Content uploaded by Harini Aiyer
Author content
All content in this area was uploaded by Harini Aiyer on May 16, 2014
Content may be subject to copyright.
Berries and Ellagic Acid Prevent Estrogen-Induced Mammary
Tumorigenesis by Modulating Enzymes of Estrogen Metabolism
Harini S. Aiyer1 and Ramesh C. Gupta1,2,3
1James Graham Brown Cancer Center, University of Louisville, Louisville, KY 40202.
2Department of Pharmacology & Toxicology, University of Louisville, Louisville, KY 40202.
Abstract
In order to determine whether dietary berries and ellagic acid prevent 17β estradiol (E2) -induced
mammary tumors by altering estrogen metabolism, we randomized ACI rats (n=6/group) into 5
groups − sham implant + control diet (SH-CD), E2 − implant + control diet (E2-CD), E2+2.5% black
raspberry (E2-BRB); E2+2.5% blueberry (E2-BB) and E2+ 400ppm ellagic acid (E2-EA). Animals
were euthanized at early (6wk), intermediate (18wk) and late (24wk) phases of E2-carcinogenesis
and the mammary tissue analyzed for gene-expression changes using quantitative real-time PCR. At
6 weeks, E2-treatment caused 48-fold increase in cytochrome P4501A1(CYP1A1) (p<0.0001), which
was attenuated by both BRB and BB diets to 12- and 21-fold, respectively (p<0.001). E2 did not alter
CYP1B1 levels, but both berry and EA diets significantly suppressed it by 11- and 3.5-fold,
respectively from baseline (p<0.05). There was a 5-fold increase in 17β-Hydroxysteroid
dehyrdogenase(17βHSD7) and this was moderately abrogated to about 2-fold by all supplementation
(p<0.05). At 18 weeks, CYP1A1 was elevated by 15-fold in E2-CD and only E2-BB reduced this
increase to 7-fold (p<0.05). Catechol-O-methyl transferase(COMT) expression was elevated 2-fold
by E2-treatment (p<0.05) and all supplementation reversed this. At 24 weeks, CYP1A1 expression
was less pronounced, but still high (8-fold) in E2-treated rats. This increase was reduced to 3.2 and
4.6-fold, by E2-BRB and E2-EA, respectively (p<0.05), but not by E2-BB. Supplementation did not
alter the effect of E2 on steroid receptors. The diets also significantly suppressed mammary tumor
incidence (10–30%), volume (41–67%) and multiplicity (38 to 51%) (p<0.05). Berries may prevent
mammary tumors by suppressing the levels of E2-metabolizing enzymes during the early phase of
E2-carcinogenesis.
Keywords
Estrogen; ACI rats; berries; polyphenols; breast cancer prevention; CYP450
INTRODUCTION
Breast cancer is the most diagnosed cancer among women in the United States and currently
costs the American economy $85 billion in terms of value of life lost due to cancer mortality
(1). The primary factors that determine mortality rate such as age, stage at diagnosis and race/
ethnicity are interlinked with another integral risk factor for breast cancer development –
female reproductive hormone - 17β-estradiol (E2) (2). Understanding the mechanism and
prevention of E2-induced breast cancer can lead to considerable long-term gains in both value
3To whom all correspondence should be addressed at: Ramesh Gupta, Brown Cancer Center, Delia Baxter II, Room 304E, 580 Preston
Street, Louisville, KY 40202. Phone: 502-852-3682; Fax: 502-852-3662; rcgupta@louisville.edu.
Disclosure: Authors have no potential conflicts of interest.
NIH Public Access
Author Manuscript
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
Published in final edited form as:
Cancer Prev Res (Phila). 2010 June ; 3(6): 727–737. doi:10.1158/1940-6207.CAPR-09-0260.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
of life for women as well as reduced health care costs in the US. E2 is a known, yet unavoidable
risk factor for breast cancer. Women chronically exposed to even physiological levels of this
hormone can be at an increased risk to develop breast cancer (3).
Research suggests that in-situ synthesis of estradiol may play a major role in the development
of breast cancer, especially in post-menopausal women (4). Primary enzymes involved in de-
novo estradiol synthesis are aromatase, which converts androgen precursors to estrone, and
17β-hydroxysteroid dehydrogenase (17βHSD), which converts estrone (E1) to estradiol (E2)
(5–6). Eight isozymes of 17βHSD have been identified so far (7). The type 1 isozyme of
17βHSD, which converts estrone to estradiol, is found in both normal and malignant breast
(8). The rodent homologue of this enzyme is 17βHSD, type 7 (17HSD7), also known as the
prolactin receptor associated protein (PRAP) (8–9). This enzyme has high specificity for the
conversion of E1 to E2 and is controlled by both prolactin and estrogen signaling pathways
(9).
There are several phase I and phase II enzymes involved in the metabolism of E2, of particular
importance in the breast are cytochrome P450 1A1 (CYP1A1), CYP1B1, catechol-O-methyl
transeferase (COMT), UDP-glucuronosyl transferase (UGT) and glutathione-S-transferase
(GST). The phase I enzyme, CYP1B1 has received wide attention due to its function in
converting E2 to 4-hyrdroxy estradiol (4E2), a postulated potentially carcinogenic metabolite
(10). Also, breast tumors show high levels of both CYP1B1 and 4E2 (11–12). Nevertheless,
metabolites of CYP1A1 action such as 2-hydroxy estrone can produce stable DNA adducts
and inhibition of CYP1A1 metabolism reduces the formation of estrogen-induced kidney
tumors in hamsters, suggesting that this pathway may also play a definitive role in estrogen
carcinogenesis (13). The hydroxy-metabolites of estradiol and estrone are conjugated for
removal by several enzymes, including COMT, GST and UGT (14–15). The 2-hydroxy
metabolites are better substrates for COMT (10), suggesting that CYP1A1 and COMT
expression may be coupled. Polymorphisms in both phase I and II genes have been associated
with a risk of breast cancer, indicating the importance of these enzymes in the production and
removal of estradiol metabolites (4,16). The estrogen metabolism pathway interacts with the
estrogen-signaling pathway. Hydroxy-metabolites of estradiol such as 4E2 and 2E2 bind to ERs
with varying affinities (17). Progesterone receptor (PGR) is known to be up-regulated by
estrogen via ER signaling, hence PGR expression is a downstream effect of ER activation
(18). Thus, studying the expression of these genes provides some idea about control of estrogen
metabolism in the mammary tissue.
Berries are an integral part of the Western cuisine and are also used in several other cuisines
around the world. Blueberries and black raspberries have been commercially cultivated in the
United States since the late 19th and early 20th century. They are also excellent sources of many
vitamins, minerals and cancer-preventing phytochemicals such as anthocyanins and ellagic
acid (19). These berries vary significantly in both their phytochemical content and composition.
Typically, black raspberry, which contains cyanidin as the primary anthocyanin component is
a richer source of ellagic acid than blueberry, while a poor source of ellagic acid contains 5
different anthocyanin pigments (20–21). Both berries are high in antioxidant capacity and have
shown cancer preventative effects (22–23). We have previously shown that dietary berries
(2.5% w/w) and ellagic acid (400 ppm) can significantly inhibit the growth of E2-induced
mammary tumors in ACI rats (24). Berries also prevented the pituitary associated mortality
(24) and reduced E2-induced hepatic DNA adducts (25). However, the exact mechanisms by
which they provide protection are not known. Berry phytochemicals such as anthocyanins and
ellagic acid (and its metabolites urolithins A and B) show selective estrogen receptor
modulating (SERM) activity in some studies (26–27). These phytochemicals are can be
absorbed into the systemic circulation in both humans and rodents and can be detected after
ingestion at various levels (28–30). Thus, they may play a role in modulating estrogen
Aiyer and Gupta Page 2
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
metabolism in organs other than the gut, which was previously thought to be the primary target
organ.
In order to determine whether berries and ellagic acid affect estrogen metabolism, we examined
the regulation of gene expression of key enzymes involved in estrogen metabolism and
signaling, in the mammary tissue during the course of mammary tumorigenesis. Three time
points – early (6 weeks), intermediate (18 weeks) and late (24 weeks) were chosen and the
expression of 9 selective genes, 3 each involved in the phase I , phase II metabolism and
estrogen signaling were selected and their relative gene expression changes analyzed using
quantitative real-time polymerase chain reaction (qRTPCR). The genes tested were: phase I
metabolism- 17βHSD7, CYP1A1, CYP1B1; phase II- COMT, GSTA1, GSTM1; steroid
signaling – ERα, ERβ, PGR.
In a separate study we also studied the effects of 2 doses- 1% w/w and 2.5% w/w, of blueberry
and black raspberry- in an ACI rat model in which mammary tumors are induced by a lower
dose of E2 (9 mg) that significantly eliminates pituitary hyperplasia-induced mortality. Ellagic
acid dose was maintained at 400 ppm similar to the previous study to provide a reference point
(24). We measured the effect of dietary berries and ellagic acid on tumor incidence, latency,
volume and multiplicity to prove that berries are consistently effective in prevention of
estrogen-induced mammary tumors.
MATERIALS AND METHODS
Animals and treatment
Female ACI rats (7–8 weeks old) were purchased from Harlan-Sprague Dawley (Indianapolis,
IN), housed under ambient conditions and fed AIN-93M diet and water ad libitum. After a
week of acclimation, 18 animals each were randomized into 5 groups. Two of the 5 groups
received control diet and the other 3 received diets supplemented with 2.5% (w/w) dehydrated
powdered blueberry; 2.5% (w/w) freeze-dried black raspberry or 400 ppm ellagic acid. The
sources, preparation and caloric contents of these diets have been previously described in detail
(24). After 2 weeks of pre-feeding, each group received either sham implants or implants
containing 27 mg E2 as described (24). The animals were maintained on their respective diets
throughout the study period and 6 animals from each group were euthanized at 6, 18 and 24
weeks after E2 treatment by carbon dioxide asphyxiation, and mammary tissue was collected
and frozen for further analysis.
In a separate second study, female ACI rats (5–6 weeks old) were randomized into different
groups (Table 2) and fed experimental diets for 2 weeks. Animals then received either a 1.2-
cm silastic implant containing 9 mg 17β-estradiol as described (31) or sham implants and
maintained on respective diets throughout the study. All diets were ordered from Harlan-
Teklad, Inc. (Madison, WI). The AIN-93M diet was supplemented with powdered berries (1%
or 2.5% w/w) or ellagic acid (400 ppm) and prepared as described earlier (24). Animals were
weighed biweekly to track weight changes and disease progression. Mammary gland from this
study was not used for RNA analysis.
RNA isolation, reverse transcription and quantitative real time polymerase chain reaction
(qRTPCR)
RNA from whole mammary tissue was isolated using the Trizol® method (Invitrogen,
Carlsbad, CA), with modifications. Briefly, mammary tissue was suspended in Trizol® at 4°
C and homogenized with a hand-held polytron at maximum speed. This homogenate was then
passed through a syringe with a 22.5 gauge needle to ensure complete dissociation of the
mammary tissue. The resultant tissue homogenate was sequentially extracted with chloroform
Aiyer and Gupta Page 3
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
and the aqueous phase was precipitated using ice-cold iso-propanol. The quality of the RNA
was ascertained by gel electrophoresis and quantitated using NanoDrop® (NanoDrop
Technologies, Wilmington, DE). One hundred ng of RNA was reverse transcribed using the
high capacity cDNA archive kit (Applied Biosystems, CA) and 3 ng of cDNA equivalent was
used for PCR. These conditions were standardized to achieve consistent and reproducible
results.
Primers for qRTPCR were designed across exon boundary to avoid amplification of genomic
DNA, using Primer express® 3.0 software (Applied Biosystems, Foster City, CA) and
synthesized by Integrated DNA Technologies, Inc., (Coralville, IA). The sequences of the
forward and reverse primers for each gene tested are listed in Table 1. The PCR amplification
was done using Power SYBR® Green PCR master mix (Applied Biosystems, CA) and 500nM
of forward and reverse primers for each gene except CYP1A1 for which the final primer
concentration was 125 nM each. Quantitative PCR was performed using a 7500 Fast-Real Time
PCR system (Applied biosystems, Foster City, CA). The PCR conditions were: 50°C for 2
min; DNA polymerase activation at 95°C for 10 min; followed by 40 cycles at 95°C for 15 sec
and 60°C for 1 min. All gene analyses were performed at least three times.
Analysis of gene expression
Gene expression analysis was done using the relative-quantification (ΔΔcT) method as
described (32). Each sample (refers to cDNA from individual animals) was analyzed in
triplicate for each gene tested. ΔcT was calculated as the difference between cT of gene of
interest (GOI) and the house-keeping gene (β-actin) (ΔcT = cTGOI – cTβ-actin). One sample
(sham treated) was chosen as the calibrator and ΔΔcT of all other samples was calculated using
the formula ΔcT = ΔcTsample - ΔcTcalibrator. A different calibrator sample (typically a sample
from the sham treated group) was chosen for the different time points (6, 18 and 24 wk) and
fold change (2−ΔΔcT) in gene expression was calculated for all genes. The results are
represented as relative fold change, which is the average fold change among the biological
replicates (n=6/group) and represents the biological variation within a specific group.
Assessment of tumor indices for tumor study
In the second study, starting at 12 weeks after estrogen implantation, animals were palpated
weekly for tumor appearance. The frequency of palpation was increased to twice a week, upon
appearance of the first tumor, to record tumor latency and incidence. Tumor incidence was
calculated using the formula: Percentage tumor incidence = (number of tumor bearing animals/
total number of animals per group) X100. The tumor incidence was considered 100% when
all animals in a group had palpable tumors. The time between E2-implants and the appearance
of the first palpable tumor in any animal in a particular group was considered as the tumor
latency for that group.
After 32 weeks of estrogen treatment, animals were euthanized and each animal was examined
grossly for the presence of mammary tumors. Tumor volume was calculated as described
(24). Liver, pituitary and mammary glands were harvested and weighed. Representative tumors
from each animal were analyzed by histopathology to confirm that they were mammary
adenocarcinomas. All animal protocols were approved by the Institutional Animal Care and
Use Committee (IACUC) at the University of Louisville.
Statistical analysis
Relative fold changes of gene expression in each group and tumor volumes were compared
using one-way analysis of variance (ANOVA), followed by a Tukey’s multiple comparison
post test. The difference in tumor incidence was assessed using the non-parametric log-rank
test. All statistical analyses were performed using the Graphpad Prism ® software (Graphpad
Aiyer and Gupta Page 4
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Software, San Diego, CA) except for tumor multiplicity, which was compared in SAS version
8, using the Poisson Regression Model (SAS procedure PROC GENMOD). A p-value <0.05
was considered significant in all cases. The data are presented as mean ± SE.
RESULTS
Two animal studies with slightly varying protocols are presented in this section. The first, ACI
rats implanted with 27 mg E2-implants and euthanized at various time points (early,
intermediate and late) during the course of carcinogenesis. In this model, as published, all
animals develop 100% mammary gland tumors by 24 weeks after implantation. Dietary berries
and ellagic acid were very effective in reducing the tumor volume and multiplicity in the order
2.5 % black raspberry > 400 ppm ellagic acid > 2.5% blueberry (24). However, a considerable
shortcoming of this model has been its tendency to develop debilitating pituitary hyperplasia,
as a response to the high E2 dose, leading to significant morbidity and mortality (24,31,33).
Several steps have been taken to correct this. Other investigators have taken a genomic
approach and have developed a new strain of inbred rats that respond with reduced pituitary
lactotroph hyperplasia upon treatment with E2 (34–36). Prior to this, we took a pharmacological
approach by reducing the E2 dosage and showed that mammary tumors can be induced with 9
mg E2, instead of 27 mg previously used, at a longer duration (32 instead of 24 weeks) with
essentially no mortality (31). This model with the reduced E2 dose allows us to study the effects
of different chemopreventive agents without the confounding mortality present in the previous
model. The effect of dietary berries, even at doses lower (1%) than previously used (2.5%), on
mammary tumor indices are presented here. Although 2 different protocols are presented, the
assumption is that the basic mechanism of E2-carcinogenesis is similar in both.
Dietary berries but not ellagic acid significantly reverse the E2-induced increase in CYP1A1
expression
In the early phases of treatment (6 weeks), the strongest increase in expression after E2-
treatment occurred for CYP1A1. Compared to sham, E2-treatment caused a 48-fold induction
in CYP1A1 expression (0.75 ± 0.09 vs 36.7 ± 5.5; p< 0.0001; Figure 1A). This increase was
significantly countered by both BB (16.3 ± 2.5; p<0.001) and BRB (9.2 ±1.8; p<0.001), but
not by ellagic acid (42.7 ± 5.7). The effect of E2 on CYP1A1 induction was somewhat blunted
at 18 weeks to only 15-fold of sham levels (0.98 ± 0.2 vs 14.4 ± 2.5; p< 0.01; Figure 1B). BB
diet continued to counter this increase during the intermediate phase (6.8 ±0.7), whereas BRB
(16.1 ± 2.3) and ellagic acid (17.5 ± 2.7) did not show any effect. However, this trend was
reversed during the late phase (24 weeks). Although E2 increased CYP1A1 by only 8-fold
compared to sham (0.9 ± 0.1 vs 7.3 ± 1.2; P <0.05; Figure 1C), both BRB (2.9 ± 0.4; p <0.05)
and EA (4.2 ± 0.6) reduced this increase. BB diet showed only slight but insignificant reduction
(Figure 1C). In summary, E2 significantly boosts the levels of CYP1A1 mRNA during the
early, middle and late phases of E2-carcinogenesis with the effect plateauing over the time
course. Blueberry is highly effective during the early and intermediate phase, black raspberry
during early and late phase and ellagic acid only during the late phase in countering this E2-
induced increase.
Both dietary berries and ellagic acid significantly reduce the levels of CYP1B1 during the
early phase of carcinogenesis
The level of CYP1B1 mRNA in the whole mammary gland was essentially unaltered after 6
weeks of E2-treatment (SH-CD: 1.1 ± 0.1 vs E2-CD: 0.6 ± 0.2; not significant; Figure 2A).
However, all supplemented diets significantly reduced the levels of CYP1B1 both from
baseline and E2-treatment. Both BB and BRB had similar effects and lowered CYP1B1 levels
by up to 11-fold from SH-CD (E2-BB: 0.1 ±0.01 and E2-BRB: 0.1 ± 0.01; p <0.01) and 6-fold
from E2-CD. Ellagic acid was less effective and caused a 4-fold decrease compared to baseline
Aiyer and Gupta Page 5
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
(0.3 ± 0.1; p <0.05). During the intermediate and late phases, E2-treatment itself caused a
significant reduction in CYP1B1 levels (Figure 2B, C) and consequently, supplementation did
not have any additional effect on this decrease. All E2-treated groups regardless of the
supplementation had similar CYP1B1 expressions at 18 and 24 weeks (Figure 2B and C).
Dietary berries and ellagic acid counter the E2-induced increase in 17βHSD7 expression at
early phase of carcinogenesis
In the rat mammary, the enzyme 17βHSD7 plays an important role in in situ E2 synthesis, by
converting E1 to E2. At 6 weeks, the expression of this enzyme increased by up to 5-fold after
E2-treatment (0.73 ± 0.2 vs 3.5 ± 0.4; p<0.01; Figure 3A). This increase was returned close to
baseline levels effectively by all dietary supplementation- BB (1.3 ± 0.1; p <0.01), BRB (1.6
± 0.2; p <0.01) and EA (1.5 ± 0.4; p<0.01). This initial response to E2 treatment did not persist
during the intermediate and late phases of carcinogenesis (Figure 3B and C). It appears that
E2-induced increase in 17βHSD7 expression is an early phase phenomenon and is countered
effectively by berries and ellagic acid also during the early phase. The expression of another
enzyme involved in in situ E2 synthesis- aromatase- was undetectable in ACI rat mammary
(data not shown).
Rats supplemented with berries and ellagic acid show significantly smaller induction in
COMT levels during the intermediate phase of tumorigenesis
An important enzyme involved in the removal of harmful E2-metabolites is COMT. Unlike
the phase I enzymes, COMT is not induced during the early phase. Instead, there is a 2-fold
increase in COMT expression during the intermediate phase (SH-CD: 2.3 ± 0.4 vs E2-CD: 4.4
± 0.4; p<0.05; Figure 4A). This increase is not seen in any of the supplemented groups (Figure
4A), with BB (2.8 ± 0.1), BRB (2.6 ± 0.1) and EA (1.9 ± 0.3) essentially showing expression
levels close to baseline. Two other phase II enzymes were analyzed- GSTM1, was not altered
by either E2 treatment or by supplementation (Figure 4B), whereas GSTA1 levels were found
to be down-regulated after estrogen treatment by up to 3 fold (p<0.05) with no effect of
intervention (Figure 4C).
Berries or ellagic acid do not alter steroid signaling enzymes in E2-induced mammary tumors
The effect of E2-treatment on classic estrogen receptor (ER) pathway was analyzed by studying
the expression of ERα, ERβ and progesterone receptor (PGR), a downstream gene of ERα
activation. As expected E2-treatment had a remarkable down-regulatory effect on ERα
expression at all time points (Figure 5A). On the other hand it had no effect of ERβ expression
(Figure 5B). PGR levels were significantly elevated at 6 weeks, suggesting activation of classic
ER signaling (Figure 5C). However, this increase was not sustained and fell to moderate levels
during the intermediate phase and was very similar to sham treatment by the end of the study
(Figure 5C).
Effect of berry or ellagic acid supplementation on pituitary wet weight
E2-treatment caused an increase in liver, mammary and pituitary wet weights (Table 2).
Compared to sham-treated animals, the most significant increase was seen in E2-treated
animals on control diet for pituitary weight, with over 7-fold increase (p <0.005). Blueberry
diet at neither dose affected this increase. However, in animals fed black raspberry, both doses
inhibited this E2-induced increase in pituitary wet weight, with 2.5% dose (4-fold > SH-CD;
p<0.05 compared to E2-CD) having a greater effect than 1% dose (6-fold > SH-CD; not
significant). Ellagic acid had the same effect as 1% BRB (6-fold > SH-CD; not significant).
Aiyer and Gupta Page 6
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Diets supplemented with black raspberry, blueberry or ellagic acid significantly reduce
tumor incidence
None of the sham-treated animals had any palpable or gross tumors. In animals fed the control
diet, the first palpable tumor appeared at 18 weeks of E2- treatment (1 of 20 animals; 5%
incidence). There was 50% incidence at just 20 weeks of treatment (10 of 20) and the linear
trend continued until all animals in this group had palpable tumors by 26 weeks of treatment
(Table 2). Although palpable mammary tumors were seen in animals fed 1% blueberry, 1%
and 2.5% black raspberry diets ( 1 of 16; 6.25% for each group; Table 2), the incidence curves
for all intervention groups except 1% blueberry were significantly different from the control
diet (Table 2; log-rank test; p<0.05). Blueberry at 1% did not affect tumor incidence (Table
2). However, at 2.5% it had a highly significant effect and resulted in the lowest tumor incidence
at 26 weeks (11 of 16; 69%; Table 2). Black raspberry at both 1% and 2.5% dose significantly
shifted the tumor incidence curve to the right, resulting in 81% (13 of 16) and 87% (14 of 16)
incidence at 26 weeks, respectively (Table 2). Ellagic acid (400 ppm) also had similar effects
and significantly reduced incidence to 81% at 26 weeks (Table 2). The E2 treatment was
continued until 32 weeks.
Effect of supplemented diets on tumor volume and multiplicity
Tumor indices were measured for each animal and are represented as mean ± SE (Table 2). In
animals fed control diet the tumor volume and multiplicity were 2804 ± 547 mm3 and 11.7 ±
1.4, respectively. Tumor volume was reduced by all interventions, from significant effects of
2.5% berry (59% for BB and 67% for BRB; p< 0.05) and ellagic acid diet (65%; p<0.05) to
marginal effects of 1% berry diets (41% for BB and 44% for BRB). The highest reduction in
tumor multiplicity was achieved by 2.5% BRB (51%; p<0.007), followed by 1% BRB (43%;
p<0.008), ellagic acid (41%; p<0.05) and 2.5% BB (38%; p< 0.05); 1% BB did not affect tumor
multiplicity.
DISCUSSION
The results presented show that one of the main mechanisms by which berries and ellagic acid
inhibit mammary tumors is by decreasing the levels of enzymes that can produce harmful E2
metabolites. Our time course analysis also suggests that this inhibition occurs mostly during
the early phases of carcinogenesis. Further, data from our tumor study show that berries
consistently inhibit E2-induced mammary tumors and black raspberry even at 1% dose shows
significant chemopreventive efficacy.
The current study is the first to show that E2 significantly affects the expression levels of
enzymes that are involved in E2 metabolism in the ACI rat. Previously published reports show
that agents that alter E2 metabolism and reduce oxidative stress can cause a reduction in
mammary tumors in ACI rats (37–38). Further, this is also the first report to show that berries
and ellagic acid significantly reverse the effect of E2 on these enzymes, thus potentially
affecting the levels of harmful E2 metabolites in the ACI rat mammary. Another significant
finding is the analysis of gene expression changes throughout the course of carcinogenesis.
The E2-induced animal model varies vastly from the classic 7,12-dimethyl benzanthrazene
(DMBA)-induced mammary tumor model in that the estrogen treatment is continuous, albeit
in much lower doses. Thus, the conventional model of initiation, promotion and progression
does not apply. However, from the results presented, it appears that most of the detrimental
effects of E2 occur during the early phase and seem to level off during the later phases.
In this study, we show that E2 significantly and consistently elevates CYP1A1 expression to
various levels throughout the carcinogenesis. CYP1A1 is primarily known to catalyze the
conversion of E2 to the less harmful metabolite 2-hydroxy estradiol (2E2). Nevertheless, 15–
Aiyer and Gupta Page 7
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
20% of the E2 metabolite produced by CYP1A1 is 4E2 (10,39). Bhat and coworkers have shown
that E2 treatment causes a higher ratio of 4E2/2E2 in the ACI rat mammary (37). However,
these studies were done using microsomes isolated from whole mammary and these
investigators did not show exactly which enzymes are responsible. It is not clear whether the
significant elevation of CYP1A1 in our study actually leads to increased production of 4E2.
Efforts are currently underway in our laboratory to identify the different metabolites using
mass spectrometry. Future studies are planned to study effect of E2 with and without
supplementation on the levels of various E2 metabolites.
A surprising finding of this study was the effect of E2 on CYP1B1 levels, especially during
the intermediate and late phases. It is well documented that the primary CYP1B1 metabolite
4E2 is more harmful with respect to mammary tumorigenesis (40). To this date only one study
has shown a clear increase in 4E2/2E2 ratio in the ACI rat mammary (37). However, no study
has as yet shown a clear increase in CYP1B1 levels after E2-treatment in ACI rats. E2-treated
mammary largely consists of proliferating cells of epithelial origin, whereas sham-treated
tissue consists of a much higher percentage of stromal cells (31,38). It is reported that CYP1B1
expression is constitutively higher in the rat mammary stroma, whereas CYP1A1 can be
induced by estrogenic agents only in the epithelial cells (42). Thus differences in the cell
composition between sham and treated rats may potentially confound the results as these
analyses were done from total tissue RNA. Thus, the higher CYB1B1 in untreated animals
reflects the constitutive expression in the stromal compartment, whereas CYP1A1 is up-
regulated by estrogen predominantly in epithelial cells and is thus increased by over 40-fold.
Regardless of the effect of E2, berries and ellagic acid significantly reduce the levels of both
CYP1A1 and CYP1B1 expression at 6 weeks. The single most significant finding of this report
is that berries and ellagic acid cause a net reduction in the expression of phase I enzymes
responsible for converting E2 to harmful metabolites, which in turn may lead to a net reduction
in metabolites themselves, especially in the early stages. This is substantiated by the effect of
both berries and ellagic acid on COMT expression at 18 weeks. The significant reduction in
the COMT expression may be due to the constant suppression in the production of catechol-
estrogen metabolites by sustained down-regulation of CYP1A1 and to a lesser extent of
CYP1B1. It remains to be seen if the actual levels of E2 metabolites are lower in animals fed
berry and ellagic acid diets. Ellagic acid does not alter CYP1A1 expression, suggesting that it
differs from other berry phytochemicals (anthocyanins) in its mechanism of action. Previous
reports suggest that ellagic acid does not alter the expression of hepatic CYP1A1, but inhibits
its activity both in vitro and in vivo (43). It has also been shown α-napthoflavone, a CYP-
inhibitor, prevents mammary tumors in ACI rats (37).
Another interesting finding is the up-regulation of 17βHSD7 by estradiol. This enzyme has
high specificity for the conversion of estrone to estradiol in the mammary, suggesting that
estradiol may influence in-situ estrogen synthesis. However, 17HSD7 expression is affected
by both E2 and prolactin in the rat corpus luteum (9,44), and E2 induces pituitary prolactinomas
in this model (33). Thus, E2 either directly influences the expression of 17βHSD7 or this may
be a downstream effect of increased prolactin secretion. This enzyme is involved in the
conversion of estrone to estradiol, however, the expression of aromatase which forms estrone
from androgen precursors, is almost undetectable in the mammary tissue of the ACI rat (data
not shown). Thus the exact role of 17βHSD7 in in-situ E2 synthesis in ACI rat mammary
remains to be demonstrated.
Berries and ellagic acid also down-regulate 17βHSD7, which may further reduce in-situ E2
formation. Also, 17βHSD7 is modulated by prolactin (9). In the current tumor study, we show
that berries and ellagic acid significantly lower pituitary prolactinoma growth as evidenced by
lower pituitary wet weight (Table 2). This finding suggests that berries regulate 17βHSD7
Aiyer and Gupta Page 8
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
expression by possibly altering prolactin levels during the early phase or that they inhibit E2-
induced pituitary proliferation. There is support for the latter since both berries and ellagic acid
significantly reduced pituitary associated mortality in the previous tumor study (24).
In this study, with lower dose E2, we also show that dietary berries reduce tumor incidence,
tumor multiplicity and tumor volume in a dose-dependant manner. Black raspberry (2.5% w/
w) with the highest concentration of both anthocyanins and ellagic acid had the greatest effect
on all three end-points, followed by ellagic acid (400 ppm). The higher dose of blueberry (2.5%)
had effects similar to that of low-dose black raspberry (1%). The lower dose of blueberry (1%)
showed a marginal reduction in tumor volume but no effect on multiplicity or incidence (Table
2). Any confounding effect of caloric restriction on mammary tumor development can be safely
ruled out as no differences were seen in either the weight gain or the feed intake among control
and supplemented diet fed groups (data not shown). Further, the supplemented diets were
shown to be isocaloric to the AIN-93M diet (24). These results are highly consistent with our
previous report in which 2.5% dietary berries or 400ppm ellagic acid significantly diminished
mammary tumors induced by high dose E2 regimen (24) . However, in the current study the
2.5% dose elicits a higher reduction of tumor volume and multiplicity than those observed in
the previous model, suggesting that the toxicity due to the higher E2 dose obscured the
beneficial effects of supplementation.
Another important organ in this framework is the liver. The liver is responsible for the
metabolism of circulating E2 and it has been shown that metabolites of E2 may play a significant
role in mammary tumor development (13,45). Mesia-Vela et al demonstrated that altering the
liver metabolism of E2 significantly affected the mammary tumor development (46). We have
previously published that both dietary berries and ellagic acid significantly inhibit E2-induced
hepatic DNA adducts, showing that berries have a distinctive effect on the liver (25). It remains
to be shown whether berries and berry phytochemicals cause a change of E2 metabolism in the
liver to bring about a change in mammary tumor development.
The differential effects of the two types of berries could be due to their distinctive anthocyanin
profiles and contents. At a comparable dose, blueberry has only 2/3rd the anthocyanin content
and less than 1/20th of the ellagic acid content as that in black raspberry. Further, malvidin and
delphinidin are the major anthocyanidins in blueberry followed by petunidin and peonidin,
whereas black raspberry contains almost exclusively cyanidin (21,47). Ellagic acid, the pure
compound consistently exhibits very similar effects regardless of the E2 dosage. This suggests
that, regardless of the E2-dose used, similar mechanisms are involved in the prevention of E2-
induced mammary tumors by ellagic acid. Even though the calculated levels of ellagic acid are
8-times lower in 2.5% BRB diet (24), both ellagic acid and 2.5% BRB elicited very similar
effects in reducing tumor volume, suggesting that whole-food source is more efficient than a
purified component. This is theory is supported by results from Stoner and colleagues, who
showed that the insoluble fraction of BRB containing just ellagitannins is as effective as either
whole BRB or the anthocyanin-rich fraction in reducing esophageal tumors (48).
In summary, this is the first report to show both the changes in expression of E2-metabolizing
enzymes during the course of E2-carcinogenesis in ACI rats and the effect of dietary berries/
ellagic acid on the same. The changes that occur during the early phase in E2-induced
carcinogenesis are indicative of the efficacy of chemopreventive agents in reducing mammary
tumor indices. CYP1A1 may play an important role in the E2-induced tumorigenesis in the
ACI rats. Dietary berries and ellagic acid cause a net reduction in the expression of phase I
E2 metabolizing enzymes. Black raspberry is so far the most effective in reducing tumor
incidence at 1% and 2.5%. It also has the greatest effect on phase I enzyme reduction at early
phases. Blueberry, which has significantly lower levels of total phenolics than black raspberry,
has much less effect on the enzyme expression, although effect on tumor indices are more
Aiyer and Gupta Page 9
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
comparable suggesting different anthocyandins (e.g., delphinidin) may be acting via alternative
mechanism. Ellagic acid, may act via mechanisms other than modulating CYP1A1 to
significantly deter mammary tumor growth.
Acknowledgments
The authors gratefully acknowledge Dr. Barb Mickelson at Harlan Teklad for her continued technical support and Dr.
Cidambi Srinivasan and Dr.Howard P. Glauert at the University of Kentucky, for performing part of the statistical
analyses using the SAS software. We are also thankful to Dr. Wendy Spencer for the review of this manuscript. This
work was supported by USPHS grant CA-90892, CA-118114 and Agnes Brown Duggan Foundation. Dr. Ramesh
Gupta holds Agnes Brown Duggan Endowed Chair in Oncological Research.
References
1. Yabroff KR, Bradley CJ, Mariotto AB, Brown ML, Feuer EJ. Estimates and projections of value of
life lost from cancer deaths in the United States. J Natl Cancer Inst 2008;100(24):1755–1762.
[PubMed: 19066267]
2. Bernstein L, Ross RK. Endogenous hormones and breast cancer risk. Epidemiol Rev 1993;15(1):48–
65. [PubMed: 8405212]
3. Lippman ME, Krueger KA, Eckert S, Sashegyi A, Walls EL, Jamal S, et al. Indicators of lifetime
estrogen exposure: effect on breast cancer incidence and interaction with raloxifene therapy in the
multiple outcomes of raloxifene evaluation study participants. J Clin Oncol 2001;19(12):3111–3116.
[PubMed: 11408508]
4. Yager JD, Davidson NE. Estrogen carcinogenesis in breast cancer. N Engl J Med 2006;354(3):270–
282. [PubMed: 16421368]
5. Sasano H, Suzuki T, Nakata T, Moriya T. New development in intracrinology of breast carcinoma.
Breast cancer (Tokyo, Japan) 2006;13(2):129–136.
6. Simpson ER. Sources of estrogen and their importance. The Journal of steroid biochemistry and
molecular biology 2003;86(3–5):225–230. [PubMed: 14623515]
7. Luu-The V. Analysis and characteristics of multiple types of human 17beta-hydroxysteroid
dehydrogenase. The Journal of steroid biochemistry and molecular biology 2001;76(1–5):143–151.
[PubMed: 11384872]
8. Miettinen MM, Poutanen MH, Vihko RK. Characterization of estrogen-dependent growth of cultured
MCF-7 human breast-cancer cells expressing 17beta-hydroxysteroid dehydrogenase type 1. Int J
Cancer 1996;68(5):600–604. [PubMed: 8938141]
9. Duan WR, Parmer TG, Albarracin CT, Zhong L, Gibori G. PRAP, a prolactin receptor associated
protein: its gene expression and regulation in the corpus luteum. Endocrinology 1997;138(8):3216–
3221. [PubMed: 9231770]
10. Liehr JG. Is estradiol a genotoxic mutagenic carcinogen? Endocrine reviews 2000;21(1):40–54.
[PubMed: 10696569]
11. McFadyen MC, Breeman S, Payne S, Stirk C, Miller ID, Melvin WT, et al. Immunohistochemical
localization of cytochrome P450 CYP1B1 in breast cancer with monoclonal antibodies specific for
CYP1B1. J Histochem Cytochem 1999;47(11):1457–1464. [PubMed: 10544218]
12. Rogan EG, Badawi AF, Devanesan PD, Meza JL, Edney JA, West WW, et al. Relative imbalances
in estrogen metabolism and conjugation in breast tissue of women with carcinoma: potential
biomarkers of susceptibility to cancer. Carcinogenesis 2003;24(4):697–702. [PubMed: 12727798]
13. Liehr JG. Dual role of oestrogens as hormones and pro-carcinogens: tumour initiation by metabolic
activation of oestrogens. Eur J Cancer Prev 1997;6(1):3–10. [PubMed: 9161806]
14. Abel EL, Lyon RP, Bammler TK, Verlinde CL, Lau SS, Monks TJ, et al. Estradiol metabolites as
isoform-specific inhibitors of human glutathione S-transferases. Chemico-biological interactions
2004;151(1):21–32. [PubMed: 15607759]
15. Lakhani NJ, Venitz J, Figg WD, Sparreboom A. Pharmacogenetics of estrogen metabolism and
transport in relation to cancer. Current drug metabolism 2003;4(6):505–513. [PubMed: 14683478]
Aiyer and Gupta Page 10
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
16. Gallicchio L, Berndt SI, McSorley MA, Newschaffer CJ, Thuita LW, Argani P, et al. Polymorphisms
in estrogen-metabolizing and estrogen receptor genes and the risk of developing breast cancer among
a cohort of women with benign breast disease. BMC cancer 2006;6:173. [PubMed: 16808847]
17. Zhu BT, Conney AH. Functional role of estrogen metabolism in target cells: review and perspectives.
Carcinogenesis 1998;19(1):1–27. [PubMed: 9472688]
18. Mauvais-Jarvis P, Kuttenn F, Gompel A. Estradiol/progesterone interaction in normal and pathologic
breast cells. Annals of the New York Academy of Sciences 1986;464:152–167. [PubMed: 3524347]
19. Stoner GD. Foodstuffs for preventing cancer: the preclinical and clinical development of berries.
Cancer Prev Res (Phila Pa) 2009;2(3):187–194. [PubMed: 19258544]
20. Daniel EM, Krupnick AS, Heur Y, Blinzler JA, Nims RW, Stoner GD. Extraction, stability and
quantitation of ellagic acid in various fruits and nuts. J Food composition and analysis 1989;2:338–
349.
21. Wu X, Beecher GR, Holden JM, Haytowitz DB, Gebhardt SE, Prior RL. Concentrations of
anthocyanins in common foods in the United States and estimation of normal consumption. J Agric
Food Chem 2006;54(11):4069–4075. [PubMed: 16719536]
22. Seeram NP. Berry fruits: compositional elements, biochemical activities, and the impact of their intake
on human health, performance, and disease. J Agric Food Chem 2008;56(3):627–629. [PubMed:
18211023]
23. Seeram NP. Berry fruits for cancer prevention: current status and future prospects. J Agric Food Chem
2008;56(3):630–635. [PubMed: 18211019]
24. Aiyer HS, Srinivasan C, Gupta RC. Dietary berries and ellagic acid diminish estrogen-mediated
mammary tumorigenesis in ACI rats. Nutr Cancer 2008;60(2):227–234. [PubMed: 18444155]
25. Aiyer HS, Kichambare S, Gupta RC. Prevention of oxidative DNA damage by bioactive berry
components. Nutr Cancer 2008;60:36–42. [PubMed: 19003579] Suppl 1
26. Schmitt E, Stopper H. Estrogenic activity of naturally occurring anthocyanidins. Nutr Cancer 2001;41
(1–2):145–149. [PubMed: 12094617]
27. Larrosa M, Gonzalez-Sarrias A, Garcia-Conesa MT, Tomas-Barberan FA, Espin JC. Urolithins,
ellagic acid-derived metabolites produced by human colonic microflora, exhibit estrogenic and
antiestrogenic activities. J Agric Food Chem 2006;54(5):1611–1620. [PubMed: 16506809]
28. Borges G, Roowi S, Rouanet JM, Duthie GG, Lean ME, Crozier A. The bioavailability of raspberry
anthocyanins and ellagitannins in rats. Mol Nutr Food Res 2007;51(6):714–725. [PubMed:
17533654]
29. Kay CD. Aspects of anthocyanin absorption, metabolism and pharmacokinetics in humans. Nutr Res
Rev 2006;19(1):137–146. [PubMed: 19079881]
30. Talavera S, Felgines C, Texier O, Besson C, Manach C, Lamaison JL, et al. Anthocyanins are
efficiently absorbed from the small intestine in rats. The Journal of nutrition 2004;134(9):2275–2279.
[PubMed: 15333716]
31. Ravoori S, Vadhanam MV, Sahoo S, Srinivasan C, Gupta RC. Mammary tumor induction in ACI
rats exposed to low levels of 17beta-estradiol. Int J Oncol 2007;31(1):113–120. [PubMed: 17549411]
32. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR
and the 2(-Delta Delta C(T)) Method. Methods 2001;25(4):402–408. [PubMed: 11846609]
33. Shull JD, Spady TJ, Snyder MC, Johansson SL, Pennington KL. Ovary-intact, but not ovariectomized
female ACI rats treated with 17beta-estradiol rapidly develop mammary carcinoma. Carcinogenesis
1997;18(8):1595–1601. [PubMed: 9276635]
34. Kurz SG, Hansen KK, McLaughlin MT, Shivaswamy V, Schaffer BS, Gould KA, et al. Tissue-specific
actions of the Ept1, Ept2, Ept6, and Ept9 genetic determinants of responsiveness to estrogens in the
female rat. Endocrinology 2008;149(8):3850–3859. PMCID: 2488241. [PubMed: 18420736]
35. Ruhlen RL, Willbrand DM, Besch-Williford CL, Ma L, Shull JD, Sauter ER. Tamoxifen induces
regression of estradiol-induced mammary cancer in the ACI.COP-Ept2 rat model. Breast Cancer Res
Treat. 2008
36. Shull JD, Lachel CM, Murrin CR, Pennington KL, Schaffer BS, Strecker TE, et al. Genetic control
of estrogen action in the rat: mapping of QTLs that impact pituitary lactotroph hyperplasia in a
BNXACI intercross. Mamm Genome 2007;18:657–669. [PubMed: 17876666]
Aiyer and Gupta Page 11
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
37. Mense SM, Singh B, Remotti F, Liu X, Bhat HK. Vitamin C and alpha-naphthoflavone prevent
estrogen-induced mammary tumors and decrease oxidative stress in female ACI rats. Carcinogenesis
2009;30(7):1202–1208. PMCID: 2704283. [PubMed: 19406931]
38. Singh B, Mense SM, Remotti F, Liu X, Bhat HK. Antioxidant butylated hydroxyanisole inhibits
estrogen-induced breast carcinogenesis in female ACI rats. J Biochem Mol Toxicol 2009;23(3):202–
211. [PubMed: 19526586]
39. Cribb AE, Knight MJ, Dryer D, Guernsey J, Hender K, Tesch M, et al. Role of polymorphic human
cytochrome P450 enzymes in estrone oxidation. Cancer Epidemiol Biomarkers Prev 2006;15(3):
551–558. [PubMed: 16537715]
40. Liehr JG. Genotoxicity of the steroidal oestrogens oestrone and oestradiol: possible mechanism of
uterine and mammary cancer development. Human reproduction update 2001;7(3):273–281.
[PubMed: 11392373]
41. Wilson AM, Reed GA. Predominant 4-hydroxylation of estradiol by constitutive cytochrome P450s
in the female ACI rat liver. Carcinogenesis 2001;22(2):257–263. [PubMed: 11181446]
42. Christou M, Savas U, Schroeder S, Shen X, Thompson T, Gould MN, et al. Cytochromes CYP1A1
and CYP1B1 in the rat mammary gland: cell-specific expression and regulation by polycyclic
aromatic hydrocarbons and hormones. Molecular and cellular endocrinology 1995;115(1):41–50.
[PubMed: 8674863]
43. Barch DH, Rundhaugen LM, Thomas PE, Kardos P, Pillay NS. Dietary ellagic acid inhibits the
enzymatic activity of CYP1A1 without altering hepatic concentrations of CYP1A1 or CYP1A1
mRNA. Biochem Biophys Res Commun 1994;201(3):1477–1482. [PubMed: 8024593]
44. Risk M, Shehu A, Mao J, Stocco CO, Goldsmith LT, Bowen-Shauver JM, et al. Cloning and
characterization of a 5' regulatory region of the prolactin receptor-associated protein/17{beta}
hydroxysteroid dehydrogenase 7 gene. Endocrinology 2005;146(6):2807–2816. [PubMed:
15731358]
45. Li KM, Todorovic R, Devanesan P, Higginbotham S, Kofeler H, Ramanathan R, et al. Metabolism
and DNA binding studies of 4-hydroxyestradiol and estradiol-3,4-quinone in vitro and in female ACI
rat mammary gland in vivo. Carcinogenesis 2004;25(2):289–297. [PubMed: 14578156]
46. Mesia-Vela S, Sanchez RI, Roberts KG, Reuhl KR, Conney AH, Kauffman FC. Dietary clofibrate
stimulates the formation and size of estradiol-induced breast tumors in female August-Copenhagen
Irish (ACI) rats. Toxicology 2008;246(1):63–72. PMCID: 2441444. [PubMed: 18280627]
47. Moyer RA, Hummer KE, Finn CE, Frei B, Wrolstad RE. Anthocyanins, phenolics, and antioxidant
capacity in diverse small fruits: vaccinium, rubus, and ribes. J Agric Food Chem 2002;50(3):519–
525. [PubMed: 11804523]
48. Wang LS, Hecht SS, Carmella SG, Yu N, Larue B, Henry C, et al. Anthocyanins in black raspberries
prevent esophageal tumors in rats. Cancer Prev Res (Phila Pa) 2009;2(1):84–93. [PubMed:
19139022]
Aiyer and Gupta Page 12
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 1. (A–C). Effect of berry and ellagic acid diets on E2-induced elevation in CYP1A1
expression
ACI rats (n=6) were treated with E2 (27 mg) for 6 (A), 18 (B) or 24 (C) weeks and fed either
a control diet (E2-CD) or diet supplemented with 2.5% w/w black raspberry (E2-BRB),
blueberry (E2-BB) or 400 ppm ellagic acid (E2-EA). The whole mammary mRNA was
analyzed for CYP1A1 expression using qRTPCR as described in Materials and Methods. The
relative fold change was calculated using the 2−ddcT method with a sample from SH-CD as the
calibrator for each particular time point. a- significantly different from SH-CD, p<0.0001; b-
significantly different from E2-CD, p<0.005.
Aiyer and Gupta Page 13
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 2. (A–C). Effect of berry and ellagic acid diets on E2-induced elevation in CYP1B1
expression
ACI rats (n=6) were treated with E2 (27 mg) for 6 (A), 18 (B) or 24 (C) weeks and fed either
a control diet (E2-CD) or diet supplemented with 2.5% w/w black raspberry (E2-BRB),
blueberry (E2-BB) or 400 ppm ellagic acid (E2-EA). The whole mammary mRNA was
analyzed for CYP1B1 expression using qRTPCR as described in Materials and Methods. The
relative fold change was calculated using the 2−ddcT method with a sample from SH-CD as the
calibrator for each particular time point. a- significantly different from SH-CD, p<0.01; b-
significantly different from E2-CD, p<0.01.
Aiyer and Gupta Page 14
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 3. (A–C). Effect of berry and ellagic acid diets on E2-induced elevation in 17βHSD7
expression
ACI rats (n=6) were treated with E2 (27 mg) for 6 (A), 18 (B) or 24 (C) weeks and fed either
a control diet (E2-CD) or diet supplemented with 2.5% w/w black raspberry (E2-BRB),
blueberry (E2-BB) or 400 ppm ellagic acid (E2-EA). The whole mammary mRNA was
analyzed for 17βHSD7 expression using qRTPCR as described in Materials and Methods. The
relative fold change was calculated using the 2−ddcT method with a sample from SH-CD as the
calibrator for each particular time point. a- significantly different from SH-CD, p<0.05; b-
significantly different from E2-CD, p<0.05.
Aiyer and Gupta Page 15
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 4. (A–C). Effect of berry and ellagic acid diets on E2-induced changes in phase II enzyme
expression
ACI rats (n=6) were treated with either sham implants or E2 (27 mg) for 6, 18 or 24 weeks and
fed a control diet (SH-CD, ◆; E2-CD, ○ ) or diet supplemented with 2.5% w/w black raspberry
(E2-BRB, △), blueberry (E2-BB, ■ ) or 400 ppm ellagic acid (E2-EA, ). The whole
mammary mRNA was analyzed for A- Catechol-O-methyl transferase (COMT); B-
Glutathione S transferase M1 (GSTM1); and C- GSTA1 expression using qRTPCR as
described in Materials and Methods. The relative fold change was calculated using the
2−ddcT method with a sample from SH-CD as the calibrator for each particular time point. a-
significantly different from SH-CD, p<0.05; b- significantly different from E2-CD, p<0.05.
Aiyer and Gupta Page 16
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 5. (A–C). Effect of berry and ellagic acid diets on E2-induced changes in steroid receptor
expression
ACI rats (n=6) were treated with either sham implants or E2 (27 mg) for 6, 18 or 24 weeks and
fed a control diet (SH-CD, ◆; E2-CD, ○ ) or diet supplemented with 2.5% w/w black raspberry
(E2-BRB, △ ), blueberry (E2-BB, ■) or 400 ppm ellagic acid (E2-EA, ). The whole
mammary mRNA was analyzed for A- Estrogen Receptor α (ERα); B- ERβ; and C-
Progesterone receptor (PGR) expression using qRTPCR as described in Materials and
Methods. The relative fold change was calculated using the 2−ddcT method with a sample from
SH-CD as the calibrator for each particular time point. a- significantly different from SH-CD,
p<0.01; b- significantly different from E2-CD, p<0.01.
Aiyer and Gupta Page 17
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Aiyer and Gupta Page 18
Table 1
Primer sequences used for quantitative real-time PCR.
Gene Forward (5’-3’) Reverse (5’-3’)
17β HSD CTTTATCCTGATTCGGGAACTG GTCCTCAAGACTGAAGTTAGA C
CYP1A1 TGGAGACCTTCCGACATTCAT GGGATATAGAAG CCATTCAGACTT G
CYP1B1 AACCCAGAGGACTTTGATCCG CGTCGTTTGCCCACTGAAAA
COMT GGATGCAGTGATTCGGGAGTA GCAGCGTAGTCAGGGTTCATCT
GSTA1 CCAGCCTTCTGACCTCTTTCC TCTTCGATTTGTTTTGCATCCA
GSTM1 TCTTGACCAGTACCACATTTTTGAG TCGAAAATATAGGTGTTGAGAGGTAGTG
ERαGGCACATGAGTAACAAAGGCA GGCATGAAGACGATGAGCAT
ERβCTCCTTTAGCGACCCATTGC CTCCCACTAAGCTTCCTCTTCAGT
PGR TCACAACGCTTCTATCAACTTACAAA GGCAGCAATAACTTCAGACATCA
β-Actin GCCAACCGTGAAAAGATGAC ACCCTCATAGATGGGCACAG
Primers were designed using Primer Express® software across exon boundary for the following genes: 17βHSD7- 17β hydroxyl steroid dehydrogenase
7;CYP1A1-Cytochrome P450 1A1; CYP1B1-Cytochrome P450 1B1; COMT- Catechol-O-methyl transferase; GSTA1- Glutathione-S-transferase
A1; GSTM1-Glutathione-S-transferase M1; ERα-Estrogen receptor α; ERβ-Estogen receptor β; PGR- Progesterone receptor.
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Aiyer and Gupta Page 19
Table 2
Comparison of organ weights and tumor indices between ACI rats fed control diet or diet supplemented with different doses of blueberry, black raspberry
or 400 ppm ellagic acid ¶
Group
Animal
Weight
(g)
Liver
(g) Mammary§
(g)
Pituitary
(mg) Tumor
Incidence#
(at 26 weeks)
Tumor
Volume#
(mm3)
Tumor
Multiplicity#
( % reduction)
Sham + Control
diet 182 ± 4 4.6 ± 0.2 3.4 ± 0.2 9.6 ± 0.8 NA NA NA
(n=6) p<0.005 p<0.005 p<0.005 p<0.005
E2 + Control diet 204 ± 2 6.8 ± 0.2 4.8 ± 0.3 70 ± 4.5 100% 2804 ± 547 11.7 ± 1.4
(n=15)
E2 + 1 % Blueberry
diet 207 ± 3 6.9 ± 0.2 5.4 ± 0.2 60 ± 7
100% 1641 ± 405
11.4 ± 2.2
(n=11) −41%
E2 + 2.5%
Blueberry diet 203 ± 6 6.6 ± 0.3 5.7 ± 0.4 69 ± 16
69% 1146 ± 276 7.2 ± 0.8
(n=13) p< 0.05
−59% p< 0.05
−38%
E2 + 1 % Black
raspberry diet 201 ± 4 6.5 ± 0.2 6.0 ± 0.4 55 ± 9
81% 1573 ± 403 6.6 ± 0.8
(n=14) p< 0.05
−44% p< 0.008
−43.50%
E2 + 2.5% Black
raspberry diet 210 ± 6 6.7 ± 0.3
7.0 ± 0.6 39 ± 3 87% 915 ± 250 5.7 ± 1.0
(n=11) p <0.05 p< 0.05 p< 0.05 p< 0.05
−67% p< 0.007
−51%
E2 + Ellagic acid
diet 205 ± 6 6.5 ± 0.2 5.5 ± 0.3 57 ± 6
81% 983 ± 331 6.9 ± 1.2
(n=11) p< 0.05 p< 0.05
−65% p< 0.05
−41%
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Aiyer and Gupta Page 20
¶The data presented in this table are from a separate independent study carried out with lower dose of the carcinogen E2 than what was previously published (Aiyer et al., 2008b). The key differences between
the studies are decribed in detail in Materials and Methods as well as Results sections. It was seen that berry/ellagic acid supplementation at the same dietary dose (2.5%/400 ppm) as before had a much higher
preventive effect in animals where mamamry tumors were induced with lower dose E2. A lower dietary dose (1%) of black raspberries also had a significant effect.
§Mammary glands were weighed after the removal of all grossly visible tumors. Typically it was seen that the higher the number of tumors, the lower the mammary wet weight. Hence there was a strong inverse
correlation between tumor volume/multiplicity and mammary gland wet weight.
#Tumor incidence was compared using log-rant test; volume using one-way ANOVA and multiplicity using poisson regression as described in Materials and Methods. A p-value ≤ 0.05 was considered significant.
Cancer Prev Res (Phila). Author manuscript; available in PMC 2011 June 1.
