Effect of Variation for Major Growth Habit Genes on Maturity and Yield in Five Spring Wheat Populations

Abstract

Segregation at major genes controlling plant height, photoperiod response, and vernalization response in wheat (Triticum aestivum L. em. Thell.) may have pleiotropic effects on several traits. Allelic variation at these loci can be monitored using polymerase chain reaction (PCR) markers. The effect of segregation at these loci on maturity and agronomic traits was measured for sets of recombinant inbred lines (RIL) developed from five crosses between spring wheat lines adapted to Montana and the Northern Great Plains. Results from field trials grown in multiple years in Bozeman, MT, showed that variation at Rht‐B1 and Rht‐D1 had large effects on most agronomic traits in two populations, including grain yield, grain protein concentration, and test weight. Variation at photoperiod response loci Ppd‐B1 and Ppd‐D1 influenced both heading date and date of flag leaf senescence under field conditions for two of three populations in which they were segregating. The insensitive allele at Ppd‐B1 was associated with higher grain yield in one population. Variation at Vrn‐B1 had a significant effect on heading date in the field for both populations in which it was segregating, with spring allele lines being earlier. Our results suggest that variation at Rht loci impacting plant height had large pleiotropic effects. Variation at photoperiod and vernalization loci impacted maturity characteristics but had less consistent effects on economic characteristics such as grain yield, test weight, and grain protein concentration.

Full text

RESEARCH
CROP SCIENCE, VOL. 49, JULY–AUGUST 2009 WWW.CROPS.ORG 1211
A
   control large portions of the variation for
growth habit traits in wheat (Triticum aestivum L. em. Thell.).
These include genes involved in vernalization, photo period
response, and plant stature. Several of these major genes con-
trolling growth habit have recently been cloned and sequenced
(Beales et al., 2007; Ellis et al., 2002; Sherman et al., 2004; Yan et
al., 2006), allowing the development of molecular markers useful
for assaying alleles present in breeding germplasm. Knowledge of
allelic variation at major loci controlling growth habit, and the
e ects of alternative alleles on important traits, may be useful for
directing selection during the breeding process.
One of the major growth habit distinctions in wheat relates
to response to vernalization, which controls the di erentiation of
wheat into winter and spring habits. Winter wheat requires a cold
period to induce  owering, while spring wheat  owers without
cold treatment. Winter and spring habit are controlled by three
major loci, referred to as Vrn-A1, Vrn-B1, and Vrn-D1 located on
chromosomes 5A, 5B, and 5D, respectively (Stelmakh, 1993; Zhang
et al., 2008). The spring habit alleles at these loci are dominant and
are epistatic to the winter alleles at other loci. Thus, winter wheat
requires the winter-habit allele at all three loci. The spring Vrn-A1
allele provides complete insensitivity to vernalization, while the
E ect of Variation for Major Growth
Habit Genes on Maturity and Yield
in Five Spring Wheat Populations
N. K. Blake, S. P. Lanning, J. M. Martin, M. Doyle, J. D. Sherman, Y. Naruoka, and L. E. Talbert*
ABSTRACT
Segregation at major genes controlling plant
height, photoperiod response, and vernaliza-
tion response in wheat (Triticum aestivum L. em.
Thell.) may have pleiotropic effects on several
traits. Allelic variation at these loci can be moni-
tored using polymerase chain reaction (PCR)
markers. The effect of segregation at these loci
on maturity and agronomic traits was measured
for sets of recombinant inbred lines (RIL) devel-
oped from  ve crosses between spring wheat
lines adapted to Montana and the Northern
Great Plains. Results from  eld trials grown in
multiple years in Bozeman, MT, showed that
variation at Rht-B1 and Rht-D1 had large effects
on most agronomic traits in two populations,
including grain yield, grain protein concentra-
tion, and test weight. Variation at photoperiod
response loci Ppd-B1 and Ppd-D1 in uenced
both heading date and date of  ag leaf senes-
cence under  eld conditions for two of three
populations in which they were segregating.
The insensitive allele at Ppd-B1 was associated
with higher grain yield in one population. Varia-
tion at Vrn-B1 had a signi cant effect on head-
ing date in the  eld for both populations in which
it was segregating, with spring allele lines being
earlier. Our results suggest that variation at Rht
loci impacting plant height had large pleiotropic
effects. Variation at photoperiod and vernaliza-
tion loci impacted maturity characteristics but
had less consistent effects on economic char-
acteristics such as grain yield, test weight, and
grain protein concentration.
Dep. of Plant Sciences and Plant Pathology, Montana State Univ.,
Bozeman, MT 59717. Received 25 Aug. 2008. *Corresponding author
(usslt@mont ana.edu).
Abbreviations: CAPS, cleaved ampli ed polymorphic sequence;
PCR, polymerase chain reaction; PI, photoperiod insensitive; PS, pho-
toperiod sensitive; RIL, recombinant inbred lines; SNP, single nucle-
otide polymorphism.
Published in Crop Sci. 49:1211–1220 (2009).
doi: 10.2135/cropsci2008.08.0505
© Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
All rights reserved. No part of this periodical may be reproduced or tran smit ted in a ny
form or by a ny means, electronic or mechanica l, including photocopy ing, recording,
or any in form ation storage and retrieva l system, wit hout permission in writi ng from
the publisher. Per mission for printi ng and for repri nting the material contained herein
has been obtained by the publisher.

1212 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, JULY–AUGUST 2009
spring Vrn-B1 and Vrn-D1 alleles provide a reduced vernal-
ization requirement relative to the winter alleles.
Photoperiod sensitive (PS) wheat genotypes require
long days for induction of  owering, while photoperiod
insensitive (PI) genotypes  ower independently of day-
length. Three loci control photoperiod response in wheat
(Scarth and Law, 1984; Mohler et al., 2004). These include
Ppd-D1, Ppd-B1, and Ppd-A1 on chromosomes 2D, 2B, and
2A, respectively. The dominant alleles at these loci confer
insensitivity to photoperiod, and the recessive alleles confer
sensitivit y. Ppd-D1 has been the most well-studied photo-
period response locus and is presumed to be the primary
determinant of photoperiod insensitivity (Beales et al.,
2007; Dyck et al., 2004; Worland et al., 1998). In Europe,
the dominant allele conferring an insensitive reaction (Ppd-
D1a) was associated with higher yields in dry, hot regions
of southern Europe, while in cool, damp environments of
England, PI varieties did not have an advantage (Worland
et al., 1994; Worland, 1996). In all environments, PI lines
tended to head and mature earlier than PS lines. Several
studies in the Northern Great Plains have found that PI lines
are earlier to head and shorter than their PS counterparts
(Busch et al., 1984; Marshall et al.,1989). Dyck et al. (2004)
studied sets of near-isogenic lines of Ppd-D1 at 10 locations
in the United States and Canada and found that PS lines
were later in heading and maturity, taller, and had a signi -
cantly higher grain yield, particularly in the more northerly
locations. The dominant Ppd-B1a allele confers an interme-
diate level of insensitivity and was found to control from 23
to 45% of the variation for heading date in a doubled haploid
population tested in France (Sourdille et al., 2000).
The major semidwarf genes in spring wheat from the
Northern Great Plains are found at the Rht-B1 and Rht-D1
loci on chromosomes 4B and 4D, respectively. Presence of
either Rht-B1b or Rht-D1b confers semidwarf growth habit,
while presence of both alleles confers a dwarf growth habit.
Presence of Rht-B1a and Rht-D1a results in tall plants.
Several studies have shown that semidwarf cultivars have
higher grain yield potential and reduced lodging under
high-input growing conditions (Knott, 1986; Hedden,
2003). McNeal et al. (1972) found that semidwarf wheat
lines containing either Rht-B1b or Rht-D1b outyielded tall
lines in Montana, except in very low yield environments,
where tall lines were superior. Butler et al. (2005) showed
that in a population of 140 recombinant inbred lines tested
in four Colorado environments varying in yield potential,
tall genotypes performed equally to or better than semid-
warf types. Within the semidwarf types, lines with Rht-B1b
yielded more than lines with Rht-D1b.
The recent molecular cloning of the major loci involved
in vernalization response, photoperiod response, and plant
height allows e cient characterization of germplasm. In
particular, polymerase chain reaction (PCR) markers were
developed for Vrn-A1, Vrn-B1, and Vrn-D1 (Fu et al., 2005;
Sherman et al., 2004; Yan et al., 2004). The photoperiod
re sp on s e l oc i on ch ro mos om e 2 have a lso b ee n c loned (Be ale s
et al., 2007). Primers for PCR that direct ampli cation of
each of the three genes have been developed. Allelic varia-
tion at Ppd-D1 has been shown to cosegregate with photo-
period response (Beales et al., 2007). Additionally, sequence
variation has been observed at the Ppd-B1 and Ppd-A1 loci,
although this variation has not been associated with segrega-
tion for photoperiod response (Beales et al., 2007). The Rht-
B1 and Rht-D1 loc i have also been cloned and PCR marker s
developed for the mutations that distinguish the functional
and nonfunctional alleles (Ellis et al., 2002).
The sum of evidence suggests that alleles at Vrn, Ppd,
and Rht loci often have pleiotropic e ects on agronomi-
cally important traits. In this report, we investigated the
contribution of allelic variation at the Vrn, Ppd, and Rht loci
to genetic variation for several traits in  ve spring wheat
populations developed from crosses between key parents for
Montana. Our intent was to estimate the degree to which
variation for agronomically important characteristics may
be explained by segregation at major growth habit loci. In
the course of the studies, a PCR-based marker distinguish-
ing sensitive from insensitive alleles at Ppd-B1 in several of
our populations was developed. Our results have implica-
tions for the development of spring wheat genotypes in the
Northern Great Plains of the United States and Canada.
MATERIALS AND METHODS
Population Development
Recombinant inbred lines (RIL) were derived by single-seed
descent starting with the F2 gener at ion fr om  ve crosses, including
‘McNeal’/’Thatcher’ (CI 10003), ‘Reeder’/’Conan’, ‘Choteau’/
Reeder, McNeal/Reeder, and MTHW9904/Choteau. The par-
ents, McNea l (L anning et al., 1994), Reeder (PI 613586), Cho tea u
(Lanning et al., 2004), and Conan (WestBred, LLC) are all widely
grown hard red spring wheat cultivars in Montana (Montana
Agricultural Statistics, 2007), and MTHW9904 is an experimen-
tal hard white spring wheat. Development of the McNeal/Reeder
population and the MTHW9904/Choteau population were pre-
viously described (Blake et al., 2007; Lanning et al., 2006).
The McNeal/Thatcher population consisted of 80 semi-
dwarf and 80 standard height RIL. To eliminate the e ects
of shading, the RIL were randomized within eight blocks in
groups of 20 for either the t all or sem idwar f genot ypes. Reeder
and Conan also di er for mutant Rht alleles, Rht-B1b and Rht-
D1b, respectively. The Reeder/Conan RIL consisted of dwar f,
semidwarf, and standard height genotypes, initially. For this
study, the dwar f genotypes were eliminated and only semid-
warf and standard height RIL were included.
Collection of Phenotypic Data
Experimental design for  eld trials is summarized in Table 1. All
experiments were grown in Bozeman, MT, at the Post Research
Farm (latitude 45.41° N, longitude 111.00° W, elevation 1455 m)
with plots consisting of 3 -m rows seeded at 60 seed m–1 for rainfed
trials and 90 seed m−1 for irrigated trials. Data collected in all RIL

CROP SCIENCE, VOL. 49, JULY–AUGUST 2009 WWW.CROPS.ORG 1213
diagnostic markers for Ppd-A1 and Ppd-B1 in our populations,
genome-speci c primer sets were developed from these two
loci (Ppd-A1: GenBank accession DQ885753; Ppd-B1: GenBank
accession DQ885757). These primers were used to amplify genic
regions from Reeder, Conan, McNeal, and Choteau, which were
then sequenced following the method of Blake et al. (2004). This
allowed development of allele-speci c primers for both loci.
A single nucleotide polymorphism (SNP) in the Ppd-B1 locus,
distinguishing Reeder from McNeal and Choteau, was used to
develop an allele-speci c primer (B6-RDR1F: CCCAATATC-
TACTCCTCCGC) paired with a reverse pr imer (Ppd2B_ SNP5_
R1: TCTGAATGATGATACACCATG) published by Beales et
al. (2007). A di erent polymorphism distinguished the Ppd-B1
locus in Reeder and Conan, allowing the design of a Reeder
allele-speci c primer set (ppd B-31F: AGGCTCTTTGGCTAT-
GACGT and ppdB8-R2: ATTCCAACGTTACAAGTGGG).
Polymerase chain reaction products were ampli ed with both sets
of Ppd-B1 markers using an ABI 2720 thermocycler (Applied Bio-
systems, Foster Cit y, CA) with a touchdown program: 94°C for
5min + 10 cycles (94°C for 20 s, 60°C for 20 s, decrease 0.5°C/
cycle, 72°C for 2 min) + 35 cycles (94°C for 20 s, 50°C for 20 s,
72°C for 2 min) + 72°C for 10 min. Reaction products were
visualized using to 0.15 g mL–1 agarose gels.
A similar strategy was followed to develop a Ppd-A1 allele-
speci c cleaved a mpli ed polymorphic sequence (CAPS) m arker
from an SNP between Reeder and Conan. Ampli cation with
the primers PpdA-F4: GCAGGGA AAGACAAGGCTGAT-
GAAAC and PpdA-R4: CCGCACTTCTACTATGTACTC-
TACG was performed with a touchdown program: 94°C for
5 min + 10 cycles (94°C for 20 s, 63°C for 20 s, decrease 0.5°C/
cycle, 72°C for 2 min) + 35 cycles (94°C for 20 s, 58°C for 20 s,
72°C for 2 min) + 72°C for 10 min.
Polymerase chain reaction products were digested with
two units of restriction enzyme RsaI. The digested reaction
products were distinguished using 12% polyacrylamide gels.
Statistical Analysis
Data for each phenotypic trait in each population were analyzed
via analysis of variance (ANOVA) using a model for a random-
ized block combined over environments using PROC MIXED
nurseries included date of heading, plant height, grain yield, test
weight, and grain protein concentration. Heading date was mea-
sured as the number of days from planting when 50% of the heads
were completely emerged. Plant height was the average of two
measurements made from the soil surface to the top of the spikes,
excluding awns. Grain yield was determined from the raw grain
weight of each plot. Test weight was measured from a sample of
cleaned grain on a Seedburo (Chicago, IL) test weight scale. Grain
protein concentration was obtained on whole grain samples using
an Infratec (Tecator, Höganäs, Sweden). Additionally, date of  ag
leaf senescence was determined for the McNeal/Thatcher, Reeder/
Conan, McNeal/Reeder, and Choteau/Reeder populations as the
number of days from planting when 75% of the plot exhibited  ag
leaves showing complete loss of green color. The duration of green
leaf period after heading was determined by subtracting heading
date from the date of  ag leaf senescence. In addition to the  eld
data, heading date was measured for parents and RIL grown under
12-hour daylength in a growth chamber. For this experiment, two
replications were tested, with each replication consisting of two to
four plants per line. Growth chamber temperatures ranged from 21
to 22°C and photosynthetic radiation was 580 µmol m−2 s−1. Plants
were grown in Cone-tainer pots (Stuey and Sons, Corvallis, OR)
with a soil capacit y of 164 mL. Soil was equal parts (by volume) of
loam soil, washed concrete sand, and sphagnum peat moss.
Montana Advanced Spring Wheat Yield Trial
The trial consisted of 64 lines grown in four-row 3.3-m plots
with three replications grown in 10 locations. Phenotypic data
collected from this nursery pertinent for this report included
heading date and plant height. These lines were also tested for
heading under 12-hour days in the growth chamber using the
same conditions as for the RIL populations.
Genotypic Data
Primer sets used to screen the parents of the  ve populations have
been previously described (Beales et al., 2007; Ellis et al., 2002;
Sherman et al., 2004; Yan et al., 2006). Loci analyzed included
Vrn-B1, Vrn -D1, Ppd-D1, Rht-B1, and Rht-D1. Polymerase chain
reaction conditions followed published protocols. Primer sets that
identi ed allelic di erences between parents were used to geno-
type the appropriate RIL population. Reaction
products were vi sua l ized usi ng 1.5% ag arose gels.
In addition to testing RIL developed from  ve
spring wheat crosses, we determined genotypes
at the Ppd, Vrn, and Rht loci for lines tested in
the Montana Advanced Spring Wheat Yield
Trial in 2007. Complete genotyping data was
not obtained for six lines from this trial, so these
were excluded from analyses.
Development of Polymerase
Chain Reaction Markers
for Ppd-B1 and Ppd-A1
In the course of the experiments, it became
apparent that an allele conferring photoperiod
insensitivity not detectable by previously pub-
lished primer sets was segregating in populations
derived from the cultivar Reeder. To develop
Table 1. Recombinant inbred line populations tested for association between
variation at growth habit loci and maturity traits in spring wheat (Tr i ti c um a es-
tivum L. em. Thell.).
Parents Generation of
line derivation
Number
of RIL†Design‡Year o f
experiment Irrigation regime
McNeal/Thatcher F6160 RCB§2006 Rainfed, irrigated
2007 Rainfed, irrigated
Reeder/Conan F592 RCB 2006 Rainfed
2007 Rainfed
MTHW9904/
Choteau
F594 RCB 2004 Rainfed, irrigated
2005 Rainfed, irrigated
McNeal/Reeder F450 RCB 2004 Rainfed, irrigated
2005 Rainfed, irrigated
Choteau/Reeder F446 Lattice 2007 Rainfed
†Recombinant inbred lines.
‡All experiments co nsisted of three replic ations, with each plot be ing a single row of 3.3 m. All expe riments
were grown at the Arthur Post Resea rch Farm in Boze man, MT.
§RCB, randomized complete block.

1214 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, JULY–AUGUST 2009
in SAS (SAS Institute, 2003). Genotype and replication were con-
sidered random factors, and environment was considered a  xed
factor. Entry means averaged over environments and replications
were used for analysis of gene e ects. Data were combined over
environments (years and rainfed versus irrigated) in that the sums
of squares owing to entry by environment interaction were low
relative to sums of squares owing to main e ects. A single-factor
ANOVA was conducted, where the single factor was the segregat-
ing locus with two allelic classes using PROC GLM in SAS (SAS
Institute, 2003). Di erences between allele class means were tested
with an F ratio. This was done for each segregating gene for each
population and in the Montana Advanced Spring Wheat Yield
Trial. In populations where more than one locus was segregat-
ing, the model was then extended to include all segregating genes
and their interactions. The proportion of variation attributable to
segregating gene(s) (R2) was computed as the sum of squares for
segregating gene(s) divided by the total sum of squares.
RESULTS
Variation at Growth Habit Loci
for Elite Yield Trial Lines
Table 2 shows variation among lines for many of the genes
important in controlling growth habit in the Montana
Advanced Spring Wheat Yield Trial in 2007. Lines within
the nurser y varied for Vrn-B1, Vrn-D1, Ppd-D1, Ppd-B1, Rht-
B1, and Rht-D1. There were 38 and 21 lines with the spring
and winter alleles at Vrn-B1, respectively. An F-test showed
that the lines with the spring version of Vrn-B1 headed
almost 1 d earlier (P = 0.05) than lines with the winter allele
(data not shown). There were only eight lines with the spring
allele at Vrn-D1, and no signi cant di erences were detected
among lines with alternate alleles at this locus. Eleven lines
contained the insensitive allele at Ppd-D1, and these lines
headed 1 d earlier (P = 0.06) and were shorter than lines with
the sensitive allele at this locus (data not shown). The frac-
tion of lines that were semidwarf was 52/59, with 21 and 31
having reduced height alleles at Rht-B1 and Rht-D1, respec-
tively. Comparison of genotype means was not conducted for
height, in that the standard height lines were all unimproved
cultivars compared with the semidwarf lines.
Development of Polymerase Chain Reaction
Markers for Ppd-B1 and Ppd-A1
It was apparent that several PI lines in the Montana Advanced
Spring Wheat Yield Trial and in the segregating populations
did not contain the insensitive allele at the Ppd-D1 locus. This
was particularly the case for populations containing Reeder
spring wheat as a parent. Thus, we wished to obtain a PCR
marker for the Reeder allele conferring insensitivity to pho-
toperiod with which to assay the segregating populations.
McNeal and Choteau are both PS, while Reeder is PI.
All three lines contain the sensitive allele at Ppd-D1 as deter-
mined by PCR assay. The McNeal/Reeder and Choteau/
Reeder populations both segregated in an approximate 1:1
ratio for sensitive versus insensitive types; 20 vs. 30 and
21 vs. 25, respectively. Beales et al. (2007) reported PCR
assays for allelic variation at Ppd-A1 and Ppd-B1 amongst a
set of European wheat lines. Reeder, McNeal, and Choteau
were not polymorphic for any of these PCR assays. One
SNP was revealed in 7000 bases of sequence that di eren-
tiated Reeder from both McNeal and Choteau at Ppd-B1.
A marker developed from the Reeder SNP was used for
analyses of the segregating populations. The product ampli-
 ed from Reeder was approximately 1350 bp.
A similar issue was found in the Reeder/Conan popu-
lation. Both Conan and Reeder are PI (data not shown).
However, 25 of the 92 RIL developed from the Reeder/
Conan cross were PS, suggesting that the lines had insensi-
tive alleles at di erent loci. Screening of the parents showed
that Conan had the insensitive allele at Ppd-D1, while Reeder
had the sensitive allele. Thus, Reeder was apparently insen-
sitive owing to alleles at a di erent locus. Reeder and Conan
did not di er for the published polymorphisms at Ppd-A1 or
Ppd-B1 or for the Ppd-B1 marker we developed to distin-
guish Reeder from Choteau and McNeal. One SNP among
13,000 bases was identi ed between Reeder and Conan for
Ppd-B1 that ampli ed a product of approximately 1500 bp
in Reeder and not Conan. This primer set was used to ana-
lyze all RIL in the Reeder/Conan population.
Similarly, we developed an allele-speci c CAPS marker
for the Ppd-A1 locus after sequencing 2000 bases from
Reeder and Conan. The marker yielded three banding pat-
terns that distinguished parents of all populations except
McNeal/Thatcher. Thus, the primer set could be used to
determine phenotypic associations with sequence varia-
tion at the Ppd-A1 locus. Reeder and Choteau had di erent
banding patterns, while McNeal, Conan, and MTHW9904
shared a pattern distinct from the other two cultivars.
Association of Phenotypic Variation
with Allelic State for Growth Habit Loci
in Five Spring Wheat Populations
Five spring wheat populations were available with which to
analyze the e ects of alternative alleles at the growth habit
loci on maturity and economic traits. Table 3 shows that
Table 2. Allelic variation at major growth habit loci among lines
entered in the 2007 Montana Advanced Spring Wheat (Tri t i-
cum aestivum L. em. Thell.) Yield Trial.
Locus Allele Number of lines
Vrn-B1 Spring (Vrn -B1)38
Winter (vrn-B1)21
Vrn-D1 Spring (Vrn-D1)8
Winter (vrn-D1)51
Ppd-D1 Insensitive (Ppd-D1a)11
Sensitive (Ppd-D1b)48
Rht-B1 Wild-type (Rht-B1a)38
Mutant (Rht-B1b)21
Rht-D1 Wild-type (Rht-D1a)28
Mutant (Rht-D1b)31

CROP SCIENCE, VOL. 49, JULY–AUGUST 2009 WWW.CROPS.ORG 1215
genotype e ects were signi cant for all traits in all popula-
tions, providing an opportunity to test the phenotypic e ect
of alternative alleles at major growth habit loci. The popula-
tions were not all grown in the same years (Table 1), so that
comparison between populations is not possible. Heading
date under 12-hour daylength was determined for all popu-
lations in a growth chamber experiment. Three of the popu-
lations showed clear demarcation between lines that  owered
early (photoperiod insensitive) and lines that  owered late
(photoperiod sensitive). Two populations (McNeal/Thatcher
and MTHW9904/Choteau) had no lines that headed as early
as the PI lines in the other populations, suggesting that RIL
in these populations were all PS. The parents were screened
for variation at the major growth habit loci, including Vrn-
B1, Vr n-D1, Ppd-A1, Ppd-B1, Ppd-D1, Rht-B1, and Rht-D1.
The number of loci containing di erent alleles in the parents
ranged from one (Rht-D1) for McNeal and Thatcher to six
for Reeder and Conan. E ects of alternative alleles on phe-
notypic performance of RIL from the  ve populations are
shown in Table 4 and Table 5 and are presented below.
McNeal/Thatcher
McNeal is a semidwarf cultivar owing to Rht-D1b, while
Thatcher is standard height. The RIL population consisted
of 80 semidwarf and 80 standard height progeny. Alleles at
Rht-D1 had a major e ect on most traits, including  eld
heading date, 12-hour heading date, green leaf duration
after heading, plant height, yield, test weight, and grain
protein concentration. Allelic state at Rht-D1 accounted
for 93% of the height variation in the population, 67% of
grain yield variation, 14% of test weight variation, 11% of
heading date variation, and 15% of the variation for green
leaf duration after heading (Table 5).
Reeder/Conan
This population was segregating for six of the major growth
habit loci. Alternative alleles at the Vrn-B1 locus a ected
maturity traits, with the spring allele conferring earlier head-
ing (P = 0.07) and longer green leaf duration after heading
(P = 0.01). The population was segregating for all three Ppd
loci, based on sequence variation, but only Ppd-B1 and Ppd-
D1 impacted maturity traits. Lines with the insensitive Ppd-
D1 allele were earlier to head by 3 d in the  eld (P < 0.001)
and had a longer green leaf duration after heading (P < 0.01).
These lines headed 13 d earlier under 12-hour daylength (P <
0.001). Test weight was higher for the lines with the insensi-
tive Ppd-D1 allele. The e ect of the Reeder allele at Ppd-B1
similarly decreased both  eld and 12-hour heading date (P =
0.03 and < 0.001, respectively), indicating it to be the insen-
sitive allele. This allele also accelerated  ag leaf senescence
by about a day (P < 0.01). Allelic state at the Ppd-A1 locus
had no e ect on maturity traits in this population but was
associated with increased protein concentration (P < 0.01).
Cumulatively, alleles at Ppd-B1 and Ppd-D1 controlled 78
and 44% of the variation for 12-hour heading date and  eld
heading date, respectively. There was a signi cant interac-
tion between Ppd-B1 and Ppd-D1 (P < .0001) for 12-hour
heading. Lines with both sensitive alleles headed 19 d later
than lines with both insensitive alleles. Lines insensitive for
Ppd-D1 and sensitive for Ppd-B1 headed 1 d later than lines
with both insensitive alleles and almost 6 d earlier than lines
sensitive for Ppd-D1 and insensitive for Ppd-B1. Along with
Table 3. Mean and range for maturity traits† in fi ve spring wheat (Triticum aestivum L. em. Thell.) populations.
Poulation HD—12 h HD—fi eld FLS GLDAH Plant height Test weight Grain yield Grain protein
————— d ————— d from Jan. 1 d cm kg m−3 kg ha–1 g kg–1
McNeal/Thatcher Mean 76.9 63.4 206.8 27.4 93.5 737 3608 154
Range 61–100‡59.2–66.6 204.5–208.9 24.9– 30 71.2–114.9 647–737 2439–4770 138–172
P§<0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001
Reeder/Conan Mean 58.5 61.3 210.9 32.6 92.3 750 3467 160
Range 47.5–82 56–68 206–216 27.5–36.7 70.5–111.8 696–789 1632–4243 145–179
P <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001
MTHW9904/
Choteau
Mean 85.3 70.4 ND¶ND 96.3 776 5249 155
Range 66.5 –99 66.3–74.5 73.5–125.3 726–809 3097–8869 129–176
P <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001
McNeal/Reeder Mean 62.4 71.6 218.9 34.3 99.0 773 5776 147
Range 49.5–81.5 68.3–76.6 215.7–222.4 31.8–37.6 72.8–121.7 648–792 4931–6833 137–161
P<0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001
Reeder/Choteau Mean 62.5 65.9 212.4 31.5 86.8 780 4804 147
Range 47–82 61.7–68.7 209.8–214 28.1–34.1 77.8–92.5 748–811 3837–5778 132–161
P <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 0.01 <0.0001
†HD, heading date; FLS, day of fl ag leaf sene scence; GLDAH, green l eaf durati on after heading.
‡Experiment was terminated after 100 d. Two RIL had not h eaded at that time.
§P, genotype P value.
¶These tr aits were not d etermined in this population.

1216 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, JULY–AUGUST 2009
Table 4. Effect of allelic variation at major loci for plant growth habit on agronomic traits† in fi ve spring wheat (Triticum aestivum
L. em. Thell.) populations.
Population Locus Allele‡ No. RIL HD-
12 h HD-fi eld FLS GLDAH Plant
height
Tes t
weight
Grain
yield
Grain
protein
————— d ————— d from Jan. 1 d cm kg m–3 kg ha –1 g kg–1
McNeal/Thatcher Rht-D1 wt 80 75.5 62.1 206.8 27.9 106.9 746 3138 159
mutant 80 77.8 62.9 206.8 27.1 79.9 731 4072 150
P§ 0.069 <0.001 0.768 <0.001 <0.001 <0.001 <0.001 <0.001
Reeder/Conan Vrn-B1 winter 53 58.9 61.7 210.9 32.2 93.4 750 3454 161
spring 36 58.5 60.7 210.9 33.2 92.1 752 3420 160
P 0.855 0.069 0.872 0.014 0.615 0.716 0.703 0.470
Ppd-A1 Rdr 4 8 59.2 61.0 210.7 32.7 91.5 750 3474 158
Con 42 5 8 . 8 61. 6 211 .1 32.5 9 4. 3 74 9 3 4 0 7 16 2
P 0.825 0.264 0.222 0.636 0.257 0.474 0.483 0.005
Ppd-B1 Rdr 49 54.6 60.7 210.5 32.7 92.8 749 3460 160
Con 42 64.1 62.0 211.4 32.4 92.8 750 3447 160
P <0.0001 0.026 0.011 0.398 0.999 0.918 0.870 0.863
Ppd-D1 sens 40 65.4 62.8 211.9 32.1 94.5 746 3474 160
insens 40 52.2 59.7 210.0 33.2 89.8 752 3467 160
P <0.001 <0.001 <0.0 01 0.009 0.072 0.157 0.958 0.746
Rht- B1 w t 64 58.4 61.2 210.7 32.6 9 6.4 752 34 54 161
mutant 26 59.3 61.5 211.2 32.7 84.1 745 3454 158
P 0.643 0.544 0.193 0.767 <0.001 0.08 6 0.959 0.083
Rht-D1 wt 71 59.5 61.5 211.1 32.6 95.3 750 3427 161
mutant 18 57.6 60.5 210.3 32.8 83.2 748 3541 157
P 0.43 0.15 0.09 0.61 <0.001 0.52 0.32 0.06
MTHW9904/
Choteau
Vrn-D1 winter 36 85.2 69.3 ND ND 96.3 776 5153 153
spring 46 84.3 69.4 97.1 777 5160 153
P 0.69 0.90 0.61 0.48 0.92 0.91
Ppd-A1 MTHW 47 86.5 69.6 ND ND 97.0 779 5268 152
Cht 45 84.2 69.1 95.5 776 5086 154
P 0.25 0.16 0.36 0.30 0.04 0.13
Rht- B1 w t 58 8 3.1 6 9.5 ND ND 10 0.0 779 5059 155
m u ta n t 3 2 9 0 .1 6 9 .1 8 9 . 2 7 7 3 54 2 2 14 8
P <0.001 0.33 <0.001 0.030 <0.001 <0.001
McNeal/Reeder Vrn-B1 winter 15 63.7 68.3 219.2 34.0 99.7 773 5846 146
spring 24 62.1 67.2 218.5 34.5 98.6 776 5778 147
P 0.60 0.06 0.15 0.24 0.55 0.36 0.59 0.56
Ppd-A1 Rdr 21 64.6 68.2 219.2 34.2 99.8 772 6027 146
McN 26 60.8 67.2 218.6 34.6 9 8.6 776 5664 148
P 0.15 0.07 0.16 0.31 0.47 0.08 <0.001 0.28
Ppd-B1 Rdr 23 58.5 67.9 218.8 34.1 98.0 776 5852 146
McN 27 66.5 67.7 219.0 34.5 9 8.0 772 5711 148
P 0.002 0.73 0.71 0. 35 0.97 0.12 0. 25 0.21
Rht- B1 w t 31 61.9 67.8 219.0 34.5 97.9 775 5 825 146
mutant 14 62.5 67.3 218.4 34.3 100.6 775 5832 150
P 0.84 0.41 0.12 0.65 0.13 0.68 0.97 0.03
Rht-D1 wt 14 62.5 67.3 218.4 34.3 100.6 775 5832 150
mutant 31 61.9 67.8 219.0 34.5 97.9 775 5825 146
P 0.84 0.41 0.12 0.65 0.13 0.68 0.97 0.03
Choteau/Reeder Vrn-D1 winter 20 62.7 66.1 212.5 31.5 87.1 784 4831 146
spring 24 62.9 65.6 212.2 31.5 86.8 780 4844 147
P 0.94 0.36 0.22 0.92 0.67 0.30 0.93 0.73
Ppd-A1 Rdr 18 64.6 66.4 212.7 31.3 87.0 779 4710 149
Cht 2 3 6 0 . 5 6 5. 4 2 12 .1 31 .7 87.1 7 8 4 4 9 52 1 45
P 0.19 0.05 0.04 0.44 0.91 0.15 0.06 0.09
Ppd-B1 Rdr 26 55.8 65.4 212.2 31.9 86.1 782 4932 146
Cht 20 71.5 66.6 212.6 31.0 87.9 780 4683 148
P <0.001 0.006 0.26 0.03 0.03 0.467 0.05 0.44
†HD, heading date; FLS, day of fl ag leaf sene scence; GLDAH, green l eaf durati on after heading.
‡wt, wild-type; sens, s ensitive; insens, ins ensitive; Rd r, Reeder; Cht, Choteau; McN, McN eal; Con, Conan; MTHW, MTHW9 904.
§P, P value of F ratio from s ingle-f actor ANOVA.

CROP SCIENCE, VOL. 49, JULY–AUGUST 2009 WWW.CROPS.ORG 1217
variation at Rht-D1, these loci accounted for 39% of the
variation for date of  ag leaf senescence.
The Reeder/Conan RIL had two height phenotypes,
semidwarf and standard height. The semidwarf lines resulted
from the mutant allele at either Rht-B1 or Rht-D1, while the
standard height lines were wild-type at both loci. Compar-
isons of semidwarf lines (either Rht-B1b or Rht-D1b) with
standard height lines showed that semidwarf lines were sig-
ni cantly shorter, with lower protein concentration and test
weight (data not shown). This is also re ected in the single
locus comparisons in Table 4, as lines with the mutant allele
at either Rht-B1 or Rht-D1 were shorter and had lower grain
protein concentration than lines with the respective wild-
type allele. In combination with variation at Ppd-D1, 65% of
height variation was explained by segregation at these loci.
MTHW9904/Choteau
The MTHW9904/Choteau population was segregating at
Vrn-D1 and Rht-B1. There was no measurable e ect of the
alternative alleles at Vrn-D1. The mutant allele at Rht-B1
(Rht-B1b) resulted i n si g n i cantly shorter plants (P < 0.001),
lower test weight (P = 0.03), higher grain yield (P < 0.001),
lower grain protein concentration (P < 0.001), and later
heading under 12-hour days (P < 0.001). This population
did not vary for either Ppd-D1 or Ppd-B1, as is re ected in
the late heading date for all RIL in this population under
12-hour days. The MTHW9904 allele for Ppd-A1 increased
yield (P = 0.04) but did not impact other traits. Cumula-
tively, variation at Rht-B1 and Ppd-A1 explained 22% of the
variation for yield in this population.
McNeal/Reeder
The McNeal/Reeder population var ied at Vrn-B1, Ppd-A1,
Ppd-B1, Rht-B1, and Rht-D1 (Table 4). In contrast to the
Reeder/Conan population, all RIL were semidwarf with
no standard height lines tested in the population. As with
the Reeder/Conan RIL, the Vrn-B1 spring allele tended
to cause earlier heading in the  eld (P = 0.06). The insen-
sitive Ppd-B1 allele contributed by Reeder had a major
e
ect only on heading date under 12-hour days (P < 0.01).
The alternative alleles at Ppd-A1 had a measurable e ect,
with lines containing the Reeder allele heading 1 d later
(P = 0.07), yielding signi cantly more (P < 0.001) with
lower test weight (P = 0.08) than lines with the McNeal
allele (Table 4). Allelic state at Ppd-A1 accounted for 7%
of the variation for test weight and 23% of the variation
for grain yield (Table 5). The cumulative e ects of alleles
at Vrn-B1 and Ppd-A1 described 18% of the variation for
heading date in the  eld. E ects of the Rht alleles were
modest, although the Rht-B1b lines had signi cantly
higher grain protein concentration (P = 0.03), accounting
for 9% of variance for this trait.
Table 5. Percentage of phenotypic variation for maturity and agronomic traits† attributable to segregation at major loci for fi ve
spring wheat (Triticum aestivum L. em. Thell.) populations. Loci included in the analysis showed signifi cant mean differences
between alleles based on single-factor ANOVA (Table 4).
Population Gene HD-12 hr HD-fi eld FLS GLDAH Plant height Test weight Grain yield Grain protein
—————————————————————————————— T r a i t s † ——————————————— ———————————————
McNeal/Thatcher Rht-D1 211–1593 14 67 42
Reeder/Conan Vrn-B1 –5–7––––
Rht-B1 ––––23 3 – 3
Rht-D1 ––3–18 – – 8
Ppd-A1 ––––––– 8
Ppd-B1 2857–––––
Ppd-D1 52 33 33 8 4 – – –
Cumulative‡78 44 39 17 65 3 – 23
MTHW9904/Choteau Rht-B1 12 – – – 46 5 18 28
Ppd-A1 ––––– – 5 –
Cumulative 12 – – – 46 5 22 28
McNeal/Reeder Vrn-B1 –9––––––
Ppd-A1 –7––– 723 –
Ppd-B1 19–––––––
Rht-B1 ––––––– 9
Rht-D1 ––––––– 9
Cumulative 19 18 – – – 7 23 9
Choteau/Reeder Ppd-A1 –910–– – 8 7
Ppd-B1 6216–1010– 8–
Cumu lative 62 17 10 10 10 – 14 7
†HD, heading date; FLS, day of fl ag leaf sene scence; GLDAH, green l eaf durati on after heading.
‡Cumulative P values were generated from analysis of all signi fi cant lo ci combined in the same PROC GLM model statement and are not the sum of P val ues of ind ividu al l oci.
Any missing data from individual loci were excluded from the cumulative analysis, which generally resulted in fewer ob servations than an alysis of individu al loci.

1218 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, JULY–AUGUST 2009
Choteau/Reeder
The Choteau/Reeder population was segregating at Vrn-
D1, Ppd-A1, and Ppd-B1 (Table 4). Alternative alleles at
Vrn-D1 had no measurable e ect on phenotype. Alterna-
tive alleles at Ppd-A1 impacted heading date, as lines with
the Reeder allele headed 1 d later in the  eld (P = 0.05)
and 4 d later under 12-hour conditions. The Ppd-A1
Reeder allele was associated with lower yield, in contrast
to its e ect in the McNeal/Reeder population. However,
Choteau and McNeal have di erent alleles at this locus.
Variation at Ppd-B1 had a major e ect on most maturity
traits. Heading date in the  eld was 1 d earlier (P < 0.01)
and almost 16 d earlier under 12-hour days (P < 0.001)
in lines with the Reeder allele. Lines with the Reeder
allele were shorter (P = 0.03), had longer green leaf dura-
tion after heading (P = 0.03), and greater yield (P = 0.05).
The cumulative e ect of variation at Ppd-A1 and Ppd-B1
accounted for 17% and 14% of the variation for heading
date and grain yield, respectively (Table 5).
DISCUSSION
Major genes controlling growth habit response in wheat
have been well characterized genetically. These include
Vrn genes that in uence vernalization response, Ppd genes
that control photoperiod response, and Rht genes that
in uence plant height. Allelic variants for these loci may
have pleiotropic e ects that in uence a range of economic
traits (Butler et al., 2005; Dyck et al., 2004; Iqbal et al.,
2007; Sourdille et al., 2000; Zhang et al., 2008). Deter-
mination of alleles at Vr n, Ppd, and Rht loci is possible
owing to the recent development of PCR-based markers
for major genes controlling wheat development and matu-
rity. Many of these markers are diagnostic across a range
of germplasm, such as the Rht genes that confer semidwarf
habit, the Vrn genes, and the Ppd-D1 gene determining
photoperiod sensitivity. The Ppd-A1 and Ppd-B1 genes
have also been cloned, and PCR primers exist to pref-
erentially amplify these genes. However, the published
polymorphisms at these loci were not present in our ger-
mplasm. Our results showed that a photoperiod response
gene in addition to Ppd-D1 was present in our material,
especially in lines derived from the cultivar Reeder. Thus
an initial objective was to develop PCR-based markers to
allow us to distinguish Reeder from other parents in RIL
populations. Two di erent primer sets were developed for
Ppd-B1 in this regard, one that identi ed an SNP distin-
guishing Reeder from Choteau and McNeal and one that
distinguished Reeder from Conan. Additionally, an SNP-
based primer set was developed to di erentiate Ppd-A1 in
parents of four of the populations.
Screening of the germplasm in the Montana Advanced
Spring Wheat Yield Trial showed variation for most of
the major growth-related loci. In particular, the nursery
contained both semidwarf and standard height lines, with
semidwarf lines resulting from either Rht-B1b or Rht-D1b.
In the McNeal/Thatcher population, lines with semidwarf
growth habit resulting from Rht-D1b yielded approximately
30% more t han standard height lines. In the Reeder/Conan
populations, semidwarf lines showed no signi cant yield
advantage (data not shown). The yield advantage for semid-
warf lines was 7% in the MTHW9904/Choteau population.
Thus, with the genotypes and environments in this experi-
ment, semidwarf growth appears to be favorable. Higher
grain yield potential has been observed under high-input
growing conditions (Knott, 1986; Hedden, 2003; McNeal
et al., 1972) for semidwarf lines in previous experiments.
However, McNeal et al. (1972) found that tall lines were
superior in low-yield environments. Butler et al. (2005)
found no advantage to semidwarf genotypes in a popula-
tion of 140 recombinant inbred lines tested in four Colo-
rado environments varying in yield potential. Both rainfed
and irrigated environments used for the present study rep-
resent h igh water input s relat ive t o spring wheat production
in most of the Great Plains.
There was also variation at photoperiod response loci
among lines in the Montana Advanced Spring Wheat Yield
Trial. Eleven lines had the insensitive allele at Ppd-D1. Sev-
eral additional lines were apparently insensitive to photo-
period based on 12-hour heading date (data not shown),
although there was not a clear phenotypic demarcation, as
observed in the RIL populations. However, a preponder-
ance of the lines that headed relatively early under 12-hour
days had the Reeder nucleotide for the Ppd-B1 SNP marker,
suggesting that they contained the insensitive allele at Ppd-
B1. This conjecture is supported by pedigree data, as over
one-half of these lines had Reeder as a parent or grandpar-
ent. However, the Reeder SNP is not completely diagnos-
tic for the insensitive allele, as some sensitive alleles (as in
Thatcher) had the Reeder nucleotide at this SNP site. This
indicates that the Reeder SNP is unlikely to be the causal
mutation for insensitive photoperiod response.
The insensitive allele at Ppd-D1 was segregating only
in the Reeder/Conan population and had a major e ect
on heading date under 12-hour days. The insensitive allele
at Ppd-D1 was associated with earlier heading under  eld
conditions and shorter stature similar to e ects shown in
separate populations (Dyck et al., 2004). Earlier heading
of insensitive genotypes under  eld conditions re ects
their ability to initiate  owering before the onset of long
days in the summer. No signi cant e ects on grain yield
were observed in this population.
The insensitive allele at Ppd-B1 had major phenotypic
e ects in our populations. This allele was associated with
earlier heading both in the  eld and under 12-hour days
in Reeder/Conan and Choteau/Reeder (Table 4). It also
decreased 12-hour day heading in McNeal/Reeder by 8 d,
though it had no e ect on heading date in the  eld. Flag
leaf senescence was 1 d earlier in Reeder/Conan lines with

CROP SCIENCE, VOL. 49, JULY–AUGUST 2009 WWW.CROPS.ORG 1219
the insensitive Reeder allele, though not signi cantly earlier
in McNeal/Reeder and Choteau/Reeder lines. Green leaf
duration after heading was signi cantly increased by slightly
less than a day in Choteau/Reeder lines with the insensitive
Reeder allele. Interestingly, the insensitive allele at Ppd-B1
introduced from Reeder appears to be the prevalent cause of
photoperiod insensitivity in the Montana germplasm pool.
An interesting e ect was seen with variation at the Ppd-
A1 allele identi ed by sequence variation between parents
involved in the crosses. Sequence di erences allowed distinc-
tion between alleles for the Reeder/Conan, MTHW9904/
Choteau, McNeal/Reeder, and Choteau/Reeder RIL.
Although  eld heading date was impacted in two popula-
tions, in no case was variation at Ppd-A1 signi cantly associ-
ated with heading date under 12-hour days. This may re ect
previous obser vations that Ppd-A1 has a weak e ect on pho-
toperiod response relative to Ppd-B1 and Ppd-D1 (Worland
et al., 1994). However, in two of the crosses, allelic variation
at Ppd-A1 was associated with grain yield. Whether this is
owing to an e ect of a Ppd-A1 mutation linked to the SNP
marker or to linkage to another gene is not known.
All Montana spring wheat lines have the spring allele
at Vrn-A1 (Sherman et al., 2004). Recombinant inbred
line populations segregating for Vrn-D1 were Choteau/
Reeder and MTHW9904/Choteau. There was no e ect
of the alternative alleles on any trait in either population.
The Reeder/Conan and McNeal/Reeder populations
were both segregating at Vrn-B1. In both populations, the
spring allele resulted in earlier heading. Similarly, Iqbal et
al. (2007) found that Canadian lines with Vrn-B1 tended to
be earlier, and Stelmakh (1993) reported that wheat geno-
types with spring alleles at all three of the group 5 Vrn loci
were early to head in Uk raine. This is also consistent with
data from our Montana Spring Wheat Advanced Yield
Trial, where lines with the spring allele at Vrn-B1 headed
earlier than those with the winter allele.
CONCLUSIONS
Allelic variation was observed for Vrn-B1, Vrn-D1, Ppd-
B1, Ppd-D1, Rht-B1, and Rht-D1 among lines tested in the
Montana Spring Wheat Advanced Yield Trial. Evaluation
of  ve RIL populations, each segregating for subsets of the
loci, showed that variation at these major genes had mea-
surable e ects on several traits. As expected, allelic varia-
tion at Rht loci explained the predominant proportion of
height variation in populations that were segregating at
these loci. The spring allele at the Vrn-B1 locus resulted in
earlier heading under  eld conditions in two populations.
Alleles for photoperiod insensitivity at either Ppd-B1 or
Ppd-D1 caused earlier heading in the  eld for two of three
populations showing segregation at these loci.
The importance of segregation at major genes on phe-
notypic variation varied depending on the population. For
instance, the Reeder/Conan RIL were notable for showing
segregation for six of the loci being investigated. Segrega-
tion at these loci explained a large percentage of variation
for heading date (44%), date of  ag leaf senescence (39%),
and green leaf duration after heading (17%). The McNeal/
Thatcher RIL only di ered for alleles at Rht-D1. However,
a large percentage of variation in grain yield (67%) and grain
protein concentration (42%) was explained by segregation at
this locus. In sum, our results suggest that variation at genes
for vernalization, plant height, and photoperiod response
contribute signi cantly to phenotypic variation for economi-
cally important traits in the sampled germplasm pool.
The existence of diversity at the major growth habit
loci may re ect the fact that the selection environment
changes every year, and alternative alleles may be favored
depending on conditions. For instance, the recent tran-
sition to higher temperatures at heading may favor PI
lines that head earlier to avoid heat stress. Additionally,
the diversity re ects continual introduction of new germ-
plasm into the breeding program. An example indicated
by this experiment is the prevalence of the Ppd-B1 allele
from Reeder in the advanced breeding germplasm. Main-
tenance of variation for major genes controlling maturity
and growth habit may allow rapid response to changing
environments through breeding and selection and may
al so allow area growers to be responsive to shifting cond i-
tions through appropriate cultivar selection.
Acknowledgments
This work was supported in part by grants from USDA/
CSREES-NRICAP (2006-55606-16629) and the Montana
Board of Research and Commercialization.
References
Beales, J., A. Turner, S. Gri ths, J.W. Snape, and D.A. Laurie.
2007. A Pseudo-Response Regulator is misexpressed in the pho-
toperiod insensitive Ppd-D1a mutant of wheat (Tr i ticu m aest i -
vum L.). Theor. Appl. Genet. 115:721–733.
Blake, N.K., S.P. Lanning, J.M. Martin, J.D. Sherman, and L.E.
Talbert. 2007. Relationship of  ag leaf characteristics to eco-
nomically important traits in two spring wheat crosses. Crop
Sci. 47:489–494.
Blake, N.K., J.D. Sherman, J. Dvo˘rák, and L.E. Talbert. 2004.
Genome-speci c primer sets for starch biosynthesis genes in
wheat. Theor. Appl. Genet. 109:1295–1302.
Busch, R.H., F.A. Elsayed, and R.E. Heiner. 1984. E ect of day-
length insensitivit y on agronomic per formance in spr ing
wheat. Crop Sci. 21:57–60.
Butler, J.D., P.F. Byrne, V. Mohammadi, P.L. Chapman, and
S.D. Haley. 2005. Agronomic performance of Rht alleles in
a spring wheat population across a range of moisture levels.
Crop Sci. 45:939–947.
Dyck, J.A., M.A. Matus-Cadiz, P. Hucl, L. Talbert, T. Hunt, J.P.
Dubuc, H. Nass, G. Clayton, J. Dobb, and J. Quick. 2004.
Agronomic performance of hard red spring wheat isolines sen-
sitive and insensitive to photoperiod. Crop Sci. 44:1976–1981.
Ellis, M.H., W. Spielmeyer, K.R. Gale, G.J. Rebetzke, and R.A.
Richards. 2002. ‘Perfect’ markers for the Rht-B1b and Rht-D1b
dwar ng genes in wheat. Theor. Appl. Genet. 105:1038–1042.

1220 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, JULY–AUGUST 2009
Fu, D., P. Szucs, L. Yan, M. Helguera, J.S. Skinner, J.V. Zitzewitz,
P.M. Hayes, and J. Dubcovsky. 2005. Large deletions within
the  rst intron in VRN-1 are associated with spring growth
habit in barley and wheat. Mol. Genet. Genomics 273:54–65.
Hedden, P. 2003. The genes of the green revolution. Trends Genet.
19:5 –9.
Iqbal, M., A. Navabi, R.-C. Yang, D.F. Salmon, and D. Spaner.
2007. The e ect of vernalization genes on earliness and
related agronomic traits of spring wheat in northern growing
regions. Crop Sci. 47:1031–1039.
Knott, D.R. 1986. E ects of genes for photoperiodism, semi-
dwar sm, and awns on agronomic characters in a spring
wheat cross. Crop Sci. 26:1158–1162.
Lanning, S.P., G.R. Carlson, D. Nash, D.M. Wichman, K.D.
Kephart, R.N. Stougaard, G.D. Kushnak, J.L. Eckho , W.E.
Grey, and L.E. Talbert. 2004. Registration of ‘Choteau’
wheat. Crop Sci. 44:2264–2265.
Lanning, S.P., P. Fox, J. Elser, J.M. Martin, N.K. Blake, and L.E.
Talbert. 2006. Microsatellite markers associated with a second-
ary stem solidness locus in wheat. Crop Sci. 46:1701–1793.
Lanning, S.P., L.E. Talbert, C.F. McGuire, H.F. Bowman, G.R.
Carlson, G.D. Jackson, J.L. Eckho , G.D. Kushnak, R.N.
Stougaard, and G.F. Stallknecht. 1994. Registration of
‘McNeal’ wheat. Crop Sci. 34:1126–1127.
Marshall, L., R. Busch, F. Cholick, I. Edwards, and R. Frohberg.
1989. Agronomic per formance of spring wheat isolines di er-
ing for daylength response. Crop Sci. 29:752–757.
McNeal, F.H., M.A. Berg, V.R. Stewart, and D.E. Baldridge.
1972. Agronomic response of three height classes of spring
wheat, Triticum aestivum L., compared at di erent yield levels.
Agron. J. 64:362–364.
Montana Agricultural Statistics. Montana Dep. of Agriculture
and U.S. Dep. of Agriculture National Agricultural Statistics
Service. vol. XLIV. October 2007. (www.nass.usda.gov/mt/;
veri ed 11 May 2009).
Mohler, V., R. Lukman, S. Or tiz-Islas, M. William, A.J. Wor-
land, J. van Beem, and G. Wenzel. 2004. Genetic and physical
mapping of photoperiod insensitive gene Ppd-B1 in common
wheat. Euphytica 138:33–40.
SAS Institute. 2003. SAS/STAT 9.1 user’s guide. SAS Inst., Cary, NC.
Scarth, R., and C.N. Law. 1984. The control of day-length
response in wheat by the g roup 2 chromosomes. Z. P anzen-
zuchtg. 92:140–150.
Sherman, J.D., L. Yan, L.E. Talbert, and J. Dubcovsky. 2004. A
PCR marker for growth habit in com mon wheat based on
allelic var iation at the Vrn-A1 gene. Crop Sci. 44:1832–1838.
Sourdille, P., J.W. Snape, T. Cadalen, G. Charmet, N. Nakata, S.
Bernard, and M. Bernard. 2000. Detection of QTL for head-
ing time and photoperiod response in wheat using a doubled-
haploid population. Genome 43:487–494.
Stelmakh, A.F. 1993. The genetic e ect of Vrn genes on heading date
and agronomic traits in spring wheat. Euphytica 65:53–60.
Worland, A.J. 1996. The in uence of  owering time on environmen-
tal adaptability in winter European wheats. Euphytica 89:49–57.
Worland, A.J., M.L. Appendino, and E.J. Sayers. 1994. The dis-
tribution in European winter wheats of genes that in uence
ecoclimatic adaptability whilst determining photoperiod
insensitivity and plant height. Euphytica 80:219–228.
Worland, A.J., A. Borner, V. Korzun, W.M. Li, S. Petrovic, and
E.J. Sayers. 1998. The in uence of photoperiod genes on the
adaptability of European winter wheat populations. Euphyt-
ica 100:385–394.
Yan, L., D. Fu, C. Li, A. Blechl, G. Tranquilli, M. Bonafede, A.
Sanchez, M. Valarik, S. Yasuda, and J. Dubcovsky. 2006. The
wheat and barley vernalization gene VRN3 is an orthologue
of FT. Proc. Natl. Acad. Sci. USA 103:19581–19586.
Yan, L., M. Helguera, K. Kato, S. Fukuyama, J. Sherman, and J.
Dubcovsky. 2004. Allelic variation at the Vr n-1 promoter region
in polyploid wheat. Theor. Appl. Genet. 109:1677–1686.
Zhang, X.K., Y.G. Xiao, Y. Zhang, X.C. Xia, J. Dubcovsky, and
Z.H. He. 2008. Allelic variation at the vernalization genes Vrn -
A1, Vrn-B1, Vrn-D1, and Vrn-B3 in Chinese wheat cultivars and
their association with growth habit. Crop Sci. 48:458–470.