Wiley & sons, inc.; 1994–2008.
Antimicrobial activity of oxacillin, vancomycin, linezolid and daptomycin against BORSA
133
21. Yoshida R, Kuwahara-Arai K, Baba T, Cui L, Richardson JF, Hiramatsu K. Physiological and molecular analysis of a
mecA-negative Staphylococcus aureus clinical strain that expresses heterogeneous methicillin resistance. J An-
timicrob Chemother 2003;51:247–55.
22. Mouton JW, Dudley MN, Cars O, Derendorf H, Drusano GL. Standardization of pharmacoki-
netic/pharmacodynamic (PK/PD) terminology for anti-infective drugs: an update. J Antimicrob Chemother
2005;55:601–7.
23. Armitage P, Berry G. Statistical methods in medical research 2nd ed. Oxford: Blackwell Scientific Publications;
1987.
24. Wilson K, Goulding KH. Principles and techniques of practical biochemistry. 3rd ed. London: Edward Arnold
1986.
25. Gunnison JB, Fraher MA, Jawetz E. Persistence of Staphylococcus aureus in penicillin in vitro. J Gen Microbiol
1964;35:335–49.
26. Massidda O, Mingoia M, Fadda D, Whalen MB, Montanari MP, Varaldo PE. Analysis of the beta-lactamase plas-
mid of borderline methicillin-susceptible Staphylococcus aureus: focus on bla complex genes and cadmium re-
sistance determinants cadD and cadX. Plasmid 2006;55:114–27.
27. Baba T, Takeuchi F, Kuroda M, et al. Genome and virulence determinants of high virulence community-acquired
MRSA. Lancet 2002;359:1819–27.
28. Czock D, Keller F. Mechanism-based pharmacokinetic-pharmacodynamic modeling of antimicrobial drug
effects. J Pharmacokinet Pharmacodyn 2007;34:727–51.
29. Tsuji BT, Yang JC, Forrest A, Kelchlin PA, Smith PF. In vitro pharmacodynamics of novel rifamycin ABI-0043
against Staphylococcus aureus. J Antimicrob Chemother 2008;62:156–60.
30. Craig WA. Pharmacokinetic/pharmacodynamic parameters: rationale for antibacterial dosing of mice and men.
Clin Infect Dis 1998;26:1–10; quiz 1–2.
31. Skinner S, Murray M, Walus T, Karlowsky JA. Failure of cloxacillin in treatment of a patient with borderline
oxacillin-resistant Staphylococcus aureus endocarditis. J Clin Microbiol 2009;47:859–61.
135
CHAPTER 9
General Discussion
Chapter 9
136
General discussion
137
General Discussion
Staphylococcus aureus continues to be a predominant cause of community-acquired and
nosocomial associated infections1. It is the most prevalent cause of endovascular infec-
tions, including catheter sepsis and infective endocarditis2,3, and the second most common
cause of bacteraemia4. There are a number of factors that contribute to the success of S.
aureus in evading host immunity and in establishing (persistent) infections. It is partly due
to its ability to form biofilm5,6. Biofilm formation often prolongs the duration of debilitating
infections since it restricts the access of many conventional antimicrobial agents to sessile
bacterial communities and because of its recalcitrance to the innate7, as well as adaptive8,
immune response. Several studies were undertaken to get a better understanding of how
biofilm formation can be prohibited and whether mature biofilm can be disassembled.
Staphylococcus aureus biofilm formation in relation to the genetic background
In a natural environment, most bacteria grow aggregated to each other and to solid sur-
faces9. Therefore, biofilm communities are considered the predominant mode of bacterial
life10. Cells within a biofilm are embedded by extracellular polysaccharides (EPS), which
provides protection against a variety of environmental stresses, such as pH shifts, osmotic
shock, desiccation and UV radiation11. It has been demonstrated that the S. aureus biofilm
matrix could consist of different components, including polysaccharide intercellular adhe-
sin (PIA) or poly-ß(1,6)-N-acetyl-D-glucosamine (PNAG), extracellular DNA (eDNA), surface-
anchored microbial surface components recognizing adhesive matrix molecules
(MSCRAMMs) and proteins. In order to find strategies to tackle or to prevent biofilm associ-
ated infections, it is necessary to get insight in the mechanisms of biofilm formation. Evi-
dently, the principles behind the capacity to form a biofilm are strain dependent. So far, it
remains unelucidated which strains are more prone to become embedded by biomass.
Under static conditions, we demonstrated in chapter 2 that the number of clonal lineages
associated with multilocus sequence typing (MLST) clonal complex (CC)8 that displayed
excessive biomass attachment to polystyrene surfaces was higher compared to a variety of
isolates with other genetic backgrounds. Although the majority of MLST CC8 associated
strains tested were classified as strong biofilm formers, 40% of these strains were not. This
means that there is another underlying predisposing factor for strong biofilm formation
that is not unravelled yet. Although all CC8 sublineages originate from the same progeni-
tor12, differences in the presence and expression of regulatory loci between subclones
could be expected due to evolutionary events. As postulated, also the major components
of biofilm matrices might be essential for the formation of robust biofilm, since it was
found that matrices containing more PIA/PNAG were predominantly associated with re-
solving instead of persistent bacteraemia6. Most of the CC8 isolates did not demonstrate a
dry crystalline colony morphology on Congo red agar (CRA), which was considered indica-
tive for PIA/PNAG formation13.
Chapter 9
138
The importance of accessory gene regulator (agr) genotype for biofilm formation was
recently discussed by Cafiso et al.14 and Kawamura et al.15 using strains isolated from pa-
tients with orthopaedic device-related infections. Based on their observations that agr-II
genotype, spa-type t002, MLST CC5 associated strains were stronger biofilm formers than
agr-I and agr-III strains, they stressed the importance of this agr genotype for biomass
accumulation. However, in both studies the variety of clonal lineages of the isolates was
limited or even unknown and not uniformly distributed compared to our examination. We
observed at 0.1% glucose only strong biofilm formers among agr-II, spa-type t002, MLST
CC5 associated strains and not in strains associated with MLST CC12 or CC15. All of their
agr-I strains belonged to spa-type t1767, which is affiliated to MLST CC8, and were not
included in our study. We are therefore convinced that the genetic background is a more
appropriate predisposing factor for biofilm formation than agr-type.
All together, these results suggest that especially the MLST CC8 (agr-I) genetic back-
ground deserves special attention in future biofilm exploratory studies as well as spa-type
t002 isolates (agr-II) for orthopaedic infections.
Biofilm formation among MLST CC8 isolates
It is known that the CC8 lineage, including USA300, disseminated successfully16 and caused
serious biofilm-associated infections17–19. Beside the ability to form biofilm, the extraordi-
narily success as a pathogen of various MLST CC8 subclones including the community-
associated methicillin-resistant S. aureus (CA-MRSA) USA300 has been attributed to their
highly active agr quorum-sensing system12,20. Thus, the enhanced invasive potential is the
consequence of abundant expression levels of virulence determinants, in particular α-toxin
and α-type PSMs21,22. Based on the observation that both a biofilm can be established as
well as toxins can be excreted by USA300, it is likely to assume that large changes in activ-
ity of global regulatory systems (i.e. agr and sarA) in the majority of MLST CC8 associated
strains occur. If the turnover from repression to activation of agr is relatively quick, fast
biomass accumulation followed by rapid dispersal of bacteria could be expected.
It would be interesting to evaluate whether slow-developing but long-lasting biofilm
communities do exist as well and to compare their (dis)advantages in terms of defence
against host immune responses and antimicrobials. With our data this question remained
unanswered, since biofilm formation was only assessed until 48 h. Although, S. aureus
biofilm are generally considered fully mature within 24–48 h23,24, it would be possible that
it takes longer for certain clones25. This sounds plausible since differences in the rapidity of
agr RNAIII (de)activation have been noticed26.
Biofilm formation among MLST CC5 isolates
The strong biofilm producing capacity of some strains with spa-type t002, belonging to the
MLST CC5 clone, could be clarified by a high percentage of dysfunctional agr as previously
observed by Schweizer et al.27. In their study, 19 out of 190 (10%) USA300 blood isolates vs.
78 out of 234 (33%) MLST sequence type (ST)5 strains were dysfunctional in agr, respec-
tively. This was higher than the overall percentage among blood stream isolates: 181 out
General discussion
139
of 814 (22%) isolates. The prevalence of agr dysfunction among colonizing S. aureus strains
was previously indicated as roughly 9%28.
In general, agr-dysfunction (i), has been associated with a prolonged duration of bac-
teremia27,29; (ii), has been attributed to prior antibiotic administration (including ß-lactams
and fluoroquinolones)30; (iii), has been correlated with slow-growing small colony vari-
ants31; (iv), has been linked with reduced killing by innate host thrombin-induced platelet
microbicidal proteins (tPMPs) and consequently a strong ability to establish endovascular
infection such as endocarditis32; (v), is less common among CA-MRSA versus healthcare-
associated (HA)-MRSA33; and (vi), showed a tendency toward higher mortality among pa-
tients infected with agr-dysfunctional S. aureus27. These observations were consistent with
in vitro studies showing that knocking out agr enhances biomass accumulation by the
mutants34,35.
However, recently, doubts have arisen concerning the determination of agr-
dysfunction, since it was discovered that even though the lack of delta-hemolysin produc-
tion is a phenotypic marker for a nonfunctional agr locus, RNAIII transcription was not
absent but rather late26. Although the agr-II genotype correlated clinically with vancomy-
cin treatment failure36, it was found that agr function, transcription and sequence did not
influence vancomycin outcomes in an infective endocarditis model26. Therefore, it remains
undefined as to how agr activity impacts treatment outcome within the agr-II (CC5) group.
Another question to be answered is whether initial adhesion and biofilm formation of the
various clonal lineages on polystyrene are in the same order of magnitude to other sur-
faces. Using flow-cells to grow biofilm on abiotic surfaces as glass, polycarbonate and
titanium, USA300 showed only minor differences in film thickness, total biomass and sur-
face coverage37. Also, MLST CC8 strains easily adhered to human tissue such as airway
epithelial cells38,39.
Finally, there is a limitation in the quantification of biofilm employed by ourselves and
others. Although the microtiter plate assay has been worldwide adopted as a useful
biofilm performance test23,40, it’s relevance for the clinical setting, i.e. device-related at-
tachment of bacteria, has never been indisputably proven41. Moreover, a non-invasive
diagnostic tool to detect biofilm in vivo is currently not available42,43, but would be highly
advantageous. Infected implant or indwelling device removal, necessary to isolate the
causative micro-organism is not always possible or desirable44 but often mandatory45, and
many replaced catheters become reinfected46. Strains could under circumstances where
preservation of the biomaterial is desirable only be indirectly isolated when quorum-
sensing induced dispersal is followed by spread via the bloodstream47. In case of device
removal, screening for biofilm can be performed by a range of standardised methods.
Beside microscopic imaging techniques, the role plate assay48, sonication and scraping
methods are available49,50. Although the roll-plate assay is not appropriate for endoluminal
evaluation of central venous catheters (CVCs), the roll-plate assay remains useful as a refer-
ence standard for catheter tip culture. We therefore chose this method for bacterial adher-
ence analysis when testing new anti-microbial adhesive and anti-thrombogenic coatings.
Chapter 9
140
Prevention of biofilm formation
Prevention of initial adherence of bacteria to indwelling devices is of unprecedented im-
portance to prohibit biofilm formation and consequently bacteraemia on the long term.
Further improvements in biomaterials are essential since the interventions to prevent
complications with CVCs are often unsuccessful51,52. In chapter 4 and 5 we assessed the
dual application of silver particles and heparin in hydrophilic surface coatings in order to
overcome bacterial adherence on and thrombotic occlusions of catheters.
Advantages of silver as anti-adherent component in coatings are broad-spectrum an-
timicrobial activity, a slow appearance of resistance53 and the lack of cross-resistance to
antibiotics54. A major concern about the clinical application of silver coatings is a general
safety issue. Although silver is considered less toxic to human cells than other metals55,56,
the potential hazard to human health of long-term exposure is not fully investigated57.
Most research focuses on silver nanoparticles (1 – 110 nm)58, since nanoparticles were
considered to prolong antimicrobial activity because of their large surface to volume ra-
tio59,60. It accounts for a sustained release of Ag+ ions at the coating-tissue interface61. It
could be argued that slightly larger silver particles, i.e. microparticles of approximately 1
m, maintain strikingly refractory to microbial colonization whereas particles distribution
throughout the body would be limited62. Since, it was demonstrated in vivo by Lankveld et
al. that nanoparticles of smaller sizes were distributed more extensively to various kinds of
tissues than the larger silver particles62. It is plausible that size-dependent distribution is
coupled to size-dependent toxicity. Silver nano-particles have been demonstrated to bind
to and transfer across cell membranes of lung fibroblasts, glioblastoma cells63, keratino-
cytes and macrophages64. Their internalisation and oxidative nature induces inflammatory,
genotoxic, and cytotoxic characteristics57. Some suggest that the window between mini-
mum concentrations lethal to microbes and those toxic to the host is narrow65, since the
intensity of toxicity seems strongly associated with the local available concentration57,64.
Therefore the release of silver ions from the biomaterial should be kept under control,
which will be the ultimate challenge for further studies. Our silver containing coatings
remained antimicrobial after several stress-tests with high bacterial inocula under vigor-
ously shaking conditions and many refreshments of medium to remove released silver
ions. However, as shown in chapter 5, coatings containing only heparin lost their anti-
adherent properties after only a few challenges, in concordance with a previously shown
short-term controlled release of heparin from comparable coatings66. In contrast, silver and
heparin synergistically maintained the adherence at a lower level than silver alone during
all the consecutive challenges. Altogether, this suggests that the release of heparin from
the coating is retarded by the presence of the silver particles, and that simultaneously the
release of silver ions is augmented by co-transport upon binding to heparin molecules. To
prove this novel concept, the release of heparin and silver from all coating compositions
should be analytically measured over time.
Although the addition of heparin to the silver coatings was remarkably successful in
prevention of in vitro adherence of S. aureus, the effect of heparin is considerably unpre-
dictable in vivo. On one hand, heparin can specifically bind certain proteins that may pos-
sess antimicrobial activity67,68. On the other hand, heparin might stimulate biofilm forma-
tion when initial adherence could not be fully prohibited69. In a meta-analysis of different
General discussion
141
CVCs, heparin-bonded catheters were associated with a significantly lower rate of catheter
related blood stream infections (CRBSI) compared with standard catheters, but no reduc-
tion in colonisation was shown70. Since CVC colonization can be a precursor of CRBSI, it
would be possible that heparin prohibited dispersal of attached bacteria. Silver-containing
CVCs performed disappointingly in another meta-analysis not demonstrating any signifi-
cant reduction in colonization or CRBSI compared to standard non-surface modified poly-
urethane or silicone catheters71. However, many studies included in the meta-analysis
suffered from substantial shortcomings in methodological quality. The fact that the forma-
tion of a fibrin sleeve and CVC-related infection are interrelated72 stresses the importance
of designing biomaterials that suppress both initial attachment of micro-organisms and
the deposition of fibrin and platelets. The preventive capacity of heparin or silver particles
alone within a coating might be highly divergent from their combined counterparts. Be-
fore clinical assessment of our identified NVP/BMA coating formulations that effectively
combine biocidal and anticoagulant features could be performed, they should meet the
requirements of negligible silver losses in order that patients are not exposed to avoidable
risk. Medical device regulation is currently a matter of debate since variable standards for
device regulatory approval exist and post-marketing surveillance is poorly organized73,74.
Another way to approach prevention of biofilm formation is the prophylactic permanent
treatment with drugs that prohibit the initial attachment of bacteria. In chapter 7 we
evaluated thioridazine and reserpine, which have proven functionality as an efflux pump
inhibitor. Trans-membrane transporters, including efflux pumps, have been suggested to
play a functional role during the biofilm maturation and disassembly process75,76. We con-
cluded that thioridazine and reserpine could only hinder biofilm accumulation of MLST
CC8-associated S. aureus strains at 0.1% glucose, probably due to differences in the trans-
membrane transporter capacity among the tested strains with different MLST-associated
genetic backgrounds, i.e. CC5, CC22 and CC30. Fluctuations in nutrient and oxygen levels
inside the biofilm and the availability in the surroundings could lead to clonal lineage-
specific modification of tricarboxylic acid (TCA) cycle activity and consequently multiple
gene regulator (mgrA) expression. It seems that mgrA plays a central role in efflux pump
expression, but it also directly interferes with biofilm formation via agr and autolysis asso-
ciated regulators, i.e. cidA and lrgAB. Our observations of the influences of EPIs on biomass
require further research focussing on gene expression of genes involved in biofilm forma-
tion and efflux and influx pump activity to confirm our presumptions. It is also worthwhile
to evaluate the simultaneous exposure to EPIs and antibiotics or to combine two or more
types of EPIs affecting an extended range of S. aureus trans-membrane transporters.
One of the main efflux transporter proteins in S. aureus is NorA. As shown in chapter 6,
we demonstrated that norA overexpression was restricted to a few clonal lineages associ-
ated with MLST CC5, CC30 and CC45. We did not find a correlation between S. aureus with
mutations in the promoter region of norA and the level of efficacy of EPIs against the same
strains under biofilm conditions. The discordance could be explained in terms of a weak
correlation between mutations in the promoter region of norA and the actual expression
on a protein level or by the presence of other trans-membrane transporters that play a
Chapter 9
142
more crucial role in adjusting to nutrient availability and in the release of toxic molecules
from the cytosol.
Disassembly of the biofilm matrix
The observed dormancy of bacteria in the deeper parts of the biofilm hinders the killing by
antibiotics like ß-lactams and glycopeptides that require an active life-cycle or cell-wall
turnover to exert their efficacy. Under planktonic conditions, ß-lactams covalently modify
the active site of penicillin binding proteins (PBPs), enzymes that synthesize and alter
bacterial peptidoglycan77, and consequently inhibit the cross-linking of linear strands of
peptidoglycan into a fishnet-like polymer that surrounds the bacterial cell and confers
osmotic stability. Furthermore, ß-lactams interfere in the balance between peptidoglycan
synthesis and autolysis. Activation of the cell division machinery seems to be required for
ß-lactam induced cell lysis77. It is a plausible scenario that nutrient deprivation deep within
the biofilm limits cell division, an aspect that deserves further research attention. Besides
slow cell division, the biofilm matrix provides a diffusion barrier to most antimicrobial
compounds78. This would lead to subinhibitory concentrations deep inside a biofilm. As a
result, ß-lactamase plasmid-related (hyper)induction might be the consequence. Accumu-
lation of the overproduced enzyme in the polysaccharide matrix in the immediate sur-
rounding vicinity of the bacteria impairs the penetration and efficacy of ß-lactams even
more. As shown in chapter 8, the pBORa53-like plasmid-containing borderline oxacillin
resistant S. aureus (BORSA) are more prone to ß-lactamase induction. Although these
strains were not capable to produce large amounts of biomass (data not shown), multi-
species biofilm or multiclonal aggregates containing BORSA could potentially further
increase the biofilm recalcitrance to beta-lactams. Previously observed high levels of ß-
lactamase inside biofilm were believed to originate from lysed bacteria or membrane
vesicles liberated from embedded bacteria79.
This highlights the fact that conventional resistance mechanisms might contribute to
the bacterial survival inside biofilm. Simultaneous exposure to matrix destructive agents
seems to be essential for efficacy of penetration-limited antibiotics. We evaluated in chap-
ter 3 whether rifampicin could serve as a pore-forming agents as adjunct to oxacillin. We
argued that if rifampicin is able to destruct the biofilm matrix, then rifampicin should also
be active against pre-formed biofilm of isogenic rifampicin-resistant mutants. Using an in
vitro static, microtiter plate biofilm assay, we demonstrated that the addition of rifampicin
to oxacillin neither reduced the viable count nor affected the amount of biomass. More-
over, the efficacy of rifampicin against biofilm established by the rifampicin-susceptible
parent isolates was highly variable. So for this reason of unpredictability, it seems neces-
sary to re-evaluate rifampicin as standard adjunctive agent to empirically initiated therapy
in patients with S. aureus infections with clinical suspicion of biofilm involvement.
General discussion
143
Closing remarks
Scientific progress in identifying the key bacterial and fungal biofilm associated (genetic)
elements and unravelling the biofilm related pathways provides a platform for the devel-
opment of novel therapeutic agents against already established biofilm. An abundance of
biofilm modifying or disruptive substances has already been tested in vitro against mature
biofilm. It seems to be only a matter of time before the first intravenous applicable anti-
biofilm agent will get market approval. At the same time the development of improved
biomaterials for (permanent) indwelling devices, such as heart valves, CVCs and prosthetic
joints, continues to provide a better basis for the prevention of bacterial adherence and
consequently biofilm formation. This is of ultimate importance since biofilm-associated
infections remain inherently difficult to treat and device removal is still the mainstay of
clinical management.
Chapter 9
144
References
1. Boucher H, Miller LG, Razonable RR. Serious infections caused by methicillin-resistant Staphylococcus aureus.
Clin Infect Dis 2010;51 Suppl 2:S183–97.
2. Que YA, Moreillon P. Infective endocarditis. Nat Rev Cardiol 2011;8:322–36.
3. Fowler VG, Jr., Miro JM, Hoen B, et al. Staphylococcus aureus endocarditis: a consequence of medical progress.
Jama 2005;293:3012–21.
4. Thwaites GE, Edgeworth JD, Gkrania-Klotsas E, et al. Clinical management of Staphylococcus aureus bacterae-
mia. Lancet Infect Dis 2011;11:208–22.
5. Archer NK, Mazaitis MJ, Costerton JW, Leid JG, Powers ME, Shirtliff ME. Staphylococcus aureus biofilms: Proper-
ties, regulation, and roles in human disease. Virulence 2011;2:445–59.
6. Seidl K, Bayer AS, Fowler VG, Jr., et al. Combinatorial phenotypic signatures distinguish persistent from resolv-
ing methicillin-resistant Staphylococcus aureus bacteremia isolates. Antimicrob Agents Chemother
2011;55:575–82.
7. Thurlow LR, Hanke ML, Fritz T, et al. Staphylococcus aureus biofilms prevent macrophage phagocytosis and
attenuate inflammation in vivo. J Immunol 2011;186:6585–96.
8. Prabhakara R, Harro JM, Leid JG, Keegan AD, Prior M, Shirtliff ME. Suppression of the inflammatory immune
response prevents the development of chronic biofilm infection due to methicillin resistant Staphylococcus
aureus. Infect Immun 2011.
9. Parsek MR, Fuqua C. Biofilms 2003: emerging themes and challenges in studies of surface-associated microbial
life. J Bacteriol 2004;186:4427–40.
10. Moons P, Michiels CW, Aertsen A. Bacterial interactions in biofilms. Crit Rev Microbiol 2009;35:157–68.
11. Verhagen P, De Gelder L, Hoefman S, De Vos P, Boon N. Planktonic versus biofilm catabolic communities:
importance of the biofilm for species selection and pesticide degradation. Appl Environ Microbiol
2011;77:4728–35.
12. Li M, Diep BA, Villaruz AE, et al. Evolution of virulence in epidemic community-associated methicillin-resistant
Staphylococcus aureus. Proc Natl Acad Sci U S A 2009;106:5883–8.
13. Knobloch JK, Horstkotte MA, Rohde H, Mack D. Evaluation of different detection methods of biofilm formation
in Staphylococcus aureus. Med Microbiol Immunol 2002;191:101–6.
14. Cafiso V, Bertuccio T, Santagati M, et al. agr-Genotyping and transcriptional analysis of biofilm-producing
Staphylococcus aureus. FEMS Immunol Med Microbiol 2007;51:220–7.
15. Kawamura H, Nishi J, Imuta N, et al. Quantitative analysis of biofilm formation of methicillin-resistant Staphylo-
coccus aureus (MRSA) strains from patients with orthopaedic device-related infections. FEMS Immunol Med Mi-
crobiol 2011.
16. Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol 2008;8:747–63.
17. Kourbatova EV, Halvosa JS, King MD, Ray SM, White N, Blumberg HM. Emergence of community-associated
methicillin-resistant Staphylococcus aureus USA 300 clone as a cause of health care-associated infections
among patients with prosthetic joint infections. Am J Infect Control 2005;33:385–91.
18. Haque NZ, Davis SL, Manierski CL, et al. Infective endocarditis caused by USA300 methicillin-resistant Staphylo-
coccus aureus (MRSA). Int J Antimicrob Agents 2007;30:72–7.
19. Seybold U, Talati NJ, Kizilbash Q, Shah M, Blumberg HM, Franco-Paredes C. Hematogenous osteomyelitis
mimicking osteosarcoma due to Community Associated Methicillin-Resistant Staphylococcus aureus. Infection
2007;35:190–3.
20. Joo HS, Cheung GY, Otto M. Antimicrobial activity of community-associated methicillin-resistant Staphylococ-
cus aureus is caused by phenol-soluble modulin derivatives. J Biol Chem 2011;286:8933–40.
21. Queck SY, Jameson-Lee M, Villaruz AE, et al. RNAIII-independent target gene control by the agr quorum-
sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus . Mol Cell
2008;32:150–8.
General discussion
145
22. Diep BA, Otto M. The role of virulence determinants in community-associated MRSA pathogenesis. Trends
Microbiol 2008;16:361–9.
23. Peeters E, Nelis HJ, Coenye T. Comparison of multiple methods for quantification of microbial biofilms grown in
microtiter plates. J Microbiol Methods 2008;72:157–65.
24. Roveta S, Marchese A, Schito GC. Activity of daptomycin on biofilms produced on a plastic support by Staphy-
lococcus spp. Int J Antimicrob Agents 2008;31:321–8.
25. Tote K, Vanden Berghe D, Maes L, Cos P. A new colorimetric microtitre model for the detection of Staphylococ-
cus aureus biofilms. Lett Appl Microbiol 2008;46:249–54.
26. Seidl K, Chen L, Bayer AS, Hady WA, Kreiswirth BN, Xiong YQ. Relationship of agr expression and function with
virulence and vancomycin treatment outcomes in experimental endocarditis due to methicillin-resistant
Staphylococcus aureus. Antimicrob Agents Chemother 2011;55:5631–9.
27. Schweizer ML, Furuno JP, Sakoulas G, et al. Increased mortality with accessory gene regulator (agr) dysfunction
in Staphylococcus aureus among bacteremic patients. Antimicrob Agents Chemother 2011;55:1082–7.
28. Shopsin B, Drlica-Wagner A, Mathema B, Adhikari RP, Kreiswirth BN, Novick RP. Prevalence of agr dysfunction
among colonizing Staphylococcus aureus strains. J Infect Dis 2008;198:1171–4.
29. Fowler VG, Jr., Sakoulas G, McIntyre LM, et al. Persistent bacteremia due to methicillin-resistant Staphylococcus
aureus infection is associated with agr dysfunction and low-level in vitro resistance to thrombin-induced plate-
let microbicidal protein. J Infect Dis 2004;190:1140–9.
30. Butterfield J, Tsuji B, Brown J, et al. Predictors of agr dysfunction in methicillin-resistant Staphylococcus aureus
(MRSA) isolates among patients with MRSA bloodstream infections in the “15–20 mg/L” target vancomycin
trough era. Antimicrob Agents Chemother 2011;55:5433–7.
31. Tsuji BT, von Eiff C, Kelchlin PA, Forrest A, Smith PF. Attenuated vancom ycin bactericidal activity against Staphy-
lococcus aureus hemB mutants expressing the small-colony-variant phenotype. Antimicrob Agents Chemother
2008;52:1533–7.
32. Sakoulas G, Eliopoulos GM, Fowler VG, Jr., et al. Reduced susceptibility of Staphylococcus aureus to vancomycin
and platelet microbicidal protein correlates with defective autolysis and loss of accessory gene regulator (agr)
function. Antimicrob Agents Chemother 2005;49:2687–92.
33. Tsuji BT, MacLean RD, Dresser LD, McGavin MJ, Simor AE. Impact of accessory gene regulator (agr) dysfunction
on vancomycin pharmacodynamics among Canadian community and health-care associated methicillin-
resistant Staphylococcus aureus. Ann Clin Microbiol Antimicrob 2011;10:20.
34. Vuong C, Saenz HL, Gotz F, Otto M. Impact of the agr quorum-sensing system on adherence to polystyrene in
Staphylococcus aureus. J Infect Dis 2000;182:1688–93.
35. Boles BR, Horswill AR. Agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog 2008;4:e1000052.
36. Moise-Broder PA, Sakoulas G, Eliopoulos GM, Schentag JJ, Forrest A, Moellering RC, Jr. Acce ssory gene regulator
group II polymorphism in methicillin-resistant Staphylococcus aureus is predictive of failure of vancomycin ther-
apy. Clin Infect Dis 2004;38:1700–5.
37. Lauderdale KJ, Malone CL, Boles BR, Morcuende J, Horswill AR. Biofilm dispersal of community-associated
methicillin-resistant Staphylococcus aureus on orthopedic implant material. J Orthop Res 2010;28:55–61.
38. Karauzum H, Ferry T, de Bentzmann S, et al. Comparison of adhesion and virulence of two predominant hospi-
tal-acquired methicillin-resistant Staphylococcus aureus clones and clonal methicillin-susceptible S. aureus iso-
lates. Infect Immun 2008;76:5133–8.
39. Amaral MM, Coelho LR, Flores RP, et al. The predominant variant of the Brazilian epidemic clonal complex of
methicillin-resistant Staphylococcus aureus has an enhanced ability to produce biofilm and to adhere to and in-
vade airway epithelial cells. J Infect Dis 2005;192:801–10.
40. Coenye T, Nelis HJ. In vitro and in vivo model systems to study microbial biofilm formation. J Microbiol Methods
2010;83:89–105.
41. Van Belkum A, Kools-Sijmons M, Verbrugh H. Attachment of Staphylococcus aureus to eukaryotic cells and
experimental pitfalls in staphylococcal adherence assays: a critical appraisal. J Microbiol Methods 2002;48:19–
42.
42. Lynch AS, Robertson GT. Bacterial and fungal biofilm infections. Annu Rev Med 2008;59:415–28.
Chapter 9
146
43. Bordi C, de Bentzmann S. Hacking into bacterial biofilms: a new therapeutic challenge. Ann Intensive Care
2011;1:19.
44. Rijnders BJ, Peetermans WE, Verwaest C, Wilmer A, Van Wijngaerden E. Watchful waiting versus immediate
catheter removal in ICU patients with suspected catheter-related infection: a randomized trial. Intensive Care
Med 2004;30:1073–80.
45. Lebeaux D, Zarrouk V, Leflon-Guibout V, Lefort A, Fantin B. Totally implanted access port-related infections:
features and management. Rev Med Interne 2010;31:819–27.
46. Ramage G, Culshaw S, Jones B, Williams C. Are we any closer to beating the biofilm: novel methods of biofilm
control. Curr Opin Infect Dis 2010;23:560–6.
47. Sabatier C, Ferrer R, Valles J. Treatment strategies for central venous catheter infections. Expert Opin Pharmaco-
ther 2009;10:2231–43.
48. Maki DG, Weise CE, Sarafin HW. A semiquantitative culture method for identifying intravenous-catheter-related
infection. N Engl J Med 1977;296:1305–9.
49. Sherertz RJ, Heard SO, Raad, II. Diagnosis of triple-lumen catheter infection: comparison of roll plate, sonication,
and flushing methodologies. J Clin Microbiol 1997;35:641–6.
50. Slobbe L, El Barzouhi A, Boersma E, Rijnders BJ. Comparison of the roll plate method to the sonication method
to diagnose catheter colonization and bacteremia in patients with long-term tunnelled catheters: a random-
ized prospective study. J Clin Microbiol 2009;47:885–8.
51. McGee DC, Gould MK. Preventing complications of central venous catheterization. N Engl J Med
2003;348:1123–33.
52. Walz JM, Memtsoudis SG, Heard SO. Prevention of central venous catheter bloodstream infections. J Intensive
Care Med 2010;25:131–8.
53. Silver S. Bacterial silver resistance: molecular biology and uses and misuses of silver compounds. FEMS Micro-
biol Rev 2003;27:341–53.
54. Chopra I. The increasing use of silver-based products as antimicrobial agents: a useful development or a cause
for concern? J Antimicrob Chemother 2007;59:587–90.
55. Lansdown AB. Critical observations on the neurotoxicity of silver. Crit Rev Toxicol 2007;37:237–50.
56. Sintubin L, De Gusseme B, Van der Meeren P, Pycke BF, Verstraete W, Boon N. The antibacterial activity of
biogenic silver and its mode of action. Appl Microbiol Biotechnol 2011;91:153–62.
57. Johnston HJ, Hutchison G, Christensen FM, Peters S, Hankin S, Stone V. A review of the in vivo and in vitro
toxicity of silver and gold particulates: particle attributes and biological mechanisms responsible for the ob-
served toxicity. Crit Rev Toxicol 2010;40:328–46.
58. Tolaymat TM, El Badawy AM, Genaidy A, Scheckel KG, Luxton TP, Suidan M. An evidence-based environmental
perspective of manufactured silver nanoparticle in syntheses and applications: a systematic review and critical
appraisal of peer-reviewed scientific papers. Sci Total Environ 2010;408:999–1006.
59. Stevens KN, Crespo-Biel O, van den Bosch EE, et al. The relationship between the antimicrobial effect of cathe-
ter coatings containing silver nanoparticles and the coagulation of contacting blood. Biomaterials
2009;30:3682–90.
60. Knetsch ML, Koole LH. New strategies in the development of antimicrobial coatings: the example of increasing
usage of silver and silver nanoparticles. Polymers 2011;3:340–66.
61. Chen X, Schluesener HJ. Nanosilver: a nanoproduct in medical application. Toxicol Lett 2008;176:1–12.
62. Lankveld DP, Oomen AG, Krystek P, et al. The kinetics of the tissue distribution of silver nanoparticles of differ-
ent sizes. Biomaterials 2010;31:8350–61.
63. AshaRani PV, Low Kah Mun G, Hande MP, Valiyaveettil S. Cytotoxicity and genotoxicity of silver nanoparticles in
human cells. ACS Nano 2009;3:279–90.
64. Shavandi Z, Ghazanfari T, Moghaddam KN. In vitro toxicity of silver nanoparticles on murine peritoneal macro-
phages. Immunopharmacol Immunotoxicol 2010;33:135–40.
65. Bayston R, Mills A, Howdle SM, Ashraf W. Comment on: the increasing use of silver-based products as antim-
icrobial agents: a useful development or a cause for concern? J Antimicrob Chemother 2007;60:447; author re-
ply -8.
General discussion
147
66. Peerlings CC, Hanssen HH, Bevers RT, et al. Heparin release from slippery-when-wet guide wires for intravascu-
lar use. J Biomed Mater Res 2002;63:692–8.
67. Malmsten M, Davoudi M, Schmidtchen A. Bacterial killing by heparin-binding peptides from PRELP and throm-
bospondin. Matrix Biol 2006;25:294–300.
68. Andersson E, Rydengard V, Sonesson A, Morgelin M, Bjorck L, Schmidtchen A. Antimicrobial activities of hepa-
rin-binding peptides. Eur J Biochem 2004;271:1219–26.
69. Shanks RM, Donegan NP, Graber ML, et al. Heparin stimulates Staphylococcus aureus biofilm formation. Infect
Immun 2005;73:4596–606.
70. Wang H, Huang T, Jing J, et al. Effectiveness of different central venous catheters for catheter-related infections:
a network meta-analysis. J Hosp Infect 2010;76:1–11.
71. Casey AL, Mermel LA, Nightingale P, Elliott TS. Antimicrobial central venous catheters in adults: a systematic
review and meta-analysis. Lancet Infect Dis 2008;8:763–76.
72. Boersma RS, Jie KS, Verbon A, van Pampus EC, Schouten HC. Thrombotic and infectious complications of
central venous catheters in patients with hematological malignancies. Ann Oncol 2008;19:433–42.
73. Cohen D, Billingsley M. Europeans are left to their own devices. Bmj 2011;342:d2748.
74. Freemantle N. Commentary: Evaluating and regulating device therapy. Bmj 2011;342:d2839.
75. Kvist M, Hancock V, Klemm P. Inactivation of efflux pumps abolishes bacterial biofilm formation. Appl Environ
Microbiol 2008;74:7376–82.
76. Martinez JL, Sanchez MB, Martinez-Solano L, et al. Functional role of bacterial multidrug efflux pumps in micro-
bial natural ecosystems. FEMS Microbiol Rev 2009;33:430–49.
77. Chung HS, Yao Z, Goehring NW, Kishony R, Beckwith J, Kahne D. Rapid beta-lactam-induced lysis requires
successful assembly of the cell division machinery. Proc Natl Acad Sci U S A 2009;106:21872–7.
78. Singh R, Ray P, Das A, Sharma M. Penetration of antibiotics through Staphylococcus aureus and Staphylococcus
epidermidis biofilms. J Antimicrob Chemother 2010;65:1955–8.
79. Hoiby N, Bjarnsholt T, Givskov M, Molin S, Ciofu O. Antibiotic resistance of bacterial biofilms. Int J Antimicrob
Agents 2010;35:322–32.
149
CHAPTER 10
Summary
Chapter 10
150
Summary
During recent decades it has been discovered that many serious chronic and/or recurrent
infections including endocarditis, osteomyelitis and CVC-related bacteremia are biofilm
associated. Upon initial adherence to a surface, bacteria consequently become embedded
in a selfproduced protective matrix consisting of a mixture of bacterial components and
substances extracted from the environment. The biofilm matrix forms a surrounding pro-
tective barrier against host defences and antibiotic treatment. Unravelling the principles
behind this survival strategy contribute to the goal-oriented design and application of
preventive anti-biofilm technologies in biomaterial science and can lead to novel ways to
reinforce the destruction of pre-existing mature biofilm.
In contrast to Staphylococcus epidermidis biofilm, most Staphylococcus aureus biofilm are
extracellular polysaccharides (mostly referred as PIA, PNAG or slime) independent, as we
found when evaluating 254 S. aureus clinical isolates by means of Congo red agar (CRA)
screening. On CRA plates, only 9% of the strains displayed a distorted morphology, associ-
ated with slime formation (chapter 2). CRA-screening is therefore not useful as a high-
throughput screening assay for S. aureus biofilm formation. To find out whether the ge-
netic background is a predisposing factor for biofilm development, the total accumulated
amount of biomass in polystyrene micro-titre plates within 24 h was related to the genetic
background. At the physiologic blood glucose concentration (0.1%), more than 60% of the
S. aureus strains associated with multilocus sequence typing (MLST) clonal complex (CC)8
produced large amounts of biomass compared to 0–7% for various other clonal lineages.
The strong biofilm forming capacity of the CC8 associated strains was observed both for
bloodstream isolates as well as for their commensal counterparts (chapter 2). Accessory
gene regulator (agr) type II has been previously put forward as predisposing factor for
promoting abudant biofilm formation. We did not find this correlation, since strains with
agr-II genotype includes also genetic backgrounds that did not produce large amounts of
biomass, such as CC15, CC12, and spa-types associated with MLST CC5. However, it was
confirmed that various strains with spa-type t002 were indeed strong biofilm formers. In
general, strains with spa-type t002 have been frequently isolated from patients with or-
thopaedic device-related infections.
It is known that bacteria embedded in biofilm are far more recalcitrant to antibiotics than
their planktonic counterparts. Nevertheless, rifampicin is often used as adjunctive agent to
empirically initiated therapy in situations of clinical suspicion of biofilm involvement. The
rationale for recommending rifampicin administration is based on the ability to penetrate
into biofilm and a presumed activity against dormant bacteria. Rifampicin has been exten-
sively investigated for prosthetic device-related infections and found beneficial in terms of
clinical and/or bacteriological cure rates. However, the number of studies for other indica-
tions is limited and the outcome often contradictory. Moreover, rifampicin resistant strains
have emerged during treatment. As rifampicin diffuses more quickly into the biofilm than
the companion agent, it would be logical that without proper destruction of biomass
Summary
151
rifampicin resistant subpopulations emerge. These could be responsible for persistent or
re-occurring infections. It was hypothesized that if rifampicin possesses pore-forming or
matrix destructive capabilities, rifampicin with a companion agent should be effective
against rifampicin-resistant embedded bacteria. Using a static in vitro biofilm assay, this
concept was evaluated in chapter 3 with oxacillin alone or in combination with rifampicin
against biofilm formed by rifampicin-susceptible or isogenic rifampicin-resistant methicil-
lin-susceptible S. aureus (MSSA). Rifampicin (1 µg/mL) added to oxacillin enhanced the
reduction in biomass produced by most rifampicin-susceptible isolates compared to ox-
acillin alone. However, the greater reductions achieved were highly variable, ranging from
17 to 54% compared to 4% for oxacillin alone. Strains embedded by more biomass at the
moment of initial exposure showed a diminished reduction in viable count. None of the
biofilm formed by isogenic rifampicin-resistant mutants yielded a synergistic reduction in
biomass and viable count upon rifampicin addition to oxacillin. Rifampicin as adjunctive
agent is therefore unwarranted against biofilm formed by rifampicin-resistant strains and is
unpredictable in case of unknown rifampicin susceptibility. Especially since rifampicin
resistance can be easily induced in the absence of a companion agent, which might be the
result of slower diffusion into the biofilm.
Substances suitable for intravenous application that specifically destruct preformed ma-
ture biofilm are under investigation but are not or rarely available on the market yet. A
more straight-forward approach is to prevent biofilm formation. Since biofilm formation
mostly starts with initial attachment to a surface, this step should be hindered to prevent
biofilm formation. As adhesion and thrombus formation are interrelated we aimed in
chapter 4 and 5 to develop coatings for central venous catheters (CVCs) that are both anti-
microbial and anti-thrombogenic as well. For this purpose, hydrophilic bifunctional bio-
compatible coatings containing sodium heparin and silver particles were systematically
developed. The coatings were examined in different in vitro test settings. Blood compatibil-
ity was assessed through thrombin generation and thrombocyte adherence assays, while
exit-site experiments and long-term challenge tests were employed to investigate bacte-
rial adherence and killing. Adhesion of both reference strain (ATCC 29213) and clinical
isolates of S. aureus was strongly inhibited by silver alone, but surprisingly, heparin aug-
mented the antimicrobial activity of silver, while maintaining its anticoagulant function.
The effect of changing the coating’s hydrophilicity, the type of silver stabilization or the
silver content was also assessed. The less hydrophilic SlipSkin® material (SS70:30), with a
NVP/BMA molar ratio of 70/30, was expected to have slower release of embedded heparin,
and –hence– a more sustained antimicrobial effect due to a long-lasting improved mobility
of silver particles. Our expectations were confirmed with the pre-washing experiments,
demonstrating that the longer the pre-wash with milliQ water, the more S. aureus cells
adhered to SS90:10-Ag-Hep at the moment of bacterial exposure, while the number of
adhered bacteria remained constant over time when SS70:30-Ag-Hep specimens were
more intensively pre-washed. Doubling the silver content (SS70:30-Ag2x-Hep) did not im-
prove the long-term prevention of adherence of S. aureus and reduced the viable count in
the time-kill assays to a similar extent as the specimens containing the standard content of
silver (SS70:30-Ag-Hep).
Chapter 10
152
All experimental results taken together with observations described in the literature
pointed out that antimicrobial synergy of heparin and silver is best explained by binding of
Ag+ ions to heparin within the swollen coating, consequently followed by release of Ag+-
heparin ligand-carrier complexes upon immersion of the coatings in an aqueous environ-
ment such as blood.
It is generally accepted that the recalcitrance to antibiotics, and also the inability of the
host’s immune system to clear S. aureus biofilm, cannot be solely attributed to the diffusion
barrier formed by the matrix. Due to the cramped conditions inside the deeper parts of the
biofilm, it is likely that locally a waste disposal problem exists. As described by others, the
matrix structure is partially interspersed with channels that are considered essential for
nutrition and oxygen support and waste drainage. Still, the supply of nutritious substances
is believed to be insufficient, which may clarify the dormancy of embedded bacteria. The
high consumption of nutrients, necessary to produce extracellular polymeric substances
(EPS) for the matrix, very likely exacerbates the waste management difficulty. Enhanced
extrusion of toxic components from the cytosol via upregulation of transmembrane trans-
porters has been suggested as a manner to help pass off toxins.
In first instance we investigated whether certain clonal lineages of S. aureus were more
prone to mutations in the promoter region of the norA gene. NorA is one of the main efflux
transporter proteins in S. aureus. As notified in chapter 6, we showed that the overexpres-
sion of norA was associated with sequence types of all three known NorA alleles, i.e. norA
wt, norA1199 and norAII. But the overexpressing strains were restricted to a few clonal
lineages including (mainly methicillin resistant) S. aureus strains associated with MLST CC5,
CC30 and CC45. The question remained whether these mutations would lead to augmen-
tation of efflux pump expression whenever these strains become embedded into a biofilm.
Recent observations already pointed out that efflux pump inhibitors (EPIs) like reserpine or
thioridazine could prevent in vitro biofilm formation of a single tested CC8-associated S.
aureus strain. We incorporated strains associated with MLST CC8, CC22, CC5 and CC30 in
our in vitro experiments to test whether reserpine and thioridazine could prohibit initial
attachment. We confirmed that under 0.1% glucose conditions thioridazine effectively
prevented biomass formation of CC8 associated strains (chapter 7). Interestingly, this
genetic background was not linked to norA overexpression, since no mutations that could
lead to norA hyperexpression were detected among our collection of CC8 isolates (n=41).
There was no effect of EPIs on pre-mature biofilm of CC22 associated strains. Biomass
production of CC30 and CC45 associated strains was specifically prevented by thioridazine
at a higher supplemental glucose concentration, i.e. 1%. Independent of the genetic back-
ground, reserpine was inferior to thioridazine in the prevention of biomass accumulation
at both tested glucose concentrations. Remarkably, at 1% glucose, biomass formation of
MLST CC8-associated strains was elevated upon exposure to both EPIs. We presume that
thioridazine and reserpine have a non-specific affinity for a variety of transporters, includ-
ing nutrient-importers and toxin exporters. This would consequently implicate that glu-
cose availability and/or metabolism influences the effects of EPIs on biofilm formation.
Blocking glucose importers at 0.1% glucose (extracellular concentration) would result in
suppression of biomass formation, especially among strains with a high carbohydrate
Summary
153
uptake capacity, since a deficiency in intracellular amount of glucose would lead to tricar-
boxylic acid (TCA) cycle activation. Enhancement of TCA cycle intermediates is known to
correlate with biofilm repression. Abundantly imported amounts of carbohydrates at 1%
glucose would theoretically result in intracellular acidification due to an inactive TCA cycle
and the conversion to acetate. Concerning the CC8-associated strains, we hypothesized
that blocking the efflux of acidic metabolites, such as acetate, promotes – instead of pre-
vents – biomass formation, while influx of glucose is not much affected by the excessive
availability in the environmental medium.
In conclusion, the glucose and oxygen presence within microbial biofilm communities
is changing over time, which concomitantly modifies the TCA cycle activity of the embed-
ded bacteria. Unique accumulation molecules and metabolic heterogeneity have been
observed on a large-scale basis by others. We hypothesized that the biofilm life-cycle turn-
over is clonal lineage specific, as is the expression of transmembrane transporters during
the different consecutive stages of biofilm formation. This makes EPIs inappropriate in the
prevention of early biomass accumulation.
The impact of EPIs on pre-existing mature biofilm was also evaluated and biofilm disas-
sembly was less pronounced (CC8) or even absent (CC22, CC30 and CC45) compared to the
prevention of biomass formation. It seems that the penetration barrier of mature biofilm
for most antibiotics also clearly exist for the EPIs themselves.
The biofilm matrix could retain waste materials by improper functioning of down-
regulated transmembrane transporters, but could also keep excreted substances necessary
for their defence in their immediate surrounding vicinity. As noticed previously, entrap-
ment and accumulation of ß-lactamases inside the biofilm occurs. Borderline oxacillin-
resistant S. aureus (BORSA) are potentially interesting in this context, since these strains
have been associated with the hyperproduction of ß-lactamases (penicillinases and/or
methicillinases). In chapter 8 we investigated a collection of BORSA isolates in order to
unravel whether they could be killed under planktonic conditions with a standard ß-lactam
antibiotic, i.e. oxacillin. Time-kill curves analysis was also performed with comparative
alternatives of oxacillin, such as vancomycin, daptomycin and linezolid. Plasmid profile
analysis revealed that a part of our collection of BORSA strains, with oxacillin MIC ≤ 2 mg/L
and including the BORSA reference strain VU94, possesses a pBORa53-like plasmid that
encodes for ß-lactamases including methicillinases. In the other BORSA, with oxacillin MIC
≥ 4 mg/L, pMW2-like penicillinase-encoding plasmids were identified. The pBORa53-like
plasmid containing BORSA showed markedly more regrowth in the time kill curve studies
when testing in the presence of oxacillin. The oxacillin killing activity was also attenuated
against BORSA with oxacillin MIC ≥ 4 mg/L compared to ATCC 29213 (MSSA reference
strain), since the pharmacodynamic parameter (EC50 or εC50) revealed that the potency of
oxacillin was markedly reduced (approximately 10×). Since these BORSA do not produce
methicillinases upon induction by oxacillin, it was anticipated, but yet not proven, that
these BORSA obtained modifications in the penicillin-binding proteins (PBPs) 1, 2 and/or 4
genes. Further investigation into ß-lactam dosing strategies against different type of
BORSA strains is warranted in order to avoid putative therapy failure. We discovered that
not all BORSA are equally interesting for biofilm related research. Especially the pBORa53-
Chapter 10
154
like plasmid-containing BORSA should be evaluated in biofilm experimental settings, since
they are the most sensitive to ß-lactamase (methicillinase) induction. However, a recently
performed pilot experiment (data not shown) revealed that our pBORa53-like plasmid-
containing BORSA, which belonged to the associated MLST clonal lineage CC25 were not
capable to produce large amounts of biomass at 0.1% glucose, when compared to the
MSSA and MRSA isolates associated with MLST CC8. Nevertheless, it could be interesting to
introduce BORSA strains in multi-species biofilm.
Additional to the main purpose of these findings, we examined an alternative method
to evaluate time-kill data. When performing time-kill analysis, it should be recommended
to take pharmacodynamic parameters into account as efficacy markers in addition to tradi-
tional end-points, like “time to 99.9% kill” or presenting the number of remaining CFU/mL
at a certain time point. These traditional methods to present efficacy data do not properly
reflect all available time-kill data, including e.g. regrowth or alterations in the growth rate
over time. By taking the absolute difference in log10 viable count between growth or killing
in the absence and presence of an antibiotic, i.e. the area between the curves over 24h
(ABC0–24h), all available time-kill data could be incorporated in the concentration-effect
parameters.
155
Nederlandse samenvatting
Chapter 10
156
Samenvatting
In de laatste decennia heeft men ontdekt dat chronische en recidiverende infecties waar-
onder endocarditis, osteomyelitis en centraal-veneuze catheter (CVC)-gerelateerde bacte-
riëmieën biofilm geassocieerd zijn. Na initiële aanhechting van bacteriën aan een opper-
vlak zorgen deze er vervolgens voor dat ze zich inkapselen in een zelfgeproduceerde ma-
trix bestaande uit bacteriële componenten en substanties die zijn onttrokken uit hun
nabije omgeving. Deze biofilm matrix waarin de bacteriën zich bevinden biedt bescher-
ming tegen het menselijke afweersysteem en antimicrobiële therapieën. Het ontrafelen
van de mechanistische principes van deze overlevingsstrategie van bacteriën, zal bijdra-
gen aan doelgerichte anti-biofilm toepassingen om al gevormde biofilm te kunnen afbre-
ken en aan het ontwikkelen van biomaterialen die biofilm vorming kunnen voorkomen.
In tegenstelling tot Staphylococcus epidermidis biofilm bestaat de matrix van Staphylococ-
cus aureus biofilm zelden uit extracellulaire polysaccharides, ook wel aangeduid als bacte-
rieel slijm of PNAG (Poly-ß(1,6)-N-acetyl-D-glucosamine). Dit is overeenkomstig onze be-
vindingen met de Congo rood agar (CRA) test van 254 klinische S. aureus isolaten. Bij de
beoordeling van de kolonies op de agar platen bleek dat slechts 9% van de stammen een
afwijkende morfologie, kenmerkend voor slijmvormende stammen, vertoonden (hoofd-
stuk 2). De CRA screenings test is om deze reden niet geschikt als diagnostische bepa-
lingsmethode om biofilmvorming van S.aureus mee aan te tonen. Om na te gaan of de
genetische achtergrond van de bacterie een predisponerende factor is voor biofilmvor-
ming, werd de totale hoeveelheid biomassa die in 24 uur werd geproduceerd gerelateerd
aan de genetische achtergrond van de betreffende bacterie. Bij een fysiologische glucose
concentratie van 0,1% was 60% van de S. aureus stammen met een multilocus sequence
typing (MLST) klonaal complex (CC)8 geassocieerde genetische achtergrond in staat een
bovengemiddeld grote hoeveelheid biomassa te genereren terwijl dit voor stammen met
andere genetische achtergronden maar in 0-7% van de gevallen gold. De goede biofilm
vormende eigenschap van de CC8 geassocieerde stammen werd zowel bij bloedstroom als
commensale isolaten waargenomen (hoofdstuk 2). Recent werd verondersteld dat het
accessory gene regulator (agr) type II een predisponerende factor zou kunnen zijn voor het
bevorderen van overmatige biofilm vorming. Deze correlatie hebben wij niet kunnen
bevestigen. Immers stammen met genetische achtergronden die geen sterke mate van
biomassa vorming vertoonden, zoals spa-typen gerelateerd aan MLCT CC15, CC12 en CC5
behoren tot agr type II. Echter verschillende stammen met spa type t002 gerelateerd aan
CC5 bleken wel degelijk sterke biofilm vormende eigenschappen te bezitten. Dit is over-
eenkomstig de bevindingen in de dagelijkse praktijk: stammen met spa type t002 worden
veelvuldig geïsoleerd bij orthopedische patiënten met kunstmateriaal geassocieerde infec-
ties.
Bacteriën omgeven door een biofilm zijn vele malen meer recalcitrant voor antibiotica dan
wanneer deze in planktonische omstandigheden verkeren. Desalniettemin, wordt rifampi-
cine vaak als additief toegevoegd aan reeds empirisch geïnitieerde antibiotische therapie,
Nederlandse samenvatting
157
met name in situaties met klinische verdenking op biofilm betrokkenheid. De reden voor
de toevoeging van rifampicine is gebaseerd op de eigenschap van goede penetratie in
biofilm en een veronderstelde activiteit tegen bacteriën in “ruste”. De toepassing van
rifampicine bij prothese-gerelateerde infecties is uitvoerig bestudeerd en zowel ten aan-
zien van de kans op klinische verbetering als op vermindering van het aantal bacteriën is
de meerwaarde aangetoond. Echter, het aantal uitgevoerde onderzoeken met rifampicine
voor andere indicaties is beperkt en/of de uitkomsten zijn tegenstrijdig. Ook is gebleken
dat rifampicine resistente subpopulaties kunnen ontstaan tijdens rifampicine behandeling.
Aangezien rifampicine vermoedelijk sneller diffundeert in de biofilm dan het antibioticum
waaraan het is toegevoegd, is het logisch dat zonder goede afbraak van biomassa rifampi-
cine resistente subpopulaties ontstaan. Deze kunnen vervolgens aanleiding geven tot
persisterende of recidiverende infecties. Indien rifampicine in staat zou zijn om poriën te
vormen in de biofilm, of de matrix zou kunnen afbreken, dan zou rifampicine toegevoegd
aan empirische therapie in staat moeten zijn om biofilm gevormd door rifampicine-
resistente S. aureus stammen te verwijderen. Deze hypothese werd in hoofdstuk 3 getest
middels een statische in vitro biofilm opstelling waarbij biofilm, gevormd door rifampicine
gevoelige of isogene rifampicine-resistente methicilline gevoelige S. aureus stammen,
werden blootgesteld aan oxacilline alleen en in combinatie met rifampicine. Rifampicine (1
mg/L) toegevoegd aan oxacilline leidde bij rifampicine-gevoelige stammen in vrijwel alle
gevallen tot een sterkere afname van de geproduceerde biomassa in vergelijking met
blootstelling aan alleen oxacilline. De additionele reductie in biomassa varieerde voor de
combinatie tussen de 17% en 54% in vergelijking met een afname van gemiddeld 4% voor
oxacilline alleen. Stammen die initieel omgeven werden door meer biomassa waren min-
der gevoelig voor behandeling met rifampicine en oxacilline, zoals bleek uit het feit dat het
aantal levende bacteriën per biofilm minder afnam. Een synergistische reductie in biomas-
sa of in aantal levende bacteriën per biofilm ten gevolge van oxacilline en rifampicine
blootstelling werd niet bereikt bij isogene rifampicine resistente mutanten. Om deze reden
is rifampicine niet geschikt als additieve strategie tegen biofilm gevormd door rifampicine
resistente stammen. Tevens is de meerwaarde van rifampicine onvoorspelbaar wanneer de
rifampicine gevoeligheid onbekend is. Bovendien kan rifampicine resistentie op eenvou-
dige wijze worden geïnduceerd in de biofilm in lokale afwezigheid van een ander antibio-
ticum. De kans hierop is aanwezig aangezien andere antibiotica langzamer diffunderen in
de biofilm dan rifampicine. Daarom wordt in de kliniek gewacht met het toevoegen van
rifampicine tot de bacteriële load verlaagd is.
Verschillende stoffen die een reeds gevormde volgroeide biofilm kunnen aantasten of
afbreken, en die intraveneus kunnen worden toegediend, zijn nog niet of nauwelijks op de
markt beschikbaar. Een alternatieve manier om biofilm vorming te lijf te gaan is het voor-
komen van biofilm vorming door middel van preventieve maatregelen. Aangezien biofilm
vorming start met aanhechting aan een oppervlak, is het duidelijk dat deze initiële stap
verhinderd moet worden. Zoals beschreven in hoofdstuk 4 en 5 zijn adhesie en trombus
vorming aan elkaar gerelateerd. Om die reden werd een coating ontwikkeld voor centraal
veneuze katheters (CVCs) die zowel antimicrobieel als antitrombogeen is. Om dit te berei-
ken werden op systematische wijze hydrofiele bifunctionele biocompatibele coatings
Chapter 10
158
ontwikkeld die zowel natriumheparine als zilver deeltjes bevatten. De coatings werden
getest met behulp van verschillende in vitro meetopstellingen. De compatibiliteit met
bloed werd onderzocht door middel van trombine generatie metingen en door microsco-
pisch naar de aanhechting van trombocyten te kijken. Bacteriële aanhechting en afdoding
werden geanalyseerd met behulp van langdurige blootstellingsexperimenten en de zoge-
naamde katheter-tip test. De adhesie van zowel een S. aureus referentie stam (ATCC 29213)
als die van klinische isolaten werd in hoge mate verhinderd door coatings met alleen zilver.
Het effect van zilver werd versterkt indien ook heparine in de coating was opgenomen. De
anticoagulerende werking van heparine werd niet tenietgedaan door de aanwezigheid
van zilver. Het effect van aanpassing van de hydrofiliciteit van de coating, de wijze waarop
het zilver was gestabiliseerd en het veranderen van de hoeveelheid zilver per coating werd
eveneens onderzocht. Het was de verwachting dat de minst hydrofiele samenstelling van
het coatingsmateriaal SlipSkin® (SS70:30), met een NVP/BMA molaire ratio van 70/30, zou
leiden tot een tragere afgifte van heparine. Dit zou dan bijdragen aan een verlengd anti-
microbieel effect vanwege het feit dat de zilverdeeltjes onder invloed van heparine lang-
duriger en tevens gelijkmatiger uit de coating zullen vrijkomen. Dit werd bevestigd met
een experiment waarbij de coatings werden voorgewassen met milliQ water om langdurig
gebruik te simuleren. Aangetoond werd met de SS90:10-Ag-Hep materialen, dat hoe lan-
ger er werd voorgewassen, des te meer S. aureus bacteriën konden aanhechten zodra de
coatings werden blootgesteld aan bacteriën. Daarentegen bleef het aantal aangehechte
bacteriën constant indien de SS70:30-Ag-Hep coatings intensiever werden voorgewassen.
Het verdubbelen van de geïncorporeerde hoeveelheid zilver (SS70:30-Ag2x-Hep) had geen
effect op de lange termijn preventie ter voorkoming van S. aureus aanhechting. Tevens
bleek het aantal bacteriën dat werd gedood per tijdseenheid gelijk aan de coatings met de
standaard hoeveelheid zilver (SS70:30-Ag-Hep).
Wanneer we alle resultaten van de afzonderlijke experimenten gezamenlijk bekijken
en deze vergelijken met de literatuur dan kan de waargenomen antimicrobiële synergie
tussen heparine en zilver het best verklaard worden door binding van de zilverionen aan
de heparinemoleculen in de opgezwollen coating gevolgd door het vrijkomen van de
gevormde complexen na immersie van de coating in een waterige omgeving zoals bloed.
De algemeen geaccepteerde opvatting betreffende de recalcitrantie van S. aureus biofilm
tegen antibiotica en het lichaamseigen afweersysteem is dat dit niet volledig kan worden
toegeschreven aan de diffusiebarrière die gevormd wordt door de biofilmmatrix. De dichte
opeenstapeling van bacteriecellen in de diepere lagen van de biofilm zouden er voor
kunnen zorgen dat lokaal de afvalstoffen niet goed kunnen worden afgevoerd. Anderen
beschreven dat de matrix kanalen bevat die als essentieel worden beschouwd voor de
aanvoer van voedingsstoffen en zuurstof en de drainage van afvalstoffen. Desondanks
wordt de beschikbaarheid van voedingssubstanties als ontoereikend beschouwd en vormt
daarmee de gangbare verklaring voor de latentie van de omgeven bacteriecellen. De grote
interne consumptie van nutriënten tijdens de opbouw- en/of uitbreidingsfase van de
biofilm om voldoende extracellulaire polymere substantie (EPS) te vormen zorgt hoogst-
waarschijnlijk voor een exacerbatie van het afvalstoffenprobleem. Er wordt verondersteld
Nederlandse samenvatting
159
dat via upregulatie van transmembraan transporters toxische componenten uit het cytosol
verwijderd kunnen worden.
In eerste instantie onderzochten wij of bepaalde S. aureus klonale complexen vatbaar-
der zijn voor mutaties in de promoterregio van het norA gen. NorA is één van het meest
voorkomende efflux transporter eiwitten in de celwand van S. aureus. In hoofdstuk 6 is
beschreven dat norA overexpressie voorkomt bij stammen van alle drie de bekende se-
quentie typen van het norA allel, namelijk norA wt, norA1199 en norAII. Echter overexpres-
sie kwam slechts bij een beperkt aantal klonale complexen voor. Dit waren voornamelijk
methicilline-resistente S. aureus geassocieerd met MLST CC5, CC30 en CC45. De cruciale
vraag die resteert is of de mutaties in de promotor regio van het S. aureus norA gen tot
overexpressie van efflux pompen zou leiden indien deze stammen omgeven worden door
een biofilm. Recent is met een enkele CC8-geassocieerde S. aureus stam waargenomen dat
efflux pomp inhibitoren (EPIs) zoals reserpine of thioridazine preventief in vitro biofilm
vorming konden verhinderen. Om te onderzoeken of initiële aanhechting van andere
stammen ook door reserpine en thioridazine voorkomen kan worden werden verschei-
dene MLST CC8, CC22, CC5 en CC30 geassocieerde stammen getest met behulp van in vitro
opstellingen. Zoals beschreven in hoofdstuk 7, kon bevestigd worden dat bij een glucose
concentratie van 0,1% thioridazine inderdaad in staat is om biomassa vorming door CC8
geassocieerde stammen te verijdelen. Opvallend is dat bij deze genetische achtergrond
overexpressie van norA onwaarschijnlijk is aangezien in de gehele collectie van CC8 isola-
ten (n=41) geen mutaties in de promotorregio van norA werden gevonden die gerelateerd
zijn aan norA overexpressie. De EPIs hadden geen effect op reeds volgroeide biofilm van
stammen geassocieerd met MLST CC22. De biomassa productie van stammen geasso-
cieerd met MLST CC30 en CC45 werd specifiek geremd bij een hogere glucose concen-
tratie van het medium, namelijk 1%. Onafhankelijk van de genetische achtergrond bleek
dat bij beide geteste glucose concentraties reserpine inferieur was ten opzichte van thiori-
dazine in de preventie van biomassa vorming. Opmerkelijk is dat bij 1% glucose de bio-
massa vorming van de MLST CC8 geassocieerde isolaten bevorderd werd zodra deze wer-
den blootgesteld aan de EPIs. Mogelijk hebben thioridazine en reserpine een niet specifie-
ke activiteit voor een diversiteit aan transporters, zoals voor het opnemen van voedings-
stoffen en het uitscheiden van toxische componenten. Derhalve impliceert dit dat de
beschikbaarheid van glucose en/of het metabolisme ervan de effecten van EPIs op biofilm
vorming beïnvloedt. Het blokkeren van de glucose toevoerkanalen bij een extracellulaire
glucose concentratie van 0,1% zou moeten resulteren in een vermindering van de biofilm-
vorming, met name bij stammen met een grote opnamecapaciteit van koolhydraten,
aangezien een intracellulaire deficiëntie in glucose zal leiden tot activatie van de tricar-
boxylzuur (TCA) cyclus. Het is bekend dat verhoging van TCA cyclus intermediairen gecor-
releerd is aan biofilm repressie. Overvloedige influx van koolhydraten bij een glucose
concentratie van 1% zou theoretisch resulteren in een intracellulaire verzuring ten gevolge
van een inactieve TCA cyclus en de conversie naar acetaat. Betreffende de CC8-
geassocieerde stammen kwamen we tot de hypothese dat het blokkeren van efflux pom-
pen voor het verwijderen van zure metabolieten zoals acetaat, zou resulteren in een be-
vordering – in plaats van de preventie – van biomassa vorming, terwijl de influx van gluco-
Chapter 10
160
se niet veel beïnvloed zal worden door de overvloedige beschikbaarheid van glucose in
het omgevingsmedium.
Ten gevolge van fluctuatie in de tijd van de hoeveelheid glucose en zuurstof in micro-
biële populaties in biofilm verandert de activiteit van de TCA cyclus van de ingebedde
bacteriën ook voortdurend. Unieke accumulatie moleculen en metabole heterogeniciteit
zijn reeds veelvuldig beschreven in de literatuur. Wij veronderstelden dat de overgang van
de opeenvolgende fasen van biofilmontwikkeling specifiek zijn per genetische achter-
grond en daarmee tevens ook de expressie van de afzonderlijke transmembraan transpor-
ters tijdens de verschillende fasen. Hierdoor zijn EPIs ongeschikt als preventief middel
tegen de initiële accumulatie van biomassa.
Het effect van EPIs op reeds bestaande volgroeide biofilm werd ook bestudeerd. De
afbraak en/of het uiteenvallen van volgroeide biofilm was minder uitgesproken (CC8) of
zelfs volledig afwezig (CC22, CC30 en CC45) in vergelijking met de effecten die zijn bereikt
ter preventie van biomassa vorming. Ogenschijnlijk lijkt de penetratiebarrière van vol-
groeide biofilm die bestaat voor diverse antibiotica ook te bestaan voor de EPIs zelf.
Indien de transmembraan transporters disfunctioneel of downgereguleerd zijn kan de
biofilm matrix afvalmaterialen vasthouden evenals uitgescheiden substanties die noodza-
kelijk zijn voor zelfbescherming van de bacterie in de directe leefomgeving. Zo kunnen ß-
lactamases (penicillinases en/of methicillinases) opgesloten raken en vervolgens accumu-
leren in de biofilm. In dat verband zijn “borderline” oxacilline resistente S. aureus (BORSA)
isolaten potentieel interessant aangezien deze stammen geassocieerd zijn met een over-
productie van ß-lactamases. Hoofdstuk 8 beschrijft de resultaten van afdodingsexperi-
menten van een aantal BORSA isolaten onder planktonische condities met een standaard
ß-lactam-antibioticum zoals oxacilline en met andere vergelijkbare antibiotica zoals dap-
tomycine, vancomycine en linezolid. Met behulp van een plasmide profiel analyse is ge-
bleken dat de BORSA stammen met een oxacilline MIC van ≤ 2 mg/L en de BORSA referen-
tiestam VU94, een pBORa53-achtig plasmide heeft dat codeert voor ß-lactamases inclusief
methicillinases. Bij BORSA isolaten met een oxacilline MIC van ≥ 4 mg/L werd een pMW2-
achtig plasmide geïdentificeerd. De pBORa53-achtige plasmide bevattende BORSA stam-
men vertoonden meer hergroei in de afdodingscurves in een oxacilline bevattend groei-
medium. Ook bij de andere groep BORSA isolaten met een oxacilline MIC van ≥ 4 mg/L was
de afdodingscapaciteit drastisch verminderd in vergelijking met de MSSA referentie stam
ATCC 29213, zoals bleek uit de pharmacodynamische parameter (EC50 of εC50) die sterk
gereduceerd was (ongeveer 10×). Aangezien deze BORSA stammen geen methicillinases
produceren werd gesuggereerd dat in deze isolaten modificaties in de genen van de peni-
cilline-bindende peptiden (PBPs) 1, 2 en/of 4 zijn opgetreden. Meer onderzoek naar de
doseringsstrategie van ß-lactam-antibiotica bij verschillende BORSA stammen lijkt nood-
zakelijk om mogelijk therapiefalen te voorkomen. We hebben vastgesteld dat niet alle
BORSA’s even interessant zijn voor biofilm gerelateerd onderzoek. Met name de pBORa53-
achtige plasmide bevattende BORSA zouden verder geëvalueerd moeten worden onder
biofilm condities, aangezien deze stammen het meest gevoelig zijn voor ß-lactamase
(methicillinase) inductie. Echter, een recent uitgevoerd pilot experiment liet zien dat de
pBORa53-achtige plasmide bevattende BORSA uit onze collectie, welke allemaal geassoci-
Nederlandse samenvatting
161
eerd zijn met MLST CC25, niet in staat zijn grote hoeveelheden biomassa bij 0,1% glucose
te genereren in vergelijking met de MLST CC8 geassocieerde MSSA en MRSA isolaten.
Desondanks kan het relevant zijn om biofilmonderzoek met BORSA stammen uit te voeren,
aangezien deze ook kunnen voorkomen in multi-species biofilm.
Naast de hoofddoelstelling van dit onderzoek is een alternatieve methode geëvalueerd
voor het analyseren van data verkregen uit afdodingscurves. Onze aanbeveling is dat aan
de al bestaande traditionele eindpunten, als markers voor effectiviteit, zoals “de tijd totdat
99,9% van de bacteriën is afgedood”, of het aantal CFU/mL na een bepaalde tijdsperiode,
nieuwe pharmacodynamische parameters toegevoegd zouden moeten worden. De tradi-
tionele eindpunten om effectiviteit in uit te drukken zijn geen goede weergave van het
totaal aan data afkomstig van afdodingsexperimenten. Processen zoals hergroei of ve-
randeringen in de groeisnelheid van de bacteriën tijdens het experiment worden niet
verdisconteerd in de traditionele parameters. Door het absolute verschil in log10 eenheden
levende bacteriën te nemen tussen de groeicurve zonder antibioticum en de afdodings-
curve in aanwezigheid van een antibioticum kan de oppervlakte tussen beide curven over
24 uur berekend worden (ABC0-24h) en daarmee alle beschikbare data verwerkt worden in
een concentratie-effect parameter.
163
List of abbreviations
164
List of abbreviations
aaa Autolysin adhesion protein
AgNP Silver nanoparticle
agr Accessory gene regulator
AIP Auto inducing peptide
ATCC American type culture collection
aur Metalloprotease aureolysin
bap Biofilm-associated protein
bbp Bone sialoprotein-binding protein
BHI Brain heart infusion (broth)
BMA n-butyl methacrylate
BORSA Borderline oxacillin resistant Staphylococcus aureus
BSI Blood stream isolates
BURP Based up on repeat pattern
CAMBH Cation adjusted Mueller Hinton Broth
CA-MRSA Community-associated methicillin/multidrug-resistant Staphylococcus aureus
CC Clonal complex
ccpA catabolite control protein A
c-di-GMP 3’-5’-cyclic diguanylic acid
can Collagen-binding adhesin
CF Cystic fibrosis
ClfA/B Clumping factor A and B
CoNS Coagulase-negative staphylococci
CLSI Clinical laboratory and standards institute
CPS Counts per second (intensity)
CRA Congo red agar
CRBSI Catheter-related bloodstream infections
CTAD Citrate-theophilline-adenosine-dipyridamole
CVC Central venous catheter
Eap Extracellular adherence protein
ebh Extracellular matrix bindinghomoloque
ebpS Elastin-binding protein
ECP Extracellular proteases
eDNA Extracellulair deoxyribonucleic acid
EDTA Ethylenediaminetetraacetic acid
ELISA Enzyme-linked immunosorbent assay
emp Extracellular matrix binding protein
eno Laminin binding protein
EPI Efflux pump inhibitor
EPS Extracellular polymeric substance / Exopolysaccharides
EUCAST European committee on antimicrobial susceptibility testing
FbpA Fibrinogen binding protein
FnbA/B Fibronectin-binding protein A and B
HA-MRSA Healthcare/Hospital-associated methicillin-resistant Staphylococcus aureus
hld δ-hemolysin, PSM-δ
LDH lactate dehydrogenase
MBC Minimal bactericidal concentration
MIC Minimal inhibitory concentration
MLST Multi Locus Sequence Typing
MSCRAMM Microbial surface components recognizing adhesive matrix molecules
MSSA Methicillin Susceptible Staphylococcus aureus
MRSA Methicillin/Multi- Resistant Stahylococcus aureus
NMP N-methylpyrrolidone
Abbreviations
165
PBP Penicillin-binding protein
PEG Polyethylene glycol
PIA Polysaccharide intercellular adhesin
PNAG Poly-ß(1,6)-N-acetyl-D-glucosamine
PRP Platelet-rich blood plasma
PSM Phenol soluble modulin
PVL Panton-Valentine leucocidin
PVP Polyvinylpyrrolidone
rot Repressor of toxins
RT/rt-PCR Reverse transcription polymerase chain reaction or Real time polymerase chain reaction
sarA Staphylococcal accessory regulator
SasG Surface protein G
SCCmec Staphylococcal cassette chromosome mec
scpA/B Cysteine proteases staphopain A/B
SCV Small Colony Variant
sdrC/D/E Serine-aspartate repeat-containing proteins C, D and E
spa Staphylococcal protein A
spoVG Stage V sporulation protein G
SS SlipSkin® (coating)
sspA V8 serine protease
ST Sequence type
TCA Tricarboxylic acid (cycle)
TSB Trypticase soy broth
UTI Urinary tract infection
XPS X-ray photoelectron spectroscopy
175
List of publications
Croes S, Deurenberg RH, Boumans MLL, Beisser PS, Neef C, Stobberingh EE.
Staphylococcus aureus biofilm formation at the physiologic glucose concentration depends on the S. aureus lineage.
BMC Microbiology. 2009; 9: 229.
Croes S, Beisser PS, Terporten PH, Neef C, Deurenberg RH, Stobberingh EE.
Diminished in vitro antibacterial activity of oxacillin against clinical isolates of borderline oxacillin resistant Staphylo-
coccus aureus.
Clinical Microbiology and Infection. 2010; 16: 979–85.
Croes S, Beisser PS, Neef C, Bruggeman CA, Stobberingh EE.
Unpredictable effects of rifampicin as adjunctive agent in elimination of rifampicin-susceptible and -resistant Staphy-
lococcus aureus grown in biofilm.
Antimicrobial Agents and Chemotherapy. 2010; 54: 3907–12.
Stevens KNJ, Croes S, Boersma RS, Stobberingh EE, van der Marel C, van der Veen FH, Knetsch MLW, Koole LH.
Hydrophilic surface coatings with embedded biocidal silver nanoparticles and sodium heparin for central venous
catheters.
Biomaterials. 2011; 32: 1264–9.
Croes S, Stobberingh EE, Stevens KNJ, Knetsch MLW, Koole LH.
Antimicrobial and anti-thrombogenic features combined in hydrophilic surface coatings for skin-penetrating cathe-
ters. Synergy of co-embedded silver particles and heparin.
ACS Applied Materials & Interfaces. 2011; 3: 2543–50.
Croes S, Wolffs PFG, Neef C, Bruggeman CA, Stobberingh EE.
Inhibition of membrane-transporters as a potential approach against Staphylococcus aureus biofilm is hampered by
adaptation to nutrient availability. Submitted.
Wolffs PFG, Croes S, Deurenberg RH, van Leerdam D, Beuken E, Stobberingh EE.
Large-scale evaluation of mutations in norA gene and its promoter leading to overexpression of the multidrug efflux
pump NorA in Staphylococcus aureus. Submitted.
Croes S, Stolk LM.
Vancomycin therapeutic guidelines: closer examination of neonatal pharmacokinetics.
Clinical Infectious Diseases. 2011; 53: 966–7.
Croes S, Neef C, Stolk LM.
Vancomycin 24h-AUC calculation – both with maximum a posteriori Bayesian estimation and with a nomogram.
Annals of Pharmacotherapy. 2011; 45: 1313–4.
Croes S, Koop AH, van Gils SA, Neef C.
Efficacy, nephrotoxicity and ototoxicity of aminoglycosides, mathematically modelled –for modelling-supported
therapeutic drug monitoring–.
European Journal of Pharmaceutical Sciences. 2012; 45: 90-100.
Filipeanu CM, Henning RH, Buikema H, van Buiten A, Croes S, de Zeeuw D, Nelemans SA.
Contribution of receptor internalization and recycling to angiotensin AT1 receptor desensitization to rat aorta
contractility. Submitted.
