Extended phylogrouping of pathogenic and non- pathogenic Escherichia coli isolates of avian origin

Abstract

Avian Pathogenic E. coli (APEC) is the causative agent of avian colibacillosis, accounting for vast economic losses to the poultry industry in form of morbidity, mortality, and carcass condemnation The E. coli strains of the various phylogroups also differ in their genotypic and phenotypic characteristics, their ability to cause disease and their ecological niche. In the present study, 64 E. coli isolates comprising of APEC (n=50) and non-APEC (n=14) were phylogrouped. The combination of phylogenetic markers viz., chuA, yjaA, DNA fragment TspE4.C2, arpA and trpA was used to amplify target specific fragments using PCR for phylogrouping. The results classified E. coli isolates (n=64) into A (28.1%), B1 (12.5%), D (10.9%), F (7.9%), B2 (6.2%), E (1.6%) and Clade I (1.6%). Sixteen E. coli isolates (25%) were untypable/unknown and none of E. coli isolates belonged to phylogroup C. A total of 6.2% E. coli isolates were either grouped to Clade I or Clade II. The phylogrouping of APEC isolates indicated that most of APEC isolates were untypable/unknown category (30%) followed by phylogroup A (24%). None of APEC isolates in the present study fall under phylogroup E and C. Similarly, among non-APEC isolates phylogroup A dominance was observed (6/14) followed by phylogroup B1 (3/14). The study revealed that phylogroup A is widely circulating among APEC as well as non-APEC pathotypes in Haryana. The circulation of unknown phylogroups warrants further investigation in phylogrouping protocols and methods, as there might be possibility of existence of newer phylogroups of APEC. The study further provided insight to the newer phylogroups of APEC as well as non-APEC isolates, generating valuable data which may be helpful in perceiving the origin and pathogenicity of APEC isolates on the basis of phylogrouping.

Full text

~ 265 ~
The Pharma Innovation Journal 2022; SP-11(1): 265-269
ISSN (E): 2277- 7695
ISSN (P): 2349-8242
NAAS Rating: 5.23
TPI 2022; SP-11(1): 265-269
© 2022 TPI
www.thepharmajournal.com
Received: 01-11-2021
Accepted: 03-12-2021
Dinesh Mittal
Assistant Professor, Department of
Veterinary Public Health and
Epidemiology, Lala Lajpat Rai
University of Veterinary and
Animal Sciences, Hisar, Haryana,
India
Kushal Grakh
Ph.D. Scholar, Department of
Veterinary Public Health and
Epidemiology, Lala Lajpat Rai
University of Veterinary and
Animal Sciences, Hisar, Haryana,
India
Manesh Kumar
Assistant Professor, Department of
Veterinary Public Health and
Epidemiology, Lala Lajpat Rai
University of Veterinary and
Animal Sciences, Hisar, Haryana,
India
Anand Prakash
Assistant Disease Investigating
Officer, Department of Veterinary
Public Health and Epidemiology,
Lala Lajpat Rai University of
Veterinary and Animal Sciences,
Hisar, Haryana, India
Ramesh Kumar
Assistant Disease Investigating
Officer, Department of Veterinary
Public Health and Epidemiology,
Lala Lajpat Rai University of
Veterinary and Animal Sciences,
Hisar, Haryana, India
Pankaj Kumar
Assistant Disease Investigating
Officer, Department of Veterinary
Public Health and Epidemiology,
Lala Lajpat Rai University of
Veterinary and Animal Sciences,
Hisar, Haryana, India
Corresponding Author
Kushal Grakh
Ph.D. Scholar, Department of
Veterinary Public Health and
Epidemiology, Lala Lajpat Rai
University of Veterinary and
Animal Sciences, Hisar, Haryana,
India
Extended phylogrouping of pathogenic and non-
pathogenic Escherichia coli isolates of avian origin
Dinesh Mittal, Kushal Grakh, Manesh Kumar, Anand Prakash, Ramesh
Kumar and Pankaj Kumar
Abstract
Avian Pathogenic E. coli (APEC) is the causative agent of avian colibacillosis, accounting for vast
economic losses to the poultry industry in form of morbidity, mortality, and carcass condemnation The E.
coli strains of the various phylogroups also differ in their genotypic and phenotypic characteristics, their
ability to cause disease and their ecological niche. In the present study, 64 E. coli isolates comprising of
APEC (n=50) and non-APEC (n=14) were phylogrouped. The combination of phylogenetic markers viz.,
chuA, yjaA, DNA fragment TspE4.C2, arpA and trpA was used to amplify target specific fragments using
PCR for phylogrouping. The results classified E. coli isolates (n=64) into A (28.1%), B1 (12.5%), D
(10.9%), F (7.9%), B2 (6.2%), E (1.6%) and Clade I (1.6%). Sixteen E. coli isolates (25%) were
untypable/unknown and none of E. coli isolates belonged to phylogroup C. A total of 6.2% E. coli
isolates were either grouped to Clade I or Clade II. The phylogrouping of APEC isolates indicated that
most of APEC isolates were untypable/unknown category (30%) followed by phylogroup A (24%). None
of APEC isolates in the present study fall under phylogroup E and C. Similarly, among non-APEC
isolates phylogroup A dominance was observed (6/14) followed by phylogroup B1 (3/14). The study
revealed that phylogroup A is widely circulating among APEC as well as non-APEC pathotypes in
Haryana. The circulation of unknown phylogroups warrants further investigation in phylogrouping
protocols and methods, as there might be possibility of existence of newer phylogroups of APEC. The
study further provided insight to the newer phylogroups of APEC as well as non-APEC isolates,
generating valuable data which may be helpful in perceiving the origin and pathogenicity of APEC
isolates on the basis of phylogrouping.
Keywords: APEC, avian, Haryana, phylogroup, non-APEC
1. Introduction
Avian pathogenic E. coli (APEC) are the causative agent for extraintestinal infections in
poultry birds. APEC infections in poultry birds produce diverse array of lesions from localized
to systemic, which results in huge economic losses to poultry industry in term of mortality,
morbidity, treatment cost and carcass condemnation [1]. Also, APEC is recognized as an
important zoonotic pathogen and can cause foodborne urinary tract infection in humans due to
the consumption of contaminated poultry carcasses [2]. Traditionally APEC classification was
based on serotyping with a limitation that it allows only for the classification of a limited
number of APEC isolates because of overlapping serogroups among member of extraintestinal
pathogenic E. coli (ExPEC) [3]. Virulence genotyping using PCR has enabled rapid
classification of APEC and their differentiation from non-APEC isolates including commensal
E. coli. However, owing to huge geographical variations and diversity among APEC isolates
some studies failed to classify APEC on the basis of virulence genes [4]. The suitability of
virulence markers for discriminating pathogenic and non-pathogenic groups within E. coli is
questionable for certain regions of the world due to geographical variations and coinfections
by otherwise commensal E. coli [4]. Additionally, the genome of E. coli strains frequently
undergoes additions, deletions, and recombinations as a reaction to natural selective pressure,
leading to divergence [5,6]. Consequently, there are diverse genetic substructure within the E.
coli, comprised of at least eight phylogenetic groups segregated into three clusters:
phylogroups B2, G, and F, phylogroups A, B1, C and E, and phylogroup D [7, 8, 9, 10, 11]. Each
phylogenetic group is broadly associated to an ecological niche, for instance strains belonging
to phylogroups B2 and D are commonly associated with virulent extra-intestinal infection,
strains from phylogroup A are often categorized as of commensal origin, and phylogroup B1
associated with environmental reservoirs [8, 12, 13, 14].

~ 266 ~
The Pharma Innovation Journal http://www.thepharmajournal.com
The extended Clermont classification is an update to the
previous classification of four phylogroups (A, B1, B2 and D)
and has used a combination of phylogenetic markers viz.,
chuA, yjaA, DNA fragment TspE4.C2, arpA, trpA and arpA
(ArpAgpE) to amplify target specific fragments using PCR [7].
This phylotyping method, is a top-level, rapid, and
inexpensive technique for classification of E. coli to
phylogenetic groups and shows high correlation with other
reference methods including multi-locus sequence type
(MLST) analysis [7].
The association between various phenotypic traits of APEC
and non-APEC with reference to biofilm formation,
antimicrobial resistance and virulence gene repertoire has
been explored in our previous study [15] however, the potential
of pathogenic traits associated with phylogenetic types
warrants consideration into the potential role of virulence
genes and their linkage with specific phylogenetic types. The
purpose of the current study was to assess the usefulness of
the phylogenetic typing tools in subtyping various APEC and
non-APEC isolates.
2. Material and Methods
2.1 Source of samples
The samples were collected from avian colibacillosis affected
broiler chicken farms in five districts in the state of Haryana,
and isolation was carried out by standard methods using
MacConkey agar, brain heart infusion broth, EMB agar,
Gram’s staining and further confirmation using Vitek 2
Compact and uspA gene amplification by PCR [15]. A total of
64 E. coli isolates differentiated as APEC (n=50) and non-
APEC (n=14) were used in the study for phylogroup analysis.
2.2 Preparation of DNA Template
The genomic DNA extraction from isolated colonies was
carried out using a heat lysis/snap-chill method [16]. Briefly,
loopful of colonies were dispensed into 250 μl of nuclease
free water in 0.6 ml eppendorf tube. The Eppendorf tubes
with bacterial suspension were placed on a heating block at 98
℃ for 10 minutes followed by snap chilling at -20 ℃. Then
after thawing at room temperature centrifugation was carried
out at 12,000 rpm for 7 minutes. The supernatant was taken
and stored as DNA for further use at -20 ℃.
2.3 Phylogenetic Typing PCR Protocols
Samples of the DNA stock were subjected to phylogenetic
typing using the revised protocols described [7]. The primer
pairs used for the current study are summarized in Table 1.
The PCR reaction used a 25 µl reaction volume with the
following PCR conditions: denaturation for 4 min at 94 ℃
followed by 30 cycles of 5 s at 94 ℃; 30 s at 52 ℃ (group E),
or 60 ℃ (quadruplex) or 62 ℃ (group C) and 30 s at 72 ℃
with a final extension at 72 ℃ for 5 min. PCR products
generated were subjected to electrophoresis in 1.5% (w/v)
agarose gels in 1X TAE buffer and run at 120 V for 2 h. A
100 bp molecular weight marker (GeNei, India) was used as
the size standard. Gels were stained with ethidium bromide,
and bands corresponding to each gene present were digitized
using a gel documentation system (Zenith, India).
Table 1: Primers used in the phylogenetic typing PCR assays
Primer name
5’-3’ sequence
Product size
Reference
Quadruplex
chuA.1b
ATGGTACCGGACGAACCAAC
288 bp
[3, 17]
chuA.2
TGCCGCCAGTACCAAAGACA
yjaA.1b
CAAACGTGAAGTGTCAGGAG
211 bp
yjaA.2b
AATGCGTTCCTCAACCTGTG
TspE4C2.1b
CACTATTCGTAAGGTCATCC
152 bp
TspE4C2.2b
AGTTTATCGCTGCGGGTCGC
AceK F
AACGCTATTCGCCAGCTTGC
400 bp
ArpA1 R
TCTCCCCATACCGTACGCTA
Group E
ArpAgpE F
GATTCCATCTTGTCAAAATATGCC
301 bp
[18]
ArpAgpE R
GAAAAGAAAAAGAATTCCCAAGAG
Group C
trpA.1
AGTTTTATGCCCAGTGCGAG
219 bp
trpA.2
TCTGCGCCGGTCACGCCCC
Internal Control
trpBA F
CGGCGATAAAGACATCTTCAC
489 bp
[19]
trpBA R
GCAACGCGGCCTGGCGGAAG
2.4 Cluster analysis
A clustered heat map/double dendrogram was constructed
using PCR results of phylogrouping analysis of APEC and
non-APEC isolates. Data were processed in a binary matrix
using the NCSS (trial version) (NCSS, LLC, USA) software
package. Grouping of the isolates was made by agglomeration
method, based on the unweighted average distance.
3. Results and Discussion
3.1 Phylogenetic Typing
All the E. coli isolates were analyzed using protocol described
[7]. Table 2 summarized the assignments and distribution of
different phylogroups among APEC and non-APEC isolates.
Overall, phylogroup A (28.1%) was dominant among E. coli
isolates used in the study followed by unknown/untypable
group (25%), B1 (12.5%), D (10.9%), F (7.9%), B2, Clade
I/II (6.2% each) and E and Clade I (1.6% each). None of the
E. coli isolates belonged to phylogroup C in the current study.
Table 2: Distribution of different phylogroups among APEC and
non-APEC pathotypes
Pathotype
Phylogroup/Clade assigned
Total
A
B1
B2
D
E
F
Clade I
Clade I/II
Unknown
APEC
12
5
4
5
-
4
1
4
15
50
Non-APEC
6
3
-
2
1
1
-
-
1
14
Total
18
8
4
7
1
5
1
4
16
64
On analyzing the results based on the individual pathotype
(APEC and non-APEC), it was observed that most of the
APEC isolates (30; 60.0%) were assigned to at least one
phylogroup (A, B1, B2, D, E, F) and some others were
assigned to either Clade I or II (8.0%) and Clade I (2.0%);
whereas, significantly high number of APEC isolates
remained untypable/unknown (15; 30.0%) based on the
Clermont protocols. None of the studied APEC isolates get
assigned under phylogroup E and C. Phylogroup A (24.0%)
was dominant among APEC isolates followed by B1 and D

~ 267 ~
The Pharma Innovation Journal http://www.thepharmajournal.com
(10.0% each), B2 and F (8.0% each). In a study conducted [20]
it was observed that majority of the APEC were assigned to
groups A and D and less than 20% assigned to group B2,
whereas dominance of phylogroup C followed by B1 among
APEC isolates was observed in other [21]. The absence of
phylogroup C and E in current study might be attributed to the
huge diversity and geographical variations among these
isolates [22,15]. Moreover, a larger number of samples used in
other studies might also be the reason for the diverse
phylogroups they have obtained and for absence of these
phylogroups among E. coli isolates in our study. The studies
conducted so far indicate that phylogroup A generally
contained commensal strains and its dominance among APEC
isolates point out the probable evolution of these pathogenic
strains from commensal strains of E. coli in poultry [23]. The
phylogrouping results indicated that most of the APEC were
assigned to phylogroup A unlike E. coli of other animals and
humans as also reported [20]. Phylogroups B2 and D are
commonly associated with virulent extra-intestinal infection
and their less occurrence among non-APEC as compared to
APEC isolates in current study points this aspect evidently [8].
Phylogroup B1 is mainly associated with environmental E.
coli, and its distribution among both APEC and non-APEC
isolates indicates the possible acquisition of pathogenic traits
by these E. coli and adoption to cause disease in poultry birds
[14, 21]. Similarly, most of the non-APEC isolates (6; 42.8%)
were of phylogroup A followed by B1 (21.4%), D (14.3%), E
and F (7.1% each), and one isolate remained
untypable/unknown. Phylogroup B2 was not detected among
non-APEC isolates in the current study and similarly none of
the non-APEC isolates were assigned under Clade I and Clade
II. As discussed earlier, the occurrence of phylogroup A
among non-APEC or commensal E. coli seems to be
admissible. Similarly, absence of phylogroup B2 among non-
APEC isolates indicates about specificity of B2 phylogroup
towards APEC isolates [8]. As the E. coli isolates from
colibacillosis affected birds as well as their environment were
investigated for research, a higher occurrence of B1
phylogroup was expected among non-APEC isolates [14].
Phylogroup C is a group of strains closely related to, but
distinct from, phylogroup B1 and was not found in our study
as opined by [24]. Several novel lineages (new species) of
Escherichia have been reported that are genetically distinct
but phenotypically indistinguishable from E. coli [25]. At least
one of these cryptic lineages, Escherichia clade I, should also
be considered a phylogroup of E. coli based on the extent of
recombination detected between strains belonging to clade I
and E. coli [26]. Therefore, currently, there are eight
recognized phylogroups of E. coli, belonging to E. coli sensu
stricto (A, B1, B2, C, D, E, F and G) excluding Escherichia
clade I, however most recently discovered phylogroup G was
not investigated in present work. The protocol described by
[7], assigned phylogroups to most of the E. coli isolates
studied, however, few remained untypable or unknown. There
may be various reasons for this viz. some E. coli strains
cannot be get assigned to any phylogroup as these untypable
strains either represent phylogroups that are extremely rare or,
more likely, are the result of large-scale recombination events
where the donor and recipient originated from two different
phylogroups [7]. Another possibility of highly variable gene
content of E. coli driven by the frequent addition and deletion
of genes also exists [27]. Consequently, grouping of few E. coli
isolates to unknown or untypable category is not surprising.
On analyzing the combination pattern of four genes (arpA,
chuA, yjA, TspE4.C2) and chi square analysis of
phylogroup/clade assigned with the presence of genes it was
observed that presence of arpA gene was significantly
associated with phylogroup A, B1 and D (p< 0.01). Similarly,
significant association was present between chuA gene and
phylogroups B2, D and F (p< 0.01), yjA with Clade I/II,
TspE4.C2 with the phylogroup B1, B2 and untypable isolates.
Table 3: Association of presence and absence of genes (arpA, chuA,
yjA, TspE4.C2) and phylogroups
Phylogroup/Cate
gory/Clade
Genotype combination
Number of
isolates
A (18)
arpA + chuA - yjA + TspE4.C2 -
13
arpA + chuA - yjA - TspE4.C2 -
5
B1 (8)
arpA + chuA - yjA - TspE4.C2 +
8
B2 (4)
arpA - chuA + yjA + TspE4.C2 +
2
arpA - chuA + yjA - TspE4.C2 +
2
Clade I (1)
arpA + chuA + yjA + TspE4.C2 -
1
Clade I/II (4)
arpA - chuA - yjA + TspE4.C2 -
4
D (7)
arpA + chuA + yjA - TspE4.C2 +
4
arpA + chuA + yjA - TspE4.C2 -
3
E (1)
arpA + chuA + yjA + TspE4.C2 -
1
F (5)
arpA - chuA - yjA + TspE4.C2 -
5
Untypable (16)
arpA + chuA + yjA + TspE4.C2 +
10
arpA + chuA - yjA - TspE4.C2 +
3
arpA - chuA – yjA + TspE4.C2 +
3
3.2 Cluster analysis
The double dendrogram (Fig. 1) defined 2 distinct clusters
and reflected the diversity of E. coli isolates in terms of
phylogroup assigned to these isolates based on PCR results.
Both the clusters (A and B) contained both APEC as well as
non-APEC pathotypes. The gene arpA, yja and chuA were
more consistently observed among isolates in cluster B as
compared to cluster A. A large number of untypable isolates
(13/16) were clustered in cluster B. These isolates
consistently amplified four fragments (arpA, yja, chuA and
TspE4.C2) indicating towards the virulence of these isolates.
All the isolates with phylogroup B1, D and F clustered in
cluster ‘A’ and maximum isolates with phylogroup A (15/18)
got clustered in cluster ‘B’. In summary, cluster ‘A’
comprised B1, D and F phylogroups and cluster ‘B’
comprised A and E phylogroup along with untypable, Clade I,
Clade I/II isolates. B2 phylogroup was equally distributed
among cluster ‘A’ and ‘B’. Evolutionary, the closely related
sister species of E. coli, phylogroups B2, F and D appear the
most basal and their clustering together in current study
implies the same (Fig. 1) [9, 28]. Subsequently, phylogroup E
emerges, followed by most recently diverged phylogroups C,
B1 and A [8]. The lifestyle or ecological niche of strains can be
linked to phylogenetic history of the species. The most
anciently diverged phylogroups B2, F and D comprises most
of ExPEC strains, whereas the strains responsible for severe
intestinal pathologies such as hemolytic and uremic syndrome
(HUS) and dysentery belongs to the recently diverged
phylogroups such as C, B1 and A [29, 9]. This suggests the role
of the genetic background in virulence and emphasizes the
need to identify and discover the novel E. coli phylogroups.

~ 268 ~
The Pharma Innovation Journal http://www.thepharmajournal.com
Fig 1: A double dendrogram on the basis of results of PCR analysis of APEC and non-APEC isolates. Left most portion of this figure is the
dendrogram resulting from cluster analysis. There appear two clusters (A and B) of isolates. Cluster A contained E. coli isolates with B1, D and
F phylogroup. Cluster B contained E. coli isolates of phylogroup A and E, untypable isolates, Clade I and Clade I/II E. coli isolates. Just to the
right of the dendrogram are columns 1 to 5 which shows the genotype of each isolate tested. Each column in this group shows the results for a
single gene amplification using PCR. The identity of each gene is shown on the top of diagram. Dark yellow color indicates that gene is present,
and red indicates that a gene is absent. Column 6 indicates the pathotype of E. coli isolates (APEC or non-APEC), where green indicates APEC
and dark blue indicates non-APEC pathotype. Column 7 contained the isolate number/ids, where source of isolation is: F; Feed, H; Heart, LT;
Litter, L; Liver, Lung, FL; fecal/cloacal swab, FS; Feeder swab, Water, DS; Drinker swab, TW; Water source surface, PVC; pipe swab. Column
8 indicates the phylogroup assigned to individual isolate as described in the legends
4. Conclusions
In this study, attempt was made to classify APEC and non-
APEC isolates of avian origin into six phylogroups viz., A,
B1, B2, D, E and F. Phylogroup A was found as dominant
group among E. coli isolates of avian origin. Despite of using
recent method for phylogrouping, a significant number of E.
coli isolates do not get assigned under any phylogroup and
remained either as untypable or in E. coli clade I or clade I/II
indicating that further investigations are required to explore
the existence of more novel phylogroups.
5. Acknowledgements
The authors are thankful to Head of the Department of
Veterinary Public Health and Epidemiology, LUVAS for
support in smooth conduction of the study.
6. References
1. Graveline R, Garneau P, Martin C, Mourez M, Hancock
MA, Lavoie R, et al. Leucine-responsive regulatory
protein Lrp and PapI homologues influence phase
variation of CS31A fimbriae. Journal of Bacteriology.
2014;196(16):2944-53.
2. LeStrange K, Markland SM, Hoover DG, Sharma M,
Kniel KE. An evaluation of the virulence and adherence
properties of avian pathogenic Escherichia coli. One
Health. 2017;1(4):22-6.
3. Ewers C, Janßen T, Kießling S, Philipp HC, Wieler LH.
Molecular epidemiology of avian pathogenic Escherichia
coli (APEC) isolated from colisepticemia in poultry.
Veterinary Microbiology. 2004;104(1-2):91-101.
4. Kemmett K, Humphrey T, Rushton S, Close A, Wigley
P, Williams NJ. A longitudinal study simultaneously
exploring the carriage of APEC virulence associated
genes and the molecular epidemiology of faecal and
systemic E. coli in commercial broiler chickens. PLoS
One. 2013;8(6):e67749.
5. Cordoni G, Woodward MJ, Wu H, Alanazi M, Wallis T,
La Ragione RM. Comparative genomics of European
avian pathogenic E. coli (APEC). BMC Genomics.
2016;17(1):1-21.
6. O’Boyle N, Connolly JP, Tucker NP, Roe AJ. Genomic
plasticity of pathogenic Escherichia coli mediates D-
serine tolerance via multiple adaptive mechanisms.
Proceedings of the National Academy of Sciences.
2020;117(36):22484-93.
7. Clermont O, Christenson JK, Denamur E, Gordon DM.
The Clermont Escherichia coli phylotyping method
revisited: improvement of specificity and detection of
new phylo‐groups. Environmental Microbiology Reports.
2013;5(1):58-65.
8. Beghain J, Bridier-Nahmias A, Le Nagard H, Denamur
E, Clermont O. Clermon Typing: an easy-to-use and
accurate in silico method for Escherichia genus strain
phylotyping. Microbial Genomics. 2018, 4(7).
9. Clermont O, Dixit OV, Vangchhia B, Condamine B,
Dion S, Bridier‐Nahmias A, et al. Characterization and
rapid identification of phylogroup G in Escherichia coli,
a lineage with high virulence and antibiotic resistance

~ 269 ~
The Pharma Innovation Journal http://www.thepharmajournal.com
potential. Environmental Microbiology.
2019;21(8):3107-17.
10. Gonzalez-Alba JM, Baquero F, Cantón R, Galán JC.
Stratified reconstruction of ancestral Escherichia coli
diversification. BMC Genomics. 2019;20(1):1-5.
11. Denamur E, Clermont O, Bonacorsi S, Gordon D. The
population genetics of pathogenic Escherichia coli.
Nature Reviews Microbiology. 2021;19(1):37-54.
12. Pires-dos-Santos T, Bisgaard M, Christensen H. Genetic
diversity and virulence profiles of Escherichia coli
causing salpingitis and peritonitis in broiler breeders.
Veterinary Microbiology. 2013;162(2-4):873-80.
13. Mosquito S, Pons MJ, Riveros M, Ruiz J, Ochoa TJ.
Diarrheagenic Escherichia coli phylogroups are
associated with antibiotic resistance and duration of
diarrheal episode. The Scientific World Journal, 2015.
14. Johnson JR, Johnston BD, Delavari P, Thuras P, Clabots
C, Sadowsky MJ. Phylogenetic backgrounds and
virulence-associated traits of Escherichia coli isolates
from surface waters and diverse animals in Minnesota
and Wisconsin. Applied and Environmental
Microbiology. 2017;83(24):e01329-17.
15. Grakh K, Mittal D, Prakash A, Jindal N. Characterization
and antimicrobial susceptibility of biofilm-producing
Avian Pathogenic Escherichia coli from broiler chickens
and their environment in India. Veterinary Research
Communications, 2022.
16. Englen MD, Kelley LC. A rapid DNA isolation
procedure for the identification of Campylobacter jejuni
by the polymerase chain reaction. Letters in Applied
Microbiology. 2000;31(6):421-6.
17. Clermont O, Bonacorsi S, Bingen E. Characterization of
an anonymous molecular marker strongly linked to
Escherichia coli strains causing neonatal meningitis.
Journal of Clinical Microbiology. 2004;42(4):1770-2.
18. Lescat M, Clermont O, Woerther PL, Glodt J, Dion S,
Skurnik D, et al. Commensal Escherichia coli strains in
Guiana reveal a high genetic diversity with host
dependent population structure. Environmental
Microbiology Reports, 2012, e00374.x.
19. Clermont O, Lescat M, O'Brien CL, Gordon DM,
Tenaillon O, Denamur E. Evidence for a human‐specific
Escherichia coli clone. Environmental Microbiology.
2008;10(4):1000-6.
20. Rodriguez-Siek KE, Giddings CW, Doetkott C, Johnson
TJ, Nolan LK. Characterizing the APEC pathotype.
Veterinary Research. 2005;36(2):241-56.
21. Logue CM, Wannemuehler Y, Nicholson BA, Doetkott
C, Barbieri NL, Nolan LK. Comparative analysis of
phylogenetic assignment of human and avian ExPEC and
fecal commensal Escherichia coli using the (previous and
revised) Clermont phylogenetic typing methods and its
impact on avian pathogenic Escherichia coli (APEC)
classification. Frontiers in Microbiology. 2017;8:283.
22. Johnson TJ, Wannemuehler Y, Doetkott C, Johnson SJ,
Rosenberger SC, Nolan LK. Identification of minimal
predictors of avian pathogenic Escherichia coli virulence
for use as a rapid diagnostic tool. Journal of Clinical
Microbiology. 2008;46(12):3987-96.
23. Dziva F, Stevens MP. Colibacillosis in poultry:
unravelling the molecular basis of virulence of avian
pathogenic Escherichia coli in their natural hosts. Avian
Pathology. 2008;37(4):355-66.
24. Clermont O, Olier M, Hoede C, Diancourt L, Brisse S,
Keroudean M, et al. Animal and human pathogenic
Escherichia coli strains share common genetic
backgrounds. Infection, Genetics and Evolution.
2011;11(3):654-62.
25. Walk ST, Alm EW, Gordon DM, Ram JL, Toranzos GA,
Tiedje JM, et al. Cryptic lineages of the Escherichia
genus. Applied and Environmental Microbiology. 2009,
21.
26. Luo C, Walk ST, Gordon DM, Feldgarden M, Tiedje JM,
Konstantinidis KT. Genome sequencing of environmental
Escherichia coli expands understanding of the ecology
and speciation of the model bacterial species.
Proceedings of the National Academy of Sciences. 2011
Apr 26;108(17):7200-5.
27. Touchon M, Hoede C, Tenaillon O, Barbe V, Baeriswyl
S, Bidet P, et al. Organised genome dynamics in the
Escherichia coli species results in highly diverse adaptive
paths. PLoS Genetics. 2009;5(1):e1000344.
28. Mageiros L, Méric G, Bayliss SC, Pensar J, Pascoe B,
Mourkas E, et al. Genome evolution and the emergence
of pathogenicity in avian Escherichia coli. Nature
Communications. 2021;12(1):1-3.
29. Picard B, Garcia JS, Gouriou S, Duriez P, Brahimi N,
Bingen E, et al. The link between phylogeny and
virulence in Escherichia coli extraintestinal infection.
Infection and Immunity. 1999;67(2):546-53.