Content uploaded by Irene Xagoraraki
Author content
All content in this area was uploaded by Irene Xagoraraki on Oct 26, 2017
Content may be subject to copyright.
Release of infectious human enteric viruses by full-scale
wastewater utilities
Fredrick James Simmons, Irene Xagoraraki*
Department of Civil and Environmental Engineering, Michigan State University, East Lansing, MI 48824, USA
article info
Article history:
Received 27 October 2010
Received in revised form
17 February 2011
Accepted 3 April 2011
Available online 19 April 2011
Keywords:
Wastewater
Infectious viruses
Human adenovirus
Human enterovirus
Human norovirus
Cell culture
MBR
Electropositive cartridge filter
abstract
In the United States, infectious human enteric viruses are introduced daily into the envi-
ronment through the discharge of treated water and the digested sludge (biosolids). In this
study, a total of 30 wastewater and 6 biosolids samples were analyzed over five months
(MayeSeptember 2008e2009) from five full-scale wastewater treatment plants (WWTPs) in
Michigan using real-time PCR and cell culture assays. Samples were collected from four
different locations at each WWTP (influent, pre-disinfection, post-disinfection and biosolids)
using the 1MDS electropositive cartridge filter. Adenovirus (HAdV), enterovirus (EV) and
norovirus genogroup II (NoV GGII) were detected in 100%, 67% and 10%, respectively of the
wastewater samples using real-time PCR. Cytopathic effect (CPE) was present in 100% of the
cell culture samples for influent, pre- and post-disinfection and biosolids with an average log
concentration of 4.1 (2.9e4.7, range) 1.1 (0.0e2.3, range) and 0.5 (0.0e1.6, range) MPN/100 L
and 2.1 (0.5e4.1) viruses/g, respectively. A significant log reduction in infectious viruses
throughout the wastewater treatment process was observed at an average 4.2 (1.9e5.0,
range) log units. A significant difference ( p-value <0.05) was observed using real-time PCR
data for HAdV but not for EV ( p-value >0.05) removal in MBR as compared to conventional
treatment. MBR treatment was able to achieve an additional 2 and 0.5 log reduction of HAdV
and EV, respectively. This study has demonstrated the release of infectious enteric viruses in
the final effluent and biosolids of wastewater treatment into the environment.
ª2011 Elsevier Ltd. All rights reserved.
1. Introduction
Human enteric viruses are currently listed on the United States
Environmental Protection Agency Contaminant Candidate List
(USEPA CCL) as emerging contaminants. To this date, no
regulations have been implemented into the monitoring of
wastewater viral concentration before being discharged into
a natural water body. Human Adenovirus (HAdV), Human
Enterovirus (EV), Norovirus Genogroups I, II and IV, (NoV GGI)
and (NoV GGII), and Hepatitis-A (HAV) are some of the enteric
viruses of concern (Gerba et al., 2002; Haramoto et al., 2007;
Kittigul et al., 2006). These viruses have been related to
several waterborne diseases, such as acute gastroenteritis,
conjunctivitis and respiratory illness in both developed and
developing countries world-wide. There are several routes
whereby the public can become infected, including direct
contact (fecal-oral route or dermal contact) and food borne
illness and contamination (Godfree and Farrell, 2005).
Virus removal from wastewater continues to receive atten-
tion due to the epidemiological significance of viruses as
waterborne pathogens and because of the high diversity that is
excreted in human waste (Rose et al., 1996). A large number of
enteric viruses are excreted in human feces and urine, which
makes wastewater one of the most concentrated sources of
*Corresponding author. A124 Engineering Research Complex, Michigan State University, East Lansing, MI 48824, USA. Tel.: þ1 517 353
8539; fax: þ1 517 355 0250.
E-mail address: xagorara@msu.edu (I. Xagoraraki).
Available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/watres
water research 45 (2011) 3590e3598
0043-1354/$ esee front matter ª2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.watres.2011.04.001
these viruses. During the peak of an infection, it has been re-
ported that enteric viruses are often detected in feces at
elevated levels averaging 10
11
viruses/gram (Rose et al., 1996).
According to the literature,the concentrations of infectious and
non-infectious HAdV, EV and NoV detected in untreated and
treated wastewater are approximately 10
4
e10
9
and
10
2
e10
7
viruses/L, respectively (Bofill-Mas et al., 2006; Carducci
et al., 2008; Kuo et al., 2010; Laverick et al., 2004; Rodriguez et al.,
2008). To ensure the safety of thepublic, inactivation of viruses
is usually achieved with chlorination and ultraviolet (UV)
treatment before discharged. Previous bench-scale studies
(Rodriguez et al., 2008; Simonet and Gantzer, 2006a,b)have
determined the inactivation of viruses from the influent and
final effluent of approximately 1e4 log units and 0.1e1.2 log
units for the chlorination and UV disinfection unit processes
alone.
In addition to the final effluent, a considerable amount of
sludge is generated in primary and secondary settling tanks
during the treatment process. Depending on the level of
sludge treatment, such as mesophilic anaerobic digestion
(MAD) and lime stabilization, biosolids are often considered
class A or B and depending on the particular crop and its
intended use. In the US, approximately 5 million tons of dry
biosolids is generated annually and 60% is used for agricul-
tural land application to provide additional nutrients for
crops. Class B biosolids are the most commonly produced in
the United States by MAD (Gerba et al., 2002; Viau and Peccia,
2009). It has been stated that a variable fraction, as high as 50%
of the enteric virus present in the raw sewage, may be asso-
ciated with the solids (Payment et al., 1986), suggesting that
the concentration of viruses in biosolids can be higher than in
wastewater. Several studies have reported the occurrence of
enteric viruses in biosolids after the digestion process
(Monpoeho et al., 2004; Bofill-Mas et al., 2006; Guzman et al.,
2007; Viau and Peccia, 2009; Wong et al., 2010).
Past studies (Bofill-Mas et al., 2006; Katayama et al., 2008;
Rodriguez et al., 2008; Laverick et al., 2004; Carducci et al.,
2008; da Silva et al., 2007) have determined the concentra-
tion of DNA/RNA viruses using real-time PCR in addition to
viral infectivity in wastewater treatment (Aulicino et al., 1995;
Petrinca et al., 2009; Rodriguez et al., 2008; Sedmak et al., 2005).
However to our knowledge, no studies have looked at the
overall release of enteric viruses from a full-scale wastewater
treatment through the final effluent and biosolids using both
real-time PCR and cell culture methods. In the current study,
we analyzed a total of 30 wastewater and 6 biosolids samples
over five different months (MayeSeptember) from five sepa-
rate full-scale WWTPs to determine the release of enteric
viruses. The results in this study provide important informa-
tion on the overall release of both infectious and non-
infectious enteric viruses following treatment.
The objectives of this study were to (i) determine the
concentration of enteric viruses within the wastewater
treatment process using real-time PCR data (ii) determine the
release of infectious viruses in the final effluent and biosolids,
(iii) compare virus removal efficiency between MBR and
conventional wastewater treatment process using real-time
PCR data and (iv) compare the effectiveness of two different
disinfection processes for virus inactivation. Four different
sampling points (raw, pre-disinfection, post-disinfection and
biosolids) were chosen to determine how viruses are removed
and inactivated during treatment. The viruses studied were
Human Adenovirus F40 and F41 (HAdV), Human Enterovirus
(EV), Norovirus Genogroup 1 (NoV GI), Norovirus Genogroup 2
(NoV GGII) and Hepatitis-A (HAV).
2. Methods and materials
2.1. Wastewater treatment plants
Five different wastewater treatment plants (WWTPs) in Mich-
igan’s Lower Peninsula were sampled from 07/17/2008e09/24/
2009 in duplicate during separate sampling events. Four
different locations were sampled: including influent (raw
sewage), pre-disinfection (after secondary biological treat-
ment), post-disinfection (final effluent) and biosolids. Table 1
lists the characteristics of each WWTP that was sampled.
2.2. Wastewater and biosolids sampling
Thirty wastewater samples were collected using the 1MDS
electropositive filter during 10 different sampling events
following the procedure explained in the USEPA Manual of
Table 1 eCharacteristics of the different WWTPs used in this study.
Wastewater Treatment
Process
(Biological Treatment)
Average
Flow
(MGD)
Capacity
(MGD)
Disinfection Sludge
Treatment
Sludge Production
(gal/day)
Disposal of
Biosolids
WWTP
1 MBR 4.0 17.0 UV MAD 4500 Land Application
2 Activated Sludge 12.5 19.0 Chlorination Dewatering 15955 Landfill
3 Activated Sludge 17.0 20.0 UV Lime
Stabilization
e
a
Land Application
4 Oxidation Ditch 0.2 0.4 UV Gravity
Thickening
e
a
Land Application
5 Rotating Biological
Contactors
0.8 2.2 Chlorination MAD 1369 Land Application
MAD eMesophilic Anaerobic Digestion.
a No biosolids were collected from these utilities.
water research 45 (2011) 3590e3598 3591
Methods for Virology (USEPA, 2001). Approximately 20 L of
influent, 375 L of pre-disinfection and 410 L of post-
disinfection (final effluent) were sampled at a rate of about
11e12 L/min (3 gal/min). Biosolids samples were collected at
three of the five different WWTPs (Table 1). Two L grab
samples were collected from the post digestion holding tanks.
The dewatered samples were collected from the exiting
conveyor belt in the loading bay. All samples collected were
then stored on ice and transported to the Water Quality
Engineering Laboratory at Michigan State University. Upon
arrival, samples were placed in a 4 C cooler before processing.
2.3. Virus elution process for 1MDS filters and biosolids
All wastewater samples collected were eluted 12e24 h after
initial sampling according to the Concentration and Process-
ing of Waterborne Viruses by Positive Charge 1MDS Cartridge
Filters and Organic Flocculation (USEPA, 2001) and previously
described by Simmons et al., 2011, and Kuo et al., 2010. The
biosolids virus elution and concentration were performed
according to the ASTM-4994.
2.4. Nucleic acid extraction
Viral samples were extracted using the MagNa Pure Compact
System automatic machine (Roche Applied Sciences, Indian-
apolis, IN). 1000 mL of samplewas extracted and concentratedto
a final volume of 100 mL. Immediately following the completion
of the extraction all samples were placed in a 80 C freezer.
Following extraction the quantity of viral nucleic acid extracts
from all samples were checked using the NanoDrop Spectro-
photometer (NanoDrop
ND-1000, Wilmington, DE).
2.5. Real-time PCR standard curves, sequencing and
detection limit
The standard curves for sample quantification of HAdV, EV,
NoV GGI, NoV GGII and HAV were created using stock cultures
of HAdV 40 (ATCC VR-930), EV Coxsackie virus B5 (ATCC VR-
1036AS/MK), HAV HM175 (ATCC VR-1402) and NoV GGII stool
samples were supplied by the Ingham County Health Depart-
ment following a confirmed outbreak at Michigan State
University.
All standard curve assays performed used the LightCycler
1.5 Instrument (Roche Applied Sciences, Indianapolis, IN).
Briefly, the PCR amplicons from HAdV, EV, NoV GGII and HAV
from pure culture and stool sample extracts were cloned into
a plasmid vector (i.e., pCR
4-TOPO
) which follows the one-
shot chemical transformation described in the manufacturer
instructions (TOPO TA Cloning
Kit for Sequencing, Invi-
trogen, Carlsbad, CA). The plasmids carrying the cloned HAdV,
EV, NoV GGI, NoV GGII and HAV were purified using Wizard
Plus SV Minipreps DNA Purification System (Promega, Madi-
son, WI) and sent for sequencing at the Research Technology
Support Facility at Michigan State University. All target gene
sequences were compared with those published in the
National Center for Biotechnology Information (NCBI) data-
base by using the program of Basic Local Alignment Search
Tool (BLAST). The concentrations were determined by using
the NanoDrop spectrophotometer and then the samples were
serial diluted 10-fold (10
1
e10
8
viruses/reaction) and used for
creating the standard curves for all target viruses. The R-
squared values for each standard curve for HAdV, EV, NoV
GGI, NoV GGII and HAV are 0.995, 0.996, 0.995, 0.999 and 0.996,
respectively. All standard curve reactions were run in tripli-
cate and the detection limit for EV and NoV GGII, is 10 viruses/
reaction and 100 viruses/reaction for HAdV, HAV and NoV GGI.
2.6. Quantitative real-time PCR assays
The crossing point (Cp) value for each PCR reaction was
automatically determined by the LightCycler
Software 4.0
and used to calculate the overall viral concentration. The
primer and probe sequences and reaction conditions used in
this study are summarized in Table 2. Briefly, all real-time PCR
reaction mixes included 10 mL of 2X LightCycler 480 TaqMan
Table 2 eList of enteric virus primer and probes, gene regions, reaction conditions and references used in this study.
Virus Type Gene Region Primers/Probes Sequence (50e30) Reaction Condition
(temp, time)
Reference
HAdV Hexon Forward ACCCACGATGTAACCACAGAC 95, 10 s edenaturation Xagoraraki et al., 2007
Modified from Jiang
et al., 2005
Reverse-1 ACTTTGTAAGAGTAGGCGGTTTC 60, 30 s eannealing
Rsverse-2 CACTTTGTAAGAATAAGCGGTGTC 72, 12 s eextension
Probe CGACKGGCACGAAKCGCAGCGT
EV 50eUntranscribed
Region
Forward ACATGGTGTGAAGAGTCTATTGAGCT 95, 15 s edenaturation Dierssen et al., 2007
Reverse CCAAAGTAGTCGGTTCCGC 60, 60 s eannealing
Probe TCCGGCCCCTGAATGCGGCTAAT
NoV GGI 50eUntranscribed
Region
Forward CGCTGGATGCGNTTCCAT 95, 15 s edenaturation da Silva et al., 2007
Reverse CCTTAGACGCCATCATCATTTAC 60, 60 s eannealing
Probe TGGACAGGAGAYOGCRATCT
NoV GGII Junction 0RF1-0RF2 Forward CARGASBCNATGTTYAGRTGGATGAG 95, 15 s edenaturation Kageyama et al., 2003
Reverse TCGACGCCATCTTCATTCACA 56, 60 s eannealing
Probe TGGGAGGGCGATCGCAATCT
Hep-A Junction 0RF1-0RF2 Forward GGTAGGCTACJGGGTGAAAC 95. 10 s edenaturation Jothikumar et al., 2005
Reverse AACAACTCACCAATATCCGC 55, 20 s eannealing
Probe CTTAGGCTAATACTTCTATG
AAGAGATGC
72,15 s eextension
water research 45 (2011) 3590e35983592
Master Mix and the appropriate volume of primers and as
previously described (Dierssen et al., 2007; Jothikumar et al.,
2005; Kageyama et al., 2003; da Silva et al., 2007; Xagoraraki
et al., 2007). The real-time PCR running program (all thermo-
cycles were performed at a temperature transition rate of
20 C/s) was 95 C for 15 min; followed by different cycles of
denaturation, annealing, extension and a final cooling step.
Each reverse transcription reaction mix for EV, NoV and HAV
included 2.5 mLof10mM reverse primer, 1 mL of reverse tran-
scriptase (Promega Corporation, Madison, WI), 4 mLof5Xtran-
scriptor reaction buffer, 20 U of protector Rnaseinhibitor, and 2 mL
of 10 mM deoxynucleotide (Roche Applied Sciences, Indianapolis,
IN). Reaction conditions for all three RNA viruses were the same;
initial incubation at 55 C for 30 min followed by 85 Cfor5minto
inactivate the enzyme. All samples were run in triplicate and
included a negative control reaction (PCR grade-H
2
Owithout
template) and a positive control reaction for all viruses.
2.7. Inhibition control
To determine if inhibition occurred during viral analysis, the
methods previously explained (Viau and Peccia, 2009; Rajal
et al., 2007) were used. Bovine Enterovirus was chosen as the
virus to spikeall samples to determine if inhibition was present,
bovine enterovirus was quantified following the methods
previously published (Jimenez-Clavero et al., 2005). Prior to the
inhibition check, all samples were analyzed for bovine entero-
virus using real-time PCR. Next, all extracted samples and
molecular grade-H
2
O were spiked with a concentration of
10
5
viruses/reaction of bovine enterovirus. Following the anal-
ysis, the Cp values of the extracted water and wastewater
sampleswere recorded. If the Cp values of both the spikedwater
and wastewater samples were within an acceptable level (5%),
we assumed that inhibitiondid not affect our analysis.
2.8. Calculations of enteric virus concentration
All real-time PCR assays were converted from viruses/reaction
to viruses/L or viruses/dry gram, using the following
equations:
Viruses
L¼
Viruses
Reaction 1 Reaction
5mL100 mL1
1000 mL30;000 mL
Initial Sample Volume
(1)
Viruses
dry gram ¼
Viruses
Reaction 1 Reaction
5mL100 mL1
25 grams
% Solids (2)
In Eq. (1), the 5 mL is the amount of sample per reaction tube,
1000 and 100 mL is the amount of sample extracted and the
volume of the extract, respectively. The 30,000 mL is the
amount of concentrated eluent after the final filtration
through a 0.22 mm syringe filter (Millipore, Billerica, MA). In Eq.
(2), the 25 g is the weight of biosolids that were concentrated.
2.9. Cell culture
In total 15 different wastewater and 3 different biosolids
samples were analyzed for virus infectivity and were cultured
using BGM cell line, which were graciously donated by Shay
Fout from the USEPA (passage #157). In addition, A549 cell line
(ATCC CCL-185, passage #126) was used for the post-
disinfection samples to determine the final infectious virus
concentration being released. Including all dilutions and repli-
cates, a total of 200 BGM and 50 A549 flasks were used for the
final analysis. All samples followed the USEPA Total Culturable
Virus Assay detailed in the “Information Collection Rule”.
2.10. Log removal
Overall log removal achieved by the MBR and conventional
WWTPs was calculated using Eq. (3):
Log Removal ¼log10
Influent Concentration
Effluent Concentration (3)
For pre- and post-secondary treatment samples that were
below the detection limit, the log removal values were calcu-
lated by using the detection limit of the individual assays. This
indicates that certain removal values may be greater than
reported. However, this will allow for conservative calcula-
tions when this value is needed for comparisons.
2.11. Statistical analysis
Log removal values for each WWTP were analyzed using t-test
in Microsoft Excel
using an alpha value (a-value of 0.05),
showing a 95% confidence interval.
3. Results
3.1. Inhibition control
Bovine enterovirus was not initially detected in the 30
wastewater (00/30) and 6 biosolids (00/06) samples. All 36
samples were then spiked with 10
5
viruses/reaction of bovine
enterovirus following extraction including a PCR grade-H
2
O.
The Cp values for the WWTPs and biosolids samples were
26.57 (std 0.14) and for H
2
O samples, 26.67 (std 0.08) which are
within 2% of each other. This indicates that any inhibition that
may be present in the extracted samples was not able to
suppress the detection of the viruses in this study.
3.2. Quantification of human enteric viruses
in wastewater
3.2.1. HAdV
Fig. 1 shows the average concentration of HAdV from the two
different sampling events at each WWTP. HAdV was detected
in all 30 samples, with an average influent concentration of
7.3 10
7
(2.0 10
4
e6.7 10
8
, range) viruses/L, average pre-
disinfection of 8.7 10
3
(1.4 10
2
e4.5 10
4
, range), and
3.7 10
3
(1.1 10
1
e2.9 10
4
, range) viruses/L for the post-
disinfection samples. WWTP 4 had the lowest average
concentration of approximately 8.3 10
4
, 2.6 10
2
and
1.0 10
2
viruses/L in the influent, pre- and post-disinfection,
respectively. It is possible that the lower concentration could
be due to the average daily flow into the plant, which receives
the lowest of all 5 plants sampled (Table 1). WWTP 4 is located
water research 45 (2011) 3590e3598 3593
within a rural city; where most residential homes use indi-
vidual septic tanks instead of the city sewer system.
3.2.2. EV
Fig. 2 shows the average concentration for the two sampling
events at each WWTP. In total 10/10 influent, 04/10 pre-
disinfection and 06/10 post-disinfection samples were posi-
tive for EV. The influent EV average concentration for all
samples is 2.1 10
5
(3.0 10
2
e1.1 10
6
, range) from viruses/L.
The overall concentration detected in the pre-disinfection
samples averaged 2.9 10
2
(below detection limit (BDL) e
2.6 10
3
, range) viruses/L. However, EV was detected in 06/10
post-disinfection (compared to 04/10 in pre-disinfection)
samples with an average concentration of 1.6 10
2
(BDL e
9.4 10
2
, range) viruses/L.
3.2.3. NoV GGI and NoV GGII
NoV GGI was not detected in the 5 WWTPs sampled (00/30).
However, 03/30 samples were positive for NoV GGII. Three of
ten influent samples from WWTPs 1 and 2 were positive for
NoV GGII with concentrations ranging from 5.2 10
4
to
1.1 10
6
(average 4.3 10
5
) viruses/L. However, NoV GGII was
not detected in any of the pre- or post-disinfection samples.
3.2.4. HAV
HAV was not detected in the 30 samples analyzed.
3.3. Quantification of human enteric viruses in biosolids
The average HAdV and EV log concentrations are 4.1 (BDL e7.8,
range) and 2.9 (BDL e4.9, range)viruses/g, respectively. Neither
HAdV nor EV was detected in the biosolids at WWTP 1. Inter-
estingly, both NoV GGI and NoV GGII were detected in all
biosolids samplesbut were not detected in theinfluent, pre- or
post-disinfection wastewater samples. NoV GGI was detected
in 06/06 biosolids samples at an average log concentration of
4.3 viruses/g (2.4e6.6, range). NoV GGII was also detected in 06/
06 biosolids samples at an average 5.2 (3.6e7.4, range) viruses/g.
HAV was not detected in any of the biosolids samples analyzed.
3.4. Infectivity of viruses
3.4.1. Wastewater samples
CPE was detected in all five WWTPs at each of the three
sampling locations using BGM cell line, indicating the pres-
ence of infectious viruses in all types of samples. Fig. 3 shows
the overall average log concentration of infectious viruses for
all 5 WWTPs monitored in this study at each sampling loca-
tion. An average log infectious virus concentration of 4.1
(2.9e4.7, range), 1.1 (0.1e2.3, range) and 0.5 (0.1e1.6) MPN/
100 L was detected in the influent, pre- and post-disinfection
samples, respectively.
3.4.2. Biosolids samples
Fig. 4 shows the average log concentration of infectious viruses
found at WWTPs 1, 2 and 5 using both BGM and A549 cell lines.
As the results show, an average log infectious concentration of
1.1 (0.5e2.9, range) and 3.2 (2.0e4.1, range) MPN/g was detected
using both BGM and A549 cell lines.
Fig. 2 eAverage (n[2) EV real-time PCR virus
concentration detected at the five different WWTPs at each
sampling point. The detection limit was used for the pre-
and post-disinfection for WWTP (3) and pre-disinfection
for WWTP (5) samples. MBR eMembrane Bioreactor, AS e
Activated Sludge, OD eOxidation Ditch, RBC eRotating
Biological Contactors, UV eultraviolet, Cl echlorination.
Fig. 1 eAverage (n[2) HAdV real-time PCR virus
concentration detected at the five different WWTPs at each
sampling point. MBR eMembrane Bioreactor, AS e
Activated Sludge, OD eOxidation Ditch, RBC eRotating
Biological Contactors, UV eultraviolet, Cl echlorination.
Fig. 3 eVirus infectivity distribution using BGM cell line
throughout the three different sampling points from all 5
WWTPs (n[5). The values are expressed as MPN/100 L.
water research 45 (2011) 3590e35983594
3.5. Removal of infectious viruses
From the cell culture results, it was determined that an overall
removal of infectious viruses from all WWTPs between the
influent and pre-disinfection (after biological treatment) was
approximately 4.4, 1.2, 3.2, 4.5 and 1.6 log units for WWTPs 1,
2, 3, 4 and 5, respectively. It was observed that WWTPs 1, 3 and
4 which use MBR, activated sludge and an oxidative ditch,
respectively in addition to UV disinfection were able to ach-
ieve comparable removal values of 4.4, 3.2 and 4.5 log units,
respectively. WWTPs 2 (activated sludge) and 5 (RBCs) which
use chlorination achieved lower removal of infectious viruses
at a level of 1.2 and 1.6 log units, respectively.
3.6. Inactivation of infectious viruses using UV and
chlorination
According to Fig. 3, the average log infectious virus concen-
tration for WWTPs 1, 3 and 4 for the pre- and post-UV disin-
fection samples was approximately 0.5 and 0.2 log units. In
WWTPs 2 and 5, an average pre- and post-chlorination
disinfection infectious virus concentration is 2.0 and 1.1 log
units, respectively. It was observed that the overall average
inactivation of infectious viruses for UV and chlorination was
about 0.3 and 0.9 log units.
In addition to using BGM cell line, this study also analyzed
the final effluent (post-disinfection) for the five WWTPs using
A549 cell line and for the biosolids samples. HAdV was only
positive for WWTPs 1 (UV disinfection) and 5 (chlorination
disinfection) and negative for EV for all WWTPs using ICC-PCR
for A549 cell line.
3.7. MBR and conventional WWTP
In total, 8 samples from WWTP 1(MBR treatment) (Kuo et al.,
2010) and 8 samples from the current study (conventional
treatment) were used to compare the log removal values for
both HAdV and EV using real-time PCR data. Due to insuffi-
cient data, NoV was not included in the comparison. An
average influent concentration of HAdV at 6.4 (5.6e7.9 range)
and 5.6 (4.3e6.7 range) log units was observed in MBR and
conventional treatment, respectively. However, the effluent
concentration for each process (MBR and conventional treat-
ment) was 2.2 and 3.5, resulting in an overall removal of
approximately 4.0 and 2.2 log units, respectively (Fig. 6). This
indicates that MBR treatment was able to achieve an extra 2
log reduction as compared to conventional treatment. There
was a significant difference ( p-value <0.05) between the two
types of secondary treatments log removal values.
EV was detected at an average 5.4 (range 4.1e6.1) and 4.8
(range 4.5e5.5) log units in the influent and 1.7 and 1.5 log
units in the post-secondary treatment in the MBR and
conventional treatment process, respectively. According to
Fig. 6, the MBR process achieved an average 3.6 log reduction
(2.9e4.3, range). However, conventional treatment achieved
an average 2.9 log reduction (2.0e3.7, range) log units. The t-
test results for EV, showed a p-value of 0.08 indicating no
significant difference.
4. Discussion
4.1. Release of viruses by WWTPs
To this date there are no requirements on the level of human
enteric viruses that are allowed to be released after waste-
water treatment. The results of this study provide conclusive
evidence of the levels of infectious viruses, in addition to
HAdV, EV and NoV total genomic copies that are being
released in the environment.
During the current study, the presence of HAdV was
detected in 100% of the wastewater samples analyzed with
real-time PCR. These results are consistent with past studies
(Bofill-Mas et al., 2006:Carducci et al., 2008; Katayama et al.,
2008; Pusch et al., 2005; Rodriguez-Diaz et al., 2009) who
have reported a presence of HAdV between 55 and 100% of
samples with an average of 88%. In addition to HAdV, EV was
detected between 65 and 89% with an average of 76% in past
studies (Pusch et al., 2005; Rodriguez et al., 2008; Katayama
et al., 2008) compared to 67% observed in this study. The
presence of NoV was detected in an average of 72% in past
studies (Laverick et al., 2004; Nordgren et al., 2009; da Silva
et al., 2007) but was only detected in 10% of our wastewater
samples (NV1 was not detected). We detected NoV GGII in 3/10
samples and 0/10 effluent samples.
Based on our cell culture data we were able to determine
that an average concentration of 2.0 10
4
MPN/100 L enter
(raw sewage) the three WWTPs (WWTPs 1, 2 and 5),
1.6 10
1
MPN/100 L are discharged as final effluent and
1.4 10
2
MPN/g are retained in the biosolids. It is assumed
that there is some virus removal in primary sedimentation
(0.1e1.0 log units) as previously reported (Nordgren et al.,
2009); however samples were not collected at this particular
location. We observed an overall removal of infectious viruses
between 1.9 and 5.0 (average 4.2) log units from influent to
final effluent. These results are comparable to previous full-
scale studies (Aulicino et al., 1995; Sedmak et al., 2005;
Petrinca et al., 2009) using cell culture assay reporting
removals between 0 and 4.0 log units.
Fig. 4 eBGM and A549 cell culture data showing the
concentration of viruses being released from WWTPs 1, 2
and 5. All results are expressed as MPN/100 L (n[3 for
influent, pre- and post-disinfection and biosolids).
water research 45 (2011) 3590e3598 3595
CPE was detected in 100% of our influent and effluent
samples as compared to past studies (Aulicino et al., 1995;
Rodriguez et al., 2008; Sedmak et al., 2005) averaging 88%
and 45% CPE in the influent and effluent samples, respec-
tively. Furthermore, the reported concentration of infectious
viruses in the above studies fluctuated between 1e4 and 0e3
log units in the influent and final effluent, respectively. This
shows inconsistencies with determining the concentration of
infectious viruses before and after treatment. In the current
study, the influent (2.8e4.8 log units) and effluent (0.1e1.6 log
units) concentrations only fluctuated by 2 and 1.5 log units,
respectively. It is plausible that this difference is due to the
low sample volumes used in the above studies which ranged
from 0.1e5to1e20 L grab samples for the influent and final
effluent, respectively. In the current study, a significantly
increased volume (20 L, 375 L and 410 L of influent, pre-
disinfection and post-disinfection, respectively) was
sampled. High sample volumes increase the chance of virus
recovery from source waters with a low concentration of
viruses (Sobsey and Glass, 1980).
We detected an average 1.1e3.2 log units of infectious
viruses in our 6 biosolids samples as compared to previously
published (Guzman et al., 2007; Monpoeho et al., 2004) which
reported values of 0.4e1.6 log units. The differences in
concentrations found in this study could be due to different
detention times for the biosolids between WWTPs. Interest-
ingly, NoV GGI and NoV GGII were both detected in 06/06
biosolids samples at an average log concentration of 4.3 and
5.2 viruses/g, respectively but NoV GGI was not detected in any
of the wastewater samples and NoV GGII was only detected in
3/30 samples. This could also be due the longer retention times
of biosolids in the WWTPs, as compared to the liquid stream.
4.2. Inactivation of infectious viruses between UV and
chlorination
In this study, WWTPs using UV disinfection achieved an
average removal and inactivation of 4.4 log units of infectious
viruses as compared to 2.4 log units for the WWTPs using
chlorination between the influent and final effluent samples.
However, the average log reduction of infectious viruses
between the pre- and post-disinfection processes was only 0.3
and 0.9 log units for UV and chlorination, respectively. Our
results indicate that chlorination was only able to achieve
0.6 log unit higher inactivation of viruses as compared to UV.
This suggests that the given configuration of unit processes in
the WWTPs sampled from, are able to achieve a higher inac-
tivation and removal of viruses as opposed to just the disin-
fection process. As shown in Fig. 5, WWTPs using UV were
able to achieve a more consistent final effluent non-infectious
virus concentration but no significant difference ( p-value
>0.05) was observed between UV and chlorination. Similar
results were previously reported (Rodriguez et al., 2008) where
it was determined that the inactivation of infectious viruses
between pre- and post-disinfection samples in a full-scale
WWTP of approximately 0.3e1.3 log units. It was reported
that CPE in 03/37 (8%) WWTP samples on BGM cell lines
ranging from 1.48 to 1.63 MPN/L were detected. During their
study, only 1 L grab samples were analyzed for infectious virus
concentration for all sampling points.
4.3. Comparing the removal of HAdV and EV in MBR
and conventional WWTPs
HAdV removal results observed in our conventional treatment
samples agree with previous studies where an average
1.0e3.0 log reduction was reported (Carducci et al., 2008;
Haramoto et al., 2007). However, in the current study average
removal efficiency in conventional wastewater treatment of
approximately 2.0 log units lower for HAdV was calculated as
compared to MBR treatment with real-time PCR data. Inter-
estingly, as shown in Fig. 6, the average removal of EV through
MBR treatment was similar to what we observed (average of
0.5 log removal increase with the MBR) during conventional
treatment. Our findings are consistent with a previous study
(Katayama et al., 2008) in conventional treatment process that
reported an average EV log influent and effluent concentration
of 4.2 and 1.2 log units, indicating an average removal of 2.6 log
units. Viruses have a tendency to attach to solids, and MBR
provides better solid separation that the conventional acti-
vated sludge WWTPs, which rely on settling.
Fig. 5 eInfectious virus reduction between WWTPs using
UV and Cl disinfection at the Pre- and Post-Disinfection
samples. UV (n[4), Cl (n[2). UV eultraviolet, Cl e
chlorination.
Fig. 6 eComparison of HAdV and EV log removal values
using real-time PCR data for MBR and conventional
wastewater treatment. (MBR removal n[8, Con removal
n[8).
water research 45 (2011) 3590e35983596
5. Conclusions
Based on our cell culture data we were able to determine
that an average concentration of 2.0 10
4
MPN/100 L enter
(raw sewage) the three WWTPs (WWTPs 1, 2 and 5),
1.6 10
1
MPN/100 L are discharged as final effluent and
1.4 10
2
MPN/g are retained in the biosolids.
It was observed that there is a significant log reduction
(1.9e5.0) in infectious viruses throughout the wastewater
treatment process before being discharged into natural
waterways.
It was observed that the reduction in infectious viruses
treated with UV or chlorination can range from 0.1 to 1.2 log
units as indicated by cell culture data between pre- and
post-disinfection.
Based on real-time PCR data, we concluded that an MBR
system is able to achieve approximately 2 log higher
reduction of HAdV (average 4.1 log units) as compared with
conventional wastewater treatment (average 2.2 log units).
However, similar EV log removal values (3.6 for MBR and 2.9
for conventional) were observed between the two types of
treatment processes.
Acknowledgments
We would like to thank the wastewater utilities personnel for
their assistance during this study.
references
Aulicino, F.A., Mastrantonio, A., Orsini, P., Bellucci, C.,
Muscillo, M., Larosa, G., 1995. Enteric viruses in a wastewater
treatment plant in Rome. Water, Air and Soil Pollution 91,
327e334.
Bofill-Mas, S., Albinana-Gimenez, N., Clemente-Casares, P.,
Hundesa, A., Rodriguez-Manzano, J., Allard, A., Calvo, M.,
Girones, R., 2006. Quantification and stability of human
adenoviruses and polyomavirus JCPyV in wastewater
matrices. Applied and Environmental Microbiology 72,
7894e7896.
Carducci, A., Morici, P., Pizzi, F., Battistini, R., Rovini, E., Verani, M.,
2008. Study of the viral removal efficiency in an urban
wastewater treatment plant. Water Science and Technology 58,
893e897.
da Silva, K., LeSaux, J.C., Parnaudeau, S., Pommepuy, M.,
Elimelech, M., Le Guyader, F.S., 2007. Evaluation of removal of
noroviruses during wastewater treatment, using real-time
reverse transcription-PCR: different behaviors of genogroups I
and II. Applied and Environmental Microbiology 73,
7891e7897.
Dierssen, U., Rehren, F., Henke-Gendo, C., Harste, G., Heim, A.,
2007. Rapid routine detection of enterovirus RNA in
cerebrospinal fluid by a one-step real-time RT-PCR assay.
Journal of Clinical Virology 42, 58e64.
Gerba, C.P., Pepper, I.L., Whitehead III, L.F., 2002. A risk
assessment of emerging pathogens of concern in the land
application of biosolids. Water Science and Technology 46,
225e230.
Godfree, A., Farrell, J., 2005. Processes for managing pathogens.
Journal of Applied Environmental Quality 34, 105e113.
Guzman, C., Jofre, J., Montemayor, M., Lucena, F., 2007.
Occurrence and levels of indicators and selected pathogens in
different sludges and biosolids. Journal of Applied
Microbiology 103, 2420e2429.
Haramoto, E., Katayama, H., Oguma, K., Ohgaki, S., 2007.
Quantitative analysis of human enteric adenoviruses in
aquatic environments. Journal of Applied Microbiology 103,
2153e2159.
Jiang, S., Dezfulian, H., Chu, W., 2005. Real-time quantitative PCR
for enteric adenovirus serotype 40 in environmental waters.
Canadian Journal of Microbiology 51, 393e398.
Jimenez-Clavero, M.A., Escribano-Romero, E., Mansilla, C.,
Go
´mez, N., Co
´rdoba, L., Roblas, N., Ponz, F., Ley, V., Sa
´iz, J.C.,
2005. Survey of bovine enterovirus in biological and
environmental samples by a highly sensitive real-time reverse
transcription-PCR. Applied and Environmental Microbiology
71, 3543e3536.
Jothikumar, N., Cromeans, T.L., Sobsey, M.D., Robertson, B.H.,
2005. Development and evaluation of a broadly reactive
TaqMan assay for rapid detection of hepatitis A virus. Applied
and Environmental Microbiology 71, 3359e3363.
Kageyama, T., Kojima, S., Shinohara, M., Uchida, K., Fukushi, F.,
Hoshino, F.B., Takeda, N., Katayama, K., 2003. Broadly reactive
and highly sensitive assay for Norwalk-like viruses based on
real-time quantitative reverse transcription-PCR. Journal of
Clinical Microbiology 41, 1548e1557.
Katayama, H., Haramoto, E., Oguma, K., Yamashita, A., Tajima, H.,
Nakajima, H., Ohgaki, S., 2008. One-year monthly quantitative
survey of noroviruses, enteroviruses, and adenoviruses in
wastewater collected from six plants in Japan. Water Research
42, 1441e1448.
Kittigul, L., Uthaisin, A., Ekchaloemkiet, S., Utrarachkij, F.,
Luksamijarulkul, P., 2006. Detection and characterization of
hepatitis A virus in water samples in Thailand. Journal
Applied Microbiology 100, 1318e1323.
Kuo, D., Simmons, F.J., Blair, S., Hart, E., Rose, J.B., Xagoraraki, I.,
2010. Assessment of human adenovirus removal in a full-scale
membrane bioreactor treating municipal wastewater. Water
Research 44, 1520e1530.
Laverick, M.A., Wyn-Jones, A.P., Carter, M.J., 2004. Quantitative rt-
pcr for the enumeration of noroviruses (Norwalk-like viruses)
in water and sewage. Letters in Applied Microbiology 39,
127e136.
Monpoeho, S., Maul, A., Bonnin, C., Patria, L., Ranarijaona, S.,
Billaudel, S., Ferre, V., 2004. Clearance of human-
pathogenic viruses from sludge: study of four stabilization
processes by real-time PCR reverse transcription-PCR and
cell culture. Applied and Environmental Microbiology 70,
5434e5440.
Nordgren, J., Matussek, A., Mattson, A., Svensson, L., Lindgren, P.
E., 2009. Prevalence of norovirus and factors influencing virus
concentrations during one year in a full-scale wastewater
treatment plant. Water Research 43, 1117e1125.
Payment, P., Fortin, S., Trudel, M., 1986. Elimination of human
enteric viruses during conventional wastewater treatment by
activated sludge. Canadian Journal of Microbiology 32,
922e925.
Petrinca, A.R., Donia, D., Pierangeli, A., Gabrieli, R., Degener, A.M.,
Bonanni, E., Diaco, L., Cecchini, G., Anastasi, P., Divizia, M.,
2009. Presence and environmental circulation of enteric
viruses in three different wastewater treatment plants.
Journal of Applied Microbiology 106, 1608e1617.
Pusch, D., Oh, D.Y., Wolf, S., Dumke, R., Schroter-Bobsin, U.,
Hohne, M., Rsoke, I., Schreier, E., 2005. Detection of enteric
viruses and bacterial indicators in German environmental
waters. Archives of Virology 150, 929e947.
water research 45 (2011) 3590e3598 3597
Rajal, V.B., McSwain, B.S., Thompson, D.E., Leutenegger, C.M.,
Kildare, B.J., Wuertz, S., 2007. Validation of hollow fiber
ultrafiltration and real-time PCR using bacteriophage PP7 as
surrogate for the quantification of viruses from water
samples. Water Research 41, 1411e1422.
Rodriguez-Diaz, J., Querales, L., Caraballo, L., Vizzi, E., Liprandi, F.,
Takiff, H., Betancourt, W.Q., 2009. Detection and
characterization of waterborne gastroenteritis viruses in
urban sewage and sewage-polluted river waters in Caracas,
Venezuela. Applied and Environmental Microbiology 75,
387e394.
Rodriguez, R., Patricia, A., Gundy, M., Gerba, C.P., 2008.
Comparison of BGM and PLC/PRC5 cell lines for total
culturable viral assay of treated sewage. Applied and
Environmental Microbiology 74, 2583e2587.
Rose, J., Dickson, L., Farrah, S., Carnahan, R., 1996. Removal
of pathogenic and indicator microorganisms by a full-
scale water reclamation facility. Water Research 30,
2785e2797.
Sedmak, G., Bina, D., MacDonald, J., Couillard, L., 2005. Nine-
year study of the occurrence of culturable viruses in
source water for two drinking water treatment plants
and the influent and effluent of a wastewater treatment
plant in Milwaukee, Wisconsin (August 1994 through July
2003). Applied and Environmental Microbiology 71,
1042e1050.
Simmons, F.J., Kuo, D.H.-W., Xagoraraki, I., 2011. Removal of
human enteric viruses by a full-scale membrane bioreactor
during municipal wastewater processing. Water Research 45
(9), 2739e2750.
Simonet, J., Gantzer, C., 2006a. Degradation of the poliovirus 1
genome by chlorine dioxide. Journal of Applied Microbiology
100, 862e870.
Simonet, J., Gantzer, C., 2006b. Inactivation of poliovirus 1 and F-
specific RNA phages and degradation of their genomes by UV
irradiation at 254 nanometers. Applied and Environmental
Microbiology 72, 7671e7677.
Sobsey, M.D., Glass, J.S., 1980. Poliovirus concentration from tap
water with electropositive absorbent filters. Applied and
Environmental Microbiology 40, 201e210.
USEPA, 2001. Manual of Methods for Virology (Chapter 14). EPA
600/4e84/013. Office of Water, U.S. Environmental Protection
Agency, Washington, DC.
Viau, E., Peccia, J., 2009. Survey of wastewater indicators and
human pathogen genomes in biosolids produced by class A
and class B stabilization treatments. Applied and
Environmental Microbiology 75, 164e174.
Wong, K., Onan, B., Xagoraraki, I., 2010. Quantification of enteric
viruses, pathogen indicators, and Salmonella bacteria in class B
anaerobically digested biosolids by culture and molecular
methods. Applied and Environmental Microbiology 76,
6441e6448.
Xagoraraki, I., Kuo, D.H.-W., Wong, K., Wong, M., Rose, J.B., 2007.
Occurrence of human adenoviruses at two recreational
beaches of the Great Lakes. Applied and Environmental
Microbiology 73, 7874e7881.
water research 45 (2011) 3590e35983598
