Hiromi Nishida

Toyama Pref. Univ. · Department of Biotechnology

The lactic acid bacterium Enterococcus faecalis genomic DNA and seven phylogenetically distant bacterial genomic DNAs were microinjected into 126 enlarged protoplasts of E. faecalis. After the microinjection, a time-lapse observation was performed on how the cells enlarged. Most cells did not stop enlarging. The enlargement patterns were compared w...

We collected 92 isolates belonging to the genus Bacillus from the sake brewing process at Shiraki Tsunesuke Sake Brewery in Gifu, Japan to determine whether there is strain specificity at individual sake breweries. After distributing the isolates into seven groups, we observed that at least two groups (68 isolates) were kuratsuki bacteria at Shirak...

Kocuria isolates collected from the sake brewing process have inhabited the Narimasa Sake Brewery in Toyama, Japan. To investigate the effect of these actinobacterial isolates on the growth and metabolism of sake yeast, co-cultivation of sake yeast and Kocuria isolates was performed in a medium containing tryptone, glucose, and yeast extract (TGY),...

Bacteria belonging to the genus Kocuria were identified as bacteria peculiar to a sake brewery in Toyama, Japan. Comparison of the 16S rRNA gene sequences revealed two groups of Kocuria isolates. Among known species, one group was similar to K. koreensis (Kk type), and the other, K. uropygioeca (Ku type). We determined complete genomic DNA sequence...

Kocuria isolates collected from the sake brewing process have inhabited the Narimasa Sake Brewery in Toyama, Japan. To investigate the effect of these actinobacterial isolates on the growth and metabolism of sake yeast, co-cultivation of sake yeast and Kocuria isolates was performed in a medium containing tryptone, glucose, and yeast extract (TGY),...

We demonstrate that plasma membrane biosynthesis and vacuole formation require DNA replication in Enterococcus faecalis protoplasts. The replication inhibitor novobiocin inhibited not only DNA replication but also cell enlargement (plasma membrane biosynthesis) and vacuole formation during the enlargement of the E. faecalis protoplasts. After novob...

Cell enlargement is essential for the microinjection of various substances into bacterial cells. The cell wall (peptidoglycan) inhibits cell enlargement. Thus, bacterial protoplasts/spheroplasts are used for enlargement because they lack cell wall. Though bacterial species that are capable of gene manipulation are limited, procedure for bacterial c...

Background The traditional Japanese alcoholic drink, sake, is classified into two types: those that contain sediment produced during the production process (cloudy sakes) and those that do not contain such sediment (clear sakes). Leftover pressed sediment from the sake production process, sake-kasu (sake cake or sake lees), is commercially availabl...

Vacuole generation occurs frequently during the enlargement of bacterial protoplasts and spheroplasts. Gram-positive Enterococcus faecalis protoplasts and gram-negative Lelliottia amnigena spheroplasts had large and small vacuoles inside the cytoplasm, respectively. Although no vacuoles were found at the early stage of cell enlargement, all enlarge...

Together with the worldwide Washoku (traditional Japanese foods and drinks) boom, interest in sake, a traditional Japanese alcoholic drink, is increasing around the world. There are few scientific analyses and studies on the production of sake or the final product itself. We show the diversity of bacterial contaminants during sake production and in...

Protoplasts of Enterococcus faecalis did not divide but enlarged in Difco Marine Broth containing penicillin. Our previous studies have demonstrated that transcription and translation were essential for bacterial cell enlargement. However, it was uncertain whether replication was also essential. In this study, we measured the amount of DNA in E. fa...

RodZ is a cytoskeletal protein associated with bacterial cell shape. It is a transmembrane protein located on the plasma membrane, and it binds to another cytoskeletal protein MreB. Deinococcus grandis contains a rodZ homolog. Although D. grandis is rod-shaped, it becomes spherical in shape when the rodZ homolog is disrupted. The rodZ deletion muta...

In our previous study, we showed that cell fusion occurred in spheroplasts of Deinococcus grandis at 200 mM calcium chloride in the incubation medium. Extra-huge cells (> 0.1 mm in diameter) were observed at this concentration with a low frequency of appearance. In this study, we showed that cell fusion occurred consecutively in D. grandis spheropl...

Generally, enlarged spheroplasts of the Gram-negative bacterium Deinococcus grandis contain a single cytoplasm and a large periplasmic space. Enlargement of D. grandis spheroplasts requires the presence of divalent cation Ca2+ or Mg2+. In this study, we elucidated the effects of concentrations of these divalent cations on the enlargement of spherop...

It is well known that horizontally transferred genes (HTGs) contribute to the adaptation of archaea to their living environment. Archaea have acquired HTGs not only from other archaea but also from bacteria. HTGs should be integrated into the host archaeal transcriptional networks to become functional. In bacteria, the nucleoid proteins, such as H-...

This book comprehensively discusses our current understanding of the role and biological mechanisms of horizontal transfer of genetic elements in the environment, which has been important in the evolution of prokaryotes (archaea and bacteria). Horizontal transfer of genetic elements generates variations of prokaryotes and their genomes. Comparative...

Background The genus Deinococcus consists of species in rod-shape ( Bacilli ) and spherical shape ( Cocci ). Objective In this study, we aimed to determine whether the common ancestor of Deinococcus species was rod-shaped or spherical. Methods We compared the homologs of the proteins related to the rod-shape in bacteria (MreB, MreC, MreD, MrdA, R...

While the cell wall strictly controls cell size and morphology in bacteria, spheroplasts lack cell walls and can become enlarged in growth medium under optimal conditions. Optimal conditions depend on the bacterial species. We frequently observed extreme enlargement of spheroplasts of the radiation-resistant bacterium Deinococcus grandis in Difco M...

There are two types of starter cultures used in Japanese rice wine (sake) fermentation, namely, sokujo-moto and yamahai-moto. Analyses of microbiota changes during sake production using yamahai-moto have already been reported. In this study, we analyzed microbiota changes during sake production using sokujo-moto. In addition, we sequenced bacterial...

We compared the gene expression levels of the blue-light-responsive genes, appA (encoding photosynthesis promoting protein AppA), ppsR (encoding photosynthesis suppressing protein PpsR), and EL368 (encoding a blue-light-activated histidine kinase with a light, oxygen, or voltage domain) between aerobic and anaerobic conditions in spheroplasts of th...

The enigmatic basidiomycete genus Mixia includes intracellular parasites of Osmunda and Osmundastrum ferns. Here, the authors review the systematic and phylogenetic history of M. osmundae, originally known as Taphrina osmundae, and provide new data from investigations of specimens of Osmunda japonica collected in Yunnan Province, China, which we de...

As Japanese rice wine (sake) brewing is not done aseptically, bacterial contamination is conceivable during the process of sake production. There are two types of the fermentation starter, sokujo-moto and yamahai-moto (kimoto). We identified bacterial DNA found in various sakes, the sokujo-moto and the yamahai-moto making just after sake yeast addi...

Recently, a methane hydrate-bearing layer located near the islands of Japan has been investigated as a new potential energy resource. This study examined the feasibility of in-situ ground improvement technologies for enhancing carbonate precipitation in the pores of the turbidite layer. First, the authors isolated urease producing bacteria from thi...

We measured the degree of nucleosome formation at the gene promoters in trichostatin A-treated (1, 2, and 3 μg/mL) cells of the archiascomycete Saitoella complicata and those in enlarged S. complicata cells after zymolyase treatment. TSA-treated and enlarged cells showed similar changes in nucleosome occupancy in five out of six positions in the ge...

We compared the expression levels of cell division related genes ftsA and ftsZ, DNA maintenance related genes hupA, recA, and topA, stress response related genes clpB, pspA and spy, and outer membrane synthesis related genes ompA and pbp1b, among normally divided cells, elongated (filamentous) cells, spheroplasts at the beginning of growth, and enl...

A subpopulation of Archaea possesses histones, which are similar to eukaryotic histones H3 and H4. However, archaeal histones are smaller than H3 and H4, and are not post-translationally modified. In addition, the fundamental unit of archaeal histones might be a dimer. The organization of archaeal nucleosomes, therefore, differs from that of eukary...

β-Decarboxylating dehydrogenases, which are involved in central metabolism, are considered to have diverged from a common ancestor with broad substrate specificity. In a molecular phylogenetic analysis of 183 β-decarboxylating dehydrogenase homologs from 84 species, TK0280 from Thermococcus kodakarensis was selected as a candidate for an ancestral-...

Bacterial spheroplasts do not divide but they grow and enlarge with DNA replication in a broth containing an inhibitor of peptidoglycan synthesis and high salt concentration. The enlarged spheroplasts of Lelliottia amnigena, belonging to the family Enterobacteriaceae, formed vacuole-like structures, while those of the aerobic photosynthetic marine...

We investigated the effects of trichostatin A (TSA) on gene expression and nucleosome position in the archiascomycetous yeast Saitoella complicata. The expression levels of 154 genes increased in a TSA-concentration-dependent manner, while the levels of 131 genes decreased. Conserved genes between S. complicata and Schizosaccharomyces pombe were mo...

In the present study, spheroplasts from the aerobic anoxygenic photosynthetic marine bacterium Erythrobacter litoralis were generated and cultivated. In the presence of penicillin, the spheroplasts grew and enlarged in marine broth without undergoing cell division. However, continuous light inhibited their enlargement, and they were therefore culti...

The draft genome sequence of the archiasomycetous yeast Saitoella complicata was determined. The assembly of newly and previously sequenced data sets resulted in 104 contigs (total of 14.1 Mbp; N50, 239 kbp). On the newly assembled genome, a total of 6,933 protein-coding sequences (7,119 transcripts, including alternative splicing forms) were ident...

We generated and characterized giant spheroplasts from the aerobic anoxygenic photosynthetic marine bacterium Roseobacter litoralis. The giant spheroplasts contained vacuole-like structures within the cells, mainly consisting of a single membrane. The in vivo absorption spectrum of the giant spheroplasts did not have peaks typically observed for ba...

We generated spheroplasts from Escherichia coli carrying a broad-host-range plasmid. In the presence of penicillin, the spheroplasts did not divide but grew and enlarged in marine broth, whereas, in the absence of penicillin, they elongated. We quantified cellular DNA at different time points by using real-time quantitative PCR. Both chromosomal an...

Both guanine-cytosine content and nucleosome occupancy are higher in exons than in introns. In this study, the association between the frequencies of the dinucleotide sequences and the nucleosome occupancy of the exons and introns of the genes of Aspergillus fumigatus, Aspergillus nidulans, and Aspergillus oryzae was studied. The frequency of the d...

The impacts of plasmid carriage on the host cell were comprehensively analyzed using the conjugative plasmid pCAR1 in three different Pseudomonas hosts, P. putida KT2440, P. aeruginosa PAO1, and P. fluorescens Pf0-1. Plasmid carriage reduced host fitness, swimming motility, and resistance to osmotic or pH stress. Plasmid carriage brought about alte...

We sequenced the genomic DNA and the transcribed RNA of the ascomycetous budding yeast Saitoella complicata, which belongs to the earliest lineage (Taphrinomycotina) of ascomycetes. We found 3 protein-coding regions similar to Clr6 of Schizosaccharomyces (a member of Taphrinomycotina). Clr6 has a structure similar to that of Rpd3 and Hos2 of Saccha...

It is no longer as difficult to determine genomic DNA sequences of uncultured bacteria as it once was, due to the development of DNA sequencing technology. It is likely that the number of whole-genome sequences of phytoplasmas will increase. In this chapter, two major strategies of whole-genome comparison studies, viz. gene content and orthologous...

We sequenced nucleosomal DNA fragments of the filamentous ascomycetes Aspergillus nidulans and A. oryzae and then mapped those sequences on their genomes. We compared the GC content and nucleosome density in the exonic and intronic regions in the genes of A. nidulans and A. oryzae. Although the GC content and nucleosome density in the exonic region...

LysW has been identified as a carrier protein in the lysine biosynthetic pathway that is active through the conversion of α-aminoadipate (AAA) to lysine. In this study, we found that the hyperthermophilic archaeon, Sulfolobus acidocaldarius, not only biosynthesizes lysine through LysW-mediated protection of AAA but also uses LysW to protect the ami...

Nucleosome positioning is not only related to genomic DNA compaction but also to other biological functions. After the chromatin is digested by micrococcal nuclease, nucleosomal (nucleosome-bound) DNA fragments can be sequenced and mapped on the genomic DNA sequence. Due to the development of modern DNA sequencing technology, genome-wide nucleosome...

Comparative genomics has revealed that variations in bacterial and archaeal genome DNA sequences cannot be explained by only neutral mutations. Virus resistance and plasmid distribution systems have resulted in changes in bacterial and archaeal genome sequences during evolution. The restriction-modification system, a virus resistance system, leads...

Carbonic anhydrase (CA) (E.C. 4.2.1.1) is a ubiquitous enzyme catalysing interconversion between CO 2 and bicarbonate. The irregular distribution of the phylogenetically distinct classes of CA in procaryotic genome suggests its complex evolutionary history in procaryotes. Genetic evidence regarding the dispensability of CA under high-CO 2 air in so...

Thermus thermophilus biosynthesizes lysine through the α-aminoadipate (AAA) pathway: this observation was the first discovery of lysine biosynthesis through the AAA pathway in archaea and bacteria. Genes homologous to the T. thermophilus lysine biosynthetic genes are widely distributed in bacteria of the Deinococcus-Thermus phylum. Our phylogenetic...

We present findings on the nucleosomal arrangement in the genome of the basidiomycete Mixia osmundae, focusing on nucleosomal linker DNA regions. We have assembled the genomic sequences of M. osmundae, annotated genes and transcription start sites (TSSs) on the genome, and created a detailed nucleosome map based on sequencing mono- and dinucleosoma...

Table S1 Summary of the numbers of reads generated by Illumina IIGx and mapped to the genome, nucleosome midpoints mapped by five or more read pairs and protein-coding genes determined

In the present paper, I compared guanine-cytosine (GC) contents, DNA sizes, and dinucleotide frequency profiles in 109 archaeal chromosomes, 59 archaeal plasmids, 1379 bacterial chromosomes, and 854 bacterial plasmids. In more than 80% of archaeal and bacterial plasmids, the GC content was lower than that of the host chromosome. Furthermore, most o...

Most ascomycetous yeasts have 2 homocitrate synthases (HCSs). Among the fungal lysine biosynthesis-related genes, only the HCS gene was duplicated in the course of evolution. It was recently reported that HCS of Saccharomyces cerevisiae has an additional function in nuclear activities involving chromatin regulation related to DNA damage repair, whi...

The extremely radioresistant bacteria of the genus Deinococcus and the extremely thermophilic bacteria of the genus Thermus belong to a common taxonomic group. Considering the distinct living environments of Deinococcus and Thermus, different genes would have been acquired through horizontal gene transfer after their divergence from a common ancest...

Although nucleosome positions tend to be conserved in gene promoters, whether they are conserved in duplicated and orthologous genes is unknown. In order to elucidate how nucleosome positions are conserved between duplicated and orthologous gene pairs, I performed 2 comparative studies. First, I compared the nucleosome position profiles of duplicat...

This chapter discusses the genus Mixia. It provides a systematic discussion of the species and concludes with comments on the genus. The diagnosis of the genus is done on the basis of asexual, sexual, physiology and biochemistry, and phylogenetic placement. In asexual reproduction colonies on corn meal agar (KM-30) are white to cream and become pal...

Comparisons of gene content and orthologous protein sequence constitute a major strategy in whole-genome comparison studies. It is expected that horizontal gene transfer between phylogenetically distant organisms and lineage-specific gene loss have greater influence on gene content-based phylogenetic analysis than orthologous protein sequence-based...

Although the bacterium Symbiobacterium thermophilum has a genome with a high guanine-cytosine (GC) content (69%), it belongs to a low GC content bacterial group. We detected only 18 low GC content regions with 5 or more consecutive genes whose GC contents were below 65% in the genome of this organism. S. thermophilum has 66 transposase genes, which...

The anaerobic thermophilic bacterial genus Dictyoglomus is characterized by the ability to produce useful enzymes such as amylase, mannanase, and xylanase. Despite the significance, the phylogenetic position of Dictyoglomus has not yet been clarified, since it exhibits ambiguous phylogenetic positions in a single gene sequence comparison-based anal...

RNA transcripts from 199-kb incompatibility P-7 plasmid pCAR1 were analyzed using microarrays with evenly tiled probes with a nine-nucleotide offset in six different Pseudomonas host strains. We re-annotated 12 ORFs based on their RNA maps and on the comparisons with other sequenced IncP-7 plasmids. Ninety six of two hundred ORFs were identified on...

We have identified 305 introns in fungal histone genes. Among the 305 introns, 21 had sequence similarities to introns that have different insertion sites. These 21 introns formed 13 intron-pairs. Nine of the 13 pairs had low similarities (35.3%-47.4%) between the flanking DNA sequences of the introns, suggesting that intron-homing or homologous re...

To determine phylogenetic placement of Mixia osmundae (T. Nishida) Kramer (Mixiaceae, Protomycetales), we sequenced the nuclear small subunit ribosomal RNA (18S rRNA) gene from M. osmundae IFO-32408 and compared it with that from 4 archiascomycetes (Ascomycota) and 24 basidiomycetes. Our molecular phylogeny indicates that M. osmundae and the basidi...

Fold change of RNA expression of each gene listed in Table S2. The following primers were used: TCCGGTGGTAAAGGTGGTAA and GAACCAATTCTCTGGGCGTA (both sequences, from 5′ to 3′) for transcripts of YBL003C; GCTTCTAAATTGGCCGCTTA and GAACCAATTCTCTGGGCGTA for transcripts of YBL002W; TTCTTGGCAAGCATTGACTG and CCCATGGCTGTACCTTTGTT for transcripts of YBR018C;...

Agarose gel electrophoresis of DNA fragments digested by different concentrations of MNase. Lane 1, DNA size marker; Lane 2, MNase free; Lane 3, 0.05 U of MNase; Lane 4, 0.1 U of MNase; Lane 5, 0.25 U of MNase; Lane 6, 0.5 U of MNase; Lane 7, 0.75 U of MNase; Lane 8, 1 U of MNase. Arrows indicate the location of mononucleosomal DNA fragments. (PPTX...

Mapping numbers of the nucleosomes around elp3 and hos2 genes. Right side, region around elp3; Left side, region around hos2. Top, Strain BY4741 (control); Middle, The elp3 disruptant; Bottom, The hos2 disruptant. Arrow indicates the region from the translational start site to the end. (PPTX)

Genes with low conservation level of nucleosome positions in promoters. (DOCX)

Comparison between the distribution of nucleosomal DNA lengths of the whole genome and that in the gene promoters. (A) Strain BY4741 (control). (B) The elp3 deletion mutant. (C) The hos2 deletion mutant. Red, the distribution of the nucleosomal DNA lengths of the whole genome; Blue, that in the gene promoters. (PPTX)

Pearson's correlation coefficient between the profiles of the control and the disruptant nucleosome mapping numbers in each gene promoter. (XLS)

In order to elucidate the influence of histone acetylation upon nucleosomal DNA length and nucleosome position, we compared nucleosome maps of the following three yeast strains; strain BY4741 (control), the elp3 (one of histone acetyltransferase genes) deletion mutant, and the hos2 (one of histone deactylase genes) deletion mutant of Saccharomyces...

Distribution of introns in fungal histone H2B genes. (DOCX)

Introns with sequence similarity. Yellow indicates the intron pair with different insertion sites in the same histone gene. Orange indicates the intron pair of different histone genes. The other indicates the intron pair with the same insertion site in the same histone gene. (DOCX)

Alignment of fungal histone H2A proteins and the intron insertion site. The character “I” on the first row indicates the intron insertion site. (TXT)

Alignment of fungal histone H4 proteins and the intron insertion site. The character “I” on the first row indicates the intron insertion site. (TXT)

Distribution of introns in fungal histone H2A genes. (DOCX)

Results (E-value <0.02) of the Fungi Genome BLAST in the Fungal Genomes Central on the NCBI web site for each intron used in this study. The hit sequence ID with the score (bits) and E-value are shown. (TXT)

Alignment of fungal histone H2B proteins and the intron insertion site. The character “I” on the first row indicates the intron insertion site. (TXT)

Alignment of fungal histone H3 proteins and the intron insertion site. The character “I” on the first row indicates the intron insertion site. (TXT)

Distribution of introns in fungal histone H3 genes. (DOCX)

Distribution of introns in fungal histone H4 genes. (DOCX)

Saccharomycotina and Taphrinomycotina lack intron in their histone genes, except for an intron in one of histone H4 genes of Yarrowia lipolytica. On the other hand, Basidiomycota and Perizomycotina have introns in their histone genes. We compared the distributions of 81, 47, 79, and 98 introns in the fungal histone H2A, H2B, H3, and H4 genes, respe...

Supplementary figure S1. Frameshift mutation in A. plueropneumoniae JL03 strain. Supplementary figure S2. Frameshift mutation in R. heilongjiangensis and R. japonica. Supplementary figure S3. Frameshift mutations in B. quintana. Supplementary table S1. The list of genome-sequenced proteobacteria. The organisms that do not retain any carbonic anhydr...

Supplementary Table 1: GC content, lineage category, and organism possessing the top hit protein of the BLAST result of the protein-coding gene of Symbiobacterium thermophilum. Supplementary Table 2: Gene clusters in the 18 low GC content regions. Supplementary Figure 1: Most transposable elements belong to the category “Symbiobacterium,” which is...

Phylogenetic relationships among enzymes related to lysine biosynthesis through the AAA pathway.

Histone-like protein H1 (H-NS) family proteins are nucleoid-associated proteins (NAPs) conserved among many bacterial species. The IncP-7 plasmid pCAR1 is transmissible among various Pseudomonas strains and carries a gene encoding the H-NS family protein, Pmr. Pseudomonas putida KT2440 is a host of pCAR1, which harbors five genes encoding the H-NS...

Expression levels of the transcriptionally active genes of the TSA-treated cells of Aspergillus fumigatus. (0.13 MB DOC)

Expression levels of the transcriptionally inactive genes of the TSA-treated cells of Aspergillus fumigatus. (0.13 MB DOC)

Mapping numbers of mononucleosomes and transcription start sites of the 50 constant expressed genes between the TSA-treated and untreated cells. Title indicates gene name with the last character “p” or “m”. The “p” indicates that the region between the positions 1 and 1,000 is the promoter and the other region is gene body. The “m” indicates that t...

Expression levels of the genes with more than 2 fold changes between the TSA-treated and untreated cells. (0.37 MB DOC)

Mapping numbers of mononucleosomes and transcription start sites of the 28 up-regulated genes between the TSA-treated and untreated cells. Title indicates gene name with the last character “p” or “m”. The “p” indicates that the region between the positions 1 and 1,000 is the promoter and the other region is gene body. The “m” indicates that the reg...

Histograms of mononucleosomal DNA fragment lengths in the promoters and bodies of transcriptionally active and inactive genes of the TSA-treated cells. We extracted highly expressed (active) genes (not including rRNA genes) and lowly expressed or silent (inactive) genes based on the microarray data of RNAs from the TSA-treated cells of Aspergillus...

Expression levels of the histone-related genes between the TSA-treated and untreated cells. (0.16 MB DOC)