Content uploaded by Julia Durzyńska
Author content
All content in this area was uploaded by Julia Durzyńska on Jan 01, 2014
Content may be subject to copyright.
© The Author 2013. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society.
All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
doi:10.1093/mutage/get037
Inuence of genetic polymorphisms on biomarkers of exposure and effects in children
living in Upper Silesia
DanutaMielzynska-Svach*, EwaBlaszczyk1,
DorotaButkiewicz2, JuliaDurzynska3 and
MalgorzataRydzanicz4,5
Department of Genetic Toxicology, Institute of Occupational Medicine and
Environmental Health, Koscielna 13 Street, 41–200 Sosnowiec, Poland,
1Department of Environmental Biotechnology, Institute for Ecology of
Industrial Areas, Kossutha 6 Street, 40-844 Katowice, Silesia, Poland, 2Center
for Translational Research and Molecular Biology of Cancer, M.Sklodowska-
Curie Memorial Cancer Center and Institute of Oncology, Gliwice, Poland,
3Department of Molecular Virology, Institute of Experimental Biology,
A.Mickiewicz University, Poznan, Poland, 4Department of Environmental
Mutagenesis, Institute of Human Genetics, Polish Academy of Sciences, Poznan,
Poland and 5Department of Human Molecular Genetic, Institute of Molecular
Biology and Biotechnology, A.Mickiewicz University, Poznan, Poland
*To whom correspondence should be addressed. Tel:+48 32 266 08 85
(ext.177); Fax: +48 32 266 11 24; Email: d.mielzynska@imp.sosnowiec.pl
Received on April 3, 2013; revised on May 15, 2013; accepted on June 4, 2013
This article is a follow-up to our previous molecular epide-
miology studies on the DNA damage in children from the
Upper Silesia region of Poland. It is expected that meta-
bolic and DNA repair gene polymorphisms may modulate
individual susceptibility to environmental exposure. In this
study, we investigate the association between polymorphisms
of metabolising (CYP2D, EPHX1, GSTM1, GSTP1, GSTT1,
NAT2) and DNA repair (XPD, XRCC1, XRCC3) genes and
selected biomarkers of exposure and effect such as levels of
1-hydroxypyrene (1-OHP) and urinary mutagenicity, aro-
matic DNA adducts, sister chromatid exchange (SCE) and
micronuclei (MN) in 74 children. Both 1-OHP concentra-
tion and urinary mutagenicity tested by TA98+S9 were sig-
nicantly higher in individuals with EPHX1 (exon 4) Arg/
Arg genotype than in individuals with other genotype. The
EPHX1 (exon 3) signicantly affected urinary mutagenic-
ity tested with strain YG1024+S9. The urinary mutagen-
icity in individuals with Tyr/Tyr homozygotes was lower
than in individuals with Tyr/His and His/His (1057 ± 685
vs. 1432 ± 1003 revertants/mol creatinine). XRCC3 Met/Met
genotype was associated with signicantly higher levels of
1-OHP in urine compared with only The/Met genotype. The
PAH-DNA adduct levels in the subgroup with GSTM1 null
genotype was 2-fold higher than in individuals with GSTM1
active (7.06 ± 5.12 vs. 13.14 ± 9.81 adduct/108 nucleotides).
The mean level of aromatic DNA adducts in children with
deletion of the GSTT1 gene was signicantly higher com-
pared with individuals with that gene present (8.03 ± 6.23 vs.
14.66 ± 10.70 adduct/108 nucleotides). Also the carriers of the
XPD Lys/Lys genotype showed higher levels of DNA adducts
than heterozygotes (13.16 ± 9.70 vs. 6.81 ± 5.86 adducts/108
nucleotides). Children carrying the XRCC3-241 Met/Met
genotype exhibited a higher number of SCE in peripheral
blood lymphocytes than carriers of Thr/Metallele (8.15 ± 0.86
vs. 7.62 ± 0.79 SCE/cell). It was also observed that children
with the GSTP1 slow conjugator had signicantly elevated
MN in peripheral blood lymphocytes compared with fast
conjugator (4.23 ± 3.49 vs. 6.56 ± 5.00 MN/1000 cells).
Introduction
According to World Health Organisation, estimates up to 25%
of the global burden of disease, especially in childhood, is
due to preventable environmental exposure (1,2). There is a
general recognition that children are more vulnerable to such
exposure by virtue of their increased susceptibility and the
higher doses received. An increased susceptibility in children
is a consequence of higher levels of exposure and uptake,
relative immaturity of metabolic and excretory pathways, and
incomplete development of target organs (3,4). Although in
recent years there has been an increased emphasis on research
aimed at this specic susceptible population, there are still large
gaps in the available data, especially in the area of chronic, low-
level exposure of children in their home and school environment
(5). Three main methods are used to assess human exposure
to chemical and biologic agents: questionnaires and other
indirect means, environmental monitoring including personal
monitoring and biomonitoring. Recently, human biomonitoring
has rapidly gained importance. Now, the measurement and the
use of biomarkers of exposure, effects and susceptibility have
replaced traditional environmental indicators (6).
A highly industrialised and densely populated region of
Upper Silesia in Poland, characterised by considerable lev-
els of occupational and environmental pollution followed by
an increased damage of genetic material in the inhabitants,
has been a major concern of Polish and cooperating foreign
researchers. Starting from the early 90s of the 20th century, the
interest has been focused mainly on molecular consequences of
exposure to complex mixtures containing polycyclic aromatic
hydrocarbons (PAHs) in coke-oven workers (7–11) and non-
occupationally exposed inhabitants of Upper Silesia (12–18),
including children (19–22).
The inuence of individual genetic susceptibility on response
to genotoxic agents is well documented in literature. The bio-
activation of carcinogens is mediated by phase I enzymes
and the reactive metabolites generated during the process are
conjugated by phase II enzymes. Also several cellular repair
pathways have evolved as defence mechanisms to maintain the
genomic integrity against DNA damage (23–25).
Cytochrome P-450 monooxygenases (CYPs) are phase I
enzymes that function in the metabolic activation of PAHs and
other pre-carcinogens. Many CYP450 enzymes are polymorphic
and genotypes associated with high enzyme activity or high
inducibility are supposed to be at risk. Microsomal epoxide
hydrolase (mEH) is a phase II enzyme, which catalyses the
hydrolysis of epoxides into dihydrodiols. This reaction usually
leads to detoxication but in the case of PAHs, mEH is part of
a metabolic activation route, since the dihydrodiol can further
be metabolised by CYP to highly reactive diol epoxides, such
as benzo(a)pyrene diol epoxide (BPDE). One of the major
groups of detoxifying enzymes is glutathione S-transferases
(GSTs). Each GST has distinct catalytic properties: conjugation
with glutathione, peroxidation and isomerisation. N-acetyl
transferases (NATs) can catalyse both reactions of detoxication,
591
Mutagenesis vol. 28 no. 5 pp. 591–599
Advance Access publication 18 July 2013
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
D. Mielzynska-Svach etal.
such as N-acetylation, and activation, such as O-acetylation of
N-hydroxyaryl amines (26,27).
The Xeroderma pigmentosum (XP) genes, including the
5′→3′ helicase encoding XPD gene, code for enzymes that
participate in nucleotide excision repair pathway. The cen-
tral part in base excision repair plays the X-ray repair cross-
complementation group 1 (XRCC1) protein acting as a
mediator of complex protein–protein interactions involving
poly(ADP-ribose) polymerase, DNA polymerase Iand DNA
ligase III. The XRCC3, in turn, is one of the RAD51-like
proteins involved in homologous recombination to maintain
chromosome stability and DNA damage repair. Many com-
mon single-nucleotide polymorphisms have been described in
the XPD, XRCC1 and XRCC3 genes. However, data on their
functional signicance and understanding of their impact on
susceptibility to carcinogens are still inconsistent and insuf-
cient (27–29).
In this study, we investigate the association between allelic
variants of genes encoding for phase I enzymes (CYP2D6
and EPHX1), phase II enzymes (GSTM1, GSTP1, GSTT1,
NAT2) and DNA repair proteins (XPD, XRCC1, XRCC3) and
selected biomarkers of exposure and effect such as levels of
1-hydroxypyrene (1-OHP) and urinary mutagenicity, aromatic
DNA adducts, sister chromatid exchange (SCE) and micronu-
clei (MN) in 74 children from Upper Silesia region of Poland. In
our previous study carried out on this population, a signicant
inuence of exposure to environmental agents on the induction
of cytogenetic effects in peripheral blood lymphocytes (PBL)
was observed (21).
Materials and methods
Individuals
The examined population included 74 healthy children (47 boys and 27
girls), aged 5–14years, who lived in Katowice and Sosnowiec—two cit-
ies located in the most polluted region of the Silesian province. The study
was approved by the Ethics Committee of the Silesian Medical Academy
in Katowice. In compliance with the Polish law, parents of all children
participating in this study gave their written consent. All parents com-
pleted a self-administered questionnaire form including items concerning
children’s demographic variables, health status, medical treatment, dietary
habits and socioeconomic conditions, etc. The study population consisted
of the same children for whom the relationships between DNA adducts and
SCE, as well as between lead and MN, in blood had already been studied
before (21).
Blood and urine sampling
Blood sampling took place in the Institute of Occupational Medicine and
Environmental Health in Sosnowiec during the cold season between November
1998 and March 1999. Blood samples were collected in sodium–heparin tubes
(Vacuette tubes) for setting cell cultures and for DNA extraction. Twenty-four
hour urine samples were collected into sterilised plastic containers. Tubes with
blood specimens were delivered to the laboratory within 2 h and DNA was
isolated immediately. DNA and urine samples were kept frozen at −80°C until
analysis.
Determination of 1-OHP inurine
The determination of 1-OHP in urine was carried out using the high-pressure liq-
uid chromatography method developed by Jongeneelen and Anzion (30). 1-OHP
in the 20 ml urine samples was enzymatically deconjugated and then transferred
to primed C18 Octadecyl cartridges, washed with 10 ml of water and eluted with
9 ml of methanol. The components of the eluate were separated by high-pressure
liquid chromatography on the HP 1090 apparatus (Hewlett Packard) with the
ODS C18 column, whereas 1-OHP was quantitatively determined using the uo-
rescence detector HP 1046 (Hewlett Packard) with 229 nm excitation and 400 nm
emission wavelengths. Concentrations of 1-OHP were expressed in millimole per
mole creatinine to account for differences in urine dilution.
Urinary mutagenicity
The organic substances present in urine were condensed using adsorption and
desorption methods on columns lled with organic resin XAD-2 (31). The
extracts were examined by plate incorporation test (32). Before the exami-
nation, the acetone extracts of urine were dissolved in dimethyl sulfoxide.
Three doses, 20, 40 and 80μl, of dimethyl sulfoxide solution (representing
6, 12 and 24 ml of urine) were examined twice with Salmonella typhimu-
rium strains: TA98 and YG1024 with metabolic activation (+S9 mixture).
Mutagenic effect was expressed as a number of induced revertants per mil-
limole of creatinine (10).
DNA extraction
DNA isolation was carried out using proteinase K digestion, phenol–chloro-
form extraction and ethanol precipitation as described in standard protocols.
The concentration of DNA was determined spectrophotometrically by measur-
ing the UV absorbance at 260 nm and the purity was ascertained by the ratio
at 260/280 nm.
Aromatic DNA adducts analysis
DNA adducts were assessed using 32P-post-labelling method mainly
described by Randerath and Randerath (33). DNA (5μg) was digested with
micrococcal nuclease, phosphodiesterase from calf spleen and nuclease P1
from Penicillum citrinum. Then the digested DNA was labelled with [γ-32P]
ATP catalysed by T4 polynucleotide kinase. Redundant [γ-32P]ATP were
eliminated by apyrase. The labelled material was then separated by thin layer
chromatography on polythyleneimine–cellulose plates and estimated by
autoradiography. The diagonally radioactive zone was excised and quantied
by scintillation counting. The parts of the plates without spots were used as
background.
Determination of cytogenetic endpoints in lymphocytes
Cultures. Venous blood was taken from each subject using heparinised vacu-
tainer tubes. Lymphocyte cultures were set up by adding 0.5 ml of heparinised
blood to 4.5 ml of medium (RPMI 1640)supplemented with 20% heat-inacti-
vated fetal bovine serum, antibiotics (penicillin and streptomycin) and -glu-
tamine. Lymphocytes were stimulated by 1% phytohaemagglutinin.
MN assay. The cultures were incubated at 37°C for 72 and 44 h after the ini-
tiation of cultures; cytochalasin B at a concentration of 6 mg/ml was added
to arrest cytokinesis. MN slides were stained with 10% Giemsa in phosphate
buffer. Atotal of 1000 binucleated cells with well-preserved cytoplasm were
examined for each subject on coded slides. The total number of MN and the
frequency of binucleated cells with MN were scored (34).
SCE assay. The cultures were incubated for 72 h at 37°C with 0.25 ml of
5-bromo-20-deoxyuridine. Colcemid was added 2 h before harvesting. The
cells were collected by centrifugation, resuspended in a pre-warmed hypotonic
solution (0.075 M KCl) for 20 min and xed in acetic acid/methanol (1:3, v/v).
Chromosome preparations and stained slides were prepared following the pro-
cedure by Anthosina and Porjadkowa (35). SCE was scored in 50 metaphases
and presented as a number of SCE per cell. Data from <50 metaphases were
discarded (36).
Analysis of polymorphisms
Blood samples were collected into EDTA-containing tubes. Genomic DNA
was extracted from the peripheral lymphocytes by proteinase K digestion
followed by standard protocols with phenol–chloroform extraction and ethanol
precipitation.
The polymorphic deletions of GSTT1 and GSTM1 genes were determined by
multiplex polymerase chain reaction (PCR) amplication (37). Allelic variants
of the CYP2D6, EPHX1, GSTP1, NAT2, XPD, XRCC1 and XRCC3 genes were
identied by PCR-restriction fragment length polymorphism (RFLP) methods
as described by others (38–44). Previously published multiplex PCR and PCR-
RFLP protocols with some modications were used. The amplication reac-
tions were carried out in a total reaction volume of 30 µl containing 100 ng
genomic DNA, 1U Taq DNA Polymerase, 1× PCR buffer (10 mM Tris-HCl, pH
8.3, 50 mM KCl, 1.5 mM MgCl2), 0.2 mM of each dNTP and 12.5–50.0 pmol of
primers. PCR amplication was conducted in an Eppendorf Mastercycler gra-
dient thermal cycler. The PCR and RFLP products were analysed in ethidium
bromide–stained 1.8 and 2.5% agarose gel, respectively. All studied allelic vari-
ants, primer sequences and PCR-RFLP conditions are summarised in Table I.
592
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
Genetic polymorphisms, biomarkers, children
Statistical analysis
Questionnaire and analytical data were stored in a database and statistically
analysed using STATISTICA for Windows, Version 10, 2011 (StatSoft).
Normal distribution was tested according to Shapiro–Wilks test. The levels
of SCE were normally distributed. The distributions of 1-OHP concentration
and urinary mutagenicity and the level of DNA adducts and MN were skewed
to the right. Therefore, they were transformed (log or square root) to make
their distribution normal (1-OHP, urinary mutagenicity and DNA adducts) or
stabilise the variance (MN). The arithmetic mean and the standard deviation
were used to describe the frequency distribution of biomarkers of exposure
(1-OHP, urinary mutagenicity and DNA adducts) and effects (MN and SCE in
peripheral blood lymphocytes). The differences between the groups were ana-
lysed using the Student’s t-test when the variance was equal or the Levence’s
t-test when the variance was unequal. For the analysis of associations between
the genotype distribution and other discrete parameters, chi-square test in con-
tingency tables was used. Amultiple linear regression analysis was applied to
determine the effect of polymorphisms on biomarkers of exposure and effects
with the confounding factors such as place of living, gender, environmental
tobacco smoke and risk connected with the use of coal-red stoves in houses.
Results
Distribution of genotypes
Out of the original group of 74 children for whom data on
biomarkers of exposure to PAHs and biomarkers of effect
were available (21), the GST (M1, M3, P1, T1), NAT2 and
EPHX1 genotypes were determined in 72 individuals, whereas
the CYP2D6, XPD and XRCC3 genotypes were determined
in 71 individuals. The XRCC1 genotype distribution was
successfully estimated in 69 children. Polymorphisms in the
genes of phases Iand II were merged into dichotomous variable
based upon the known effect on enzymatic function (e.g. low
and fast). For DNA repair genes, all three genotypes were
analysed. Variant distribution of all studied polymorphic genes
in the group is shown in Table II. The frequencies were similar
to those observed in other healthy Caucasian populations
and the distribution was in agreement with Hardy–Weinberg
equilibrium. Girls had a signicantly higher (or 2.4 time higher)
frequency of the GSTM1 active genotype than boys (P=0.026)
and only three children living in a house with coal-red stove
had a CYP2D6 poor metaboliser genotype (P=0.042).
Inuence of genotypes on biomarkers of exposure
The inuence of genetic polymorphisms of phase I and
phase II enzymes and DNA repair on concentration of
1-OHP and urinary mutagenicity is shown in Table III. Both
1-OHP concentration (Figure 1) and urinary mutagenicity
tested by TA98+S9 (Figure2) were signicantly higher in
individuals (only three children) with EPHX1 (exon 4)Arg/
Table I. Sequences of primers and restriction enzymes used in multiplex PCR and PCR-RFLP reactions
Gene Primer name Primer sequence Amplicon
length (bp)
Annealing
Tm (°C)
Restriction
enzyme
Allele name (RFLP
fragments length bp)
CYP2D6 P51 5′–GCTGGGGCCTGAGACTT–3′201 60 BsaAIa*1 (201)
P522 5′–GGCTGGGTCCCAGGTCATAC–3′*3 (180; 121)
*1 (190; 163)
P*3 5′–CCTGGGCAAGAAGTCGCTGGACCAG–3′353 60 MvaIb*4 (353)
P2 5′–GAGACTCCTCGGTCTCTCG–3′*6 (190; 139; 24)
EPHX1 EPHX3F 5′–CCTGACCTCTGTCCTTCCCATCCC–3′231 56 Tth111IaT (209; 22)
EPHX3R 5′–AATCTTAGTCTTGAAGTGACGGT–3′C (231)
EPHX4F 5′–GGGGTACCACAGCCTGACCGT–3′A (295; 62)
EPHX4R 5′–AACACCGGGCCCACCCTTGGC–3′357 59 RsaIbG (174; 121)
GSTM1cJ6 5′–GCTTCACGTGTTATGAAGGTTC–3′132 52 – –
E7A 5′–TTGGGAAGGCGTCCAAGCGG–3′
E7B 5′–TTGGGAAGGCGTCCAAGCAG–3′
BGI1 5′–CAACTTCATCCACGTTCACC–3′
BGI2 5′–GAAGAGCCAAGGACAGGTAC–3′280
GSTP1 P1F1 5′–CAGTGACTGTGTGTTGATCA–3′173 58 SnabIa*A (173)
P1R1 5′–TGCTCACATAGTTGGTGTAGATGAGGGATA–3′*B or C (142; 31)
P1F2 5′–ACAGGATTTGGTACTAGCCT–3′*A or B (170; 144; 26)
P1R2 5′–AGTGCCTTCACATAGTCATCCTTGCGC 170 58 BstUIa*C (170)
GSTT1cTLF 5′–TTCCTTACTGGTCCTCACATCTC–3′480 60 – –
TLR 5′–TCACCGGATCATGGCCAGCA–3′
VDRF 5′–CCAAGACTACAAGTACCGCGTCAGTGA–3′
VDRR 5′–AACCAGCGGGAAGAGGTCAAGG–3′800
NAT2 Hu7 5′–GGCTATAAGAACTCTAGGAAC–3′1093 50 KpnIb*4 (660; 433)
*5B (1093)
TaqIb* 4 (380; 317; 226; 170)
Hu16 5′-GATGAAAGTATTTGATGTTTA-3′*6A (396; 380; 317)
BamHb*4 (811; 150; 132)
*7B (1093)
XPD CC5 5′-TCAAACATCCTGTCCCTACT-3′344 61 PstIbA (244; 110)
CC4 5′-CTGCGATTAAAGGCTGTGGA-3′C (171; 110; 63)
XRCC1 CC3 5′-CAGTGGTGCTAACCTAATC-3′871 61 BcnIbG (461; 278; 132)
CC4 5′-AGTAGTCTGCTGGCTCTGG-3′A (593; 278)
XRCC3 CC7 5′-GCCTGGTGGTCATCGACTC-3′136 61 NcoIbC (97; 39)
CC8 5′-ACAGGGCTCTGGAAGGCACTGCTCAGCTCACGCACC-3′T (136)
aNew England Biolabs, Germany.
bFermentas UAB, Lithuania.
cDeletion genotypes of GSTT1 and GSTM1 were determined by multiplex PCR.
593
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
D. Mielzynska-Svach etal.
Arg genotype than in individuals with His/Arg or His/His
genotype. The EPHX1 polymorphism in exon 3 signicantly
affected urinary mutagenicity tested with strain YG1024+S9.
It was observed that urinary mutagenicity in individuals
with Tyr/Tyr homozygotes was lower (low activity) than
in individuals with Tyr/His and His/His (high activity)
(1057 ± 685 vs. 1432 ± 1003 revertants/mol creatinine,
respectively, P = 0.039). XRCC3 Met/Met genotype was
associated with signicantly higher levels of 1-OHP in urine
compared with only The/Met genotypes (P=0.010).
Inuence of genotypes on biomarkers ofeffect
Association between the genotypes and DNA adducts and
number of SCEs and MN frequencies are shown in TableIV.
The arithmetic mean of PAH-DNA adduct levels in the
subgroup with GSTM null genotype was nearly 2-fold higher
than in individuals with GSTM1 A/A, A/B or B/B (7.06 ± 5.12
vs. 13.14 ± 9.81 adduct/108 nucleotides, respectively,
P = 0.005). Similarly, the mean level of aromatic DNA
adducts in individuals (n= 17) with deletion of the GSTT1
gene was signicantly higher compared with individuals
(n= 55) with the gene present (8.03 ± 6.23 vs. 14.66 ± 10.70
adduct/108 nucleotides, respectively, P = 0.008). For DNA
repair gene polymorphisms, statistically signicant result
was observed only for the XPD exon 23. The carriers of the
Lys/Lys genotype showed higher levels of DNA adducts
than heterozygotes (13.16 ± 9.70 vs. 6.81 ± 5.86 adducts/108
nucleotides, respectively, P= 0.002). Children carrying the
XRCC3-241 Met/Met genotype exhibited a higher number
of SCE in PBL than carriers of Thr/Met allele (8.15 ± 0.86
vs. 7.62 ± 0.79 SCE/cell, respectively, P=0.049). It was also
observed that nine children with the GSTP1 slow conjugator–
predicted phenotype had signicantly elevated MN in PBL
compared with 60 children with fast conjugator phenotype
(4.23 ± 3.49 vs. 6.56 ± 5.00 MN/1000 cells, respectively,
P=0.012).
Table II. Distribution of the studied genotypes in Silesian children
Gene Genotype Enzyme activity/
phenotype
N (%)
CYP2D6 *1/*1 Extensive metaboliser 49 (69.0)
*1/*3, *1/*4, *3/*4,
*4/*4
Poor metaboliser 22 (31.0)
EPHX1 (exon 3) TT Low enzyme activity 28 (38.9)
TC, CC High enzyme activity 44 (61.1)
EPHX1 (exon 4) AA Low enzyme activity 45 (62.5)
AG, GG High enzyme activity 27 (37.5)
GSTM1 (+) Functional enzyme 42 (58.3)
(−) Null activity 30 (41.7)
GSTT1 (+) Functional enzyme 55 (76.4)
(−) Null activity 17 (23.6)
GSTP1 AA, AB, AC Fast conjugator 63 (87.5)
BB, BC, CC Slow conjugator 9 (12.5)
NAT2 *4/*4, *4/*5B, *4/
*6A, *4/*7B
Fast acetylator 41 (56.9)
*5B/*5B, *5B/*6A,
*5B/*7B, *6A/*6A,
*6A/*7B, *7B/*7B
Slow acetylator 31 (43.1)
XPD AA 26 (36.6)
AC 32 (45.1)
CC 13 (18.5)
XRCC1 GG 30 (43.5)
GC 32 (46.4)
CC 7 (10.1)
XRCC3 CC 14 (19.7)
CT 25 (35.2)
TT 32 (45.1)
Table III. Biomarkers of exposure in Silesian children by genotypes of phase I, phase II metabolic and DNA repair enzymes
Gene Enzyme activity/
genotype
1-OHP (μmol/mol creatinine) TA98+S9 (revertants/mmol creatinine) YG1024+S9 (revertants/mmol
creatinine)
NMean (standard
deviation)
P N Mean (standard
deviation)
P N Mean (standard
deviation)
P
CYP2D6 Extensive metaboliser 44 0.57 (0.34) 0.121 44 536 (477) 0.078 44 1416 (1016) 0.211
Poor metaboliser 19 0.44 (0.24) 17 363 9195) 17 979 (441)
EPHX1 (exon 3) Low enzyme activity 23 0.56 (0.36) 0.476 24 376 (201) 0.079 24 1057 (685) 0.039
High enzyme activity 41 0.49 (0.21) 38 550 (506) 38 1432 (1003)
EPHX1 (exon 4) Low enzyme activity 41 0.50 (0.26) 0.263 41 416 (202) 0.329 41 1182 (703) 0.212
High enzyme activity 23 0.59 (0.39) 21 615 (658) 21 1492 (1202)
GSTM1 Functional enzyme 37 0.51 (0.36) 0.344 35 547 (530) 0.317 35 1453 (1034) 0.064
Null activity 27 0.56 (0.25) 27 401 (192) 27 1072 (664)
GSTT1 Functional enzyme 50 0.54 (0.33) 0.864 47 482 (433) 0.989 47 1284 (891) 0.864
Null activity 14 0.50 (0.21) 15 488 (401) 15 1298 (982)
GSTP1 Fast conjugator 56 0.51 (0.37) 0.112 54 473 (440) 0.303 54 1282 (926) 0.488
Slow conjugator 8 0.69 (0.30) 8 557 (272) 8 1320 (498)
NAT2 Fast acetylator 34 0.58 (0.37) 0.863 34 531 (536) 0.988 34 1327 (926) 0.864
Slow acetylator 30 0.47 (0.22) 28 426 (317) 28 1239 (895)
XPD AA 21 0.56 (0.28) 0.591 21 499 (280) 0.149 21 1432 (994) 0.260
AC 30 0.50 (0.29) 30 386 (194) 30 1118 (664)
CC 12 0.58 (0.48) 10 770 (882) 10 1536 (1305)
XRCC1 GG 25 0.53 (0.28) 0.898 26 469 (265) 0.759 26 1330 (964) 0.406
GC 29 0.54 (0.37) 26 547 (5800 26 1395 (967)
CC 7 0.46 (0.18) 7 395 (240) 7 902 (489)
XRCC3 CC 14 0.47 (0.24) 0.032 14 423 (234) 0.194 14 1010 (494) 0.107
CT 20 0.40 (0.17) 20 389 (194) 20 1096 (436)
TT 28 0.65 (0.39) 26 609 (588) 26 1613 (911)
594
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
Genetic polymorphisms, biomarkers, children
Multiple linear regression analysis
Multiple linear regression analysis was carried out taking into
consideration the following factors: place of living, gender,
indoor exposure to environmental tobacco smoke, emission from
indoor coal-red stoves and genetic polymorphisms. The analysis
showed that EPHX1 exon 4 polymorphism inuenced urinary
mutagenicity tested by TA98+S9 in a subgroup of children living
in houses (n=4) with a coal-red stove. The signicant inuence
of GSTM1 genotype on the level of DNA adducts was observed
only in 13 girls. When the gene–gene interaction was examined, it
was found out that only GSTM1 and GSTT1 combined genotypes
inuenced the DNA adduct levels. Children with deletions of both
genes (n = 10) had signicantly higher aromatic DNA adduct
levels than those with the genes present (n=35; Figure3).
Discussion
Our previous study showed that the exposure to emission
from indoor coal-red stoves affected the level of 1-OHP and
urinary mutagenicity in children. It was also noticed that there
was a relationship between DNA adducts and SCE, as well as
between lead and MN (all measured in blood). The level of
DNA adducts and SCE was clearly and signicantly associated
with gender with higher levels found in girls (21).
Among the studied gene polymorphisms, only EPHX1
and XRCC3 had a signicant effect on the tested markers of
exposure to PAHs in Silesian children. It was observed that only
children with genotype Arg/Arg in EPHX1 (exon 4)excreted
about twice as much of 1-OHP as children with His/His and
His/Arg genotypes (Figure1). The same phenomenon occurred
in the case of the urinary mutagenicity tested by TA98+S9
(Figure 2). This could, however, be due to the fact that only
three children had genotype Arg/Arg. Urinary mutagenicity
levels tested with strain YG1024+S9 were statistically lower
among Silesian children with the EPHX1 Tyr/Tyr genotype
(exon 3 polymorphism).
So far, the inuence of the EPHX1 gene polymorphisms
at the level of markers of exposure has been studied only in
association with occupational exposure. Several studies have
indicated consistent associations between low mEH activity
genotype/phenotype and lower levels of 1-OHP, urinary muta-
genicity, DNA adducts and BPDE–serum albumin adducts
(45–48). Results regarding the inuence of both EPHX1 poly-
morphisms and their combinations on cancer risk were incon-
sistent (49,50).
Microsomal epoxide hydrolase plays an important role in the
detoxication of toxic, highly reactive intermediates formed
by CYP-mediated reactions (51). Generally, investigations of
the effect of EPHX1 polymorphism focus on two polymorphic
sites but the impact of these sequence variations on the enzyme
activity is not yet conclusive (52,53). Furthermore, EPHX1 var-
iants seem not to have a strong impact on the enzyme kinetics,
probably due to amino acid exchanges distant from the cata-
lytic centre of the protein (46).
GSTs are one of the major groups of detoxifying enzymes.
Each GST has distinct catalytic properties: conjugation with
glutathione, peroxidation and isomerisation. Essential non-
enzymatic role of GST connection with modulation of signal-
ling pathways have also been shown (54). In our study, no effect
of GSTM1 gene polymorphism on the level of excreted 1-OHP
was found, whereas in Mexican children with the GSTM1 null
polymorphism, the risk of high urinary 1-OHP concentrations
was ve times higher (55).
No inuence of GSTM1 polymorphism on urinary muta-
genicity in children has been observed in our studies, which is
similar to results obtained for non-smoking Polish women and
Italian healthy smokers (16,56).
So far the signicant impact on selected biomarkers of
effect in children from Silesia has been attributed to polymor-
phism of genes such as GSTM1, GSTT1, GSTP1, XPD and
XRCC3. The present study demonstrated a signicant associa-
tion between PAH-DNA adduct level and GSTM1 and GSTT1
polymorphism, alone or together (Table IV, Figure 3). There
was a 3-fold higher number of DNA adducts in Silesian chil-
dren with GSTM1 and GSTT1 deletions compared with those
with both genes present (20.3 ± 10.35/108 nucleotides and
7.2 ± 5.36/108 nucleotides). The reliability of these results is
limited due to the small number of children with deletion of
two genes but this problem is extremely interesting because it
can be assumed that a complete lack of both active enzymes
is responsible for a fairly ineffective elimination of reactive
xenobiotics derivatives.
His/HisHis/Arg Arg/Arg
EPHX1 (exon 4) genotype
0,4
0,6
0,8
1,0
1,2
1,4
1,6
1-OHP (µmol/mol creat.)(square- scale)
Mean
Mean±SEM
Mean±SD
HH/HA P = 0.699
HH/AA
P
= 0.015
HA/AA
P
= 0.027
N=41
N=3
N=20
Fig.1. The inuence of genotype of EPHX1 (exon 4)of children on the level
of urinary 1-hydroxypyrene.
His/HisHis/Arg Arg/Arg
EPHX1 (exon 4) genotype
5,2
5,6
6,0
6,4
6,8
7,2
7,6
8,0
8,4
8,8
Urinary mutagenicity on TA98+S9 (rev./mmol creat.)
(log-scale)
Mean
Mean±SEM
Mean±SD
HH/HA P = 0.714
HH/AA
P
< 0.000
HA/AA
P
= 0.005
N=17
N=3
N=41
Fig.2. The inuence of genotype of EPHX1 (exon 4)of children on the
level of urinary mutagenicity in Salmonella typhimurium TA98 strain (with
metabolic activation).
595
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
D. Mielzynska-Svach etal.
GSTM1 is known to detoxify arene oxides, including the
ultimate carcinogenic form of benzo(a)pyrene, BPDE, but
it is not involved in the detoxication of aromatic amines.
Some studies suggest that individuals who are homozygous
null have an increased risk of cancer at a number of sites—
lung, bladder, colon and breast (57). Individuals classied
as GSTM1 null should theoretically have a higher level of
DNA damage (e.g. PAH-DNA adducts) compared with
individuals with the gene present. No effect of GSTM1
genotypes on lymphocyte DNA adducts (32P) was found in
Italian (58), French (59) and Polish coke-oven workers (60).
In environmentally exposed non-smoking women, DNA
adducts were correlated with pollution levels only in GSTM1
active individuals (61). The results on Polish environmentally
exposed individuals showed higher PAH-DNA adduct levels
only in summer samples from subjects with GSTM1 null and
in those with the GSTM1 null/CYP1A1 Ile/Val combination
(62). Wang etal. (63) studying PAH-DNA adduct formation
in African American, Dominican, and Polish mothers and
their newborns who were environmentally exposed to PAHs
found that GSTM1-02 deletion in African Americans had a
protective effect.
No inuence of GSTM1, GSTT1, GSTP1 and NAT2 on DNA
adduct levels has been reported in coke-oven workers from
the Czech Republic (64), Netherland (65), Portugal (66) and
Finland (45). Also two studies on women environmentally
exposed to PAHs indicated a lack of inuence of CYP1A1 and
GSTM1 genotypes on DNA adducts (16,67). No signicant
effect of CYP1A1, GSTM1 and GSTT1 genotype on the levels
of 1-OHP and DNA adducts in children attending schools in
the inner city of Bangkok and rural areas were observed (68).
However, the results are ambiguous, which can be contributed
to different methods for PAH-DNA adduct analyses using dif-
ferent targets, sources and/or levels of exposure (57). It may
also attributed to the fact that the genes of the GST group
among many enzymatic and non-enzymatic functions have
may involved in maintenance of DNA stability and modulate
DNA repair (54).
No papers have been found regarding the impact of GSTT1
null allele on the level of aromatic adducts in DNA or of addi-
tive effect of the combination GSTM1 null/GSTT1 null on this
biomarker. The biological consequences of this polymorphism
are fairly difcult to predict, as the enzyme is involved in both
detoxication and activation reactions. Epidemiological stud-
ies do not show any clear association between the GSTT1 null
genotype and cancer development but an additive effect of the
combination GSTT1 null/GSTM1 null was observed for certain
types of cancers (57).
Table IV. Biomarkers of effect in Silesian children by genotypes of phase I, phase II metabolic and DNA repair enzymes
Gene Enzyme activity/
genotype
DNA adducts (per 108 nucleotides) SCE (per cell) MN (per 1000 cells)
NMean (standard
deviation)
P N Mean (standard
deviation)
P N Mean (standard
deviation)
P
CYP2D6 Extensive metaboliser 49 9.11 (6.42) 0.902 48 7.86 (0.94) 0.951 48 4.85 (3.91) 0.130
Poor metaboliser 22 10.40 (10.83) 22 7.84 (0.73) 20 4.00 (3.32)
EPHX1 (exon 3) Low enzyme activity 28 9.68 (9.44) 0.696 27 8.02 (0.96) 0.233 27 4.57 (4.05) 0.723
High enzyme activity 44 9.54 (7.00) 44 7.76 (0.79) 42 4.40 (3.61)
EPHX1 (exon 4) Low enzyme activity 45 9.92 (8.98) 0.905 44 7.90 (0.85) 0.607 43 4.53 (4.04) 0.755
High enzyme activity 27 9.06 (6.05) 27 7.79 (0.91) 26 4.54 (3.33)
GSTM1 Functional enzyme 42 7.06 (5.12) 0.005 42 7.76 (0.77) 0.247 40 4.82(3.44) 0.327
Null activity 30 13.14 (9.81) 29 8.00 (0.77) 29 4.13 (3.44)
GSTT1 Functional enzyme 55 8.03 (6.23) 0.008 54 7.87 (0.87) 0.828 52 4.36 (3.360 0.431
Null activity 17 14.65 (10.70) 17 7.82 (0.88) 17 5.06 (4.89)
GSTP1 Fast conjugator 63 9.51 (8.07) 0.888 62 7.89 (0.91) 0.492 60 4.23 (3.49) 0.012
Slow conjugator 9 9.89 (7.72) 9 7.67 (0.57) 9 6.56 (5.00)
NAT2 Fast acetylator 41 10.21 (8.54) 0.491 41 7.99 (0.85) 0.148 41 4.46 (3.09) 0.633
Slow acetylator 31 8.77 (7.19) 30 7.68 (0.58) 28 4.46 (4.63)
XPD AA 26 13.16 (9.70) 0.007 26 8.03 (0.79) 0.104 26 4.46 (4.11) 0.181
AC 32 6.81 (5.86) 31 7.60 (0.79) 30 4.07 (3.59)
CC 13 8.82 (6.28) 13 8.10 (1.11) 12 6.25 (4.00)
XRCC1 GG 30 11.11 (9.43) 0.357 30 7.73 (0.92) 0.456 28 4.11 (3.19) 0.815
GC 32 8.38 (6.36) 32 7.94 (0.88) 32 5.16 (4.39)
CC 7 8.02 (8.17) 6 7.64 (0.59) 6 5.17 (2.14)
XRCC3 CC 14 8.73 (7.80) 0.692 14 7.68 (0.91) 0.055 14 4.86 (4.55) 0.802
CT 25 8.74 (6.70) 24 7.62 (0.79) 24 4.54 (3.92)
TT 31 10.63 (9.11) 31 8.15 (0.86) 29 4.41 (3.30)
null/nullnull/active active/nullactive/active
GSTM1 and GSTT1 genotypes
1,0
1,5
2,0
2,5
3,0
3,5
4,0
DNA adducts/108 nucleotides
null/null:null/active
P
= 0.004
null/null:active/null
P
= 0.001
null/null:active/active
P
< 0.000
Mean
Mean±SEM
Mean±SD
N=10
N=35
N=7
N=20
Fig.3. The inuence of genotype of GSTM1 and GSTT1 on the level of DNA
adducts in PBL in children.
596
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
Genetic polymorphisms, biomarkers, children
GSTP1 is another important GST responsible for metabolism
of PAHs. The 105Val (allele A) variant should consequently
be the risk factor for cancer in which PAH is involved in the
a etiology due to a lower rate of detoxication of the active
metabolite.
Our observations concerning the lower frequency of micro-
nuclei in lymphocytes of children with wild-type homozy-
gotous genotypes GSTP1 (A/A) conrm the results of other
studies. Similar results were obtained for population of the
coke-oven workers (69) and 53 policemen from Prague (70)
in which homozygotes with the GSTP1Val105 allele had sig-
nicantly higher MN frequencies than those with the Ile105
allele.
The impact of GSTP1 polymorphism on the increase of
DNA damage (such as micronuclei) was demonstrated in
two works performed with PBLs in vitro exposed to styrene-
7,8-oxide (SO) (71) and doxorubicin (72). In lymphocytes from
healthy donors exposed to SO, a non-signicant increase in
induced MN frequency was found for A/B and A/C genotypes
compared with the wild-type homozygous genotype A/A (71).
Lymphocytes from individuals with the homozygous geno-
type for the variant (Val/Val) had a signicantly higher number
of doxorubicin-induced micronuclei than those with the het-
erozygous genotype. The occurrence of spontaneous lesions
(background controls) in DNA was higher in lymphocytes
from individuals with the Ile/Ile genotype compared with the
heterozygotes (72) similarly to healthy male volunteers in the
study of Czech policemen (70).
Up to now, the major research activities have been focused
on polymorphisms in DNA repair genes as an important com-
ponent of the individual susceptibility phenomenon because
DNA repair activities are closely involved with the protection
of the genome (73). The greater health impact is expected
for genetic polymorphisms that affect genes with key func-
tions in DNA repair such as e.g. XPD, XRCC1 or XRCC3.
Some studies suggest that polymorphisms in these genes can
modulate spontaneous and/or in vitro-induced DNA damage
and/or cancer risk (27,74). However, the overall weight of
such evidence is low because of the minimal incremental risk
associated with variant alleles and inconsistencies in the pub-
lished data (75).
In Silesian children, signicantly higher level of PAH-DNA
adducts was observed in the XPD Lys/Lys homozygotes, in
comparison with Lys/Gln heterozygotes (P=0.002). Asimilar
effect of XPD polymorphism on DNA adducts was observed
in the study of exposure to PAHs carried out among population
from Prague, where homozygous carriers of the Lys/Lys (AA)
showed the highest level of total DNA adduct. This, however,
was observed only in the control group and not among
the exposed policemen (70). A similar effect of XPD-Lys
homozygote on chromosome aberration and micronuclei, as
observed in our study, was recorded in 31 Caucasian women
from the USA and 291 volunteers from Slovakia (76,77).
However, in the case of trafc workers, never-smoking healthy
individuals, ofcers from the Municipality of Rome and people
exposed to Prestige oil with at least one variant allele for XPD-
Lys751Gln polymorphism showed increased mean levels of
DNA adducts, SCE and MN frequency (78–80). Apossible
explanation for these results is that amino acid variants in
different domains of XPD may not only affect different protein
activities, resulting in the expression of different phenotypes
(81), but also the XPD codon 751 polymorphism may have
divergent effects in different DNA repair pathways. Moreover,
this substitution could be in linkage with another XPD variant
responsible for phenotypic effect. It is possible that different
alleles may be in linkage disequilibrium with responsible XPD
variant in different populations.
The Thr241Met substitution in XRCC3 is a non-conservative
change with a possible biological implication for function-
ality of the enzyme and/or the interaction with other protein
involved in DNA damage repair (82). XRCC3 gene polymor-
phism had a signicant impact on the level of urinary excretion
of 1-OHP and the level of SCE in PBL of the Silesian children.
Children who are homozygous Met/Met excreted signicantly
more 1-OHP and had a greater number of SCE in peripheral
blood lymphocytes in comparison with homozygous Thr/Thr.
No studies on the impact of XRCC3 polymorphism on excre-
tion of urinary 1-OHP and SCE levels have been found, either.
The XRCC3-241Met variant was closely associated with higher
DNA adduct level (42). In some studies, it was demonstrated
that the level of SCE was inuenced by XRCC1 gene polymor-
phism but not by XRCC3 (83–85). In this study, a clear associa-
tion between the XRCC3-241Met variant and SCE in children’s
PBL suggested the contribution of homologous recombination
pathways in SCE formation.
Numerous studies have investigated the effects of poly-
morphisms in genes involved in activation/detoxication of
carcinogens and DNA repair on phenotypic biomarkers of
exposure and effect. Only three studies have been conducted
in environmentally exposed children (55,68,86). Since our
ndings are based on relatively small numbers of children,
and therefore might be accidental, further studies are required
to conrm our observations and to obtain explanations for
the suggested inuence of metabolism and, especially DNA
repair, gene polymorphisms on biomarkers of exposure and
effect.
Funding
Polish Committee of Scientic Research (3 P05D 052 24).
Acknowledgement
The authors thank Miroslawa Cyrana-Szram for excellent technical assistance
in the preparation of this article.
Conict of interest statement: None declared.
References
1. Pruss-Ustun, A. and Corvalan, C. (2006) Preventing Disease Through
Health Environments. Towards an Estimate of the Environmental Burden of
Disease. World Health Organisation, Geneva, Switzerland.
2. Environmental Health Criteria 237. (2006) Principles for Evaluating the
Health Risks in Children Associated with Exposure to Chemicals. World
Health Organisation, Geneva, Switzerland.
3. Sly, P. D. and Flack, F. (2008) Susceptibility of children to environmental
pollutants. Ann. N.Y. Acad. Sci., 1140, 163–183.
4. Sly, P. D., Eskenazi, B., Pronczuk, J., Srám, R., Diaz-Barriga, F., Machin,
D. G., Carpenter, D. O., Surdu, S. and Meslin, E. M. (2009) Ethical issues
in measuring biomarkers in children’s environmental health. Environ.
Health Perspect., 117, 1185–1190.
5. Wilson, N. K., Chuang, J. C., Iachan, R., Lyu, C., Gordon, S. M., Morgan,
M. K., Ozkaynak, H. and Sheldon, L. S. (2004) Design and sampling meth-
odology for a large study of preschool children’s aggregate exposures to
persistent organic pollutants in their everyday environments. J. Expo. Anal.
Environ. Epidemiol., 14, 260–274.
6. Bauer, S. (2008) Societal and ethical issues in human biomonitoring—a
view from science studies. Environ. Health, 7 (Suppl.1), S10.
597
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
D. Mielzynska-Svach etal.
7. Hemminki, K., Grzybowska, E., Chorazy, M., Twardowska-Saucha, K.,
Sroczynski, J. W., Putman, K. L., Randerath, K., Phillips, D. H. and Hewer,
A. (1990) Aromatic DNA adducts in white blood cells of coke workers. Int.
Arch. Occup. Environ. Health, 62, 467–470.
8. Mielzyńska, D. and Snit, M. (1992) Urine mutagenicity in workers directly
employed in coke production. Pol. J. Occup. Med. Environ. Health, 5,
363–371.
9. Ovrebø, S., Fjeldstad, P. E., Grzybowska, E., Kure, E. H., Chorazy, M. and
Haugen, A. (1995) Biological monitoring of polycyclic aromatic hydrocar-
bon exposure in a highly polluted area of Poland. Environ. Health Perspect.,
103, 838–843.
10. Simioli, P., Lupi, S., Gregorio, P., Siwinska, E., Mielzynska, D., Clonfero,
E. and Pavanello, S. (2004) Non-smoking coke oven workers show an occu-
pational PAH exposure-related increase in urinary mutagens. Mutat. Res.,
562, 103–110.
11. Siwińska, E., Mielzyńska, D. and Kapka, L. (2004) Association between
urinary 1-hydroxypyrene and genotoxic effects in coke oven workers.
Occup. Environ. Med., 61, e10.
12. Hemminki, K., Grzybowska, E., Chorazy, M., etal. (1990) DNA adducts
in human environmentally exposed to aromatic compounds in an industrial
area of Poland. Carcinogenesis, 11, 1229–1231.
13. Perera, F. P., Hemminki, K., Gryzbowska, E., etal. (1992) Molecular and
genetic damage in humans from environmental pollution in Poland. Nature,
360, 256–258.
14. Motykiewicz, G., Michalska, J., Pendzich, J., Perera, F. P. and Chorazy,
M. (1992) A cytogenetic study of men environmentally and occupationally
exposed to airborne pollutants. Mutat. Res., 280, 253–259.
15. Motykiewicz, G., Małusecka, E., Grzybowska, E., Chorazy, M., Zhang, Y.
J., Perera, F. P. and Santella, R. M. (1995) Immunohistochemical quantita-
tion of polycyclic aromatic hydrocarbon-DNA adducts in human lympho-
cytes. Cancer Res., 55, 1417–1422.
16. Motykiewicz, G., Michalska, J., Pendzich, J., etal. (1998) A molecular
epidemiology study in women from Upper Silesia, Poland. Toxicol. Lett.,
96–97, 195–202.
17. Grzybowska, E., Hemminki, K. and Choraźy, M. (1993) Seasonal varia-
tions in levels of DNA adducts and X-spots in human populations living in
different parts of Poland. Environ. Health Perspect., 99, 77–81.
18. Pendzich, J., Motykiewicz, G., Michalska, J., Wang, L. Y., Kostowska, A.
and Chorazy, M. (1997) Sister chromatid exchanges and high-frequency
cells in men environmentally and occupationally exposed to ambient air
pollutants: an intergroup comparison with respect to seasonal changes and
smoking habit. Mutat. Res., 381, 163–170.
19. Siwińska, E., Mielzyńska, D., Smolik, E., Bubak, A. and Kwapuliński,
J. (1998) Evaluation of intra- and interindividual variation of urinary
1-hydroxypyrene, a biomarker of exposure to polycyclic aromatic hydro-
carbons. Sci. Total Environ., 217, 175–183.
20. Siwińska, E., Mielzyńska, D., Bubak, A. and Smolik, E. (1999) The effect
of coal stoves and environmental tobacco smoke on the level of urinary
1-hydroxypyrene. Mutat. Res., 445, 147–153.
21. Mielzyńska, D., Siwińska, E., Kapka, L., Szyfter, K., Knudsen, L. E. and
Merlo, D. F. (2006) The inuence of environmental exposure to complex
mixtures including PAHs and lead on genotoxic effects in children living in
Upper Silesia, Poland. Mutagenesis, 21, 295–304.
22. Kapka, L., Baumgartner, A., Siwińska, E., Knudsen, L. E., Anderson,
D. and Mielzyńska, D. (2007) Environmental lead exposure increases
micronuclei in children. Mutagenesis, 22, 201–207.
23. Dusinska, M. and Collins, A. R. (2008) The comet assay in human bio-
monitoring: gene-environment interactions. Mutagenesis, 23, 191–205.
24. Mahimkar, M. B., Samant, T. A., Kannan, S. and Patil, T. (2010) Inuence
of genetic polymorphisms on frequency of micronucleated buccal epithelial
cells in leukoplakia patients. Oral Oncol., 46, 761–766.
25. Dhillon, V. S., Thomas, P., Iarmarcovai, G., Kirsch-Volders, M., Bonassi,
S. and Fenech, M. (2011) Genetic polymorphisms of genes involved in
DNA repair and metabolism inuence micronucleus frequencies in human
peripheral blood lymphocytes. Mutagenesis, 26, 33–42.
26. Pavanello, S. and Clonfero, E. (2000) Biological indicators of genotoxic
risk and metabolic polymorphisms. Mutat. Res., 463, 285–308.
27. Norppa, H. (2004) Cytogenetic biomarkers and genetic polymorphisms.
Toxicol. Lett., 149, 309–334.
28. Ronen, A. and Glickman, B. W. (2001) Human DNA repair genes. Environ.
Mol. Mutagen., 37, 241–283.
29. Wood, R. D., Mitchell, M., Sgouros, J. and Lindahl, T. (2001) Human DNA
repair genes. Science, 291, 1284–1289.
30. Jongeneelen, F. and Anzion, R. B.M. (1990) Hydroxypyrene, analyses of
hazardous substances in biological materials. In Angerer, J. and Schaller,
K. H. (eds), Analyses of Hazardous Substances in Biological Materials.
Deutsche Forschungsgemeinschaft, VCH-Verlag, Weinheim, Germany, pp.
151–167.
31. Yamasaki, E. and Ames, B. N. (1977) Concentration of mutagens from
urine by absorption with the nonpolar resin XAD-2: cigarette smokers have
mutagenic urine. Proc. Natl Acad. Sci. U.S. A., 74, 3555–3559.
32. Ames, B. N., Mccann, J. and Yamasaki, E. (1975) Methods for detecting
carcinogens and mutagens with the Salmonella/mammalian-microsome
mutagenicity test. Mutat. Res., 31, 347–364.
33. Randerath, K. and Randerath, E. (1993) Postlabelling methods—an his-
torical review. In Phillips, D. H., Castegnaro, M. and Bartsch, H. (eds),
Postlabelling Methods for Detection of DNA Adducts. IARC, Lyon, France,
pp. 3–9.
34. Fenech, M. (1993) The cytokinesis-block micronucleus technique: a
detailed description of the method and its application to genotoxicity stud-
ies in human populations. Mutat. Res., 285, 35–44.
35. Anthosina, M. and Porjadkowa, N. (1978) A technique for differential
staining of sister chromatid without using uorochrome. Cytol. Genet., 4,
349–352.
36. Lamberti, L., Bigatti Ponzetto, P. and Ardito, G. (1983) Cell kinetics and
sister-chromatid-exchange frequency in human lymphocytes. Mutat. Res.,
120, 193–199.
37. To-Figueras, J., Gené, M., Gómez-Catalán, J., Galán, M. C., Fuentes,
M., Ramón, J. M., Rodamilans, M., Huguet, E. and Corbella, J. (1997)
Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) polymorphisms
and lung cancer risk among Northwestern Mediterraneans. Carcinogenesis,
18, 1529–1533.
38. Sachse, C., Brockmöller, J., Bauer, S. and Roots, I. (1997) Cytochrome
P450 2D6 variants in a Caucasian population: allele frequencies and phe-
notypic consequences. Am. J.Hum. Genet., 60, 284–295.
39. Hassett, C., Aicher, L., Sidhu, J. S. and Omiecinski, C. J. (1994) Human
microsomal epoxide hydrolase: genetic polymorphism and functional
expression in vitro of amino acid variants. Hum. Mol. Genet., 3, 421–428.
40. Ali-Osman, F., Akande, O., Antoun, G., Mao, J. X. and Buolamwini, J.
(1997) Molecular cloning, characterization, and expression in Escherichia
coli of full-length cDNAs of three human glutathione S-transferase Pi gene
variants. Evidence for differential catalytic activity of the encoded proteins.
J. Biol. Chem., 272, 10004–10012.
41. Cascorbi, I., Drakoulis, N., Brockmöller, J., Maurer, A., Sperling, K. and
Roots, I. (1995) Arylamine N-acetyltransferase (NAT2) mutations and their
allelic linkage in unrelated Caucasian individuals: correlation with pheno-
typic activity. Am. J.Hum. Genet., 57, 581–592.
42. Matullo, G., Palli, D., Peluso, M., etal. (2001) XRCC1, XRCC3, XPD
gene polymorphisms, smoking and (32)P-DNA adducts in a sample of
healthy subjects. Carcinogenesis, 22, 1437–1445.
43. Yengi, L., Inskip, A., Gilford, J., et al. (1996) Polymorphism at the glu-
tathione S-transferase locus GSTM3: interactions with cytochrome P450
and glutathione S-transferase genotypes as risk factors for multiple cutane-
ous basal cell carcinoma. Cancer Res., 56, 1974–1977.
44. Shen, M. R., Jones, I. M. and Mohrenweiser, H. (1998) Nonconservative
amino acid substitution variants exist at polymorphic frequency in DNA
repair genes in healthy humans. Cancer Res., 58, 604–608.
45. Kuljukka-Rabb, T., Nylund, L., Vaaranrinta, R., Savela, K., Mutanen, P.,
Veidebaum, T., Sorsa, M., Rannug, A. and Peltonen, K. (2002) The effect
of relevant genotypes on PAH exposure-related biomarkers. J. Expo. Anal.
Environ. Epidemiol., 12, 81–91.
46. Rihs, H. P., Pesch, B., Kappler, M., et al. (2005) Occupational exposure
to polycyclic aromatic hydrocarbons in German industries: association
between exogenous exposure and urinary metabolites and its modulation
by enzyme polymorphisms. Toxicol. Lett., 157, 241–255.
47. Moretti, M., Dell’Omo, M., Villarini, M., Pastorelli, R., Muzi, G., Airoldi,
L. and Pasquini, R. (2007) Primary DNA damage and genetic polymor-
phisms for CYP1A1, EPHX and GSTM1 in workers at a graphite electrode
manufacturing plant. BMC Public Health, 7, 270.
48. Pastorelli, R., Cerri, A., Rozio, M., Dell’Omo, M., Muzi, G., Abbritti, G.,
Fanelli, R., and Airoldi, L. (2001) Benzo(a)pyrene diolepoxide adducts to
albumin in workers exposed to polycyclic aromatic hydrocarbons: asso-
ciation with specic CYP1A1, GSTM1, GSTP1 and EHPX genotypes.
Biomarkers, 6, 357–374.
49. Tiemersma, E. W., Omer, R. E., Bunschoten, A., van’t Veer, P., Kok, F. J.,
Idris, M. O., Kadaru, A. M., Fedail, S. S. and Kampman, E. (2001) Role
of genetic polymorphism of glutathione-S-transferase T1 and microso-
mal epoxide hydrolase in aatoxin-associated hepatocellular carcinoma.
Cancer Epidemiol. Biomarkers Prev., 10, 785–791.
50. Wenghoefer, M., Pesch, B., Harth, V., et al. (2003) Association between
head and neck cancer and microsomal epoxide hydrolase genotypes. Arch.
Toxicol., 77, 37–41.
598
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
Genetic polymorphisms, biomarkers, children
51. Au, W. W., Oh, H. Y., Grady, J., Salama, S. A. and Heo, M. Y. (2001)
Usefulness of genetic susceptibility and biomarkers for evaluation of envi-
ronmental health risk. Environ. Mol. Mutagen., 37, 215–225.
52. Omiecinski, C. J., Hassett, C. and Hosagrahara, V. (2000) Epoxide hydro-
lase–polymorphism and role in toxicology. Toxicol. Lett., 112–113,
365–370.
53. Saito, S., Iida, A., Sekine, A., Eguchi, C., Miura, Y. and Nakamura, Y.
(2001) Seventy genetic variations in human microsomal and soluble epox-
ide hydrolase genes (EPHX1 and EPHX2) in the Japanese population. J.
Hum. Genet., 46, 325–329.
54. Dusinska, M., Staruchova, M., Horska, A., Smolkova, B., Collins, A.,
Bonassi, S. and Volkovova, K. (2012) Are glutathione S transferases
involved in DNA damage signalling? Interactions with DNA damage and
repair revealed from molecular epidemiology studies. Mutat. Res., 736,
130–137.
55. Sánchez-Guerra, M., Pelallo-Martínez, N., Díaz-Barriga, F., Rothenberg,
S. J., Hernández-Cadena, L., Faugeron, S., Oropeza-Hernández, L. F.,
Guaderrama-Díaz, M. and Quintanilla-Vega, B. (2012) Environmental
polycyclic aromatic hydrocarbon (PAH) exposure and DNA damage in
Mexican children. Mutat. Res., 742, 66–71.
56. Pavanello, S., Simioli, P., Lupi, S., Gregorio, P. and Clonfero, E.
(2002) Exposure levels and cytochrome P450 1A2 activity, but not
N-acetyltransferase, glutathione S-transferase (GST) M1 and T1, inuence
urinary mutagen excretion in smokers. Cancer Epidemiol. Biomarkers
Prev., 11, 998–1003.
57. Autrup, H. (2000) Genetic polymorphisms in human xenobiotica metabo-
lizing enzymes as susceptibility factors in toxic response. Mutat. Res., 464,
65–76.
58. Viezzer, C., Norppa, H., Clonfero, E., Gabbani, G., Mastrangelo, G.,
Hirvonen, A. and Celotti, L. (1999) Inuence of GSTM1, GSTT1, GSTP1,
and EPHX gene polymorphisms on DNA adduct level and HPRT mutant
frequency in coke-oven workers. Mutat. Res., 431, 259–269.
59. Rojas, M., Cascorbi, I., Alexandrov, K., Kriek, E., Auburtin, G., Mayer, L.,
Kopp-Schneider, A., Roots, I. and Bartsch, H. (2000) Modulation of benzo[a]
pyrene diolepoxide-DNA adduct levels in human white blood cells by
CYP1A1, GSTM1 and GSTT1 polymorphism. Carcinogenesis, 21, 35–41.
60. Pavanello, S., Siwinska, E., Mielzynska, D. and Clonfero, E. (2004) GSTM1
null genotype as a risk factor for anti-BPDE-DNA adduct formation in mon-
onuclear white blood cells of coke-oven workers. Mutat. Res., 558, 53–62.
61. Costa, D. J., Slott, V., Binkova, B., Myers, S. R., and Lewtas, J. (1998) Inuence
of GSTM1 and NAT2 genotypes on the relationship between personal expo-
sure to PAH and biomarkers of internal dose. Biomarkers, 3, 411–424.
62. Butkiewicz, D., Grzybowska, E., Hemminki, K., Ovrebø, S., Haugen, A.,
Motykiewicz, G. and Chorazy, M. (1998) Modulation of DNA adduct lev-
els in human mononuclear white blood cells and granulocytes by CYP1A1
CYP2D6 and GSTM1 genetic polymorphisms. Mutat. Res., 415, 97–108.
63. Wang, S., Chanock, S., Tang, D., Li, Z., Jedrychowski, W. and Perera, F.
P. (2008) Assessment of interactions between PAH exposure and genetic
polymorphisms on PAH-DNA adducts in African American, Dominican,
and Caucasian mothers and newborns. Cancer Epidemiol. Biomarkers
Prev., 17, 405–413.
64. Binková, B., Topinka, J., Mracková, G., etal. (1998) Coke oven workers
study: the effect of exposure and GSTM1 and NAT2 genotypes on DNA
adduct levels in white blood cells and lymphocytes as determined by
32P-postlabelling. Mutat. Res., 416, 67–84.
65. van Delft, J. H., Steenwinkel, M. S., van Asten, J. G., etal. (2001) Biological
monitoring the exposure to polycyclic aromatic hydrocarbons of coke oven
workers in relation to smoking and genetic polymorphisms for GSTM1 and
GSTT1. Ann. Occup. Hyg., 45, 395–408.
66. Teixeira, J. P., Gaspar, J., Martinho, G., Silva, S., Rodrigues, S., Mayan, O.,
Martin, E., Farmer, P. B. and Rueff, J. (2002) Aromatic DNA adduct levels
in coke oven workers: correlation with polymorphisms in genes GSTP1,
GSTM1, GSTT1 and CYP1A1. Mutat. Res., 517, 147–155.
67. Binková, B., Lewtas, J., Mísková, I., etal. (1996) Biomarker studies in
northern Bohemia. Environ. Health Perspect., 104 (Suppl.3), 591–597.
68. Ruchirawat, M., Settachan, D., Navasumrit, P., Tuntawiroon, J. and Autrup,
H. (2007) Assessment of potential cancer risk in children exposed to urban
air pollution in Bangkok, Thailand. Toxicol. Lett., 168, 200–209.
69. Leng, S., Dai, Y., Niu, Y., Pan, Z., Li, X., Cheng, J., He, F. and Zheng,
Y. (2004) Effects of genetic polymorphisms of metabolic enzymes
on cytokinesis-block micronucleus in peripheral blood lymphocyte
among coke-oven workers. Cancer Epidemiol. Biomarkers Prev., 13,
1631–1639.
70. Binkova, B., Chvatalova, I., Lnenickova, Z., Milcova, A., Tulupova, E.,
Farmer, P. B. and Sram, R. J. (2007) PAH-DNA adducts in environmentally
exposed population in relation to metabolic and DNA repair gene polymor-
phisms. Mutat. Res., 620, 49–61.
71. Laffon, B., Pérez-Cadahía, B., Pásaro, E. and Méndez, J. (2003) Effect of
epoxide hydrolase and glutathione S-tranferase genotypes on the induction
of micronuclei and DNA damage by styrene-7,8-oxide in vitro. Mutat. Res.,
536, 49–59.
72. Ramos, D. L., Gaspar, J. F., Pingarilho, M., Gil, O. M., Fernandes, A. S.,
Rueff, J. and Oliveira, N. G. (2011) Genotoxic effects of doxorubicin in
cultured human lymphocytes with different glutathione S-transferase geno-
types. Mutat. Res., 724, 28–34.
73. Moraes, M. C., Neto, J. B. and Menck, C. F. (2012) DNA repair mech-
anisms protect our genome from carcinogenesis. Front. Biosci., 17,
1362–1388.
74. Marsin, S., Vidal, A. E., Sossou, M., Ménissier-de Murcia, J., Le
Page, F., Boiteux, S., de Murcia, G. and Radicella, J. P. (2003) Role of
XRCC1 in the coordination and stimulation of oxidative DNA damage
repair initiated by the DNA glycosylase hOGG1. J. Biol. Chem., 278,
44068–44074.
75. Mohrenweiser, H. W., Wilson, D. M. III and Jones, I. M. (2003) Challenges
and complexities in estimating both the functional impact and the disease
risk associated with the extensive genetic variation in human DNA repair
genes. Mutat. Res., 526, 93–125.
76. Lunn, R. M., Helzlsouer, K. J., Parshad, R., Umbach, D. M., Harris, E.
L., Sanford, K. K. and Bell, D. A. (2000) XPD polymorphisms: effects on
DNA repair prociency. Carcinogenesis, 21, 551–555.
77. Kazimírová, A., Barancoková, M., Dzupinková, Z., Wsólová, L. and
Dusinská, M. (2009) Micronuclei and chromosomal aberrations, impor-
tant markers of ageing: possible association with XPC and XPD polymor-
phisms. Mutat. Res., 661, 35–40.
78. Palli, D., Russo, A., Masala, G., Saieva, C., Guarrera, S., Carturan, S.,
Munnia, A., Matullo, G. and Peluso, M. (2001) DNA adduct levels and
DNA repair polymorphisms in trafc-exposed workers and a general popu-
lation sample. Int. J.Cancer, 94, 121–127.
79. Zijno, A., Verdina, A., Galati, R., Leopardi, P., Marcon, F., Andreoli, C.,
Rossi, S. and Crebelli, R. (2006) Inuence of DNA repair polymorphisms
on biomarkers of genotoxic damage in peripheral lymphocytes of healthy
subjects. Mutat. Res., 600, 184–192.
80. Pérez-Cadahía, B., Laffon, B., Valdiglesias, V., Pásaro, E. and Méndez,
J. (2008) Cytogenetic effects induced by Prestige oil on human popula-
tions: the role of polymorphisms in genes involved in metabolism and DNA
repair. Mutat. Res., 653, 117–123.
81. Taylor, E. M., Broughton, B. C., Botta, E., etal. (1997) Xeroderma pig-
mentosum and trichothiodystrophy are associated with different mutations
in the XPD (ERCC2) repair/transcription gene. Proc. Natl Acad. Sci. U.S.
A., 94, 8658–8663.
82. O’Driscoll, M. and Jeggo, P. A. (2006) The role of double-strand break
repair—insights from human genetics. Nat. Rev. Genet., 7, 45–54.
83. Duell, E. J., Wiencke, J., Cheng, T-J., et al. (2000) Polymorphisms in the
DNA repair genes XRCC1 and ERCC2 and biomarkers of DNA damage in
human blood mononuclear cells. Carcinogenesis, 21, 965–971.
84. Lei, Y. C., Hwang, S. J., Chang, C. C., Kuo, H. W., Luo, J. C., Chang, M. J.
and Cheng, T. J. (2002) Effects on sister chromatid exchange frequency of
polymorphisms in DNA repair gene XRCC1 in smokers. Mutat. Res., 519,
93–101.
85. Tuimala, J., Szekely, G., Wikman, H., Järventaus, H., Hirvonen, A., Gundy,
S. and Norppa, H. (2004) Genetic polymorphisms of DNA repair and
xenobiotic-metabolizing enzymes: effects on levels of sister chromatid
exchanges and chromosomal aberrations. Mutat. Res., 554, 319–333.
86. van Leeuwen, D. M., Pedersen, M., Hendriksen, P. J., et al. (2008)
Genomic analysis suggests higher susceptibility of children to air pollu-
tion. Carcinogenesis, 29, 977–983.
599
by guest on August 19, 2013http://mutage.oxfordjournals.org/Downloaded from
