Content uploaded by Keiko Kadono-Okuda
Author content
All content in this area was uploaded by Keiko Kadono-Okuda on Jan 18, 2016
Content may be subject to copyright.
ORIGINAL ARTICLE
Mapping and recombination analysis of two moth colour
mutations, Black moth and Wild wing spot, in the silkworm
Bombyx mori
K Ito1, S Katsuma2, S Kuwazaki3, A Jouraku3, T Fujimoto4, K Sahara4, Y Yasukochi3, K Yamamoto3,
H Tabunoki1, T Yokoyama1, K Kadono-Okuda3and T Shimada2
Many lepidopteran insects exhibit body colour variations, where the high phenotypic diversity observed in the wings and bodies
of adults provides opportunities for studying adaptive morphological evolution. In the silkworm Bombyx mori, two genes
responsible for moth colour mutation, Bm and Ws, have been mapped to 0.0 and 14.7 cM of the B. mori genetic linkage group
17; however, these genes have not been identified at the molecular level. We performed positional cloning of both genes to
elucidate the molecular mechanisms that underlie the moth wing- and body-colour patterns in B. mori. We successfully narrowed
down Bm and Ws to ~ 2-Mb-long and 100-kb-long regions on the same scaffold Bm_scaf33. Gene prediction analysis of this
region identified 77 candidate genes in the Bm region, whereas there were no candidate genes in the Ws region. Fluorescence
in-situ hybridisation analysis in Bm mutant detected chromosome inversion, which explains why there are no recombination in
the corresponding region. The comparative genomic analysis demonstrated that the candidate regions of both genes shared
synteny with a region associated with wing- and body-colour variations in other lepidopteran species including Biston betularia
and Heliconius butterflies. These results suggest that the genes responsible for wing and body colour in B. mori may be
associated with similar genes in other Lepidoptera.
Heredity (2016) 116, 52–59; doi:10.1038/hdy.2015.69; published online 29 July 2015
INTRODUCTION
In Lepidoptera, adult body colour patterns are important for sexual
selection, mimicry and predator avoidance (Parcham et al., 2007). The
wings of insects are believed to be a monophyletic adaptation that
allowed the insects to exploit new niches, thereby resulting in rapid
diversification. Many studies have investigated the factors that control
the wing- and body-colour patterns of butterflies and moths; however,
the underlying mechanism still remains unknown. Recently, the
genomes and genomic information have been updated for various
lepidopteran insects and molecular genetic studies have provided
information that is useful for this field of study (International
Silkworm Genome Consortium, 2008; Zhan et al., 2011; Heliconius
Genome Consortium, 2012; You et al.,2013).
Over 50 body colour mutants have been reported in the silkworm
B. mori (Banno et al., 2010). However, most of these mutants
correspond to larval body colour variations and few wing- and
body-colour variations have been reported in this moth. Five mutants
have been reported, that is, Black moth (Bm; Chikushi, 1960), black-
striped pupal wing (bpw; Yamamoto, 1986), melanism (mln;
Hasimoto, 1961), Wild wing spot (Ws;Doiraet al., 1981) and
white-banded black wing (wb; Kanbe and Nara, 1959). Recently, the
mln mutant, which exhibits a readily distinguishable phenotype in
both the larvae and adults, was characterised at the molecular level
based on positional cloning and functional analysis (Dai et al., 2010;
Zhan et al., 2010). Linkage analysis and genomic studies have shown
that Bombyx arylalkamine-N-acetyl transferase, the homologous gene
(Dat) that converts dopamine into N-acetyl dopamine, encodes a
precursor of N-acetyl dopamine, sclerotin in Drosophila and it is the
gene responsible for mln (Dai et al., 2010; Zhan et al., 2010). However,
other causal genes have not yet been identified.
The Bm mutant has black scales on the body and wings, which
contrasts with the white appearance of the wild-type moth (Figure 1a).
The gene responsible, Bm, has been mapped to 0.0 cM in B. mori
genetic linkage group 17 (Chikushi, 1960) (Figure 1b). The Ws mutant
strain exhibits a phenotype where the moth has a spot on the apex of
its wing (Figure 1a). The Ws gene has been transferred by introgres-
sion from the wild silkworm Bombyx mandarina, which is widely
believed to have the same ancestor as the domesticated silkworm
B. mori (Goldsmith et al., 2005). This gene has been mapped to 14.7 cM
in linkage group 17 and it is linked to the bts (brown head and tail
spot) gene (Doira et al.,1981;Bannoet al.,2010)(Figure1b).TheBm
and Ws phenotypes are both dominant over the wild type. In addition,
according to our observations these phenotypes are clearly exhibited in
males, whereas it is difficult to distinguish mutant females from the
1
Department of Science of Biological Production, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Fuchu, Tokyo, Japan;
2
Department of
Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Bunkyo-ku, Tokyo, Japan;
3
Division of Insect Sciences,
National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan and
4
Faculty of Agriculture, Iwate University, Morioka, Iwate, Japan
Correspondence: Dr K Ito, Department of Science of Biological Production, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu, Tokyo 183-8509, Japan.
E-mail: katsuito@cc.tuat.ac.jp
Received 20 April 2015; accepted 22 June 2015; published online 29 July 2015
Heredity (2016) 116, 52–59
&
2016 Macmillan Publishers Limited All rights reserved 0018-067X/16
www.nature.com/hdy
wild type in BC1individuals. Recently, we succeeded in the positional
cloning of four genes responsible for bts,nm-g,nsd-2 and ow,which
also map to linkage group 17 (Ito et al., 2008, 2009, 2010; Niwa et al.,
2010) (Figures 1b and 2a). We consider that the genomic information
obtained in previous studies may be a useful tool for isolating and
identifying Bm and Ws mutations.
To better understand the molecular mechanisms that control colour
variations in a Lepidoptera, we performed positional cloning and
recombination analysis of two genes, that is, Bm and Ws. Based on
mapping, we successfully narrowed down the candidate regions of
both genes to one scaffold, Bm_scaf33. In addition, recombination
analysis between Bm and Ws,andfluorescence in-situ hybridisation
(FISH) analysis demonstrated that chromosome 17 carrying the Bm
gene has inversion in the candidate region. Therefore, recombination
between both genes occurred in none of the individuals. Moreover, we
found that the candidate regions of both genes shared correspondence
with a region associated with wing- and body-colour variations in
different lepidopteran species, that is, B. betularia,Heliconius cydno,
Heliconius erato,Heliconius melpomene and Heliconius numata (Joron
et al., 2006; Kronfost et al., 2006; Papa et al., 2008; Ferguson et al.,
2010; van't Hof et al., 2011). These results strongly suggest that the
same genes and/or regulatory elements responsible for wing and body
colour in Bombyx,Bm and Ws, may underlie these variants in different
Lepidoptera.
In this study, we demonstrate that the genomic context is highly
relevant given the orthology in lepidopteran patterning regions and the
fact that the Ws mutation appears to influence three nearby genes that
do not fall within the 100-kb mapping interval. The apparent
involvement of clustered genes in similar processes suggests the
existence of a supergene. B. mori is the most advanced model
Lepidoptera, thereby facilitating interpretation in a genomic context.
MATERIALS AND METHODS
Insects
The Bm (Bm/Bm;+
Ws/+Ws) and the Ws (+Bm/+Bm;Ws/Ws) used No. 908
(National Institute of Agrobiological Sciences, Tsukuba, Japan) and u42
(Kyushu University, Fukuoka, Japan), respectively. The wild type (+Bm/+Bm;
+Ws/+Ws) were p50T (University of Tokyo, Bunkyo-ku, Japan) and p50
(Kyushu University) (Figure 1a). BC1progeny from the cross p50T × (p50T ×
No. 908) and p50T × (p50T × u42) were used for mapping Bm and Ws,
respectively. The offspring from the cross p50T × (u42 × No. 908) were used for
the recombination analysis between Bm and Ws. All of the silkworm larvae
were reared on mulberry leaves at 25 °C.
In the screening of BC1,theBm and Ws phenotypes present themselves
clearly in males, while mutant females can be hard to distinguish from wild
type. Therefore, we only used males in the analysis.
Preparation for genomic DNA and PCR analysis
DNA was isolated from moth legs using DNAzol (Invitrogen, Carlsbad, CA,
USA) according to the manufacturer’s protocol. PCR was performed using Ex
Taq DNA Polymerase (Takara Bio, Otsu, Japan) and the primer sets are listed
Ws mutant
(u42) Bombyx mandarina
Wild-type
(p50T)
Bm mutant
(No. 908)
0.0 Bm
14.7 Ws
30.1 ow
36.4 bts
39.1 nm-g
Suc-1
nsd-2
17
Figure 1 Phenotypes and linkage maps of the Bm and Ws mutations.
(a) Phenotypes of B. mori wild type (p50T), Bm mutant (No. 908), Ws mutant
(u42) and B. manderina. Arrowheads indicate the spot at the apex of the
wing. (b) Linkage map of group 17. The loci are labelled based on their
position in centimorgan units (left) and the locus name (right).
Abbreviations: Bm, Black moth; Ws, Wild wing spot; ow, waxy translucent;
bts, brown head and tail spot; nm-g, non-molting glossy; nsd-2, non-
susceptibility to DNV-2; Suc-1, sucrase-1 (Banno et al., 2010).
ow
1 Mb
nsd-2
ow bts nmg
Bm_scaf33 (4,426,693 bp)
2,390,014
Bm candidate region
4,426,693 2,000,000
nscaf2829-26F
Ws candidate region
nscaf2829-39R nscaf2829-50F
2,445,0942,541,315
4,426,693
4,426,693 1 1 390,686
Bm_scaf154
(390,686 bp)
Figure 2 Mapping of the Bm and Ws mutations in linkage group 17.
(a) Physical map and scaffold of linkage group 17. Black and grey lines
indicate the physical map and the scaffold, respectively. The upper and
lower figures indicate the whole and upstream regions of linkage group 17,
respectively. The upper numbers indicate the positions that correspond to
each gene (Ito et al., 2008, 2009, 2010; Niwa et al., 2010). nsd-2 could
not be mapped onto the physical map of group 17, because it was located
on a non-mapped scaffold (Bm_scaf131). ow was mapped to the
Bm_scaf154 (Ito et al., 2009). (b) The narrowed down candidate region on
the Bm_scaf33. The dotted arrows indicate the results of the detailed
linkage analysis to narrow down the region linked to the Bm (upper) and Ws
(lower) mutations (Table 2). The black boxes are candidate regions of each
mutations.
Moth colour mutations in the silkworm
KItoet al
53
Heredity
in Supplementary Table S1. The PCR conditions were as follows: initial
denaturation at 94 °C for 2 min followed by 35 cycles of denaturation at 94 °C
for 15 s, annealing at 60 °C for 15 s and extension at 72 °C for 1 or 3 min with a
final incubation step at 72 °C for 4 min.
Isolation of total RNA and reverse-transcriptase PCR analysis
Total RNA was isolated from the forewings of pupae and adults using TRIzol
(Invitrogen) according to the manufacturer’s protocol. The isolated RNA was
reverse transcribed using an Oligo (dT)12–18 primer (GE Healthcare, Buck-
inghamshire, UK) and Ready-to-Go RT-PCR Beads (GE Healthcare), according
to the manufacturer’s protocol, and the cDNA was then diluted 10-fold before
reverse-transcriptase PCR (RT-PCR). RT-PCR was performed using Ex Taq
DNA Polymerase, with the primer sets listed in Supplementary Table S1 in the
following conditions: initial denaturation at 94 °C for 2 min followed by 30
cycles of denaturation at 94 °C for 15 s, annealing at 60 °C for 15 s and
extension at 72 °C for 1 min followed by a final i ncubation at 7 2 °C for 4 min.
Positional cloning
Positional cloning of the Bm and Ws candidate genes was performed as
previously described (Ito et al., 2009). PCR and single-nucleotide polymorphism
markers that exhibited polymorphism in the parents were detected at each position
on chromosome 17. Mapping was performed using 1861 and 434 BC1progeny
with the Bm and Ws phenotypes, respectively. Candidate genes in the region
narrowed by linkage analysis were predicted and annotated using KAIKObase
(http://sgp.dna.affrc.go.jp/KAIKObase/), KAIKOBLAST (http://kaikoblast.dna.affrc.
go.jp/) and NCBI BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Recombination analysis between Bm and Ws
Recombination analysis was performed using 1163 male moths obtained by
crossing wild-type females with F1males. The progeny could be classified
according to four different phenotypes in terms of their body and wing colours:
Bm type (+Bm/Bm;+
Ws/+Ws), Ws type (+Bm/+Bm;+
Ws/Ws), Bm and Ws type
(+Bm/Bm;+
Ws/Ws), and normal type (+Bm/+Bm;+
Ws/+Ws) (Supplementary
Figure S1). However, Bm is overdominant to Ws phenotype, which made it
impossible to discriminate Bm and Ws type from Bm type. Hence, we count the
former type together with the latter type. Recombination between Bm and Ws
occurred in the Bm and Ws types and the normal type, but we judged only
from the numbers of the normal type.
FISH analysis
Bacterial artificial chromosomes (BACs) used for FISH analysis were described
by Yasukochi et al. (2006) (Table 1). We selected additional 4D3C and 3C11C
BACs for the present study (Table 1). Chromosomes were prepared according
to Sahara et al. (1999) and Yoshido et al. (2014). Briefly, female and/or male
gonads were dissected from last instar larvae. The cells in the gonads were
spread on a glass slide with 60% acetic acid at 50°C. The chromosomes were
air dried and stored until further use, at −20 °C after dehydration with an
ethanol series of 70%, 80% and 99%. BAC-FISH analysis was performed as
described by Yoshido et al. (2005) and Sahara et al. (2013). Briefly, BAC DNA
extracted with a Plasmid Midi kit (Qiagen GmbH, Hilden, Germany) was
labeled with fluorochromes (Orange-, Green- and Red-dUTP purchased from
Abbott Molecular Inc., Des Plaines, IL, USA, and Cy5-dUTP from GE
Healthcare) using a Nick Translation Mix (Roche Diagnostics Inc., Basel,
Switzerland) (Table 1). Hybridisation was performed at 37 °C for 3 days, which
was followed by washing with 0.1 × SSC and 0.1% Triton X-100. Re-probe
technique was also used according to Shibata et al. (2009). The FISH
preparations were counterstained and mounted with antifade (0.233g 1,4-
diazabicyc lo(2.2.2)-octane, 1 ml 0.2 mMTris-HCl, pH 8.0, 9 ml glycerol)
containing 0.5 μgml−1DAPI (4′,6-diamidino-2-phenylindole; Sigma-Aldrich,
St Louis, MO, USA). Signals were captured with a DFC350FX CCD camera
mounted on a DM 6000B microscope (Leica Microsystems Japan, Tokyo,
Japan) and processed with Adobe Photoshop CS6J (Adobe, San Jose, CA, USA).
Table 1 BAC probe information used for chromosome analysis and its primer sequences for the selection
BAC code Labeled dyeaPsuedo colour Forward primer (5′–3′) Reverse primer (5′–3′) Product size (bp) Position in KAIKObase
Chromosomal Scaffold Definition
4D3C O Yellow CAGGGTTCTTCTTTATTTTG ATTGGCAGGTCAGTTCTCAT 572 chr17: 500 151–502 713 Bm_scaf33: 3 923 981–3 926 543 AY769310
5F11E G Cyan GAAAACAAAACAAAAACAATbACATCCAAAGAGTAAAGGTAb755 chr17:1 490 552–1 489 034 Bm_scaf33: 2 936 142–2 937 66 0 B3L3G15b
1G10A R Red CCGCAACTATCCACTACATbTAAGCAAATCTACTCACTCb1139 chr17:1 688 344–1 687 205 Bm_scaf33: 2 739 386–2741910 AB019864
b
3C11C G Green TACCGTTGTATTCGCTTTA ACAGTTGACTTTCTCCTTC 461 chr17: 2 177 038–2 178 320 Bm_ scaf33: 2 248 374–2 249 656 DQ311300
1D2A C5 Magenta ACATAACTCAACGCAAAAGCAbTGACTACGGACACTACCAAACb415 chr17:6 107 883–6 108 297 Bm_scaf92: 290 504–290918 B16F2F32b
aO, G, R and C5 represent fluorochromes of Orange-dUTP, Green dUTP, Red-dUTP and Cy5-dUTP, respectively.
bSee Yasukochi et al. (2006).
Moth colour mutations in the silkworm
KItoet al
54
Heredity
RESULTS
Mapping of Bm and Ws
To identify the genomic regions responsible for Bm and Ws mutations,
we performed genetic linkage analysis referred by the B. mori single-
nucleotide polymorphism linkage map (Yamamoto et al., 2008) and
genome sequence (International Silkworm Genome Consortium,
2008). The female body colour of BC1was too faint to allow us to
distinguish each phenotype; therefore, we only used males for
screening. We mapped the Bm mutation using ~ 1800 BC1individuals
and narrowed down the Bm-linked region to between 2 390 014
(nscaf2829-26F) and 4 426 693 (the downstream terminal of the
Bm_scaf33) (Figure 2 and Supplementary Table S2). This region
was ~ 2-Mb long on the Bm_scaf33. Next, we performed
gene prediction analysis for the candidate region using gene
prediction models in KAIKOBLAST and we found 77 candidate
genes (data not shown). For the Ws mutation, we delimited the
locus to 100-kb-long regions between 2 445 094 (nscaf2829-50F)
and 2 541 315 (nscaf2829-39R) on the Bm_scaf33 using ~ 400 BC1
individuals (Figure 2 and Supplementary Table S2). However, there
were no candidate genes within this region (data not shown).
According to the linkage analysis of the Bm gene, although the
mapping procedure used ~ 1800 BC1individuals, the Bm-linked
region could not be narrowed down further within an ~ 2-Mb-long
region on the Bm_scaf33, thereby suggesting suppression of recombi-
nation. Therefore, the Bm-narrowed region was wider than that of Ws
(Figure 2).
Recombination analysis between Bm and Ws
To confirm the recombination between Bm and Ws, the moth
phenotype was observed in seven egg batches obtained from the cross
between wild type (+Bm/+Bm;+
Ws/+Ws) females with F1males
(Bm female × Ws male (Bm/+Bm;+
Ws/Ws)) (Supplementary Figure S1
and Table 2). Among 1163 individuals obtained from 7 batches, none
of the normal type expected as recombinants appeared (Table 2). The
segregation ratio between Bm phenotype and Ws phenotype was ~ 1 : 1
(Table 2). These strongly suggested that recombination did not occur
between Bm and Ws alleles (Table 2), although the genetic distance
between both genes is 14.7 cM in the linkage map of B. mori.
FISH analysis
To confirm the possibility of suppression of crossing over, we
performed FISH analysis of the pachytene nuclei of the wild type
(p50) and Bm mutant (No. 908) using four BACs mapped on
Bm_scaf33 and a BAC on Bm_scaf92. FISH analysis revealed that
the five BAC probes mapped onto p50 in a sequence according to the
KAIKObase information. However, the FISH signals between 4D3C
(yellow) and 1G10A (red) were invertedly ordered in No. 908
(Figure 3 and Table 1). Therefore, a chromosomal inversion is
apparent in No. 908. This chromosome feature explained why
recombination was not observed between Bm and Ws loci.
Comparative genomic analysis of the Bm and Ws regions, and other
lepidopteran genomes
Based on the comparative genomic analysis, we found that the Bm and
Ws regions shared synteny with a region associated with wing- and
body-colour variations in different lepidopteran species of B. betularia
and Heliconius butterflies (Joron et al., 2006; Kronfost et al., 2006;
Papa et al., 2008; Ferguson et al., 2010; van't Hof et al., 2011). The
carbonaria region, which determines the phenotype of industrial
melanism in B. betularia, shared synteny with the upstream region
of B. mori genetic linkage group 17, corresponding to 2 390 014–
2 875 682 on the Bm_scaf33 (between trehalase 1B and lrtp) (Figure 4)
(van't Hof et al., 2011). This phenotype is very similar to the Bm
phenotype. The Ws region shared synteny with H. melpomene linkage
group 15 and this region was located between the H. melpomene
yellow hindwing bar (HmYb)andH. melpomene hindwing margin
(HmSb) candidate regions, corresponding to 2 880 220–2 568 710 and
2 195 440–2 281 515 on the Bm_scaf33, respectively (HmYb,between
BGIBMGA005665 and 005652;HmSb,betweenBGIBMGA005650 and
005559) (Figure 4). Both of these causal genes determine wing colour
variations in H. melpomene (Ferguson et al., 2010). In addition, this
region overlapped with the mimetic patterning regions, Yb,Pand Cr,
in other Heliconius species, that is, H. cydno,H. erato and H. numata
(Joron et al., 2006; Kronfost et al.,2006;Papaet al., 2008). These
Table 2 Segregation of moth phenotype in the cross normal (+/+, +/+)
females × Bm and Ws (+/Bm,+/Ws)males
Batch numbers Moth phenotypea
‘Bm (+/Bm, +/+)’and
‘Bm and Ws (+/Bm, + /Ws)’b
‘Ws
(+/+, +/Ws)’
‘Normal
(+/+, +/+)’
1101830
286970
380730
487940
529500
6811040
7100980
The female body colour was not clear and both phenotypes could not be distinguished.
aOnly male was used for screening of the phenotypes.
bBm (+/Bm, +/+) and Bm, and Ws (+/Bm,+/Ws) phenotypes could not be judged whether it was
only Bm or Bm and Ws phenotype, because the majority of the phenotypes had black wings.
Figure 3 Inversion in chromosome 17 of B. mori No. 908 strain carrying the
Black moth loci. The inverted order of FISH signals between 4D3C (yellow)
and 1G10A (red) is apparent compared with the p50 strain. BAC codes are
shown in the same colours as the signals. Marker sequence (see Yasukochi
et al. 2006) or GenBank accession numbers for the BACs are shown on the
left of the black bar, which represents B. mori chromosome 17 drawn to a
relative scale in Mb taken from KAIKObase. White and black scale bars
represent 5 μm and 5 Mb for the bivalents and chromosome 17, respectively.
See Table 1 for details of the BAC probe information.
Moth colour mutations in the silkworm
KItoet al
55
Heredity
results suggest that this region may control wing- and body-colour
variations in lepidopteran insects. Therefore, we focused on the
predicted genes within the overlapping candidate regions of five genes,
that is, Bm,Ws,carbonaria,HmYb and HmSb (Figure 4), and we
performed gene expression analysis based on the RT-PCR results.
RT-PCR analysis of candidate genes in the overlapping region
Using KAIKObase, we predicted 24 Bm and Ws candidate genes
within the overlapping region: BGIBMGA005665 (A), 005664 (B),
005663 (C), 005548 (D), 005662 (E), 005661 (F), 005549 (G), 005660
(H), 005550 (I), 005659 (J), 005551 (K), 005658 (L), 005552 (M),
005553 and 005554 (N), 005555 (O), 005556 (P), 005657 (Q), 005656
(R), 005557 (S), 005655 (T), 005558 (U), 005654 (V), 005653 (W) and
005652 (X) (Figure 4 and Table 3). First, we investigated whether these
candidate genes were expressed in the forewing from pupal day 0 to
adult day 0 (Supplementary Figures S2 and S3). RT-PCR analysis
demonstrated that seven candidate genes were expressed in the
forewing, that is, BGIBMGA005550 (I), 005658 (L), 005552 (M),
005657 (Q), 005656 (R), 005557 (S) and 005655 (T) (Supplementary
Figure S3 and Table 3). In particular, three candidate genes, that is,
BGIBMGA005658 (L), 005657 (Q) and 005655 (T), exhibited clear
differences in their expression profiles where these genes were properly
expressed only in the wild-type strain (p50T) (Figure 5,
Supplementary Figure S3 and Table 3). In the genomic PCR analysis
using primer sets for these three differentially expressed genes,
identical PCR products were obtained from respective genes in
p50T, No. 908 and u42 individuals. These results suggest that the
differences in the expression profiles were not due to the primer-
binding sites but the expression levels (data not shown). Next, we
cloned and sequenced four additional candidate genes, that us,
BGIBMGA005550 (I), 005552 (M), 005656 (R) and 005557 (S), and
compared their sequences in the wild type (p50T), Bm mutant (No.
908) and Ws mutant (u42). According to the KAIKObase database
search, these genes correspond to the full-length cDNA or expressed
sequence tag clones AK383524; FS895121, FS917714 and FY019022;
AK38029 and FY026966; and AK384540 and FY030309, respectively
(Table 3). Therefore, we prepared primer sets based on the 5′-and3′-
untranslated regions using the sequences of each expressed sequence
tag clone and performed RT-PCR analyses. Two candidate genes, that
is, BGIBMGA005550 (I) and 005656 (R), lacked mutations in the
coding regions (Supplementary Figure S4) and we could not detect the
transcripts of two candidate genes, BGIBMGA005552 (M) and 005557
(S) (Supplementary Figure S4). Overall, the results of the PCR and
sequencing analysis suggest that BGIBMGA005658 (L), 005657 (Q)
and 005655 (T) may be candidates for the Bm and Ws genes.
DISCUSSION
In this study, we attempted to isolate two genes responsible for moth
colour mutations, that is, Bm and Ws, based on positional cloning
using B. mori genome information. The genetic and genomic analysis
demonstrated the following: (i) the candidate regions of the Bm and
Ws genes are located in ~2-Mb-long and 100-kb-long regions on the
same scaffold Bm_scaf33 of chromosome 17; (ii) chromosome 17 of
Bm mutation harbours inversion within a compartment correspond-
ing to Bm_scaf33; and (iii) the Bm and Ws regions share synteny with
a region associated with wing- and body-colour variations in different
lepidopteran species (Joron et al., 2006; Kronfost et al., 2006; Papa
et al., 2008; Ferguson et al., 2010; van't Hof et al., 2011). Based on our
results, we hypothesise that this common region may control wing-
and body-colour variations in lepidopteran insects. These results
provide insights into the molecular mechanisms that control colour
variations in Lepidoptera.
Chikushi (1960) mapped the Bm gene to 0.0 cM on B. mori genetic
linkage group 17 based on three-point crosses using the Bm,ow and
bts genes (Chikushi, 1960). In addition, Doira et al. (1981) reported
that the Ws gene was located at 14.7cM in the same linkage group
based on recombination analysis between the Ws and bts genes. FISH
analysis demonstrated that a proximal region of chromosome 17 in
No. 908 has an inversion. Thus, no recombination among 1163 BC1
individuals is most probably caused by suppression of chromosome
crossing over. Taking into account for classical linkage analysis, similar
pattern of gene expression results in the present study and recent
finding for mimicry and pheromone response (Joron et al. 2011;
Nishikawa et al. 2015; Wadsworth et al. 2015), inversion-associated
mutation is a possible explanation for Bm origin. This supposes the
Bm and Ws share a mechanism for regulating wing and body
colouration. However, the classical recombination value was calculated
by a combination of different cross-experiments (Chikushi, 1960,
Doira et al. 1981). Hence, it is also possible to predict the Bm locates
in the proximity to Ws as well as any position in ~ 2-Mb region in
Bm_scaf33.
Bm narrowed region
(4,426,693-2,390,014)
Bm_scaf33
(4,426,693-1)
Biston betularia carbonaria
(2,875,682-41,273)
Ws narrowed region
(2,541,315-2,445,094)
Overlapped region
(2,875,682-2,390,014)
Heliconius melpomene HmYb
(2,880,220-2,568,710)
Heliconius melpomene HmSb
(2,281,585-2,195,440)
A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
U
P
Q
R
S
T
X
V
W
410,093,2286,578,2
Predicted candidate genes
Figure 4 Localisation of Bm and Ws regions narrowed down to the
Bm_scaf33 and their positional relationships with candidate regions of
carbonaria,HmSb and HmYb. The brown, purple, black, blue and green bars
indicate the Bm,Ws,carbonaria,HmSb and Hmyb regions, respectively. The
red bar indicates the overlapping region for all genes. The carbonaria gene
determines the phenotype of industrial melanism in the British peppered
moth, B. betularia (van't Hof et al., 2011). The HmSb and HmYb genes
exhibit phenotypes with a hindwing margin and a yellow hindwing bar in
H. melpomene, respectively (Ferguson et al., 2010). Lower bars indicate
25 predicted genes. A, BGIBMGA005665;B,005664;C,005663;
D, 005548;E,005662;F,005661;G,005549;H,005660;I,005550;
J, 005659;K,005551;L,005658;M,005552;N,005553 and 005554;
O, 005555;P,005556;Q,005657;R,005656;S,005557;T,005655;
U, 005558;V,005654;W,005653;andX,005652. The letters
correspond to Supplementary Figure S3 and Suppementary Table S3.
Moth colour mutations in the silkworm
KItoet al
56
Heredity
Table 3 Predicted genes on the overlapping region
No.aPredicted candidate gene Size (bp) Position on Bm_scaf33 B. mori EST RT-PCR product NCBI-blastp
Top hit EST name Tissue
A BGIBMGA005665 1737 2 873 946–2 875 682 AK381626|fwgP06H20 Wing nTrehalase-like protein [Heliconius erato]
B BGIBMGA005664 1740 2 868 742–2870 481 AK384297|fcaL15O08 Corpora allata nTrehalase precursor [Bombyx mori]
C BGIBMGA005663 591 2 838 348–2 841 051 AK379306|ftes10O22 Testis × Putative B9 protein [Heliconius melpomene]
D BGIBMGA005548 594 2 829 200–2 835 667 E_FL_fufe_48N15_F_0|FS919927 Embryo × HM00008 [Heliconius melpomene]
E BGIBMGA005662 1041 2 816 343–2 819 205 E_FL_ftes_50J04_R_ 0|FS903315 Testis nPutative WD40 repeat domain 85 [Heliconius me lpomene]
F BGIBMGA005661 351 2 809 822–2 810 172 AK382038|fdpe05B13 Diapause-destined embryo × Cyclin-dependent kinase 2 [Biston betularia]
G BGIBMGA005549 2985 2 775983–2 802 234 No hit —× Hypothetical protein KGM_17540 [Danaus plexippus]
H BGIBMGA005660 1314 2 756 026–2 762 984 No hit —× Putative unkempt [Danaus plexippus]
I BGIBMGA005550 411 2 753 403–2 753 958 AK383524|MFB-10F15 Fat body JHistone H3 [Actinoposthia beklemischevi]
J BGIBMGA005 659 516 2 7 49 885–2 751 628 AK379353|ftes12C18 Testis × Hypothetical protein KGM_11305 [Danaus plexippus]
K BGIBMGA005551 426 2 742 379–2 745 280 AK379178|ftes07B24 Testis × HM00016 [Heliconius melpomene]
L BGIBMGA005658 522 2 739 386–2 741 910 E_FL_ftes_35L07_F_0|FS886292 Testis JGloverin 2 precursor [Bombyx mori]
M BGIBMGA005552 2406 2 729 127–2 732 029 FY019022|rbmov23p16 Ovary JPutative smooth muscle caldesmon [Danaus plexippus]
N BGI BMGA005553 438 2 721 679–2 723 756 E_FL_fufe_ 16K04_F_0|FS909237 Embryo × Sorting nexin-8-like protein [Heliconius erato]
BGIBMGA005554 576 2 715 598–2 719 407 No hit —Sorting nexin-8-like protein [Heliconius erato]
O BGIBMGA005555 1521 2 711 826–2713 346 No hit —× Putative beta-fructofuranosidase [Bombyx mori]
P BGIBMGA005556 879 2 700 631–2 708 135 E_FL_fwg P_39N15_F_0|FS93438 Wing nGlutaminyl-peptide cyclotransferase-like protein [Heliconius erato]
Q BGIBMGA005657 1389 2 676 659–2682 113 AK387492|bmov26C16 Ovary JHM00021 [Heliconius melpomene]
R BGIBMGA005656 909 2 666 003–2 673 048 FY030309|bmte25h07 Testis JEnoyl-CoA hydratase precursor 1 [Bombyx mori]
S BGIBMGA005557 531 2 657 185–2 659 641 FY026966|bmte16b06 Testis JATP binding protein [Bombyx mori]
T BGIBMGA005655 1410 2 651 271–2 653 800 E_FL_ftes_26G19_R_ 0|FS897276 Testis JLeucine-rich repeat Protein soc-2-like protein [Heliconius erato]
U BGI BMGA005558 378 2 646 473–2 647 703 AK388012|bmte28L08 Testis × Putative ATP-binding protein [Danaus plexippus]
V BGIBMGA005654 621 2 634 452–2 639 545 No hit —× Hypothetical protein KGM_00352 [Danaus plexippus]
W BGIBMGA005653 372 2 632 428–2 633 450 No h it —× Hypothetical protein KGM_00351 [Danaus plexippus]
X BGIBMGA005652 738 2 568 710–2 572 721 AK381234|fufe37G19 Embryo × Cell division cycle protein 20 [Heliconius erato]
Three candidate genes showed in bold font.
aThe alphabets correspond to Figure 4 and Supplementary Figure S3.
Moth colour mutations in the silkworm
KItoet al
57
Heredity
According to the linkage analysis of the Ws gene, we narrowed
down Ws to a 100-kb-long region on the Bm_scaf33; however, there
was no candidate gene within this region. Thus, the following two
hypotheses are proposed. First, the nucleotide responsible for Ws
mutation may correspond to a cis-regulatory element of Ws,which
controls Ws expression in the spot at the apex of the wing. Second, the
candidate gene may exist in an unknown genomic region that is
specific to the mutant strain. This may explain why we could not find
the candidate gene, because it was predicted using the genome
sequence of the model strains p50T and Dazao, which exhibits the
wild-type phenotype (International Silkworm Genome Consortium,
2008). Therefore, we are currently attempting to determine the
genome sequence of the Ws mutant strain and B. mandarina by
shotgun sequencing analysis.
RT-PCR analysis of the predicted genes indicated that three genes,
that is, BGIBMGA005658 (L), 005657 (Q) and 005655 (T), are current
candidates for the Bm and Ws genes. The expression profiles of these
genes revealed that transcripts were detected only in the wild-type
strain (p50T), thereby suggesting that the phenotypes may be due to
functional inactivation of these genes via haploinsufficiency or
dominant-negative mutations. Investigations of the expression profiles
of these genes using F1individuals will help to identify the gene
responsible for these mutations. In addition, further gene expression
analysis using RNA-seq and microarray will help to identify the genes
responsible for Bm and Ws. Furthermore, BGIBMGA005658 encodes
the gloverin 2 precursor in B. mori; however, it is not present at the
orthologous location in Heliconius (Ferguson et al., 2010). This may be
because of a difference in genome information between Bombyx and
Heliconius. In general, gloverins have been reported to be antibacterial
proteins in lepidopteran insects because of their antibacterial activity
against Escherichia coli, Gram-positive bacteria, fungi and viruses
(Kawaoka et al.,2008;Yiet al., 2013). Therefore, the possibility the
gloverin 2 precursor is candidates for Bm and Ws genes will be a low.
The candidate regions of Bm and Ws genes shared synteny with a
region associated with wing- and body-colour variations in different
lepidopteran species (Joron et al., 2006; Kronfost et al., 2006; Papa
et al., 2008; Ferguson et al., 2010; van't Hof et al., 2011). The
phenotypes of the Bm and Ws mutations comprise black scales on the
moth body and a spot at the apex of wing, respectively. The colour of
both mutants is mainly black; however, the coloured parts of the body
differ from each other. In the carbonaria type of B. betularia,the
phenotype has a black body colour, which is very similar to the Bm
mutation. However, the HmSb,HmYb,Cr,Pand Yb genes of
Heliconius species are associated with mimetic patterning of the wings.
The wing colouration is consistent with the phenotype of the Ws
mutation. These results suggest that the control of colour pattern
formation in lepidopterans may have a common genetic basis, although
the critical factor has yet to be identified. Further studies to clarify the
nature of this regulation will help to understand the molecular
mechanisms that regulate the development of wing colouration.
Data archiving
The B. mori linkage maps and genetic markers used for genotyping are
available from http://www.shigen.nig.ac.jp/silkwormbase/index.jsp and
http://sgp.dna.affrc.go.jp/KAIKObase/.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
ACKNOWLEDGEMENTS
We thank Mr Munetaka Kawamoto (University of Tokyo) for technical
assistance and Dr Yutaka Banno (National BioResource Project (NBRP),
Kyushu University) for providing the silkworm strains. This research was
supported by grants from MAFF-NIAS (Agrigenome Research Program),
MEXT (KAKENHI No. 22128004), NBRP (National BioResource Project) and
JST (Professional Program for Agricultural Bioinformatics), Japan.
Banno Y, Yamamoto K, Nishikawa K, Tamura K, Yamamoto K, Aso Y (2010). Integration of
the twenty-fourth and twenty-seventh linkage groups of the silkworm Bombyx mori.
J Insect Biotech Sericol 79:67–70.
Chikushi H (1960). A new linkage group of the silkworm, Bombyx mori.JSericSciJpn29:
278 in Japanese.
Dai FY, Qiao L, Tong XL, Cao C, Chen P, Chen J et al. (2010). Mutations of an
arylalkylamine-N-acetyltransferase, Bm-iAANAT, are responsible for silkworm melanism
mutant. JBiolChem285:19553–19560.
Diora H, Kihara H, Masuda S (1981). Linkage analysis of the ‘Wild wing spot’gene in the
silkworm. Proc Sericult Sci Kyushu 12: 64 (in Japanese).
Ferguson L, Lee SF, Chamberlain N, Nadeau N, Joron M, Baxter S et al. (2010).
Characterization of a hotspot for mimicry: assembly of a butterfly wing transcriptome to
genomic sequence at the HmYb/Sb locus. Mol Ecol 19:240–254.
Goldsmith MR, Shimada T, Abe H (2005). The genetics and genomics of the silkworm
Bombyx mori.Annu Rev Entomol 50:71–100.
Hasimoto H (1961). Genetika studo pri melanismo ĉemorusasilkraŭpo, Bombyx mori.
J Seric Sci Jpn 30: 389 (in Japanese with Esperanto summary).
Heliconius Genome Consortium (2012). Butterfly genome reveals promiscuous exchange of
mimicry adaptations among species. Nature 487:94–98.
0123456 7 0
AP
01234567 0
AP
89
0123456 7 0
A
P
8910
p50T (WT)
u42 (Ws)
No. 908 (Bm)
BGIBMGA005658 (L)
0123456 70
AP
0123456 7 0
AP
89
0123456 7 0
AP
8910
p50T (WT)
u42 (Ws)
No. 908 (Bm)
BGIBMGA005657 (Q)
0123456 7 0
AP
0123456 7 0
AP
89
0123456 7 0
AP
8910
p50T (WT)
u42 (Ws)
No. 908 (Bm)
BGIBMGA005655 (T)
012345670
AP
0123456 7 0
AP
89
0123456 7 0
AP
8910
p50T (WT)
u42 (Ws)
No. 908 (Bm)
18S
Figure 5 RT-PCR analysis of the candidate genes of Bm and Ws. Stage-
specific expression profiles of three candidate genes, BGIBMGA005658 (L),
005657 (Q) and 005655 (T), were investigated with p50T (wild type), No.
908 (Bm mutant) and u42 (Ws mutant) strains. P and A indicate pupa and
adult, respectively. The numbers under the P and A bars show the day for
each stage. 18S ribosomal RNA was used as an internal control.
Moth colour mutations in the silkworm
KItoet al
58
Heredity
International Silkworm Genome Consortium (2008). The genome of a lepidopteran
model insect, the silkworm Bombyx mori.Insect Biochem Mol Biol 38:
1036–1045.
Ito K, Katsuma S, Yamamoto K, Kadono-Okuda K, Mita K, Shimada T (2009). A 25 bp-long
insertional mutation in the BmVarp gene causes the waxy translucent skin of the
silkworm, Bombyx mori.Insect Biochem Mol Biol 39:287–293.
Ito K, Katsuma S, Yamamoto K, Kadono-Okuda K, Mita K, Shimada T (2010). Yellow-e
determines the color pattern of larval head and tail spots of the silkworm Bombyx mori.
JBiolChem285: 5624–5629.
Ito K, Kidokoro K, Sezutsu H, Nohata J, Yamamoto K, Kobayashi I et al. (2008). Deletion o f
a gene encoding an amino acid transporter in the midgut membrane causes resistance
to a Bombyx parvo-like virus. Proc Natl Acad Sci USA 105:7523–7527.
Joron M, Papa R, Beltrán M, Chamberlain N, Mavárez J, Baxter S et al. (2006). A conserved
supergene locus controls color pattern diversity in Heliconius butterflies. PLoS Biol 4: e303.
Joron M, Frezal L, Jones RT, Chamberlain NL, Lee SF, Haag CR et al. (2011).
Chromosomal rearrangements maintain a polymorphic supergene controlling butterfly
mimicry. Nature 477:203–206.
Kanbe R, Nara S (1959). Gemetical studies of a new mutamt, white bamded black (wb)
wing, in silkworm. J Seric Sci Jpn 28: 37 (in Japanese).
Kawaoka S, Katsuma S, Daimon T, Isono R, Omuro N, Mita K et al. (2008). Functional
analysis of four Gloverin-like genes in the silkworm Bombyx mori.Arch Insect Biochem
Physiol 67:87–96.
Kronforst MR, Kapan DD, Gilbert LE (2006). Parallel genetic architecture of parallel
adaptive radiations in mimetic Heliconius butterflies. Genetics 174:535–539.
Nishikawa H, Iijima T, Kajitani R, Yamaguchi J, Ando T, Suzuki Y et al. (2015). A genetic
mechanism for female-limited Batesian mimicry in Papilio butterfly. Nat Genet 47:
405–409.
Niwa R, Namiki T, Ito K, Shimada-Niwa Y, Kiuchi M, Kawaoka S et al. (2010). Non-molting
glossy/shroud encodes a short-chain dehydrogenase/reductase that functions in the
‘Black Box’of the ecdysteroid biosynthesis pathway. Development 137:1991–1999.
Papa R, Morrison CM, Walters JR, Counterman BA, Chen R, Halder G et al. (2008). Highly
conserved gene order and numerous novel repetitive elements in genomic regions linked
to wing pattern variation in Heliconius butterflies. BMC Genomics 9: 345.
Parchem RJ, Perry MW, Patel NH (2007). Patterns on the insect wing. Curr Opin Genet Dev
17:300–308.
Sahara K, Marec F, Traut W (1999). TTAGG telomeric repeats in chromosomes of some
insects and other arthropods. Chromosome Res 7:449–460.
Sahara K, Yoshido A, Shibata F, Fujikawa-Kojima N, Okabe T, Tanaka-Okuyama M et al.
(2013). FISH identification of Helicoverpa armigera and Mamestra brassicae chromo-
somes by BAC and fosmid probes. Insect Biochem Mol Biol 43:644–653.
Shibata F, Sahara K, Naito Y, Yasukochi Y (2009). Reprobing of multicolour FISH in
preparations of lepidopteran chromosomes. Zoolog Sci 26:187–190.
van't Hof AE, Edmonds N, Dalíková M, Marec F, Saccheri IJ (2011). Industrial melanism in
British peppered moths has a singular and recent mutational origin. Science 332:
958–960.
Wadsworth CB, Li X, Dopman EB (2015). A recombination suppressor contributes to
ecological speciation in OSTRINIA moths. Hered Adv online 114:593–600.
Yamamoto T (1986). Linkage group of the black-striped pupal wing gene in the silkworm.
Proc J Seric Sci Jpn 56: 60 (in Japanese).
Yamamoto K, Nohata J, Kadono-Okuda K, Narukawa J, Sasanuma M, Sasanuma S et al.
(2008). A BAC-based integrated linkage map of the silkworm Bobmyx mori.Genome
Biol 9:R21.
Yasukochi Y, Ashakumary LA, Baba K, Yoshido A, Sahara K (2006). A second generation
integrated map of the silkworm reveals synteny and conserved gene order between
lepidopteran insects. Genetics 173: 1319–1328.
Yoshido A, Bando H, Yasukochi Y, Sahara K (2005). The Bombyx mori karyotype and the
assignment of linkage groups. Genetics 170:675–685.
Yoshido A, Sahara K, Yasukochi Y (2014). Chapter 6; Silkmoths (Lepidoptera). In:
Sharakhov IV (ed). Protocols for Cytogenetic Mapping of Arthropod Genomes.CRC
Press: London, pp 219–256.
You M, Yue Z, He W, Yang G, Xie M, Zhan D et al. (2013). A heterozygous
moth genome provides insights into herbivory and detoxification. Nat Genet 45:
220–225.
Yi HY, Deng XJ, Yang WY, Zhou CZ, Cao Y, Yu XQ (2013). Gloverins of the silkworm Bombyx
mori: structural and binding properties and activities. Insect Biochem Mol Biol 43:
612–625.
Zhan S, Guo Q, Li M, Li M, Li J, Miao X et al. (2010). Disruption of an N-acetyltransferase
gene in the silkworm reveals a novel role in pigmentation. Development 137:
4083–4090.
Zhan S, Merlin C, Boore JL, Reppert SM (2011). The monarch butterfly genome yields
insights into long-distance migration. Cell 147: 1171–1185.
Supplementary Information accompanies this paper on Heredity website (http://www.nature.com/hdy)
Moth colour mutations in the silkworm
KItoet al
59
Heredity
