Content uploaded by Kilaza Samson Mwaikono
Author content
All content in this area was uploaded by Kilaza Samson Mwaikono on Sep 16, 2015
Content may be subject to copyright.
Journal of Applied & Environmental Microbiology, 2015, Vol. 3, No. 3, 82-94
Available online at http://pubs.sciepub.com/jaem/3/3/4
© Science and Education Publishing
DOI:10.12691/jaem-3-3-4
Prevalence and Antimicrobial Resistance Phenotype of
Enteric Bacteria from a Municipal Dumpsite
Kilaza Samson Mwaikono1,*, Solomon Maina2, Paul Gwakisa1,3
1The Nelson Mandela African Institution of Science and Technology, Arusha, Tanzania
2BecA-ILRI Hub International Livestock Research Institute, Nairobi, Kenya
3Genome Sciences Centre, Faculty of Veterinary Medicine, Sokoine University of Agriculture, Morogoro, Tanzania
*Corresponding author: kilazasmsn24@gmail.com
Received August 02, 2015; Revised August 21, 2015; Accepted August 26, 2015
Abstract The objective of the study was to determine the prevalence and antibiotic resistance phenotype of
enteric bacteria from the municipal dumpsite. A qualitative survey of the dumpsite was conducted to identify types
of solid wastes and nature of interaction on the dumpsite. Samples were collected from different type of solid waste,
including domestic waste (Dom), solid biomedical waste (Biom), river sludge near the dumpsite (Riv) and faecal
material of pigs scavenging on the dumpsite (FecD). A control sample was collected from faecal material of pigs
initially reared indoor (FecI) and shifted to scavenging on the dumpsite (FecIF). Total genomic DNA was extracted,
and the 16S rRNA gene was amplified, sequenced and used to study prevalence of enteric bacteria. The same sample
was used to isolate enteric bacteria that were later tested to 8 different antibiotics for their susceptibility phenotype.
Solid wastes are not sorted in Arusha municipal. There was high interaction between animals and humans on the
dumpsite. A total of 219 enteric bacteria from 75 genera were identified. Escherichia sp and Shigella sp (12%),
Bacillus sp (11%) and Proteiniclasticum (4%) were the predominant genera. Most of the Escherichia sp, Shigella sp
and Bacillus were from FecD, while Proteiniclasticum spp was from Biom. Some isolates from FecD had 99%
sequence similarity to pathogenic Escherichia furgosonii, Shigella sonnei, Enterococcus faecium and Escherichia
coli O154:H4. Over 50% of the isolates were resistant to Penicillin G, Ceftazidime and Nalidixic Acid.
Ciprofloxacin and Gentamycin were the most effective antibiotics with 81% and 79% susceptible isolates,
respectively. Of all the isolates, 56% (45/80) were multidrug resistant. Escherichia sp and Bacillus sp (12 isolates
each) constituted a large group of multidrug resistant bacteria. All Pseudomonas sp from Biom and FecD were
multidrug resistant. There is high prevalence of antibiotic resistant enteric bacteria on the dumpsite. We report
possible risks of spreading antibiotic resistant bacteria/genes from the dumpsite to clinical settings through animals
and humans interacting on the dumpsite. This finding calls for a comprehensive research to study the shared
resistome in bacteria from the environment, humans and animals using PCR and metagenomic based approaches to
identify prevalence of known and capture new resistant genes.
Keywords: Enteric bacteria, pigs, antibiotic resistance, Municipal dumpsite, solid wastes
Cite This Article: Kilaza Samson Mwaikono, Solomon Maina, and Paul Gwakisa, “Prevalence and
Antimicrobial Resistance Phenotype of Enteric Bacteria from a Municipal Dumpsite.” Journal of Applied &
Environmental Microbiology, vol. 3, no. 3 (2015): 82-94. doi: 10.12691/jaem-3-3-4.
1. Introduction
Antibiotic resistant bacteria are extremely important to
human and animals health, as it has become a major
public health challenge globally [1,2,3]. Microbes have
developed a mechanism to evade our drugs and the trend
is worrisome as day’s go by. The knowledge on the origin
of antibiotic resistance in the environment is key to public
health owing to the growing importance of zoonotic
diseases as well as the necessity for predicting emerging
resistant pathogens [4]. Inappropriate use of antibiotics
has been pointed out as one of the reasons which leads to
selection and hence development of drug resistant
microbes [5,6,7].
Poor solid waste management in many municipalities in
developing countries [8,9,10] is associated with the
accumulation of unsorted garbage in both undesignated
areas and in common dumpsite. In African settings it is
normal to find biomedical / pharmaceutical / antibiotic
residues thrown into common dumpsites. The diverse
microbes from domestic, biomedical and industrial wastes
create a complex interface on dumpsites that favors
bacterial changes. The variety of chemicals and drug
residues on dumpsites are likely to create a selection
pressure to microbes, hence generating resistant groups
that could easily be carried by feral and domestic animals
as well as humans often times interacting on dumpsite.
Several studies have reported on the prevalence of
bacteria of public health importance on municipal
dumpsite [11,12,13]. Enteric bacterial isolates from the
Journal of Applied & Environmental Microbiology 83
dumpsite were reported to be resistant to commonly used
antibiotics [12]. The fact that geographical conditions and
types of waste generated in one location varies from any
other; and since microbial proliferation depends on the
geographical conditions and available nutrients; it is
logical that public health risks caused by one municipal
dumpsite cannot be the same elsewhere.
Despite the poor solid waste management in most
municipalities in Tanzania [14,15], no study has been
done to screen for antimicrobial resistant bacteria from
dumpsites. Only few studies on antimicrobial resistant
bacteria have been reported in hospital settings. For
example, a report on antimicrobial resistant bacteria in
diabetic women by Lyamuya et al., [16], multiple resistant
bacteria causing surgical site infection by Manyahi et al.,
[17], nasal carriage of methicilin resistant Staphylococcus
by under-five in Tanzania [18] and antimicrobial resistant
bacteria from urinary isolate. All of these studies were
conducted in hospital settings.
In this study, culture independent approach was used to
identify enteric bacteria on the dumpsite and culture based
method was used for isolation and study antimicrobial
resistance phenotype. We communicate high prevalence
of antibiotic resistant bacteria amidst a complex
interaction of domestic and feral animals as well as
humans on a municipal dumpsite.
2. Materials and Methods
2.1. Study Site and Sampling
Site for this study was the Arusha municipal dumpsite
in Tanzania, where waste from different urban sources is
dumped. Sampling was done during March to June 2013
whereby prior to sample collection, a qualitative survey
was conducted to identify types of most common solid
waste on the dumpsite. This comprised waste from
households and markets (foods, pampers, clothes, etc.),
chemical and biomedical waste (drug containers, used
syringes), various plastics and used glassware, waste from
abattoirs and brewers as well as fecal matter from animals
scavenging on the dumpsite itself. Samples for this study
were fresh droppings of pigs continuously scavenging on
the dumpsite (FecD, n = 20), solid waste from different
sources (domestic waste – Dom, n = 22; solid biomedical
waste – Biom, n = 15) and run-off water sludge from
adjoining nearby river (Riv, n = 10). As a control sample,
fresh fecal materials collected from indoor reared pigs
(FecI, n = 10) which were later shifted from indoor to free
range on dumpsite (FecIF, n =15) were incorporated in
this study. About 5g of the core of fresh droppings of pig
as well as solid waste and sludge from the dumpsite were
aseptically collected into sterile plastic containers and
within one hour transported on ice to the molecular
biology laboratory of the Nelson Mandela African
Institution of Science and Technology, and stored at -20°C
until further processing
2.2. Ethical Statement
This study was approved by the research committee of
The Nelson Mandela African Institution of Science and
Technology, in Arusha, Tanzania. Permits to sample the
dumpsite was granted by the Arusha District Veterinary
office and to transfer samples between laboratories, permits
were given by the Zoosanitary inspectorate services of
Tanzania, Arusha (VIC/AR/ZIS/0345) and Veterinary
Services under the Ministry of Agriculture Livestock and
fisheries of Kenya (RES/POL/VOL.XXIV/506).
2.3. Extraction of Total DNA and PCR
Amplification
Total genomic DNA was extracted from about 250 mg
of sample using PowerSoil™ DNA extraction kit
(MOBIO Laboratories, Carlsbad, CA) as per
manufacturer’s protocol. Quality of DNA; A260/A280
and A260/A230) was verified with NanoDrop ND-2000c
spectrophotometer (Thermo Scientific) and
electrophoresis in 0.8 % agarose gel stained with GelRed
(Biotium) and run in 0.5X TBE buffer and electrophoresis
run at 80V for 30 minutes. Bacterial 16S rRNA gene
fragments were amplified using universal primers 27F (5’-
AGAGTTTGATCCTGGCTCAG -3’) and 1492R (5’-
GGTTACCTTGTTACGACTT-3’) [19,20,21]. PCR
reaction in 20 μl AccuPower® Taq PCR PreMix (Bioneer
Corporation, Korea) composed of 0.8 μl of 10 pmol/μl
each for the forward and reverse primers, 16.4 μl
molecular grade water and 2 μl DNA template.
Amplification was done in TC-PLUS PCR machine
(TECHNE Scientific, UK) programme set at 94°C for 5
min (initial denaturation), 35 cycles of 94°C for 30s, 57 oC
for 30 s (annealing), 68°C for 1min (initial extension) and
final extension at 68°C for 7 min. Amplicons were
verified with gel electrophoresis in 1.5% agarose at 100 V,
45 min and visualized using Gel documentation system
(DIGIDOC-IT System, UK). The PCR products were
purified using Qiagen kit (Qiagen, Valencia, CA)
following manufacturer’s protocol
2.4. 16S rRNA Gene Library Construction
and Sequencing
Five libraries corresponding to five sample sources,
FecI, FecD, FecIF, Biom and Dom were constructed. Pure
PCR product from the same sample source were pooled in
equal concentration, ligated to vector pTZ57R/T
(Fermentas, Lithuania) and then transformed DH5α™
strain of E. coli (Invitrogen, Life Technologies) as per
manufacturer’s instructions. Transformed bacteria cells
(150μl) were inoculated in LB agar composed of 100 mg/l
Ampicillin, 40 μl of 20 mg/ml X-gal and 60 μl of 100 mM
IPTG (Thermal Scientific) then incubated at 37 oC for
24hrs (J.P Selecta, Spain). To ascertain presence and
correct orientation of insert DNA, screening of
recombinant clone was done using colony PCR. Briefly,
individual white clones (90 – 100 per library) were
resuspended into 20μl PCR master mix composed of 0.5
μl each of the universal vector specific primers M13F (5‘-
CGCCAGGGTTTCCCAGTCA-3’) and M13R (5‘-
CAGGAAACAGCTATGAC-3’) [22] and the
AccuPower® Taq PCR PreMix as explained above. PCR
programme run in GeneAMP™ PCR system 9700
(Applied Biosystems) set at 95°C for 3 min (initial
denaturation) and 35 cycles of 94°C for 1 min, 55°C for 1
min, 72°C for 2 min and final extension at 72°C for 15
min. Amplicons, along with pTZ57R positive controls
were visualized using 1.5% agarose gel electrophoresis.
84 Journal of Applied & Environmental Microbiology
Colony PCR products were purified using QiAquick®
PCR kit as previously explained. The quality of DNA was
further verified with NanoDrop reading and agarose gel
electrophoresis. Clones with a single band (ninety from
each library) and at a minimum of 25 ng/μl concentration
were selected for sequencing. Bidirectional sequencing of
16S rRNA nucleotide of was done using Automatic
BigDye® terminator cycle chemistry (Applied Biosystems,
USA). Forward and reverse M13 primers were
independently used to generate forward and reverse
sequences. Plasmid pGEM® (Promega, USA) was used as
a control. Electrophoresis and data collection were
performed on ABI 3730 DNA analyser (Applied
Biosystems, USA).
2.5. Sequence Data Analysis and Statistics
The 16S rRNA sequences were edited, trimmed and
assembled using CLC Main Workbench (v7.0.3, CLC Bio
Aarhus, Denmark). Quality control was done using default
setting (quality limit = 0.05, and residue ambiguous = 2).
Trimmed sequences were assembled with minimum
aligned read length of 50 at stringency = medium and
conflict vote (A, C, G, T). Conflicts were resolved to
generate consensus sequences. Mothur algorithm v1.34
[23] was used for sequence alignment, chimera detection,
distance calculation and clustering of sequences. Sequence
identification was done using Naive Bayesian
classification method in the Ribosomal Database Project
(RDP) http://rdp.cme.msu.edu/ [24]. The differences in
bacteria community between solid wastes were
determined using the Parsimony, Libshuff and Unifrac
analysis using the built-in commands in Mothur. A p value
≤ 0.05 was considered significant for all comparisons.
High quality representative sequences were deposited at
the NCBI database and assigned with the GenBank
accession numbers KM 24477 to KM 244949.
2.6. Phylogeny of Enteric Bacteria from the
Dumpsite and Similarity to Known Pathogens
The MEGA6 software [25] was used to build
phylogenetic tree of enteric bacteria from different solid
wastes. The 16S rRNA gene sequences of pathogenic
bacteria gi|210063436| and gi|444439579| for
Enterococcus faecium and Shigella sonnei, respectively
were incorporated in the analysis. The 16S rRNA
sequence of Methanosarcina sp (gi|37222667|) from
Archaea was used as an out-group. Sequence alignment
was done using ClustalW [26] and the evolutionary
history was inferred using the Neighbor-Joining method
[27]. The evolutionary distances were computed using the
Jukes-Cantor method [28]. Sequence similarity of enteric
bacteria isolate from the dumpsite to known pathogens
was assessed using the BLASTN v2.2.31 at the NCBI
GenBank database. All sequences with identity of ≥ 99%
were considered highly similar to particular known bacteria.
2.7. Isolation and Identification of Enteric
Bacteria from the Dumpsite
The same sample used for total genomic DNA
extraction was used to isolate enteric bacteria. Based on
morphology and colony characteristics, individual colonies
were sub-cultured onto MacConkey agar to generate
individual pure colonies. Isolation of gram positive
fastidious bacteria was done using blood agar media
constituting Tryptone Soy Agar (HiMedia Laboratories
Ltd, India) and 8% sheep blood. Based on the nature of
hemolysis (α, β or γ); individual colonies from primary
culture were further sub-cultured to generate pure colonies.
Initially, pure isolates were identified based on colony
morphology and Gram staining according to Cowan and
Steel method [29]. Further, identification was done using
Analytical Profile Index kit (API 20E) specific for
Enterobacteriacea and other non-fastidious gram negative
rods (bioMerieux, France) as per manufacturer’s
instructions. None Enterobacteriaceae isolates were
identified based on their 16S rRNA sequences. Briefly,
genomic DNA of pure isolate was extracted using ZR-
Bacteria DNA kit™ (Zymo Research, USA) as per
manufacturer’s instructions. The quality of DNA,
amplification of 16S rRNA, purification of amplicons,
sequencing and identification of isolates through sequence
similarity was done as previously explained
2.8. Antimicrobial Susceptibility Testing
The Kirby-Bauer disk diffusion technique [30] was
used to study the antimicrobial susceptibility of bacteria
isolates from the dumpsite. The commercially prepared
antibiotic discs, Cefotaxime (CTXM, 30μg), Cefoxitin
(FOX, 30ug), Penicillin G (P, 10μg), Amoxycillin /
Clavulanic acid (AMC, 20/10μg) and Ceftazidime (CAZ,
30μg) in group of β-lactam antibiotics; and Ciprofloxacin
(CIP, 5μg) and Nalidixic acid (NA, 30μg) in group of
quinolones; and Gentamicin (CN, 10μg) in aminoglycoside
antibiotics were used in this study. All antibiotic discs
were purchased from (Oxoid, Basingstoke UK). An
overnight culture of pure isolates in Tryptone Soy Broth
(TSB) (HiMedia Laboratories Pvt, India) was suspended
into a sterile Peptone water (HiMedia Laboratories Pvt,
India). Interpretation of antimicrobial resistance
phenotype was performed as per Clinical Laboratory
Standards Institute guide [31]. Isolates were categorized as
resistant (R), intermediate resistant (IR) and susceptible
(S). Excel program was used to prepare summary plots of
resistance profile of different enteric bacteria isolates.
3. Results
3.1. Qualitative Survey of the Dumpsite
A survey of the dumpsite found different types of solid
wastes from domestic, industries, markets and
hospitals/pharmaceuticals thrown on the same dumpsite
without prior sorting. Wastes comprised of biomedicals
such as used syringes, swabs, expired drugs and used
catheters; diapers, dead animals, food remnants, cosmetics
and torn clothes from domestic; used bottles, package
material and other industrial wastes. Domestic animals
such as pigs, goats, and cattle, dogs, as well as chickens
were scavenging on dumpsite. Wild animals such as
rodents, snakes and birds like crows were seen on
dumpsite. Humans, apart from the dumpsite workers;
women and children were seen searching for recyclable
materials on the dumpsite. Close to the dumpsite there is
river Burka, to which garbage and non-solid waste leaches
during rains. Figure 1 shows the dumpsite scenery.
Journal of Applied & Environmental Microbiology 85
Figure 1. Dumpsite interaction and types of solid waste on the
dumpsite. A - Truck offloading garbage on the dumpsite and people
searching for valuable recyclable materials; B - domestic free range pigs
scavenging on garbage; C - Diapers from domestic waste; D - used
syringes from hospitals; E - cattle drinking water from the river near the
dumpsite
3.2. Prevalence of Enteric Bacteria, Phylogeny
and Similarity to Known Pathogens
A total of 218 enteric bacteria from both isolates and
cloned amplicons of 16S rRNA were identified. These bacteria
were from 75 different genera. Escherichia/Shigella
(12%), Bacillus (11%) and Proteiniclasticum (4%) were
the most abundant genera. It was also noted that
Escherichia/Shigella and Bacillus were mostly contributed
by faecal materials of pigs scavenging on dumpsite (FecD)
(8% and 4%, respectively) while Proteiniclasticum
dominated in Biom waste (Supplementary file 1).
Figure 2. Phylogenetic tree of faecal bacteria from pigs under
different management system. Evolutionary relationship of faecal
bacteria of pigs under different management system was established
using Mega6 software. The bootstrap values (expressed as percentages of
100 replications) are shown at branch points; only values above 50% are
indicated. The scale bar represents substitutions per 100 nucleotides.
Green triangles are bacteria sequences from indoor reared pigs; Blue-
diamond are bacteria sequences from pigs recently shifted from indoor to
free range on dumpsite, and Red - rectangles are bacteria sequences from
pigs continuously scavenging on the dumpsite. The black - circles with
GenBank accession numbers gi|210063436| and gi|444439579| are
reference sequences of Enterococcus faecium and Shigella sonnei,
respectively, both known to be pathogenic. The yellow – circle is
Methanosarcina sp from Achaea (gi|37222667|) which was used as an
out-group
Due to the importance of Escherichia and Shigella to
public health; further analysis of enteric bacteria from pigs
scavenging on the dumpsite was performed. In this
analysis phylogenetic relationship of sequences of enteric
bacteria from pigs scavenging on the dumpsite was
compared to those from indoor reared, and pigs shifted
from indoor to free range on the dumpsite. The
phylogenetic tree (Figure 2) revealed three major clusters
of bacteria. The first cluster (A) was composed of
bacterial sequences exclusively found in indoor reared
pigs (FecI). The second and third clusters (B and C)
comprised of sequences originating from indoor, pigs
shifted from indoor to free range as well as pigs
permanently under free range. In these clusters at least two
bacterial sequences from the same source clustered
together. Of interest, sequences of both Enterococcus
faecium and Shigella sonnei; well-known human
pathogens fell into cluster B, and moreover, fell closer to
sequences originating from FecD pigs.
Further, implication of sequence similarities shown
between the two reference pathogenic bacteria
(Enterococcus faecium and Shigella sonnei) with enteric
bacteria from the FecD pigs was investigated. On
interrogation of the 16S rRNA gene sequences at NCBI
database with bacterial sequences generated in this study,
17 sequences of bacteria with high similarity to Shigella
sonnei, Escherichia furgosonii, Escherichia faecium and
Escherichia coli 0157:H7 (Table 1) all of them known as
important human and animal pathogens.
Table 1. Similarity of bacterial sequences from pigs scavenging on
dumpsite to known pathogens
This work* From literature
Accession #
# of
clones
Description
Accession
#
% ID Ref
KM244771 6 S. sonnei NR_074894.1 99 [32]
KM244773 5 E. furgosonii NR_074902.1 99 [33]
KM244781 3 *E. faecium NR_102790.1 99 [34]
KM244796 3
E.coli
O157:H7
NR_074891.1 99 [35]
*E - Enterococcus, E- Escherichia, S – Shigella.
3.3. Antimicrobial Sensitivity Test
Figure 3. Antimicrobial resistance phenotypic profile of bacteria
isolates. Percentage of enteric bacterial isolates with different degrees of
resistance; P - Penicillin G, CAZ - Ceftazidime, CTXM - Cefotaxime,
AMC - Amoxycillin /Clavulanic, CN - Gentamicin, NA - Nalidixic Acid,
FOX- Cefoxitin, CIP - Ciprofloxacin. Blue bars represent resistant
isolates and red bars represent isolates with intermediate resistance
86 Journal of Applied & Environmental Microbiology
Eighty pure bacteria isolates from different solid wastes
were used for antimicrobial sensitivity test. Phenotypic
profile analysis revealed that, over 50% of all the isolates
were resistant to Penicillin G, Ceftazidime and Nalidixic
Acid antibiotics (Figure 3). While for penicillin G most
bacteria showed resistance (92% of all isolates);
Ciprofloxacin and Gentamycin were the most effective
antibiotics with 81% and 79%, respectively susceptible
isolates. When the isolates exhibiting intermediate and
total resistance are put together, it was found that, in the
third generation cephalosporin β-lactam antibiotics CAZ
and CTXM, resistance was evident in over 60% of all
isolates tested (61% for CTXM and 62% for CAZ).
Table 2. Multidrug resistance profile of bacteria from the dumpsite
Escherichia sp
# of antibiotics
Resistance pattern
#of isolates
2
P, NA
4
3
P,CAZ, NA
2
3
CIP, P, NA
1
4
CIP,CAZ, P,NA
1
4
P, CAZ, CTXM, NA
1
5
AMC, P, CAZ, CTXM, FOX
1*
6
CN, AMC, P, CAZ, FOX, NA
1*
Shigella sp
2
P, NA
1
3
P, CAZ, NA
1
4
P, CAZ, CTXM, NA
1*r
5
AMC, P, CAZ, CTXM, NA
1*a
6
AMC, CAZ, P, CTXM, FOX ,NA
1*b
Pseudomonas sp
2
P, NA
1
3
P, CAZ, CTXM
1
3
CIP, CAZ, NA
1
4
CIP, P, CAZ, NA
2**
5
AMC, P, CAZ, CTXM, NA
1 ***
6
AMC, P, CAZ, CTXM, FOX, NA
1***
Serratia sp
3
P, CAZ, NA
1
7
CIP, CN, AMC, P, CAZ, CTXM, NA
1*y
Enterococcus sp
2
CIP, NA
1
3
P, CAZ, NA
1*z
Enterobacter sp
4
P, CAZ, CTXM, FOX
1
Bacillus sp
2
P, CAZ
1
2
P, NA
2
3
P, CAZ, CTXM
1
3
P, CAZ, NA
1
4
P, CAZ, CTXM, FOX
4
5
AMC, P, CAZ, CTXM, FOX
1x*
5
P, CAZ, CTXM, FOX, NA
1x*
5
AMC, P, CAZ, CTXM, FOX
1x*
6
AMC, P, CAZ,CTXM, FOX, NA
1x*
Multidrug resistance expressed by bacterial isolates from different solid
waste. Isolates expressing resistance to more than four antibiotics are
shown with an asterisk; * Escherichia coli isolated from faecal matter of
indoor reared pigs; *r Shigella sp isolates from the river near the
dumpsite; *a Shigella flexneri isolated from faecal material of pigs
scavenging on dumpsite; ** Pseudomonas luteola from faecal material
of pigs scavenging on dumpsite; *** Pseudomonas luteola from solid
biomedical waste. *y Serratia rubidae isolated from solid biomedical
waste, *z Enterococcus casseliflavus isolated from pigs scavenging on
dumpsite; x* Bacillus sp isolated.
Further, phenotypic profiling revealed prevalence of
multidrug resistant bacteria on the dumpsite (Table 2). Of
all the isolates, 56% (45/80) were resistant to at least two
antibiotics. Some isolates were resistant to more than four
antibiotics. For example, Escherichia coli from faecal
material of pigs scavenging on dumpsites was resistant to
Gentamycin, Amoxy/Clavulanic, Penicillin G,
Ceftazidime, Cefoxitin and Nalidixic Acid; Shigella
flexneri and Pseudomonas luteola both from faecal
material of pigs were resistant to Amoxycillin / Clavulanic
Acid, Penicillin G, Ceftazidime, Cefotaxime, Cefoxitin
and Nalidixic acid. Pseudomonas luteola from solid
biomedical wastes and faecal material of pigs scavenging
on dumpsite were multidrug resistant. Interestingly,
multidrug resistant bacteria were also found in faecal
material of pigs reared indoors.
4. Discussion
This study determined the prevalence and antibiotic
resistance profile of enteric bacteria from a municipal
dumpsite in Arusha, Tanzania. High prevalence of
bacteria resistant to most commonly used antibiotics was
revealed on the dumpsite. Since the dumpsite was
composed of solid waste from diverse sources such as
hospitals, domestic and industrials, it is therefore expected
that microbes found therein were brought to the dumpsite
along with solid wastes from the respective sources. The
fact that antimicrobial resistant genes are common in
environments [36,37,38] and play an important role for
bacterial survival; the high prevalence of multidrug
resistant bacteria on the dumpsite is probably due to a
multitude of biological as well as ecological factors.
The complex interaction of microbes from different
sources on the dumpsite creates a favourable environment
for genetic material exchange between microbes, hence
the possible prevalence of antibiotic resistant bacteria
detected in this study. The fact that most of Escherichia
coli and Shigella sp were multidrug resistant implies that
there is possibility of these bacteria to harbour plasmids
with several genes conferring resistance to a broad array
of antibiotics. This finding is in agreement with previous
studies where Escherichia coli from animals previously
treated with antibiotics were found to harbour genes
conferring resistance to β-lactam antibiotics [39,40]. The
presence of multidrug resistant bacteria on dumpsite may
also be attributed to by the selection pressure from variety
of drugs on dumpsite and the noted high interaction
between microbes from different sources.
The study has shown that multidrug resistant
Escherichia coli were also detected in faecal material of
indoor reared pigs. By sampling faecal material of pigs
managed differently from those scavenging on the
dumpsite we anticipated to confirm whether pig
management has a significant impact on composition of
faecal enteric bacteria. This finding is similar to previous
reports [40,41,42], where resistant genes to given
antibiotics were found in animal microbiota in the absence
of treatment with particular antibiotics. This suggest that
probably there is a broad spread of yet unknown resistant
genes in both an environment and animal, hence further
research is needed.
Journal of Applied & Environmental Microbiology 87
The prevalence of multidrug resistant Pseudomonas sp
mostly from solid biomedical waste is also reported by
Odjadjare et al., [43] in effluent of municipal waste water
treatment plant. Pseudomonas is associated with diseases
in humans and animals, for example, Casalta et al., [44]
isolated P. luteola in patient with prosthetic valve
endocarditis, Benoit reported chromosome encoding β-
lactamase gene in Pseudomonas luteola; hence their
resistance to β-lactam antibiotics. Other researchers
reported the potential of Pseudomonas luteola in
degrading natural and man-made chemicals with their
extracellular enzymes lipase and amylase [45]. The fact
that these multidrug resistant bacteria were found on
dumpsite, suggests that there is high chance of spreading
these pathogens and the associated resistant genes to
humans and animals. Shigella sp from the river near the
dumpsite was among the multidrug resistant isolate. As
documented in this study (Figure 1), the river near the
dumpsite is used by local people around the dumpsite for
domestic chores and their animals. People using the river
have a high risk of contracting multidrug resistant bacteria.
The study further speculates the risk of spreading resistant
genes from the dumpsite to a larger population through the
river.
Bacillus species was the second most abundant group
after Escherichia sp. This group expressed high multidrug
resistance to most of the antibiotics. Gentamycin was the
most effective antibiotics to Bacillus sp with most isolates
susceptible. Similarly, previous studies reported multidrug
resistant Bacillus sp in municipal waste and tanneries, and
they associated it with presence of mega plasmid with
resistant genes [46,47]. The fact that Bacillus sp is
associated with several diseases of humans and animals
[48,49,50,51], their prevalence and multidrug resistance
shown in this study, signifies presence of human and
animal health risks on the dumpsite.
Many of the known antibiotic resistance genes are
found on transposons and plasmids, which can be
mobilized and transferred to other bacteria of the same or
different species through horizontal gene transfer [52,53].
The fact that there is high diversity of antimicrobial
resistant bacteria on dumpsite, and that animals and
humans are commonly interacting on dumpsite; there is
high chance of resistant genes from the dumpsite to be
transferred to previously susceptible bacterial groups in
human and animal populations through horizontal gene
transfer. This situation could further broaden the spectrum
of resistant pathogenic bacteria in the environment.
The presence of high interaction between people
working on dumpsite without any protective gear and
domestic animals scavenging on dumpsite; presents a
viable interface with high risks of contacting and
spreading resistant genes from the dumpsite to the public.
This could be through food animals scavenging on
dumpsite, shedding of the infected faecal material on the
environment and through people working on dumpsite.
In Tanzania, the prevalence of antibiotic resistant
bacteria has been reported mostly in hospital settings.
Reported cases in Tanzania includes, the prevalence of β-
lactamase producing gram negative bacteria of
nosocomial origin in hospital [54], antimicrobial
resistance in urinary isolates [55], and antibiotic resistant
bacteria in diabetic women’s [16], nasal carriage of
methicillin resistant Staphylococcus to under 5 children
[18] and antimicrobial resistant isolates from blood stream
[56]. Most of these studies reported Escherichia coli as the
most prominent aetiological agent with high resistance to
most of the drugs. As the case here, all studies were
conducted in hospital settings; implying that little is
known of the prevalence of the antimicrobial resistant
bacteria and other pathogens in the environment and the
possible association to growing antimicrobial resistance
levels in Tanzania.
The study has also found high sequence similarity of
bacteria from the dumpsite to known pathogens, including
Shigella sonnei, Enterococcus faecium, Enterococcus
furgosonii and Escherichia coli. Public health risks
associated with these bacteria have been extensively
reported and includes food borne diseases outbreaks
caused by Shigella sonnei [57,58]; nosocomial infections
by Enterococcus [59,60] as well as various food-borne
diseases by Escherichia coli [61,62] . This finding suggest
that probably these pathogens are present on the dumpsite,
and the fact that there is high interaction between animals
and human on the dumpsite they could easily be spread to
human setting through food animals as well as people
working on the dumpsite.
The prevalence of antibiotic resistant bacteria (with
56% multidrug resistant) on dumpsite, which represents
an ‘end-point’ of biodegradable and unrecyclable garbage
from diverse human activities has demonstrated the
microbial complexity on a municipal dumpsite and shows
the role of such dumpsites as hotspots for emergence of
new pathogens.
5. Conclusion
This study has shown high prevalence of antibiotic
resistant enteric bacteria on the dumpsite. Some isolates
have high similarity to known pathogens. This indicates a
possible risk of spreading of these pathogens and resistant
genes from the dumpsite to human or clinical setting. The
finding calls for further research to study the shared
resistome in bacteria from the environment, humans and
animals using functional metagenomic approach to
capture known and new resistant genes.
Acknowledgements
We acknowledge the Government of Tanzania through
The Nelson Mandela African Institution of Science and
Technology for sponsoring this research; The Africa
Biosciences Challenge Fund (ABCF) for a fellowship to
execute laboratory work at Biosciences eastern and
Central Africa – International Livestock Research Institute
(BecA- ILRI hub) in Nairobi, Kenya. Dr. Rob Skilton for
official facilitation while at BecA-ILRI hub, Ms Lucy
Muthui for her assistance with sequencing, the Genome
Science Centre at Sokoine University of Agriculture for
assistance with Microbiology and sampling techniques are
highly acknowledged.
References
[1] Sayah RS, Kaneene JB, Johnson Y, Miller R: Patterns of
antimicrobial resistance observed in Escherichia coli isolates
88 Journal of Applied & Environmental Microbiology
obtained from domestic-and wild-animal fecal samples, human
septage, and surface water. Applied and environmental
microbiology 2005, 71(3):1394-1404.
[2] Mshana SE, Matee M, Rweyemamu M: Antimicrobial resistance
in human and animal pathogens in Zambia, Democratic Republic
of Congo, Mozambique and Tanzania: an urgent need of a
sustainable surveillance system. Annals of clinical microbiology
and antimicrobials 2013, 12(1):28.
[3] Broens EM, Graat EAM, van de Giessen AW, Broekhuizen-Stins
MJ, de Jong MCM: Quantification of transmission of livestock-
associated methicillin resistant Staphylococcus aureus in pigs.
Veterinary Microbiology 2012, 155(2–4):381-388.
[4] Allen HK, Donato J, Wang HH, Cloud-Hansen KA, Davies J,
Handelsman J: Call of the wild: antibiotic resistance genes in
natural environments. Nature Reviews Microbiology 2010,
8(4):251-259.
[5] Gómez J, García-Vázquez E, Bonillo C, Hernández A, Bermejo M,
Canteras M: Self-assessment of patterns of antibiotic use in a
university hospital. Enfermedades infecciosas y microbiologia
clinica 2014.
[6] Sözen H, Gönen I, Sözen A, Kutlucan A, Kalemci S, Sahan M:
Application of ATC/DDD methodology to evaluate of antibiotic
use in a general hospital in Turkey. Ann Clin Microbiol
Antimicrob 2013, 12:23.
[7] You J, Yau B, Choi K, Chau C, Huang Q, Lee S: Public
knowledge, attitudes and behavior on antibiotic use: a telephone
survey in Hong Kong. Infection 2008, 36(2):153-157.
[8] Karak T, Bhagat R, Bhattacharyya P: Municipal solid waste
generation, composition, and management: the world scenario.
Critical Reviews in Environmental Science and Technology 2012,
42(15):1509-1630.
[9] Getahun T, Mengistie E, Haddis A, Wasie F, Alemayehu E, Dadi
D, Van Gerven T, Van der Bruggen B: Municipal solid waste
generation in growing urban areas in Africa: current practices and
relation to socioeconomic factors in Jimma, Ethiopia.
Environmental monitoring and assessment 2012, 184(10):6337-
6345.
[10] Sharholy M, Ahmad K, Mahmood G, Trivedi R: Municipal solid
waste management in Indian cities–A review. Waste Management
2008, 28(2):459-467.
[11] Achudume A, Olawale J: Microbial pathogens of public health
significance in waste dumps and common sites. Journal of
Environmental Biology 2007, 28(1):151.
[12] Emmanuel I, Joseph N, Kingsley E-I, Egbebor EM, Lawrence E:
Antibiotic susceptibility profiles of enteric bacterial isolates from
dumpsite utisols and water sources in a rural community in Cross
River State, Southern Nigeria. Nat Sci 2011, 9:46-50.
[13] Semrau JD: Current knowledge of microbial community structures
in landfills and its cover soils. Applied microbiology and
biotechnology 2011, 89(4):961-969.
[14] Matiko D: Managing disposal of unwanted pharmaceuticals at
health facilities in Tanzania: A case of Dar es Salaam region
public health facilities. Dar es Salaam: Muhimbili University of
Health and Allied Sciences; 2012.
[15] Mungure MJ: Governance and community participation in
Municipal Solid Waste management, case of Arusha and Dar es
Salaam Tanzania. M.Sc. In Environmental Management. Aalborg
University; 2008.
[16] Lyamuya EF, Moyo SJ, Komba EV, Haule M: Prevalence,
antimicrobial resistance and associated risk factors for bacteriuria
in diabetic women in Dar es Salaam Tanzania. Afr J Microbiol Res
2011, 5(6):683-689.
[17] Manyahi J, Matee MI, Majigo M, Moyo S, Mshana SE, Lyamuya
EF: Predominance of multi-drug resistant bacterial pathogens
causing surgical site infections in Muhimbili national hospital,
Tanzania. BMC Research Notes 2014, 7(1):500.
[18] Moyo SJ, Aboud S, Blomberg B, Mkopi N, Kasubi M, Manji K,
Lyamuya EF, Maselle SY, Langeland N: High nasal carriage of
methicillin-resistant Staphylococcus aureus among healthy
Tanzanian under-5 children. Microbial Drug Resistance 2014,
20(1):82-88.
[19] Bourne DG, Munn CB: Diversity of bacteria associated with the
coral Pocillopora damicornis from the Great Barrier Reef.
Environmental Microbiology 2005, 7(8):1162-1174.
[20] Galkiewicz JP, Kellogg CA: Cross-kingdom amplification using
bacteria-specific primers: complications for studies of coral
microbial ecology. Applied and environmental microbiology 2008,
74(24):7828-7831.
[21] Calheiros C, Teixeira A, Pires C, Franco A, Duque A, Crispim L,
Moura S, Castro P: Bacterial community dynamics in horizontal
flow constructed wetlands with different plants for high salinity
industrial wastewater polishing. Water research 2010,
44(17):5032-5038.
[22] Kleinsteuber S, Riis V, Fetzer I, Harms H, Müller S: Population
dynamics within a microbial consortium during growth on diesel
fuel in saline environments. Applied and environmental
microbiology 2006, 72(5):3531-3542.
[23] Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M,
Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson CJ:
Introducing mothur: open-source, platform-independent,
community-supported software for describing and comparing
microbial communities. Applied and environmental microbiology
2009, 75(23):7537-7541.
[24] Cole JR, Wang Q, Fish JA, Chai B, McGarrell DM, Sun Y, Brown
CT, Porras-Alfaro A, Kuske CR, Tiedje JM: Ribosomal Database
Project: data and tools for high throughput rRNA analysis. Nucleic
acids research 2014, 42(D1):D633-D642.
[25] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S: MEGA6:
molecular evolutionary genetics analysis version 6.0. Molecular
biology and evolution 2013, 30(12):2725-2729.
[26] Thompson JD, Gibson T, Higgins DG: Multiple sequence
alignment using ClustalW and ClustalX. Current protocols in
bioinformatics 2002:2.3. 1-2.3. 22.
[27] Saitou N, Nei M: The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Molecular biology and
evolution 1987, 4(4):406-425.
[28] Jukes T, Cantor C: Evolution of protein molecules, Munro HN,
Mammalian protein metabolism, 1969, 21-132. In.: Academic
Press, New York.
[29] Cowan S, Steel K: Identification of medical bacteria. Cambridge
University Press, Cambridge 1974.
[30] Bauer A, Kirby W, Sherris JC, turck, Turck M: Antibiotic
susceptibility testing by a standardized single disk method.
American journal of clinical pathology 1966, 45(4):493.
[31] CLSI: Performance Standard for Antimicrobial Disk and Dilution
Susceptibility Test for Bacteria Isolated From Animals; Approved
Standard - Third edition. CLSI document M31- 3A, Wayne, PA:
Clinical Laboratory Standard Institute. In.; 2013.
[32] Yang F, Yang J, Zhang X, Chen L, Jiang Y, Yan Y, Tang X,
Wang J, Xiong Z, Dong J: Genome dynamics and diversity of
Shigella species, the etiologic agents of bacillary dysentery.
Nucleic Acids Research 2005, 33(19):6445-6458.
[33] Forgetta V, Rempel H, Malouin F, Vaillancourt R, Topp E, Dewar
K, Diarra M: Pathogenic and multidrug-resistant Escherichia
fergusonii from broiler chicken. Poultry science 2012, 91(2):512-
525.
[34] Lam MM, Seemann T, Bulach DM, Gladman SL, Chen H, Haring
V, Moore RJ, Ballard S, Grayson ML, Johnson PD: Comparative
analysis of the first complete Enterococcus faecium genome.
Journal of bacteriology 2012, 194(9):2334-2341.
[35] Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K,
Yokoyama K, Han C-G, Ohtsubo E, Nakayama K, Murata T:
Complete genome sequence of enterohemorrhagic Eschelichia coli
O157: H7 and genomic comparison with a laboratory strain K-12.
DNA research 2001, 8(1):11-22.
[36] Riesenfeld CS, Goodman RM, Handelsman J: Uncultured soil
bacteria are a reservoir of new antibiotic resistance genes.
Environmental Microbiology 2004, 6(9):981-989.
[37] Sengeløv G, Agersø Y, Halling-Sørensen B, Baloda SB, Andersen
JS, Jensen LB: Bacterial antibiotic resistance levels in Danish
farmland as a result of treatment with pig manure slurry.
Environment international 2003, 28(7):587-595.
[38] Wright GD: Antibiotic resistance in the environment: a link to the
clinic? Current Opinion in Microbiology 2010, 13(5):589-594.
[39] Jørgensen CJ, Cavaco LM, Hasman H, Emborg H-D, Guardabassi
L: Occurrence of CTX-M-1-producing Escherichia coli in pigs
treated with ceftiofur. Journal of Antimicrobial Chemotherapy
2007, 59(5):1040-1042.
[40] Horton R, Randall L, Snary E, Cockrem H, Lotz S, Wearing H,
Duncan D, Rabie A, McLaren I, Watson E: Fecal carriage and
shedding density of CTX-M extended-spectru m β-lactamase-
producing Escherichia coli in cattle, chickens, and pigs:
implications for environmental contamination and food production.
Applied and environmental microbiology 2011, 77(11):3715-3719.
Journal of Applied & Environmental Microbiology 89
[41] Pallecchi L, Bartoloni A, Paradisi F, Rossolini GM: Antibiotic
resistance in the absence of antimicrobial use: mechanisms and
implications. 2008.
[42] Allen HK: Antibiotic resistance gene discovery in food-producing
animals. Current Opinion in Microbiology 2014, 19:25-29.
[43] Odjadjare EE, Igbinosa EO, Mordi R, Igere B, Igeleke CL, Okoh
AI: Prevalence of Multiple Antibiotics Resistant (MAR)
Pseudomonas Species in the Final Effluents of Three Municipal
Wastewater Treatment Facilities in South Africa. International
journal of environmental research and public health 2012,
9(6):2092-2107.
[44] Casalta J-P, Fournier P-E, Habib G, Riberi A, Raoult D: Prosthetic
valve endocarditis caused by Pseudomonas luteola. BMC
infectious Diseases 2005, 5(1):82.
[45] Khannous L, Jrad M, Dammak M, Miladi R, Chaaben N,
Khemakhem B, Gharsallah N, Fendri I: Isolation of a novel
amylase and lipase-producing Pseudomonas luteola strain: study
of amylase production conditions. Lipids in health and disease
2014, 13(1):9.
[46] Samanta A, Bera P, Khatun M, Sinha C, Pal P, Lalee A, Mandal A:
An investigation on heavy metal tolerance and antibiotic
resistance properties of bacterial strain Bacillus sp. isolated from
municipal waste. J Microbiol Biotech Res 2012, 2:178-189.
[47] Naraian R, Ram S, Kaistha S, Srivastava J: Occurrence of plasmid
linked multiple drug resistance in bacterial isolates of tannery
effluent. Cell Mol Biol 2012, 58(1):134-141.
[48] Kivanç S, Takim M, Kivanç M, Güllülü G: Bacillus Spp. isolated
from the conjunctiva and their potential antimicrobial activity
against other eye pathogens. African Health Sciences 2014,
14(2):364-371.
[49] Bottone EJ: Bacillus cereus, a volatile human pathogen. Clinical
microbiology reviews 2010, 23(2):382-398.
[50] Logan N: Bacillus and relatives in foodborne illness. Journal of
Applied Microbiology 2012, 112(3):417-429.
[51] Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M-A,
Roy SL, Jones JL, Griffin PM: Foodborne illness acquired in the
United States—major pathogens. Emerg Infect Dis 2011, 17(1).
[52] Kristiansson E, Fick J, Janzon A, Grabic R, Rutgersson C,
Weijdegård B, Söderström H, Larsson DJ: Pyrosequencing of
antibiotic-contaminated river sediments reveals high levels of
resistance and gene transfer elements. PloS one 2011, 6(2):e17038.
[53] Andam CP, Fournier GP, Gogarten JP: Multilevel populations and
the evolution of antibiotic resistance through horizontal gene
transfer. FEMS microbiology reviews 2011, 35(5):756-767.
[54] Ndugulile F, Jureen R, Harthug S, Urassa W, Langeland N:
Extended Spectru m β-Lactamases among Gram-negative bacteria
of nosocomial origin from an Intensive Care Unit of a tertiary
health facility in Tanzania. BMC infectious Diseases 2005, 5(1):86.
[55] Moyo SJ, Aboud S, Kasubi M, Lyamuya EF, Maselle SY:
Antimicrobial resistance among producers and non-producers of
extended spectrum beta-lactamases in urinary isolates at a tertiary
Hospital in Tanzania. BMC Research Notes 2010, 3(1):348.
[56] Moyo S, Aboud S, Kasubi M, Maselle S: Bacteria isolated from
bloodstream infections at a tertiary hospital in Dar es Salaam,
Tanzania: antimicrobial resistance of isolates. SAMJ: South
African Medical Journal 2010, 100(12):835-838.
[57] Okame M, Adachi E, Sato H, Shimizu S, Kikuchi T, Miyazaki N,
Koga M, Nakamura H, Suzuki M, Oyaizu N: Shigella sonnei
outbreak among men who have sex with men in Tokyo. Jpn J
Infect Dis 2012, 65(3):277-278.
[58] 58. Karlsson MS, Bowen A, Reporter R, Folster JP, Grass JE,
Howie RL, Taylor J, Whichard JM: Outbreak of infections caused
by Shigella sonnei with reduced susceptibility to azithromycin in
the United States. Antimicrobial agents and chemotherapy 2013,
57(3):1559-1560.
[59] Arias CA, Murray BE: The rise of the Enterococcus: beyond
vancomycin resistance. Nature Reviews Microbiology 2012,
10(4):266-278.
[60] Hossain MS, Rahman NNNA, Balakrishnan V, Puvanesuaran VR,
Sarker MZI, Kadir MOA: Infectious Risk Assessment of Unsafe
Handling Practices and Management of Clinical Solid Waste.
International journal of environmental research and public health
2013, 10(2):556-567.
[61] Manges AR, Johnson JR: Foodborne origins of Escherichia coli
causing extraintestinal infections. Clinical infectious diseases
2012:cis502.
[62] Grad YH, Lipsitch M, Feldgarden M, Arachchi HM, Cerqueira
GC, FitzGerald M, Godfrey P, Haas BJ, Murphy CI, Russ C:
Genomic epidemiology of the Escherichia coli O104: H4
outbreaks in Europe, 2011. Proceedings of the national academy
of sciences 2012, 109(8):3065-3070.
Supplementary file 1
Table S1. Bacterial genera identified in solid biomedical waste from the dumpsite
S/N Sample/Clone Genera % ID
Ref K12 Escherichia/Shigella 100
1 Biom28 Alkalitalea 99
2
Biom60
Alkalitalea
97
3 Biom81 Aquisphaera 84
4 Biom123 Bacillus 100
5
Biom125
Bacillus
100
6 Biom127 Bacillus 100
7 Biom131 Bacillus 100
8 Biom135 Bacillus 76
9 Biom139 Bacillus 100
10 Biom145 Bacillus 100
11 Biom17
Bacillus
100
12 Biom70 Cellvibrio 100
13 Biom16 Derxia 33
14 Biom6
Derxia
56
15 Biom2 Enterococcus 100
16
Biom24
Flavisolibacter
98
17 Biom19 Flavobacterium 88
18 Biom56 Luteimonas 100
19
Biom142
Lysinibacillus
97
20 Biom143 Lysinibacillus 97
21 Biom146 Lysinibacillus 100
90 Journal of Applied & Environmental Microbiology
22 Biom149 Lysinibacillus 71
23 Biom39 Massilia 100
24 Biom83
Micrococcineae
96
25 Biom22 Oligella 100
26 Biom53 Parapusillimonas 25
27
Biom78
Peptoniphilus
66
28 Biom3 Planomicrobium 83
29 Biom15 Proteiniclasticum 100
30
Biom35
Proteiniclasticum
99
31 Biom37 Proteiniclasticum 100
32
Biom38
Proteiniclasticum
100
33 Biom61 Proteiniclasticum 100
34 Biom66 Proteiniclasticum 100
35 Biom69 Proteiniclasticum 100
36 Biom74
Proteiniclasticum
100
37 Biom80 Proteiniclasticum 99
38 Biom12 Pseudomonas 99
39 Biom77
Rhodoplanes
55
40 Biom68 Roseicyclus 11
41
Biom122
Salirhabdus
40
42 Biom86 Stenotrophomonas 100
43 Biom14 Thauera 100
44
Biom30
Tissierella
61
Table S2: Bacterial genera identified in domestic solid waste from the dumpsite
S/N Sample Genera % ID
1 Dom16 Acinetobacter 100
2 Dom23 Acinetobacter 100
3 Dom44 Acinetobacter 100
4 Dom7 Allochromatium 99
5 Dom52 Atopostipes 100
6 Dom113 Bacillus 100
7 Dom114 Bacillus 100
8 Dom132 Bacillus 100
9 Dom37 Candidatus Hydrogenedens 100
10 Dom47 Clostridium XI 99
11 Dom11 Fusibacter 100
12 Dom28 Kurthia 58
13 Dom40 Leuconostoc 100
14 Dom38 Meniscus 31
15 Dom5 Mesorhizobium 100
16 Dom54 Mesorhizobium 58
17 Dom48 Oceanibaculum 58
18 Dom30 Phascolarctobacterium 94
19 Dom36 Pontibacter 100
20 Dom8 Pontibacter 100
21 Dom35 Proteiniclasticum 100
22 Dom111 Pseudomonas 100
23 Dom12 Saccharofermentans 75
24 Dom31 Saccharophagus 18
25 Dom19 Sphingomonas 100
26 Dom26 Sporacetigenium 100
27 Dom129 Staphylococcus 100
28 Dom34 Thalassolituus 100
29 Dom4 Tindallia 74
30 Dom39 Treponema 100
Journal of Applied & Environmental Microbiology 91
Table S3: Bacterial genera identified in faecal material of pigs scavenging on the dumpsite
S/N Sample Genera % ID
1 FecD12 Bacillus 100
2 FecD128 Bacillus 100
3 FecD26 Bacillus 84
4 FecD50 Bacillus 100
5 FecD60 Bacillus 100
6 FecD60 Bacillus 100
7 FecD84 Bacillus 100
8 FecD85 Bacillus 100
9 FecD87 Bacillus 86
10 FecD91 Bacillus 100
11 FecD99 Bacillus 81
12 FecD133 Brevibacillus 48
13 FecD16 Clostridium IV 45
14 FecD83 Clostridium sensu stricto 100
15 FecD17 Clostridium XI 99
16 FecD19 Clostridium XI 75
17 FecD7 Clostridium XI 100
18 FecD120 Enterococcus 100
19 FecD144 Enterococcus 100
20 FecD35 Enterococcus 100
21 FecD77 Enterococcus 100
22 FecD86 Enterococcus 100
23 FecD1 Escherichia/Shigella 100
24 FecD21 Escherichia/Shigella 100
25 FecD3 Escherichia/Shigella 100
26 FecD3 Escherichia/Shigella 99
27 FecD34 Escherichia/Shigella 100
28 FecD44 Escherichia/Shigella 100
29 FecD48 Escherichia/Shigella 100
30 FecD50 Escherichia/Shigella 100
31 FecD51 Escherichia/Shigella 100
32 FecD61 Escherichia/Shigella 100
33 FecD63 Escherichia/Shigella 99
34 FecD81 Escherichia/Shigella 100
35 FecD82 Escherichia/Shigella 100
36 FecD83 Escherichia/Shigella 100
37 FecD87 Escherichia/Shigella 99
38 FecD93 Escherichia/Shigella 100
39 FecD97 Escherichia/Shigella 100
40 FecD75 Fusobacterium 66
41 FecD37 Kandleria 98
42 FecD13 Lachnospiracea_incertae_sedis 71
43 FecD10 Lactobacillus 100
44 FecD88 Mitsuokella 100
45 FecD58 Oscillibacter 48
46 FecD33 Paenibacillus 99
47 FecD40 Planococcaceae_incertae_sedis 96
48 FecD43 Planococcaceae_incertae_sedis 94
49 FecD14 Sporacetigenium 63
92 Journal of Applied & Environmental Microbiology
Table S4: Bacteria genera identified in faecal materials of indoor reared pigs
S/N Sample Genera % ID
1 FecI11 Acetivibrio 68
2 FecI16 Anaerorhabdus 39
3 FecI17 Bacillus 100
4 FecI19 Bacillus 100
5 FecI2 Clostridium IV 80
6 FecI20 Clostridium IV 84
7 FecI21 Clostridium sensu stricto 100
8 FecI23 Clostridium sensu stricto 100
9 FecI27 Clostridium sensu stricto 98
10 FecI27 Clostridium sensu stricto 98
11 FecI29 Clostridium sensu stricto 100
12 FecI30 Coprobacillus 9
13 FecI30 Escherichia/Shigella 100
14 FecI32 Escherichia/Shigella 100
15 FecI34 Escherichia/Shigella 100
16 FecI38 Escherichia/Shigella 100
17 FecI39 Escherichia/Shigella 100
18 FecI41 Escherichia/Shigella 100
19 FecI41 Escherichia/Shigella 100
20 FecI43 Escherichia/Shigella 100
21 FecI43 Escherichia/Shigella 100
22 FecI44 Escherichia/Shigella 100
23 FecI45 Eubacterium 39
24 FecI46 Gemmiger 57
25 FecI47 Lachnospiracea_incertae_sedis 79
26 FecI48 Lachnospiracea_incertae_sedis 97
27 FecI51 Lachnospiracea_incertae_sedis 74
28 FecI54 Lactobacillus 100
29 FecI58 Lactobacillus 100
30 FecI59 Lactobacillus 100
31 FecI6 Lactobacillus 100
32 FecI61 Lactobacillus 100
33 FecI64 Lactobacillus 100
34 FecI67 Lactobacillus 100
35 FecI68 Megasphaera 100
36 FecI7 Megasphaera 100
37 FecI72 Oscillibacter 45
38 FecI79 Oscillibacter 76
39 FecI84 Oscillibacter 100
40 FecI86 Prevotella 99
41 FecI93 Roseburia 100
42 FecI97 Tannerella 63
43 FecI98 Tannerella 63
Journal of Applied & Environmental Microbiology 93
Table S5: Bacterial genera identified in faecal material of pigs shifted from indoor to free range on the dumpsite
S/N Sample Genera % ID
1 FecIF15 Anaerotruncus 31
2 FecIF75 Anaerovorax 95
3 FecIF76 Anaerovorax 90
4 FecIF101 Bacillus 100
5 FecIF53 Bacillus 100
6 FecIF39 Clostridium IV 36
7 FecIF71 Clostridium IV 90
8 FecIF91 Clostridium IV 48
9 FecIF92 Clostridium IV 32
10 FecIF19 Clostridium sensu stricto 100
11 FecIF56 Clostridium sensu stricto 100
12 FecIF2 Clostridium XI 100
13 FecIF35 Clostridium XI 64
14 FecIF41 Clostridium XI 100
15 FecIF42 Clostridium XI 100
16 FecIF46 Clostridium XI 100
17 FecIF60 Coriobacterineae 72
18 FecIF43 Escherichia/Shigella 100
19 FecIF55 Escherichia/Shigella 100
20 FecIF58 Escherichia/Shigella 100
21 FecIF62 Escherichia/Shigella 100
22 FecIF80 Escherichia/Shigella 100
23 FecIF92 Escherichia/Shigella 100
25 FecIF29 Oscillibacter 35
26 FecIF36 Oscillibacter 21
27 FecIF95 Oscillibacter 93
28 FecIF90 Papillibacter 32
29 FecIF86 Prevotella 95
30 FecIF96 Prevotella 99
31 FecIF3 Prolixibacter 10
32 FecIF32 Rikenella 46
33 FecIF33 Rikenella 46
34 FecIF58 Rikenella 34
35 FecIF61 Rikenella 22
36 FecIF64 Rikenella 72
37 FecIF63 Roseburia 39
38 FecIF1 Ruminococcus 79
39 FecIF82 Ruminococcus 100
40 FecIF83 Subdivision5_genera_incertae_sedis 70
41 FecIF12 Tannerella 63
42 FecIF14 Tannerella 68
43 FecIF47 Treponema 94
94 Journal of Applied & Environmental Microbiology
Table S6: Bacterial genera identified in river sludge near the dumpsite
S/N Sample Genera % ID
210 Riv137 Bacillus 99
211 Riv138 Bacillus 100
212 Riv1 Bacillus 100
213 Riv2 Bacillus 100
215 Riv105 Escherichia/Shigella 99
216 Riv4 Escherichia/Shigella 97
217 Riv5 Lysinibacillus 59
218 Riv6 Lysinibacillus 100
219 Riv106 Obesumbacterium 17
