Fine-mapping of a resistance gene to bacterial leaf pustule in soybean

Abstract

Soybean bacterial leaf pustule (BLP) is a prevalent disease caused by Xanthomonas axonopodis pv. glycines. Fine mapping of the BLP resistant gene, rxp, is needed to select BLP resistant soybean cultivars by marker-assisted selection (MAS). We used a total of 227 recombinant inbred lines (RILs) derived from a cross between 'Taekwangkong' (BLP susceptible) and 'Danbaekkong' (BLP resistant) for rxp fine mapping and two different sets of near isogenic lines (NILs) from Hwangkeumkong x SS2-2 and Taekwangkong x SS2-2 were used for confirmation. Using sequences between Satt372 and Satt486 flanking rxp from soybean genome sequences, eight simple sequence repeats (SSR) and two single nucleotide polymorphism (SNP) markers were newly developed in a 6.2-cM interval. Linkage mapping with the RILs and NILs allowed us to map the rxp region with high resolution. The genetic order of all markers was completely consistent with their physical order. QTL analysis by comparison of the BLP phenotyping data with all markers showed rxp was located between SNUSSR17_9 and SNUSNP17_12. Gene annotation analysis of the 33 kb region between SNUSSR17_9 and SNUSNP17_12 suggested three predicted genes, two of which could be candidate genes of BLP resistance: membrane protein and zinc finger protein. Candidate genes showed high similarity with their paralogous genes, which were located on the duplicated regions obtaining BLP resistance QTLs. High-resolution map in rxp region with eight SSR and two SNP markers will be useful for not only MAS of BLP resistance but also characterization of rxp.

Full text

ORIGINAL PAPER
Fine mapping of a resistance gene to bacterial leaf pustule
in soybean
Dong Hyun Kim •Kil Hyun Kim •Kyujung Van •
Moon Young Kim •Suk-Ha Lee
Received: 29 September 2009 / Accepted: 27 December 2009 / Published online: 20 January 2010
ÓSpringer-Verlag 2010
Abstract Soybean bacterial leaf pustule (BLP) is a
prevalent disease caused by Xanthomonas axonopodis pv.
glycines. Fine mapping of the BLP resistant gene, rxp,is
needed to select BLP resistant soybean cultivars by
marker-assisted selection (MAS). We used a total of 227
recombinant inbred lines (RILs) derived from a cross
between ‘Taekwangkong’ (BLP susceptible) and
‘Danbaekkong’ (BLP resistant) for rxp fine mapping and
two different sets of near isogenic lines (NILs) from
Hwangkeumkong 9SS2-2 and Taekwangkong 9SS2-2
were used for confirmation. Using sequences between
Satt372 and Satt486 flanking rxp from soybean genome
sequences, eight simple sequence repeats (SSR) and two
single nucleotide polymorphism (SNP) markers were
newly developed in a 6.2-cM interval. Linkage mapping
with the RILs and NILs allowed us to map the rxp region
with high resolution. The genetic order of all markers was
completely consistent with their physical order. QTL
analysis by comparison of the BLP phenotyping data with
all markers showed rxp was located between SNUSSR17_9
and SNUSNP17_12. Gene annotation analysis of the 33 kb
region between SNUSSR17_9 and SNUSNP17_12 sug-
gested three predicted genes, two of which could be
candidate genes of BLP resistance: membrane protein and
zinc finger protein. Candidate genes showed high similarity
with their paralogous genes, which were located on the
duplicated regions obtaining BLP resistance QTLs. High-
resolution map in rxp region with eight SSR and two SNP
markers will be useful for not only MAS of BLP resistance
but also characterization of rxp.
Introduction
Bacterial leaf pustule (BLP), caused by Xanthomonas
axonopodis pv. glycines (Xag), is a serious bacterial
disease of soybean [Glycine max (L.) Merr.]. BLP is
widespread in many soybean-growing regions of the
world where high temperature and humidity prevail. The
area of Xag-infected soybean fields in Korea has steadily
increased, reaching 88% in 1998 (Lee 1999). The
symptoms of BLP are characterized by small, yellow to
brown lesions with raised pustules in the center,
which cause premature defoliation resulting in 15% loss
of yield (Hartwig and Lehman 1951; Laviolette et al.
1970).
BLP was first reported in the USA and resistance was
controlled by a single recessive gene in F
3
generation
from crosses of BLP resistant variety, CNS (PI 548445),
with several susceptible varieties (Hartwig and Lehman
1951). The rxp, a resistance gene to BLP, was mapped on
chromosome 17 (previously linkage group D2) 3.9 cM
away from Satt372 and 12.4 cM from Satt014
(Narvel et al. 2001; Palmer et al. 1992). Quantitative trait
loci (QTLs) identification for BLP resistance revealed that
Satt372 on chromosome 17 was strongly associated with
Communicated by H. T. Nguyen.
D. H. Kim K. H. Kim K. Van M. Y. Kim S.-H. Lee (&)
Department of Plant Science and Research Institute for
Agriculture and Life Sciences, Seoul National University,
Seoul 151-921, Korea
e-mail: sukhalee@snu.ac.kr
S.-H. Lee
Plant Genomics and Breeding Institute,
Seoul National University, Seoul 151-921, Korea
123
Theor Appl Genet (2010) 120:1443–1450
DOI 10.1007/s00122-010-1266-0

resistance to six different isolates of Xag under green-
house and field conditions (Van et al. 2004). Several
minor QTLs were also identified depending on the Xag
isolates, indicating that BLP resistance was mainly con-
trolled by a single major gene tightly linked to Satt372
with several minor genes. Satt486 was also known as the
marker significantly associated to BLP resistance (Kim
et al. 2004). Three single nucleotide polymorphism
(SNP) markers between Satt372 and Satt486 were pres-
ent in soybean transcript map: BARC-021191-04000,
BARC-022037-04263, BARC-040963-07870 (Choi et al.
2007), but the physical location of BARC-040963-07870
was changed to about 400 kb away from the original
position in soybean transcript map according to soybean
genome sequences (http://www.phytozome.net/soybean.
php). Related to that, more markers need to be devel-
oped for constructing a high-resolution map near rxp.
The strategy of map-based cloning is to find molec-
ular markers linked tightly to the gene of interest. In
previous studies, sequencing BACs or chromosome
walking was commonly used for identifying the candi-
date genes (Blair et al. 2003; Chu et al. 2006). Since
genomes from various organisms have been fully
sequenced, we can now use these sequences as refer-
ences for identifying candidate genes or developing new
markers like xa24 (Wu et al. 2008). Gene-for-gene
theory suggests that a plant has resistance, if it has a
specific resistance (R) gene against a specific pathogen
avirulence gene (Staskawicz et al. 1995). Many Rgenes
identified in plants are dominant and most of the dom-
inant Rgenes belong to five classes, e.g. Ser/Thr kinase,
transmembrane and leucine-rich repeat (Martin et al.
2003). However, recessive resistance genes did not have
prototypes and only few recessive resistance genes
including mlo,RRS1-R and xa5 were identified
(Deslandes et al. 2002; Jiang et al. 2006; Kim et al.
2002). These have different structures and functions and
their signal pathway or any part of recessive defense
system was uncharacterized. Thus, developing linked
markers and fine mapping could be the first step to clone
recessive resistance genes.
Marker-assisted selection (MAS) could help breeders
to select resistant lines without pathogen inoculation on
plants and regardless of environmental conditions.
Breeding of resistant cultivars with MAS could be the
most economically and environmentally efficient
approach which can reduce time-consuming labor and
expenses for many selection cycles. However, tightly
linked genetic markers for resistance genes are needed
for MAS in crop breeding (Mohan et al. 1997). Thus, the
objective of this study is to finely map rxp by devel-
oping new simple sequence repeats (SSR) and SNP
markers tightly linked to rxp.
Materials and methods
Plant materials and DNA extraction
Danbaekkong is resistant to soybean BLP while
Taekwangkong is BLP susceptible cultivar (Han et al.
2007; Park et al. 2008). A population of 227 F
7
recombi-
nant inbred lines (RILs) was developed from a cross of
Taekwangkong and Danbaekkong and these RILs were
used for linkage mapping. Fine mapping of the BLP
resistance gene was confirmed using two different sets
of near isogenic lines (NILs). Three Hwangkeumkong-
resistant (HR) lines and two Taekwangkong-resistant (TR)
lines were generated by backcrossing a rxp donor parent
SS2-2 with susceptible Hwangkeumkong and Taekwang-
kong as recurrent parents, respectively. Hwangkeumkong
is BLP susceptible and SS2-2 is BLP resistant (Kim et al.
2008). DNA was extracted from young leaves by CTAB
method with minor modifications (Allen et al. 2006).
Concentration of DNA was determined with a ND-1000
(NanoDrop Technologies, Inc., Wilmington, DE, USA).
Xag inoculation and BLP evaluation
Experiments were carried out in a greenhouse at Suwon,
Korea during July and August 2008, where relative
humidity averaged 85.6% and 25.7°C was average tem-
perature. The pathogen strain 8ra of Xag was cultured in
peptone sucrose agar medium 28°C for 48 h. Four-week-
old parents and their 227 RILs were inoculated by spraying
the bacterial suspension on both sides of leaves using an
atomizer (Park et al. 2008). All plant inoculation experi-
ments were repeated twice and each replicate consisted of
three leaves. After inoculation with Xag in the RILs, the
disease scale was determined by the numbers of their
lesions (Fig. 1). The lesion numbers were counted 1 week
after inoculation. BLP phenotype was visually rated by
counting disease spots of each plant after inoculation of
Xag using a 0–5 scale: 0 is for below 5 disease spots, 1 is
for 5–20 spots, 2 is for 20–50 spots, 3 is for 50–80 spots, 4
is for covering half of leaf with spots and 5 is for almost
dead leaf. This disease assessment was modified from Kim
(2003).
SSR/SNP marker development and PCR conditions
Marker development and fine mapping near the rxp region
was done in two steps. The first step was performed with
SSR markers developed in this study (Table 1). Amplifi-
cations were carried out by PTC-225 Thermal cycler (MJ
research, Waltham, MA, USA) with Satt372 and Satt486 as
described in Soybase (http://soybase.org). For developing
new SSR markers between Satt486 and Satt372, the
1444 Theor Appl Genet (2010) 120:1443–1450
123

sequences were downloaded from Phytozome (http://
www.phytozome.net/soybean) and repeat sequences were
searched by Sputnik (http://cbi.labri.fr/outils/Pise/sputnik.
html) with default parameters except max unit length as 4.
The primers for amplification of the searched SSR were
designed by primer3 (http://frodo.wi.mit.edu) with default
parameters. The SSR amplification consisted of an initial
denaturation at 94°C for 4 min, followed by 30 cycles of
denaturation at 94°C for 30 s, annealing at temperatures
mentioned in Table 1by each primer for 30 s and exten-
sion at 72°C for 30 s and final extension at 72°C for
10 min. PCR products for SSR were separated by 8%
polyacrylamide gel (Wang et al. 2003).
The second step was carried out with the SNP markers.
We selected intron, UTR and intergenic regions for
developing SNP markers because those regions showed
higher frequency of SNPs than exon (Zhu et al. 2003).
Among them, the duplicated regions showing less than
70% in homology were only used for designing primers
because their flanking regions were duplicated with high
similarity. Primers were tested using genomic DNA of
Taekwangkong and Danbaekkong. For identifying SNP,
sequencing was performed with the BigDye Terminator
(v. 3.1) cycle sequencing kit (Applied Biosystems, Foster
City, CA, USA). Since PCR products less than 250 bp
could lead to the best results, the SNP genotyping primers
were redesigned for high-resolution melting (HRM) after
SNP was detected. However, PCR products for HRM were
longer than 300 bp because SNPs were located in AT-rich
regions. PCR for HRM analysis was performed with the
presence of the dye 5 lM Syto
Ò
9 (Invitrogen, Sydney,
Australia) on a LightCycler
Ò
480 (Roche, Mannheim,
Germany). The PCR reactions were performed in 20 ll
reaction volume contained 50 ng of genomic DNA, 1 lMof
forward and reverse primer, 19reaction buffer, 0.1 mM
dNTP and 0.5 U of Taq DNA polymerase (Vivagen,
Sungnam, Korea). The HRM amplification consisted of
pre-incubation at 95°C for 10 min, followed by 45 cycles
of denaturation at 94°C for 10 s, annealing at 62°C for 10 s,
and extension at 72°C for 10 s and final extension at 72°C for
10 min. Melting analysis was performed with the additional
denaturation at 95°C for 1 min, cooling down with a pro-
grammed rate of 2.2°C/s to 40°C for 1 min and a continuous
melting of the amplicon with high-resolution data acquisi-
tion. The HRM results were obtained with LightCycler
Ò
480
Gene Scanning program as a manufacturer’s protocol.
Data analysis
Linkage map was constructed with the Kosambi mapping
function using Mapmaker 3.0 (Lander et al. 1987) with the
threshold LOD score of 3.0. Composite interval mapping
(CIM) was performed by Qgene V. 4.2.2 (Joehanes and
Nelson 2008) with scan interval 1. Gene annotation was
conducted with gene prediction program FGENESH (http://
www.softberry.ru) against Arabidopsis database. Each pre-
dicted gene was subjected to a BLASTP query of the UniRef
database (http://www.ebi.ac.uk/uniref) and a BLASTN
query of the EST database (http://www.ncbi.nlm.nih.
gov/blast).
Fig. 1 Disease scale and
distribution by lesion numbers.
Disease scale was made by
counting lesion numbers in
RILs. Scale 0\5 lesions, scale 1
5–20 spots, scale 2 20–50 spots,
scale 3 50–80 spots, scale 4
covering half of leaf, scale 5
almost death of leaf. The
numbers of plants were counted
by the disease scale.
Danbaekkong belonged to
scale 1 while Taekwangkong
was scale 3
Theor Appl Genet (2010) 120:1443–1450 1445
123

Results
Evaluation of disease
Danbaekkong belonged to scale 1 and Taekwangkong to
scale 3 (Fig. 1). Danbaekkong showed strong resistance to
BLP, but Taekwangkong was not severely susceptible.
Among RILs, a total of 33, 67 and 57 plants were scaled as
0, 1 and 2, respectively, which were considered as resistant
to BLP. For susceptible RILs, 25, 40 and 8 plants were in
scale 3, 4 and 5, respectively (Fig. 1). So, the progenies
showed various phenotypes, some plants showed more
resistance than Danbaekkong and some lines had more
severe damage by Xag than Taekwangkong (Fig. 1).
Development of SSR and SNP markers
For the fine mapping of rxp, sequence data available at
Phytozome and the BAC clones sequenced in our pre-
vious study (Van et al. 2008) were used for designing
SSR and SNP markers. Three SNP markers, BARC-
021191-04000, BARC-022037-04263 and BARC-040963-
07870 were between Satt372 and Satt486 in the recent
soybean transcript map (Choi et al. 2007). However, the
genetic distance between BARC-021191-04000 and
BARC-022037-04263 was 0.06 cM and they were
monomorphic in our mapping population. BARC-
040963-07870 was physically located on the outer range
of Satt372 and Satt486. Therefore, new genetic markers
in this region should be developed for fine mapping of
rxp.
Within this region, putative 70 SSR loci were iden-
tified by Sputnik. A total of 17 putative SSR loci having
more than 40 bp repeat motifs were selected for
designing primers to survey polymorphisms between
Taekwangkong and Danbaekkong. Out of the 17 SSR
markers, 8 markers having ‘AT’ as a repeat motif
showed polymorphisms between the parents of the RILs
(Table 1).
To identify SNPs for fine mapping, five regions were
selected based on two criteria, low similarity with dupli-
cated regions in other chromosomes and longer than 3 kb
in size. Two SNP markers, SNUSNP17_2 and
SNUSNP17_12, were developed between SNUSSR17_3
and SNUSSR17_9 (Table 1). In SNUSNP17_2, a trans-
version SNP (C: Taekwangkong/G: Danbaekkong)
was observed at 7,098,492 bp on chromosome
17. SNUSNP17_12 showed transition substitution
(G: Taekwangkong/A: Danbaekkong) at 7,270,471 bp on
chromosome 17. And, both of these SNPs were located in
introns. Thus, eight new SSR markers and two new SNP
markers were developed in this region spanning of about
820 kb.
Table 1 General information of primer sequences for SSR and SNP markers
Marker type Primer name Location
a
Forward primer (50?30) Reverse primer (50?30)T
m
(°C) Amplicon length (bp) Miscellaneous
b
SSR SNUSSR17_1 6,817,439–6,817,739 GGTGGACAATCATCCAACT TTAGTCATCTCTAGGTTACCTACG 48 300 AT
SNUSSR17_3 7,064,132–7,064,465 CCTCAGATATCTCTATTCG TCATATTCAGCTCACTACTTAG 44 333 AT
SNUSSR17_9 7,303,694–7,303,940 ATGTGTATCAAAGTATGGACG TTCAGATAAGCATCTGGGA 47 246 AT
SNUSSR17_12 7,368,501–7,368,886 TGATTTAGTGATCGGAAGAG AGTTGCTAATGAGATCTCACT 44 385 AT
SNUSSR17_13 7,431,730–7,431,971 AAATGCTTGAAAACCCATTCA AATACCCTTTATGCACATACCC 51 241 AT
SNUSSR17_14 7,471,253–7,471,550 TGCATATTCAGATACGGAAG AGTTGTGTGACTGCAAAGTT 46 297 AT
SNUSSR17_15 7,515,826–7,516,019 CAAGACGTTGAGTATAAGCA CGGAAATAATGTAATGACAA 45 193 AT
SNUSSR17_17 7,654,172–7,654,477 TGGCCCACGGTAGACTTTTA TTCACATGGTTGATGGTTGTC 52 305 AT
SNP SNUSNP17_2 7,098,190–7,099,018 CAGGGCCTCCATGAAGGTAT TCCTTCCTAGCCTTCAACCTC 55 828 C/G (7,098,492)
?SNUHRM17_2 7,098,320–7,098,680 TCAGGAGGGAGAAAGATAGA GGTGTGAGAGAACGAAGACT 64 360 C/G (7,098,492)
SNUSNP17_12 7,270,139–7,270,984 GGCAAAATAGAGAAGCCTCTACC CAAAGAAAAGCGTCACACCA 54 845 G/A (7,270,471)
?SNUHRM17_12 7,270,259–7,270,570 AGCCAATGAGTGATAGTTGC CTCCAAAGGACATAAAATGG 64 311 G/A (7,270,471)
a
Location: physical location in soybean genome reference sequence (http://www.phytozome.net/soybean.php)
b
Miscellaneous: repeat motif in SSR marker, SNP sequence of Taekwangkong/Danbaekkong and its location in Phytozome
1446 Theor Appl Genet (2010) 120:1443–1450
123

Fine mapping and QTL identification
We genotyped the RILs with eight SSR and two SNP
newly developed markers and a genetic map was con-
structed within 6.2 cM of genetic distance between
SNUSSR17_1 and SNUSSR17_17. The average distance
between markers in this region was 0.68 cM, and the
largest marker interval was 1.8 cM between
SNUSNP17_12 and SNUSSR17_9. Around Satt372 and
Satt486, ten newly developed markers were added, thus
increasing the genetic resolution of the previous map (Choi
et al. 2007). Two SNP markers were positioned at 0.4 cM
from SNUSSR17_3 (Fig. 2) and their physical distance
was 170 kb (Table 1). But the genetic distance between
the two SNP markers was 0 cM because the RILs showed
the same genotype in these SNP markers. On this map, the
genetic order of these markers was completely consistent
with their physical location in soybean genome sequences.
QTL analysis using composite interval mapping was
performed by comparison of the BLP phenotyping data
Fig. 2 Fine mapping of rxp
and graphical genotypes of
RILs. QTL map of rxp in the
middle of chromosome 17 was
constructed with 8 SSR markers
and 2 SNP markers. Two SNP
markers (SNUSNP17_2 and
SNUSNP17_12) showed the
same genotypes. Black bars,
white bars and grey bars
represent Danbaekkong
segments, Taekwangkong
segments and heterozygous
region, respectively. Susceptible
and resistant phenotypes are
represented by Sand R,
respectively. The black arrows
represent predicted genes
Theor Appl Genet (2010) 120:1443–1450 1447
123

with the marker genotyping data. Out of 227 F
7
RILs, 15
RILs were identified as recombinants between Taekwang-
kong and Danbaekkong (Fig. 2). The maximum LOD score
was on SNUSSR17_9. The genotypes of RILs at
SNUSSR17_9 were identical with their phenotypes except
TD_74. TD_74 showed resistant genotype in SNUSNP17_
2 and SNUSSR17_9, even though it had susceptible
phenotype.
Confirmation of linkage map with NILs
To confirm newly developed markers linked to rxp, two
different set of NILs having resistant phenotypes were
used to genotype with four markers, SNUSSR17_3,
SNUSSR17_9, SNUSNP17_2 and SNUSSR17_12 (Kim
et al. 2008). Hwangkeumkong followed susceptible
Taekwangkong genotypes and SS2-2 was the same
as Danbaekkong. Taekwangkong-resistant (TR) lines
showed resistant genotypes at both SNUSSR17_9 and
SNUSNP17_2 whereas Hwangkeumkong-resistant (HR)
lines had susceptible genotype at SNUSSR17_9 (Fig. 3).
Therefore, according to linkage mapping of both RILs and
NILs, rxp could be located between SNUSNP17_12 and
SNUSSR17_9.
Candidate gene prediction
Analysis of the 33 kb sequences flanked by two markers,
SNUSSR17_9 and SNUSNP17_12, revealed that three
open reading frames were predicted; one was DNA poly-
merase and the other two genes could be considered as
putative candidate genes after each predicted gene was
subjected to a BLASTP query of the UniRef database
(Table 2). First, membrane protein (Glyma17g09780,
6E-43) has three exons and is 768 bp long. The second
candidate gene is similar to zinc finger family protein from
Arabidopsis (Glyma17g09790, 2E-97), having six exons
and 759 bp long. The expression of these genes was sup-
ported by EST data (CD398246 and CO984038 at
http://www.ncbi.nlm.nih.gov/).
Discussion
A total of ten markers including eight SSRs and two SNPs
were developed and rxp mapped between SNUSNP17_12
and SNUSSR17_9. The region between Satt486 and
Satt372 showed high similarity with the duplicated region
(chromosomes 4, 5, 6, 10 and 17) (Kim et al. 2009; Van
et al. 2008) and six QTLs for resistance to BLP were also
detected in chromosomes 4, 5, 10, 13, 17 and 19 (Van et al.
2004). It suggested that the candidate gene of rxp was
duplicated and each duplicated gene might have its own
function for the resistance to BLP. So, six regions con-
tained SSR markers for BLP resistance QTLs were anno-
tated and compared by BLASTN for candidate genes
(Table 3). The membrane protein showed high similarity
with five genes, which were located on the duplicated
Fig. 3 The rxp genetic mapping with NILs. Black bars and white
bars represent resistant genotype and susceptible genotype, respec-
tively. Hwangkeumkong-resistant lines (HR 1-4, HR 3-1 and HR 5-1)
are developed by backcrossing rxp donor parent SS2-2 with
Hwangkeumkong as recurrent parent. Taekwangkong-resistant lines
(TR 3-2 and TR 3-5) are developed by backcrossing SS2-2 with
Taekwangkong as recurrent parent. HR lines and TR line showed
resistant phenotype but HR lines had susceptible genotype in
SNUSSR17_9, TS lines had resistant genotype in SNUSSR17_9
Table 2 BLAST results of candidate genes positioned between SNUSNP17_12 and SNUSSR17_9
Candidate
name
a
Uniref ID
b
Identity
c
(%) Length
(amino acid)
evalue Description
Glyma17g09780 UniRef100_Q84WP5 48.44 256 6.00E-43 Membrane protein At2g36330;
Arabidopsis thaliana
Glyma17g09790 UniRef100_UPI0000196F93 69.96 253 2.00E-97 Zinc finger (C3HC4-type RING finger)
family protein; Arabidopsis thaliana
a
Candidate name: annotation by Phytozome (http://www.phytozome.net/soybean.php)
b
Uniref ID: BLASTP results in UniRef database (http://www.ebi.ac.uk/uniref)
c
Identity: percentage of amino acid homology
1448 Theor Appl Genet (2010) 120:1443–1450
123

regions with BLP resistance QTLs. For zinc finger family
protein, only three paralogous genes (chromosomes 4, 5
and 6) were identified instead of five paralogous genes.
However, all annotated names by Phytozome, which con-
tained chromosome number and numerical index of genes,
indicated gene synteny. Also, their gene order and orien-
tation were conserved among paralogous genes in chro-
mosomes 4, 5 and 6.
The SSR and SNP markers developed in this study were
much closer than any marker published. Until now, Satt372
and Satt486 were used for MAS of BLP resistance (Kim
et al. 2008). Among the 15 NILs selected based on Satt486
and Satt372, 4 did not show any resistant phenotype.
However, in SNUSSR17_9, genotypes of the RILs were
identical with their phenotypes except a TD-74 RIL and
SNUSNP17_12 had three exceptions (TD-74, 166 and 182
RILs) among 227 RILs. SNUSSR17_9 and SNUSNP17_12
were found to be more tightly linked to rxp than Satt372
and Satt486. Thus, these newly developed markers were
highly useful for MAS.
The fine mapping allowed us to narrow down the loca-
tion of rxp within 33 kb between SNUSSR17_9 and
SNUSNP17_12. Among three annotated ORFs, one was
DNA polymerase and the rest were considered as potential
candidate genes. These two candidate genes are a mem-
brane protein and a zinc finger (C3H4-type RING finger)
family protein. The membrane protein is one of the largest
protein superfamily. Although at least 12 functional cate-
gories were identified in Arabidopsis, each of their func-
tions was not fully characterized (Ward 2001). Usually,
their members have predicted transmembrane regions like
Mildew resistance Locus O (MLO) (Kim et al. 2002). The
zinc finger family protein has RING finger domain, a
specialized type of zinc finger with 40–60 residues bound
to two atoms of zinc. It was probably involved in mediation
of protein–protein interaction. The RING finger protein is
known as having a wide range of functions such as viral
replication, signal transduction and development. The zinc
proteins are also considered as contributing towards pro-
tection against environmental stresses (Davletova et al.
2005). Two genes were the most likely candidates for the
observed resistance because some well-known genes with
similar structures were involved in resistance processes.
Until now, little about the mechanisms for recessive
resistance are known because few recessive resistance
genes have been characterized (Iyer-Pascuzzi and
McCouch 2007). Since recessive resistance genes have
various structures, the functions of each gene might be
different. Xa5, bacterial blight resistance gene in rice,
encoded the gamma subunit of transcription factor IIA, but
only two nucleotide substitutions resulted in amino acid
change from valine to glutamic acid leading to resistance
phenotype (Jiang et al. 2006). MLO has seven transmem-
brane domains and its function seems to be a negative
regulator of the defense against powdery mildew fungus in
barley (Kim et al. 2002). The RRS1-R gene from Arabid-
opsis gives resistance to bacterial wilt and encodes a
nucleotide binding site-leucine-rich repeat (NBS-LRR)
protein (Deslandes et al. 2002).
Two hypotheses for recessive resistance in plants have
been suggested. First, recessive resistance genes may be
required for the pathogen growth or reproduction. For
example, translation initiation factors, eIF4E and eIF4G,
responsible for resistance to Rice yellow mottle virus are
recessive (Albar et al. 2006). The recessive allele prevented
the formation of complexes involved in the fixation of
mRNA cap and ribosome recruitment. Therefore, mutation
in plant gene products, which are essential for pathogen’s
activities, can give resistance to plants because the virus
does not have its own system for transcription or transla-
tion. Secondly, recessive resistance genes may be a nega-
tive regulator in plant defense pathways. For example,
recessive mutations in the barley gene, mlo, give resistance
to the powdery mildew pathogen. MLO encodes plant-
specific integral membrane protein and has calmodulin
(CaM)-binding domain in C-terminal. CaM binding
enhanced MLO activity and mutations in CaM-binding
domain prevented MLO with negative defense regulation
against powdery mildew (Kim et al. 2002). Since genes
with binding domains are related to the signal pathways,
BLP candidate genes with similar structures might be
involved in the signal pathway for disease resistance.
Therefore, the second hypothesis might be more positive, if
one of these candidate genes is the BLP resistance gene.
Our results showed that rxp is between SNUSNP17_12
and SNUSSR17_9. Two candidate genes were selected and
Table 3 Percentage in
nucleotide similarity between
candidate genes and their
homologs
Candidate gene Membrane protein Zinc finger family protein
Chromosome 17 100 (Glyma17g09780) 100 (Glyma17g09790)
Chromosome 5 93 (Glyma05g02140) 94 (Glyma05g02130)
Chromosome 4 83 (Glyma04g35320) 89 (Glyma04g35340)
Chromosome 6 82 (Glyma06g19450) 86 (Glyma06g19470)
Chromosome 19 80 (Glyma19g23460) –
Chromosome 10 80 (Glyma10g15610) –
Theor Appl Genet (2010) 120:1443–1450 1449
123

their potentials as a resistance gene were described. High-
resolution map in rxp region with eight SSR and two SNP
markers could help breeders for MAS of resistant cultivars
to BLP because the markers identified in this study are
tightly linked to rxp.
Acknowledgments This work was supported by the Agricultural
R&D Promotion Center, Ministry for Food, Agriculture, Forestry, and
Fisheries, Republic of Korea (grant no. 305005–4), by the Crop
Functional Genomics Center of the 21st Century Frontier R&D
Program funded by the Ministry of Education, Science, and
Technology, Republic of Korea (grant no. CG3121), by the BioGreen
21 Project, Rural Development Administration, Republic of Korea
(grant no. 20080401034011 for DNA sequencing).
References
Albar L, Bangratz-Reyser M, Hebrard E, Ndjiondjop MN, Jones M,
Ghesquiere A (2006) Mutations in the eIF(iso)4G translation
initiation factor confer high resistance of rice to Rice yellow
mottle virus. Plant J 47:417–426
Allen GC, Flores-Vergara MA, Krasynanski S, Kumar S, Thompson
WF (2006) A modified protocol for rapid DNA isolation from
plant tissues using cetyltrimethylammonium bromide. Nat
Protoc 1:2320–2325
Blair MW, Garris AJ, Iyer AS, Chapman B, Kresovich S, McCouch
SR (2003) High resolution genetic mapping and candidate gene
identification at the xa5 locus for bacterial blight resistance in
rice (Oryza sativa L.). Theor Appl Genet 107:62–73
Choi IY, Hyten DL, Matukumalli LK, Song Q, Chaky JM, Quigley
CV, Chase K, Lark KG, Reiter RS, Yoon MS, Hwang EY, Yi SI,
Young ND, Shoemaker RC, van Tassell CP, Specht JE, Cregan
PB (2007) A soybean transcript map: gene distribution, haplo-
type and single-nucleotide polymorphism analysis. Genetics
176:685–696
Chu Z, Fu B, Yang H, Xu C, Li Z, Sanchez A, Park YJ, Bennetzen JL,
Zhang Q, Wang S (2006) Targeting xa13, a recessive gene for
bacterial blight resistance in rice. Theor Appl Genet 112:455–
461
Davletova S, Schlauch K, Coutu J, Mittler R (2005) The zinc-finger
protein Zat12 plays a central role in reactive oxygen and abiotic
stress signaling in Arabidopsis. Plant Physiol 139:847–856
Deslandes L, Olivier J, Theulieres F, Hirsch J, Feng DX, Bittner-Eddy
P, Beynon J, Marco Y (2002) Resistance to Ralstonia solana-
cearum in Arabidopsis thaliana is conferred by the recessive
RRS1-R gene, a member of a novel family of resistance genes.
Proc Natl Acad Sci USA 99:2404–2409
Han SW, Choi MS, Lee SH, Hwang D, Hwang BK, Heu S (2007)
Characterization of a novel necrotic response of Glycine max
line ‘PI96188’ to Xanthomonas axonopodis pv. glycines. Plant
Pathol J 23:193–202
Hartwig EE, Lehman SG (1951) Inheritance of resistance to the
bacterial pustule disease in soybeans. Agron J 43:226–229
Iyer-Pascuzzi AS, McCouch SR (2007) Recessive resistance genes
and the Oryza sativa–Xanthomonas oryzae pv. oryzae pathosys-
tem. Mol Plant Microbe Interact 20:731–739
Jiang GH, Xia ZH, Zhou YL, Wan J, Li DY, Chen RS, Zhai WX, Zhu
LH (2006) Testifying the rice bacterial blight resistance gene xa5
by genetic complementation and further analyzing xa5 (Xa5)in
comparison with its homolog TFIIAc1. Mol Genet Genomics
275:354–366
Joehanes R, Nelson JC (2008) QGene 4.0, an extensible Java QTL-
analysis platform. Bioinformatics 24:2788–2789
Kim KS (2003) Development of molecular markers for resistance
gene to Xanthomonas axonopodis in soybean. Dissertation,
Seoul National University
Kim MC, Panstruga R, Elliott C, Muller J, Devoto A, Yoon HW, Park
HC, Cho MJ, Schulze-Lefert P (2002) Calmodulin interacts with
MLO protein to regulate defence against mildew in barley.
Nature 416:447–451
Kim KS, Van K, Kim MY, Lee SH (2004) Development of molecular
markers for Xanthomonas axonopodis resistance in soybean.
Korean J Crop Sci 49:429–433
Kim KH, Kim MY, Van K, Moon JK, Kim DH, Lee SH (2008)
Marker-assisted foreground and background selection of near
isogenic lines for bacterial leaf pustule resistant gene in soybean.
J Crop Sci Biotechnol 11:263–268
Kim KD, Shin JH, Van K, Kim DH, Lee SH (2009) Dynamic
rearrangements determine genome organization and useful traits
in soybean. Plant Physiol. 151:1066–1076
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE,
Newburg L (1987) MAPMAKER: an interactive computer
package for constructing primary genetic linkage maps of
experimental and natural populations. Genomics 1:174–181
Laviolette FA, Athow KL, Probst AH, Wilcox JR (1970) Effect of
bacterial pustule on yield of soybeans. Crop Sci 10:150–151
Lee S (1999) Occurrence and characterization of major plant bacterial
diseases in Korea. Dissertation, Seoul National University
Martin GB, Bogdanove AJ, Sessa G (2003) Understanding the
functions of plant disease resistance proteins. Annu Rev Plant
Biol 54:23–61
Mohan M, Nair S, Bhagwat A, Krishna T, Yano M, Bhatia C, Sasaki
T (1997) Genome mapping, molecular markers and marker-
assisted selection in crop plants. Mol Breed 3:87–103
Narvel JM, Jakkula LR, Phillips DV, Wang T, Lee SH, Boerma HR
(2001) Molecular mapping of Rxp conditioning reaction to
bacterial pustule in soybean. J Hered 92:267–270
Palmer RG, Lim SM, Hedges BR (1992) Testing for linkage between
the Rxp locus and nine isozyme loci in soybean. Crop Sci
32:681–683
Park HJ, Han SW, Oh C, Lee S, Ra D, Lee SH, Heu S (2008)
Avirulence gene diversity of Xanthomonas axonopodis pv.
glycines isolated in Korea. J Microbiol Biotechnol 18:1500–
1509
Staskawicz BJ, Ausubel FM, Baker BJ, Ellis JG, Jones JD (1995)
Molecular genetics of plant disease resistance. Science 268:661–
667
Van K, Ha BK, Kim MY, Moon JK, Paek NC, Heu S, Lee SH (2004)
SSR mapping of genes conditioning soybean resistance to six
isolates of Xanthomonas axonopodis pv. glycines. Korean
J Genet 26:47–54
Van K, Kim DH, Cai CM, Kim MY, Shin JH, Graham MA,
Shoemaker RC, Choi BS, Yang TJ, Lee SH (2008) Sequence
level analysis of recently duplicated regions in soybean [Glycine
max (L.) Merr.] genome. DNA Res 15:93–102
Wang D, Shi J, Carlson SR, Cregan PB, Ward RW, Diers BW (2003)
A low-cost, high-throughput polyacrylamide gel electrophoresis
system for genotyping with microsatellite DNA markers. Crop
Sci 43:1828–1832
Ward JM (2001) Identification of novel families of membrane
proteins from the model plant Arabidopsis thaliana. Bioinfor-
matics 17:560–563
Wu X, Li X, Xu C, Wang S (2008) Fine genetic mapping of xa24,a
recessive gene for resistance against Xanthomonas oryzae pv.
oryzae in rice. Theor Appl Genet 118:185–191
Zhu YL, Song QJ, Hyten DL, Van Tassell CP, Matukumalli LK,
Grimm DR, Hyatt SM, Fickus EW, Young ND, Cregan PB
(2003) Single-nucleotide polymorphisms in soybean. Genetics
163:1123–1134
1450 Theor Appl Genet (2010) 120:1443–1450
123