Content uploaded by Hwan Drew Kim
Author content
All content in this area was uploaded by Hwan Drew Kim on Sep 20, 2023
Content may be subject to copyright.
FULL PAPER
© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1339
wileyonlinelibrary.com
Physical Stimuli-Induced Chondrogenic Differentiation of
Mesenchymal Stem Cells Using Magnetic Nanoparticles
Boram Son , Hwan D. Kim , Minsoo Kim , Jeong Ah Kim , Jinkyu Lee , Heungsoo Shin ,
Nathaniel S. Hwang ,* and Tai Hyun Park *
DOI: 10.1002/adhm.201400835
B. Son, H. D. Kim, M. Kim, J. A. Kim,
N. S. Hwang, T. H. Park
School of Chemical and Biological Engineering
Seoul National University
1 Gwanak-ro , Gwanak-gu
Seoul 151–742 , Republic of Korea
E-mail: nshwnag@snu.ac.kr; thpark@snu.ac.kr
J. Lee, H. Shin
Department of Bioengineering
Hanyang University
Haengdang-dong 17 , Seongdong-gu
Seoul 133–791 , Republic of Korea
J. Lee, H. Shin
BK21 Plus Future Biopharmaceutical
Human Resources Training and Research Team
Hanyang University
Seoul 133–791 , Republic of Korea
T. H. Park
Advanced Institutes of Convergence Technology
145 Gwanggyo-ro , Yeongtong-gu , Suwon 443–270 , Republic of Korea
Chondrogenic commitments of mesenchymal stem cells (MSCs) require 3D
cellular organization. Furthermore, recent progresses in bioreactor technol-
ogy have contributed to the development of various biophysical stimulation
platforms for effi cient cartilage tissue formation. Here, an approach is reported
to drive 3D cellular organization and enhance chondrogenic commitment
of bone-marrow-derived human mesenchymal stem cells (BM-hMSCs) via
magnetic nanoparticle (MNP)-mediated physical stimuli. MNPs isolated from
Magnetospirillum sp. AMB-1 are endocytosed by the BM-hMSCs in a highly
effi cient manner. MNPs-incorporated BM-hMSCs are pelleted and then sub-
jected to static magnetic fi eld and/or magnet-derived shear stress. Magnetic-
based stimuli enhance level of sulfated glycosaminoglycan (sGAG) and col-
lagen synthesis, and facilitate the chondrogenic differentiation of BM-hMSCs.
In addition, both static magnetic fi eld and magnet-derived shear stress applied
for the chondrogenic differentiation of BM-hMSCs do not show increament of
hypertrophic differentiation. This MNP-mediated physical stimulation platform
demonstrates a promising strategy for effi cient cartilage tissue engineering.
1. Introduction
Recent progress in stem cell research has contributed to the
emergence in the fi eld of regenerative medicine, whereby tissue
repair and regeneration are stimulated by complex extracellular
signaling patterns.
[ 1 ] Cartilage is an avascular tissue that lacks
self-regeneration ability upon cartilage
lesions in the case of trauma or diseases.
Current clinical treatment strategies such
as mosaicplasty, autologous chondrocyte
transplantation, and microfractures have
varying success rate, with unsatisfactory
long-term outcomes.
[ 2,3 ] Besides, allo- and
autografts have many diffi culties such as
numerical inferiority of the cell source as
well as the easy loss of the transplanted
cells.
[ 4 ] Due to these disadvantages, human
mesenchymal stem cells (hMSCs), espe-
cially the bone-marrow- derived hMSCs
(BM-hMSCs), are currently being utilized
to regenerate cartilaginous tissues.
[ 5 ]
Recent stem cell-based cartilage tissue
engineering has been focused on not only
biochemical factors but also biophysical
stimulation for the chondrogenic dif-
ferentiation.
[ 6 ] Chondrogenesis of MSCs
involves multi-step process, where cellular
condensation is prerequisite for chondro-
genic differentiation.
[ 7,8 ] Micromass pellet culture system has
been established as a conventional method for chondroinduc-
tion of BM-hMSCs.
[ 9 ] In addition, the pellet culture system has
been used for the mass-production of cartilaginous modules.
[ 10 ]
However, in order to improve the chondrogenic differentiation
of BM-hMSCs and the retention of the transplanted cells, inno-
vative approaches are needed to create 3D-driven cellular struc-
tures.
[ 11 ] Magnetic nanoparticles (MNPs) have shown to offer
a promising strategy to induce multicellular organizations.
Forcing the cellular condensation via magnetic forces mimics
the cellular condensation that takes places in vivo during limb
development.
[ 8 ] Recent evidences have demonstrated that strat-
egies utilizing magnetic forces have proven their value in cell
therapy by allowing the engineering of the thick tissue sheets
and cellular clusters of controlled sizes.
[ 11,12 ] In addition, MNP-
incorporated microgels have shown to offer a promising alter-
native to shape the complex tissue-like organizations.
[ 13 ]
Previously, we have isolated uniformly sized MNPs from
Magnetospirillum sp. AMB-1, where they displayed high
cell-penetrating and intracellular delivery effi ciencies.
[ 14 ]
Magnetospirillum sp. AMB-1 is a helically shaped magnetic bac-
terium. When Magnetospirillum sp. AMB-1 cells are cultured in
aerobic condition, MNP are synthesized within the bacterium
cytoplasm.
[ 15 ] Tseng et al.
[ 16 ] demonstrated that the intracellular
delivery of MNPs has potential tool for simultaneous, mechan-
ical stimulation over range of forces. These cell-penetrating
MNPs did not impact the 10 d of long-term culture behavior
Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
FULL PAPER
1340 wileyonlinelibrary.com © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
of BM-hMSCs.
[ 17 ] In the present study, chondrogenic differen-
tiation of MNP delivered and pelleted BM-hMSCs under static
magnetic fi eld and/or magnet-derived shear stress were inves-
tigated. Our approach demonstrates the potential of magnetic-
force-induced biophysical stimulation to enhance cartilage
tissue formation of stem cells.
2. Results
2.1. Physical Stimuli-Induced Chondrogenic Differentiation
of BM-hMSCs Using MNPs
The magnetic nanoparticles (MNPs, Fe
3 O 4 ) with uniformed
average size of 40–50 nm were isolated from Magnetospirillum
sp. AMB-1 with ultrasonic disruption of the cell membrane.
Isolated MNPs were collected with magnet separation and steri-
lized prior to the intracellular delivery process ( Figure 1 ). MNP-
incorporated BM-hMSCs were then purifi ed with a magnetic
fi eld and 2 × 10
5 cells were centrifuged for 5 min at 500 × g for
the pellet formation. Pelleted BM-hMSCs were then cultured
under static magnetic fi eld and/or magnet-derived shear stress.
Since chondrogenic differentiation requires hMSC conden-
sation and shear stress on cells, we have applied the physical
stimuli (i.e., static magnetic and/or magnet-derived shear
stress) in the early phase of the chondrogenic differentiation.
Physical stimuli were applied to MNP-incorporated cell pel-
lets for 1 h for fi ve consecutive days up to 3 weeks in chon-
drogenic differentiation medium. Static magnetic fi eld resulted
in sedimentation of pellets at the bottom of the well. Further-
more, magnet-derived shear stress resulted in rotation of pel-
lets within the well (Supplementary video clip, Supporting
Information).
2.2. Characterization and Visual Inspection of MNPs within
BM-hMSCs
Cytotoxicity and optimal MNP concentration for intracellular
delivery were examined by incubating 5–50 µg mL
−1 of MNPs
with BM-hMSCs for upto 72 h. MNP concentration below
30 µg mL
−1 did not show any cytotoxicity ( Figure 2 A). However,
when BM-hMSCs were incubated with higher concentration
of MNPs (>40 µg mL
−1 ), decreased viability
depending on MNP concentration was
observed. 40 µg mL
−1 and 50 µg mL
−1 of
MNPs displayed viability of (87.01 ± 2.31)%
and (78.62 ± 5.03)%, respectively. More-
over, upto 72 h of incubation, cell viability
remained relatively constant (Supplementary
data 2, Supporting Information). Intracellular
uptake of MNPs by BM-hMSCs depended
on the concentration of MNPs added in the
medium. The intracellular delivery of MNPs
increased as the incubated concentration of
MNPs was increased (Figure 2 B). However,
delivery effi ciency of MNPs per cell reduced
at higher concentration, suggesting that
the cells reached their saturation capacity.
Maximum amount of MNPs uptake was around 150 pg cell
−1
when 40 mg mL
−1 of MNPs was incubated. Considering the
cytotoxicity and intracellular delivery effi ciency depending on
the concentration of MNPs, 150 µg of MNPs was treated to 10
6
cells in a 75 cm
2 tissue culture fl ask. Likewise, 150 µg MNPs
per 10
6 cells referred to as 10 µg mL
−1 MNPs were suffi cient
to induce cellular magnetization, which allowed the magnetic-
fi eld-induced cell separation (data not shown).
We further confi rmed the presence and location of MNPs in
the BM-hMSCs via transmission electron microscopy (TEM)
analysis and Prussian blue staining. As control, BM-hMSCs
without MNPs showed shape of the cell (Figure 2 C, left)
resulting in negative for Prussian blue staining (Figure 2 C,
right). On the other hand, TEM analysis of BM-hMSCs incor-
porated with MNPs indicated intracellularly delivered MNPs.
Clusters of MNPs were located within vesicle-like structures
and the number of MNP clusters varied from few (Figure 2 D-I,
II, and III) to hundreds (Figure 2 D-IV, V, and VI). We did not
detect any MNPs in the nucleus. Intracellularly delivered MNPs
showed positive for Prussian blue iron detection staining
(Figure 2 D, right).
2.3. Physical Stimuli-Induced Gross Morphological Swelling
The morphology of cell pellets was observed after 3-week chon-
drogenesis with or without physical stimuli. MNP incorporation
resulted in the darkening of the cell pellets. MNP-incorporated
cell pellet without any stimuli resulted in similar pellet size as
control BM-hMSCs pellet. On the contrary, the gross images
of each group showed that short-term static magnetic fi eld
and/or magnet-derived shear stress signifi cantly increased the
pellet size in comparison to Control (the pellet of BM-hMSCs
without MNPs and any stimuli) ( Figure 3 A). However, intracel-
lular delivery of MNPs and physical stimuli did not infl uence
the cellular proliferation after 3 weeks of culture in chondro-
genic differentiation medium (Figure 3 B). Cellular proliferation
was performed by quantifying the DNA, which showed relative
DNA content in all groups. Even though apoptotic cells were
observed in the center of the pellets by TUNEL assay, MNP is
not the main reason of the cell death but diffi culties of nutri-
tion and oxygen transfer
[ 18 ] (Supplementary data 3, Supporting
Information).
Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
Figure 1. Schematic for biophysical stimuli-induced chondrogenic differentiation of MNP-
incorporated BM-hMSC pellets. MNPs isolates and purifi ed were added to BM-hMSCs culture
medium. After overnight incubation with MNPs, cells were centrifuged to form pellets. More-
over, then cellular pellets with MNPs were cultured in chondrogenic differentiation medium in
presence of biophysical stimuli, represented as static magnetic fi eld and magnet-derived shear
stress for chondrogenic differentiation.
FULL PAPER
1341
wileyonlinelibrary.com
© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
2.4. Physical Stimuli-Induced Cartilage Tissue-Specifi c ECM
Production
For biochemical analysis of cell pellets, we examined the
amount of sulfated GAG (sGAG) and collagen in both secreted
form (in medium) and deposited form (within pellets). For
static magnetic fi eld condition (MNP_MF), sGAG released into
medium was increased from 18.12 ± 9.00 to 30.81 ± 7.94 (µg
µg
−1 of GAG/DNA) and the sGAG contained in pellets was
increased from 8.85 ± 1.47 to 20.93 ± 2.95 compared to the
condition without MNPs and any stimuli (Control). Also in
the same manner, sGAG content of medium and pellets was
increased to 64.41 ± 18.1 and 23.98 ± 1.59 for magnet-derived
shear stress applied group (MNP_S). The experimental group
with both magnetic fi eld and magnet-derived shear stress
(MNP_MF+S) increased sGAG content of medium and pel-
lets to 58.57 ± 5.10 and 30.37 ± 4.63, respectively ( Figure 4 A).
The sGAG content secreted into medium for MNP_S and
MNP_MF+S showed statistically signifi cant difference
compared to Control ( p < 0.01) and deposited sGAG content in
pellets of MNP_MF, MNP_S, and MNP_MF+S was also statisti-
cally different from one of Control ( p < 0.01), respectively (Sup-
plementary data 4, Supporting Information). As the result, the
total sGAG content in physical stimuli-induced groups (MNP_
MF, MNP_S, and MNP_MF+S) was enhanced up to statistically
signifi cant level compared to Control. Furthermore, MNP_S
and MNP_MF+S more than tripled as compared to Control.
Production of collagen was also quantifi ed after 3 weeks of
culture in differentiation medium. Measured total collagen
content in both medium and pellets for MNP_MF was 14.31 ±
1.37 (µg µg
−1 of Collagen/DNA), MNP_S was 18.92 ± 3.36, and
MNP_MF+S was 25.74 ± 6.17. All these results were higher
compared to both Control (6.69 ± 1.37) and MNP control
(5.89 ± 1.23) (Figure 4 B). The total collagen content of MNP_
MF, MNP_S, and MNP_MF+S showed statistical difference
compared to Control ( p < 0.01), respectively. Among those
groups, MNP_MF+S more than trebled to Control showing
synergistically enlarged total collagen content. Furthermore,
Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
Figure 2. The intracellular properties of MNPs. A) Cell viability according to the concentration of MNPs. B) The concentration of MNPs in a cell
according to their concentration incubated with cells. C) A TEM image (left) and the Prussian blue staining image (right) of a cell without MNPs. Scale
bar, 1 µm and 5 µm, respectively. D) TEM images and a Prussian blue staining image of the cells incorporated with 10 µg mL
−1 MNPs. I) An image
of incorporated MNPs in cytosol. MNPs were randomly dispersed throughout the cytoplasm indicated by dotted rectangle. Scale bar, 2 µm. IV) An
image of incorporated MNPs in vesicle-like structure. MNPs were encapsulated by cellular structure showed in the dotted rectangle. Scale bar, 2 µm.
II), V) Images focused on incorporated MNPs of I) and IV), each. Scale bar, 1 µm. III), VI) Images on an enhanced scale of I) and IV), each. Scale bar,
200 nm. VII) An image of Prussian blue staining presented iron ion of MNPs inside of the cells. Scale bar, 5 µm.
FULL PAPER
1342 wileyonlinelibrary.com © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
the amount of collagen in medium of physical stimuli-induced
groups (MNP_MF, MNP_S, and MNP_MF+S) was statistically
signifi cant ( p < 0.01) to Control, so was in pellets (Supplementary
data 5, Supporting Information). From the statistically signifi -
cant increase in sGAG and collagen concentration, we confi rmed
the effectiveness of mechanical stimulation in chondrogenesis,
which include magnetic fi eld and magnet-derived shear stress.
2.5. Physical Stimuli-Induced Cartilage-Specifi c Gene Regulation
To confi rm the effect of physical stimuli on chondrogenesis of
BM-hMSCs with MNPs, gene expression of type II collagen
(Col2A1), Aggrecan (Agg), and sex-determining region Y-box
(Sox9) was analyzed with real-time polymerase chain reaction
(PCR). The expression of all the genes was normalized by Con-
trol. Intracellular delivery of MNPs did not affect the expression
of any chondrogenic genes. The results showed that the gene
expression of Col2A1, Agg, and Sox9 was signifi cantly upregu-
lated ( p < 0.05) in the presence of biophysical stimuli ( Figure 5 ).
In particular, the group that was subjected to both magnetic
fi eld and magnet-derived shear stress demonstrated the highest
gene expression level for Col2A1, Agg, and Sox9 among all
experimental groups. Besides, MNP_S showed statistical sig-
nifi cance (p < 0.05) compared to MNP_MF and MNP_MF+S
to both MNP_MF and MNP_S with regard to Agg, respectively.
Regarding Sox9, the expression of chondrogenic genes for
MNP_MF+S was statistically upregulated ( p < 0.05) compared
to both MNP_MF and MNP_S.
2.6. Histological Confi rmation of Cartilage-Specifi c ECMs
Pellets were cut into 5-µm-thick sections and stained with
Safranin-O (Saf-O) for the detection of negatively charged pro-
teoglycan within the pellets. All pellets showed positive for
Saf-O. Compared to the control pellets, MNP incorporation
did not signifi cantly altered the chondrogenic commitment of
BM-hMSCs. Furthermore, single form of stimulus (i.e., either
a magnetic fi eld or a magnet-derived shear alone) did not sig-
nifi cantly modulate the proteoglycan deposition. However, his-
tological examinations confi rmed that application of the both
magnetic fi eld and magnet-derived shear stress facilitated
the cartilaginous tissue formation. MNPs with both physical
stimulations showed clear evidence of increased proteoglycan
deposition compared to the Control ( Figure 6 A). Furthermore,
periphery of MNP_S and MNP_MF+S cellular pellets showed
pronounced Saf-O stained regions (indicated by dotted ovals).
Among various types of collagen, collagen type II takes a sig-
nifi cant portion of the articular cartilage protein. Immunohis-
tochemical (IHC) analysis of engineered cartilaginous tissues
showed distinct type II collagen deposition when BM-hMSCs
pellets were cultured under exposure to static magnetic fi eld
and/or magnet-derived shear stress (Figure 6 B).
2.7. Hypertrophical Analysis
We further examined, whether the magnetic-fi eld-induced
hypertrophic differentiation of cell pellets. Real-time PCR
analysis after 3 weeks of culture showed that the hypertrophic
genes, such as matrix metallopeptidase 13 (MMP13), col-
lagen type X (Col10A1), and runt-related transcription factor
2 (RunX2), were not infl uenced by the magnetic-fi eld-induced
differentiation ( Figure 7 A). Collagen type X represents hyper-
trophy of the cartilage, which means ossifi cation of the tissue
losing its own function. IHC of sectioned tissues showed the
minimal collagen type X content variations in all experimental
groups (Figure 7 B).
3. Discussion
Chondrogenesis is a complex, highly organized process, in
which MSC condensation precedes chondrogenic differen-
tiation and extracellular matrix generation. Environmental
stimuli, in the form of mechanical stimulations have been
shown to have a profound effect on gene expression, prolifera-
tion, and differentiation of MSCs.
[ 19 ] The paradigm of stem cell-
based cartilage tissue engineering, in essence, is to manipulate
a patient’s own stem cells using mechanical stimuli and bio-
chemical signaling molecules to develop functional cartilage
replacement at the defective site.
Recently, many researchers studied the effect of those bio-
physical stimuli on chondrogenic differentiation of MSCs,
in efforts to enhance the effi ciency of chondrogenesis.
[ 5 ]
Magnetic-force-based approaches have the advantage of
remotely controlling the stimuli with spatial and/or temporal
precision.
[ 20 ] Recently developed MNP technologies have
been employed to modulate specifi c mechanosensitive signal
Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
Figure 3. Gross images of each pellet group and their DNA content.
A) Gross morphology of fi ve independent experimental groups observed
after 3 weeks of chondrogenic differentiation. From left to right, a pellet
of BM-hMSCs (without MNPs) without stimuli; a pellet of the cells
(with MNPs) without stimuli; a pellet of the cells (with MNPs) under
static magnetic fi eld; a pellet of the cells (with MNPs) under magnet-
derived shear stress; and a pellet of the cells (with MNPs) under both
static magnetic fi eld and magnet-derived shear stress. Scale bar, 500 µm.
B) The change of DNA content in BM-hMSC pellets examined after
3-week cultivation.
FULL PAPER
1343
wileyonlinelibrary.com
© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
transduction pathways. RGD-conjugated MNPs were utilized
to remotely manipulate the chondrogenic differentiation of
MSCs.
[ 21 ] Furthermore, when TREK-1 ion channel (a stretch-
activated potassium channel) antibody-conjugated MNPs were
bound to MSCs, TREK-1 activation was observed upon 1 Hz
magnetic fi eld stimulations.
[ 22 ]
Results from this study demonstrated
that MNPs isolated from Magnetospirillum
sp. AMB-1 were effi ciently taken upon by
the BM-hMSCs. MNPs were isolated upon
ultrasonic disruption of harvested cells,
and enhanced cellular uptake of MNPs
was probably due to the bacterium lipid
layer residue on MNPs. We confi rmed cell-
penetrating property and incorporation of
MNPs into cells through TEM analysis and
Prussian blue staining. Quantifi cation of
intracellularly delivered MNPs showed the
maximum uptake of 150 pg per cell. Intra-
cellular delivery of MNPs amounting ≈75 pg
per cell (corresponding to 10 µg mL
−1 ) was
suffi cient to be modulated (i.e., magnetically
assemble) by the applied magnetic fi eld.
Probable mechanisms of MNP delivery into
the cells are either via endocytic uptake or
via membrane-fusion.
[ 23 ] Our 3-week study
showed that MNPs were able to stably incor-
porate within the cells. Furthermore, TEM
analysis demonstrated two similar fates of
intracellularly delivered MNPs. MNPs were
either randomly dispersed over the cyto-
plasm
[ 24 ] or clustered within endosome-like
vesicles.
[ 25 ] The infl uence of dispersed or
localized form of MNPs in conjunction with
a magnetic fi eld/stress on the intracellular
modulation is unclear, yet. Furthermore,
fi nal intracellular destination or fates of
MNPs need to be clarifi ed over a long period
of time. Though MNPs themselves did not
have any direct effect on chondrogenic dif-
ferentiation, exogenously applied static
magnetic fi eld, and magnet-derived shear
stress have probably induced closer cell–cell
interactions and increased the nutrient perfusion within the
pellets, respectively. The application of the magnetic fi eld to
MSCs without MNPs could have an effect on chondrogenesis.
However, it was reported that the magnetic fi eld weaker than
0.4 T did not enhance the chondrogenic induction of MSCs.
[ 26 ]
The magnetic fi eld used in this study (0.25 T) is not strong
Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
Figure 4. Biochemical analysis. A) sGAG and B) collagen of each group determined by bio-
chemical assays. All data were normalized by DNA amount. Error bars represented the standard
deviation on the mean for n = 5. * indicated p < 0.05 and ** indicated p < 0.01 compared to
control cell pellets without MNPs and any stimuli.
Figure 5. Chondrogenic genes analysis. Gene expression level of chondrogenic markers was detected. Expression of Col2A1, Agg, and Sox9 was normal-
ized by control group (cell pellets without MNPs and any stimuli) and GAPDH was used for housekeeping gene. Black lines indicate the statistically
signifi cant difference between linked groups ( p < 0.05).
FULL PAPER
1344 wileyonlinelibrary.com © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
enough to give an effect on chondrogenesis of MSCs without
MNPs.
The results of gross images demonstrated that the diameter
of cell pellets increased when more than one of static magnetic
fi eld and magnet-derived shear stress was applied. However,
there was no cellular proliferation regardless of MNPs and
physical stimuli following the DNA content analysis. According
to Oster GF (1985), the ECM is osmotically swollen following
Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
Figure 6. Histological analysis. A) Saf-O staining. sGAG were stained in distinct experimental groups. Scale bar, 100 µm. B) IHC analysis of collagen
type II staining (red). Scale bar = 100 µm (40×).
Figure 7. Analysis of hypertrophic chondrogenesis. A) Gene expression level of hypertrophy. Expression of MMP13, Col10A1, and RunX2 was normal-
ized by control group (cell pellets without MNPs and any stimuli) and GAPDH was used for housekeeping gene. B) IHC analysis of collagen type X
staining (red). Scale bar = 100 µm (40×).
FULL PAPER
1345
wileyonlinelibrary.com
© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
the chondrogenesis progression, due to cross-linked GAG, one
of the major components in chondrogenic ECM.
[ 27 ] Increment
in volume of cell pellets with physical stimuli would signify
their suffi cient chondrogenic differentiation.
In biochemical analysis, the concentration of sGAG and col-
lagen was higher in medium than in pellets for all the experi-
mental groups. The cartilage tissue-specifi c ECM is composed
of mainly sGAG and collagen and the amount of secreted form
into medium would be larger compared to deposited form in
pellets. Despite the medium or pellet difference, these cartilage
tissue-specifi c ECMs were upregulated in stimulated groups
compare to nonstimulated groups.
Further applications using MNP technologies could be pos-
sible to maintain cells at a specifi c region of the cartilage defect
using an external magnet. This would signifi cantly reduce the
number of cells required for transplantation by preventing the
migration of cells to other regions of the body. On this issue,
using our method could be a novel solution. We developed cell
pellets with MNPs, where pellet migration and rotation can be
regulated by magnetic force.
4. Conclusion
In summary, we improved the chondrogenic differentiation
effi ciency by applying a static magnetic fi eld and/or magnet-
derived shear stress with cell-penetrating MNPs. MNP-incor-
porated BM-hMSCs were placed under biophysical stimuli
in pellet cultures. The results of this study demonstrated that
short-term biophysical stimuli on BM-hMSCs labeled with
MNPs over 3 weeks enhanced cartilage tissue-specifi c biochem-
icals and chondrogenic gene expression. The result indicated
that single magnet-derived shear stress had more chondrogenic
differentiation effect than single static magnetic fi eld, and static
magnetic fi eld synergized with magnet-derived shear stress
was more effective than single magnet-derived shear stress in
chondrogenesis. Although the physical stimuli referred to as
static magnetic fi eld and magnet-derived shear stress needed
more precise optimization, it was obvious that static magnetic
fi eld synergized with magnet-derived shear stress would be the
most effective biophysical stimuli on chondrogenesis. Further-
more, it demonstrated magnetic force-induced physical stimuli
did not affect hypertrophic differentiation of BM-hMSC pellets.
Therefore, experimental groups with MNPs seemed to differ-
entiate into chondrocytes more effectively regardless of hyper-
trophy when stimulated by more than one of static magnetic
fi eld and magnet-derived shear stress.
5. Experimental Section
Preparation of Magnetic Nanoparticles : Magnetic nanoparticles (MNPs,
Fe
3 O 4 ) prepared in this study were isolated from Magnetospirillum sp.
AMB-1 as previously described.
[ 14 ] In brief, cultured bacteria cells were
centrifuged at 11300 × g for 20 min and then sonicated (VCX500, Sonics
& Materials, USA) at 35% amplifi cation degree for 15 min. Isolated
MNPs were purifi ed using neodymiumiron boron (NdFeB) magnets.
Relationship between NDfeB magnets’ magnetic fi eld and z-position
was measured (Supplementary data 1, Supporting Information) by given
equation (program derived):
BBLW
zz LW
LW
Dz Dz L W
arctan 24 arctan 2( ) 4( )
r
22 2 22 2
π
=++
⎛
⎝
⎜⎞
⎠
⎟−++++
⎛
⎝
⎜⎞
⎠
⎟
⎡
⎣
⎢
⎢
⎤
⎦
⎥
⎥
(1)
where B r is the remanence fi eld (in our case: B r = 0.25 mT), z is a
distance from a pole face on the symmetry axis, L is length, W is width,
and D is the thickness of the magnet. Finally, MNPs were dispersed in
PBS and autoclaved. After collection and purifi cation of MNPs, their
concentration was quantifi ed using inductively coupled plasma atomic
emission spectroscopy (ICPS-7500, Shimadzu, Japan). MNPs were
concentrated to 1 mg mL
−1 in PBS, and stored at 4 °C.
Bone Marrow-Derived Human Mesenchymal Stem Cell Culture : Bone
marrow-derived human mesenchymal stem cells (BM-hMSCs) were
purchased at passage 2 from Lonza (Switzerland). BM-hMSCs were
maintained in 75 cm
2 tissue culture fl asks in mesenchymal stem cell
growth medium (MSCGM) supplemented with MSCGM SingleQuots
Kit (Lonza, Switzerland) at 37 °C in a humidifi ed CO
2 incubator. Cells
were detached using 0.25% trypsin–EDTA (Sigma, USA) when they
have reached approximately 95% cellular confl uence and re-seeded for
passage after re-suspension in growth medium. Passage 3–5 cells were
used for experiments.
Cell Viability Test : To examine cytotoxicity of MNPs, a WST-8 Cell
Counting Kit (Dojindo, Japan) assay was performed. The WST-8 CCK
test is based on the conversion of the tetrazolium salt, WST-8, to highly
water-soluble formazan by dehydrogenase in living cells. The amount
of yellow-color formazan dye generated by the reaction is measured
to detect the number of viable cells. After the incubation of cells with
MNPs in 96-well plates at 37 °C in a humidifi ed CO
2 incubator, cells
were incubated with cell culture medium supplemented with 10% WST-8
solution for an additional 2 h in the incubator. The absorbance of each
well was then measured at 450 nm (Tecan Infi nite m200, Switzerland).
Pellet Culture and Chondrogenic Differentiation of BM-hMSCs :
BM-hMSCs were incubated with 10 µg mL
−1 of cell-penetrating MNPs
for 24 h. MNP-incorporated cells were then placed into round-bottom
96-well plates (Micronic, Netherlands) at a concentration of 200 000
cells per well and centrifuged for 5 min at 500 × g for pellet formation.
Pellets were then maintained with chondrogenic differentiation
medium composed of serum-free DMEM (Sodium pyruvate, Glutamine
included), 1% Insulin, human Transferrin, and Selenous acid (ITS)
universal cell culture supplement Premix (BD Bioscience, Franklin Lakes,
NJ, USA), 39 ng mL
−1 dexamethasone (Sigma, St. Louis, MO, USA),
50 µg mL
−1 ascorbic-2-phosphate (Sigma, USA), 40 µg mL
−1 L -proline
(Sigma, USA), and 10 ng mL
−1 recombinant human transforming growth
factor-
β
3 (TGF-
β
3, R&D Systems, Minneapolis, MN, USA) for 3 weeks at
37 °C in a humidifi ed atmosphere of 5% CO
2 in air. The chondrogenic
medium was replaced in every 3 d.
Application of Static Magnetic Field and/or Magnet-Derived Shear
Stress : For static magnetic fi eld induction, pelleted BM-hMSCs with
intracellular-delivered MNPs were placed on neodymium iron boron
(NdFeB) magnets (0.25 mT). For magnet-derived shear stress, pelleted
BM-hMSCs with intracellular-delivered MNPs were placed on top of
magnetic stirrer (60 rpm). For combined stimulation, cell pellets with
MNPs were placed on the top of NdFeB magnets and then transferred
to the top of magnetic stirrer in consecutive order. Static magnetic fi eld
and/or magnet-derived shear stress on pellets was applied for 1 h a day
for 5 consecutive days and further maintained for 3 weeks. Cell pellets
without MNP were maintained as control. In addition, BM-hMSCs
with MNPs were also pellet-cultured for 3 weeks without any external
stimulation as MNP control.
Transmission Electron Microscopy Analysis : For transmission electron
microscopy (TEM) analysis, pellets of BM-hMSCs incorporated
with 10 µg mL
−1 MNPs or without MNPs were fi xed with 4%
paraformaldehyde for 24 h at 4 °C and then treated with 2.5%
glutaraldehyde for an hour. The pellets were then treated with 2% OsO
4
and 0.1
M sodium cacodylate buffer for 1 h and 2 h, respectively. The
cell pellets were washed and serially dehydrated with ethanol. Finally,
they were penetrated with a propylene oxide and resin mixture and
Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
FULL PAPER
1346 wileyonlinelibrary.com © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
then embedded in Epon 812 (Electron Microscopy Sciences, Hatfi eld,
PA, USA). The embedded samples were cut using an Ultracut UCT
ultramicrotome (MTX ultramicrotome, RMC, Boeckeler Instruments,
Tucson, AZ, USA) and then observed using by TEM (JEM-3010).
Biochemical Analysis : Pellets were collected ( n = 5) and digested
in papainase solution (1 mL construct
−1 ; 125 µg mL
−1 , Worthington
Biomedical, Lakewood, NJ, USA) for 16 h at 60 °C.
[ 3 ] DNA content
was quantifi ed using Quant-iT PicoGreendsDNA Assay Kit (Invitrogen,
Carlsbad, CA, USA) according to the manufacturer’s instruction. The
sulfated glycosaminoglycan (sGAG) content was quantifi ed using
dimethylmethylene blue (DMMB) spectrophotometric assay at A525,
as previously described.
[ 7 ] Total collagen content was determined by
measuring the hydroxyproline content of the constructs after acid
hydrolysis and reaction with p-dimethylaminobenzaldehyde and
chloramine-T, as previously described.
[ 8 ] All fl uorescence and absorbance
were measured by Infi nite 200 reader (Tecan, Switzerland). DNA
contents normalized the amount of sGAG and collagen.
Real-Time Polymerase Chain Reaction : To analyze the chondrogenic
differentiation of BM-hMSCs, relative expression changes of
chondrogenic specifi c genes and hypertrophic genes were measured.
Total RNA was extracted using Trizol reagent (Invitrogen, USA)
according to the manufacturer’s instruction. M-MLV cDNA synthesis
kit (Enzynomics, South Korea) was used for reverse transcription. Real-
time polymerase chain reaction (PCR) was performed using TOPrealTM
qPCR 2X PreMIX (Enzynomics, South Korea) utilizing StepOnePlusTM
Real-Time PCR System. Each of the expressed genes was normalized by
glyceraldehyde 3-phosphate dehydrogenase (GAPDH), an endogenous
reference gene, and analyzed using relative quantifi cation methods.
Relative expression values are represented as fold changes in gene
expression relative to the control group (cell pellets without MNPs and
any stimuli). For the primer, collagen type II (Col2A1), aggrecan (Agg)
and sex-determining region Y-box (Sox9) were used as chondrogenic
markers while matrix metallopeptidase 13 (MMP13), collagen-type X
(Col10A1), and runt-related transcription factor 2 (RunX2) were used
as hypertrophic markers. The sequences of each marker’s forward and
reverse primers are listed in Table 1 .
Histological and Immunohistochemical Analysis : Pellets were collected
and fi xed in 4% paraformaldehyde for 24 h. After serial dehydration with
ethanol, samples were then embedded in paraffi n to be cut in sections.
The 5-µm-thick histologic sections were stained with 0.1% of Safranin-O
(Saf-O) for detecting sulfated proteoglycan. For Prussian blue staining,
unstained histological sections were immersed in solution containing
equal parts of hydrochloric acid and potassium ferrocyanide for 20 min.
Immunohistochemical (IHC) staining was performed to identify the
chondrogenic markers using the primary antibodies: collagen type II
antibody (ab34712, 1:100, abcam, Cambridge, USA), and collagen type X
antibody (ab104601, 1:100, abcam, Cambridge, USA). The sections were
incubated with primary antibodies overnight and were subsequently
exposed to biotinylated secondary antibody and streptavidin peroxidase
complex.
Statistical Analysis : All Data are expressed as mean±standard
deviation (SD). Statistical signifi cance was determined by analysis
of variance (ANOVA single factor) with * for p < 0.05, and ** for p <
0.01.
Supporting Information
Supporting Information is available from the Wiley Online Library or
from the author.
Acknowledgements
B.S. and H.D.K. contributed equally. This research was supported by the
National Research Foundation of Korea (NRF) funded by the Ministry
of Science, ICT & Future Planning (Grant Numbers: 2014060753,
2014001783, and 2014060780).
Received: December 29, 2014
Revised: March 9, 2015
Published online: April 2, 2015
[1] a) N. S. Hwang , J. Elisseeff , J. Knee Surg. 2009 , 22 , 60 ;
b) N. S. Hwang , C. Zhang , Y. S. Hwang , S. Varghese , Wiley Interdis-
cipl. Rev. Syst. Biol. Med. 2009 , 1 , 97 .
[2] D. J. Huey , J. C. Hu , K. A. Athanasiou , Science 2012 , 338 ,
917 .
[3] E. B. Hunziker , Osteoarthritis Cartilage 2001 , 9 , 22 .
[4] E. B. Hunziker , Osteoarthritis Cartilage 2002 , 10 , 432 .
[5] a) M. F. Pittenger , A. M. Mackay , S. C. Beck , R. K. Jaiswal ,
R. Douglas , J. D. Mosca , M. A. Moorman , D. W. Simonetti , S. Craig ,
D. R. Marshak , Science 1999 , 284 , 143 ; b) A. I. Caplan , J. Ortho-
paedic Res. 1991 , 9 , 641 .
[6] a) P. Angele , J. U. Yoo , C. Smith , J. Mansour , K. J. Jepsen ,
M. Nerlich , B. Johnstone , J. Orthopaedic Res. 2003 , 21 , 451 ;
b) D. R. Wagner , D. P. Lindsey , K. W. Li , P. Tummala , S. E. Chandran ,
R. L. Smith , M. T. Longaker , D. R. Carter , G. S. Beaupre , Ann.
Biomed. Eng. 2008 , 36 , 813 ; c) J. J. Campbell , D. A. Lee , D. L. Bader ,
Biorheology 2006 , 43 , 455 ; d) Y. J. Li , N. N. Batra , L. You , S. C. Meier ,
I. A. Coe , C. E. Yellowley , C. R. Jacobs , J. Orthopaedic Res. 2004 , 22 ,
1283 .
[7] B. J. Rodgers , W. M. Kulyk , R. A. Kosher , Cell Differentiation Dev.
1989 , 28 , 179 .
[8] F. Revillion-Carette , X. Desbiens , L. Meunier , A. Bart , Differentiation
Res. Biol. Diversity 1986 , 33 , 121 .
[9] K. Onodera , I. Takahashi , Y. Sasano , J. W. Bae , H. Mitani ,
M. Kagayama , H. Mitani , Eur. J. Cell Biol. 2005 , 84 , 45 .
[10] a) Y. H. Park , J. I. Yun , N. R. Han , H. J. Park , J. Y. Ahn , C. Kim ,
J. H. Choi , E. Lee , J. M. Lim , S. T. Lee , BioMed. Res. Int. 2013 , 2013 ,
347618 ; b) X. Tang , L. Sheng , F. Xie , Q. Zhang , Mol. Med. Rep.
2012 , 6 , 745 .
[11] a) T. J. Bartosh , J. H. Ylostalo , A. Mohammadipoor , N. Bazhanov ,
K. Coble , K. Claypool , R. H. Lee , H. Choi , D. J. Prockop , Proc.
Natl. Acad. Sci. U.S.A. 2010 , 107 , 13724 ; b) A. Papadimitropoulos ,
E. Piccinini , S. Brachat , A. Braccini , D. Wendt , A. Barbero , C. Jacobi ,
I. Martin , PloS One 2014 , 9 , e102359 .
[12] R. Z. Lin , H. Y. Chang , Biotechnol. J. 2008 , 3 , 1172 .
[13] a) V. H. Ho , K. H. Muller , A. Barcza , R. Chen , N. K. Slater , Bio-
materials 2010 , 31 , 3095 ; b) A. M. Bratt-Leal , K. L. Kepple ,
R. L. Carpenedo , M. T. Cooke , T. C. McDevitt , Integrative Biol. 2011 ,
3 , 1224 ; c) G. R. Souza , J. R. Molina , R. M. Raphael , M. G. Ozawa ,
D. J. Stark , C. S. Levin , L. F. Bronk , J. S. Ananta , J. Mandelin ,
M. M. Georgescu , J. A. Bankson , J. G. Gelovani , T. C. Killian ,
W. Arap , R. Pasqualini , Nat. Nanotechnol. 2010 , 5 , 291 .
[14] a) S. Seong , T. H. Park , Biotechnol. Bioeng. 2001 , 76 , 11 ; b) J. A. Kim ,
H. J. Lee , H. J. Kang , T. H. Park , Biomed. Microdevices 2009 , 11 , 287 .
[15] T. Suzuki , Y. Okamura , R. J. Calugay , H. Takeyama , T. Matsunaga ,
J. Bacteriol. 2006 , 188 , 2275 .
Table 1. The sequences of each marker’s forward and reverse primers.
Gene Sense Antisense
GAPDH CCACTGGCGTCTTCACCA GCCAGGGGTGCTAAGCA
Aggrecan CGGAATGGAAACGTGAATC GGCGCCAGTTCTCAAATT
SOX9 ATGAATCTCCTGGACCCCTT CTCGCTCTCCTTCTTCAGAT
COL2A1 GGGCCCAGTGGTCTTGCT GCCAGGAAGACCCCTCAG
COL10A1 GGCAACAGCATTATGACC CCACACCTGGTCATTTTC
RUNX-2 CCAAGTAGCAAGGTTCAACG CATCAAGCTTCTGTCTGTGC
MMP-13 GGCCTGCTGGCTCATGCT GTGCTCCAGGGTCCTTGG
FULL PAPER
1347
wileyonlinelibrary.com
© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Adv. Healthcare Mater. 2015, 4, 1339–1347
www.advhealthmat.de
www.MaterialsViews.com
[16] P. Tseng , J. W. Judy , D. Di Carlo , Nat. Methods 2012 , 9 , 1113 .
[17] J. A. Kim , J. H. Choi , M. Kim , W. J. Rhee , B. Son , H. K. Jung ,
T. H. Park , Biomaterials 2013 , 34 , 8555 .
[18] K. Jahn , R. G. Richards , C. W. Archer , M. J. Stoddart , Eur. Cells
Mater. 2010 , 20 , 149 .
[19] a) R. M. Delaine-Smith , G. C. Reilly , Muscles , Ligaments Tendons J.
2012 , 2 , 169 ; b) D. Li , J. Zhou , F. Chowdhury , J. Cheng , N. Wang ,
F. Wang , Regenerative Med. 2011 , 6 , 229 .
[20] J. Dobson , Nat. Nanotechnol. 2008 , 3 , 139 .
[21] a) G. Liu , C. Xia , Z. Wang , F. Lv , F. Gao , Q. Gong , B. Song , H. Ai ,
Z. Gu , J. Mater. Sci. Mater. Med. 2011 , 22 , 601 ; b) J. M. Anderson ,
M. Kushwaha , A. Tambralli , S. L. Bellis , R. P. Camata , H. W. Jun ,
Biomacromolecules 2009 , 10 , 2935 ; b) B. S. Shah , P. A. Clark ,
E. K. Moioli , M. A. Stroscio , J. J. Mao , Nano Lett. 2007 , 7 , 3071 ;
c) S. P. Grogan , C. Pauli , P. Chen , J. Du , C. B. Chung ,
S. D. Kong , C. W. Colwell Jr. , M. K. Lotz , S. Jin , D. D. D’Lima ,
Tissue Eng. Part C, Methods 2012 , 18 , 496 ; d) B. Hu ,
A. J. El Haj , J. Dobson , Int. J. Mol. Sci. 2013 , 14 , 19276 .
[22] a) Q. A. Pankhurst , N. T. K. Thanh , S. K. Jones , J. Dobson , J. Phys. D
Appl. Phys. 2009 , 42 , 224001 ; b) S. Hughes , A. J. El Haj , J. Dobson ,
Med. Eng. Phys. 2005 , 27 , 754 ; c) J. M. Kanczler , H. S. Sura ,
J. Magnay , D. Green , R. O. Oreffo , J. P. Dobson , A. J. El Haj , Tissue
Eng. Part A 2010 , 16 , 3241 ; d) N. J. Sniadecki , Endocrinology 2010 ,
151 , 451 ; e) S. Hughes , S. McBain , J. Dobson , A. J. El Haj , J. R. Soc.
Interface 2008 , 5 , 855 .
[23] a) V. L. Colvin , Nat. Biotechnol. 2003 , 21 , 1166 ; b) A. K. Gupta ,
M. Gupta , Biomaterials 2005 , 26 , 3995 .
[24] J. Gao , G. Liang , B. Zhang , Y. Kuang , X. Zhang , B. Xu , J. Am. Chem.
Soc. 2007 , 129 , 1428 .
[25] A. Wittrup , S. H. Zhang , K. J. Svensson , P. Kucharzewska ,
M. C. Johansson , M. Morgelin , M. Belting , Proc. Natl. Acad. Sci.
U.S.A. 2010 , 107 , 13342 .
[26] H. D. Amin , M. A. Brady , J. P. St-Pierre , M. M. Stevens ,
D. R. Overby , C. R. Ethier , Tissue Eng. Part A 2014 , 20 , 1612 .
[27] G. F. Oster , J. D. Murray , P. K. Maini , J. Embryol. Experimental Mor-
phol. 1985 , 89 , 93 .
