Content uploaded by Lei Lei
Author content
All content in this area was uploaded by Lei Lei on Oct 19, 2022
Content may be subject to copyright.
AUTHOR COPY ONLY
© 2022 Society for Reproduction and Fertility https://doi.org/10.1530/REP -22-0169
ISSN 1470–1626 (paper) 1741–7899 (online) Online version via https://rep.bioscientifica.com
REPRODUCTION
-22-0169
164 5
RESEARCH
Inhibition of METTL5 improves preimplantation development
of mouse somatic cell nuclear transfer embryos
Luchun Zhang , Meng Yuan, Xingwei Huang, Qianzi Cao, Shaogang Huang , Ruizhen Sun
and Lei Lei
Department of Histology and Embryology, Harbin Medical University, Harbin, Heilongjiang, China
Correspondence should be addressed to L Lei; Email: lei086@ems.hrbmu.edu.cn
*(L Zhang and M Yuan contributed equally to this work)
Abstract
In brief: Several factors affect the reprogramming efficiency of nuclear transfer embryos. This study shows that inhibiting 18S rRNA
m6A methyltransferase METTL5 during nuclear transfer can improve the developmental rate of nuclear transfer embryos.
Abstract: N6-methyladenosine (m6A) is one of the most important epigenetic modifications in eukaryotic RNAs, which regulates
development and diseases. It is identified by several proteins. Methyltransferase-like 5 (METTL5), an enzyme that methylates
18S rRNA m6A, controls the translation of proteins and regulates pluripotency in embryonic stem cells. However, the
functions of METTL5 in embryonic development have not been explored. Here, we found that Mettl5 was upregulated in
somatic cell nuclear transfer (SCNT) embryos compared with normal fertilized embryos. Therefore, we hypothesized that
METTL5 knockdown during the early stage of SCNT would improve the developmental rate of SCNT embryos. Notably,
injection of Mettl5 siRNA (si-Mettl5) into enucleated oocytes during nuclear transfer increased the rate of development and
the number of cells in blastocysts. Moreover, inhibition of METTL5 reduced the activity of phosphorylated ribosomal protein
S6, decreased the levels of the repressive histone modification H3K27me3 and increased the expression of activating
histone modifications H3K27ac and H3K4me3 and mRNA levels of some 2-cell-specific genes. These results expand our
understanding of the role of METTL5 in early embryonic development and provide a novel idea for improving the efficiency
of nuclear transfer cloning.
Reproduction (2022) 164 221–230
Introduction
Somatic cell nuclear transfer (SCNT) is a technique
that can reprogram differentiated somatic cells to
obtain pluripotent stem cells or produce new animals.
It has broad application prospects in the breeding
of endangered species and regenerative medicine.
However, the developmental ability of cloned embryos
is poor. Abnormal epigenetic modification has been
linked to the inhibition of SCNT embryo development
(Matobaetal. 2014).
N6-methyladenosine (m6A) is one of the most
prevalent RNA modifications. It can be recognized by
a set of m6A binding proteins and regulates signaling
pathways to influence the cell fate (Batistaetal. 2014,
Guoetal. 2017), growth and development of animals
(Zhengetal. 2013, Ivanovaetal. 2017). The m6A RNA
modification is a reversible process coordinated by m6A
methyltransferases (‘writers’, including METTL3/5/14,
WTAP), demethylases (‘erasers’, including FTO,
ALKBH5) and binding proteins (‘readers’, including
YTHDF1/2/3, IGF2BPs). It has been reported that m6A
is involved in the differentiation of embryonic stem
cells (ESCs) (Huang et al. 2019), reprogramming of
induced pluripotent stem cells (iPSCs) (Aguilo et al.
2015) and development of early embryos (Cao et al.
2021, Changetal. 2022). For example, inhibiting m6A
reader YTHDC1 increased the number of 2-cell-like
(2C-like) cells in ESC (Chenetal. 2021). Inhibition of
another reader YTHDF2 increased the expression level
of somatic cell-related genes during iPSC induction
(Liuetal. 2020). Furthermore, YTHDF2 regulates m6A-
dependent maternal transcript dosage during oocyte
maturation (Ivanova et al. 2017). Knockout of Ythdf2
in zebrafish embryos decelerated the decay of m6A-
modified maternal mRNA and impaired early embryo
development (Zhaoetal. 2017). Furthermore, it has been
found that METTL3 negatively modulates autophagy
to support porcine preimplantation development (Cao
etal. 2021).
The most important function of nucleoli is ribosome
biogenesis. In eukaryotes, RNA pol Ι transcribes rRNA
gene (rDNA) to form 47S pre-rRNA, then, the rRNA
precursor is processed to generate 28S, 18S and
AUTHOR COPY ONLY
https://rep.bioscientifica.com
L Zhang, M Yuan and others
222
Reproduction (2022) 164 221–230
5.8S rRNA, which form an integral component of the
ribosome. rRNA is crucial for protein translation, and
rRNA modifications influence the structure and function
of ribosomes. The 80S human ribosome consists of
over 200 modifications, making it one of the sources
of ribosome heterogeneity (Van Tran et al. 2019).
However, the function of these modifications is not fully
understood.
Methyltransferase-like 5 (METTL5) is an 18S rRNA
m6A1832 methyltransferase. It has a typical m6A-specific
methyltransferase motif and forms a heterodimer with
TRMT112, a protein with a zinc-binding domain and a
central domain, to execute its function (Van Tran etal.
2019). A previous study reported that bi-allelic variants
in METTL5 cause autosomal-recessive intellectual
disability and microcephaly (Richard et al. 2019).
Another report showed that Mettl5 was enriched in the
nervous system in flies (Leismann et al. 2020). In the
field of stem cell research, METTL5 has been associated
with ubiquitinated protein FBXW7 to maintain stemness
and differentiation potency in mouse ESC (Ignatovaetal.
2020, Xingetal. 2020).
Our previous report indicated that transient inhibition
of RNA pol Ι using CX5461 in donor cells restrained
ribosome biogenesis in somatic cells, which improved
the developmental rate of SCNT embryos (Liao et al.
2020). Therefore, we speculated that inhibition of
METTL5 during the early stage of SCNT embryos can
also decrease the activity of ribosomes in donor cells,
thereby facilitating the repression of somatic genes.
Meanwhile, METTL5 suppression may increase the
expression of some 2C-specific genes, to improve the
developmental rate and blastocyst quality of SCNT
embryos.
Materials and methods
Animals and ethics approval
B6D2F1 female/male mice were purchased from Vital River
(Beijing, China). All animal care guidelines conformed to the
Guide for the Care and Use of Laboratory Animals. Mice were
housed in a room adjusted to a 12 h light/12 h darkness cycle
and provided with enough food and water in a temperature
room. All animal experiments in this study were implemented
in line with the Guidelines for Animal Experiments of Harbin
Medical University (HMUIRB20190011). All methods were
approved by the Harbin Medical University Ethics Committee.
MEFs culture and treatments
Mouse embryonic fibroblasts (MEFs) were isolated from
B6D2F1 fetus at E13.5 dpc. The cells were cultured in DMEM
(Gibco) containing 15% fetal bovine serum (FBS, BI), 2 mM
l-glutamine (Gibco) and 100 IU/mL penicillin–streptomycin at
37°C under a 5% CO2 atmosphere.
Mettl5 siRNA (si-Mettl5; GenePharma, Suzhou, China) was
diluted in nuclease-free water to a concentration of 20 μM,
and Lipofectamine 3000 (Invitrogen, L3000-015) was used for
siRNA transfection. The samples were collected at 48 h post-
transfection for further analyses. The siRNA oligonucleotides
sequence information is presented in Table 1.
Collection of MIIⅡ oocytes and sperms
Eight- to 10-week-old female B6D2F1 mice were sequentially
injected with 7.5 IU pregnant mare serum gonadotropin
(NSH, Ningbo, China), followed by 7.5 IU human chorionic
gonadotropin (hCG, NSH, ) at an interval of 48 h. Cumulus–
oocyte complexes were collected into HEPES-CZB at 14 h
after hCG injection and digested in HEPES-CZB containing 0.1
mg/mL hyaluronidase (Sigma, H4272). The oocytes were then
transferred to the CZB medium supplemented with glucose
(CZBG) at 37°C under a 5% CO2 atmosphere. Cumulus cells
were centrifuged and resuspended in HEPES-CZB medium
containing 3% polyvinylpyrrolidone (PVP, Sigma) as SCNT
donors (Gaoetal. 2003).
The sperms were collected from 8- to 10-week-old male
B6D2F1 mice. To obtain mature sperms, the epididymides of
the mice were removed and cut into small pieces in a dish
containing a drop of HEPES-CZB, and the samples were
transferred to a suitable centrifugal tube and centrifuged
at low speed until the fragment sank to the bottom of the
tube. Next, the tube was incubated at 37°C under a 5% CO2
atmosphere for 5 min, and the supernatant was collected for
intracytoplasmic sperm injection (ICSI).
Construction of SCNT and ICSI embryos
Donor cell or sperm drops were added to a manipulation
dish containing one drop of 10% PVP, several drops of 3%
PVP and several drops of HEPES-CZB containing 5 μg/mL
cytochalasin B (CB, Aladdin, Shanghai, China; C113160)
for micromanipulation. All drops were covered with
sterile mineral oil (Thermo Fisher, O121-20). The ICSI and
SCNT technologies were carried out using a PIEZO-driven
micromanipulator as previously described. For nuclear
transfer, one-step micromanipulation was used. The Mettl5
siRNA was dissolved in RNA-free water and mixed with
cumulus cells to a final concentration of 20 μmol/L. The
mixture of cumulus cells and Mettl5 siRNA was injected
into MⅡ oocytes after several piezo pulses penetrated the
zona and the oolemma of the oocytes, and the spindles of
the oocytes were immediately removed by a pipette using a
negative suction. The reconstructed embryos were incubated
in CZBG medium for 30 min before activation. Activation
was performed in Ca2+-free CZB containing 10 mM strontium
chloride (SrCl2), 5 μg/mL CB. After 6 h of activation, the
embryos were transferred to several drops of potassium
simplex optimization medium (KSOM) and covered with
Table 1 The siRNA sequence of Mettl5
Primers Sequence
Mettl5-1 5’-GCCCAAGUUACUUCUAGAATT-3’
Mettl5-2 5’-GUUAAAGCUUAAGGAACUATT-3’
Mettl5-3 5’-GCGGUUGCAGAUCUAGGAUTT-3’
AUTHOR COPY ONLY
https://rep.bioscientifica.com
Knockdown of METTL5 improves development of somatic cell nuclear transfer embryos 223
Reproduction (2022) 164 221–230
sterile mineral oil at 37°C under a 5% CO2 atmosphere (Liao
etal. 2020, Huangetal. 2021).
The construction procedure for ICSI embryos was similar
to that of embryos produced by SCNT, except that the donor
cells were replaced with sperm heads, which were isolated by
several piezo pulses, and the spindles were not removed. After
ICSI, the embryos were transferred to several drops of KSOM
and covered with sterile mineral oil at 37°C under a 5% CO2
atmosphere for long-term culture.
RNA extraction and quantitative reverse transcription
PCR
Embryos at different stages were divided into several groups
(20 embryos per group) and placed in an RNAse-free
centrifuge tube. QIAGEN RNeasy Mini Kit (Qiagen, 74104)
was used for total RNA extraction. Then, the TransScript® All-
in-One First-Strand cDNA Synthesis SuperMix kit was used
for qPCR (Transgen, Beijing, China; AT34102) to synthesize
cDNA. Quantitative PCR (qPCR) was performed as previously
described using SYBR Green Q-PCR SuperMix (Transgen,
AQ131) on a CFX96 Real-time System (Bio-Rad). The primer
sequences for RT-qPCR are listed in Table 2. The relative mRNA
expression levels were calculated using the 2−ΔΔCt method.
Immunostaining
Different groups of embryos were added to 96-well plates
containing 4% paraformaldehyde for 2 h at room temperature
and then permeabilized thrice for 5 min with phosphate buffer
saline solution with 0.25% Triton X-100 (PBST). After washing,
the embryos were transferred to new wells containing PBST
with 4% BSA (Sigma, A3311) at room temperature for 2 h to
block unspecific binding. Then the embryos were incubated
overnight at 4°C with primary antibodies against METTL5
(Affinity, Jiangsu, China; #DF13232, 1:100), H3K27me3 (Cell
Signaling Technology, #9733, 1:500), H3K27ac (Cell Signaling
Technology, #8173, 1:100), H3K4me3 (Cell Signaling
Technology, #9751, 1:200), PS6 (Cell Signaling Technology,
#4858, 1:100) and UTX (Cell Signaling Technology, #33510,
1:200) diluted in PBST with 4% BSA. They were then washed
thrice for 5 min with PBST and then incubated with appropriate
secondary antibodies (Invitrogen, A10040, 1:200) diluted in
PBST with 4% BSA for 1 h. The DNA was stained for 10 min with
DAPI (Beyotime, C1005). Finally, samples were imaged using
laser scanning confocal microscope (Nikon, C2). Fluorescence
intensities were measured as previously described (Yangetal.
2018). Briefly, the nuclei of embryos were identified by DAPI
staining, and the immunofluorescence levels in the nuclei or
the whole embryos were calculated with Image J.
SELECT
The SELECT approach was performed as previously described
(Xiaoetal. 2018, Xing etal. 2020). Briefly, total RNA (1 ng)
extracted from MEFs was mixed with 40 nM up/down primer
and 5 μM dNTP in 17 μL 1× CutSmart buffer. The primer
sequences for SELECT are listed in Table 3. SELECT qPCR was
performed with the following program: 90°C for 1 min, 80°C
for 1 min, 70°C for 1 min, 60°C for 1 min, 50°C for 1 min
and 40°C for 6 min. Then, a 3 μL mixture containing 0.01 U
Bst2.0 DNA polymerase (New England Biolabs (NEB), USA,
M0537S), 0.5 U SplintR ligase (NEB, M0375S) and 10 nmol
ATP (NEB, P0756S) was added to the former reaction mixture
and incubated at 40°C for 20 min and denatured at 80°C for
20 min.
The qPCR was performed as previously described using
SYBR Green Q-PCR SuperMix (AQ131; Transgene) on a
CFX96 Real-time System (Bio-Rad). Data were analyzed using
Bio-Rad CFX software.
RNA-seq data analysis
The SCNT and ESC RNA-seq data were analyzed as previously
described (Huang et al. 2021). Briefly, raw RNA-seq data
were downloaded from the NCBI-GEO database (GSE70605,
GSE144346). The adapters were pre-filtered using Trimmomatic
(v0.39) before mapping. For RNA-seq data analysis, filtered
reads were mapped to the GRCm38/mm10 mouse genome
using Hisat2 (v2.1.0) with the parameter ‘−k 20’. Genes were
annotated according to the Ensembl database. Transposable
element annotations were from the UCSC Genome Browser
(RepeatMasker). Reads were counted using feature counts
with the parameter ‘-O -M - fraction’ to retain multi-mapped
reads. The count matrix was used as input data for DESeq. The
volcano map was drawn using the GraphPad Prism 8.
Statistical analysis
Two-tailed unpaired t-tests were used for statistical analysis.
A P < 0.05 was considered statistically significant. The results
were expressed as mean ± standard deviation (s.d).
Table 2 Primers used in quantitative real-time PCR.
Primers
Sequence
Forward Reverse
U6 ATTGGAACGATACAGAAGAAGATT GGAACGCTTCACGAATTTG
18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG
47S CTCCTGTCTGTGGTGTCCAA GCTGGCAGAACGAGAAGAAC
Mettl5 AACTAGAGAGTCGCCTGCAAG CTGCAACCGCTTTGTTTTCAA
Trmt112 CGTAAGCCTTTGCAGTCTCCC TTCATGTTGTCACAGCGGAGC
Zcchc4 GTGCTGCTCTGAAGATCACG TGCACTTGTCACACCGAAAG
MERVL ATCTCCTGGCACCTGGTATG CGGAAATGTGAGCGTGTTCTC
Zscan4 AAATGCCTTATGTCTGTTCCCTATG TGTGGTAATTCCTCAGGTGACGAT
Tdpoz4 ACCCAAGACCTGCAATCAAG ATTCATGGCCAGCTACCAAC
AUTHOR COPY ONLY
https://rep.bioscientifica.com
L Zhang, M Yuan and others
224
Reproduction (2022) 164 221–230
Results
METTL5 expression was different between SCNT and
ICSI embryos
To explore the function of rRNA m6A modification in early
embryonic development, we compared the changes of
18S and 28S rRNA m6A methyltransferases at different
stages of early embryonic development by analyzing
RNA-seq data from the GEO database (Liuetal. 2016)
and compared the data with SCNT embryos at two-
cell and four-cell stages. The results showed that from
two-cell to blastocyst stage, the expression of 18S
rRNA methyltransferase METTL5 and its heterodimer
TRMT112 and 28S rRNA methyltransferase ZCCHC4
in fertilized embryos increased gradually, which was
higher in SCNT embryos at the two-cell or four-cell
stage (Fig. 1A, B and C).
Next, RNA expression of these enzymes was
explored in ICSI and SCNT embryos at various stages
using RT-qPCR. The results for the two-cell and four-
cell embryos were in agreement with the RNA-seq data
(Fig. 1D and E). Since TRMT112 is the heterodimer of
METTL5, and Zcchc4 is the maternal transcript, we
explored the 18S rRNA methyltransferase METTL5,
which is gradually transcribed after zygotic genome
activation. RT-qPCR results showed that Mettl5 in SCNT
embryos was significantly higher than that in the ICSI
embryos at the 2-cell stage.
Knockdown of METTL5 improved the developmental
rate of SCNT embryos
Based on RNA-seq results, we speculated that
Mettl5 inhibition might improve the preimplantation
development of SCNT embryos. Therefore, SCNT was
performed using a mixture of si-Mettl5 and cumulus
cells to block the function of METTL5 (Fig. 2A).
RT-qPCR (Fig. 2B) and immunofluorescence (IF) (Fig.
2C, D, E and F) analyses showed that the expression of
METTL5 was successfully decreased. Furthermore, the
blastocyst rate of SCNT embryos treated with si-Mettl5
was significantly improved (Fig. 2G, H and Table 4),
and an increase in embryonic quality in terms of higher
cell number than that of control, but still lower than
that of ICSI embryos, was observed (Fig. 2I and J). Then,
we used SELECT technology to detect the numbers
of m6A modifications at position 1832 on 18S rRNA;
since it is hard to collect a large number of embryos for
SELECT detection, we used MEF cells to detect the m6A
modification, and the result showed that the number of
m6A modifications in MEF cells treated with si-Mettl5
was significantly reduced (Supplementary Fig. 1A and
B, see section on supplementary materials given at the
end of this article).
Mettl5 knockdown reduced ribosomal activity in two-
cell embryos
The activation of ribosome protein S6 kinase (S6K) by
T389 phosphorylation is important for translation. It has
been reported that the phosphorylation level of S6K in
HEK293T and HeLa cells was significantly reduced with
METTL5 loss (Rongetal. 2020). Thus, we hypothesized
that Mettl5 inhibition in SCNT embryos may also
influence the level of phospho-S6 ribosomal protein
(pS6), which is phosphorylated by S6K. We performed
RT-qPCR to examine the expression of 47S precursor
rRNA and 18S rRNA at the 4-cell stage of SCNT embryos
and did not observe noticeable changes (Fig. 3A and
B). IF analysis showed that the expression of pS6 at the
Table 3 Primers used for SELECT.
Primers
Sequence
Up Down
18S m6A1825 TAGCCAGTACCGTAGTGCGTGCCTACGGAAAC phos/TTTACTTCCTCTAGATAGTCAAGTTCGA
18S m6A1832 TAGCCAGTACCGTAGTGCGTGGGTTCACCTAC phos/TACGACTTTTACTTCCTCTAGATAGTCA
SELECT qPCR F: ATGCAGCGACTCAGCCTCTG R: TAGCCAGTACCGTAGTGCGTG
F, forward; R, reverse.
Figure1 The expression trend of genes related
to rRNA methylation in early embryos. (A, B
and C) RNA-seq data shows the expression
trend of Mettl5, Trmt112 and Zcchc4 in SCNT
or fertilized embryos (GSE70605). (D and E)
RT-qPCR analysis of Mettl5, Trmt112 and
Zcchc4 mRNA expression trend in SCNT or
ICSI embryos. *P < 0.05, **P < 0.01 by
Student’s t-test.
AUTHOR COPY ONLY
https://rep.bioscientifica.com
Knockdown of METTL5 improves development of somatic cell nuclear transfer embryos 225
Reproduction (2022) 164 221–230
pseudo-pronucleus 3 (PPN3) stage was dramatically
decreased (Fig. 3C and D) and partially recovered at
two-cell stages as expected (Fig. 3E and F). Since a high
level of RNA translation occurs at the four-cell stage,
we believed that decreasing Mettl5 may increase the
blastocyst rate by reducing the translation of somatic-
related genes in donor cells at pseudo-pronucleus and
2-cell stages.
Mettl5 knockdown altered the level of histone
modification in SCNT 2-cell embryos
Based on published Mettl5-KO Ribo-seq data, we
found that EZH2, a methyltransferase of inhibitory
histone marker H3K27me3, was significantly reduced,
and KDM5A, a demethylase of activating histone
marker H3K4me3, was also lower than that of the
control group (Xing et al. 2020), suggesting higher
chromatin openness. Hence, we hypothesized that
the same phenomenon might be observed in siMettl5
SCNT embryos. First, we analyzed Mettl5-KO RNA-seq
data downloaded from GEO datasets (GSE144346),
and the results revealed that Ezh2 was lower in the
KO-Mettl5 group and Kdm6A and Kdm6B showed
a contrary tendency (Fig. 4A). Meanwhile, H3K4
methyltransferases Kmt2a and Kmt2d increased
significantly, while demethylases Kdm5d and Kdm1b
decreased (Fig. 4A). Because the increase of KDM6A
has been reported to improve the developmental rate of
SCNT blastocysts (Yang etal. 2018), we chose KDM6A
to measure the expression level of KDM6A in SCNT and
ICSI 2-cell embryos. Consistent with the RNA-seq data,
the expression of KDM6A in the interference group was
Figure2 Mettl5 knockdown improved the
development rate of SCNT embryos. (A)
Schematic view of SCNT method. (B) RT-qPCR
analysis of Mettl5 mRNA level in SCNT 2-cell
embryos injected with control si-RNA or
si-Mettl5. The concentration of si-RNA is 20
μmol/L. (C and D) Immunofluorescence
images (C) and the fluorescence intensity
quantification (D) of METTL5 in control or
si-Mettl5 SCNT pseudo-pronucleus 5 (PPN5)
embryos (Scale bar, 50 μm). (E)
Immunofluorescence images of METTL5 in
control or si-Mettl5 SCNT 2-cell embryos. The
bright field images represent a pool of
embryos that were stained for METTL5 (Scale
bar, 50 μm), and a representative stained
embryo is shown in immunofluorescence
images (Scale bar, 50 μm). (F) The fluorescence
intensity quantification of METTL5 in control
or si-Mettl5 SCNT 2-cell embryos. (G and H)
The preimplantation development rate (G) and
representative images (H) of SCNT embryos
injected with control si-RNA or si-Mettl5. (I)
Immunofluorescence images of DAPI in
control or si-Mettl5 SCNT or ICSI embryos
(Scale bar, 100 μm). (J) The number of
DAPI-stained cell per embryo. **P < 0.01,
***P < 0.001 by Student’s t-test.
Table 4 The development rate of SCNT embryos derived from
control or si-Mettl5. The number of cleaved, reconstructed embryo
was considered to be 100% in each group. Data are presented as
mean percent ± s.d.
Two-cell Four-cell Mo Bl
Con-SCNT
(126) 100% 84.5 ± 3.90 51.8 ± 12.67 26.3 ± 4.53
si-SCNT
(134) 100% 79.5 ± 5.02 56.5 ± 11.71 43.4 ± 7.56 **
**P < 0.01 by Student’s t-test.
Bl, blastocyst; Con-SCNT, SCNT control group; Mo, morula; si-SCNT,
SCNT embryos treat with Mettl5 interfering RNA.
AUTHOR COPY ONLY
https://rep.bioscientifica.com
L Zhang, M Yuan and others
226
Reproduction (2022) 164 221–230
significantly higher than that in the control group, but
contrary to our expectations, it was also higher than
that in the ICSI group (Fig. 4B and F). Meanwhile,
we found that the localization of KDM6A changed
between different groups. KDM6A was located in the
nucleus and cytoplasm in the SCNT group, but it was
mainly located in the nucleus in the ICSI group (Fig.
4B and F). To further test our hypothesis, we performed
IF staining with H3K27me3, H3K27ac and H3K4me3
antibodies in SCNT and ICSI two-cell embryos (Fig.
4C, D and E) and found that the expression level of
H3K27me3 in SCNT two-cell embryos injected with
si-Mettl5 was significantly reduced compared with the
control group, which was closer to the ICSI expression
level (Fig. 4G). In addition, the expression levels of
H3K27ac and H3K4me3 were significantly higher in
the si-Mettl5 group compared with the control group
(Fig. 4H and I).
Mettl5 knockdown increased the mRNA expression
level of some 2C-specific genes in SCNT two-cell
embryos
Recent studies found that inhibiting the activity of RNA
polymerase Ι by rapamycin could lead to nucleolar
stress, thereby increasing the expression of the 2C-like
genes (Yu et al. 2021). Since METTL5 knockout
decreased the ribosomal activity (Ignatova etal. 2020),
we hypothesized that it also promotes 2C-like gene
expression. We analyzed RNA-seq data of Mettl5-KO
ESC, and as speculated, the expression of 2C-like genes
was significantly increased (Fig. 5A). Subsequently, we
performed SCNT with Mettl5 siRNA. To observe the
expression changes in 2C-specific genes, we collected
SCNT 2-cell embryos and perform qPCR, and the results
showed that RNA expression of 2C-specific genes was
higher in the interference group than in the control
group (Fig. 5B).
Discussion
METTL5 and TRMT112 form a heterodimer, which can
add a methyl group to 18S rRNA. Currently, it has been
found that METTL5 is related to the pluripotency of
ESC, and its deletion impairs the differentiation of ESC
to form embryonic bodies and reduces the number of
polyribosomes (Ignatova etal. 2020). Although METTL5
regulates ribosomal activity and translation, its role in
early embryonic development has not been reported.
As for reprogramming, SCNT embryo shows different
patterns in gene expression from normal fertilized
embryos (Zhengetal. 2012). In addition to chromatin
remodeling and nucleolar precursor formation,
some genes are inactivated after transplantation into
enucleated oocytes (Zheng et al. 2012). Our finding
showed that the expression of Mettl5 in SCNT 4-cell
embryos is higher than normal fertilized embryos, and
reduced Mettl5 expression facilitated the development
rate of SCNT embryos. Given that METTL5 regulates
the activity of ribosomes, we hypothesized that the
increased SCNT embryonic development rate is related
to the inhibition of somatic-related translation.
To test this hypothesis, we used Mettl5 siRNA
and mixed it with donor cells before being injected
into oocytes during nuclear transfer. RT-qPCR and
IF analyses confirmed the successful knockdown of
Mettl5. Meanwhile, the results of IF also confirmed
the findings from a previous study that METTL5 is
located in both the nucleus and cytoplasm (Richard
etal. 2019), indicating that METTL5 not only mediates
18S rRNA modification in the nucleus but may also
perform other undiscovered functions in the cytoplasm.
Figure3 Mettl5 knockdown reduced the
ribosome activity of two-cell embryos. (A and
B) RT-qPCR analysis of 18S rRNA and 47S
rRNA level in SCNT four-cell embryo injected
with control si-RNA or si-Mettl5. (C and D)
Immunofluorescence images (C) and
fluorescence intensity quantification (D) of pS6
in control or si-Mettl5 SCNT PPN3 embryos.
(E) Immunofluorescence images of pS6 in
control or si-Mettl5 SCNT or ICSI two-cell
embryos. The bright field images represent a
pool of embryos that were stained for pS6
(Scale bar, 50 μm), and a representative stained
embryo is shown in immunofluorescence
images (Scale bar, 50 μm). (F) The fluorescence
intensity quantification of pS6 in control or
si-Mettl5 SCNT or ICSI 2-cell embryos (Scale
bar, 50 μm). **P < 0.01, ***P < 0.001 by
Student’s t-test.
AUTHOR COPY ONLY
https://rep.bioscientifica.com
Knockdown of METTL5 improves development of somatic cell nuclear transfer embryos 227
Reproduction (2022) 164 221–230
To explore the changes of m6A modification in 18S
rRNA, we used the SELECT technology, but due to the
small number of SCNT embryos, the standard embryo
RNA concentration could not be accurately measured,
which affected the detection results. Therefore, we used
the MEFs transfected with the same siRNA instead. The
SELECT result showed that the m6A in 1832 site of 18S
rRNA in si-Mettl5 group was significantly reduced than
that in the control group. Next, IF assay was used to
detect the expression of pS6, and the results showed that
pS6 was significantly reduced in the pseudo-pronucleus
stage and 2-cell stages compared with the control
group, which verified our hypothesis that reduced
METTL5 expression could affect functional ribosome
formation. The rRNA gene transcription in normal
fertilized embryos started at the two-cell stage, but for
nuclear transfer embryos, there are several aberrantly
expressed somatic genes in the nucleus before the two-
cell stage (Zheng etal. 2012). We speculated that the
nascent ribosomes in SCNT embryos were derived from
cumulus cells before two-cell stage, and the reduced
S6 activity led by the reduction of METTL5 in SCNT
pseudo-pronucleus stage embryos is likely to inhibit
the function of somatic-related new ribosomes, in a
way that does not affect the maternal ribosomes, thus
promoting the shutdown of somatic-related genes and
the developmental rate of SCNT embryos. However,
the specific mechanism needs further investigation.
Although it has been reported that Mettl5 knockout
resulted in significantly lower PS6K levels in HEK293T
(Rong et al. 2020), to our knowledge, this is the first
study to report this phenomenon in SCNT embryos.
The potential relationship between METTL5 and histone
modifications was discovered by Ribo-seq data analysis.
Researchers analyzed Ribo-seq data of Mettl5 knockout
ESC and counted up-regulated and down-regulated
Figure4 Mettl5 knockdown altered the levels
of histone modifications in SCNT 2-cell
embryos. (A) RNA-seq data show the
expression levels of enzymes related to
H3K27me3 and H3K4 methylation
modification in control or Mettl5 KO ESC
(GSE144346). (B and E) Immunofluorescence
images of the KDM6A, H3K27me3, H3K27ac,
H3K4me3 in control, si-Mettl5 SCNT and ICSI
2-cell embryos. The bright field images
represent a pool of embryos that were stained
for KDM6A, H3K27me3, H3K27ac and
H3K4me3 (Scale bar, 50 μm), and a
representative stained embryo is shown in
immunofluorescence images of each group
(Scale bar, 50 μm). (F) The fluorescence
intensity quantification of KDM6A in whole
embryo or in nucleus of control, si-Mettl5
SCNT and ICSI embryos. (G, H and I) The
fluorescence intensity quantification of
H3K27me3, H3K27ac, H3K4me3 in control,
si-Mettl5 SCNT and ICSI embryos. White
dashed circles indicate the location of the
nucleus. Scale bar, 50 μm. *P < 0.05, ***P <
0.001 by Student’s t-test.
AUTHOR COPY ONLY
https://rep.bioscientifica.com
L Zhang, M Yuan and others
228
Reproduction (2022) 164 221–230
embryonic genes. They found that the methyltransferases
and demethylases associated with histone H3K27me3
and H3K4me3 were significantly down-regulated
(Xing et al. 2020). Therefore, we reanalyzed RNA-seq
data of Mettl5-knockout ESC and found that consistent
with Ribo-seq data, methyltransferase associated with
silencing histone modification H3K27me3 was down-
regulated and demethylase was up-regulated, while
methyltransferase associated with activating histone
modification H3K4 was up-regulated and demethylase
was down-regulated. These were subsequently verified
in SCNT embryos, where H3K27me3 was significantly
decreased and H3K4me3 was significantly increased in
the interference group compared with the control group.
In addition, previous studies showed that overexpressing
histone demethylase KDM6A significantly increased the
developmental rate of nuclear transfer embryos (Yang
et al. 2018). The present study also found increased
KDM6A in the interference group, which may be one
of the reasons for the improved developmental rate of
SCNT embryos. As the relationship between METTL5
and histone modification has not been reported, we
hypothesized that this change may be related to the
remodeling of the nucleolar structure, or this change may
cause genes to enter the state of bivalent modification.
The nucleolar ultrastructure of mammals is mainly
divided into the fibrous center, the dense fibrous
component and the granular component (Shubinaetal.
2020). rRNA synthesis mainly occurs in the fibrous
center. As an important part of the ribosomes, rRNA
transcription and post-transcriptional modification
play an important role in multiple biological processes
such as cell replication and metabolism. Nucleolus in
preimplantation embryos differs from normal somatic
cells. After fertilization, highly differentiated oocytes and
sperm require to be rebuilt to form totipotency zygotes;
thus, almost no transcription process takes place in the
embryo at the zygote stage, and all life activities in the
embryo depend on the maternal RNA (Kresoja-Rakic &
Santoro 2019, Zhangetal. 2022).
Recent studies have shown that inhibiting rRNA
synthesis could lead to nucleolar stress, which results
in the activation of Dux and other genes and causes
ESC to enter a 2C-like state similar to the expression
characteristics of 2-cell embryos (Yu et al. 2021).
Incomplete activation of the 2C-specific genes is one of
the important reasons for the impaired developmental
rate of nuclear transfer embryos (Huang et al. 2021).
In our previous study, we found that treating donor
cells with RNA Pol Ι inhibitor CX-5461 to prevent the
transcription of rDNA promoted the establishment of
functional nucleoli and improved the developmental
efficiency of preimplantation SCNT embryos (Liao etal.
2020). Having demonstrated that the ribosomal activity
was reduced in Mettl5-KO embryos, we speculated
that this phenomenon would also be accompanied
by nucleolar stress and increased 2C-specific gene
expression. The volcano plot from RNA-seq data
confirmed this hypothesis. Moreover, the initiation of
2C-specific genes was verified at the RNA level, and the
results demonstrated that the mRNA expression of the
2C-specific genes was elevated.
In summary, this study demonstrated that knockdown
of METTL5 improved the preimplantation development
of mouse SCNT embryos. Future studies should
explore the specific mechanisms of Mettl5, such as the
interacting proteins of METTL5 and whether METTL5
is involved in nucleolar stress. The high expression
level of METTL5 in the cytoplasm also needs further
exploration. Moreover, whether METTL5 participates in
other biological processes such as neural development
should be further elucidated.
Supplementary materials
This is linked to the online version of the paper at https://doi.
org/10.1530/REP-22-0169.
Figure5 Mettl5 knockdown increased the mRNA expression levels of
some 2C-specific genes in SCNT 2-cell embryos. (A) The volcano plot
depicting down-regulated (left) and up-regulated (right) genes in
control or Mettl5-KO ESC (GSE144346). Examples of up-regulated 2C
genes are annotated. Significantly up-regulated genes are defined as
those ≥-2-fold change and P value < 0.05 (shown in red dots). Blue
dots represent genes with ≤2-fold change and P value < 0.05. Gray
dots represent genes with no significant change. (B) RT-qPCR analysis
of MERVL, Tdpoz4 and Zscan4 mRNA levels in control or si-Mettl5
SCNT embryos. *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s t-test.
AUTHOR COPY ONLY
https://rep.bioscientifica.com
Knockdown of METTL5 improves development of somatic cell nuclear transfer embryos 229
Reproduction (2022) 164 221–230
Declaration of interest
The authors declare that there is no conflict of interest that
could be perceived as prejudicing the impartiality of the
research reported.
Funding
This work was supported by the Key projects of Heilongjiang
Natural Science Foundation (No. ZD2021C005).
Author contribution statement
Z L C and L L proposed the study design; H X W performed
acquisition of data; Z L C, Y M, C Q Z performed experimental
procedures; Z L C wrote the manuscript with input from all
authors and critical reading from S R Z, H S G and L L. L L
supervised all the experiments.
Acknowledgements
All members of L L’s laboratory are appreciated for their help
and support.
References
AguiloF, ZhangF, SanchoA, FidalgoM, Di CeciliaS, VashishtA, LeeDF,
ChenCH, Rengasamy M, Andino B etal. 2015 Coordination of m(6)
A mRNA methylation and gene transcription by ZFP217 regulates
pluripotency and reprogramming. Cell Stem Cell 17 689–704. (https://
doi.org/10.1016/j.stem.2015.09.005)
BatistaPJ, MolinieB, WangJ, Qu K, ZhangJ, Li L, BouleyDM, LujanE,
HaddadB, DaneshvarK etal. 2014 m(6)A RNA modification controls
cell fate transition in mammalian embryonic stem cells. Cell Stem Cell 15
707–719. (https://doi.org/10.1016/j.stem.2014.09.019)
CaoZ, ZhangL, HongR, LiY, WangY, QiX, NingW, GaoD, XuT, MaY
etal. 2021 METTL3-mediated m6A methylation negatively modulates
autophagy to support porcine blastocyst development double dagger.
Biology of Reproduction 104 1008–1021. (https://doi.org/10.1093/
biolre/ioab022)
ChangY, YiM, WangJ, CaoZ, ZhouT, GeW, MuhammadZ, Zhang Z,
FengY, YanZ etal. 2022 Genetic regulation of N6-Methyladenosine-
RNA in mammalian gametogenesis and embryonic development.
Frontiers in Cell and Developmental Biology 10 819044. (https://doi.
org/10.3389/fcell.2022.819044)
ChenC, LiuW, GuoJ, LiuY, LiuX, LiuJ, DouX, LeR, HuangY, LiC etal.
2021 Nuclear m 6 A reader YTHDC1 regulates the scaffold function
of LINE1 RNA in mouse ESCs and early embryos. Protein and Cell 12
455–474. (https://doi.org/10.1007/s13238-021-00837-8)
Gao S, Mcgarry M, Latham KE & Wilmut I 2003 Cloning of mice by
nuclear transfer. Cloning and Stem Cells 5 287–294. (https://doi.
org/10.1089/153623003772032790)
GuoM, LiuX, ZhengX, HuangY & ChenX 2017 m(6)A RNA modification
determines cell fate by regulating mRNA degradation. Cell Reprogram
19 225–231. (https://doi.org/10.1089/cell.2016.0041)
HuangH, Weng H, Zhou K, WuT, ZhaoBS, SunM, ChenZ, DengX,
XiaoG, AuerF etal. 2019 Histone H3 trimethylation at lysine 36 guides
m(6)A RNA modification co-transcriptionally. Nature 567 414–419.
(https://doi.org/10.1038/s41586-019-1016-7)
HuangX, HuX, JiangQ, CaoQ, WuY & LeiL 2021 Functional study
of distinct domains of Dux in improving mouse SCNT embryonic
development dagger. Biology of Reproduction 105 1089–1103. (https://
doi.org/10.1093/biolre/ioab141)
IgnatovaVV, StolzP, KaiserS, GustafssonTH, LastresPR, Sanz-MorenoA,
ChoYL, AmarieOV, Aguilar-PimentelA, Klein-RodewaldT etal. 2020
The rRNA m(6)A methyltransferase METTL5 is involved in pluripotency
and developmental programs. Genes and Development 34 715–729.
(https://doi.org/10.1101/gad.333369.119)
IvanovaI, Much C, Di Giacomo M, AzziC, Morgan M, Moreira PN,
MonahanJ, Carrieri C, EnrightAJ & O'carrollD 2017 The RNA m(6)
A reader YTHDF2 is essential for the post-transcriptional regulation of
the maternal transcriptome and oocyte competence. Molecular Cell 67
1059.e4–1067.e4. (https://doi.org/10.1016/j.molcel.2017.08.003)
Kresoja-RakicJ & SantoroR 2019 Nucleolus and rRNA gene chromatin in
early embryo development. Trends in Genetics 35 868–879. (https://doi.
org/10.1016/j.tig.2019.06.005)
LeismannJ, SpagnuoloM, PradhanM, WacheulL, VuMA, MusheevM,
MierP, Andrade-NavarroMA, GrailleM, NiehrsC etal. 2020 The 18S
ribosomal RNA m 6 A methyltransferase Mettl5 is required for normal
walking behavior in Drosophila. EMBO Reports 21 e49443. (https://doi.
org/10.15252/embr.201949443)
LiaoC, PangN, LiuZ & LeiL 2020 Transient inhibition of rDNA transcription
in donor cells improves ribosome biogenesis and preimplantation
development of embryos derived from somatic cell nuclear transfer.
FASEB Journal 34 8283–8295. (https://doi.org/10.1096/fj.202000025RR)
LiuW, LiuX, WangC, GaoY, GaoR, KouX, ZhaoY, LiJ, WuY, XiuW
etal. 2016 Identification of key factors conquering developmental arrest
of somatic cell cloned embryos by combining embryo biopsy and single-
cell sequencing. Cell Discovery 2 16010. (https://doi.org/10.1038/
celldisc.2016.10)
LiuJ, GaoM, XuS, ChenY, WuK, LiuH, WangJ, YangX, WangJ, LiuW
etal. 2020 YTHDF2/3 are required for somatic reprogramming through
different RNA deadenylation pathways. Cell Reports 32 108120. (https://
doi.org/10.1016/j.celrep.2020.108120)
MatobaS, LiuY, Lu F, IwabuchiKA, Shen L, Inoue A & ZhangY 2014
Embryonic development following somatic cell nuclear transfer
impeded by persisting histone methylation. Cell 159 884–895. (https://
doi.org/10.1016/j.cell.2014.09.055)
Richard EM, Polla DL, Assir MZ, Contreras M, Shahzad M, Khan AA,
Razzaq A, Akram J, Tarar MN, Blanpied TA et al. 2019 Bi-allelic
variants in METTL5 cause autosomal-recessive intellectual disability
and microcephaly. American Journal of Human Genetics 105 869–878.
(https://doi.org/10.1016/j.ajhg.2019.09.007)
RongB, ZhangQ, WanJ, XingS, DaiR, LiY, CaiJ, XieJ, SongY, ChenJ
etal. 2020 Ribosome 18S m(6)A methyltransferase METTL5 promotes
translation initiation and breast cancer cell growth. Cell Reports 33
108544. (https://doi.org/10.1016/j.celrep.2020.108544)
Shubina MY, Arifulin EA, Sorokin DV, Sosina MA, Tikhomirova MA,
SerebryakovaMV, SmirnovaT, SokolovSS, MusinovaYR & ShevalEV
2020 The GAR domain integrates functions that are necessary for the
proper localization of fibrillarin (FBL) inside eukaryotic cells. PeerJ 8
e9029. (https://doi.org/10.7717/peerj.9029)
Van Tran N, Ernst FGM, Hawley BR, Zorbas C, Ulryck N, Hackert P,
BohnsackKE, BohnsackMT, JaffreySR, GrailleM etal. 2019 The human
18S rRNA m6A methyltransferase METTL5 is stabilized by TRMT112.
Nucleic Acids Research 47 7719–7733. (https://doi.org/10.1093/nar/
gkz619)
XiaoY, WangY, TangQ, WeiL, ZhangX & JiaG 2018 An elongation-
and ligation-based qPCR amplification method for the radiolabeling-
free detection of locus-specific N(6)-methyladenosine modification.
Angewandte Chemie 57 15995–16000. (https://doi.org/10.1002/
anie.201807942)
XingM, LiuQ, MaoC, ZengH, ZhangX, ZhaoS, ChenL, LiuM, ShenB,
Guo X et al. 2020 The 18S rRNA m6A methyltransferase METTL5
promotes mouse embryonic stem cell differentiation. EMBO Reports 21
e49863. (https://doi.org/10.15252/embr.201949863)
YangL, Song L, Liu X, Bai L & Li G 2018 KDM6A and KDM6B play
contrasting roles in nuclear transfer embryos revealed by MERVL
reporter system. EMBO Reports 19 e46240. (https://doi.org/10.15252/
embr.201846240)
YuH, SunZ, TanT, PanH, ZhaoJ, ZhangL, ChenJ, LeiA, ZhuY, ChenL
et al. 2021 rRNA biogenesis regulates mouse 2C-like state by 3D
structure reorganization of peri-nucleolar heterochromatin. Nature
Communications 12 6365. (https://doi.org/10.1038/s41467-021-
26576-2)
ZhangG, XuY, WangX, ZhuY, WangL, ZhangW, WangY, GaoY, WuX,
ChengY etal. 2022 Dynamic FMR1 granule phase switch instructed
AUTHOR COPY ONLY
https://rep.bioscientifica.com
L Zhang, M Yuan and others
230
Reproduction (2022) 164 221–230
by m6A modification contributes to maternal RNA decay. Nature
Communications 13 859. (https://doi.org/10.1038/s41467-022-28547-7)
ZhaoBS, WangX, BeadellAV, LuZ, ShiH, Kuuspalu A, HoRK & He C
2017 m(6)A-dependent maternal mRNA clearance facilitates zebrafish
maternal-to-zygotic transition. Nature 542 475–478. (https://doi.
org/10.1038/nature21355)
ZhengZ, JiaJL, BouG, Hu LL, WangZD, Shen XH, Shan ZY, ShenJL,
Liu ZH & Lei L 2012 rRNA genes are not fully activated in mouse
somatic cell nuclear transfer embryos. Journal of Biological Chemistry
287 19949–19960. (https://doi.org/10.1074/jbc.M112.355099)
Zheng G, Dahl JA, Niu Y, FedorcsakP, Huang CM, Li CJ, Vagbo CB,
ShiY, WangWL, Song SH etal. 2013 ALKBH5 is a mammalian RNA
demethylase that impacts RNA metabolism and mouse fertility. Molecular
Cell 49 18–29. (https://doi.org/10.1016/j.molcel.2012.10.015)
Received 16 May 2022
First decision 28 June 2022
Revised manuscript received 6 September 2022
Accepted 15 September 2022
