Content uploaded by Jian Zhang
Author content
All content in this area was uploaded by Jian Zhang on Feb 07, 2022
Content may be subject to copyright.
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
1 of 17
MUCOSAL IMMUNOLOGY
Epithelial Gasdermin D shapes the host-microbial
interface by driving mucus layer formation
Jian Zhang1, Qianzhou Yu1, Danlu Jiang1, Kang Yu2, Weiwei Yu1, Zhexu Chi1, Sheng Chen1,3,
Mobai Li1, Dehang Yang1, Zhen Wang1, Ting Xu1, Xingchen Guo1, Kailian Zhang1, Hui Fang1,
Qizhen Ye1, Yong He2, Xue Zhang4, Di Wang1*
Goblet cells and their main secretory product, mucus, play crucial roles in orchestrating the colonic host-microbe
interactions that help maintain gut homeostasis. However, the precise intracellular machinery underlying this
goblet cell–induced mucus secretion remains poorly understood. Gasdermin D (GSDMD) is a recently identified
pore-forming effector protein that causes pyroptosis, a lytic proinflammatory type of cell death occurring during
various pathophysiological conditions. Here, we reveal an unexpected function of GSDMD in goblet cell mucin secr etion
and mucus layer formation. Specific deletion of Gsdmd in intestinal epithelial cells (IEC) led to abrogated mucus
secretion with a concomitant loss of the mucus layer. This impaired colonic mucus layer in GsdmdIEC mice featured a
disturbed host-microbial interface and inefficient clearance of enteric pathogens from the mucosal surface. Mecha-
nistically, stimulation of goblet cells activates caspases to process GSDMD via reactive oxygen species production; in
turn, this activated GSDMD drives mucin secretion through calcium ion–dependent scinderin-mediated cortical
F-actin disassembly, which is a key step in granule exocytosis. This study links epithelial GSDMD to the secretory gra nule
exocytotic pathway and highlights its physiological nonpyroptotic role in shaping mucosal homeostasis in the gut.
INTRODUCTION
Gasdermin D (GSDMD) is a recently identified pore-forming effec-
tor protein that causes membrane permeabilization and pyroptosis
(1). In macrophages, multiprotein cytosolic inflammasome complexes
sense the presence of pathogens and activate caspase-1 and/or
caspase-11, leading to GSDMD-dependent pyroptosis and matura-
tion of the inflammatory cytokines interleukin-1 (IL-1) and IL-18.
Cleavage of GSDMD removes the inhibitory GSDMD-C domain and
triggers the oligomerization and lipid binding by its GSDMD-N
domain to assemble membrane pores, which is also necessary for
the rapid release of IL-1 and IL-18 (2–4). However, it was recently
found that different cell types or populations appear to have variable
resistance to GSDMD pore-mediated cell death (5–9). For example,
hyperactive macrophages or neutrophils can be stimulated to release
IL-1 while maintaining viability (5,10). GSDMD is also expressed
in many healthy tissues without evident pyroptosis and inflamma-
tion such as the gastrointestinal tract (11), highlighting distinct cell
fates and potential physiological functions associated with GSDMD
activity that can be regulated in the steady state.
An enormous surface area of mucosal epithelial cells in the
gastrointestinal tract is potentially exposed to enteric microorganisms.
To protect the mucosa from microbial and pathogen invasion, the
host produces a complex layer of mucus covering the entire intesti-
nal tract. There is a two-layered mucus system in the colon where
the inner mucus layer is stratified as a filter that physically separates
the bacteria from the epithelium, whereas the outer loose mucus
layer is penetrable to bacteria and serves as their habitat (12,13).
The mucus layer is produced by goblet cells, specialized secretory
cells that produce and secrete mucins (mainly Muc2) into the intes-
tinal lumen (13–17). Muc2 polymers are densely packed in the
regulated secretory vesicles and then stored within a highly orga-
nized cytoskeletal cage called the theca, which is responsible for the
classical goblet cell morphology and separates mucin granules from
the rest of the cytoplasm (13,15,16,18). In the absence of Muc2, there
is no mucus, and bacteria are in direct contact with the epithelium
(12); this results in spontaneous inflammation similar to that found
in ulcerative colitis and, in the long term, can lead to colorectal cancer
(19,20). Mice deficient in Muc2 also develop severe, life-threatening
disease when infected with the attaching and effacing (A/E) patho-
gen Citrobacter rodentium (21,22). Although the critical roles of
goblet cells and mucus have been appreciated for decades, the regu-
latory mechanisms underlying mucus layer formation have only
been investigated recently and remain largely unknown.
In this study, we identified GSDMD as a critical player in colonic
segregation between bacteria and epithelium for gut homeostasis
by driving goblet cell–mediated mucus layer formation. Deletion of
GSDMD in epithelial cells led to bacterial attachment to the epithe-
lium in the steady-state colon and increased susceptibility to enteric
infection. Unexpectedly, this physiological function of GSDMD
relies on its regulation of cortical actin cytoskeleton disassembly
during mucin granule exocytosis, which extends our understanding
of GSDMD as an orchestrator during exocytosis in addition to
executing pyroptotic cell death.
RESULTS
Intestinal epithelial GSDMD is required for
mucus layer formation
To explore possible links between GSDMD function and gut homeo-
stasis, we first isolated RNA prepared from colonic epithelium and
sorted colonic CD45+ hematopoietic cells. A much higher level of
Gsdmd mRNA in the epithelial compartment than that in the
hematopoietic compartment was found (Fig.1A). NOD-like recep-
tor family pyrin domain containing 6 (NLRP6), a member of the
1Institute of Immunology and Sir Run Run Shaw Hospital, Zhejiang University
School of Medicine, Hangzhou 310058, P. R. China. 2State Key Laboratory of Fluid
Power and Mechatronic Systems, School of Mechanical Engineering, Zhejiang Uni-
versity, Hangzhou 310058, P. R. China. 3Department of Colorectal Surgery of the
Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou
310058, P. R. China. 4Department of Pathology and Pathophysiology, Zhejiang
University School of Medicine, Hangzhou 310058, P. R. China.
*Corresponding author. Email: diwang@zju.edu.cn
Copyright © 2022
The Authors, some
rights reserved;
exclusive licensee
American Association
for the Advancement
of Science. No claim
to original U.S.
Government Works
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
2 of 17
nucleotide- binding oligomerization domain–like receptor family
that forms an inflammasome and plays critical roles in intestinal
homeostasis (23), similarly showed a higher expression in the
epithelial compartment, but the adaptor protein Apoptosis associ-
ated s peck-like protein containing a CARD (ASC) showed comparable
mRNA expression in both compartments (Fig.1A). We next detected
the protein level of GSDMD in distal colonic tissues by immunohis-
tochemistry with an anti-mGSDMD (mouse derived GSDMD protein)
antibody that recognizes both full-length and cleaved mGSDMD-N. A
robust anti-mGSDMD signal was detected throughout the colonic
muco sa, and the most concentrated staining appeared in the apical mu-
cosal and upper crypt regions (Fig.1B). Immunofluorescence stain-
ing further revealed that GSDMD expression was specifically seen
surrounding areas containing mature Muc2 granules in goblet cells
(Fig.1C). In normal human colon sections, we used a specific
anti-cleaved human derived N-terminal GSDMD (hGSDMD- N)
antibody that only recognizes the hGSDMD-N fragment but not the
full-length hGSDMD and hGSDMD-C (24) and found that cleaved
hGSDMD-N similarly appeared in epithelial cells with goblet cell
morphology (Fig.1D). The NLRP6 inflammasome has been re-
cently recognized as a key player that shapes colonic homeostasis
and the host-microbial interface by multiple mechanisms including the
regulation of mucus production (23, 25). Upon stimulation, NLRP6
was reported to recruit ASC, caspase-1, and possibly caspase-11 to
form the inflammasome complex (26,27). The cleavage of GSDMD
was abolished in the colonic tissues from Nlrp6−/−, Asc−/−, Casp1−/−,
and Casp11−/− mice but not Nlrp3−/− mice (Fig.1E and fig. S1A). We
also demonstrated that the gut microbiota was important for both
GSDMD expression and activation, as its absence in germ-free mice
resulted in decreased full-length GSDMD and its cleavage (Fig.1F).
These results suggest that the commensal microbiota and NLRP6 in-
flammasome signaling are critical for GSDMD activation in the gut.
Goblet cells are largely responsible for secreting mucus compo-
nents to form and maintain the mucus layers (13,17). To investigate
the function of epithelial GSDMD in the gut, in addition to mice with
complete GSDMD deletion (Gsdmd−/−), we conditionally deleted
Gsdmd in intestinal epithelial cells by generating Villin-cre+;Gsdmdf/f
(GsdmdIEC) mice. To minimize the alterations in gut microbiota,
we used cohoused wild-type (WT) and floxed WT littermates as
controls. In contrast to the complete absence in Gsdmd−/− mice,
Gsdmd mRNA in the hematopoietic compartment and staining
of GSDMD protein in lamina propria hematopoietic cells remained
largely intact in GsdmdIEC mice (Fig.1,G and H), suggesting its
specific deletion in the epithelium. Gsdmd−/− and GsdmdIEC mice
did not show gross structural or cellular irregularities as determined
by measurements of colon length, crypt number, crypt length, and
crypt width (fig. S1, B and C), as well as staining for several markers
indicating the functions of different epithelial cell subtypes (fig. S1,
D to F). Because no significant phenotypic differences including the
intestinal structure, GSDMD staining, and mucus layer presence in
distal colon sections were observed between Gsdmd+/+ and Gsdmdf/f
controls (fig. S1, G and H), we thus subsequently only showed Gsdmdf/f
controls in certain comparisons for a simpler presentation. When
we stained mucin with periodic acid–Schiff/Alcian blue (PAS/AB)
and Carnoy’s fixative to preserve the mucus layer (12), both Gsdmd−/−
and GsdmdIEC mice featured a loss of the thick continuous overlaying
inner mucus layer in the distal colon compared with controls
(Fig.1,I andJ). The Gsdmd−/− and GsdmdIEC mice contained
comparable numbers but larger goblet cells compared with controls
(Fig.1J). Consistently, staining of the inner mucus layer with anti-
Muc2 antibody by either immunohistochemistry or immuno-
fluorescence revealed a similar lack of the intact mucus layer in
Gsdmd−/− and GsdmdIEC mice (Fig.1,K and L). We also found
comparable mRNA levels of several key regulators of goblet cell dif-
ferentiation including Klf5, Foxa1, Foxa2, Spdef, and Cftr (13,15,17),
as well as the goblet cell–specific genes Muc1, Muc2, Muc3, Muc4,
and trefoil factor 3 (Tff3) (fig. S1, I and J), suggesting that the defi-
ciency in mucus layer is not due to either blocked differentiation of
goblet cells or reduced transcript production of mucins. Collectively,
these results indicate that epithelial GSDMD is crucial for colonic
mucus layer formation and mucosal integrity.
GSDMD drives goblet cell mucus granule secretion
and configures the host-microbial interface in the
steady-state colon
To assess whether the abolished colonic mucus layer is associated with
goblet cell dysfunction, we first used scanning electron microscopy
and observed many protruding granules in the colonic epithelium
from Gsdmd−/− and GsdmdIEC mice but not in control mice
(Fig.2A). Using transmission electron microscopy, the mucin gran-
ules within the theca were found to fuse and empty their content
into the intestinal lumen when they reached the apical surface of the
epithelium in WT mice, but this membrane fusion process was
markedly blocked in Gsdmd−/− and GsdmdIEC mice, as evidenced
by the protruding mucin granules featuring intact membranes that
hardly fused with or emptied into the lumen (Fig. 2B). We also
found intact membrane-bound structures with multiple unfused
granules present inside the lumen (Fig.2B), possibly removed from
the epithelial surface by the shearing force of fecal matter passing
through the colon (25). The colonic epithelium from Asc−/−,
Casp1−/−, and Casp11−/− mice, but not Nlrp3−/− mice, phenocopied
that from Gsdmd−/− and GsdmdIEC mice regarding the protruding
mucin granules (fig. S1K). When we measured the levels of secreted
inflammatory cytokines in colon explant supernatants, the secretion
of IL-1, IL-6, and IL-18 was largely unaffected in the absence of
epithelial GSDMD (fig. S1L). In addition, we did not find an abnor-
mal appearance of mucin granules in the colonic epithelium from
Il18−/− and Il1r1−/− mice (fig. S1M). Although littermate controls
were strictly used and the normalization of the intestinal microbiota
in the cohoused environments was confirmed by 16S ribosomal
DNA (rDNA) gene sequencing (fig. S2, A to D), we further cohoused
WT mice purchased from a commercial vendor with GsdmdIEC mice
to induce microbiota transfer into the cohoused WT mice (28). Same
as the singly housed WT mice, the cohoused WT mice showed few
protruding mucin granules that persisted in the cohoused GsdmdIEC
mice (fig. S2I), ruling out a significant contribution of microbiota to this
GSDMD-mediated mucus secretion by goblet cells. We next assessed
whether GSDMD deficiency led to changed cell death in the steady-
state colon. The TUNEL (terminal deoxynucleotidyl transferase–
mediated deoxyuridine triphosphate nick end labeling) assay found
that the number of dying cells in the colon was not significantly
changed in GsdmdIEC mice (fig. S3, A and B). A propidium iodide
(PI) injection and staining assay were recently reported to measure
cell pyroptosis invivo (29). In a sepsis model, we found significantly
increased PI-positive pyroptotic cells in the lungs and spleens
upon lipopolysaccharide (LPS) challenge that were diminished in
Gsdmd−/− mice (fig. S3, C and D). However, few PI-positive cells
were detected in the colons, and no difference between WT and
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
3 of 17
Fig. 1. Intestinal epithelial GSDMD is required for mucus layer formation. (A) Reverse transcription qPCR (RT-qPCR) analysis of Gsdmd mRNA levels in sorted colonic
epithelia (CD45−CD11b−CD3−B220−EpCAM+) and hematopoietic (EpCAM−CD45+CD11b+) cells. Villin and Ptprc are markers for epithelial and hematopoietic cells, respectively.
Data were analyzed using two-tailed Student’s t test and expressed as the means ± SEM (n = 3 mice per group). *P < 0.05 and **P < 0.01. (B) Immunohistochemical analysis
of GSDMD protein expression in the distal colon of mice with anti-mGSDMD antibody (recognizing full-length and cleaved mGSDMD-N). Magnification, ×40 and ×100.
Scale bar, 20 m. (C) Immunofluorescence analysis of GSDMD and MUC2 protein expression in the distal colon of mice. Magnification, ×100. Scale bar, 20 m. (D) Immuno-
histochemical analysis of GSDMD protein expression in three human colonic samples of paracancerous tissues with anti–hGSDMD-N antibody (recognizing hGSDMD-N
fragment only). Magnification, ×40 and ×100. Scale bar, 20 m. (E and F) Immunoblots of GSDMD protein cleavage in the distal colon from (E) Gsdmd+/+, Gsdmd−/−,
Nlrp6−/−, Casp1−/−, Casp11−/− and Asc−/−mice, and (F) specific pathogen–free (SPF) and germ-free WT mice (from the same source). (G) Immunohistochemical analysis of
GSDMD expression in the distal colon of Gsdmd−/− mice, intestinal epithelial cell conditional Gsdmd knockout mice (GsdmdIEC) and cohoused floxed WT littermates
(Gsdmdf/f). Magnification, ×40. Scale bar, 50 m. (H) RT-qPCR analysis of Gsdmd gene deletion efficiency in GsdmdIEC colonic epithelial cells. Villin and Ptprc are markers
for epithelial and hematopoietic cells, respectively. Data were analyzed using two-tailed Student’s t test and expressed as the means ± SEM (n = 3 mice per group). **P < 0.01
and ***P < 0.001. NS, not significant. (I and K) Distal colon sections from Gsdmdf/f, Gsdmd−/−, and GsdmdIEC mice stained with PAS/AB (I) and anti-Muc2 antibody (K) featured
a loss of the thick continuous inner layer in Gsdmd−/− and GsdmdIEC mice compared with controls. Magnification, ×40. Scale bars, 50 m. (J) Quantification of inner mucus
layer thickness in Gsdmd+/+, Gsdmdf/f, Gsdmd−/−, and GsdmdIEC mice. This inner mucus layer is absent from Gsdmd−/− and GsdmdIEC mice (n = 9 mice per group). Number
of goblet cells per crypt showed comparable values in Gsdmdf/f (n = 6 mice, 45 sections), Gsdmd −/− (n = 6 mice, 90 sections), and GsdmdIEC (n = 6 mice, 43 sections) mice,
but a greater area per goblet cell was present in Gsdmd−/− (n = 6 mice, 250 cells) and GsdmdIEC (n = 6 mice, 256 cells) mice than in controls (n = 6 mice, 256 cells). Data were
analyzed using one-way ANOVA and expressed as the means ± SEM. ****P < 0.0001. n.d., not determined. (L) Immunofluorescence of the inner mucus layer stained with
anti-Muc2 antibody in Gsdmd−/− and GsdmdIEC mice. Magnification, ×20 and ×40. Scale bars, 50 and 20 m.
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
4 of 17
Fig. 2. Epithelial GSDMD is required for goblet cell mucus granule secretion and configures the host-microbial interface in the steady-state colon. (A) Representative
scanning electron microscopy images of the distal colon of Gsdmdf/f, Gsdmd−/−, and GsdmdIEC mice. Goblet cells with mucus granules in great numbers protrude into the
lumen were seen in Gsdmd−/− and GsdmdIEC mice. Each experiment was repeated three times; n = 3 mice per group. (B) Transmission electron microscopy images of
goblet cells of Gsdmdf/f, Gsdmd−/−, and GsdmdIEC mice. Mucin granules are blocked at the apical surface (b′), and granules with intact membranes in the lumen only occur
in Gsdmd−/− and GsdmdIEC mice (b″). Each experiment was repeated three times; n = 3 mice per group. (C) Representative scanning electron microscopy images of
colonic bacteria on the colonic epithelial surface showing remarkable bacterial translocation to colonic epithelium in Gsdmd−/− and GsdmdIEC mice but scattered bacteria in
Gsdmd+/+ and Gsdmdf/f mice. Each experiment was repeated three times; n = 3 mice per group. (D) Quantification of the number of bacteria attached to the colonic
epithelium using 16S rDNA gene qPCR in Gsdmd−/− and GsdmdIEC mice. Data were analyzed using one-way ANOVA and expressed as the means ± SEM; n = 9 mice per
group. **P < 0.01 and ***P < 0.001. (E) FISH (EUB338) combined with immunofluorescence imaging (anti-Muc2 antibody) analysis of the distal colon sections showed
colonic bacteria invading into crypts (arrowheads) in Gsdmd−/− and GsdmdIEC mice, although commensal microbiota are separated from the epithelium. Each experiment
was repeated three times; n = 3 mice per group. Magnification, ×20 and ×40. Scale bars, 50 and 20 m. (F) Schematic of colonic epithelial cells sorting and quantitative
proteomics analysis. Epithelial cells (CD45−CD11b−CD3e−B220−EpCAM+) of Gsdmd+/+ and Gsdmd−/− mice were sorted and analyzed by tandem mass tag (TMT)-labeled
quantitative proteomics. (G) Volcano plots of the host defense–related proteins expression in colonic epithelial cells from Gsdmd+/+ and Gsdmd−/− mice. The proteins
critical for mucosal defense are labeled.
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
5 of 17
Gsdmd−/− mice was found (fig. S3, C and D). Together, these results sug-
gest that epithelial GSDMD drives goblet cell mucus secretion largely
uncoupled from inflammatory cytokines, microbiota, and cell death.
The mucus layer provides the spatial separation of the colonic
commensal microbiota and the epithelium to preserve a near-sterile
epithelium and maintain intestinal homeostasis (13,16,17). Using
scanning electron microscopy, we observed a remarkable increase in
bacterial attachment to the colonic epithelial surface in Gsdmd−/− and
GsdmdIEC mice compared with WT controls, respectively (Fig.2C),
which was further confirmed by 16S rDNA gene quantitative poly-
merase chain reaction (qPCR) analysis (Fig.2D). Using fluorescence
in situ hybridization (FISH) with EUB338, a universal 16S rRNA
probe, we found colonic bacteria in the crypts of Gsdmd−/− and
GsdmdIEC mice, although these regions were usually free of bacterial
invasion in WT controls (Fig.2E). Besides this remarkable change in
spatial distribution, epithelial GSDMD deficiency also led to compo-
sitional changes in the intestinal microbiota (fig. S2, A, B, and E). We
identified four significant operational taxonomic units that had a re-
markable change between Gsdmdf/f and GsdmdIEC mice, including
families Prevotellaceae, Helicobacteraceae, and Akkermansiaceae
(fig. S2, F to H). In response to this changed host- microbial interface,
the quantitative proteomics analysis of colonic epithelial cells (Fig.2F)
showed that the most up-regulated protein associated with GSDMD
deficiency was the antimicrobial peptide (AMP) RegIII (Fig.2G),
suggesting a compensatory induction of AMP-mediated spatial segre-
gation between the epithelium and commensal bacteria (30,31). The
levels of other defense proteins including serum amyloid A1 (SAA1)
(32,33), deleted in malignant brain tumors 1 (DMBT1) (34,35),
Cathepsin B (CTSB) (36,37), and A Short-Type Peptidoglycan Recogni-
tion Protein 1 (PGRP1) (38) were also increased (Fig.2G), together
indicating an enhanced defensive response by epithelial cells when
the GSDMD- mediated mucus layer formation is impaired.
Bacterial signals induce mucus production dependently
on epithelial GSDMD
It has been suggested that the intestinal microbiota plays critical
roles in shaping the mucosal defense system including the mucus
layer (39,40). To examine whether certain bacterial signals could
induce mucus secretion through epithelial GSDMD, we developed
an exvivo colonic organ culture system by three-dimensional (3D)
printing (Fig.3A and fig. S9) based on a previous study (41) that viably
preserves the normal multicellular composition of the mouse colon
with luminal flow containing different treatments (Fig.3,AandB).
To examine the intact inner mucus layer in the colon, we performed
colonic tissue imaging with an ultrafast optical clearing method
(FOCM) that allows 300-m-thick tissues to be quickly clarified by
a nontoxic tissue clearing method with little morphological distortion
and fluorescence quenching (Fig.3A) (42). Using mucus staining
with the lectin Ulex europaeus agglutinin I (UEA-I), the impaired
mucus layer in GsdmdIEC colons was recapitulated by deep tissue
imaging (fig. S4, A and B). We found that LPS stimulated potent mu-
cus growth in WT colons, which was abolished by epithelial GSDMD
deficiency or necrosulfonamide (NSA; an inhibitor of GSDMD-N
oligomerization) (fig. S4, A and B), indicating the critical role of
epithelial GSDMD in LPS-induced mucus production. We detected
little lactate dehydrogenase (LDH) release and few PI-positive cells,
and no difference was found among all groups (fig. S4, C to E).
To further examine the effects of bacterial signals on mucus
production, we treated mice with antibiotics in vivo to acquire
bacteria-free colons that showed a significant decrease in mucus
layer (Fig.3,BtoD). We applied these colons to the exvivo culture
system in the presence of several typical bacterial molecules and
strains (Fig.3B). Besides LPS, the intestinal typical symbiotic bacteria
Bacteroides fragilis (Gram negative) also restored the mucus layer in
the bacteria-free colons (Fig.3,C and D). In contrast, the Gram-
positive component lipoteichoic acid (LTA) and probiotic strain
Bifidobacterium bifidum (Gram positive) showed less effect on
mucus growth (Fig.3,CandD). Taurine, as a microbiota-modulated
metabolite, was reported to activate intestinal NLRP6 signaling by
acting as a “signal II” in the presence of “signal I” such as Toll-like
receptor (TLR) ligands (27). P3CSK4 and taurine also led to a potent
induction of mucus growth (Fig.3,CandD). During these processes,
GSDMD activation was detected correlating with the induction of
mucus secretion (fig. S4F). In the absence of epithelial GSDMD, all
these bacterial signal-induced mucus secretions were abolished
(Fig.3,CandD). These remarkable changes in mucus growth were
uncoupled from altered pyroptosis or inflammatory cytokines (Fig.3E
and fig. S4, G and H), further suggesting a goblet cell intrinsic function
of GSDMD in regulating mucus secretion upon microbial signals.
Epithelial GSDMD deficiency renders mice more susceptible
to enteric pathogen infection
The colonic mucus layer is an efficient physical barrier to not only
commensal bacteria but also enteric pathogens such as the A/E
Escherichia coli–like pathogen C. rodentium (16,21). We infected
GsdmdIEC mice with a luciferase-expressing C. rodentium variant
that allows for noninvasive invivo bioluminescent monitoring of
bacterial growth (43). As previously reported (22), C. rodentium
was found to substantially colonize the colon by day 4 post-infection
(p.i.), with the number of bacteria peaking at day 8 p.i.. By day 12 p.i.,
the number began to drop, and the infection was essentially cleared
by day 14 p.i. (Fig.4A). In contrast, at days 12 and 14 p.i., we found
enhanced C. rodentium colonization in GsdmdIEC mice compared
with WT controls (Fig.4,AandB, and fig. S5A) as well as increased
colonic and systemic pathogen colonization (Fig.4,CandE),
suggesting that epithelial GSDMD deficiency impairs the host-
mediated clearance of A/E pathogens. Using anti-luciferase antibody,
we found that C. rodentium was more invasive and penetrated
deeper into the colonic crypts in GsdmdIEC mice, which was less
seen in WT mice (Fig.4D). GsdmdIEC mice also featured increased
crypt length, which indicates the pathological severity at day 14 p.i.
(Fig.4,FandG). The increased C. rodentium burden and pathology
in GsdmdIEC mice were not accompanied by changed levels of
inflammatory cytokines and AMPs (fig. S5, B and C). Moreover,
epithelial GSDMD deficiency led to unchanged PI-positive cells in
the distal colon at day 14 p.i. (fig. S5, D to F). Consistent with the
self-limiting nature of C. rodentium infection by which a self-resolving
inflammatory response eventually clears the infection (44), we
found GsdmdIEC mice to eventually clear the infection with a
1-week delay (fig. S5G). Therefore, the impaired mucosal defense
against enteric A/E pathogen is predominantly contributed by the
impaired mucus layer due to epithelial GSDMD deficiency.
Epithelial GSDMD mediates mucin granule exocytosis by
goblet cells
Using deep tissue imaging combined with UEA-I staining, the
mucus layer in GsdmdIEC mice was found markedly thinner and
more dispersed (Fig.5,AandB). A considerable amount of mucus
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
6 of 17
was retained beneath the apical surface of epithelial cells (Fig.5A).
In contrast to the mucus layer composed of secreted mucins in WT
mice, epithelial GSDMD deficiency resulted in remarkably blocked
fusion of the secretory vesicles containing mucins with the
epithelial surface (Fig.5C), suggesting that GSDMD regulates the
mucin granule secretory pathway in goblet cells. Gene Ontology
analysis of the quantitative proteomics data from colonic epithelial
cells revealed that a substantial proportion of enriched “cellular
Fig. 3. Epithelial GSDMD promotes
intestinal mucus secretion by bac-
terial signals in an ex vivo colonic
organ culture system. (A) Schematic
of ex vivo gut culture system and mucus
layer formation analysis. Terminal co-
lonic fragment was extensively washe d
using a syringe to remove lumen con-
tent and original mucus layer and
connected to input and output of the
chamber and contact with the internal
culture medium fluid (left). The colonic
fragments, cultured for 1 or 6 hours,
were then optically cleared with
FOCM and visualized with 3D scan-
ning, combined with 3D reconstruc-
tion, to analyze mucus layer formation
(right). (B) Schematic of mice anti-
biotic treatment and stimulus treat-
ment in the Ex-vivo culture system in
(C). Gsdmdf/f and GsdmdIEC mice were
pretreated with or without broad-
spectrum antibiotics included a com-
bination of vancomycin (0.5 g/liter),
ampicillin (1 g/liter), kanamycin (1 g/lit er),
and metronidazole (1 g/liter) in the
drinking water for 2 weeks. (C) 3D
reconstruction of distal colonic tissues
with UEA-I (red, for mucus layer) and
DAPI (blue, for nucleus) stained. The
3D images obtained by 3D scanning
(first and third rows) were reconstructed
by IMARS software, and UEA-I fluoresce nce
signals above the epithelial were ob-
tained as the mucus layer (second and
fourth rows). Ex vivo cultured colonic
tissues that were treated with LPS
(200 g/ml) and P3CSK4 (50 g/ml)
combined with taurine (10 g/ml) for
60 min or B. fragilis (ATCC25285; 5 ×
106 CFU/ml) for 6 hours showed a sig-
nificant increasement of thickness of
mucus layer in Gsdmdf/f mice but no sig-
nificant changes in GsdmdIEC mice. LTA
(200 g/ml) or B. bifidum (DSM20082;
5 × 106 CFU/ml) treatments had a weak
stimulating effect of mucus secretion.
Results are representative of two in-
dependent experiments. Scale bars,
50 m. (D) Quantification of thickness
of reconstructed inner mucus layer
in Gsdmdf/f mice and GsdmdIEC mice;
n = 2 mice per group. Data were ana-
lyzed using two-tailed Student’s t test
and expressed as the means ± SEM.
*P < 0.05, **P < 0.01, ***P < 0.001, a nd
****P < 0.0001. (E) Percentages of cells
with LDH release. Under each experimental condition, six different colonic tissue cultures were examined. Data were analyzed using two-tailed Student’s t test
and express ed as the means ± SEM.
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
7 of 17
component” terms were closely associated with vesicle trafficking
and exocytosis (Fig.5D). Mucin granule secretion is highly regulated
via (i) granule transport to the apical membrane, (ii) actin filament
(F-actin) disassembly and remodeling, and (iii) granule tethering
and fusion with the membrane (16,18, 45,46). To assess which
stage was primarily affected in the absence of GSDMD, we analyzed
the expression of 615 annotated vesicle-related proteins with the
quantitative proteomics data and found the two most decreased
exocytotic regulators including scinderin (a Ca2+-activated, F-actin–
severing protein essential for cortical F-actin disassembly and
Fig. 4. Epithelial GSDMD is required for clearance of C. rodentium infection. (A and B) Time-course quantification (A) and representative images (B) on day 14 p.i. of
in vivo whole-body bioluminescence imaging showed enhanced C. rodentium signal colonization in GsdmdIEC mice. Data were analyzed using two-tailed Student’s t test
and expressed as the means ± SEM; n = 9 mice per group. **P < 0.01. (C) Bacterial plating reveals increased colonic and systemic pathogen colonization in GsdmdIEC mice
(n = 9 mice per group) than in Gsdmdf/f (n = 10 mice per group). Data were analyzed using two-tailed Student’s t test and expressed as the means ± SEM. **P < 0.01 and ***P < 0.001. m LN,
mesenteric lymph node. (D) Immunofluorescence analysis of distal colon sections on day 14 p.i. with anti-luciferase antibody. Each explement was repeated twice; n = 4 mice
per group. Magnification, ×40. Scale bars, 20 m. (E) Quantification of the number of C. rodentium attached to the colonic epithelium using 16S rDNA gene qPCR. Data
were analyzed using one-way ANOVA and expressed as the means ± SEM; n = 3 mice per group. ****P < 0.0001. (F) Hematoxylin and eosin–stained distal colonic sections
on day 14 p.i.. Magnification, ×10 and ×20. Scale bars, 200 and 100 m. (G) Quantification of length of the crypts on day 14 p.i. in Gsdmdf/f and GsdmdIEC mice (n = 9 mice
per group; at least 194 crypts per group). Data were analyzed using two-tailed Student’s t test and expressed as the means ± SEM; n = 9 mice per group. ****P < 0.0001.
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
8 of 17
Fig. 5. Epithelial GSDMD mediates mucin granule exocytosis by goblet cells. (A) 3D reconstruction of distal colonic tissues with UEA-I (red) and phalloidin (green)
staining. Dotted line showed the interface between epithelial cells and the mucus layer. Results are representative of three independent experiments. Scale bar, 40 and
50 m. (B) Quantification of number, area, volume, and sphericity of reconstructed inner mucus layer in Gsdmdf/f and GsdmdIEC mice. Data were analyzed using two-tailed
Student’s t test and expressed as the means ± SEM. ****P < 0.0001. (C) Representative images arranged in a sequence along the Y axis showing a continuous inner mucus
layer in Gsdmdf/f mice (dotted lines) and blocked fusion of the secretory vesicles with the epithelial surface (arrowheads). Scale bar, 50 m. (D) Gene Ontology analysis of up-regulate d
and down-regulated cellular components terms. The results are presented as a bar chart; X axis, fold enrichment. The P value and number of genes involved in each term
were labeled as color change and aside, respectively. (E) Volcano plots of 615 proteins from the vesicle term of Gene Ontology analysis in (D). A P < 0.05 was used as a
threshold to determine the significance of differentially expressed proteins. Ratios of >1.3 and <0.5 were used as thresholds to determine the significantly up-regulated
and down-regulated proteins. The two proteins critical for mucus granules exocytosis are labeled. KO, knockout. (F) Schematic of mucus granule exocytosis. Proteins
involved in exocytosis are labeled. Heatmap of genes relative to Gapdh expression by RT-qPCR in distal colon tissue from Gsdmdf/f and GsdmdIEC mice; n = 5 mice per
group. Data were generated using Prism 8.2.0. (G) Immunohistochemical analysis of MARCKS and scinderin expression in distal colonic tissue from GsdmdIEC mice and
Gsdmdf/f mice. Results are representative of three independent experiments. Scale bars, 50 m. (H) Quantification of intensity of SCIN (n = 6 mice per group; 14 sections)
and phosphorylated MARCKS (p-MARCKS) (n = 6 mice per group; 17 sections) expression in distal colonic tissue from Gsdmdf/f and GsdmdIEC mice. Data were analyzed using
two-tailed Student’s t test and expressed as the means ± SEM. ****P < 0.0001. (I) Immunoblots analysis of phosphorylated MARCKS and scinderin protein expression in
sorted CD45+/CD45− cells from distal colonic tissues of Gsdmdf/f and GsdmdIEC mice. n = 3 mice per group. (J and K) Quantification of phosphorylated MARCKS and
scinderin protein relative to GAPDH expression in (I). Data were analyzed using one-way ANOVA and expressed as the means ± SEM; n = 3 mice per group. ***P < 0.001.
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
9 of 17
remodeling) and Rab27b (a guanosine triphosphatase required for
granule transport) (Fig.5E) (45). The mRNA level of Scin was
increased rather than decreased upon GSDMD deficiency (Fig.5F),
suggesting a feedback up-regulation in response to its decreased
protein level. Unexpectedly, in contrast to this increased transcript
of “actin disassembly” gene Scin, the mRNA levels of “tethering/
fusion” genes were simultaneously decreased (Fig.5F), which
suggests a concomitant change in the transcription of exocytic genes
due to a disturbed transition between F-actin disassembly and granule
tethering/docking (Fig.5F). To allow the passage of mucin secretory
granules, the cortical F-actin barrier is disrupted and remodeled by
Ca2+-dependent scinderin activation and/or MARCKS (myristoylated
alanine-rich C kinase substrate) phosphorylation by protein kinase
C (18,45,47,48). Using immunohistochemistry in the colon sections,
scinderin was found to be preferentially expressed in epithelial cells
with goblet cell morphology, but this expression was remarkably
decreased in GsdmdIEC mice (Fig.5,GandH). In contrast, phos-
phorylated MARCKS was unaffected (Fig.5,GandH). Biochemical
analysis confirmed the decreased scinderin protein, particularly
in the epithelial population, but not phosphorylated MARCKS
(Fig.5,ItoK). Together, these results suggest that epithelial
GSDMD promotes mucin granule exocytosis, possibly by modulat-
ing scinderin-mediated F-actin disassembly.
GSDMD is activated by goblet cell secretagogues via
a mechanism of reactive oxygen species synthesis
To explore the mechanism underlying the regulation of GSDMD in
mucus secretion, we first generated a GSDMD-deficient human
colonic goblet cell line (LS174T) (49) using the CRISPR-Cas9 sys-
tem (fig. S6A). Consistent with the data from invivo and exvivo
experiments, GSDMD-deficient LS174T cells showed a remarkable
decrease in MUC2 secretion upon stimulation by goblet cell
secretagogues including adenosine 5′-triphosphate (ATP), histamine,
and phorbol 12-myristate 13-acetate (PMA) (18), which was con-
firmed by dot blotting the supernatants of LS174T goblet cells (50)
(Fig.6,AandB). In resting LS174T cells, we detected the expression of
NLRP6, caspase-1, and caspase-4 (homologous to murine caspase-11)
(Fig.6C), suggesting a primed state of these goblet cells. ATP or
PMA stimulation potently led to the activation of GSDMD and
caspase-1/4 correlating with MUC2 secretion (Fig.6C and fig. S6B).
We also found GSDMD activation and MUC2 secretion triggered
by intracellular LPS and, to a lesser extent, stimulation with extra-
cellular LPS (fig. S6C). In contrast, the expression of NLRP3, which
can also be stimulated by ATP, was not detected in LS174 cells, and
the NLRP3 inhibitor MCC950 had no effect on either GSDMD
activation or MUC2 secretion (fig. S6D). In line with the data of
Casp1−/− and Casp11−/− colons (Fig.1E and fig. S1K), inactivation of
caspase-1 and/or caspase-11 by VX-765 or Ac-LEVD-CHO sup-
pressed GSDMD activation and MUC2 secretion (fig. S6E). NLRP6
was reported to be activated by LPS relying on reactive oxygen spe-
cies (ROS) synthesis in goblet cells (40). We found that ATP, PMA,
and intracellular LPS all induced significant ROS production (fig.
S6F). Their effects on MUC2 secretion were greatly inhibited by
N-acetylcysteine (NAC), a nonspecific ROS scavenger (Fig.6C and
fig. S6G). NAC suppressed the activation of the caspase-1/4/GSDMD
axis upon ATP stimulation (Fig.6C). ATP-induced mucus secretion
is recognized to depend on P2Y2 purinergic signaling (fig. S6H),
which typically couples to phospholipase C (PLC) (45). The PLC
inhibitor U73122, but not inositol 1,4,5-trisphosphate receptor
(IP3R) inhibitor 2-aminoethyl diphenylborinate (2-APB), suppressed
the activation of caspase-1/4/GSDMD and MUC2 secretion (Fig.6C),
consistent with its inhibition of ATP-induced ROS production (fig.
S6I). Together, we revealed a convergent mechanism of ROS
synthesis required for GSDMD activation in goblet cells triggered
by both purinergic signaling and microbial signal.
GSDMD drives scinderin-mediated F-actin disassembly
for mucin granule secretion
The decreased scinderin protein level in the colons of GsdmdIEC
mice was recapitulated in GSDMD-deficient LS174T cells (Fig.6D
and fig. S7A). As this decreased protein level was not induced by
decreased mRNA transcription (Fig.5F), we considered a post-
translational mechanism by which the Ca2+-activated scinderin was
inactivated and subsequently degraded in the absence of GSDMD.
The degradation of scinderin protein was largely enhanced by GSDMD
deficiency (Fig.6D) via both proteasomal and lysosomal pathways
(fig. S7A). In addition, the suppressed MUC2 secretion was restored when
we incubated permeabilized GSDMD-deficient LS174T goblet cells
with recombinant full-length scinderin or Sc-PIP2BP peptide [with se-
quence corresponding to a phosphatidylinositol 4,5- bisphosphate
(PIP2)–binding site of scinderin that potentiates its F-actin–severing
effect] but not Sc-ABP1 and Sc-ABP2 peptides (with sequences
corresponding to two actin-binding sites of scinderin that impair
its F-actin–severing effect) (Fig.6E and fig. S7B) (51), suggesting
the substantial contribution of scinderin-evoked F-actin disassembly
to the GSDMD regulation of mucin granule exocytosis. The ratios
of G-actin (globular actin) to F-actin in secretagogue-stimulated
goblet cells, indicative of F-actin disassembly, were significantly
decreased by GSDMD deficiency (Fig.6,FandG). To visualize the
cortical actin cytoskeleton in situ, we treated LS174T cells with a
membrane-stripping solution to “unroof” the cells combined with
in situ cell fixation and stabilization of all actin filaments (52,53).
Using scanning electron microscopy, we found sufficient clearances
in the F-actin network upon mucin secretion that could provide ac-
cess to the plasma membrane for granule exocytosis (Fig.6,HandI).
In contrast, these clearances were significantly reduced and many
granules were trapped in the F-actin network in the absence of
GSDMD (Fig.6,HandI). We also performed a fluorescence micro-
scopic analysis with iFluor 488–labeled phalloidin staining (47,51).
Combined with 3D image analysis, a continuous and uniform
fluorescent ring of rhodamine fluorescence was observed in the
steady state, which was markedly disrupted by mucin secretion
(Fig.6,JandK). In the absence of GSDMD, this disruption was
largely prevented (Fig.6, Jand K). However, forced F-actin disas-
sembly by cytochalasin B rescued the phenotypes induced by
GSDMD deficiency, including the MUC2 secretion (Fig.6,LandM),
clearances in the F-actin network (Fig.6,HandI), disruption of the
F-actin fluorescent ring (Fig.6,JandK), and change in the ratio of
G-actin to F-actin (Fig.6,NandO).
To confirm that these changes are not associated with pyroptosis,
we provided several important evidence including (i) no typical
pyroptosis morphology with cell swelling and membrane rupture as
observed in macrophages during pyroptosis (fig. S7C and movies
S1 to S3), (ii) no degradation of major cytoskeleton components as
observed in macrophages during pyroptosis (fig. S7, D to H) (54),
(iii) no LDH release (fig. S7I), and (iv) no release of inflammatory
factors such as IL-1 as detected in the supernatant of macrophages
during pyroptosis (fig. S7J). Collectively, we revealed a noncanonical
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
10 of 17
Fig. 6. GSDMD modulates scinderin-mediated
F-actin disassembly during mucin granule
secretion. (A and B) Dot blotting analysis (A) and
quantification (B) of Muc2 secretion level in super-
natants from GSDMD−/− LS174T cells upon stimu-
lation with (A) ATP (100 M), histamine (100 M),
and PMA (2 M). Results are representative of
three independent experiments. Data were ana-
lyzed using two-tailed Student’s t test and expressed
as the means ± SEM. ***P < 0.001. NS, no significant
difference. (C) Immunoblots analysis of Muc2
secretion and NLRP6, caspase-1, caspase-4, and
N-terminal GSDMD protein expression in WT
and GSDMD−/− LS174T cells. Cells were pretreated
with Inhibitors for PLC (U73122; 30 M), IP3Rs
(2-APB; 50 M) or ROS (NAC; 1 mM) for 30 min and
then stimulated with ATP (100 M) for 30 min.
Results are representative of three independent
experiments. (D) Western blotting analysis of
scinderin in LS174T cells pretreated with or without
ATP (100 M) for 30 min and then treated with
cycloheximide (CHX) (25 g/ml) up to 12 hours.
Results are representative of three independent
experiments. (E) Western blotting ana lysi s of Muc 2
secretion level in WT and GSDMD−/− LS174T
cells. Cells were permeabilize d with digitonin as de-
scribed in experimental proce dures a nd incub ated
with recombinant scinderin protein, peptides with
sequences corresponding to actin-binding (Sc-
ABP1 and Sc-ABP2) or PIP2-binding (Sc-PIP2BP)
sites. Results are representative of three indepen-
dent experiments. (F and G) Western blotting (F)
and quantification (G) revealed that the ratio of
F-actin (F) to G-actin (G) of GSDMD−/− LS174T cells.
Results are representative of three independent ex-
periments. Data were analyzed using two-tailed
Student’s t test and expressed as the means ±
SEM. *P < 0.05 and **P < 0.01. (H) Representative
SEM images of cortical cytoskeleton in membrane-
exfoliated WT and GSDMD−/− LS174T cells show-
ing sufficiently clearances of the F-actin network
in WT cells, but granules (shaded in brown for
clarity) were trapped in the F-actin network with
ATP treatment in GSDMD−/− LS174T cells; this is
rescued by cytochalasin B treatment in GSDMD−/−
LS174T cells. Results are representative of three
independent experiments. (I) Quantification
of F-actin disassembly from SEM images as in
(H). Percentages of cells showing F-actin disas-
sembly (short filaments, ruptured cavities, and
unbound granules) under each experimental
condition are shown. For each of the experimental
conditions, 180 cells from three different cell cul-
tures were examined. Data were analyzed using
one-way ANOVA and expressed as the means ±
SEM. ****P < 0.0001. (J) Fluorescence microscopic
and 3D an alysis of cortical F-actin disassembly showing continuous cortical fluorescent rings in resting (PBS) WT and GSDMD−/− LS174T cells. Stimulation of cells with ATP caused
the disruption of the cortical fluorescent ring such as valley and peaks (arrowheads) in WT cells; this is greatly prevented in GSDMD−/− LS174T cells and is rescued by
cytochalasin B treatment. Results are representative of three independent experiments. (K) Quantification of cortical F-actin disassembly from fluorescence images as in
(J). Percentages of cells showing cortical F-actin disassembly (irregular cortical fluorescent intensity pattern) are calculated. For each of the experimental conditions,
180 cells from three different cell cultures were examined. Data were analyzed using one-way ANOVA and expressed as the means ± SEM. ***P < 0.001. (L and M) Dot blotting
analysis (L) and quantification (M) of Muc2 secretion level in supernatants from GSDMD−/− LS174T cells upon stimulation with ATP for 30 min, which was fully rescued by
cytochalasin B (10 M) treatment. Results are representative of three independent experiments. Data were analyzed using two-tailed Student’s t test and expressed as the
means ± SEM. ***P < 0.001. (N and O) Western blotting (N) and quantification (O) reveal the ratio of F-actin (F) to G-actin (G) in WT cells and GSDMD−/− LS174T cells. Results are
representative of three independent experiments. Data were analyzed using two-tailed Student’s t test and expressed as the means ± SEM. **P < 0.01 and ***P < 0.001.
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
11 of 17
function of GSDMD driving F-actin disassembly for mucin granule
exocytosis, which is largely independent of pyroptosis.
GSDMD pores promote mucin granule secretion by
mediating Ca2+ entry
We last addressed the mechanism by which GSDMD drives F-actin
disassembly during mucin granule exocytosis. Unexpectedly, we
found a rapid but moderate increase in PI uptake upon mucin
secretion, which was abolished by pretreatment with NSA, the
inhibitor of GSDMD-N oligomerization, or GSDMD deficiency
(Fig.7A). These results suggest the formation of plasma membrane
GSDMD-N pores during mucin granule exocytosis in goblet cells.
We next used biochemical and imaging approaches to identify the
subcellular GSDMD-N localization in goblet cells during mucin
secretion. Detergent-free cell homogenates were generated and
serially centrifuged as previously reported (55) to yield different
subcellular fractions including (i) nuclei and undisrupted cells, (ii)
organelle fraction, (iii) plasma membrane fraction, and (iv) cytosolic
fraction. Using the anti-cleaved hGSDMD-N–selective antibody
that does not recognize full-length hGSDMD and hGSDMD-C
(24), we found the accumulation of cleaved GSDMD-N in the plasma
membrane fraction with the marker E-cadherin (Fig.7B). Immuno-
fluorescence staining combined with confocal microscopic analysis
of ATP-stimulated LS174T cells revealed the colocalization of
cleaved GSDMD-N with the plasma membrane marker wheat germ
agglutinin (WGA) (Fig.7C), and most of GSDMD-N was localized
to the apical surface (Fig.7D).
The Ca2+-activated, scinderin-mediated F-actin–severing action
relies on secretagogue-induced Ca2+ entry (18,47,48,51). Using
1,2-bis-(2-amino-phenoxy)ethane- N,N,N’,N’-tetraacetic acid (BAPTA)
and a cell-permeant acetoxymethyl ester derivative of BAPTA
(BAPTA-AM) to chelate extracellular and intracellular Ca2+, re-
spectively, we found a more essential role of extracellular Ca2+ in
mucin secretion (Fig.7E). ATP stimulation led to a rapid elevation
of the cytosolic Ca2+ level, which was greatly inhibited by GSDMD
deficiency or NSA (Fig.7F). However, when the cells were cultured
in the absence of extracellular Ca2+, although the residual elevation of
cytosolic Ca2+ still promoted a compromised MUC2 secretion, the
phenotypes due to GSDMD deficiency were abrogated, including intra-
cellular Ca2+ elevation (Fig.7G) and Muc2 secretion (Fig.7,HandI),
the change in the ratio of G-actin to F-actin (fig. S8, A and B), clear-
ances in the F-actin network (fig. S8, C and D), and disruption of the
F-actin fluorescent ring (fig. S8, E and F). Last, the Ca2+ ionophore
ionomycin restored the ATP-induced intracellular Ca2+ elevation and
MUC2 secretion in the absence of GSDMD (Fig.7, JtoL). These
results together indicate that GSDMD pores are essential for the
Ca2+ influx that activates and stabilizes scinderin for F-actin remodeling
and mucin secretion.
DISCUSSION
Increasing evidence has recently started to uncouple GSDMD pores
from eventual cell death and provided lysis-independent func-
tions in myeloid cells, although the nature of their prolytic and
proinflammatory properties remains similar (1). We have provided
a more physiological scenario in which epithelial GSDMD drives
mucus granule secretion by goblet cells in the steady-state colon
(Fig.7M). Supporting this nonpyroptotic function of GSDMD,
goblet cells usually maintain viability during mucus secretion and
exhibit a strong resistance to cell death even under conditions of
cellular stress (56).
In the absence of epithelial GSDMD, the colon featured a
missing mucus layer that led to remarkable changes in both spatial
distribution and compositional manifestations of the intestinal
microbiota. In response to these microbial changes, other mucosal
defense mechanisms were potently induced in the GsdmdIEC colon to
prevent an evident epithelial abnormality. Among the up-regulated
proteins in the epithelial cells with GSDMD depletion, RegIII
protein was most stimulated. A marked increase in AMP was simi-
larly observed in Muc2−/− mice lacking a mucus layer in which the
RegIII protein was increased by 100-fold (21). These data suggest
an “urgent” induction of AMP-mediated spatial segregation be-
tween the epithelium and commensal bacteria and highlight different
collaborative strategies adopted for mucosal defense acting together
at the host-microbiome interface. This collaboration is also critical
when a pathogen such as C. rodentium is introduced into the eco-
system. GsdmdIEC mice eventually recovered from the C. rodentium
infection, which fits the self-limiting nature of C. rodentium infec-
tion in the presence of uncompromised inflammation (44). Given
the much higher bacterial burden in GsdmdIEC mice during infec-
tion, the function of GSDMD in goblet cells appears to limit the rate
of pathogen colonization and its deeper penetration into the crypts
by providing a physical barrier.
GSDMD activation relies on upstream inflammasome signaling
pathways. The major inflammasome-forming sensor functioning in
the gut under homeostatic conditions is NLRP6 (23). Immunofluo-
rescence staining revealed a highly enriched expression of GSDMD
in Muc2-positive goblet cells, which was notably correlated to that
of NLRP6 (25). NLRP6 activity is a prerequisite for GSDMD activa-
tion in the gut according to the absence of GSDMD-N in the
Nlrp6−/− colons. Consistent with the centrality of microbial mole-
cules in the regulation of NLRP6 activity (57), GSDMD expression
and activation were both impaired in germ-free mice, which is in line
with the dysfunctional colonic mucus system observed in germ-free
mice (28). Although the NLRP6-dependent mucus secretion was
reported to be required for both homeostatic mucus layer for-
mation (25) and “emergency” mucus production against bacterial inv as ion
by TLR ligand-responsive “sentinel” goblet cells (40), a recent study
reached a conflicting conclusion that the NLRP6 activity is not required
for baseline mucus layer formation in the steady-state colon (58).
Genetically identical mice from different breeding colonies or animal
facilities could have microbiota-dependent mucus layer variation (59).
We also found that the intestinal bacteria B. fragilis and B. bifidum
had different abilities to promote mucus growth. Therefore, one
plausible explanation for this discrepancy is that the “baseline”
microbiota and microbe-derived signals activating the NLRP6-
GSDMD axis may vary among different animal facilities.
GSDMD pores can initiate membrane repair by the endosomal
sorting complexes required for transport machinery and makes an
anti-inflammatory contribution (10). This process features molecular
properties in common with granule exocytosis: For example, they
both require Ca2+ entry and cortical F-actin remodeling (10,60). In
this regard, GSDMD uses a common membrane-targeting mecha-
nism to form pores but leads to the distinct cell fates of lytic cell
death, membrane repair, or granule exocytosis in diverse physiological
settings, suggesting its ability to sense context-dependent signals
and execute distinct actions. How could different cell types respond
to these structurally similar GSDMD pores in different ways? One
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
12 of 17
Fig. 7. GSDMD pores mediate
calcium entry for mucin granule
secretion. (A) Time course of PI up-
take by LS174T WT or GSDMD−/−
cells was stimulated with 0.01%
Triton X-100 (positive control),
PBS (blank control), or 100 M ATP,
and cells were pretreated with
20 M NSA for 1 hour and then
stimulated with ATP. Results were
representative of three indepen-
dent experiments, and data
wer e analyzed using two-tailed
Student’s t test and expressed as
the means ± SEM. MFI, mean flu-
orescence intensity. (B) Western
blotting analysis of subcellular
fractionations of ATP-stimulated
LS174T cell homogenate. P0.7
(nuclei, undisrupted cells): pellet
from 700g; P10 (organelle frac-
tion): pellet from 10,000g; P100
(plasma membrane fraction):
pellet from 100,000g; and S100
(cytosolic fraction): supernatant
from 100,000g. TOM-20, E-cadherin,
and GAPDH are markers for mito-
chondria, plasma membrane, and
cytosolic fractions, respectively.
Results are representative of thr ee
independent experiments. (C) Im-
munofluorescence analysis of
ATP-stimulated cells with anti–
hGSDMD-N antibody (red) and
WGA (green) showing the colo-
calization of cleaved GSDMD-N
with the plasma membrane
(arrowheads) in WT cells. Magni-
fication, ×100. Scale bar, 10 m.
(D) Images captured on the Z axis
showing most of the GSDMD-N
are localized to the apical sur-
face. Results are representative of
three independent experiments.
Magnification, ×100. Scale bar,
10 m. (E) Immunoblots analysis
showed that BAPTA (50 M,
30 min) treatment significantly
inhibited the secretion of MUC2
protein, but BAPTA-AM (25 M,
30 min) treatment had no signifi-
cant effect. (F, G, and J) Time
course of Ca2+ influx in cell with
or without NSA pretreatment
(20 M for 1 hour) and then stim u-
lation with ATP (100 M) alone or
together with ionomycin (10 g/ml)
in normal Ca2+-containing buffer (2 mM) or Ca2+-free buffer (0 mM). Results are representative of three independent experiments. (H, I, K, and L) Dot blotting analysis
(H and K) and quantification (I and L) of Muc2 secretion level in supernatants of WT and GSDMD−/− LS174T cells upon stimulation with ATP (100 M) in Ca2+-free medium
(H and I) and in medium containing normal Ca2+. Cell were treated with ionomycin (10 g/ml) 30 min (K and L). Results are representative of three independent experi-
ments. Data were analyzed using two-tailed Student’s t test and expressed as the means ± SEM. ***P < 0.001. (M) Schematic illustrating how epithelial GSDMD shapes the
host-microbial interface by modulating Ca2+-dependent scinderin-mediated mucus granule exocytosis.
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
13 of 17
possible explanation is that the amount and the size of the GSDMD
pores may vary among different cell types and populations (1),
endowing cells with specific tolerances to these pores. We also
hy po th esize that some specialized plasma membrane regions that fea-
ture highly dynamic properties, such as the apical membrane surface
surrounding the theca of goblet cells, adapt to the presence of
GSDMD pores and use them for vesicle trafficking and secretion.
Further mechanistic studies on two issues are of significant interest:
(i) whether this exocytotic function of GSDMD pores is a general
mechanism underlying the granule secretion by other secretory
cells and (ii) whether the formation of tolerable membrane pores is a
general strategy for releasing cell contents, as another lytic mem-
brane pore of mixed- lineage kinase domain–like pseudo- kinase
has also been reported to facilitate the release of extracellular vesi-
cles (61).
MATERIALS AND METHODS
Study design
The aim of this study was to explore the physiological function of
GSDMD in colonic segregation between bacteria and epithelium
for gut homeostasis by driving goblet cell–mediated mucus layer
formation. We generated the conditional knockout mouse strains
(GsdmdIEC) to investigate the function of epithelial GSDMD in
the gut. In addition, scanning electron microscopy, 16S rDNA gene
qPCR analysis, and fluorescence in suit hybridization were used to
visualize and quantify the bacteria attachment on the colonic epi-
thelium surface. To investigate the possible signals that could induce
mucus secretion through epithelial GSDMD, we developed an
exvivo colonic organ culture system by 3D printing and treated the
colonic explants with bacterial molecules, microbes, metabolites,
and GSDMD inhibitor to study their effects on mucus secretion.
For the study of the mechanism of GSDMD affecting mucus
granule secretion, we generated a GSDMD-deficient human colonic
goblet-like cell line (LS174T) using CRISPR-Cas9 system. All experi-
ments were repeated at least two to three independent experiments.
The number of individual replicates and the statistically significant
differences of each experiment were shown in the figure legends.
Animals were randomly assigned to study groups within each
genotype. The mice were age- and sex-matched, and the littermate
controls were used where possible. The analyses were performed
unblinded because mice were grouped according to the genotype
and treatment.
Mice
Male mice with a C57BL/6 background were used in this study.
C57BL/6, Villin-Cre, Gsdmdf/f mice, and germ-free mice were from
GemPharmatech Co. Ltd. Intestinal epithelial cell conditional
Gsdmd knockout mice (GsdmdIEC) were generated by crossing
Gsdmdf/f mice with Villin-Cre mice. Nlrp3−/− and Casp1−/− mice
were purchased from the Jackson Laboratory. Asc−/− mice were pur-
chased from Beijing Viewsolid Biotech. Gsdmd−/− mice were a gift
from H. Luo of Harvard Medical School, and Casp11−/− mice were
provided by B. Lu of Xiangya Hospital of Central South University.
Colorectal tissues of Nlrp6+/+ and Nlrp6−/− mice were provided by
S. Zhu of the University of Science and Technology of China. Il18−/−
mice were provided by G. Meng of Institut Pasteur of Shanghai,
Chinese Academy of Sciences. The Il1r1−/− mice were provided by
L. Li of the Third Military Medical University. Mice had the
same genetic background and were reared in the same standard,
pathogen-free animal facility. To avoid effects of rhythmic environ-
mental variation on mice, mice were housed under a 12-hour light/
12-hour dark cycle at 22° to 24°C with unrestricted access to food
and water for the duration of the experiment. For intestinal bacteria
observations using scanning electron microscopy, all the mice were
euthanized at 1400 Beijing time. In cohousing experiments, age- and
gender-matched Gsdmdf/f and GsdmdIEC mice were cohoused in new
cages at a 1:1 ratio for 6 weeks. All animal experimental protocols
were reviewed and approved by the Animal Care Committee of the
Zhejiang University (ethics code: ZJU20200138).
Cells
LS174T (ATCC-CL-188) cells were purchased from American Type
Culture Collection (ATCC). All cells were cultured in Dulbecco’s
modified Eagle’s medium (DMEM) or Ca2+-free medium supple-
mented with 10% fetal bovine serum (FBS) and 1% penicillin and
streptomycin at 37°C and 5% CO2.
GSDMD gene knockout in the LS174T cell line was generated
using the CRISPR-Cas9 system. Briefly, LS174T cells were plated on
six-well plates at 5×105 per well in complete cell culture medium.
When the cell density reached 80%, the plasmids pGL3-U6-gRNA-
puromycin mut Bsa 1 ACCG (2 g) and pST1374-N-NLS-Flag-
Linker-Cas9-BSD (2 g) were cotransfected into the cells with
Lipofectamine 3000 (Vazyme Biotech) according to the manufacturer’s
protocols. Then, the cells were cultured for 24hours and then treated
with puromycin (2 g/ml) and blasticidin (20 g/ml) for the next
48hours. Monoclonal cells were obtained by the limiting dilution
method, and lysates were analyzed for GSDMD expression by
Western blotting. The plasmids pGL3-U6-gRNA-puromycin mut
Bsa 1 ACCG and pST1374-N-NLS-Flag-Linker-Cas9-BSD were
gifts from X. Zhang of Wuhan University.
For stimulation, cells were plated on six-well plates at 2× 105 cells per
well overnight and then pretreated with the inhibitor of GS DMD-N
oligomerization NSA (20 M; Selleck Chemicals) for 1hour. After
that, cells were stimulated with phosphate-buffered saline (PBS), ATP
(100 M; Sigma-Aldrich), histamine dihydrochloride (100 M;
Sangon Biotech), or PMA (2 M; Sangon Biotech) for 30min at
37°C. Cell lysates and culture supernatants were analyzed by Western
blotting and dot blotting.
The target sequences (5′ to 3′) used for human GSDMD were
as follows: gRNA1, TGAGTGTGGACCCTAACACC; gRNA2,
CCTCTGGCCTCTCCATGATG; gRNA3, TTGGGGAAACA-
CAATAAAGG.
Human samples
Human colonic samples of paracancerous tissues were isolated
from three volunteers with colorectal adenocarcinoma aged 48 to
52 years (two men and one woman) who had given informed con-
sent. To use these clinical materials for research purposes, prior
written informed consent was given by the patients and approval
was obtained from the Institutional Research Ethics Committee of
The Second Affiliated Hospital of Zhejiang University School of
Medicine (approval no. 2017-067).
Bacterial strains and growth conditions
B. fragilis [ATCC25285; 5 × 106 colony-forming units (CFU)/ml] and
B. bifidum (DSM20082; 5 × 106 CFU/ml) were used in this study to
stimulate mucus layer formation in exvivo culture system. The bacteria
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
14 of 17
were cultured in an anaerobic incubator at 37°C for 24 to 48 hours
using Man-Rogosa-Sharpe (MRS) medium for B. fragilis and BBL
medium for B. bifidum.
Reagents
Ca2+-deficient DMEM was from Shanghai Basal Media Technolo-
gies, deoxyribonuclease I (DNase I) (#DN25), ATP (#10519987001),
Ac-LEVD-CHO (#218755), LTA (#L2515), and disuccinimidyl
suberate (#S1885) were from Sigma-Aldrich. Liberase (#5401054001)
was from Roche. Histamine dihydrochloride (#A600501), PMA
(#A606759), EGTA (#A600077), polyethylene glycol 6000 (#A610432),
and phenol red (#A600420) were all from Sangon Biotech. Ionomycin
(S7074), cytochalasin B (#S9628), belnacasan (VX-765, #S2228), and
NSA (#S8251) were from Selleck Chemicals. 2-APB (#HY-W009724),
NAC (#HY-B0215), and MCC950 (#HY-12815A) were from
MedChemExpress. PI (#00-6990-50) was from eBioscience. Media
components included RPMI 1640 medium (#12633012, Gibco), po rcin e
serum (#04-006-1A, Biological Industries), 2% B-27 (#17504-044,
Gibco), and N-2 supplements (#17502-048, Gibco).
The antibodies used were luciferase (ab185923, Abcam), MUC2
(orb372331, Biorbyt), scinderin (bs-17286R, Bioss), -catenin (ab32572,
Abcam), GSDMD (ab209845, Abcam), N-terminal GSDMD
(ab215203, Abcam), phosphorylated MARCKS (ab81295, Abcam),
vimentin (ab92547, Abcam), -tubulin (ab7291, Abcam), actin
(ab7817, Abcam), E-cadherin [#3195, Cell Signaling Technology
(CST)], lysozyme (ab108508, Abcam), ZO-1 (ab221547, Abcam),
Ki-67 (ab16667, Abcam), MUC2 (Sc-7314, Santa Cruz Biotechnology),
TOM-20 (ST04-72, HUABIO), E-cadherin (3195s, CST), and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (db106, Diagbio).
The secondary antibodies were DyLight 488–conjugated goat anti-
rabbit (70-GAR4882, Multi Sciences), DyLight 549–conjugated goat
anti-mouse (70-GAR5492, Multi Sciences), DyLight 649–conjugated
goat anti-rabbit (70-GAR6492, Multi Sciences), iFluor 488–conjugated
phalloidin (ab176753, Abcam), biotin- conjugated lectin from Triticum
vulgaris (L5142, Sigma-Aldrich), and fluorescein isothiocyanate
(FITC)– conjugated UEA-I lectin (V4754, Sigma-Aldrich).
Isolation of colonic epithelial and immune cells
Two centimeters of the terminal colon was excised from WT or
Gsdmd−/− mouse longitudinally opened, and feces was removed
with forceps to preserve the integrity of the tissues. For epithelial
and immune cell separation, tissue was incubated with RPMI 1640
medium supplemented with penicillin, streptomycin, and 10% FBS in a
gentleMACS C Tube at 4°C. To digest the tissues, DNase I (DN25,
Sigma-Aldrich) at 1:2000 dilution and Liberase (5401054001, Roche)
at 1:37.5 dilution were added. The tissue was then digested using a
gentleMACS Dissociator (Miltenyi Biotec) with program(m_intestine_ 01)
and program (m_Lung_2). The tissue was disrupted to a single- cell
suspension by EDTA and passed through a 70 M sieve. Cells were
centrifuged and washed before staining with anti-EpCAM (epithelial cell
adhesion molecule), anti-CD45, anti-CD11b, anti-CD3, and anti- B220
for fluorescence- activated cell sorting (FACS) analysis using B D FAC S
Ar ia II SORP (BD Biosciences). Myeloid cells (EpCAM−CD45+CD11b+)
and epithelial cells (CD45−CD11b−CD3−B220−EpCAM+) were col-
lected and analyzed by qPCR and proteomics.
RNA isolation and qPCR
The 4 mm of the terminal colon was excised, and RNA was extracted
using an RNeasy Mini kit (QIAGEN). Complementary DNA was
synthesized using the SuperScript First Strand cDNA Synthesis Kit
(Vazyme Biotech) according to the manufacturer’s protocols. qPCR
was performed using SYBR Green (Vazyme Biotech) on a CFX96
(Bio-Rad). Each sample was normalized to Gapdh. Please refer to
table S1 for the primer list.
Immunohistochemistry
For mucus layer staining, the 4 mm of the terminal colon contain-
ing feces was fixed in Carnoy’s buffer for 24hours and washed in
absolute ethyl alcohol. Paraffin-embedded tissues were deparaffinized,
rehydrated, and stained with PAS/AB. For immunohistochemistry,
tissue was processed as mentioned above, with the addition of anti-
gen retrieval in citric acid (10 mM, pH 6.0). The antibodies used
for immunostaining were against luciferase (ab185923, Abcam),
MUC2 (arb372331, Biorbyt), scinderin (bs-17286R, Bioss), -catenin
(ab32572, Abcam), GSDMD (ab209845, Abcam), N-terminal GSDMD
(ab215203, Abcam), vimentin ( ab92547, Abcam), -tubulin (ab7291,
Abcam), actin (ab7817, Abcam), E-cadherin (#3195, CST), lysozyme
(ab108508, Abcam), ZO-1 (ab221547, Abcam), Ki-67 (ab16667,
Abcam), and phosphorylated MARCKS (ab81295, Abcam). The sec-
ondary antibodies were Dylight 488–conjugated goat anti-rabbit,
Dylight 649–conjugated goat anti-rabbit (Multi Sciences), iFluor
488–conjugated phalloidin (ab176753, Abcam), biotin-conjugated
lectin from T. vulgaris (L5142, Sigma-Aldrich), or FITC-conjugated
UEA-I lectin (V4754, Sigma-Aldrich), and DNA was stained with
4′,6-diamidino-2-phenylindole (DAPI).
Immunoblotting
Colon homogenates from mice were lysed in extraction solution
[150 mM NaCl, 10 mM tris (pH 7.4), 1 mM EGTA, and 0.1% NP-40]
supplemented with a protease inhibitor cocktail (MedChemExpress).
Samples were denatured in SDS loading buffer and boiled for
10min. Proteins were separated on 10 or 12% SDS–polyacrylamide
gel electrophoresis gels and transferred to nitrocellulose membranes
(#28637358, Pall), which were blocked for 1hour in blocking buffer
(5% skimmed milk and 0.1% Tween 20in tris-buffered saline) at
room temperature and incubated with primary and secondary anti-
bodies. For MUC2 secretion analysis, LS174T cells were cultured in
DMEM or Ca2+-free medium supplemented with 10% FBS and 1%
penicillin and streptomycin at 37°C with 5% CO2 before treatment
with ATP (100 M; Sigma-Aldrich), histamine dihydrochloride
(100 M; Sangon Biotech), PMA (2 M; Sangon Biotech), ionomycin
(10 g/ml; Selleck Chemicals), or cytochalasin B (10 M; Selleck
Chemicals) for 30min at 37°C. The supernatant was collected. Cells
were lysed in lysis buffer solution (1% Triton X-100 and 1 mM
dithiothreitol in PBS) for 1hour at 4°C. The supernatant was spotted
on nitrocellulose membranes, which were incubated in blocking
solution (4% bovine serum albumin (BSA)/0.1% Tween 20/PBS)
for 1hour at room temperature. Membranes were then incubated
with anti-MUC2 primary antibody (Santa Cruz Biotechnology)
and goat anti-mouse immunoglobulin G (H+L)–horseradish
peroxidase secondary antibody (Diagbio); enhanced chemilumines-
ence blotting reagents (Thermo Fisher Scientific) were used for
immunoblot detection. The MUC2 protein secretion level was
quantified in ImageJ (version 1.53). The antibodies used for im-
munoblotting were MUC2 (Sc-7314, Santa Cruz Biotechnology),
GSDMD (ab209845, Abcam), N-terminal GSDMD (ab215203,
Abcam), TOM-20 (ST04-72, HUABIO), E-cadherin (3195s, CST), and
GAPDH (db106, Diagbio).
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
15 of 17
Subcellular fractionation isolation of LS174T cells
LS174T cells and GSDMD−/− LS174T cells were homogenized using
a 1-ml syringe: The cell suspension was passed through a 27-gauge
needle 20 to 25 times in ice-cold fractionation buffer [250 mM
sucrose, 20 mM Hepes (pH 7.4), 10 mM KCl, 1.5 mM MgCl2, 1 mM
EDTA, and 1 mM EGTA] supplemented with a protease inhibitor
cocktail (MedChemExpress). The degree of rupture was examined
under a microscope for the duration of the experiment until only
5 to 10% of the cells were visible. The homogenate was then centrifuged
at 720g for 5min (p0.7 pellet: predominantly cells and nucleus),
10,000g for 10min (p10 pellet: predominantly granules, mitochondria,
and lysosome), or 100,000g for 60min to yield p100 pellet (predomi-
nantly plasma membrane and endoplasmic reticulum) and s100 super-
natant (predominantly cytosol). Fractions were analyzed by Western
blotting using Tom-20, E-cadherin, and GAPDH as markers for mito-
chondria, plasma membrane, and cytosolic fractions, respectively.
Recombinant scinderin preparation and effects
on MUC2 secretion
To obtain the scinderin protein, complementary SCIN DNA was
obtained from LS174T cells and cloned into expression vectors,
pET28a-6×His-SUMO vector. E. coli BL21 (DE3) cells were trans-
formed with SCIN plasmid and grown in LB medium for 12hours
at 22°C with 0.8 mM isopropyl--d-thiogalactopyranoside after the
optical density at 600nm reached 0.8. The precooled lysis buffer
(20 mM imidazole) was used to resuspend the bacteria solution,
which was fractured by ultrasound on ice until it was completely
decomposed, and the supernatant was collected. The fusion protein
was affinity-purified using Ni-Sepharose beads (Invitrogen). The
SUMO tag was removed by overnight digestion with homemade
ubiquitin-like-specific protease 1 (ULP1) protease at 4°C.
To determine the effects of SCIN or SCIN-derived peptides on
MUC2 protein secretion, LS174T and GSDMD−/− LS174T cells were
plated on 24-well plates and incubated with Lock’s solution for
30min. Cells were permeabilized with digitonin (20 M; Sigma-
Aldrich) in K+ glutamate buffer [129 mM K+ glutamate, 3 mM
MgCl2, 2 mM ATP, 5 mM EGTA, and 20 mM Pipes (pH 6.6)] and
then incubated with recombinant SCIN (0.1 M) or 10 M peptides
with sequences corresponding to actin-binding (Sc-ABP1: AAAIFT-
VQMDDYL; Sc-ABP2: RLLHVKGRR) or PIP2-binding (Sc-PIP2BP:
KGGLKYKAG) sites of SCIN for 2min at room temperature. Last,
cells were stimulated with 100 M ATP for 30min. Supernatants
and cell lysates were analyzed by Western blotting.
Fluorescence in situ hybridization
The 4 mm of the terminal colon was fixed and processed as described
above. Tissue sections were deparaffinized and dehydrated. After
washing twice with PBS, the sections were digested with proteinase
K at 37°C for 20min and dehydrated in graded ethanols. Hybridiza-
tions were done with the RNA FISH Kit (GenePharma) according
to the manufacturer’s protocols. The probe used for hybridizations
was 5′ Cy3–labeled EUB338 (GCTGCCTCCCGTAGGAGT).
3D imaging with the FOCM
After fecal removal and thorough washing, the the 4 mm of mouse
terminal colon was opened longitudinally, flattened out on filter
paper, and immediately fixed in Carnoy’s buffer for 1min. The
tissue together with the filter paper was included in a 24-well plate,
where fixation with Carnoy’s buffer was continued for 4hours and
then changed to dehydration in anhydrous ethanol for 4hours.
For immunofluorescence staining, tissue was blocked with 10%
BSA in PBS for 2hours at room temperature and incubated with
FITC- conjugated UEA-I lectin (V4754, Sigma-Aldrich) for 48hours
at room temperature and 50rpm on a shaker. After washing three
times (1 hour each) with PBST (0.01% Triton X-100 in PBS) at
50rpm on a shaker at room temperature, the tissue was incubated
with iFluor 488–conjugated phalloidin (ab176753, Abcam) for 24hours
at room temperature and shaken at 50rpm. Secondary antibodies
were washed under the same condition as above. DAPI was used for
DNA staining, and then the tissue was cleared. Samples were incu-
bated in FOCM reagent [30% (w/v) urea, 20% (w/v) d-sorbitol, and
5% (w/v) glycerol dissolved in dimethyl sulfoxide] for 3min. The
tissue was moved into a holder and, at the appropriate thickness,
was glued to a glass coverslip and covered with another glass coverslip.
3D imaging was processed with a Nikon A1R confocal microscope,
and Imaris software was used for surface analysis.
C. rodentium culture and infection of mice
Mice were infected by oral gavage with 1×109CFU of C. rodentium
DBS100 (a gift from G. Frankel) and analyzed on day 14 p.i. For
invivo bioluminescence imaging, mice were anesthetized with 1%
isoflurane. Bioluminescence was quantified using Living Image
software (IVIS Spectrum) using a 5-s exposure. Bioluminescence
imaging was also used to visualize plated CFU dilutions. The whole
spleen and the 1 cm of the terminal colon were collected in 1ml of
sterile PBS supplemented with EDTA-free protease inhibitor cocktail
(MedChemExpress) at the final concentration recommended by the
manufacturer. The samples were weighed and homogenized. Serially
diluted tissue homogenates were plated on LB kanamycin plates and
incubated overnight at 37°C, and C. rodentium colonies, identified
by kanamycin resistance and a luciferase signal, were enumerated the
following day; they were normalized to tissue weight (per gram).
Quantification of bacterial DNA
Mouse colons were collected and extensively cleaned of fecal material
and rinsed thoroughly to remove nonepithelial adherent bacteria.
DNA was extracted by using the DNA Bacteria Plus Kit (QIAGEN)
according to the manufacturer’s protocol. DNA concentrations
were determined according to a standard curve of known DNA
concentrations from E. coli K12. Amplimers from different regions
of the V6 16S gene were identified using SYBR Green (Vazyme
Biotech) on a CFX96 (Bio-Rad). Numbers of bacteria were calculated
as DNA amount in a sample/DNA molecular mass of bacteria. For
quantification of C. rodentium, the specific primers used were espB-F
and espB-R. Please refer to table S2 for the primer list.
Ex vivo colon culture system and mucus layer
growth analysis
Briefly, a 3D-printed chamber was designed using AutoCAD and printed
using projection-based 3D bioprinter (EFL-BP8600, Suzhou Intelligent
Manufacturing Research Institute) with photosensitive bioresin (EFL).
Please refer to fig. S9 for detailed print parameters and model data.
For exvivo culture, 3cm of the terminal colon was dissected
sterilely from Gsdmdf/f mice, GsdmdIEC mice, and Gsdmdf/f mice
given intraperitoneal injection of NSA (20 mg/kg) for 30min. The
luminal contents were extensively washed using a syringe to remove
the original mucus. The colonic fragment was put into the exvivo
culture chamber and threaded and fixed over the internal culture
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
16 of 17
ports using a sterile surgical thread. A constant temperature heating
platform was used to keep the temperature of medium in the cham-
ber to 37°C, and colonic fragments were maintained in a constant
flow of sterile medium using a high-precision peristaltic pump
(internal culture medium: 100 l/hour). To maintain the pH of the
culture environment and better growth, medical grade 95% O2/CO2
gas mixture was humidified and filtered into the chamber. Culture
medium contains RPMI 1640 medium (12633012, Gibco) supple-
mented with 20% porcine serum (04-006-1A, Biological Industries),
2% B-27 (17504-044, Gibco) and N-2 supplements (17502-048,
Gibco), 1% l-glutamine, 1% Hepes, and 1× mixture of amino acids
(BYA9010, Solarbio). For LPS stimulation, LPS (200 g/ml) was
added into the internal culture medium with or without NSA (20 M).
Mucus thickness was measured after 60-min exvivo culture and by
3D imaging with the FOCM. For antibiotic- treated assay, Gsdmdf/f
and GsdmdIEC mice were pretreated with or without broad-spectrum
antibiotics including a combination of vancomycin (0.5 g/liter),
ampicillin (1 g/liter), kanamycin (1 g/liter), and metronidazole
(1 g/liter) in the drinking water for 2 weeks. Ex vivo cultured colonic
tissues were treated with LPS (200 g/ml), LTA (200 g/ml), or
P3CSK4 (50 g/ml) combined with taurine (10 g/ml) for 60min
or B. fragilis (ATCC25285; 5 × 106 CFU/ml) or B. bifidum (DSM20082;
5 × 106 CFU/ml) for 6hours.
ROS generation assay
ROS production in LS174T cells was determined using the Total
ROS Assay Kit 520nm (88-5930-74, Invitrogen) according to the
manufacturer’s instructions. Briefly, LS174T cells were pretreated
with or without U73122 (30 M; Sigma-Aldrich) or NAC (1 mM;
Sigma-Aldrich) for 30min and then stimulated with ATP (100 M)
and PMA (1 M) for 30min or transfected with LPS (1 g/ml) for
4hours. Cells were then incubated for 60min in a 37°C incubator
with 5% CO2. To maintain more physiological cellular activity, cells
were kept at 37°C by a water bath for the duration of the experi-
ment. Fluorescence was recorded using an ACEA NovoCyte flow
cytometer (ACEA Biosciences). The assay was analyzed using the
488-nm blue laser in the FITC channel.
Statistical analysis
All results are presented as the means±SEM or SD, and statistical
calculations were performed with GraphPad Prism 8.0. Data were
analyzed using the two-tailed Student’s t test (for two groups) or
analysis of variance (ANOVA) (for multigroup comparison) to
determine the significance of differences between population means.
Gene Ontology analysis was performed in DAVID (version 6.8).
P < 0.05 was considered to be statistically significant.
SUPPLEMENTARY MATERIALS
www.science.org/doi/10.1126/sciimmunol.abk2092
Methods
Figs. S1 to S9
Tables S1 and S2
Movies S1 to S3
Data file S1
Materials Design Analysis Reporting (MDAR) Checklist for Authors
View/request a protocol for this paper from Bio-protocol.
REFERENCES AND NOTES
1. P. Broz, P. Pelegrin, F. Shao, The gasdermins, a protein family executing cell death
and inflammation. Nat. Rev. Immunol. 20, 143–157 (2020).
2. J. Ding, K. Wang, W. Liu, Y. She, Q. Sun, J. Shi, H. Sun, D. C. Wang, F. Shao, Pore-forming
activity and structural autoinhibition of the gasdermin family. Nature 535, 111–116
(2016).
3. X. Liu, Z. Zhang, J. Ruan, Y. Pan, V. G. Magupalli, H. Wu, J. Lieberman, Inflammasome-
activated gasdermin D causes pyroptosis by forming membrane pores. Nature 535,
153–158 (2016).
4. X. Chen, W. T. He, L. Hu, J. Li, Y. Fang, X. Wang, X. Xu, Z. Wang, K. Huang, J. Han, Pyroptosis
is driven by non-selective gasdermin-D pore and its morphology is different from MLKL
channel-mediated necroptosis. Cell Res. 26, 1007–1020 (2016).
5. J. Lieberman, H. Wu, J. C. Kagan, Gasdermin D activity in inflammation and host defense.
Sci Immunol 4, (2019).
6. M. M. Gaidt, T. S. Ebert, D. Chauhan, T. Schmidt, J. L. Schmid-Burgk, F. Rapino,
A. A. B. Robertson, M. A. Cooper, T. Graf, V. Hornung, Human monocytes engage
an alternative inflammasome pathway. Immunity 44, 833–846 (2016).
7. I. Zanoni, Y. Tan, M. di Gioia, A. Broggi, J. Ruan, J. Shi, C. A. Donado, F. Shao, H. Wu,
J. R. Springstead, J. C. Kagan, An endogenous caspase-11 ligand elicits interleukin-1
release from living dendritic cells. Science 352, 1232–1236 (2016).
8. M. Carty, J. Kearney, K. A. Shanahan, E. Hams, R. Sugisawa, D. Connolly, C. G. Doran,
N. Muñoz-Wolf, C. Gürtler, K. A. Fitzgerald, E. C. Lavelle, P. G. Fallon, A. G. Bowie, Cell
survival and cytokine release after inflammasome activation is regulated by the toll-IL-1R
protein SARM. Immunity 50, 1412–1424.e6 (2019).
9. C. L. Evavold, J. Ruan, Y. Tan, S. Xia, H. Wu, J. C. Kagan, The pore-forming protein
gasdermin D regulates interleukin-1 secretion from living macrophages. Immunity 48,
35–44.e6 (2018).
10. S. Rühl, K. Shkarina, B. Demarco, R. Heilig, J. C. Santos, P. Broz, ESCRT-dependent
membrane repair negatively regulates pyroptosis downstream of GSDMD activation.
Science 362, 956–960 (2018).
11. N. Saeki, Y. Kuwahara, H. Sasaki, H. Satoh, T. Shiroishi, Gasdermin (Gsdm) localizing
to mouse chromosome 11 is predominantly expressed in upper gastrointestinal tract but
significantly suppressed in human gastric cancer cells. Mamm. Genome 11, 718–724 (2000).
12. M. E. V. Johansson, M. Phillipson, J. Petersson, A. Velcich, L. Holm, G. C. Hansson, The inner
of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc. Natl.
Acad. Sci. U.S.A. 105, 15064–15069 (2008).
13. M. E. Johansson, G. C. Hansson, Immunological aspects of intestinal mucus and mucins.
Nat. Rev. Immunol. 16, 639–649 (2016).
14. K. M. Tytgat, H. A. Büller, F. J. Opdam, Y. S. Kim, A. W. Einerhand, J. Dekker, Biosynthesis
of human colonic mucin: Muc2 is the prominent secretory mucin. Gastroenterology 107,
1352–1363 (1994).
15. G. M. Birchenough, M. E. Johansson, J. K. Gustafsson, J. H. Bergstrom, G. C. Hansson, New
developments in goblet cell mucus secretion and function. Mucosal Immunol. 8, 712–719
(2015).
16. M. A. McGuckin, S. K. Linden, P. Sutton, T. H. Florin, Mucin dynamics and enteric
pathogens. Nat. Rev. Microbiol. 9, 265–278 (2011).
17. H. A. McCauley, G. Guasch, Three cheers for the goblet cell: Maintaining homeostasis
in mucosal epithelia. Trends Mol. Med. 21, 492–503 (2015).
18. G. Forstner, Signal transduction, packaging and secretion of mucins. Annu. Rev. Physiol.
57, 585–605 (1995).
19. A. Velcich, W. C. Yang, J. Heyer, A. Fragale, C. Nicholas, S. Viani, R. Kucherlapati, M. Lipkin,
K. Yang, L. Augenlicht, Colorectal cancer in mice genetically deficient in the mucin Muc2.
Science 295, 1726–1729 (2002).
20. M. Van der Sluis, B. A. E. De Koning, A. C. J. M. De Bruijn, A. Velcich, J. P. P. Meijerink,
J. B. Van Goudoever, H. A. Büller, J. Dekker, I. Van Seuningen, I. B. Renes,
A. W. C. Einerhand, Muc2-deficient mice spontaneously develop colitis, indicating that
MUC2 is critical for colonic protection. Gastroenterology 131, 117–129 (2006).
21. K. S. B. Bergstrom, V. Kissoon-Singh, D. L. Gibson, C. Ma, M. Montero, H. P. Sham, N. Ryz,
T. Huang, A. Velcich, B. B. Finlay, K. Chadee, B. A. Vallance, Muc2 protects against lethal
infectious colitis by disassociating pathogenic and commensal bacteria from the colonic
mucosa. PLOS Pathog. 6, e1000902 (2010).
22. K. S. B. Bergstrom, J. A. Guttman, M. Rumi, C. Ma, S. Bouzari, M. A. Khan, D. L. Gibson,
A. W. Vogl, B. A. Vallance, Modulation of intestinal goblet cell function during
infection by an attaching and effacing bacterial pathogen. Infect. Immun. 76,
796–811 (2008).
23. T. Prochnicki, E. Latz, Inflammasomes on the crossroads of innate immune recognition
and metabolic control. Cell Metab. 26, 71–93 (2017).
24. K. Wang, Q. Sun, X. Zhong, M. Zeng, H. Zeng, X. Shi, Z. Li, Y. Wang, Q. Zhao, F. Shao,
J. Ding, Structural mechanism for GSDMD targeting by autoprocessed caspases
in pyroptosis. Cell 180, 941–955.e20 (2020).
25. M. Wlodarska, C. A. Thaiss, R. Nowarski, J. Henao-Mejia, J. P. Zhang, E. M. Brown,
G. Frankel, M. Levy, M. N. Katz, W. M. Philbrick, E. Elinav, B. B. Finlay, R. A. Flavell, NLRP6
inflammasome orchestrates the colonic host-microbial interface by regulating goblet cell
mucus secretion. Cell 156, 1045–1059 (2014).
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Zhang et al., Sci. Immunol. 7, eabk2092 (2022) 4 February 2022
SCIENCE IMMUNOLOGY | RESEARCH ARTICLE
17 of 17
26. H. Hara, S. S. Seregin, D. Yang, K. Fukase, M. Chamaillard, E. S. Alnemri, N. Inohara,
G. Y. Chen, G. Núñez, The NLRP6 inflammasome recognizes lipoteichoic acid
and regulates Gram-positive pathogen infection. Cell 175, 1651–1664.e14 (2018).
27. M. Levy, C. A. Thaiss, D. Zeevi, L. Dohnalová, G. Zilberman-Schapira, J. A. Mahdi, E. David,
A. Savidor, T. Korem, Y. Herzig, M. Pevsner-Fischer, H. Shapiro, A. Christ, A. Harmelin,
Z. Halpern, E. Latz, R. A. Flavell, I. Amit, E. Segal, E. Elinav, Microbiota-modulated
metabolites shape the intestinal microenvironment by regulating NLRP6 inflammasome
signaling. Cell 163, 1428–1443 (2015).
28. M. E. V. Johansson, H. E. Jakobsson, J. Holmén-Larsson, A. Schütte, A. Ermund,
A. M. Rodríguez-Piñeiro, L. Arike, C. Wising, F. Svensson, F. Bäckhed, G. C. Hansson,
Normalization of host intestinal mucus layers requires long-term microbial colonization.
Cell Host Microbe 18, 582–592 (2015).
29. Q. Wang, Y. Wang, J. Ding, C. Wang, X. Zhou, W. Gao, H. Huang, F. Shao, Z. Liu,
A bioorthogonal system reveals antitumour immune function of pyroptosis. Nature 579,
421–426 (2020).
30. L. V. Hooper, D. R. Littman, A. J. Macpherson, Interactions between the microbiota
and the immune system. Science 336, 1268–1273 (2012).
31. S. Vaishnava, M. Yamamoto, K. M. Severson, K. A. Ruhn, X. Yu, O. Koren, R. Ley,
E. K. Wakeland, L. V. Hooper, The antibacterial lectin RegIIIgamma promotes the spatial
segregation of microbiota and host in the intestine. Science 334, 255–258 (2011).
32. J.-Y. Lee, J. A. Hall, L. Kroehling, L. Wu, T. Najar, H. H. Nguyen, W.-Y. Lin, S. T. Yeung,
H. M. Silva, D. Li, A. Hine, P.’n. Loke, D. Hudesman, J. C. Martin, E. Kenigsberg, M. Merad,
K. M. Khanna, D. R. Littman, Serum amyloid a proteins induce pathogenic Th17 cells
and promote inflammatory disease. Cell 180, 79–91. e16 (2020).
33. T. Sano, W. Huang, J. A. Hall, Y. Yang, A. Chen, S. J. Gavzy, J. Y. Lee, J. W. Ziel, E. R. Miraldi,
A. I. Domingos, R. Bonneau, D. R. Littman, An IL-23R/IL-22 circuit regulates epithelial
serum amyloid a to promote local effector Th17 responses. Cell 163, 381–393 (2015).
34. W. Kang, K. B. Reid, DMBT1, a regulator of mucosal homeostasis through the linking
of mucosal defense and regeneration? FEBS Lett. 540, 21–25 (2003).
35. M. Renner, G. Bergmann, I. Krebs, C. End, S. Lyer, F. Hilberg, B. Helmke, N. Gassler,
F. Autschbach, F. Bikker, O. Strobel–Freidekind, S. Gronert–Sum, A. Benner, S. Blaich,
R. Wittig, M. Hudler, A. J. Ligtenberg, J. Madsen, U. Holmskov, V. Annese, A. Latiano,
P. Schirmacher, A. V. N. Amerongen, M. D’Amato, P. Kioschis, M. Hafner, A. Poustka,
J. Mollenhauer, DMBT1 confers mucosal protection in vivo and a deletion variant is
associated with Crohn’s disease. Gastroenterology 133, 1499–1509 (2007).
36. X. Qi, S. M. Man, R. K. S. Malireddi, R. Karki, C. Lupfer, P. Gurung, G. Neale, C. S. Guy,
M. Lamkanfi, T. D. Kanneganti, Cathepsin B modulates lysosomal biogenesis and host
defense against Francisella novicida infection. J. Exp. Med. 213, 2081–2097 (2016).
37. B. Oronsky, S. Caroen, K. Zeman, M. Quinn, C. Brzezniak, J. Scicinski, P. Cabrales, T. R. Reid,
J. B. Trepel, N. D. Abrouk, C. Larson, A. Oronsky, H. E. Lybeck, R. M. Day, C. A. Carter, A part ial
response to reintroduced chemotherapy in a resistant small cell lung cancer patient after
priming with RRx-001. Clinical Medicine Insights. Oncology 10, 105–108 (2016).
38. C. Liu, Z. Xu, D. Gupta, R. Dziarski, Peptidoglycan recognition Proteins. J. Biol. Chem. 276,
34686–34694 (2001).
39. N. Kamada, S. U. Seo, G. Y. Chen, G. Nunez, Role of the gut microbiota in immunity
and inflammatory disease. Nat. Rev. Immunol. 13, 321–335 (2013).
40. G. M. Birchenough, E. E. Nystrom, M. E. Johansson, G. C. Hansson, A sentinel goblet cell
guards the colonic crypt by triggering Nlrp6-dependent Muc2 secretion. Science 352,
1535–1542 (2016).
41. N. Yissachar, Y. Zhou, L. Ung, N. Y. Lai, J. F. Mohan, A. Ehrlicher, D. A. Weitz, D. L. Kasper,
I. M. Chiu, D. Mathis, C. Benoist, An intestinal organ culture system uncovers a role
for the nervous system in microbe-immune crosstalk. Cell 168, 1135–1148.e12 (2017).
42. X. Zhu, L. Huang, Y. Zheng, Y. Song, Q. Xu, J. Wang, K. Si, S. Duan, W. Gong, Ultrafast
optical clearing method for three-dimensional imaging with cellular resolution. Proc.
Natl. Acad. Sci. U.S.A. 116, 11480–11489 (2019).
43. S. Wiles, K. M. Pickard, K. Peng, T. T. MacDonald, G. Frankel, In vivo bioluminescence
imaging of the murine pathogen Citrobacter rodentium. Infect. Immun. 74, 5391–5396
(2006).
44. J. W. Collins, K. M. Keeney, V. F. Crepin, V. A. K. Rathinam, K. A. Fitzgerald, B. B. Finlay,
G. Frankel, Citrobacter rodentium: Infection, inflammation and the microbiota. Nat. Rev.
Microbiol. 12, 612–623 (2014).
45. C. W. Davis, B. F. Dickey, Regulated airway goblet cell mucin secretion. Annu. Rev. Physiol.
70, 487–512 (2008).
46. R. Bansil, B. S. Turner, The biology of mucus: Composition, synthesis and organization.
Adv. Drug Deliv. Rev. 124, 3–15 (2018).
47. J. Trifaro, S. D. Rose, T. Lejen, A. Elzagallaai, Two pathways control chromaffin cell cortical
F-actin dynamics during exocytosis. Biochimie 82, 339–352 (2000).
48. J. M. Trifaro, S. D. Rose, M. G. Marcu, Scinderin, a Ca2+−dependent actin filament severing
protein that controls cortical actin network dynamics during secretion. Neurochem. Res.
25, 133–144 (2000).
49. B. J. van Klinken, E. Oussoren, J. J. Weenink, G. J. Strous, H. A. Büller, J. Dekker,
A. W. Einerhand, The human intestinal cell lines Caco-2 and LS174T as models to study
cell-type specific mucin expression. Glycoconj. J. 13, 757–768 (1996).
50. S. Mitrovic, C. Nogueira, G. Cantero-Recasens, K. Kiefer, J. M. Fernández-Fernández, J. F. Popoff,
L. Casano, F. A. Bard, R. Gomez, M. A. Valverde, V. Malhotra, TRPM5-mediated calcium uptake
regulates mucin secretion from human colon goblet cells. eLife 2, e00658 (2013).
51. L. Zhang, M. G. Marcu, K. Nau-Staudt, J. M. Trifaro, Recombinant scinderin enhances
exocytosis, an effect blocked by two scinderin-derived actin-binding peptides and PIP2.
Neuron 17, 287–296 (1996).
52. L. E. Tchakarov, L. Zhang, S. D. Rose, R. Tang, J. M. Trifaro, Light and electron microscopic
study of changes in the organization of the cortical actin cytoskeleton during chromaffin
cell secretion. J. Histochem. Cytochem. 46, 193–203 (1998).
53. G. D. Rak, E. M. Mace, P. P. Banerjee, T. Svitkina, J. S. Orange, Natural killer cell lytic granule
secretion occurs through a pervasive actin network at the immune synapse. PLoS Biol. 9,
e1001151 (2011).
54. M. A. Davis, M. R. Fairgrieve, A. den Hartigh, O. Yakovenko, B. Duvvuri, C. Lood,
W. E. Thomas, S. L. Fink, M. Gale Jr., Calpain drives pyroptotic vimentin cleavage,
intermediate filament loss, and cell rupture that mediates immunostimulation. Proc. Natl.
Acad. Sci. U.S.A. 116, 5061–5070 (2019).
55. M. Karmakar, M. Minns, E. N. Greenberg, J. Diaz-Aponte, K. Pestonjamasp,
J. L. Johnson, J. K. Rathkey, D. W. Abbott, K. Wang, F. Shao, S. D. Catz, G. R. Dubyak,
E. Pearlman, N-GSDMD trafficking to neutrophil organelles facilitates IL-1 release
independently of plasma membrane pores and pyroptosis. Nat. Commun. 11, 2212
(2020).
56. K. You, L. Wang, C. H. Chou, K. Liu, T. Nakata, A. Jaiswal, J. Yao, A. Lefkovith, A. Omar,
J. G. Perrigoue, J. E. Towne, A. Regev, D. B. Graham, R. J. Xavier, QRICH1 dictates
the outcome of ER stress through transcriptional control of proteostasis. Science 371,
eabb6896 (2021).
57. M. Levy, H. Shapiro, C. A. Thaiss, E. Elinav, NLRP6: A multifaceted innate immune sensor.
Trends Immunol. 38, 248–260 (2017).
58. J. K. Volk, E. E. L. Nyström, S. van der Post, B. M. Abad, B. O. Schroeder, Å. Johansson,
F. Svensson, S. Jäverfelt, M. E. V. Johansson, G. C. Hansson, G. M. H. Birchenough, The
Nlrp6 inflammasome is not required for baseline colonic inner mucus layer formation or
function. J. Exp. Med. 216, 2602–2618 (2019).
59. H. E. Jakobsson, A. M. Rodríguez-Piñeiro, A. Schütte, A. Ermund, P. Boysen, M. Bemark,
F. Sommer, F. Bäckhed, G. C. Hansson, M. E. V. Johansson, The composition of the gut
microbiota shapes the colon mucus barrier. EMBO Rep. 16, 164–177 (2015).
60. A. J. Jimenez, P. Maiuri, J. Lafaurie-Janvore, S. Divoux, M. Piel, F. Perez, ESCRT machinery is
required for plasma membrane repair. Science 343, 1247136 (2014).
61. S. Yoon, A. Kovalenko, K. Bogdanov, D. Wallach, MLKL, the protein that mediates
necroptosis, also regulates endosomal trafficking and extracellular vesicle generation.
Immunity 47, 51–65.e7 (2017).
Acknowledgments: We thank H. Luo, B. Lu, S. Zhu, G. Meng, L. Li, and W. Xu for providing
relevant mice in this study. We thank H. Luo, S. Zhu, and Q. Sun for helpful discussion and
I. C. Bruce for reading the manuscript. We thank D. Song, F. Zhou, and B. Wang of the Center
of Cryo-Electron Microscopy (CCEM) of Zhejiang University for technical assistance with
transmission and scanning electron microscopy. We are grateful for the technical support by
J. Chen, Q. Huang, and S. Liu of the Core Facilities, Zhejiang University School of Medicine.
Funding: This work was supported by the National Natural Science Foundation of China
(81930042, 81730047, 82025017, 31800759, and 32000630) and the Fundamental Research
Funds for the Central Universities. This work was also supported by the Key Laboratory of
Immunity and Inflammatory Diseases of Zhejiang Province and Liangzhu Laboratory of
Zhejiang Province. Author contributions: J.Z., D.J., Z.Q.Y., W.Y., Z.C., S.C., M.L., D.Y., Z.W., T.X.,
X.G., K.Z., H.F., Y.H., K.Y., and Q.Y. performed experiments. X.Z. and D.W. designed the research. J.Z.,
Q.Y., and D.W. wrote the manuscript. D.W. supervised the project. Competing interests: The
authors declare that they have no competing interests. Data and materials availability: All
data needed to evaluate the conclusions in the paper are present in the paper or the
Supplementary Materials.
Submitted 29 June 2021
Accepted 13 January 2022
Published 4 February 2022
10.1126/sciimmunol.abk2092
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
Use of think article is subject to the Terms of service
Science Immunology (ISSN ) is published by the American Association for the Advancement of Science. 1200 New York Avenue NW,
Washington, DC 20005. The title Science Immunology is a registered trademark of AAAS.
Copyright © 2022 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim
to original U.S. Government Works
Epithelial Gasdermin D shapes the host-microbial interface by driving mucus layer
formation
Jian ZhangQianzhou YuDanlu JiangKang YuWeiwei YuZhexu ChiSheng ChenMobai LiDehang YangZhen WangTing
XuXingchen GuoKailian ZhangHui FangQizhen YeYong HeXue ZhangDi Wang
Sci. Immunol., 7 (68), eabk2092. • DOI: 10.1126/sciimmunol.abk2092
Pores needed for mucus export
Colonic goblet cells synthesize mucin glycoproteins secreted through exocytosis to form a mucosal barrier that
separates the host epithelium and the luminal colonic microbiota. While analyzing the colonic mucosa in knockout
mice lacking the pyroptosis-associated pore-forming protein Gasdermin D (GSDMD) in intestinal epithelial cells,
Zhang et al. observed that the inner mucus layer normally associated with the apical epithelial surface was absent,
resulting in a marked increase in the number of surface-attached bacteria. Epithelial goblet cells were still present
at normal numbers but were defective in their ability to exocytose mucin granules to form the external mucus layer.
These studies reveal an unanticipated physiological role for GSDMD in mucus export and establishment of the normal
interface separating gut bacteria from colonic epithelial cells.
View the article online
https://www.science.org/doi/10.1126/sciimmunol.abk2092
Permissions
https://www.science.org/help/reprints-and-permissions
Downloaded from https://www.science.org at Zhejiang University on February 06, 2022
