ArticlePDF Available

Metagenomics reveals the high PAH-degradation potential of abundant uncultured bacteria from chronically-polluted subantarctic and temperate coastal marine environments

May 2015
Journal of Applied Microbiology

May 2015

DOI:10.1111/jam.12843

Authors:

Claudia Loviso

Centro Nacional Patagonico

Mariana Lozada

IBIOMAR

Lilian Guibert

Faculty of Medical Sciences

Matías A Musumeci

National Scientific and Technical Research Council (CONICET), Concordia, Entre Ríos Argentina

Show all 8 authorsHide

Aims: To investigate the potential to degrade polycyclic aromatic hydrocarbons (PAHs) of yet-to-be cultured bacterial populations from chronically-polluted intertidal sediments. Methods and Results: A gene variant encoding the alpha subunit of the catalytic component of an aromatic ring-hydroxylating oxygenase (RHO) was abundant in intertidal sediments from chronically-polluted subantarctic and temperate coastal environments, and its abundance increased after PAH amendment. Conversely, this marker gene was not detected in sediments from a non-impacted site, even after a short-term PAH exposure. A metagenomic fragment carrying this gene variant was identified in a fosmid library of subantarctic sediments. This fragment contained five pairs of alpha and beta subunit genes and a lone alpha subunit gene of oxygenases, classified as belonging to three different RHO functional classes. In silico structural analysis suggested that two of these oxygenases contain large substrate-binding pockets, capable of accepting high molecular weight PAHs. Conclusions: The identified uncultured microorganism presents the potential to degrade aromatic hydrocarbons with various chemical structures, and could represent an important member of the PAH-degrading community in these polluted coastal environments. Significance and Impact of Study: This work provides valuable information for the design of environmental molecular diagnostic tools and for the biotechnological application of RHO enzymes. Keywords: intertidal sediments; polycyclic aromatic hydrocarbons; ring-hydroxylating oxygenases; qPCR; metagenomic library; protein modelling.

Figure S3. Topology of the catalytic cavities of the modelled oxygenases. A) oxygenase from Sphingomonas sp CHY-1 (PDB 2CKF) (Jakoncic et al. 2007); B) oxygenase from Sphingomonas yanoikuyae (PDB 2GBW) (Ferraro et al. 2007); C) M117-33 (template 2CKF). D) M117-36 (template 2GBW). E) M117-38 (template 2GBW). The spatial disposition of pyrene was obtained from docking analysis. The sphere represents the catalytic iron.

…

Figures - uploaded by Hebe Dionisi

Content may be subject to copyright.

Content uploaded by Hebe Dionisi

Content may be subject to copyright.

Accepted Article

This article has been accepted for publication and undergone full peer review but has not

been through the copyediting, typesetting, pagination and proofreading process which may

lead to differences between this version and the Version of Record. Please cite this article as

an 'Accepted Article', doi: 10.1111/jam.12843

Article Type: Original Article

Metagenomics reveals the high PAH-degradation potential of abundant uncultured

bacteria from chronically-polluted subantarctic and temperate coastal marine

environments

Claudia L. Loviso

, Mariana Lozada

, Lilian M. Guibert, Matías A. Musumeci, Sandra

Sarango Cardenas, Ruud V. Kuin, Magalí S. Marcos and Hebe M. Dionisi*

These authors contributed equally to this work.

Laboratorio de Microbiología Ambiental, Centro para el Estudio de Sistemas Marinos

(CESIMAR, CENPAT-CONICET), Blvd. Brown 2915, U9120ACD, Puerto Madryn,

Chubut, Argentina.

Abbreviated running headline: uncultured PAH-degrading bacteria

E-mail addresses: C.L.L.: loviso@cenpat-conicet.gob.ar, M.L.: lozada@cenpat-

conicet.gob.ar, L.M.G.: guibert@cenpat-conicet.gob.ar, M.A.M.: musumeci@cenpat-

conicet.gob.ar, S.S.C.: sandra.sarango.c@gmail.com, R.V.K.: rvjkuin@gmail.com, M.S.M.

magali@cenpat-conicet.gob.ar, H.M.D. hdionisi@cenpat-conicet.gob.ar.

*Correspondence: Hebe M. Dionisi, Laboratorio de Microbiología Ambiental, Centro para

el Estudio de Sistemas Marinos (CESIMAR, CENPAT-CONICET), Blvd. Brown 2915,

Accepted Article

U9120ACD, Puerto Madryn, Chubut, Argentina. Tel. +54-280-4883184 extension 1251; Fax

+54-280-4883543. e-mail: hdionisi@cenpat-conicet.gob.ar.

Current addresses: Sandra Sarango Cardenas, Teconec SAC, Av. La Molina 3365, La

Molina, Perú; Magalí S. Marcos, Laboratorio de Microbiología y Biotecnología, Instituto

Patagónico para el Estudio de los Ecosistemas Continentales (IPEEC, CENPAT-CONICET).

Abstract

Aims: To investigate the potential to degrade polycyclic aromatic hydrocarbons (PAHs) of

yet-to-be cultured bacterial populations from chronically-polluted intertidal sediments.

Methods and Results: A gene variant encoding the alpha subunit of the catalytic component

of an aromatic ring-hydroxylating oxygenase (RHO) was abundant in intertidal sediments

from chronically-polluted subantarctic and temperate coastal environments, and its

abundance increased after PAH amendment. Conversely, this marker gene was not detected

in sediments from a non-impacted site, even after a short-term PAH exposure. A

metagenomic fragment carrying this gene variant was identified in a fosmid library of

subantarctic sediments. This fragment contained five pairs of alpha and beta subunit genes

and a lone alpha subunit gene of oxygenases, classified as belonging to three different RHO

functional classes. In silico structural analysis suggested that two of these oxygenases contain

large substrate-binding pockets, capable of accepting high molecular weight PAHs.

Conclusions: The identified uncultured microorganism presents the potential to degrade

aromatic hydrocarbons with various chemical structures, and could represent an important

member of the PAH-degrading community in these polluted coastal environments.

Accepted Article

Significance and Impact of Study: This work provides valuable information for the design

of environmental molecular diagnostic tools and for the biotechnological application of RHO

enzymes.

Keywords: intertidal sediments; polycyclic aromatic hydrocarbons; ring-hydroxylating

oxygenases; qPCR; metagenomic library; protein modelling.

INTRODUCTION

Urbanized coastal marine environments receive a constant input of polycyclic

aromatic hydrocarbons (PAHs). Due to their hydrophobic nature and slow biodegradability,

these compounds accumulate in sediments and in some marine organisms, where they can

elicit adverse effects on both human and environmental health (Nikolaou et al. 2009). The

management of contaminated sediments greatly depends on natural or enhanced

biodegradation processes (Himmelheber and Hughes 2014). The molecular analysis of key

genes related to pollutant biodegradation can provide valuable information concerning the

presence or activity of the microbial populations responsible for the removal of

environmental contaminants. Furthermore, this information sets the basis for the design of

molecular biological tools for environmental bioremediation applications (Mahendra et al.

2012). The genes encoding the large (α) subunit of PAH dioxygenases have been widely

utilized as biomarkers to analyze the potential of a microbial community to degrade PAHs

under aerobic conditions (Iwai et al. 2011). These enzymes catalyze the first and limiting step

in the activation of these compounds, the dihydroxylation of one of the aromatic rings of the

molecule to generate a cis-dihydrodiol (Parales and Resnick 2006). PAH dioxygenases are

members of a large enzyme family named ring-hydroxylating oxygenases (RHOs). These

multicomponent enzyme systems are composed of a terminal oxygenase presenting an homo-

Accepted Article

(α

) or hetero-multimeric (α

) structure, and one or two soluble proteins that transfer

electrons from NAD(P)H to the oxygenase (Chakraborty et al. 2012).

Many vulnerable coastal environments of Patagonia (Argentina), such as breeding and

feeding grounds of seabirds and marine mammals, are close to oil producing areas or urban

settlements, raising concerns about the possible effects of hydrocarbon pollution (Barragán

Muñoz et al. 2003; Yorio 2009). Moderate to high levels of PAHs have been detected in both

sediments and benthic fauna at a number of coastal areas (Commendatore and Esteves 2007;

Lozada et al. 2008; Amin et al. 2011; Commendatore et al. 2012; Marcos et al. 2012). The

diversity of the PAH-degrading community from these chronically-polluted environments is

just starting to emerge. The majority of the sequences identified in studies targeting RHO α-

subunit genes shared low to moderate identity values with previously reported oxygenases

(Lozada et al. 2008; Marcos et al. 2009;

Dionisi

et al. 2011). The bacterial populations

carrying some of these gene variants were found to be abundant and stable, although mostly

restricted to cold coastal environments (Marcos et al. 2012). In contrast, the phnA1 gene,

previously identified in PAH-degrading strains belonging to the genus Cycloclasticus (Kasai

et al. 2003), was found to be abundant in only half of the analyzed sediment samples from

both temperate and subantarctic environments of Patagonia (Marcos et al. 2012). However, a

strong positive correlation between phnA1 gene abundances and low molecular weight PAH

concentrations suggested that members of this cosmopolitan genus could play a role in the

degradation of these compounds in coastal environments of Patagonia. More information is

still needed to be able to select marker genes suitable for molecular environmental

diagnostics of hydrocarbon pollution in the more than 2,000 km of the Patagonian coast.

In this work, we used multiple molecular approaches to identify environmentally

relevant members of the PAH-degrading community from coastal environments of Patagonia

exposed to different climates. First, we identified a RHO α-subunit gene variant that was

Accepted Article

abundant in PCR clone libraries from both temperate and subantarctic sediments. Secondly,

we designed a quantitative PCR (qPCR) assay to estimate the abundance of microorganisms

carrying this gene in intertidal sediments from both types of environments, as well as to

evaluate their response after PAHs and crude oil exposure. Lastly, in order to recover the full-

length sequence of this gene variant, as well as to obtain information about the capabilities of

these yet-uncultured microorganisms, we constructed a large-insert metagenomic library from

polluted intertidal sediments. We identified a metagenomic fragment carrying this marker

gene, which encoded six oxygenases with various potential substrates, including high

molecular weight PAHs.

MATERIALS AND METHODS

Sample collection. Figure 1 shows the three selected sampling locations along the

Patagonian coast. An intertidal sediment sample was obtained in Fracasso Beach (PF, 42°25'

S, 64°7' W), a non-impacted environment located in the San José Gulf, Valdés Peninsula

(sample PF08). Chronically polluted sediment samples were retrieved from: (a) Cordova

Cove (CC, 45°45' S, 67°22' W), a temperate environment situated in the San Jorge Gulf

(samples CC08-1, CC08-2, CC10-1 and CC10-2), and (b) Ushuaia Bay (UB, 54°48' S, 68°17'

W), a subantarctic environment located within the Beagle Channel (samples EM06, OR05,

OR06, OR07 and OR08). For each of these samples, intertidal sediments (top 3 cm) were

retrieved along the low-tide line at ten random points using acrylic cores with an inner

diameter of 4.4 cm and stored at 4°C during transport to the laboratory. The ten sub-samples

were mixed thoroughly to produce a composite sample, which was used immediately to

construct the experimental systems, or stored at –80°C for molecular analyses and -20°C for

chemical analysis. Samples were named according to their sampling location (PF, CC), or site

within UB (EM, OR) followed by the last two digits of the sampling year, with an additional

number for the two CC samples obtained in the same date. Table S1 shows a summary of the

Accepted Article

samples used in this study. Detailed information of the sampling locations, dates and PAH

concentrations can be found in previous studies (Lozada et al. 2008; Marcos et al. 2012).

Experimental systems. Sediment-in-seawater slurries were built in 500-ml flasks and

consisted of approximately 40 g of sediment [samples PF08, CC08-2 or OR08, (Marcos et al.

2012)] and 80 ml of 0.45-μm filtered natural seawater, as previously described (Guibert et al.

2012). Slurries were left without further hydrocarbon addition, or were amended with the

following hydrocarbons: 0.34 g of phenanthrene, 0.34 g of pyrene or 0.46 ml of light crude

oil (from the San Jorge Basin, Comodoro Rivadavia, Argentina). Slurries were incubated in

the dark at 15°C for 20 days, with constant agitation at 150 rev min

-1

. Samples were obtained

from the slurries without decanting, centrifuged 5 min at 6000 g, the supernatant was

discarded and the sediment was stored at -80ºC for qPCR analysis.

Metagenomic DNA extraction. The DNA used for the construction of PCR clone libraries

and for qPCR analysis was purified in duplicate from 0.5 to 0.8 g wet sediment using the

FastDNA

SPIN kit for soil (MP Biomedicals, Santa Ana, CA, USA), as previously described

(Lozada et al. 2008). Two independent DNA extractions per sample were pooled in equal

mass amounts and used as template in PCR-based assays. The metagenomic DNA used for

the construction of the fosmid library was purified from sediment sample OR07 following the

protocol described by Zhou et al. (1996). DNA concentrations were determined using the

DNA binding-fluorophore EvaGreen

(Biotium, Inc., Hayward, CA, USA) in a Chromo4

thermal cycler (Bio-Rad, Hercules, CA, USA) (Wang et al. 2006) or Hoechst 33258 dye

(Amersham Biosciences, Piscataway, NJ) in a Hoefer DyNA Quant 200 fluorometer (Hoefer

Scientific Instruments, San Francisco, CA).

Construction and screening of PCR clone libraries. The PCR clone libraries were

constructed using primers Nah-for and Ac596r [(Wilson et al. 1999; Zhou et al. 2006), Table

S2]. PCR amplifications were performed in a Chromo4 thermal cycler in 25-μl reactions

Accepted Article

containing 50 mmol l

-1

KCl, 10 mmol l

-1

Tris-HCl pH 9.0, 0.1% Triton X-100, 1.5 mmol l

-1

MgCl

, 0.2 μmol l

-1

dNTPs, 2 μmol l

-1

primer Nah-for, 0.5 μmol l

-1

primer Ac596R, 1 U of T-

PLUS DNA polymerase (Inbio-Highway, Tandil, Argentina) and 1 to 10 ng of metagenomic

DNA. The PCR program is indicated in Table S2. PCR products from UB sediment samples

(OR06, OR07, OR08 and EM06) were combined, purified with PCR WIZARD

SV Gel and

PCR Clean-Up System (Promega, Madison, WI, USA), and cloned into the pCR

4.0 vector

using the TA Cloning kit for sequencing (Invitrogen, Carlsbad, CA, USA) following the

manufacturer's instructions. PCR products from CC sediment samples (CC08-1, CC08-2,

CC10-1 and CC10-2) were processed following the same protocol. For the analysis of the

experimental system of UB sediments exposed to crude oil [OR08-oil, (Guibert et al. 2012)],

six independent PCR reactions were combined and run in a 1.5% agarose gel. The band with

the expected amplicon size was excised and purified using the PCR WIZARD

SV Gel and

PCR Clean-Up System before cloning. Plasmids were purified from randomly chosen clones

using QIAprep

Spin Miniprep Kit (QIAGEN Inc., Valencia, CA, USA), and 20 inserts (8

clones from both UB and OR08-oil libraries, and 4 clones from CC library) were sequenced

using the vector primer M13F at the sequencing service of INTA-CASTELAR (Hurlingham,

Buenos Aires, Argentina).

qPCR assays. The quantification of the target genes (RHO α subunit gene variants T and

phnA1, as well as bacterial 16S rRNA gene) was carried out in DNA purified from intertidal

sediments and experimental systems using SybrGreen I-based qPCR assays. Primer3

software (www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) was used for the

design of the primer set targeting gene variant T, based on the consensus sequence of the

gene fragments identified in the PCR clone libraries. The specificity of the potential primers

was evaluated by comparing their sequences with the NCBI database using blastn tool. Assay

optimization and sample analysis were performed as previously described (Marcos et al.

Accepted Article

2012). The qPCR reactions were carried out in a Chromo4 thermal cycler in a 20-μl volume

containing 1× PerfeCTa® SYBR® Green Supermix (Quanta BioSciences, Inc., Gaithersburg,

MD) or Mezcla Real (Biodynamics, Buenos Aires, Argentina), the primers at the

concentrations indicated in Table S2, and 0.2 to 2.5 ng of template DNA. The amplification

program for each qPCR assay is indicated in Table S2. Non-template controls were included

in all runs. Plasmids carrying a larger fragment of the target genes were used as standard for

each assay. Each plasmid was purified, linearized and quantified as previously described

(Marcos et al. 2012). A standard curve with target concentrations between 5 and 10

copies

reaction

-1

was calculated for each run. Reactions were performed in triplicate or

quadruplicate, and an additional spiking reaction was added (10

copies of standard DNA

reaction

-1

) in each sample and target, in order to correct for PCR inhibition (Marcos et al.

2012). The specificity of the reactions was confirmed by comparing melting curves from the

samples and the standards and by agarose gel electrophoresis. The qPCR data are reported as

copies of the target gene µg DNA

-1

. Amplification efficiencies were calculated as Eff = (10

1/slope)

)

-1

(Pfaffl 2004).

Construction and screening of the sediment metagenomic library. A fosmid library was

constructed using the metagenomic DNA isolated from sample OR07 (Marcos et al. 2012)

using the CopyControl™ HTP Fosmid Library Production Kit (Epicentre Biotechnologies,

Madison, WI, USA) following the protocol suggested by the manufacturer. The library was

plated on LB agar with 12.5 μg ml

-1

chloramphenicol (approximately 100 clones per plate).

After an overnight incubation at 37ºC, the bacterial cells from each plate were resuspended

with 1 ml of LB medium containing 20% glycerol and stored at -80°C. Primers Nah-for and

Ac596r were chosen for the molecular screening of the metagenomic library, using the same

conditions as described above with the exception that whole-cell PCR amplifications were

used to simplify the screening. Cells from each group of clones were washed and

Accepted Article

resuspended in sterile distilled water and used as template in PCR reactions. The PCR

products were visualized in agarose gels. PCR products of the expected size were sequenced

to confirm their specificity before isolation and screening of individual clones.

Fosmid DNA extraction and sequencing. Fosmid DNA was purified from 10 ml of cells

previously induced for 15 h [LB medium with 12.5 μg ml

-1

chloramphenicol and 1X

CopyControl Fosmid Autoinduction Solution (Epicentre Biotechnologies, Madison, WI,

USA)], using Qiagen Miniprep Kit (Qiagen, Valencia, CA, USA). The purified fosmid DNA

was sequenced at INDEAR (Rosario, Argentina) using 454/Roche sequencing platform.

Functional annotation and taxonomic assignment of the metagenomic fragment. After

read assembly (peak depth of 39), gene prediction and annotation were performed using the

Integrative Services for Genomic Analysis (ISGA, http://isga.cgb.indiana.edu) and the Rapid

Annotation using Subsystem Technology (RAST, http://rast.nmpdr.org), and further

manually curated. Conserved amino acid sequences and potential biochemical functions of

predicted genes were confirmed using InterProScan program (Goujon et al. 2010), Kyoto

Encyclopedia of Genes and Genomes database (KEGG) (Kanehisa and Goto 2000), pfam

(Finn et al. 2014), COG (Tatusov et al. 2001) and blast analyses (McGinnis and Madden

2004). G+C % content was calculated using GC Calculator

(www.genomicsplace.com/gc_calc.html). The taxonomic assignment of the metagenomic

fragment was performed using PhyloPythiaS (Patil et al. 2012) and Megan5 (Huson et al.

2007). In the case of PhyloPythyiaS, the sequence was split into ~3-kb fragments. The model

type used was generic 2013, which includes 4,522 genomes from 800 different genera. The

parameters used in Megan 5 were: blastp of all coding sequences with min-score = 100, min-

support = 3, top-percent = 10, win-score = 0, min-complexity = 0.44.

Phylogenetic and in silico structural analyses of RHO sequences. Multiple sequence

alignments of RHO α-subunit sequences were performed using ClustalX with default settings

Accepted Article

(Larkin et al. 2007), accessed as a web service from Jalview multiple sequence alignment

editing, visualisation and analysis program (Waterhouse et al. 2009). Phylogenetic trees were

constructed using the Molecular Evolutionary Genetics Analysis software [MEGA 6.06,

(Tamura et al. 2013)], with the Neighbour-Joining method and Jones Taylor Thornton matrix

as amino acid replacement model. Robustness of the inferred tree topology was verified by

bootstrapping with 1,000 replications. The RHObase program was also used for RHO

classification into functional classes, as well as for the prediction of their potential substrates

(Chakraborty et al. 2014). The hypothetical structure models of the three class A RHO

sequences identified in the metagenomic fragment were generated using the Swiss-Model

server (Biasini et al. 2014), using the crystal structures of oxygenases from Sphingomonas sp

CHY-1 (PhA1, PDB 2CKF; Jakoncic et al. 2007) and Sphingomonas yanoikuyae B1 (BphA1,

PDB 2GBW; Ferraro et al. 2007) as templates, as indicated. The models were checked using

the servers QMEAN (Benkert et al. 2008), Verify3D (Liithy et al. 1992) and VADAR

(Willard et al. 2003). The CASTp server (Dundas et al. 2006) was used for identifying the

catalytic cavities and calculating their respective volume, while the height, width and length

were measured using UCSF Chimera software (Pettersen et al. 2004). For docking analysis,

enzyme-substrate complexes were generated based on the information on the substrate

binding mode in the active site of previously determined RHO crystal structures.

Phenanthrene and pyrene were fit in the catalytic cavities in accordance with the geometry of

phenanthrene displayed in the reported crystal structure (PDB 2HMK; Ferraro et al. 2006),

following a reported procedure (Kweon et al. 2010). Briefly, the modelled three-dimensional

structures of the M117 dioxygenases and their templates were superimposed to the crystal

structure of naphthalene 1,2-dioxygenase bound to phenanthrene (PDB 2HMK) by using

UCSF Chimera. After superimposition, phenanthrene and pyrene molecules were overlapped

to the bound phenanthrene, preserving the distances of the to-be-hydroxylated target atoms of

Accepted Article

the ligands to the catalytic iron. Docking analyses were also performed using SwissDock

server (Grosdidier et al. 2011a; Grosdidier et al. 2011b). The Pose and Rank server was used

to score the protein-ligand complexes (Fan et al. 2011).

Sequence accession numbers. Sequences obtained in this study have been deposited in the

NCBI database under accession numbers KM102501 to KM102507 (PCR clone libraries) and

KP330468 (M117 fosmid clone).

RESULTS

Identification of RHO α-subunit gene fragments

In order to identify functional marker genes related to PAH biodegradation in coastal

environments of Patagonia, we selected a high-coverage primer set targeting RHO α-subunit

genes based on the analysis of primer specificity and coverage recently reported by Iwai and

collaborators (2011). To obtain a better representation of the diversity of PAH dioxygenase

genes in each selected chronically-polluted environment, we combined the PCR products

obtained from 4 different sediment samples from each sampling location before cloning

(Table S1). Total PAH concentrations in these samples varied between 378 and 4,127 μg kg

-1

dry weight sediment (Table S1; Lozada et al. 2008; Marcos et al. 2012). Primers Nah-for and

Ac596r (Table S2) yielded strong and reproducible PCR amplifications from samples of both

temperate and subantarctic environments of Patagonia (CC and UB, respectively; Figure 1),

as well as from an experimental system constructed with a UB sediment sample and amended

with crude oil (OR08-oil; Guibert et al. 2012). The cloning and sequencing of these

amplicons revealed four distinct variants of RHO α-subunit genes, sharing only 19.5 to 51.2

% identity at the amino acid level. One of the gene variants was closely related to gene

fragments previously amplified from UB sediments (gene variant E, Table 1). The other three

variants presented only moderate identities at the amino acid level with PAH dioxygenases

Accepted Article

identified in cultured bacteria, and were named T, U and V following the nomenclature used

in previous works (Lozada et al. 2008; Marcos et al. 2009). The most abundant clone type

corresponded to gene variant T, which was detected in sediments from both subantarctic and

temperate coastal environments and overall represented 60 % of the analyzed clones (Table

1).

Abundance of gene variant T in sediment samples and experimental systems

To be able to estimate the abundance of gene variant T in intertidal sediment samples,

as well as to evaluate changes in the abundance of microorganisms carrying this gene after

exposure to phenanthrene, pyrene or crude oil, we designed and optimized a qPCR assay

targeting this gene (Table S2). We compared the abundances of this gene with those of

phnA1, identified in PAH-degrading strains belonging to the genus Cycloclasticus (Kasai et

al. 2003). We analyzed the relative abundance of the bacterial 16S rRNA gene as reference.

Gene variant T was not detected in sample PF08, retrieved from a temperate coastal

environment not exposed to anthropogenic pollution, nor was observed in slurries constructed

using this sediment sample after hydrocarbon amendment (Figure 2A). In contrast, gene

variant T was abundant in polluted sediment samples CC08-2 and OR08, and further increase

its abundance in most experimental systems constructed with these sediments and exposed to

crude oil, phenanthrene or pyrene (Figure 2B and C). These results indicate that

microorganisms carrying this gene were not only abundant in sediments from both temperate

and subantarctic environments, but these populations were able to grow after PAH exposure

in the experimental systems. In comparison, the phnA1 gene from Cycloclasticus spp. was

undetectable or at abundances below the quantification limit of the assay in the three

analyzed sediment samples, but showed a dramatic increase in abundance when chronically-

polluted sediments were amended with crude oil or PAHs. In non-impacted sediments, phnA1

gene abundances increased after pyrene and crude oil exposure, but not after phenanthrene

Accepted Article

amendment (Figure 2A). This result suggests the presence of pyrene degrading

Cycloclasticus strains in pristine environments of Patagonia, which would be able to respond

rapidly in the event of an oil spill.

We analyzed the prevalence and dynamics of microbial populations carrying gene

variant T in sediments of UB, by assessing the abundance of this gene in a series of intertidal

sediment samples obtained during three consecutive years at the same site. Gene variant T

was found at high relative abundances in all the analyzed samples (Figure 2D). These results

indicate that, at least in the sampled period, the microorganisms carrying this gene variant

represented stable population/s within the microbial community indigenous of this site.

Genomic context of gene variant T

In order to recover a full-length sequence of gene variant T as well as to obtain

information about its genomic context, we constructed a large-insert metagenomic library

from intertidal sediment sample OR07. This sample was chosen based on the overall

abundance of novel RHO α subunit gene variants (Marcos et al. 2012 and this study). The

library consisted of approximately 46,000 clones covering 1.6 Gb of metagenomic

information. The same primer set and conditions used for the construction of the PCR clone

libraries were applied for the sequence-based screening of the metagenomic library. One

fosmid clone (M117) carried a gene that shared 97.7 to 98.8 % identity at the amino acid

level with the gene variant T identified in the PCR clone libraries. None of the other gene

variants identified in the PCR clone libraries were detected in the metagenomic library. Clone

M117 had an insert size of 36.7 kb, a G+C content of 54.1 %, and contained 38 coding

sequences (Figure 3 and Table S3). The potential source organism of this metagenomic

fragment was evaluated using both PhyloPythiaS, a composition-based taxonomic classifier

(Patil et al. 2012), and Megan, a sequence similarity-based method (Huson et al. 2007).

PhyloPythiaS binned this metagenomic fragment within the Gammaproteobacteria class.

Accepted Article

Megan assigned 21 % of the coding sequences to this class and 45 % of the sequences to

Proteobacteria, while the rest of the coding sequences binned to Bacteria or received no

assignment. Discontiguous megablast algorithm within blastn (McGinnis and Madden 2004)

indicated that the identified metagenomic fragment was most closely related to the

betaproteobacterium Rhodocyclaceae bacterium PG1-Ca6 (NCBI Accession number

CP010554), with a 68 % identity and 32 % coverage. However, the alignment was highly

fragmented and over 1.5 Mb of the chromosome of this microorganism. The second most

related genome was the gammaproteobacterium Cyclocasticus sp. P1 (CP003230, 67 %

identity and 27 % coverage). These results suggest that this fragment belongs to a member of

the phylum Proteobacteria, although divergent from currently described PAH-degrading

microorganisms.

Fosmid M117 contained a lone gene encoding the α-subunit of an oxygenase (M117-

16) as well as five pairs of adjacent and codirectional α and β subunits genes (M117-22/21,

23/24, 33/32, 36/35 and 38/37; Figure 3 and Table S3). M117-33 was the gene detected in the

molecular screening of the metagenomic library, corresponding to gene variant T. The

majority of the oxygenase sequences identified in this fragment shared moderate identity

values with their closest matches of the NCBI database in Blastp analysis, which were

dioxygenase sequences identified in isolates belonging to the classes Alpha-, Beta- and

Gammaproteobacteria, as well as Bacilli (Table S4). Two methods were used to classify these

terminal oxygenases into functional classes, a phylogenetic analysis of the α subunit

sequences (Figure S1) and the prediction tool of the Ring-Hydroxylating Oxygenase database

(RHObase; Chakraborty et al. 2014). The results of the two analyses were in agreement

(Table S4). This server was also used to evaluate the potential substrates of these oxygenases

(Table S4). The lone α subunit gene (M117-16) was classified as class C RHO. Despite the

absence of an adjacent gene encoding the β subunit in the identified fragment, this sequence

Accepted Article

clustered with oxygenases with a hetero-multimeric structure, classified as type IV based on

their electron transport protein components (Figure S1). The putative substrates of this

enzyme were various carboxylated aromatics, such as salicylate, substituted salicylates,

dihydroxybenzoates and anthranilate. Sequences M117-21 to 24 corresponded to two

contiguous sets of α and β subunits with opposite orientations (Figure 3), classified within the

functional class B. The α-subunit sequences did not cluster with reference sequences

classified as type I, II and IV (Figure S1), and their putative substrates corresponded to

carboxylated aromatics, like benzoate and toluate.

The last three pairs of oxygenase sequences identified in the metagenomic fragment

coded for the terminal component of class A RHOs (Figure 3 and Table S4). All three α-

subunit sequences clustered with type IIIαβ RHO enzymes (Figure S1), and their potential

substrates included various aromatic hydrocarbons, such as PAHs, arylbenzenes, and/or

alkylbenzenes (Table S4). Three-dimensional models of these oxygenases were constructed

to evaluate the potential shape and size of their active sites. These models were based on the

crystal structure of PhnA1 from Sphingomonas sp CHY-1 (PDB 2CKF) for sequences M117-

33/32 or BphA1 from S. yanoikuyae B1 (PDB 2GBW) for sequences M117-36/35 and M117-

38/37. M117-38 was truncated, but contained a complete catalytic domain. A hybrid

sequence was then generated using 166 amino acids of the N-terminus end of its closest

relative, sequence NP_049184 from Novosphingobium aromaticivorans F199. The sequence

identities of the modelled RHO α-subunit sequences with their template ranged from 42 to

51%. Differences in both composition and conformation of the active sites were observed in

the three modelled enzymes, when compared with their template (Figure S2). In agreement,

the catalytic cavities were also quite different (Figure S3). The model for sequences M117-

38/37 showed the largest catalytic cavity dimensions, which was 50 % larger than the one

from its template structure and 30% larger than the active site dimension calculated for

Accepted Article

sequence pair M117-33/32 (Table S5). Docking analyses were performed to assess if

phenanthrene and pyrene (PAHs evaluated in the experimental systems) could potentially be

substrates of these oxygenases (Figure S3). These studies were based on the binding mode of

phenanthrene in the crystal structure of naphthalene 1,2-dioxygenase from Pseudomonas sp.

strain NCIB 9816-4 (Ferraro et al. 2006). The score values for phenanthrene binding in the

three sequences were similar to the one calculated for PhnA1 from Sphingomonas CHY-1

(Table S6), which is able to bind and oxidize this ligand (Demaneche et al. 2004). In the case

of pyrene, however, better score values were obtained for M117-38/37 and M117-36/35 than

for M117-33/32. These results suggest that while phenanthrene could fit in the active sites of

the three modelled oxygenases, pyrene could probably only be accommodated in the catalytic

pocket of enzymes encoded by sequences M117-36/35 and M117-38/37.

The other coding sequences identified in the metagenomic fragment were mostly

related to general cellular processes, such as the biosynthesis of tryptophan, lysine, purine

and folate, cell division, lipid metabolism, stress response, signal transduction and trans

editing activity of D-tyrosyl-tRNA, among others (Figure 3 and Table S3). No genes

encoding electron transport protein components were found in the metagenomic fragment,

nor genes related to horizontal gene transfer events.

DISCUSSION

Intertidal environments are highly dynamic, and sediment microbial communities

from this zone are heavily exposed to abiotic factors (Van Colen et al. 2014). The extensive

coast of eastern Patagonia features important differences in near-surface air temperatures and

precipitations (Garreaud et al. 2013). Arid conditions, strong winds and moderate

temperatures are the predominant climatic conditions in northern and central Patagonia, while

a humid and colder climate is prevalent in subantarctic environments such as the Beagle

Channel (Marcos et al. 2012). These differences in the environmental conditions might

Accepted Article

represent an important factor influencing the structure of the PAH-degrading microbial

community. Previous works were successful in identifying various novel RHO α-subunit

gene fragments in Ushuaia Bay (UB), a subantarctic coastal environment (Lozada et al. 2008;

Marcos et al. 2009;

Dionisi

et al. 2011), but a similar strategy applied to sediments from

polluted coastal environments of Northern or Central Patagonia resulted in either unspecific

amplification or the retrieval of previously characterized sequences that were found often

present al low abundances (Lozada et al. 2008; Marcos et al. 2012). A more complete

knowledge of the bacterial populations with PAH-degradation potential in different coastal

environments of Patagonia is still needed. This information is not only necessary for a better

understanding of PAH-degradation processes, but also for the selection of suitable marker

genes for the design of environmental diagnostic tools for this region (Mahendra et al. 2012).

In this work, we identified a gene variant encoding a RHO α subunit that was present

in intertidal sediment samples from two chronically-polluted sites distanced approximately

1,000 km and belonging to different biogeographic regions (Marcos et al. 2012). The closest

relative of this gene was an aromatic-ring-hydroxylating dioxygenase from the pyrene

degrading strain Cycloclasticus sp. P1 (Lai et al. 2012), although these sequences only shared

a moderate identity. Other close relatives of gene variant T were dioxygenase sequences

identified in Novosphingobium and Sphingomonas strains (data not shown). We designed a

qPCR assay targeting this gene with the sequence information obtained in the clone libraries,

as PCR clone libraries are not suitable to accurately assess the abundance of target genes in

environmental samples (Sipos et al. 2010). We used this assay to estimate the abundance of

uncultured microorganisms containing this gene in the sediments and to assess the short-term

response of these populations after PAH or crude oil amendment. This analysis showed that

these microorganisms were stable members of the PAH-degrading community in chronically

polluted environments, and in some experimental conditions further increased their

Accepted Article

abundance. In contrast, we were not able to detect this gene in sediments with low

anthropogenic impact, even after exposure to high concentration of PAHs in experimental

systems. These results suggest that this gene could constitute a valuable biomarker of chronic

pollution in coastal environments of Patagonia, although further studies are needed to

evaluate the role of these populations in PAH biodegradation processes.

Obligate hydrocarbonoclastic bacteria belonging to the genus Cycloclasticus have

long been recognized as predominant PAH degrading microorganisms in marine sediments

(Staley 2010). In the polluted sediments analyzed in this study, the functional marker gene for

these microorganisms (phnA1), was present at abundances below the quantification or

detection limits of the technique, in agreement with a previous study (Marcos et al. 2012).

However, bacteria carrying the phnA1 gene were able to grow rapidly at the expense of the

added PAHs in the experimental systems built with polluted sediments. Cycloclasticus spp.

have been shown to thrive in the presence of PAHs, in particular in seawater, reaching high

abundances (Kasai et al. 2002; Teira et al. 2007; Yang et al. in press). This shift has been

associated with the biodegradation of low molecular weight compounds, and it is typically

transient (Teira et al. 2007). It is possible that, while the microorganisms carrying gene

variant T are already established members of the benthic community, the conditions used in

the experimental systems (seawater saturation, and high oxygen levels due to agitation) were

more adequate than those from the original sediments for the growth of bacteria belonging to

the genus Cycloclasticus.

A rapid response to hydrocarbon exposure of the bacterial populations targeted by the

qPCR assays in chronically-polluted sediments was consistent with the long-standing notion

that pre-exposure results in a pre-adaptation to pollutants and therefore a faster response in a

further pollution event (Païssé et al. 2010). Possibly, the time frame chosen for this

experiment was too short to be able to observe a similar response in PF sediments, which did

Accepted Article

not have a history of exposure to anthropogenic hydrocarbons and contained no detectable

PAHs (Marcos et al. 2012). Interestingly, a moderate increase in phnA1 gene abundance was

observed after pyrene amendment in these sediments. Several Cycloclasticus strains have

shown the ability to degrade pyrene (Wang et al. 2008; Lai et al. 2012; Cui et al. 2014). The

increase in phnA1 gene abundance observed in all the experimental systems exposed to

pyrene suggests that Cycloclasticus strains with similar capabilities could be present in

intertidal sediments of all three sites.

In this work, we used a metagenomic approach to increase our knowledge of the yet-

to-be-cultured microorganisms carrying gene variant T. The fosmid metagenomic library was

constructed using an intertidal sediment sample obtained near an oil jetty that is used to

discharge refined petroleum products to shore storage tanks. The operation of this oil terminal

represents a source of chronic hydrocarbon pollution to the coastal environment located near

this jetty (Commendatore et al. 2012). Aliphatic hydrocarbon diagnostic indices in this

sample provided evidence of ongoing biodegradation processes (Guibert et al. 2012).

Moderate levels of PAHs were detected in this sample, which included naphthalene,

acenaphthene, anthracene, fluoranthene as well as pyrene (Marcos et al. 2012). Assuming an

average prokaryotic genome size of 3.8 Mb (Tomazetto et al. 2015), this metagenomic library

contains a genomic information equivalent to approximately 470 prokaryotic genomes. Due

to the high diversity of the sediment microbial community at this site, with an estimated

richness of more than 3,000 OTUs (defined at 0.03 distance threshold) only for the bacterial

fraction (Guibert et al. 2012), the metagenomic library presents a low coverage of the

microbial community indigenous of this site. However, due to the high relative abundance of

the microorganisms carrying this gene variant, the size of the metagenomic library was

sufficient for the identification of one clone carrying the biomarker gene.

Accepted Article

The identified metagenomic fragment contained sequences encoding six oxygenase

component of RHOs, which were classified as belonging to three different functional classes

(Chakraborty et al. 2012) and presented potential substrates with various chemical structures

(Chakraborty et al. 2014). The recent sequencing of the genome of PAH-degrading bacterial

strains showed that these microorganisms often carry multiple genes encoding the oxygenase

component of RHOs, distributed throughout their genome (Lai et al. 2012; Zhang and

Anderson 2012; Cui et al. 2013, Khara et al. 2014; Singleton et al. 2015). In fact, the

organization of the genes involved in PAH biodegradation pathways originally described in

Pseudomonas strains (two gene clusters encoding the enzymes involved in the upper and

lower pathways), is now known to be extremely rare (Suenaga et al. 2009). For instance,

Cycloclasticus strains, which are highly specialized in the utilization of aromatic compounds,

were found to carry at least twelve RHO α-subunit genes (Lai et al. 2012; Cui et al. 2013).

Metabolically versatile Sphingomonad strains, capable of degrading various aromatic

compounds, contained seven pairs of genes coding for α and β subunits of RHOs organized in

several clusters, and only one set of genes encoding the electron transport system (Khara et

al. 2014). Similarly, a novel microorganism belonging to the Rhodocyclaceae family (strain

PG1) had eight sets of genes coding for RHO enzymes (Singleton et al. 2015). The majority

of α and β subunit sequences identified in the metagenomic fragment were related to

oxygenases identified in these three groups of PAH-degrading bacteria, although the

moderate identity values suggest that the identified microorganism is not affiliated with either

of these groups. Interestingly, the genome of strain PG1 (isolated from contaminated soil)

also contains a coding sequence with 85 % identity at the amino acid level with gene variant

A, identified in UB sediments using a PCR based approach (Lozada et al. 2008, Marcos et al.

2012).

Accepted Article

Three pairs of RHO α and β subunits, located in less than 7 kb within the

metagenomic fragment, encoded class A oxygenases. Class A RHOs preferentially

hydroxylate α,β-positions of the aromatic ring with respect to an adjacent fused aromatic ring

or a phenyl/alkyl/chloro-substitution, and include PAH dioxygenases (Chakraborty et al.

2012). Three-dimensional models of these oxygenases predicted catalytic pockets with

different volumes and shapes, and possibly different substrate preferences. When compared

with the enzymes used as template, PhnA1 from Sphingomonas sp. CHY-1 and BphA1 from

S. yanoikuyae B1, the identified oxygenases contained similar or larger catalytic pockets, and

two of these oxygenases seemed to be able to accommodate pyrene. Naphthalene was the

preferred substrate of PhnA1 (Demaneche et al. 2004), while BphA1 recognized

preferentially biphenyl (Yu et al. 2007). The oxygenase encoded by sequences M117-38/37

presented a much larger catalytic pocket, which was comparable in size with NidAB from

Mycobacterium vanbaalenii PYR-1, whose preferential substrate is pyrene (Kweon et al.

2010). Overall, our results suggest that the three class A oxygenases encoded in fragment

M117 might be able to hydroxylate phenanthrene and two of them pyrene, which were the

PAHs evaluated in the experimental systems. Further studies, including the heterologous

expression of these enzymes and their enzymatic characterization, will be needed to validate

this hypothesis. Although the genes encoding the electron transport components of these

enzymes were not present within the metagenomic fragment, it is still possible to express

these enzymes using compatible components from related bacteria. This characterization will

not only allow to gain a better understanding of the biodegradation capabilities of this

uncultured microorganism, but also represents an essential step to explore the potential

biotechnological applications of the identified enzymes (Parales and Resnick 2007; Allen

2012).

Accepted Article

In this work, we used three different molecular approaches to identify and characterise

a novel proteobacterium that appears to be highly specialized in the degradation of PAHs.

The analysis of marine metagenome datasets available in public databases could not identify

sequences with high identities with variant T (data not shown). Since only a small fraction of

the marine microbial diversity is currently covered by these metagenomic datasets, this result

cannot exclude the possibility that this biomarker gene could still be present in marine

environments. The evidence obtained so far indicates that this microorganism has a

biogeographic distribution at least extending polluted coastal environments of Patagonia.

This RHO α-subunit gene, distinctive of chronically-polluted sediments from both temperate

and subantarctic environments, represents a first step for its use as a biomarker in the analysis

of sediment samples during natural or enhanced attenuation of polluted coastal environments

of Patagonia. PAHs are highly persistent in coastal sediments, and molecular biological tools

targeting PAH-degrading populations could provide valuable information for the

management of polluted coastal environments, potentially reducing both time and total costs

for site restoration (Interstate Technology Regulatory Council 2011).

ACKNOWLEDGMENTS

ML and HMD are staff members from The Argentinean National Research Council

(CONICET). At the time of this study, CLL, LMG and MSM were recipients of graduate

student fellowships and MAM was a recipient of a postdoctoral fellowship from CONICET.

RVK (an undergraduate student from Leiden University of Applied Sciences, The

Netherlands) and SVS (a master student at the University of Rouen, France) participated of

this work while carrying out training internships at the Environmental Microbiology

Laboratory (CENPAT-CONICET). This work was funded by grants from CONICET, the

National Agency for the Promotion of Science and Technology from the Argentinean

Ministry of Science and Technology (ANPCyT, MINCyT) and the Blacksmith Institute. We

Accepted Article

thank M. Gil, J. L. Esteves, H. Ocariz, A. Torres, L. Bala and L. Musmeci for their invaluable

contribution during sample collection.

Conflict of interest: No conflict of interest declared.

REFERENCES

Allen, C.C.R. (2012) Ring-hydroxylating dioxygenases: biocatalysts with remarkable

Substrate specificity and exquisite product stereochemistry. J Biocatal

Biotransformation 1, e104.

Amin, O.A., Comoglio, L.I. and Sericano, J.L. (2011) Polynuclear aromatic and chlorinated

hydrocarbons in mussels from the coastal zone of Ushuaia, Tierra del Fuego,

Argentina. Environ Toxicol Chem 30, 521-529.

Barragán Muñoz, J.M., Dadón, J.R., Matteucci, S.D., Morello, J.H., Baxendale, C. and

Rodríguez, A. (2003) Preliminary basis for an integrated management program for the

coastal zone of Argentina. Coast Manage 31, 55-77.

Benkert, P., Tosatto, S.C. and Schomburg, D. (2008) QMEAN: A comprehensive scoring

function for model quality assessment. Proteins: Struct, Funct, Bioinf 71, 261-277.

Biasini, M., Bienert, S., Waterhouse, A., Arnold, K., Studer, G., Schmidt, T., Kiefer, F.,

Cassarino, T.G., Bertoni, M. and Bordoli, L. (2014) SWISS-MODEL: modelling

protein tertiary and quaternary structure using evolutionary information. Nuc Acids

Res 42(W1), W252-W258.

Commendatore, M. and Esteves, J. (2007) An assessment of oil pollution in the coastal zone

of Patagonia, Argentina. Environ Manage 40, 814-821.

Accepted Article

Commendatore, M.G., Nievas, M.L., Amin, O. and Esteves, J.L. (2012) Sources and

distribution of aliphatic and polyaromatic hydrocarbons in coastal sediments from the

Ushuaia Bay (Tierra del Fuego, Patagonia, Argentina). Mar Environ Res 74, 20-31.

Cui, Z., Xu, G., Gao, W., Li, Q., Yang, B., Yang, G. and Zheng, L. (2014) Isolation and

characterization of Cycloclasticus strains from Yellow Sea sediments and

biodegradation of pyrene and fluoranthene by their syntrophic association with

Marinobacter strains. Int Biodeter Biodeg 91, 45-51.

Cui, Z., Xu, G., Li, Q., Gao, W. and Zheng, L. (2013) Genome sequence of the pyrene-and

fluoranthene-degrading bacterium Cycloclasticus sp. strain PY97M. Genome Announc

1, e00536-00513.

Chakraborty, J., Ghosal, D., Dutta, A. and Dutta, T.K. (2012) An insight into the origin and

functional evolution of bacterial aromatic ring-hydroxylating oxygenases. J Biomol

Struct Dyn 30, 419-436.

Chakraborty, J., Jana, T., Saha, S. and Dutta, T.K. (2014) RHObase: A database of bacterial

aromatic ring-hydroxylating oxygenases in the management of bioremediation and

biocatalysis of aromatic compounds. Environ Microbiol Rep 6, 519–523.

Demaneche, S., Meyer, C., Micoud, J., Louwagie, M., Willison, J.C. and Jouanneau, Y.

(2004) Identification and functional analysis of two aromatic-ring-hydroxylating

dioxygenases from a Sphingomonas strain that degrades various polycyclic aromatic

hydrocarbons. Appl Environ Microbiol 70, 6714-6725.

Dionisi, H.M., Lozada, M., Marcos, M.S., Di Marzio, W.D. and Loviso, C.L. (2011)

Aromatic Hydrocarbon Degradation Genes from Chronically Polluted Subantarctic

Marine Sediments. In Handbook of Molecular Microbial Ecology II: Metagenomics in

Accepted Article

Different Habitats ed. De Bruijn, F.J. pp: 461-473. Hoboken, New Jersey,

Wiley/Blackwell.

Dundas, J., Ouyang, Z., Tseng, J., Binkowski, A., Turpaz, Y. and Liang, J. (2006) CASTp:

computed atlas of surface topography of proteins with structural and topographical

mapping of functionally annotated residues. Nuc Acids Res 34, W116-W118.

Fan, H., Schneidman-Duhovny, D., Irwin, J.J., Dong, G., Shoichet, B.K. and Sali, A. (2011)

Statistical potential for modeling and ranking of protein-ligand interactions. J Chem

Inf Model 51, 3078-3092.

Ferraro, D., Brown, E., Yu, C.-L., Parales, R., Gibson, D. and Ramaswamy, S. (2007)

Structural investigations of the ferredoxin and terminal oxygenase components of the

biphenyl 2,3-dioxygenase from Sphingobium yanoikuyae B1. BMC Struct Biol 7, 10.

Ferraro, D.J., Okerlund, A.L., Mowers, J.C. and Ramaswamy, S. (2006) Structural basis for

regioselectivity and stereoselectivity of product formation by naphthalene 1, 2-

dioxygenase. J Bacteriol 188, 6986-6994.

Finn, R.D., Bateman, A., Clements, J., Coggill, P., Eberhardt, R.Y., Eddy, S.R., Heger, A.,

Hetherington, K., Holm, L. and Mistry, J. (2014) Pfam: the protein families database.

Nuc Acids Res 42 (D1), D222-D230.

Garreaud, R., Lopez, P., Minvielle, M. and Rojas, M. (2013) Large-scale control on the

Patagonian climate. J Climate 26, 215-230.

Goujon, M., McWilliam, H., Li, W., Valentin, F., Squizzato, S., Paern, J. and Lopez, R.

(2010) A new bioinformatics analysis tools framework at EMBL-EBI. Nuc Acids Res

38, W695-W699.

Grosdidier, A., Zoete, V. and Michielin, O. (2011a) Fast docking using the CHARMM force

field with EADock DSS. J Comput Chem 32, 2149-2159.

Accepted Article

Grosdidier, A., Zoete, V. and Michielin, O. (2011b) SwissDock, a protein-small molecule

docking web service based on EADock DSS. Nuc Acids Res 39, W270-W277.

Guibert, L.M., Loviso, C.L., Marcos, M.S., Commendatore, M.G., Dionisi, H.M. and Lozada,

M. (2012) Alkane biodegradation genes from chronically polluted Subantarctic

coastal sediments and their shifts in response to oil exposure. Microb Ecol 64, 605-

616.

Himmelheber, D.W. and Hughes, J.B. (2014) In Situ Biotransformation of Contaminants in

Sediments. In Processes, Assessment and Remediation of Contaminated Sediments ed.

Reible, D.D. pp.263-304. New York: Springer.

Huson, D.H., Auch, A.F., Qi, J. and Schuster, S.C. (2007) MEGAN analysis of metagenomic

data. Genome Res 17, 377-386.

Interstate Technology Regulatory Council, E.M.D. (2011) Environmental Molecular

Diagnostics Fact Sheets No. EMD-1

(http://www.itrcweb.org/GuidanceDocuments/EMD1.pdf).

Iwai, S., Johnson, T.A., Chai, B., Hashsham, S.A. and Tiedje, J.M. (2011) Comparison of the

specificities and efficacies of primers for aromatic dioxygenase gene analysis of

environmental samples. Appl Environ Microbiol 77, 3551-3557.

Jakoncic, J., Jouanneau, Y., Meyer, C. and Stojanoff, V. (2007) The crystal structure of the

ring-hydroxylating dioxygenase from Sphingomonas CHY-1. FEBS J 274, 2470-

2481.

Kanehisa, M. and Goto, S. (2000) KEGG: Kyoto encyclopedia of genes and genomes. Nuc

Acids Res 28, 27-30.

Accepted Article

Kasai, Y., Kishira, H. and Harayama, S. (2002) Bacteria belonging to the genus

Cycloclasticus play a primary role in the degradation of aromatic hydrocarbons

released in a marine environment. Appl Environ Microbiol 68, 5625-5633.

Kasai, Y., Shindo, K., Harayama, S. and Misawa, N. (2003) Molecular characterization and

substrate preference of a polycyclic aromatic hydrocarbon dioxygenase from

Cycloclasticus sp. strain A5. Appl Environ Microbiol 69, 6688-6697.

Khara, P., Roy, M., Chakraborty, J., Ghosal, D., and Dutta, T.K. (2014) Functional

characterization of diverse ring-hydroxylating oxygenases and induction of complex

aromatic catabolic gene clusters in Sphingobium sp. PNB. FEBS Open Bio 4, 290-

300.

Kweon, O., Kim, S.-J., Freeman, J.P., Song, J., Baek, S. and Cerniglia, C.E. (2010) Substrate

specificity and structural characteristics of the novel rieske nonheme iron aromatic

ring-hydroxylating oxygenases NidAB and NidA3B3 from Mycobacterium

vanbaalenii PYR-1. MBio 1, e00135-00110.

Lai, Q., Li, W., Wang, B., Yu, Z. and Shao, Z. (2012) Complete genome sequence of the

pyrene-degrading bacterium Cycloclasticus sp. strain P1. J Bacteriol 194, 6677-6677.

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H.,

Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. and

Higgins, D.G. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947-

2948.

Liithy, R., Bowie, J.U. and Eisenberg, D. (1992) Assessment of protein models with three-

dimensional profiles. Nature 356, 83-85.

Accepted Article

Lozada, M., Riva Mercadal, J.P., Guerrero, L.D., Di Marzio, W.D., Ferrero, M.A. and

Dionisi, H.M. (2008) Novel aromatic ring-hydroxylating dioxygenase genes from

coastal marine sediments of Patagonia. BMC Microbiol 8, 50.

McGinnis, S. and Madden, T.L. (2004) BLAST: at the core of a powerful and diverse set of

sequence analysis tools. Nuc Acids Res 32, W20-W25.

Mahendra, S., Gedalanga, P., Kotay, S.M., Torres, C.I., Butler, C.S. and Goel, R. (2012)

Advancements in molecular techniques and applications in environmental

engineering. Water Environ Res 84, 814-844.

Marcos, M.S., Lozada, M., Di Marzio, W.D. and Dionisi, H.M. (2012) Abundance,

dynamics, and biogeographic distribution of seven polycyclic aromatic hydrocarbon

dioxygenase gene variants in coastal sediments of Patagonia. Appl Environ Microbiol

78, 1589-1592.

Marcos, M.S., Lozada, M. and Dionisi, H.M. (2009) Aromatic hydrocarbon degradation

genes from polluted Subantarctic marine sediments. Lett Appl Microbiol 49, 602-608.

Nikolaou, A., Kostopoulou, M., Lofrano, G., Meric, S., Petsas, A. and Vagi, M. (2009)

Levels and toxicity of polycyclic aromatic hydrocarbons in marine sediments. Trends

Analyt Chem 28, 653-664.

Païssé, S., Goñi-Urriza, M., Coulon, F. and Duran, R. (2010) How a bacterial community

originating from a contaminated coastal sediment responds to an oil input. Microb

Ecol 60, 394-405.

Parales, R.E. and Resnick, S.M. (2006) Aromatic Ring Hydroxylating Dioxygenases. In

Pseudomonas. pp. 287-340. The Netherlands: Springer.

Accepted Article

Parales, R.E. and Resnick, S.M. (2007) Applications of Aromatic Hydrocarbon

Dioxygenases. In Biocatalysis in the Pharmaceutical and Biotechnology Industries

ed. Patel, R.N. pp. 299-331. Boca Raton, FL: CRC Press.

Patil, K.R., Roune, L. and McHardy, A.C. (2012) The PhyloPythiaS web server for

taxonomic assignment of metagenome sequences. PLoS One 7, e38581.

Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C. and

Ferrin, T.E. (2004) UCSF Chimera-a visualization system for exploratory research

and analysis. J Comput Chem 25, 1605-1612.

Pfaffl, M.W. (2004) Quantification Strategies in Real-Time PCR. In AZ of Quantitative PCR

ed. Bustin, S.A. pp.89-113. La Jolla, CA: International University Line (IUL).

Singleton, D.R., Dickey, A.N., Scholl, E.H., Wright, F.A. and Aitken, M.D. (2015) Complete

genome sequence of a novel bacterium within the family Rhodocyclaceae that

degrades polycyclic aromatic hydrocarbons. Genome Announc 3, e00251-15.

Sipos, R., Székely, A., Révész, S. and Márialigeti, K. (2010) Addressing PCR Biases in

Environmental Microbiology Studies. In Bioremediation: Methods and Protocols

(Methods in Molecular Biology nº 599) ed. Cummings, S.P. pp. 37-58. New York:

Springer-Verlag.

Staley, J.T. (2010) Cycloclasticus: A Genus of Marine Polycyclic Aromatic Hydrocarbon

Degrading Bacteria. In Handbook of Hydrocarbon and Lipid Microbiology, part 19

ed. McGenity, T. pp. 1781-1786. Berlin Heidelberg: Springer.

Suenaga, H., Koyama, Y., Miyakoshi, M., Miyazaki, R., Yano, H., Sota, M., Ohtsubo, Y.,

Tsuda, M. and Miyazaki, K. (2009) Novel organization of aromatic degradation

pathway genes in a microbial community as revealed by metagenomic analysis. ISME

J 3, 1335-1348.

Accepted Article

Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013) MEGA6: molecular

evolutionary genetics analysis version 6.0. Molec Biol Evol 30, 2725-2729.

Tatusov, R.L., Natale, D.A., Garkavtsev, I.V., Tatusova, T.A., Shankavaram, U.T., Rao, B.S.,

Kiryutin, B., Galperin, M.Y., Fedorova, N.D. and Koonin, E.V. (2001) The COG

database: new developments in phylogenetic classification of proteins from complete

genomes. Nuc Acids Res 29, 22-28.

Teira, E., Lekunberri, I., Gasol, J.M., Nieto-Cid, M., Álvarez-Salgado, X.A. and Figueiras,

F.G. (2007) Dynamics of the hydrocarbon-degrading Cycloclasticus bacteria during

mesocosm-simulated oil spills. Environ Microbiol 9, 2551-2562.

Tomazetto, G., Wibberg, D., Schlüter, A. and Oliveira, V.M. (2015) New FeFe-hydrogenase

genes identified in a metagenomic fosmid library from a municipal wastewater

treatment plant, as revealed by high-throughput sequencing. Res Microbiol 166, 9-19.

Van Colen, C., Underwood, G.J., Serôdio, J. and Paterson, D.M. (2014) Ecology of intertidal

microbial biofilms: Mechanisms, patterns and future research needs. J Sea Res 92, 2-

Wang, B., Lai, Q., Cui, Z., Tan, T. and Shao, Z. (2008) A pyrene-degrading consortium from

deep-sea sediment of the West Pacific and its key member Cycloclasticus sp. P1.

Environ Microbiol 10, 1948-1963.

Wang, W., Chen, K. and Xu, C. (2006) DNA quantification using EvaGreen and a real-time

PCR instrument. Anal Biochem 356, 303-305.

Waterhouse, A.M., Procter, J.B., Martin, D.M., Clamp, M. and Barton, G.J. (2009) Jalview

Version 2-a multiple sequence alignment editor and analysis workbench.

Bioinformatics 25, 1189-1191.

Accepted Article

Wilson, M.S., Bakermans, C. and Madsen, E.L. (1999) In situ, real-time catabolic gene

expression: extraction and characterization of naphthalene dioxygenase mRNA

transcripts from groundwater. Appl Environ Microbiol 65, 80-87.

Willard, L., Ranjan, A., Zhang, H., Monzavi, H., Boyko, R.F., Sykes, B.D. and Wishart, D.S.

(2003) VADAR: a web server for quantitative evaluation of protein structure quality.

Nuc Acids Res 31, 3316-3319.

Yang, T., Nigro, L.M., Gutierrez, T., Joye, S.B., Highsmith, R. and Teske, A. Pulsed blooms

and persistent oil-degrading bacterial populations in the water column during and after

the Deepwater Horizon blowout. Deep Sea Research Part II: Topical Studies in

Oceanography. In press.

Yorio, P. (2009) Marine protected areas, spatial scales, and governance: implications for the

conservation of breeding seabirds. Conserv Lett 2, 171-178.

Yu, C.L., Liu, W., Ferraro, D.J., Brown, E.N., Parales, J.V., Ramaswamy, S., Zylstra, G.J.,

Gibson, D.T. and Parales, R.E. (2007) Purification, characterization, and

crystallization of the components of a biphenyl dioxygenase system from

Sphingobium yanoikuyae B1. J Ind Microbiol Biotechnol 34, 311-324.

Zhang, C. and Anderson, A.J. (2012) Multiplicity of genes for aromatic ring-hydroxylating

dioxygenases in Mycobacterium isolate KMS and their regulation. Biodegradation 23,

585–596.

Zhou, H.W., Guo, C.L., Wong, Y.S. and Tam, N.F.Y. (2006) Genetic diversity of

dioxygenase genes in polycyclic aromatic hydrocarbon-degrading bacteria isolated

from mangrove sediments. FEMS Microbiol Lett 262, 148-157.

Zhou, J., Bruns, M. and Tiedje, J. (1996) DNA recovery from soils of diverse composition.

Appl Environ Microbiol 62, 316-322.

Accepted Article

FIGURE LEGENDS

Figure 1. Sampling locations. PF: Fracasso Beach, San José Gulf, Valdés Peninsula (non-

impacted site, 42°25' S, 64°7' W), CC: Cordova Cove, San Jorge Gulf (chronically-polluted

site, temperate climate, 45°45' S, 67°22' W), UB: Ushuaia Bay, Tierra del Fuego Island

(chronically-polluted site, subantarctic climate, 54°48' S, 68°17' W).

Figure 2. Abundance of gene variants T and phnA1 in sediment samples and

experimental systems. qPCR assays targeting gene variants T and phnA1from

Cycloclasticus spp., as well as bacterial 16S rRNA genes were applied to sediment samples

and experimental systems from PF (A), CC (B), and UB (C) sampling locations. Relative

abundance of the analyzed genes in sediment samples (PF08, CC08, OR08), slurries without

further hydrocarbon addition (PF08-exp, CC08-exp, OR08-exp), slurries with phenanthrene

addition (PF08-phe, CC08-phe, OR08-phe), slurries with pyrene addition (PF08-py, CC08-

py, OR08-py), and slurries with crude oil addition (PF08-oil, CC08-oil, OR08-oil) are shown.

Circle: detected at a concentration below the quantification limit of the assay (8 x 10

copies

μg

-1

DNA); *: not determined. D- Quantification of gene variant T in sediment samples

retrieved from UB site in three consecutive years. Black bars, gene variant T; gray bars,

phnA1 gene; white bars, bacterial 16S rRNA genes.

Figure 3. Gene organization of metagenomic fragment M117. The predicted protein-

coding sequences are shown with arrows, coloured by COG categories: dark blue, amino acid

metabolism and transport [E]; orange, lipid metabolism [I]; yellow, coenzyme metabolism

[H]; purple, cell cycle control and mitosis [D]; light green, nucleotide metabolism and

transport [F]; pink, cell wall/membrane/envelope biogenesis [M]; brown, signal transduction

[T]; light blue, translation [J]; red, inorganic ion transport and metabolism [P]; dark green,

replication and repair [L]; fuchsia, energy production and conversion [C]; gray, general

functional prediction only [R], function unknown [S] or not in COG. Detailed information of

Accepted Article

the functional annotation of these sequences can be found in Table S3. Genes encoding α and

β subunits of the terminal oxygenases are indicated with gray rectangles. The numbers of the

coding sequences are indicated on the top, with the sequence corresponding to gene variant T

shown with gray background.

Supporting Information

Table S1. Sediment samples, total PAH concentrations and molecular analyses

performed in this study

Table S2. Primers and conditions used in this study for PCR-based analyses

Table S3. Putative function of the coding sequences identified in fosmid M117

Table S4. Best Blastp matches in the NCBI database to the oxygenase sequences

identified in fosmid M117

Figure S1. Phylogenetic trees of RHO α-subunit sequences identified in fosmid M117.

Neighbor-joining trees including metagenomic sequences (in red), previously classified

sequences (Chakraborty et al. 2012) and the closest homologs of the metagenomic sequences

from the NCBI database (bold fonts). Sequence name and strain name (in brackets) is

indicated in each case. RHO classification according to the scheme proposed for Chakraborty

et al. (2012) is indicated on the right. Figure S2a, class A RHOs; Figure S2b, class B RHOs;

Figure S2c, class C RHOs. Bootstrap values were calculated as percentage of 1,000

replicates, with only values ≥50% shown in the figure. The scale bar represents the inferred

amino acid changes per position.

Figure S2. Active sites of the modelled oxygenases. Stick representations identify the

amino acids interacting with the catalytic iron (sphere), whereas line representations show the

amino acids involved in substrate-binding. A) M117-33; B) M117-36; C) M117-38. The

amino acids composing the active site of the templates, identified from previous works

[(Jakoncic et al. 2007) for A, (Ferraro et al. 2007) for B and C], are shown in green. The

amino acids belonging to the modelled enzyme are shown in red, and only those residues

differing from the template sequence are identified in red. The figure was constructed with

PyMOL (0.99RC6).

Accepted Article

Figure S3. Topology of the catalytic cavities of the modelled oxygenases. A) oxygenase

from Sphingomonas sp CHY-1 (PDB 2CKF) (Jakoncic et al. 2007); B) oxygenase from

Sphingomonas yanoikuyae (PDB 2GBW) (Ferraro et al. 2007); C) M117-33 (template

2CKF). D) M117-36 (template 2GBW). E) M117-38 (template 2GBW). The spatial

disposition of pyrene was obtained from docking analysis. The sphere represents the catalytic

iron.

Table S5. Active site dimensions of the modelled class A oxygenases and their respective

templates

Table S6. Pose and Rank scores for docking analysis of different complexes between the

oxygenases and phenanthrene or pyrene

Table 1. Analysis of the RHO α-subunit gene variants identified in the PCR clone libraries.

Gene

variant

Sequence

length

(bp)

Library

clones)

Closest homolog

Accession

number

Identity

(%)

Query

coverage

(%)

E 257 UB (38)

OR08-oil

(38)

Aromatic ring-

hydroxylating

dioxygenase, partial

[uncultured bacterium],

intertidal sediments,

Ushuaia Bay,

Argentina

CAP60623

85 98

Naphthalene 1,2-

dioxygenase

[Polycyclovorans

algicola TG408]

WP_029889175

84 98

Accepted Article

T 260 UB (50)

OR08-oil

(62)

CC (75)

Aromatic-ring-

hydroxylating

dioxygenase subunit

alpha-like protein

[Cycloclasticus sp. P1]

YP_006837517 67 96

U 245 UB (12) (2Fe-2S)-binding

protein

[Novosphingobium

malaysiense]

WP_039290189 60 98

V 275 CC (25) Naphthalene

dioxygenase iron sulfur

protein, partial

[Pseudomonas sp.

5N1-1]

CAD42906 47 96

Libraries: UB, library constructed from Ushuaia Bay sediment samples OR06, OR07, OR08

and EM06 (Lozada et al. 2008; Marcos et al. 2012); OR08-oil, library constructed from

OR08-oil experimental system (Guibert et al. 2012); CC, library constructed from Cordova

Cove sediment samples CC08-1, CC08-2, CC10-1 and CC10-2 (Marcos et al. 2012). Further

information can be found in Material and Method and Table S1.

Percentage of clones of the PCR-clone library corresponding to each gene variant is

indicated in parentheses.

Closest homolog of the NCBI database, showing the highest Blastp maximum score.

Percent identity at the amino acid level shared with the closest homolog.

Accepted Article

Beagle Channel

46°S

80°W 70°W 60°W

68°20'

54°50'

68°15' 68°10'

Atlantic Ocean

56°S

Accepted Article

Metagenomics reveals the high PAH-degradation potential of abundant uncultured bacteria

from chronically-polluted subantarctic and temperate coastal marine environments

Claudia L. Loviso, Mariana Lozada, Lilian M. Guibert, Matías A. Musumeci, Sandra Sarango

Cardenas, Ruud V. Kuin, Magalí S. Marcos and Hebe M. Dionisi

Laboratorio de Microbiología Ambiental, Centro para el Estudio de Sistemas Marinos

(CESIMAR, CENPAT-CONICET), Blvd. Brown 2915, U9120ACD, Puerto Madryn, Chubut

Province, Argentina.

Supporting Information

Pages Description

2 Table S1. Sediment samples, total PAH concentrations and molecular analyses

performed in this study

3 Table S2. Primers and conditions used in this study for PCR-based analyses

4-7 Table S3. Putative function of the coding sequences identified in fosmid M117

8-9 Table S4. Best Blastp matches in the NCBI database to the oxygenase sequences

identified in fosmid M117

10-12 Figure S1. Phylogenetic trees of RHO α-subunit sequences identified in fosmid

M117

13 Figure S2. Active sites of the modelled oxygenases

14 Figure S3. Topology of the catalytic cavities of the modelled oxygenases

15 Table S5. Active site dimensions of the modelled class A oxygenases and their

respective templates

16 Table S6. Pose and Rank scores for docking analysis of different complexes between

the oxygenases and phenanthrene or pyrene

17 References

Table S1. Sediment samples, total PAH concentrations and molecular analyses performed in this

study

Molecular analyses Sampling

location

Sediment

samplea

Total PAH

concentration (μg

kg-1 dry weight

sediment)b

PCR

clone

libraries

qPCR

sediment

samples

Experim.

systems

Metag.

library

PF PF08 non detected x x

CC08-1 1,054 x

CC08-2 758 x x x

CC10-1 378 x

CC10-2 454 x

EM06 1,803 x

OR05 209 x

OR06 1,726 x x

OR07 883 x x x

OR08 4,127 x x x

aSediment samples were named according to their sampling location (PF, CC), or site within UB (EM,

OR) followed by the last two digits of the sampling year, with an additional number for the two CC

samples obtained at the same date. More information can be found elsewhere (Lozada et al. 2008; Marcos

et al. 2012).

bThis information, as well as the concentration of the individual PAHs, has been reported in previous

studies (Lozada et al. 2008; Marcos et al. 2012).

Table S2. Primers and conditions used in this study for PCR-based analyses.

Primer

name

Sequence (5’ – 3’) Product

length (bp)

Primer

concentration

PCR program Methodology References

Nah-for TGCMVNTAYCAYGGYTGG 2 μM (Zhou et al. 2006)

Ac596r CRGGTGYCTTCCAGTTG 245-275 500 nM

5 min at 95°C; 40 cycles of 30 s at

94°C, 30 s at 54°C and 30 s at 72°C;

15 min at 72°C

PCR clone libraries

Screening of

metagenomic library (Wilson et al.

1999)

Tgroup-f TGGTACCTTCGACGCAAGC 900 nM This work

Tgroup-r GGCACATCCAGAAATGAGTCC 84 600 nM

5 min at 95°C; 45 cycles of 30 s at

95°C and 30 s at 56ºC; 30 s at 72°C;

melting curve 70°C-95°C with

incrementing temperatures of 0.2°C

qPCR This work

phnA1f GGGTGGACTAGCTGGAA 600 nM (Marcos et al.

2012)

phnA1r TTCGCATGAATAGCGATGG

120

600 nM

5 min at 95°C; 45 cycles of 30 s at

95°C and 30 s at 60ºC; 30 s at 72°C;

melting curve 70°C-95°C with

incrementing temperatures of 0.2°C

qPCR

(Marcos et al.

2012)

16S-

1055f

ATGGCTGTCGTCAGCT 500 nM (Marcos et al.

2012)

16S-

1392r

ACGGGCGGTGTGTAC

352

500 nM

5 min at 95°C; 45 cycles of 30 s at

95°C and 30 s at 50ºC; 30 s at 72°C;

melting curve 70°C-95°C with

incrementing temperatures of 0.2°C.

qPCR

(Marcos et al.

2012)

Table S3. Putative function of the coding sequences identified in fosmid M117.

CDS Strand Start-Finish Description Gene Name Pfam domain ID COG ID COG Category

M117-01 +

2-535

Phosphoribosylanthranilate isomerase

(EC 5.3.1.24)

trpF

PRAI

COG0135 E

M117-02 +

528-1745

Tryptophan synthase beta chain (EC

4.2.1.20)

trpB

PALP

COG0133 E

M117-03 +

1742-2551

Tryptophan synthase alpha chain (EC

4.2.1.20)

trpA

Trp_syntA

COG0159 E

M117-04 +

2555-3469

Acetyl-coenzyme A carboxyl transferase

beta chain (EC 6.4.1.2)

accD

Carboxyl_trans

COG0777 I

M117-05 + 3586-4854

Dihydrofolate synthase (EC 6.3.2.12) /

Folylpolyglutamate synthase (EC

6.3.2.17)

folC Mur_ligase_C/Mur_lig

ase_M COG0285 H

M117-06 + 4966-5562 Cell division protein ftsN SPOR COG3087 D

M117-07 + 5677-6174 Colicin V production protein cvpA Colicin_V COG1286 R

M117-08 + 6222-7730 Amidophosphoribosyltransferase (EC

2.4.2.14)

purF Pribosyltran/GATase_2 COG0034 F

M117-09 +

7714-9255 Xaa-His dipeptidase (EC 3.4.13.3)

argE Peptidase_M20/M20_d

imer

COG0624 E

M117-10 - 10088-9405 Probable metal-dependent peptidase - Zn_peptidase_2 - -

M117-11 - 10701-10138 Lipid A 3-O-deacylase family protein - PagL COG3637 M

M117-12 + 10931-11365 Thioesterase superfamily protein fcbC 4HBT_2 COG0824 R

M117-13 + 11408-13228

GTP-binding protein TypA/BipA (EC

3.6.5.-) typA GTP_EFTU/EFG_C/

GTP_EFTU_D2 COG1217 T

M117-14 + 13228-13665 D-tyrosyl-tRNA(Tyr) deacylase dtd Tyr_Deacylase COG1490 J

M117-15

+ 13712-14530

Bis(5'-nucleosyl)-tetraphosphatase,

symmetrical (EC 3.6.1.41)

- Metallophos - -

M117-161 + 14606-15874 Ring-hydroxylating dioxygenases,

alpha subunit (EC 1.14.12.-) hcaE Rieske/Ring_hydroxyl

_A COG4638 P/R

M117-17 + 16016-16885

Xanthine dehydrogenase, FAD binding

subunit (EC 1.17.1.4)2

- FAD_binding_5/CO_d

eh_flav_C

- -

M117-18

+ 16901-17377

Xanthine dehydrogenase iron-sulfur

subunit (EC 1.17.1.4) 2

- Fer2/Fer2_2 - -

M117-19 + 17380-19668

Xanthine dehydrogenase, molybdenum

binding subunit (EC 1.17.1.4)2 - Ald_Xan_dh_C/Ald_X

an_dh_C2 - -

M117-20 + 19675-19965 ThiS family protein - ThiS - -

M117-21

- 20569-20063

Ring-hydroxylating dioxygenase, beta

subunit

- Ring_hydroxyl_B - -

M117-22 - 21908-20559 Ring-hydroxylating dioxygenases,

alpha subunit (EC 1.14.12.-) hcaE Rieske/Ring_hydroxyl

_A COG4638 P/R

M117-23 + 22335-23594

Ring-hydroxylating dioxygenases, hcaE Rieske/Ring_hydroxyl COG4638 P/R

alpha subunit (EC 1.14.12.-) _A

M117-24

+ 23614-24099 Ring hydroxylating dioxygenase, beta

subunit (EC 1.14.12.-)

- Ring_hydroxyl_B - -

M117-25 + 24262-25221

Gamma-carboxymuconolactone

decarboxylase

subunit/Lactoylglutathione lyase-like

protein3

- CMD/Glyoxalase_4 COG0599 S

M117-26 + 25325-26392 Lactoylglutathione lyase-like protein - No Hit - -

M117-27

+ 26416-26934

G:T/U mismatch-specific uracil/thymine

DNA-glycosylase

mug UDG COG3663 L

M117-28 + 27162-28070 Fatty acid desaturase desA FA_desaturase COG3239 I

M117-29 + 28310-28483 Rubredoxin - Rubredoxin COG1773 C

M117-30 + 28711-29166 Ion channel family protein - Ion_trans_2 - -

M117-31 + 29260-30033 Conserved hypothetical protein - DUF328 COG3022 S

M117-32 - 30598-30044 Ring hydroxylating dioxygenase, beta

subunit (EC 1.14.12.-) - Ring_hydroxyl_B - -

M117-33 - 31932-30598

Ring-hydroxylating dioxygenases,

alpha subunit (EC 1.14.12.-) hcaE Rieske/Ring_hydroxyl

_A COG4638 P/R

M117-34 - 33171-32056 Xylene monooxygenase (EC 1.14.13.-) xylM FA_desaturase - -

M117-35

- 33765-33217

Ring hydroxylating dioxygenase beta

subunit (EC 1.14.12.-)

- Ring_hydroxyl_B - -

M117-36 - 35109-33778 Ring-hydroxylating dioxygenases,

alpha subunit (EC 1.14.12.-) hcaE Rieske/Ring_hydroxyl

_A COG4638 P/R

M117-37

- 35724-35167

Ring hydroxylating dioxygenase beta

subunit (EC 1.14.12.-)

- Ring_hydroxyl_B - -

M117-38 - 36728-35724 Ring-hydroxylating dioxygenases,

alpha subunit (EC 1.14.12.-) hcaE Rieske/Ring_hydroxyl

_A COG4638 P/R

1Coding sequences encoding α and β subunits of RHOs are indicated in bold.

2COG hit corresponded to carbon-monoxide dehydrogenase (cox genes), although the rest of the evidences of conserved domains suggested that they could

correspond to xanthine dehydrogenase genes.

3M117-25 is a single open reading frame containing two domains.

Table S4. Best Blastp matches in the NCBI database to the oxygenase sequences identified in fosmid M117.

Sequence

name

Length

(aa)

Subunita Predicted

RHO

classb

Putative substratesc Closest homologued Accession

number

Identity

(%)

Coverage

(%)

M117-16 422 α C Carboxylated aromatics like

salicylate, methylsalicylates,

mono- and di-

chlorosalicylates,

nitrosalicylate,

dihydroxybenzoates and

anthranilate

Hypothetical protein

[Bacillus sp. L1(2012)] WP_017727645 50 96

M117-21 168 β Hypothetical protein

[Rhodocyclaceae bacterium

PG1-Ca6]

AJP49441 61 95

M117-22 449 α B

Carboxylated aromatics like

benzoate and toluate Hypothetical protein

[Rhodocyclaceae bacterium

PG1-Ca6]

AJP49440 67 99

M117-23 419 α B MULTISPECIES: ring

hydroxylating dioxygenase

subunit alpha/Rieske (2Fe-

2S) protein [Cycloclasticus]

WP_016390151 64 97

M117-24 161 β

Carboxylated aromatics like

benzoate and toluate Aromatic-ring-hydroxylating

dioxygenase subunit beta

[Rhodocyclaceae bacterium

PG1-Ca6]

AJP47937 62 100

M117-32 184 β PAH dioxygenase iron sulfur

protein small subunit

[Cycloclasticus sp. P1]

YP_006837518 54 95

M117-33 444 α A

PAHs like naphthalene,

phenanthrene, anthracene,

acenaphthene, acenaphthylene,

fluorene, fluoranthene, pyrene,

chrysene, benz[a]anthracene,

benzo[a]pyrene and 3-

Aromatic-ring-hydroxylating

dioxygenase subunit alpha-

like protein [Cycloclasticus

YP_006837517 59 99

aType of subunit of the oxygenase component of RHOs identified in the sequenced metagenomic fragments.

bPredicted functional affiliation based on the phylogenetic analysis of the RHO α-subunit sequences and the sequence prediction at the RHObase server

(http://bicresources.jcbose.ac.in/ssaha4/Rhobase), which were in agreement.

cPutative substrate analyzed using the RHObase server.

dSequence with the maximum score in blasp analysis.

ePartial sequence.

methylcholanthrene,

arylbenzenes like biphenyl,

hetero polycyclic

hydrocarbons like carbazole,

dibenzofuran,

dibenzothiophene, dibenzo-p-

dioxin, and benzo[h]quinoline

sp. P1]

M117-35 182 β Small subunit of

phenylpropionate

dioxygenase [Cycloclasticus

zancles 7-ME]

YP_008375225 72 93

M117-36 443 α A

Alkylbenzenes like

ethylbenzene, propylbenzene,

cumene and p-cymene,

arylbenzenes like biphenyl,

PAHs like naphthalene,

phenanthrene, anthracene,

acenaphthene and

Benz[a]anthracene, tetralin

Aromatic-ring-hydroxylating

dioxygenase subunit alpha-

like protein [Cycloclasticus

sp. P1]

YP_006838780 70 99

M117-37 185 β Aromatic-ring-hydroxylating

dioxygenase [Sphingobium

sp. KK22]

WP_025548211 46 91

M117-38e 334 α A

Alkylbenzenes like

ethylbenzene, propylbenzene,

cumene and p-cymene,

arylbenzenes like biphenyl,

PAHs like naphthalene,

phenanthrene, anthracene,

acenaphthene and

benz[a]anthracene, tetralin

Large subunit aromatic

oxygenase

[Novosphingobium

aromaticivorans F199]

NP_049184 68 95

Figure S1a-c. Phylogenetic trees of RHO α-subunit sequences identified in fosmid M117.

Neighbor-joining trees including metagenomic sequences (in red), previously classified

sequences (Chakraborty et al. 2012) and the closest homologs of the metagenomic sequences

from the NCBI database (bold fonts). Sequence name and strain name (in brackets) is indicated

in each case. RHO classification according to the scheme proposed for Chakraborty et al. (2012)

is indicated on the right. Figure S2a, class A RHOs; Figure S2b, class B RHOs; Figure S2c,

class C RHOs. Bootstrap values were calculated as percentage of 1,000 replicates, with only

values ≥50% shown in the figure. The scale bar represents the inferred amino acid changes per

position.

Figure S1a

Figure S1b

Figure S1c

Figure S2. Active sites of the modelled oxygenases. Stick representations identify the amino

acids interacting with the catalytic iron (sphere), whereas line representations show the amino

acids involved in substrate-binding. A) M117-33; B) M117-36; C) M117-38. The amino acids

composing the active site of the templates, identified from previous works [(Jakoncic et al.

2007) for A, (Ferraro et al. 2007) for B and C], are shown in green. The amino acids belonging

to the modelled enzyme are shown in red, and only those residues differing from the template

sequence are identified in red. The figure was constructed with PyMOL (0.99RC6).

Figure S3. Topology of the catalytic cavities of the modelled oxygenases. A) oxygenase from

Sphingomonas sp CHY-1 (PDB 2CKF) (Jakoncic et al. 2007); B) oxygenase from

Sphingomonas yanoikuyae (PDB 2GBW) (Ferraro et al. 2007); C) M117-33 (template 2CKF).

D) M117-36 (template 2GBW). E) M117-38 (template 2GBW). The spatial disposition of

pyrene was obtained from docking analysis. The sphere represents the catalytic iron.

Table S5. Active site dimensions of the modelled class A oxygenases and their respective

templates.

1Measured with CASTp (Dundas et al. 2006).

2Measured with UCSF Chimera (Pettersen et al. 2004).

3Dioxygenase from Sphingomonas CHY-1, PDB entry 2CKF (Jakoncic et al. 2007).

4Dioxygenase from Sphingomonas yanoikuyae B1, PDB entry 2GBW (Ferraro et al. 2007).

Sequence Catalytic cavity

volume (Å3)1

Width (Å)2 Height (Å)2 Length (Å)2

M117-33 457.0 9.7 6.2 11.9

M117-36 555.4 7.8 7.4 15.0

M117-38 603.9 9.2 7.1 15.3

PhnA13 424.0 8.9 6.6 12.4

BphA14 397.8 9.6 6.7 10.9

Table S6. Pose and Rank scores for docking analysis of different complexes between the

oxygenase sequences and phenanthrene or pyrene1.

Phenanthrene Pyrene

Oxygenase Pose2 Rank3 Pose2 Rank3

Positive Control4 -32.3 -6.79 -39.19 -6.79

2CKF5 -17.85 -0.24 -21.75 -0.41

2GBW6 -29.64 -5.13 -33.99 -6.65

M117-33

-17.03 -3.76 -14.71 1.79

M117-36 -18.74 -3.76 -21.09 -2.79

M117-38 -19.09 -3.82 -19.22 -3.81

1The ligands were oriented into the active sites in accordance to the observed orientation of

phenanthrene in the reported crystal structure of naphthalene 1,2-dioxygenase from

Pseudomonas sp. NCIB 9816-4 (PDB 2HMK) (Ferraro et al. 2006).

2PoseScore was optimized for recognizing native binding geometries of ligands from other poses

(Fan et al. 2011).

3RankScore was optimized for distinguishing ligands from non-binding molecules (Fan et al.

2011).

4Positive control corresponds to naphthalene 1,2-dioxygenase from Pseudomonas sp. NCIB

9816-4 (PDB 2HMK) without the ligand phenanthrene.

5Dioxygenase from Sphingomonas sp. CHY-1 (Jakoncic et al. 2007).

6Dioxygenase from Sphingomonas yanoikuyae B1 (Ferraro et al. 2007).

References

Chakraborty, J., Ghosal, D., Dutta, A. and Dutta, T.K. (2012) An insight into the origin and

functional evolution of bacterial aromatic ring-hydroxylating oxygenases. J Biomol

Struct Dyn 30, 419-436.

Fan, H., Schneidman-Duhovny, D., Irwin, J.J., Dong, G., Shoichet, B.K. and Sali, A. (2011)

Statistical potential for modeling and ranking of protein-ligand interactions. J Chem Inf

Model 51, 3078-3092.

Ferraro, D., Brown, E., Yu, C.-L., Parales, R., Gibson, D. and Ramaswamy, S. (2007) Structural

investigations of the ferredoxin and terminal oxygenase components of the biphenyl 2,3-

dioxygenase from Sphingobium yanoikuyae B1. BMC Struct Biol 7, 10.

Ferraro, D.J., Okerlund, A.L., Mowers, J.C. and Ramaswamy, S. (2006) Structural basis for

regioselectivity and stereoselectivity of product formation by naphthalene 1, 2-

dioxygenase. J Bacteriol 188, 6986-6994.

Jakoncic, J., Jouanneau, Y., Meyer, C. and Stojanoff, V. (2007) The crystal structure of the ring-

hydroxylating dioxygenase from Sphingomonas CHY-1. FEBS J 274, 2470-2481.

Lozada, M., Riva Mercadal, J.P., Guerrero, L.D., Di Marzio, W.D., Ferrero, M.A. and Dionisi,

H.M. (2008) Novel aromatic ring-hydroxylating dioxygenase genes from coastal marine

sediments of Patagonia. BMC Microbiol 8, 50.

Marcos, M.S., Lozada, M., Di Marzio, W.D. and Dionisi, H.M. (2012) Abundance, dynamics,

and biogeographic distribution of seven polycyclic aromatic hydrocarbon dioxygenase

gene variants in coastal sediments of Patagonia. Appl Environ Microbiol 78, 1589-1592.

Wilson, M.S., Bakermans, C. and Madsen, E.L. (1999) In situ, real-time catabolic gene

expression: extraction and characterization of naphthalene dioxygenase mRNA

transcripts from groundwater. Appl Environ Microbiol 65, 80-87.

Zhou, H.W., Guo, C.L., Wong, Y.S. and Tam, N.F.Y. (2006) Genetic diversity of dioxygenase

genes in polycyclic aromatic hydrocarbon-degrading bacteria isolated from mangrove

sediments. FEMS Microbiol Lett 262, 148-157.

Metagenomic Insights Into the Mechanisms for Biodegradation of Polycyclic Aromatic Hydrocarbons in the Oil Supply Chain

Article

Full-text available

Sep 2020

Petroleum is a very complex and diverse organic mixture. Its composition depends on reservoir location and in situ conditions and changes once crude oil is spilled into the environment, making the characteristics associated with every spill unique. Polycyclic aromatic hydrocarbons (PAHs) are common components of the crude oil and constitute a group of persistent organic pollutants. Due to their highly hydrophobic, and their low solubility tend to accumulate in soil and sediment. The process by which oil is sourced and made available for use is referred to as the oil supply chain and involves three parts: (1) upstream, (2) midstream and (3) downstream activities. As consequence from oil supply chain activities, crude oils are subjected to biodeterioration, acidification and souring, and oil spills are frequently reported affecting not only the environment, but also the economy and human resources. Different bioremediation techniques based on microbial metabolism, such as natural attenuation, bioaugmentation, biostimulation are promising approaches to minimize the environmental impact of oil spills. The rate and efficiency of this process depend on multiple factors, like pH, oxygen content, temperature, availability and concentration of the pollutants and diversity and structure of the microbial community present in the affected (contaminated) area. Emerging approaches, such as (meta-)taxonomics and (meta-)genomics bring new insights into the molecular mechanisms of PAH microbial degradation at both single species and community levels in oil reservoirs and groundwater/seawater spills. We have scrutinized the microbiological aspects of biodegradation of PAHs naturally occurring in oil upstream activities (exploration and production), and crude oil and/or by-products spills in midstream (transport and storage) and downstream (refining and distribution) activities. This work addresses PAH biodegradation in different stages of oil supply chain affecting diverse environments (groundwater, seawater, oil reservoir) focusing on genes and pathways as well as key players involved in this process. In depth understanding of the biodegradation process will provide/improve knowledge for optimizing and monitoring bioremediation in oil spills cases and/or to impair the degradation in reservoirs avoiding deterioration of crude oil quality

High wax ester and triacylglycerol biosynthesis potential in coastal sediments of Antarctic and Subantarctic environments

Article

Full-text available

Jul 2023
PLOS ONE

The wax ester (WE) and triacylglycerol (TAG) biosynthetic potential of marine microorganisms is poorly understood at the microbial community level. The goal of this work was to uncover the prevalence and diversity of bacteria with the potential to synthesize these neutral lipids in coastal sediments of two high latitude environments, and to characterize the gene clusters related to this process. Homolog sequences of the key enzyme, the wax ester synthase/acyl-CoA:diacylglycerol acyltransferase (WS/DGAT) were retrieved from 13 metagenomes, including subtidal and intertidal sediments of a Subantarctic environment (Ushuaia Bay, Argentina), and subtidal sediments of an Antarctic environment (Potter Cove, Antarctica). The abundance of WS/DGAT homolog sequences in the sediment metagenomes was 1.23 ± 0.42 times the abundance of 12 single-copy genes encoding ribosomal proteins, higher than in seawater (0.13 ± 0.31 times in 338 metagenomes). Homolog sequences were highly diverse, and were assigned to the Pseudomonadota, Actinomycetota, Bacteroidota and Acidobacteriota phyla. The genomic context of WS/DGAT homologs included sequences related to WE and TAG biosynthesis pathways, as well as to other related pathways such as fatty-acid metabolism, suggesting carbon recycling might drive the flux to neutral lipid synthesis. These results indicate the presence of abundant and taxonomically diverse bacterial populations with the potential to synthesize lipid storage compounds in marine sediments, relating this metabolic process to bacterial survival.

Bacterial Microbiota and Soil Fertility of Crocus sativus L. Rhizosphere in the Presence and Absence of Fusarium spp

Article

Full-text available

Nov 2022

Intensive agricultural practices have led to intense soil degradation and soil fertility losses. Many soil-borne diseases affect these intensive agricultural soils, worsening the physical-chemical and fertility imbalances. Among the numerous pathogens, the genus Fusarium includes members that destroy many crops, including Crocus sativus L., which also impairs the composition and functions of the microbial communities. This work aimed to investigate, for the first time, the bacterial communities of the rhizosphere of saffron in the presence and absence of fusariosis. The rhizosphere of the saffron fields in the territory of L’Aquila (Italy) with and without fusariosis was sampled and subjected to a microbiological analysis. Culture-dependent methods characterized the fusariosis. The dehydrogenase activity assay was estimated. The metabarcoding of the 16S rRNA gene, a metagenome functioning prediction, and a network analysis were also carried out. The results showed that fusariosis, when it is linked to intensive agricultural practices, causes alterations in the microbial communities of the rhizosphere. The culture-dependent and independent approaches have shown changes in the bacterial community in the presence of fusariosis, with functional and enzymatic imbalances. The samples showed a prevalence of uncultured and unknown taxa. Most of the known Amplicon Sequence Variants (ASVs) were associated with the Pseudomonadoa (syn. Proteobacteria) lineage. The composition and richness of this phylum were significantly altered by the presence of Fusarium. Moreover, pathogenesis appeared to improve the ASVs interconnections. The metagenome functions were also modified in the presence of fusariosis.

Microbial metabolic routes in metagenome assembled genomes are mirrored by the mass balance of polycyclic aromatic hydrocarbons in a high altitude lake

Article

Jun 2022
ENVIRON POLLUT

Semivolatile organic pollutants have potential for long range atmospheric transport and can thus reach pristine remote lakes by atmospheric deposition. Polycyclic aromatic hydrocarbons (PAHs) are among the most abundant and toxic semivolatile pollutants affecting lakes, however, the main factors controlling their fate are still poorly known. Here we show two contrasting lines of evidence for the importance of microbial degradation on the environmental fate of PAHs in a high altitude deep lake. The first evidence is given by an assessment of the metagenomes from surface and deep waters from Lake Redon (Pyrenees Mountains), which shows the occurrence of the initial ring hydroxylating dioxygenases as well as other PAH degrading genes from the complete metabolic route of PAH degradation. The second line of evidence is by the application of an environmental fate model for PAHs to Lake Redon under two contrasting scenarios considering the inclusion or not of degradation. When degradation is included in the model, PAH concentrations in the sediment are predicted within a factor of two of those measured in Lake Redon. Finally, the extent of the degradation sink is quantified and compared to other cycling PAH fluxes in the lake.

Difference in the rhizosphere microbiome of Melia azedarach during removal of benzo(a)pyrene from cadmium co-contaminated soil

Article

May 2020
CHEMOSPHERE

Benzo(a)pyrene (BaP) is a highly persistent biohazard polyaromatic hydrocarbon and often reported to be present in soils co-contaminated with heavy metals. The present study explains the rhizodegradation of BaP using bacterial consortium in the rhizosphere of Melia azedarach, along with a change in taxonomical and functional properties of the rhizosphere microbiome. The relative abundance of most dominant phylum Proteobacteria was 2% higher with BaP, while in the presence of both BaP and Cd, its abundance was 2.2% lower. Functional metagenome analysis also revealed the shifting of microbial community and functional gene abundance in the favor of xenobiotic compound degradation upon augmentation of bacterial consortium. Interestingly, upon the addition of BaP the range of functional abundance for genes of PAH degradation (0.165–0.19%), was found to be decreasing. However, augmentation of a bacterial consortium led to an increase in its abundance including genes for degradation of benzoate (0.55–0.64%), toluene (0.2–0.22%), naphthalene (0.25–0.295%) irrespective of the addition of BaP and Cd. Moreover, under greenhouse condition, the application of M. azedarach-bacterial consortium enhanced the degradation of BaP in the rhizosphere (88%) after 60 days, significantly higher than degradation in bulk soil (68.22%). The analysis also showed an increase in degradation of BaP by 15% with plant-native microbe association than in bulk soil. Therefore, the association of M. azedarach-bacterial consortium enhanced the degradation of BaP in soil along with the taxonomical and functional attributes of the rhizosphere microbiome.

Challenges of unculturable bacteria: environmental perspectives

Article

Full-text available

Mar 2020
Rev Environ Sci Biotechnol

Environmental biotechnology offers several promising techniques for the rehabilitation of polluted environments. The modern industrialized world presents novel challenges to the environmental sciences, requiring a constant development and deepening of knowledge to enable the characterization of novel pollutants and a better understanding of the bioremediation strategies as well as their limiting factors. The success of bioremediation depends heavily on the survival and activities of indigenous microbial communities and their interaction with introduced microorganisms. The majority of natural microbiomes remain uncultivated; therefore, further investigations focusing on their intrinsic functions in ecosystems are needed. In this review, we aimed to provide (a) a comprehensive overview of the presence of viable but nonculturable bacteria and yet-to-be-cultivated cells in nature and their diverse awakening strategies in response to, among other factors, signalling extracellular metabolites (autoinducers, resuscitation promoting factors, and siderophores); (b) an outline of the trends in isolating unculturable bacteria; and (c) the potential applications of these hidden players in rehabilitation processes.

Review on biochar as a sustainable green resource for the rehabilitation of petroleum hydrocarbon-contaminated soil

Article

Jun 2024
SCI TOTAL ENVIRON

Metagenomic insight on consortium degradation of soil weathered petroleum and its supplement based on gene abundance change

Article

Jun 2023
ENZYME MICROB TECH

Petroleum biodegradation is of importance for the mitigation of secondary pollutants from soil chemical remediation. Describing the gene abundance change of the petroleum degradation emerged as an important practice for success. In this study, an indigenous consortium with targeting-enzyme was utilized to develop a degradative system that was later subjected to metagenomic analysis on the soil microbial community. Centering on ko00625 pathway, abundance change of dehydrogenase gene was firstly found increasing from groups D, DS to DC in turn, just in an opposite direction with that of oxygenase. In addition, gene abundance of responsive mechanism went rising with degradative process as well. This finding sufficiently promoted that equal attention should be paid to both degradative and responsive processes. Hydrogen donor system was innovatively built on the consortium-used soil to satisfy the demand of dehydrogenase gene tendency and to sustain further petroleum degradation. Anaerobic pine-needle soil was supplemented to this system, bi-functionally serving as dehydrogenase substrate with nutrients and hydrogen donor. In doing so, two successive degradations optimally achieved the total removal rate 75.6-78.7% for petroleum hydrocarbon. The conception on the gene abundance changes and its corresponding supplement helps industries of concern to develop geno-tag guided framework.

Diversity of GH51 α-L-arabinofuranosidase homolog sequences from subantarctic intertidal sediments

Article

Mar 2023
BIOLOGIA

Bacteria from coastal habitats exposed to challenging environmental conditions constitute a promising source of enzymes with novel catalytic properties for the depolymerization of complex carbohydrates of terrestrial and marine origins. In this work, we investigated the sequence and structural diversity of putative enzymes related to the glycoside hydrolase family 51 (GH51) identified in a metagenomic dataset of intertidal sediments from a subantarctic environment. The majority of the characterized members of the GH51 family are α-L-arabinofuranosidases (EC 3.2.1.55), enzymes with important industrial applications that catalyze the hydrolysis of side chains from arabinose-substituted polysaccharides. The 28 sequences identified in the metagenome were highly diverse and were assigned to the Bacteroidota, Planctomycetota, Chloroflexota, Pseudomonadota, and Kiritimatiellaeota phyla, with four sequences remaining unassigned. In a sequence similarity network, most GH51 homolog sequences clustered with uncharacterized members of the GH51 family or were highly divergent. Three-dimensional models of the putative enzymes showed distinctive structural characteristics, including a highly variable length of the loop located between β-strand 2 and α-helix 2 and the absence in some of the sequences of a highly conserved Trp residue in this loop. Important differences in the predicted surface electrostatic potential in models of closely related GH51 homologs suggest various levels of adaptation to the prevailing environmental conditions. This work provides an insight into the characteristics of putative enzymes related to the GH51 family from intertidal sediment bacteria, from taxa that are relevant in the marine environment but remain poorly characterized due to the difficulties in their cultivation.

Association of plants and microorganisms for degradation of polycyclic aromatic hydrocarbons

Chapter

Jan 2022

Polycyclic aromatic hydrocarbons (PAHs) are widespread persistent contaminants that enter the environment from both natural and anthropogenic sources. The principal role of PAHs in environmental degradation is played by biological systems. The most important among these are plants and microorganisms, which have a flexible metabolism and unique mechanisms of pollutant detoxification. This review discusses the uptake, translocation, accumulation, and biochemical transformation of PAHs in plants, PAH effects on rhizosphere microbial communities, and pathways for the microbial degradation of these compounds. Special attention is given to plant growth promoting rhizobacteria, which are closely associated with plants, and to plant microbial cooperation for the biodegradation of PAHs. The review concludes with a discussion of the microbe-assisted phytoremediation of PAHs.

Complete Genome Sequence of a Novel Bacterium within the Family Rhodocyclaceae That Degrades Polycyclic Aromatic Hydrocarbons

Article

Full-text available

Apr 2015

A polycyclic aromatic hydrocarbon-degrading bacterium designated strain Ca6, a member of the family Rhodocyclaceae and a representative of the uncharacterized pyrene group 1 (PG1), was isolated and its genome sequenced. The presence of several genes suspected to be associated with PG1 was confirmed, and additional genes for aromatic compound metabolism were detected.

Preliminary Basis for an Integrated Management Program for the Coastal Zone of Argentina

Article

Full-text available

Jan 2003
COAST MANAGE

The continental coastal zone of Argentina can be differentiated by environmental, biological, socioeconomic, and historical characteristics in four distinct regions. The Great Fluvial Region, 3725 km long, shows richness of natural resources and has a developing economy based on forestry and agriculture. The La Plata River Region, with 392 km of waterfront, is the most densely populated, urbanized, industrialized area in the country, and it also exhibits high levels of environmental degradation. The Pampean and Patagonian Regions have a 4725 km litoral. They hold important fishery stocks, the largest of which is currently overexploited. Tourism demand has caused urban landscape to progress in the Pampa coast during the last three decades. In Patagonia, most of the natural resources are well preserved but the territorial and economic integration is still delayed. Despite the environmental and socioeconomic differences among the four regions, there is however a common set of problems which, to a greater or lesser extent, affect them all: a) privatization of the public domain; b) inadequate urban planning of coastal zone; c) industrial and urban pollution; d) coastal erosion, linked to inadequate coastal management practices; e) overexploitation of natural resources; f) loss and fragmentation of natural habitats leading to the loss of biodiversity; g) increased coastal vulnerability. According to this diagnosis, coordinated specific, long term actions should be promoted. Even when Argentina has a wide range of environmental legislation, it lacks a single tool or instrument specifically designed for coastal management. Most of the regulations and administrative requirements applied to the current coastal zone management are general normatives, and thus diffuse or hardly suitable for specific situations. We propose to attain consensus about a minimal preliminary basis in order to develop a national integrated management coastal program. Some of the issues are: design of specific governmental policies; creation of a specific institutional organization; long term funding for the program; promotion of interinstitutional coordination and public participation in the decison-making process; development of specific research, education, training and information generation; and promotion of international cooperation aimed at sharing experiences in coastal zone management.

Applications of aromatic hydrocarbon dioxygenases

Chapter

Jan 2006

Aromatic hydrocarbon dioxygenases refer specifically to enzymes that catalyze the oxidation of the aromatic ring of aromatic hydrocarbons, compounds containing only carbon and hydrogen. This group of enzymes represents an important subset of a large family of “aromatic-ring-hydroxylating dioxygenases” or “Rieske nonheme iron oxygenases” as they have been variously designated, all with similar mechanism and structure [1,2]. Aromatic-ringhydroxylating dioxygenases initiate bacterial pathways for the degradation of a wide range of aromatic compounds, including polycyclic aromatic hydrocarbons, nitroaromatic and chlorinated aromatic compounds, aromatic acids, and heterocyclic aromatic compounds. Toluene dioxygenase (TDO) from Pseudomonas putida F1 was the first characterized aromatic hydrocarbon dioxygenase. Identified by Gibson and coworkers, TDO [3,4] was shown to catalyze cis-dihydroxylation of benzene and toluene [5-7]. Our understanding of the structure, function, and substrate specificity of aromatic hydrocarbon dioxygenases has come from the studies ofTDO and naphthalene dioxygenase (NDO). To date, more than 100 Rieske nonheme iron oxygenases have been identified on the basis of biological activity or nucleotide sequence identity. These multicomponent enzyme systems are cofactor requiring proteins (EC 1.14.12.-) that catalyze the addition of molecular oxygen to the aromatic ring through reductive dihydroxylation. The initial oxidation of the aromatic ring is the most difficult step in the degradation of this class of compounds. This addition of hydroxyl groups to the highly stable aromatic ring activates the molecule for further oxidation and eventual ring cleavage. Aromatic-ring-hydroxylating dioxygenases are unrelated in both structure and function to aromatic-ring-cleavage (or ring-fission) dioxygenases (EC 1.13.11.-) that oxidize and cleave the catecholic intermediates produced during the catabolism of aromatic compounds.

Pfam: the protein families database

Article

Jan 2013

KEGG: Kyoto encyclopedia of genes and genomes

Article

Jan 2006
ARTIF INTELL

The Pfam protein families database

Article

Jan 2010

Quantification strategies in real-time PCR

Article

Jan 2004

M.W. Pfaffl

In Situ Biotransformation of Contaminants in Sediments

Chapter

Apr 2014

Challenges to sediment remediation include not only the sheer scope of contamination but also technical limitations and escalating costs associated with cleanup. The development of in situ sediment remediation technologies, mirroring the development of successful in situ groundwater remediation approaches, has recently been identified as a priority research need (SERDP and ESTCP, 2004) and could result in treatments that are more effective compared to traditional methods. Implementation of technically feasible and cost-efficient in situ remediation approaches, such as in situ biotransformation, provides numerous potential advantages which could contribute to successful contaminated sediment management. Most notably, in situ biotransformation can directly reduce contaminant concentrations and/or toxicity. When occurring naturally, in situ biotransformations could serve as a key component for management strategies based on monitored natural recovery (MNR) and could potentially be incorporated into capping and combined remedy designs. In other scenarios, engineering may be required to stimulate particular microbial populations and/or manipulate environmental conditions to optimize biotransformation (and biodegradation) activity.

Advancements in Molecular Techniques and Applications in Environmental Engineering

Article

Oct 2012

Molecular biological tools continue to be well suited to the challenges and complexity of research focused on the natural and engineered environments. These methods are being applied to an increasing range of efforts in environmental engineering research and practice for an improved understanding of important biological processes. While real-time quantitative PCR (qPCR) has become a staple analytical technique in the molecular toolbox, other nucleic acid-based techniques are gaining popularity. Microbial community analysis has seen an increasing impact in the literature in part due to the diverse array of analytical techniques that are able to provide information on structural changes including catalyzed reporter deposition fluorescence in situ hybridization (CARD-FISH), microarrays, denaturing gradient gel electrophoresis (DGGE), terminal restriction fragment length polymorphism (T-RFLP) and next generation sequencing technologies. Novel biosensors that integrate molecular analysis are being developed to rapidly detect and quantify microorganisms, estrogenic compounds and other targets of interest. The advent of advanced molecular analyses has resulted in an exponential rise in genomic, transcriptomic, and metabolomic data. Hence, methods involving quality control are gaining popularity as the concern for rigorous standards in molecular data collection and analysis keeps pace with demand. This review will provide environmental engineers and microbiologists an overview of important advancements in molecular techniques and highlight the application of these methods in diverse environments.

Soil Biology

Chapter

Jan 2004

Since the initial discovery of toluene dioxygenase (TDO) by David Gibson and coworkers (Yeh et al. 1977; Subramanian et al. 1979), aromatic hydrocarbon dioxygenases have been reported to catalyze the initial reaction in the bacterial biodegradation of a diverse array of aromatic and polyaromatic hydrocarbons, aromatic acids, chlorinated aromatic, and heterocyclic aromatic compounds. To date, more than 100 aromatic compound dioxygenases have been described in the literature based on biological activity or nucleotide sequence identity. These enzymes are cofactor-requiring multicomponent heteromultimeric proteins (EC 1.14.12) that catalyze the initial activation through reductive dihydroxylation of their substrates, and are distinct from aromatic ring-cleavage (or ring-fission) dioxygenases (EC 1.13.11), which act on the catechol intermediates in many of the same catabolic pathways. This chapter will focus primarily on the aromatic ringhydroxylating dioxygenases (Rieske non-heme iron dioxygenases; EC 1.14.12), which initiate an attack on aromatic hydrocarbons, heterocycles and related compounds carrying various substituents (Cl, NO2). The aspects described will relate to dioxygenase discovery, classification, enzymology, structure, electron transport, mechanism and applications.

Metagenomics reveals the high PAH-degradation potential of abundant uncultured bacteria from chronically-polluted subantarctic and temperate coastal marine environments

Abstract and Figures

Recommended publications

Substrate specificities of aromatic ring-hydroxylating oxygenases of an uncultured gammaproteobacter...

Molecular Biological Tools for the Assessment of Hydrocarbon-Degrading Potential in Coastal Environm...

Abundance, Dynamics, and Biogeographic Distribution of Seven Polycyclic Aromatic Hydrocarbon Dioxyge...

Alkane Biodegradation Genes from Chronically Polluted Subantarctic Coastal Sediments and Their Shift...