Content uploaded by Kevin J Marchbank
Author content
All content in this area was uploaded by Kevin J Marchbank on Mar 17, 2017
Content may be subject to copyright.
BRIEF COMMUNICATION www.jasn.org
ADe Novo Deletion in the Regulators of Complement
Activation Cluster Producing a Hybrid Complement
Factor H/Complement Factor H–Related 3 Gene in
Atypical Hemolytic Uremic Syndrome
Rachel C. Challis,* Geisilaine S.R. Araujo,* Edwin K.S. Wong,* Holly E. Anderson,* Atif Awan,
†
Anthony M. Dorman,
‡
Mary Waldron,
†
Valerie Wilson,* Vicky Brocklebank,* Lisa Strain,*
B. Paul Morgan,
§
Claire L. Harris,
§
Kevin J. Marchbank,
|
Timothy H.J. Goodship,* and
David Kavanagh*
*Institutes of Genetic Medicine and
|
Cellular Medicine, Newcastle University, Newcastle upon Tyne, United Kingdom;
†
Department of Nephrology, Our Lady’s Children’s Hospital, Crumlin, Dublin;
‡
Department of Renal Pathology,
Beaumont Hospital, Royal College of Surgeons in Ireland, Dublin, Ireland; and
§
Institute of Infection and Immunity,
Cardiff University School of Medicine, Cardiff, United Kingdom
ABSTRACT
The regulators of complement activation cluster at chromosome 1q32 contains the
complement factor H (CFH)andfive complement factor H–related (CFHR)genes.
This area of the genome arose from several large genomic duplications, and these
low-copy repeats can cause genome instability in this region. Genomic disorders
affecting these genes have been described in atypical hemolytic uremic syndrome,
arising commonly through nonallelic homologous recombination. We describe a
novel CFH/CFHR3 hybrid gene secondary to a de novo 6.3-kb deletion that arose
through microhomology–mediated end joining rather than nonallelic homologous
recombination. We confirmed a transcript from this hybrid gene and showed a se-
creted protein product that lacks the recognitiondomainoffactorHandexhibits
impaired cell surface complement regulation. The fact that the formation of this
hybrid gene arose as a de novo event suggests that this cluster is a dynamic area of
the genome in which additional genomic disorders may arise.
J Am Soc Nephrol 27: ccc–ccc, 2015. doi: 10.1681/ASN.2015010100
The complement factor H (CFH)and
complement factor H–related (CFHR1–
CFHR5) genes reside in a 360-kb region
in the regulators of complement activa-
tion (RCA) cluster on chromosome
1q32 (Figure 1A).
1
This is an area of
the genome that arose from several large
genomic duplications,
2,3
and these low-
copy repeats can cause genome instabil-
ity in this region.
Mutations in CFH are the most com-
mon genetic predispositions to the
thrombotic microangiopathy: atypical he-
molytic uremic syndrome (aHUS).
4
The
majority of mutations in CFH occur at the
C-terminal end responsible for host poly-
anion binding.
5–7
Several of these CFH
mutations (e.g., S1191L and V1197A)
have been shown to be gene conversion
events between CFH and CFHR1.
8
Non-
allelic homologous recombination involv-
ing CFH and CFHR1 can result in CFH/
CFHR1 hybrid genes (Supplemental Fig-
ure 1).
9,10
A single family with a hybrid
CFH/CFHR3 gene (factor H [FH] protein
complement control protein modules
[CCPs] 1–19 and factor H–related 3
[FHR3] CCP1–CCP5) has been reported
to arise through microhomology–
mediated end joining (MMEJ)
11
(Supple-
mental Figure 1). These genetic variants
have all been shown to impair C3b/host
polyanion binding on host cells, thus im-
pairing local complement regulation.
5,8,11
Recently, a reverse CFHR1/CFH
hybrid gene arising through nonallelic
homologous recombination has been
described in aHUS. This encodes an
FHR1, where the C-terminal CCPs are
replaced by the C-terminal CCPs of
FH.
12,13
Unlike previously reported hy-
brid proteins, this does not impair FH
cell surface binding but instead, acts as a
competitive inhibitor of FH.
13
Received January 27, 2015. Accepted September
7, 2015.
R.C.C., G.S.R.A., and E.K.S.W. contributed equally
to this work.
Published online ahead of print. Publication date
available at www.jasn.org.
Correspondence: Dr.DavidKavanagh,Instituteof
Genetic Medicine, International Centre for Life,
Central Parkway, Newcastle upon Tyne, NE1 3BZ,
UK. Email: david.kavanagh@ncl.ac.uk
Copyright © 2015 by the American Society of
Nephrology
J Am Soc Nephrol 27: ccc–ccc, 2015 ISSN : 1046-6673/2706-ccc 1
Figure 1. A 6.3-kb deletion in the RCA cluster results in a novel CFH/CFHR3 hybrid gene transcript. (A) Genomic organization of the RCA
cluster region containing the CFH and CFHR genes. (B) MLPA of CFH,CFHR3,CFHR1,CFHR2,andCFHR5 showing the copy number
ratio. The dotted lines represent ratios considered within the normal range. (C) Identification of breakpoint. Genomic DNA was amplified
2Journal of the American Society of Nephrology J Am Soc Nephrol 27: ccc–ccc,2015
BRIEF COMMUNICATION www.jasn.org
In this study, we report a novel CFH/
CFHR3 hybrid gene arising through
MMEJ that impairs cell surface comple-
ment regulation.
An 8-month-old boy presented with a
diarrheal illness; on admission, creati-
nine was 52 mmol/L, and urea was
11.1 mmol/L. A blood film showed mi-
croangiopathic hemolytic anemia, and
lactate dehydrogenase was 5747 units/L.
Stool culture was positive for Escherichia
coli O157:H7, and a diagnosis of Shiga
toxin–producing E. coli (STEC) hemo-
lyticuremicsyndrome(HUS)was
made. He did not require RRT and did
not receive plasma exchange. He was
discharged 2 weeks later with a creati-
nine of 107 mmol/L. He was readmitted
2 weeks later with an upper respira-
tory tract infection. Creatinine on read-
mission was 141 mmol/L, urea was
20.6 mmol/L, lactate dehydrogenase
was 2398 units/L, and platelets were
128310
9
/L, with evidence of microan-
giopathic hemolytic anemia on blood
film. This relapse suggested a diagnosis
of aHUS rather than STEC HUS. Serum
complement levels were within the nor-
mal range: C3, 1.05 g/L (0.68–1.80 g/L);
C4, 0.30 g/L (0.18–0.60 g/L); and FH,
0.51 g/L (0.35–0.59 g/L). He com-
menced plasma exchange and required
three sessions of hemofiltration. A renal
biopsy confirmed a thrombotic micro-
angiopathy (Figure 2). Creatinine re-
turned to a baseline of approximately
100 mmol/L. He was treated with weekly
plasma exchange for 3.5 years before
starting Eculizumab, on which he has
been maintained for 3 years. Creatinine
is currently 200 mmol/L, and there have
been no additional episodes of aHUS
while on treatment with Eculizumab
(Supplemental Figure 2).
Sanger sequencing of aHUS-associated
genes (CFH,CFI,CFB,CD46,C3,THBD,
and DGKE) did not reveal any muta-
tions, although heterozygosity was found
for the common Y402H polymorphism
(rs1061170) in CFH. Multiplex ligation–
dependent probe amplification (MLPA)
of CFH and the CFHRs revealed a dele-
tion in the CFH gene (Figure 1B). To de-
fine the extent of the deletion and the
breakpoint, Sanger sequencing of geno-
mic DNA was under taken. This showed a
6.3-kb deletion extending from CFH in-
tron 20 to the CFH 39intergenic region
incorporating exons 21–23 of CFH (Fig-
ure 1C). Directly flanking the breakpoint
was a 7-bp region of microhomology
(Figure 1D). The deletion was not de-
tected in either parent, suggesting that
this was a de novo event.
We hypothesized that the loss of CFH
exons 21–23 and the 39UTR of CFH
would lead to aberrant splicing. In silico
analysis showed that the next acceptor
splice site following the CFH exon 20
donor site was 59of CFHR3 exon 2,
thus potentially producing a transcript
for a hybrid CFH/CFHR3 gene (Supple-
mental Figure 3). mRNA for this puta-
tive hybrid CFH/CFHR3genewas
confirmed by amplifying patient and
control cDNA with CFH–and CFHR3–
specific primers. This showed a product
in the patient and not in healthy controls
(Figure 1E).
To confirm that this hybrid transcript
led to the synthesis and secretion of a
hybrid protein, Western blotting was
performed using a series of epitope–
defined anti–FH mAbs (Figure 3A). An
initial blot probed with OX24, an FH
CCP5–specific antibody, showed, in ad-
dition to FH, two additional bands only
in the patient (Figure 3B). The species at
approximately 160 kD was consistent
with the predicted intact hybrid
FH/FHR3. A species at approximately
120kDwashypothesizedtobea
degradation product. No abnormal bands
were detected in either parent (Supple-
mental Figure 4A). An FH C terminus–
specific antibody (L20/3) did not reveal
additional aberrant bands, indicating that
these protein species lacked FH CCP20
(Figure 3C). Genotyping showed the pa-
tient to be heterozygous for the Y402H
polymorphism in FH. This allowed the
use of mAbs specific for histidine or
tyrosine in CCP7 of FH.
14
The normal
allele’s product reacted to the histidine-
specific mAb (MBI7) and gave a single
band of approximately 150 kD, consis-
tent with FH. The hybrid allele reacted
to the tyrosine-specificmAb(MBI6),
showingadoubletatapproximately
160 kD (Figure 3D). FHR3 is known to
be alternately glycosylated,
15–17
and we
hypothesize that the doublet is caused
by an alternately glycosylated hybrid pro-
tein. Additionally, it can be seen that the
presumed degradation product at 120 kD
is only seen using the tyrosine-specific
mAb, consistent with this only arising
from the hybrid protein.
To confirm these findings, FH species
were purified from serum using affinity
chromatography with an OX24 mAb.
These were separated by a 6% SDS-PAGE
before trypsin digestion. Mass spec-
trometrywasthencarriedoutonthese
three purified bands (Figure 4A). Pep-
tide species identified from the approx-
imately 160-kD band confirmed that
this was a hybrid FH/FHR3 protein.
Protein fragments from the 150-kD
band were consistent with FH. Frag-
ments from CCP5, CCP6, CCP8,
CCP9, and CCP14 of FH were seen in
the band at approximately 120 kD. Cov-
erage at CCP7 was insufficient to deter-
mine whether there was a tyrosine or
histidine at position 402. The Western
blot analysis and mass spectrometry
data together show that breakdown
using a forward primer specificforCFH exon 20 (1f) and a reverse primer in the CFH 39region intergenic region (1r) and sequenced. The
deletion of exons 21–23 of CFH is shown (shaded box), and the breakpoint is highlighted. (D) The CFH and CFHR3 sequence flanking the
breakpoint. The 7-b p area of microhomology is shown (b old and boxed). (E) Confirmation of hyb rid CFH/CFHR3 mRNA. A message for th e
hybrid CFH/CFHR3 gene was confirmed by amplif ying patient and control cDNA with cross CFH and CFHR3 gene primers (bla ck arrows 2f
and 2r in C). The agarose gel shows amplified cDNA. The patient lane shows an amplified product consistent with a hybrid CFH/CFHR3
gene, which is not present in either control cDNA.
J Am Soc Nephrol 27: ccc–ccc, 2015 Hybrid CFH/CFHR3 Gene and aHUS 3
www.jasn.org BRIEF COMMUNICATION
products from only the hybrid protein
are seen in serum.
To examine the functional signifi-
cance, the FH/FHR3 hybrid protein
was purified from serum using affinity
chromatography with an MBI6 mAb
followed by gel filtration (Supplemental
Figure 4B). The FH/FHR3 hybrid pro-
tein displayed both impaired cell surface
decay acceleration (Figure 4B) and co-
factor activity (Figure 4C, Supplemental
Figure 5).
Thus, in this study, we show a de-
letion in the RCA cluster resulting in a
novel de novo CFH/CFHR3 hybrid gene.
Microhomology in the sequence flank-
ing the breakpoint suggests that the
deletion has occurred through MMEJ.
Genomic disorders affecting CFH and
the CFHRs as a result of nonallelic ho-
mologous recombination are found in
approximately4.5%ofpatientswith
aHUS. In contrast, only one patient
with a genomic disorder secondary to
MMEJ has been described.
11
We have shown that the product of
this gene, a 22 CCP domain protein, is
secreted, albeit with degradation frag-
ments present in the serum, suggesting
impaired stability of the protein. Func-
tional analysis of the purified FH/FHR3
protein showed impaired cell surface
complement regulation.
This FH/FHR3 hybrid protein is sim-
ilar to that d escribed by Francis et al.,
11
in
that in both, the C-terminal end of FH is
replaced by all five CCPs of FHR3 (Sup-
plemental Figure 1). Although both hy-
brids lack CCP20 of FH responsible for
cell surface protection, the hybrid
reported here also lacks CCP18 and
CCP19.
The functional role of FHR3 is un-
clear, with various regulatory activities
being suggested.
16,18
Unsurprisingly,
given its high homology with CCP7 of
FH, FHR3 binds to heparin.
16
FHR3
also binds to C3b and C3d through
CCP4 and CCP5.
16,19
Competition be-
tween FHR3 and FH for surface-bound
C3b has been described.
18
The hybrid
described by Francis et al.
11
showed
normal fluid–phase complement
Figure 2. A renal biopsy from the patient demonstrating haemolytic uraemic syndrome. Renal
biopsyof thepatientshowing thrombi(arrows)oncapillaryloops. (A) hematoxylinandeosin.(B)
Masson trichrome. A developing membranoproliferative pattern of injury can be seen in (C)
characterized by capillary loop double contours (arrows). Silver counterstained H&E, 3400.
4Journal of the American Society of Nephrology J Am Soc Nephrol 27: ccc–ccc,2015
BRIEF COMMUNICATION www.jasn.org
regulatory activity but a profoundly re-
duced cell surface complement regula-
tory activity.
ThefactthatsuchanFH/FHR3hy-
brid should lack cell surface regulatory
activity is not surprising. Both of these
hybrids lack the CCP20 domain of FH
responsible for cell surface localization.
6
Additionally, structural analysis has
revealed a specifichairpinstructure
suggesting a model whereby cell surface–
bound C3b is engaged by both CCP1–4
and CCP19 and CCP20 of FH concur-
rently.
20
The elongation of FH by the ad-
dition of extra CCPs would prevent such
an orientation.
Although the initial presentation of
disease was seen in association with
STEC, the rapid relapse suggested
aHUS rather than STEC HUS, and this
was confirmed by the finding of the CFH/
CFHR3 hybrid gene. In individuals car-
rying mutations in complement genes,
additional triggers (e.g.,pregnancy
21
and infection
22
) are required for disease
to manifest.
4,22
In this case, STEC served
to unmask the genetic predisposi-
tion to disease, such as in two previously
reported patients with STEC-triggered
aHUS.
23
In summary, we describe a deletion
in the RCA cluster arising through
MMEJ that results in a novel CFH/
CFHR3 hybrid gene. The fact that this
arose as a de novo event suggests that
this is a dynamic area of the genome
where we should expect additional ge-
nomic disorders.
CONCISE METHODS
The study was approved by Newcastle and
North Tyneside 1 Research Ethics Com-
mittee, and informed consent was obtained
in accordance with the Declaration of
Helsinki.
Complement Assays
C3 and C4 levels were measured by rate
nephelometry (Beckman Coulter Array 360).
FH levels were measured by radial immuno-
diffusion (Binding Site). Screening for FH
autoantibodies was undertaken using ELISA
as described previously.
24
Genetic Analyses and MLPA
Mutation screening of CFH,
25
CFI,
26
CFB,
27
MCP,
28
C3,
29
and DGKE
30
was un-
dertaken using Sanger sequencing as
Figure 3. Identification of a novel FH/FHR3 hybrid protein in patient serum. (A) The protein
product of wild-type FH and the predicted FH/FHR3 hybrid protein consisting of CCP1–17 of FH
and CCP1–5 of FHR3. The CCPs originating from FHR3 are highlighted in gray. The patient is
heterozygous for a common polymorphism in CCP7 of FH (Y402H). Binding epitopes for the mAbs
are shown: Ox24-CCP5, MBI7-CCP7 amino acid 402 histidine variant, MBI6-CCP7 amino acid 402
tyrosine variant, and L20/3-CCP20. (B) Serum Western blot using OX24 showing two additional
bands in the patient in addition to FH. The upper band is consistent with the predicted size of the
FH/FHR3 hybrid. (C) Serum Western blot using L20/3. When using this FH C terminus–specific
antibody, no additional bands are seen, consistent with the hybrid protein lacking CCP18–20. (D)
Serum Western blot using MBI7. This shows that the patient has a normal allele producing FH with
the histidine at amino acid 402. (E) Serum Western blot using MBI6. The patient has three addi-
tional bands and no wild–type FH band. This is consistent with the FH/FHR3 hybrid protein carrying
the tyrosine amino acid at position 402. The two additional upper bands represent differentially
glycosylated hybrid protein, consistent with that seen in the native FHR3. There is a faint degra-
dation product only detected with the MBI6 antibody. This is consistent with the breakdown
product being generated only from the hybrid protein and suggests a less stable protein product.
The controls were unaffected, unrelated, genotyped samples. In B and C, a sample from an in-
dividual heterozygous at Y402H was used. In D and E, samples from individuals homozygous for
Y402 (Y/Y), homozygous for H402 (H/H), or heterozygous (Y/H) were used.
J Am Soc Nephrol 27: ccc–ccc, 2015 Hybrid CFH/CFHR3 Gene and aHUS 5
www.jasn.org BRIEF COMMUNICATION
previously described. Screening for geno-
mic disorders affecting CFH,CFHR1,
CFHR2,CFHR3,andCFHR5 was under-
taken using MLPA in both the affected
individual and 500 normal controls as pre-
viously described.
11
Aproprietarykitfrom
MRC Holland (SALSA MLPA Kit P236-A1
ARMD; www.mlpa.com) was supplemented
by specificin–house CFH probes (Supple-
mental Material). GeneMarker software
(Version 1.90) was used to calculate dosage
quotients.
Figure 4. Impaired cell surface co-factor and decay acceleration activity of hybrid FH/FHR3 hybrid protein. (A) Mass spectrometry of
purified proteins. The FH, FH/FHR3 hybrid, and degradation product were purified using affinity chromatography with an OX24
column. These FH species were separated by 6% SDS-PAGE, stained using Coomassie, cut from the gel (left panel), and submitted for
trypsin digest and mass spectrometry. Peptides sequences identified using mass spectrometry are indicated with asterisks. The
peptides detected in the hybrid degradation product by mass spectrometry are annotated on a full–length FH/FHR3 hybrid protein.
CCPs that cannot be directly inferred from mass spectrometry data are outlined with a dashed line. A molecular mass of approximately
120 kD is consistent with an approximately 17 CCP protein. (B) Decay acceleration assays on sheep erythrocytes. The purified FH/
FHR3 hybrid from the patient showed impaired cell surface complement regulation compared with wild type (WT) FH purified from
control. Alternative pathway convertase (C3bBb) was formed on sheep erythrocytes. Cells were incubated for 15 minutes with di-
lutions of purified FH/FHR3 hybrid and WT FH before triggering lysis with NHSDBDH. Maximal lysis occurs in buffer-only (0 mM FH)
conditions. Addition of WT FH caused decay of the C3 convertase and decay of convertase resulting in inhibition of lysis. The FH/
FHR3 hybrid was up to 2-fold less efficient at inhibiting lysis. (C) C3b cofactor activity on sheep erythrocytes. WT FH and purified FH/
FHR3 hybrid were tested for the abilitytoactasacofactorforfactorI–catalyzed inactivation of C3b deposited on the surfaces of sheep
erythrocytes. The C3 convertase (C3bBb) was formed on residual C3b, and lysis was triggered by adding NHSDBDH. Maximal lysis
occurs in the presence of buffer only (0 mM FH). The addition of WT FH and factor I produces iC3b, which decreases convertase
formation and subsequent lysis, and this is shown as increasing amounts of inhibition of lysis (expressed as percentage of maximal
lysis) after incubation with factor I and WT FH (black circles) or FH/FHR3 hybrid (white circles). The FH/FHR3 hybrid can be seen to be
markedly less active than WT.
6Journal of the American Society of Nephrology J Am Soc Nephrol 27: ccc–ccc,2015
BRIEF COMMUNICATION www.jasn.org
Genomic Breakpoint Analyses
To identify the breakpoint of the deletion that
resulted in the CFH/CFHR3 hybrid gene, genomic
DNAwas amplified using a forward primer specific
for CFH in exon 20 and a reverse primer in the
CFH 39region (Figure 1C). The sequence of the
forward primer was GTAACTGTTATCAGTT-
GATTTGC, and the reverse was ACGGATTG-
CATGTATAAGTG. The product was then
sequenced using direct fluorescent sequencing.
Confirmation of CFH/CFHR3 RNA
Product
mRNA was extracted from peripheral blood lym-
phocytes of the patient, and cDNA was prepared.
This was amplified using a forward primer in CFH
exon 20 (TGGATGGAGCCAGTAATGTAA-
CATGCAT) and a reverse primer in CFHR3 exon
2 (GAAATAGACCTCCATGTTTAATGTCTG)
(Figure 1C). The PCR product was detected in an
ethidium bromide–stained 1.5% agarose gel.
Western Blotting
Detection of abnormal protein products in
serum arising as a consequence of the deletion
was undertaken by Western blotting. Sera were
diluted 1:100, and under nonreducing condi-
tions, they were electrophoresed on 6% SDS-
PAGE gel and transferred onto nitrocellulose.
mAbsof knownspecificity to FH(OX24,CCP5,
L20/3,CCP20, MBI6, CCP7402Y, MBI7 CCP7,
and 402H) were used with sheep anti–mouse Ig
HRP (Jackson Immuno Research) at dilutions
of 1:2000 (primary antibody) and 1:4000 (sec-
ondary antibody) (Supplemental Material).
After washes in 13TBST, blots were developed
using Pierce ECL Western Blotting Substrate
(Thermo Scientific).
Purification of FH Species
FH species (wild-type FH from normal allele,
FH/FHR3 hybrid, and FH/FHR3 breakdown
product all with CCP5 of FH) were purified
from serum with affinity chromatography
using immobilized mAb to FH (OX24) on a
1-ml HiTrap NHS HP Column (GE Health-
care). After washing with PBS, the bound
proteins were then eluted using 0.1 M glycine
(pH 2.7). The eluted material was pooled and
concentratedfor analysis bymass spectrometry.
The FH/FHR3 hybr id protein was purified
from patient serum with affinity chromatog-
raphy using immobilized mAb to FH CCP7
402Y (MBI6)
31
on a 1-ml HiTrap NHS HP
Column (GE Healthcare). After washing with
PBS, the bound proteins were eluted using
PBS/diethylamine (50 mM). Subsequently,
the FH/FHR3 protein was purified from its
degradation product and FHL1 using a Su-
perdex 200 Size Exclusion Column. We also
purified wild–type FH protein from a healthy
control. FH or FH/FHR3 hybrid protein pu-
rified using the MBI6 column was used for
cofactor and decay acceleration assays.
Mass Spectrometry
A 6% SDS-PAGE was run, a nd the three b ands
identified by Coomassi e staining were excised
from the gel as indic ated in Figure 4A. Trypsin
digest and mass spectrometry were then un-
dertaken (Supplemental Material).
Cell Surface Decay Acceleration
Assays
Decay acceleration on sheep erythrocytes was
performed as previously described
32
and in
Supplemental Material. Briefly, FH/FHR3
hybrid from the patient and FH from con-
trols were purified by immunoaffinity chro-
matography as above and gel filtered into
PBS. Alternative pathway convertase
(C3bBb) was formed on sheep erythrocytes.
Cells were incubated for 15 minutes with
1.24–50 nM patient FH/FHR3 hybrid or con-
trol FH. The molar concentration of the pu-
rified patient FH/FHR3 was estimated using
the extinction coefficient (272,170 M cm
21
),
whereas the extinction coefficient of FH
(246,800 M cm
21
) was used for the control.
Lysis was initiated with 4% normal human
serum depleted of factor B and FH
(NHSDBDH). Maximal lysis was achieved
by adding NHSDBDHtonoFHwells(buffer
only). To determine the amount of lysis, cells
were pelleted by centrifugation, and hemo-
globin release was measured at 420 nm
(A
420
). Percentage of inhibition of lysis in
the presence of increasing concentrations
was defined as (A
420
[buffer only] 2
A
420
[FH])/A
420
[buffer only] 3100%.
Cell Surface Cofactor Assays
Cofactor activity on sheep erythrocytes was
performed as previously described.
32
Briefly
washed C3b–coated sheep erythrocyte cells
were resuspended in AP buffer and incubated
with an equal volume of a range of concen-
trations of FH/FHR3 hybrid and wild-type
FH and 2.5 mg/ml factor I (CompTech) for
8 minutes at 25°C. After three washes in AP
buffer, AP convertase was formed on the re-
maining C3b. Lysis was initiated with 4%
NHSDBDH. Again, cells were pelleted, and
hemoglobin release was measured at 420
nm. Percentage of inhibition from lysis was
calculated by the formula (A
420
[buffer only]
2A
420
[FH])/A
420
[buffer only] 3100%.
ACKNOWLEDGMENTS
We thank Achim Treumann for technical help
with mass spectrometry.
The research leading to these results has re-
ceived funding from European Union’s Seventh
Framework Programme FP7/2007-2013 Grant
305608 (EURenOmics). Funding for this
study was provided by United Kingdom
Medical Research Council Grant G0701325.
G.S.R.A. is funded by Conselho Nacional de
Desenvolvimento Científico e Tecnológico.
E.K.S.W. is a Medical Research Council
Clinical Training Fellow. D.K. is a Wellcome
Trust Intermediate Clinical Fellow.
DISCLOSURES
A.A. has received fees from Alexion Pharmaceu-
ticals for lectures. C.L.H. is also employed by
GlaxoSmithKline and has shares in this company.
Newcastle University has received fees from Alexion
Pharmaceuticals for lectures and consultancy un-
dertaken by T.H.J.G. and D.K.
REFERENCES
1. Díaz-Guillén MA, Rodríguez de Córdoba S,
Heine-Suñer D: A radiation hybrid map of
complement factor H and factor H-related
genes. Immunogenetics 49: 549–552, 1999
2. Male DA, Ormsby RJ, Ranganathan S,
Giannakis E, Gordon DL: Complement factor
H: Sequence analysis of 221 kb of human ge-
nomic DNAcontaining the entire fH, fHR-1 and
fHR-3 genes. Mol Immunol 37: 41–52, 2000
3. Zipfel PF, Jokiranta TS , Hellwage J, Koistinen
V, Meri S: The factor H protein family. Im-
munopharmacology 42: 53–60, 1999
4. Kavanagh D, Goodship TH, Richards A:
Atypical hemolytic uremic syndrome. Semin
Nephrol 33: 508–530, 2013
5. Ferreira VP, Herbert AP, Co rtés C, McKee KA,
Blaum BS, Esswein ST, Uhrín D, Barlow PN,
Pangburn MK, Kavanagh D: The binding of
factor H to a complex of physiological poly-
anions and C3b on cells is impaired in atypi-
cal hemolytic uremic syndrome. JImmunol
182: 7009–7018, 2009
J Am Soc Nephrol 27: ccc–ccc, 2015 Hybrid CFH/CFHR3 Gene and aHUS 7
www.jasn.org BRIEF COMMUNICATION
6. Schmidt CQ, Herbert AP, Kavanagh D,
Gandy C, Fenton CJ, Blaum BS, Lyon M,
Uhrín D, Barlow PN: A new map of glycos-
aminoglycan and C3b binding sites on factor
H. JImmunol181: 2610–2619, 2008
7. Blaum BS, Hannan JP, Herbert AP, Kavanagh
D, Uhrín D, Stehle T: Structural basis for sialic
acid-mediated self-recognition by comple-
ment factor H. Nat ChemBiol 11: 77–82, 2015
8. Heinen S, Sanchez-Corral P, Jackson MS,
Strain L, Goodship JA, Kemp EJ, Skerka C,
Jokiranta TS, Meyers K, Wagner E, Robitaille
P, Esparza-Gordil lo J, Rodriguez de Cordoba
S, Zipfel PF, Goodship TH: De novo gene
conversion in the RCA gene cluster (1q32)
causes mutations in complement factor H
associated with atypical hemolytic uremic
syndrome. Hum Mutat 27: 292–293, 2006
9. Venables JP, Strain L, Routledge D, Bourn D,
Powell HM, Warwicker P, Diaz-Torres ML,
Sampson A, Mead P, Webb M, Pirson Y,
Jackson MS, Hughes A, W ood KM, Goodship
JA, Goodship TH: Atypical haemolytic urae-
mic syndrome associated with a hybrid
complement gene. PLoS Med 3: e431, 2006
10. Maga TK, Meyer NC, Belsha C, Nishimura
CJ, Zhang Y, Smith RJ: A novel del etion in the
RCA gene cluster causes atypical hemolytic
uremic syndrome. Nephrol Dial Transplant
26: 739–741, 2011
11. Francis NJ, McNicholas B, Awan A, Waldron
M, Reddan D, Sadlier D, Kavanagh D, Strain
L, Marchbank KJ, Harris CL, Goodship TH: A
novel hybrid CFH/CFHR3 gene generated
by a microhomology-mediated deletion in
familial atypical hemolytic uremic syndrome.
Blood 119: 591–601, 2012
12. Eyler SJ, Meyer NC, Zhang Y, Xiao X, Nester
CM, Smith RJ: A novel hybrid CFHR1/CFH
gene causes atypical hemolytic uremic syn-
drome. Pediatr Nephrol 28: 2221–2225, 2013
13. Valoti E, Alberti M, Tortajada A, Garcia-
Fernandez J, Gastoldi S, Besso L, Bresin E,
Remuzzi G, Rodriguez de Cordoba S, Noris
M: A novel atypical hemolytic uremic syn-
drome-associated hybrid CFHR1/CFH gene
encoding a fusion protein that antagonizes
factor H-dependen t complement regulation.
JAmSocNephrol26: 209–219, 2015
14. Hakobyan S, Tortajada A, Harris CL, de
Córdoba SR, Morgan BP: Variant-specific
quantification of factor H in plasma identifies
null alleles associated with atypical hemolytic
uremic syndrome. Kidney Int 78: 782–788, 2010
15. Skerka C, Kühn S, Günther K, Lingelbach K,
Zipfel PF: A novel short consensus repeat-
containing molecule is related to human
complement factor H. JBiolChem268:
2904–2908, 1993
16. Hellwage J, Jokiranta TS, Koistinen V,
Vaarala O, Meri S, Zipfel PF: Functional
properties of complement factor H-related
proteins FHR-3 and FHR-4: Binding to the
C3d region of C3b and diff erential regulation
by heparin. FEBS Lett 462: 345–352, 1999
17. Skerka C, Chen Q, Fremeaux-Bacchi V,
Roumenina LT: Comp lement factor H related
proteins (CFHRs). Mol Immunol 56: 170–180,
2013
18. Fritsche LG, Lauer N, Hartmann A, Stippa S,
Keilhauer CN, Oppermann M, Pandey MK,
Köhl J, Zipfel PF, Weber BH, Skerka C: An
imbalance of human complement regulatory
proteins CFHR1, CFHR3 and factor H influ-
ences risk for age-related macular de-
generation (AMD). Hum Mol Genet 19:
4694–4704, 2010
19. Hellwage J, Jokiranta TS, Friese MA, Wolk TU,
Kampen E, Zipfel PF, Meri S: Complement
C3b/C3d and cell surface polyanions are rec-
ognized by overlapping binding sites on the
most carboxyl-terminal domainof complement
factor H. J Immunol 169: 6935–6944, 2002
20. Morgan HP, Schmidt CQ, Guariento M,
Blaum BS, Gillespie D, Herbe rt AP, Kavanagh
D, Mertens HD, Svergun DI, Johansson CM,
Uhrín D, Barlow PN, Hannan JP: Structural
basis for engagement by complement factor
H of C3b on a self surface. Nat Struct Mol Biol
18: 463–470, 2011
21. Fakhouri F, Roumenina L, Provot F, Sallée M,
Caillard S, Couzi L, Essig M, Ribes D, Dragon-
Durey MA, Bridoux F, R ondeau E, Frémeaux-
Bacchi V: Pregnancy-associated hemolytic
uremic syndrome revisited in the era of
complement gene mutations. JAmSoc
Nephrol 21: 859–867, 2010
22. Caprioli J, Noris M, Brioschi S, Pianetti G,
Castelletti F, Bettinaglio P, Mele C, Bresin E,
Cassis L, Gamba S, Porrati F, Bucchioni S,
Monteferrante G, Fang CJ, Liszewski MK,
Kavanagh D, Atkinson JP, Remuzzi G; In-
ternational Reg istry of Recurrent and Familial
HUS/TTP: Genetics of HUS: The impact of
MCP, CFH, and IF mutations on clinical pre-
sentation, response to treatment, and out-
come. Blood 108: 1267–1279, 2006
23. Alberti M, Valoti E, Piras R, Bresin E,
Galbusera M, Tripodo C, Thaiss F, Remuzzi
G, Noris M: Two patients with history of
STEC-HUS, posttransplant recurrence and
complement gene mutations. Am J Trans-
plant 13: 2201–2206, 2013
24. Moore I, Strain L, Pappworth I, Kavanagh D,
Barlow PN, Herbert AP, Schmidt CQ,
Staniforth SJ, Holmes LV, Ward R, Morgan L,
Goodship TH, Marchbank KJ: Association of
factor H autoantibodies with deletions of
CFHR1, CFHR3, CFHR4, and with mutations
in CFH, CFI, CD46, and C3 in patients with
atypical hemolytic uremic syndrome. Blood
115: 379–387, 2010
25. RichardsA, Buddles MR, Donne RL, KaplanBS,
Kirk E, Venning MC, Tielemans CL, Goodship
JA, Goodship TH: Factor H mutations in
hemolytic uremic syndrome cluster in exons
18-20, a domain important for host cell rec-
ognition.Am J Hum Genet 68: 485–490, 2001
26. KavanaghD, Kemp EJ, Mayland E, Winney RJ,
Duffield JS, Warwick G, Richards A, Ward R,
Goodship JA, Goodship TH: Mutations in
complement factor I predispose to develop-
ment of atypical hemolytic uremic syndrome.
J Am Soc Nephrol 16: 2150–2155, 2005
27. Kavanagh D, Kemp EJ, Richards A, Burgess
RM, Mayland E, Goodship JA, Goodship TH:
Does complement factor B have a role in the
pathogenesis of atypical HUS? Mol Immunol
43: 856–859, 2006
28. Richards A, Kemp EJ, Liszewski MK,
Goodship JA, Lampe AK, Decorte R,
Müslümano
glu MH, Kavukcu S, Filler G,
Pirson Y, Wen LS, Atkinso n JP, Goodship TH:
Mutations in human complement regulator,
membrane cofactor protein (CD46), pre-
dispose to developm ent of familial hemolytic
uremic syndrome. Proc Natl Acad Sci U S A
100: 12966–12971, 2003
29. Frémeaux-Bacchi V, Miller EC, Liszewski MK,
Strain L, Blouin J, Brown AL, Moghal N,
Kaplan BS, Weiss RA, Lhotta K, Kapur G,
Mattoo T, Nivet H, Wong W, Gie S, Hurault
de Ligny B, Fischbac h M, Gupta R, Hauhart R,
Meunier V, Loirat C, Dragon-Durey MA,
Fridman WH, Janssen BJ, Goodship TH,
Atkinson JP: Mutations in complement C3
predispose to development of atypical he-
molytic uremic syndrome. Blood 112: 4948–
4952, 2008
30. Lemaire M, Frémeaux-Bacchi V, Schaefer F,
Choi M, Tang WH, Le Quintrec M, Fakhouri
F,TaqueS,NobiliF,MartinezF,JiW,
Overton JD, Mane SM, Nürnberg G,
Altmüller J, Thiele H, Morin D, Deschenes G,
Baudouin V, Llanas B, Collard L, Majid MA,
Simkova E, Nürnberg P, Rioux-Leclerc N,
Moeckel GW, Gubler MC, Hwa J, Loirat C,
Lifton RP: Recessive mutations in DGKE
cause atypical hemolytic-uremic syndrome.
Nat Genet 45: 531–536, 2013
31. Hakobyan S, Harris CL, Tortajada A,
Goicochea de Jorge E, García-Layana A,
Fernández-Robredo P, Rodríguez de
Córdoba S, Morgan BP: Measurement of
factor H variants in plasma using variant-
specific monoclonal antibodies: Application
to assessing risk of age-related macular de-
generation. Invest Ophthalmol Vis Sci 49:
1983–1990, 2008
32. Wong EK, Anderson HE, Herbert AP, Challis
RC, Brown P, Reis GS, Tellez JO, Strain L,
Fluck N, Humphrey A, Macleod A, Richards
A, Ahlert D, Santibanez-Koref M, Barlow PN,
Marchbank KJ, Harris CL, Goodship TH,
Kavanagh D: Characterization of a factor H
mutation that perturbs the alternative path-
way of complement in a family with mem-
branoproliferati ve GN. JAmSocNephrol25:
2425–2433, 2014
This article contains supplemental material online
at http://jasn.asnjournals.org/lookup/suppl/doi:10.
1681/ASN.2015010100/-/DCSupplemental.
8Journal of the American Society of Nephrology J Am Soc Nephrol 27: ccc–ccc,2015
BRIEF COMMUNICATION www.jasn.org
