Content uploaded by Hamid Reza Nouri
Author content
All content in this area was uploaded by Hamid Reza Nouri on Apr 06, 2014
Content may be subject to copyright.
Diagnosis of Chenopodium album allergy with a cocktail
of recombinant allergens as a tool for component-resolved
diagnosis
Hamid Reza Nouri •Mojtaba Sankian •Fatemeh Vahedi •
Danial Afsharzadeh •Leila Rouzbeh •Maliheh Moghadam •
Abdolreza Varasteh
Received: 11 April 2011 / Accepted: 11 June 2011 / Published online: 29 June 2011
ÓSpringer Science+Business Media B.V. 2011
Abstract Chenopodium album pollen is one of the main
sources of pollen allergy in desert and semi-desert areas
and contains three identified allergens, so the aim of this
study is comparison of the diagnostic potential of C. album
recombinant allergens in an allergenic cocktail and
C. album pollen extract. Diagnostic potential of the aller-
genic cocktail was investigated in 32 individuals using skin
prick test and obtained results were compared with the
acquired results from C. album pollen extract. Specific IgE
reactivity against the pollen extract and allergenic cocktail
was determined by ELISA and western blotting tests.
Inhibition assays were performed for the allergenic cocktail
characterization. The exact sensitization profile of all
patients was identified which showed that 72, 81 and 46%
of allergic patients had IgE reactivity to rChe a 1, rChe a 2
and rChe a 3, respectively. Almost all of C. album allergic
patients (30/32) had specific IgE against the allergenic
cocktail. In addition, there was a high correlation between
IgE levels against the allergenic cocktail and IgE levels
against the pollen extract. The allergenic cocktail was able
to completely inhibit IgE binding to natural Che a 1, Che a
2 and Che a 3 in C. album extract. In addition, positive skin
test reactions were seen in allergic patients that tested by
the allergenic cocktail. The reliable results obtained from
this study confirmed that the allergenic cocktail with high
diagnostic potential could be replaced with natural
C. album allergen extracts in skin prick test and serologic
tests.
Keywords Allergenic cocktail Recombinant allergen
Skin prick test Component resolved diagnosis
Introduction
Pollens from anemophilous plants are the major problem in
Type I allergy and they are the most predominant source of
allergens in outdoor environment [1]. Chenopodium album
(Lambs quarter) is a summer annual plant that belongs to
Amaranthaceae/Chenopodiaceae family, which grows in
temperate zones of southern Europe and the western United
States [2]. C. album pollen is one of the most important
Electronic supplementary material The online version of this
article (doi:10.1007/s11033-011-1083-9) contains supplementary
material, which is available to authorized users.
H. R. Nouri M. Sankian D. Afsharzadeh M. Moghadam
A. Varasteh (&)
Immunobiochemistry Lab, Immunology Research Center,
School of Medicine, Mashhad University of Medical Sciences,
Mashhad, Iran
e-mail: varasteha@mums.ac.ir
H. R. Nouri
e-mail: nourihr851@mums.ac.ir
M. Sankian
e-mail: sankianm@mums.ac.ir
D. Afsharzadeh
e-mail: dm.lotus@yahoo.com
M. Moghadam
e-mail: moghadamm1@mums.ac.ir
F. Vahedi
Biotechnology Department, Razi Vaccine and Serum Research
Institute, Mashhad, Iran
e-mail: vahedif@yahoo.com
L. Rouzbeh
Department of Food Science, Nour Branch, Islamic Azad
University, Nour, Iran
e-mail: Leila_roozbeh@yahoo.com
123
Mol Biol Rep (2012) 39:3169–3178
DOI 10.1007/s11033-011-1083-9
causes of allergic diseases in desert and semi-desert areas,
with a prevalence of 62.9, 53 and 70.7% in Iran, Saudi
Arabia and Kuwait respectively [3–5]. Over the last dec-
ade, C. album pollen allergenic molecules have been ana-
lyzed and three antigens of 10–18 kDa have been identified
that have capacity of binding to human IgE. Che a 1, Che a
2 and Che a 3 are the most important allergens which
identified in C. album pollen extract [2,6]. Che a 1 has
been characterized in detail, as a single N-glycosylated
polypeptide chain, and recognized in more than 77% of
C. album allergic patients [2]. Profilin (Che a 2) and pol-
calcin (Che a 3) in C. album pollen extract have been
distinguished by IgE inhibition assays. C. album allergic
patients showed 55 and 46% reactivity to Che a 2 and Che
a 3, respectively [6].
Type I allergy is one of the most major health prob-
lems that affected more than 25% of the population in
industrialized countries [7]. In type I allergy IgE anti-
bodies induce allergic rhinitis, conjunctivitis, asthma, and
anaphylaxis against the different allergens [8]. Currently
diagnosis of type I allergy performs on the basis of case
history, skin prick test (SPT) and detection of allergen-
specific IgE antibodies in the serum [9]. To date, the
allergic diagnostic tests had been based on natural aller-
gen extracts obtained from natural sources that contain
unknown concentrations of allergenic components and
high amounts of undefined products [10,11]. Therefore,
in the patients who are sensitized to more than one type
of allergenic source it would be difficult and often
impossible to precisely identify the disease-eliciting
allergen. In such cases, it would be important for the
clinicians to know whether a patient is co-sensitized to
the several allergen sources, or the patient is sensitized to
the several sources due to sensitization to cross-reactive
components [7]. One of the main goals of allergy research
programs is to improve the tools for diagnosis and spe-
cific immunotherapy. The recently suggested concept for
allergy diagnosis, component-resolved diagnosis (CRD),
that identify allergy eliciting proteins by using pure
allergen molecules, which are either produced by
recombinant technology or by purification from natural
allergen sources, for determination of the patients sensi-
tization profile[12]. Using CRD with recombinant aller-
gens, make it possible to determine the disease-causing
molecules and to discriminate two clinical conditions of
‘co-sensitization’ and ‘cross-sensitization’ [13,14].
Therefore, the first aim of this study is determination of
allergenic profile in C. album allergic patients in Mash-
had, northeast of Iran via recombinant allergens. Subse-
quently, we designed a cocktail of C. album recombinant
allergens (rChe a 1, rChe a 2, rChe a 3) which may be
replaceable with C. album pollen extract for diagnostic
purposes.
Materials and methods
Chenopodium album pollen extract and purification
of recombinant C. album allergens
Aqueous extract of C. album was prepared as it described
previously [15]. In brief, pollens were mixed with 1:20 w/v
phosphate-buffered saline (PBS, 0.15 M, pH 7.4) contain-
ing 20 mM EDTA and were shaked at 4°C for 16 h.
Subsequently, they were clarified by centrifugation at
7,1509gfor 20 min at 4°C, and the clear supernatants
containing the solublized proteins were dialyzed, lyophi-
lized and stored at -20°C to use. The proteins quality were
checked by SDS-PAGE and Coomassie Blue staining
according to Laemmli under the reducing condition [16].
The protein concentration of pollen extract was determined
by Bradford’s method [17].
Coding regions of Che a 1, Che a 2 and Che a 3 were
amplified using the first strand cDNA as template. The
sense primer for Che a 1 was 50ATTGCGGCCGCAT-
GGCGAAGTGTCAAGCTG 30, and the antisense primer
was 50TATCTCGAGATTAGCTTTAACATCATAA
AGATCCA 30. In the case of Che a 2, the sense and
antisense primers were 50ATTGCGGCCGCATGTCGT
GGCAGACGTACGT 30and 50TATCTCGAGCATGC
CCTGTTCGACCAG 30respectively. Finally Che a 3 was
amplified by sense primer 50ATTGCGGCCGCAT
GGCTGCTGAGGATACACCTC 30and antisense primer
50TATCTCGAGGAAGATCTTGGAAACATCTTT AAC
CCA 30. The primers designed according to the deposited
nucleotide sequences with GeneBank accession numbers
AY049012, FJ985985 and AY082338 for Che a 1, Che a 2
and Che a 3, respectively. The Not I restriction sites which
were incorporated in the sense primers have been under-
lined, and Xho I restriction sites in antisense primers have
been written in italics. The PCR products were first cut
with Not I and Xho I restriction enzymes, and purified by
preparative agarose gel electrophoresis (Bioneer, Korea),
then subcloned into Not I and Xho I sites of plasmid
pET21b(?) (Novagen, USA). Plasmids were transformed
into Escherichia coli BL21 codon plus (DE3) RIL (Strat-
agene, USA). Plasmids from positive clones were isolated
using Qiagen tips (Qiagen, USA) and were sequenced
according to Sanger method. Expression of rChe a 1, rChe
a 2 and rChe a 3 was initiated by adding 1 mM isopropyl-
b-D-thiogalactopyranoside (IPTG) and then, recombinant
allergens produced as histidine-tag fusion proteins. The
rChe a 2 and rChe a 3 which had been produced in the
soluble phase, were purified by the native condition of Ni-
NTA chromatography (Qiagen, USA). In the other hand,
rChe a 1 was expressed in the inclusion bodies and purified
via a special method. Allergen expressed cells were
resuspended in lysis buffer A (50 mM Tris–HCl; pH 8.0,
3170 Mol Biol Rep (2012) 39:3169–3178
123
10 mM NaCl, and 5 mM EDTA) plus 16 ll of 50 mg/ml
lysozyme per gram of pellet. After three times freezing and
thawing, the suspension was centrifuged at 14,4809gfor
40 min at 4°C. The pellet was resuspended in the buffer B
(20 mM Na
2
HPO
4
pH 7.2; 20 mM NaCl, and 5 mM
EDTA), and again centrifuged under the same condition.
Inclusion bodies were solubilized after addition of 8 M
urea; 100 mM NaH
2
PO
4
, and 10 mM Tris–HCl, pH 8.0,
and then centrifuged at 12,0009gfor 20 min. The resultant
supernatant was diluted to 6 M urea and then, loaded on a
Ni-NTA column. Afterwards the rChe a 1 was purified
according to the denaturing condition (Qiagen, USA). The
purified proteins were renatured by using a linear 6–1 M
urea gradient in 20 mM Tris–HCl (pH 7.4), 500 mM NaCl
and 10% glycerol over a period of 8 h. The purity and
integrity of the recombinant proteins were checked by 15%
SDS-PAGE and Coomassie Brilliant Blue (CBB) staining.
All of the recombinant proteins were desalted via dialysis
against PBS, 0.15 M. The concentration of the recombinant
proteins was determined by Bradford’s method [17].
Demographic and clinical characterization of patients
Most of Chenopodiacea allergic patients are sensitized to
more than one allergen source in this family, which may be
due to the sensitization to C. album,Amarantus retrofe-
lexsus or Salsola kali. So this study focused on these co-
sensitized patients. In brief, thirty-two allergic patients to
chenopodiaceae pollens (14 female and 18 male patients;
mean age, 28.1 years old; 19–54 years old) were involved
in this study. The diagnosis of chenopodiaceae pollen
allergy in the respective patients was based on a clinical
history of seasonal allergic conjunctivitis/rhinitis, and SPT.
As control group, four non-atopic individuals (2 female and
2 male patients; mean age 27.8 years old; 19–37 years old)
took part in the study. The Patient’s characteristics
including age, sex, clinical symptoms and total IgE level
are summarized in supplementary Table 1. The Human
Ethics Committee of the Mashhad University of Medical
Sciences (Mashhad, Iran) approved this study. After pro-
viding the informed patient consent, skin tests were per-
formed on the ventral side of the subjects’ forearms
according to Dreborg method [18]. Reactions with a wheal
of 3 mm greater than negative controls, surrounded by the
mild to moderate erythema, were considered as the positive
results. Finally, blood was collected for serum sampling.
Determination of total and specific immunoglobin E
levels and inhibition assays
Total serum IgE levels (kU per liter) were measured by
means of a commercially available ELISA kit according to
the manufacturer’s instructions (Radim, Pomezia Terme,
Italy). The serum-specific IgE levels in the chenopodiaceae
allergic patients were quantified by means of ELISA as
previously described [19,20]. The specific IgE antibodies
against the allergenic cocktail of rChe a 1, rChe a 2 and
rChe a 3, as well as the single allergens were measured by
using an indirect ELISA in patients’ sera. The wells of the
ELISA microplate (Nunc MaxiSorp
TM
, Fisher Scientific,
Pittsburg, PA) were overnight saturated at 4°Cin15mM
Na
2
CO
3
and 35 mM NaHCO
3
, pH 9.6 with the allergenic
cocktail which includes an equimolar concentration of each
of the recombinant allergens. Nonspecific binding sites
were blocked using 2% Bovine Serum Albumin (BSA) in
PBS, and then the wells were incubated with the allergic
patient’s serum (1:5 diluted in 1% BSA) at 37°C in the
agitation condition. In the next step, 1:1,000 diluted of
biotinylated goat anti human IgE antibody (KPL, USA)
was added to each of the wells and incubated for 2 h at
37°C. Then, for visualization of IgE complex, the wells
were incubated with 1:20,000 dilution of horseradish per-
oxidase (HRP)-conjugated streptavidin (Bio-Rad, USA) for
45 min. Finally, the colorimetric reaction was performed
by addition of chromogenic substrate (tetramethyl benzi-
dine (TMB)/H2O2) and the optical density was read at
450 nm by an ELISA reader (Stat fax2100). The optical
density (OD
450nm
) values higher than the mean OD
450nm
of
the negative controls plus three SDs were considered as
positive. ELISA inhibition assays were carried out in the
microtiter plates, which had been coated with C. album
pollen extract (50 lg/well). The following steps had
exactly similar conditions as were explained earlier in the
case of direct ELISA. Except that in the current ELISA, we
used a pooled serum (diluted 1:2 in 1% BSA) that over-
night pre-incubated at 4°C with equivolumetric of each of
inhibitors, including different concentrations of C. album
pollen extract, allergenic cocktail and BSA/PBS. The per-
centage of inhibition was calculated according to the for-
mula: inhibition (%) =[OD
A
–OD
B
/OD
B
]9100, where
OD
A
and OD
B
represent optical densities which were
obtained from the non-inhibited and inhibited pool sera,
respectively.
IgE-binding capacity of recombinant allergenic cocktail
and immunoblotting inhibition assays
Natural C. album pollen extract and the allergenic cocktail
were tested for IgE-binding capacity by Western blotting.
For immunoblotting, the pollen extract and the allergenic
cocktail were separated via denaturing SDS-PAGE with
15% polyacrylamide gels, according to the Laemmli
method [16]. Protein (60 lg of the pollen extract, 5 lgof
each recombinant allergens and the allergenic cocktail
Mol Biol Rep (2012) 39:3169–3178 3171
123
which contains an equimolar concentration of rChe a 1,
rChe a 2 and rChe a 3) bands were electro-transferred to the
polyvinylidene difluoride (PVDF) membranes (Immobilon
P, Millipore Corp, Bedford, USA) and after that, the PVDF
membranes were cut into the strips of approximately
0.6 cm in width. The strips were incubated with BSA 2%
in PBS for 16 h at 4°C to block non specific sites. Immu-
nodetection on the strips was achieved by using a pooled
serum obtained from the allergic patients (diluted 1:10) or
from the individual sera. Complexes of IgE were detected
using a biotinylated goat anti human IgE antibody (KPL,
USA). The strips were incubated in the secondary antibody
(diluted 1:1,000 in BSA 1%) for 1 h at the room temper-
ature. Then the last incubation was performed with
1:20,000 diluted HRP-conjugated streptavidin (Bio-Rad,
USA). Finally, the signals were developed using the
chemiluminescent method as it was recommended by the
manufacturer (ECL-PlusTM, Amersham Biosciences) and
documented with the use of G: box imaging system
(Syngene, UK). For immunoblotting inhibition assays,
C. album pollen extract was electrophorized and blotted to
PVDF and was immunostained with the pooled serum. The
pooled serum had been previously incubated with 60 lgof
C. album pollen extract or the allergenic cocktail as
inhibitors or alternatively with PBS as a negative control.
The percentage of the inhibition was calculated by densi-
tometric analysis of protein bands with the use of Tiny-
Quant v1.55 software (Iscove Lab).
Skin prick test with the allergenic cocktail
The ability of allergenic cocktail in induction of the
immediate skin reactions was investigated in the allergic
patients. SPT was performed on the forearms of the indi-
viduals with C. album pollen extract and the allergenic
cocktail according to the standard procedure. To construct
the allergenic cocktail (15 lg/ml), equimolar concentration
of rChe a 1, rChe a 2 and rChe a 3 were mixed and diluted
in NaCl 0.9% for SPT. Histamine (10 mg/ml) and NaCl
0.9% served as the positive and negative controls. Elicited
weal areas were recorded after 20 min and the weal sur-
faces of greater than 4 mm were considered as positive.
Statistical analysis
Statistical analysis of data were performed using the
Pearson rcorrelation test and Student’s t-test which are
included in the statistical GraphPad Prism 5 software.
Correlation coefficients were determined by means of lin-
ear regression. A P-value of less than 0.05 was considered
to be significant.
Results
Cloning and expression of an allergenic cocktail
from C. album pollen
The coding sequence for recombinant Che a 1, Che a 2 and
Che a 3 proteins were amplified by RT-PCR of the first
strand cDNA which had been prepared from the total RNA.
These sequences were successfully inserted into
pET21b(?) vector. The sequencing data resulted in a high
similarity with deposited sequences for Che a 1, Che a 2
and Che a 3 which reported by AY049012, FJ985985 and
AY082338 GenBank accession numbers, respectively.
Production of rChe a 2 and rChe a 3 was successfully
fulfilled by E. coli BL21 codon plus (DE3) RIL and
accumulated mainly in the soluble fraction, while rChe a 1
was remained in the insoluble fraction of the cell homog-
enate under the same conditions (Fig. 1a). After SDS-
PAGE and staining of the gels by CBB rChe a 1, rChe a 2
an rChe a 3 were visualized with an apparent molecular
mass of 22, 18 and 13 kDa, respectively. These proteins
were further purified by Ni
2?
-chelate affinity chromatog-
raphy (Fig. 1b). The yield of the rChe a 1, rChe a 2 and
rChe a 3 were estimated, according to the Bradford’s
method, which were around 1, 0.4 and 0.6 lg per 1 ml of
cell culture, respectively. According to the concentration
and molecular weight of recombinant allergens, the mo-
larities of these proteins were calculated about 45.4, 22.2
and 33.3 nmol (nM) respectively. In the same way, 1 nM
of rChe a 1 solution was equal to 22 lg of rChe a 1. Also,
1 nM of rChe a 2 and rChe a 3 solutions were equivalent to
18 and 13 lg of rChe a 2 and rChe a 3, respectively. There
were 6 910
14
molecules of each purified recombinant
allergens in 1 nM of each recombinant allergen solutions.
Therefore, an allergenic cocktail was constructed with an
equimolar concentration (0.3 nM) of these recombinant
allergens.
Western blot analysis of the purified recombinant
allergens
Assessment of the polyacrilamide gel, indicated that
C. album pollen extracts (Fig. 1b) contained several pro-
teins of approximately 9–85 kDa that occur in variable
quantities. These proteins are probably responsible for the
allergic sensitization to C. album extracts. In details, in
staining of C. album extract proteins, large quantity of Che
a 2 was detected, whereas Che a 1 and Che a 3 were not
well represented in the extract. IgE immunostaining of
purified rChe a 1, rChe a 2 and rChe a 3 that blotted to
PVDF membranes was performed with the sera of 32
patients included in this study. Che a 1 and Che a 2 which
were previously reported as the major allergens [2,6]of
3172 Mol Biol Rep (2012) 39:3169–3178
123
C. album were recognized by 72% (n=23) and 81%
(n=26) of the Iranian patient’s sera (Fig. 2a). Frequencies
of sensitization to Che a 3 (Fig. 2a), an allergenic com-
ponents from polcalcin family proteins, was 41% (n=13)
among 32 patients. IgE immunoblotting with natural pollen
extracts indicated that patients have exhibited individual
IgE reactivity profiles (Fig. 2b, lane 1). Analysis of data
which obtained by immunoblotting was revealed that
almost all of C. album allergic patients are at least sensi-
tized to one of the rChe a 1 or rChe a 2 or rChe a 3. Two
serum samples of allergic patients (no. 7 and 11) had no
IgE reactivity with three recombinant allergens. Moreover,
25% (n=8) of allergic patients sera (no. 12, 18, 21, 24,
25, 27, 28, 30 and 32) were recognized which are simul-
taneously sensitized to all of these allergens. A pooled
serum was prepared from these patients sera for inhibition
assays. The allergenic cocktail with equimolar concentra-
tion of each recombinant allergen showed high potential of
IgE reactivity (Fig. 2b, lane 4). To assess the participation
of the allergenic cocktail in IgE reactivity, an IgE-binding
immunobloting inhibition assay was designed using a
pooled serum, with C. album as coating extract, the aller-
genic cocktail and C. album pollen extracts as alternative
inhibitors (Fig. 2c). After densitometry analysis of the
immunoblotting experiment, a complete inhibition in the
responses of IgE reactive bands was obtained when
C. album extract had been used as an inhibitor. Using the
allergenic cocktails as another inhibitor, an inhibition of
95–100% was occurred in the Che a 1, Che a 2 and Che a 3
bands in C. album extract. But when the allergenic cocktail
had been used as inhibitor no inhibition was accomplished
in the other allergenic bands in C. album extract.
The patients’ IgE reactivity profile: component-
resolved in vitro allergy diagnosis with recombinant
pollen allergens
Using ELISA test on C. album pollen extract, 30 of 32
C. album pollen allergic patients were diagnosed. In all of
these patients, specific IgE levels (OD values of
450 [0.4 nm) were significantly elevated against
C. album pollen extract. Moreover, there was a significant
increase in specific IgE antibodies against the combination
of three recombinant allergens (rChe a 1, rChe a 2 and rChe
a 3) as the allergenic cocktail in 30 of the 32 allergic
patients. Patients no 7 and 11, who had not exposed IgE
reactivity to rChe a 1, rChe a 2 and rChe a 3 in immuno-
blotting, showed OD
450nm
values of lower than 0.4 with
C. album extract and the allergenic cocktail (supplemen-
tary Table 1). Analysis of serum-specific IgE levels to
C. album extract and allergenic cocktail showed a highly
significant correlation (r=0.89, P\0.0001) (supple-
mentary Fig. 1) between them. Subsequently there was no
significant correlation between OD
450nm
obtained from
each recombinant allergen and C. album extract or the
allergenic cocktail (data not shown). Approximately 72%,
81% and 41% of the sera exhibited IgE reactivity to rChe a
1, rChe a 2 and rChe a 3 respectively. The quantitative
analysis of specific IgE levels indicated that rChe a 2 has
higher IgE binding capacity in comparison with rChe a 1
and rChe a 3. Although most of allergic patients displayed
IgE reactivity to more than one recombinant allergens, but
there were a few allergic patients that their sera specifically
reacted to rChe a 1(patient no. 16 and 31) and rChe a 2
(patient no. 6, 19, 20 and 26). In addition, certain patients
Fig. 1 Coomassie blue stained
gel for C. album purified
recombinant allergens. aThe
polyacrylamide gel stained by
coomassie brilliant blue R-250
revealed that rChe a 2 and rChe
a 3 express in soluble phase,
while rChe a 1 mainly expresses
in insoluble phase. Lanes 1,3
and 5are supernatants of cells
including pET21b(?)/rChe a 1,
rChe a 2 and rChe a 3,
respectively. Lanes 2,4and 6
are inclusion bodies of above
cells. bSDS-PAGE of crude
extracts of C. album pollens, Ni-
NTA purified recombinant Che
a 3, Che a 2, Che a 1, and the
allergenic cocktail on a 15%
polyacrylamide gel. Lane M low
molecular weight (Amersham,
Buckinghamshire, UK)
Mol Biol Rep (2012) 39:3169–3178 3173
123
(patient no. 12, 18, 21, 24, 25, 27, 28, 30 and 32) had IgE
antibodies with varying levels to all three recombinant
allergens.
Inhibition of IgE-binding to the natural allergens in
C. album pollen extract was examined by means of ELISA
inhibition. The pooled serum was pre-incubated with (0.1,
1, 10, 100, 1,000 lg/ml) of the allergenic cocktail or
C. album pollen extract. About 92% of inhibition was
observed in 100 lg/ml of C. album pollen extract as an
inhibitor. In contrast, the allergenic cocktail at the same
concentration was able to inhibit only 65% of IgE binding
to natural allergens in C. album pollen extract. When the
concentration of allergenic cocktail was increased up to
1,000 lg/ml, the inhibition percentage moved up to 82%
(Fig. 3). These inhibition data supported that rChe a 1,
rChe a 2 and rChe a 3 in the allergenic cocktail had shared
many epitopes with their equal natural allergens in
C. album pollen extract. However, BSA as an unrelated
protein did not significantly increase inhibition to the nat-
ural allergens.
A cocktail of three recombinant pollen allergens allows
in vivo diagnosis of C. album pollen allergy
Through use of C. album pollen extract (1 mg/ml) in SPT,
31 of 32 allergic patients were diagnosed. In our data, there
was only one patient (supplementary Table 1 patient no 26)
who showed negative response to SPT with C. album
Fig. 2 Immunoreactivity of purified recombinant allergens.aIgE
binding capacity of purified rChe a 1, rChe a 2 and rChe3 checked by
sera of allergic and control (C
-
) patients. Eight of allergenic patients
had IgE reactivity to all of rChe a 1, rChe a 2 and rChe a 3. bIn the
lanes 1 and 2, the IgE reactivity of a pooled serum of allergic and
non-allergic patients to the C. album extract bands are manifested.
Lanes 3,4and 5represent interaction of the pooled serum with rChe
a 1, rChe a 2 and rChe a 3, respectively. Lane 6 shows recognition of
the allergenic cocktail protein bands by pooled serum. cThe strips
blotted with 60 lg of crude extract and incubated with a pooled serum
pre-adsorbed with PBS, C. album pollen extract and the allergenic
cocktail as inhibitors. Lane M low molecular weight (Amersham,
Buckinghamshire, UK)
3174 Mol Biol Rep (2012) 39:3169–3178
123
pollen extract, while he showed positive SPT to S. kali and
A. retroflexus pollen extract beside possessing IgE reac-
tivity to C. album extract in ELISA experiment. Moreover,
we found two patients with positive skin reactions (sup-
plementary Table 1, patient no 7 and 11) without signifi-
cant IgE against C. album pollen extract in serum. Neither
immediate skin type reactions nor adverse side-effects
were observed in SPT results of four non-allergic patients.
The potency of the allergenic cocktail in induction of in
vivo immediate cutaneous reactions was evaluated by
applying SPT on 15 volunteer of the respective allergic
patients. Almost all of the allergic patients (14 of 15
individuals) exhibited positive skin reactivity to 15 lg/ml
of the allergenic cocktail (Fig. 4). Only the patient who had
been reported as the non-responding individual to C. album
extract (patient no 26) did not show any skin reaction to the
allergenic cocktail. The mean diameter in millimeters of
the wheals that had been induced by the crude extract in
C. alum sensitized individuals (10.8 ±0.8) was statisti-
cally (t-student test, P[0.05) equal to the mean diameter
induced to the allergenic cocktail (9.0 ±0.5).
Comparison between allergen specific IgE antibody
levels and SPT results
The level of skin sensitivity that elicited through application
of 1 mg/ml C. album extract or 15 lg/ml of the allergenic
cocktail and determined via the mean wheal diameter,
compared to serum specific IgE levels and showed as OD
results at 450 nm.According to the results, we found that in
almost all of the respective allergic patients, the presence of
specific IgE is associated with positive skin reactions to
C. album extract or/and to the allergic cocktail.
Despite of this association, as it presented in supple-
mentary Table 2, there were weak correlations between the
levels of the above mentioned skin sensitivity and serum
specific IgE level in respective patients. It means that, there
were both patients that exhibited low IgE binding capacity
along with the strong skin reactions (supplementary
Table 1, patient no. 7 and 11) and patients with high IgE
binding capacity to C. album and/or to the allergenic
cocktail with low or mild skin reactions (supplementary
Table 1, patient no. 26).
Discussion
Natural allergen extracts are a poorly defined mixture of
allergenic proteins and other unknown macromolecules,
which cause some clinical limitations in immunotherapy
and diagnosis [21].
The purified natural allergens were introduced as an
alternative option in the allergy diagnostic methods and
immunotherapy. However, because of low yield and tech-
nical difficulties in the purification process of allergens
from their natural sources [22], recombinant allergens has
been developed in CRD and component resolved immu-
notherapy (CRIT) [23–25]. During the past decade, with
development in molecular biology techniques, many
important allergens of different sources such as mites,
birch, timothy grass, phleum and parietaria judaica pro-
duced and characterized [26–31]. Nowadays, many of
researches in the field of allergy focused on construction
panels of recombinant allergens and their usage in diag-
nosis and specific allergen immunotherapy.
Fig. 3 IgE binding inhibition assay. This experiment was assayed
against a pooled serum that pre-adsorbed with allergenic cocktail and
crude extract
Hist
0
5
10
15
20
SPT (mm)
stamin
C. album ext
All
xtract
Allergenic cockta
sodium
P>0.05
tail
m chloride 0.9%
%
Fig. 4 Skin prick test results from C. album allergic patients. This
box-plot chart exhibits the skin reactivity in allergic patients. Y-axis is
displays mean diameter of wheal areas in mm and X-axis shows the
immediate skin reaction inducing factor that include C. album pollen
extract and the allergenic cocktail; additionally histamine diphosphate
(10 mg/ml) and 0.9% sodium chloride are as positive and negative
control, respectively
Mol Biol Rep (2012) 39:3169–3178 3175
123
In the west of USA and the temperate areas of Europe,
Chenopodiacea pollens are one of the most significant
pollen allergen sources [2]. Among Chenopodiacea family,
C. album was selected for this study due to two following
reasons. Firstly, C. album pollen was one of the most
important allergenic sources in desert and semi-desert areas
especially in our country, Iran [3]. Secondly, two pan
allergens, which belong to profilins and procalcin proteins,
were identified in C. album. Currently obtained results
from this study, has made us able to diagnose the allergic
sensitivity to other allergenic members of Chenopodiacea
family and additional allergenic sources related to these
two pan allergens. The S. kali and A. retroflexuse pollens
have two identified pan allergens belong to profilins protein
family which are specified as Sal k 4 and Ama r 2 repec-
tively. Ama r 2 and Sal k 4 showed high cross-reactivity to
Che a 2 [32,33] which caused to propose Che a 2 as a
gatekeeper allergen to identify the patients with primary
sensitization to Chenopodiacea pollen.
Che a 1, Che a 2 (profilin) and Che a 3 (procalcin) are
three identified allergens in C. album. So far, Che a 1 has
been expressed in Pichia pastoris, as Che a 2 and Che a 3
have been expressed in E. coli BL21(DE3) in the previous
studies[2,6]. In this study, we have used the E. coli BL21
codon plus (DE3) RIL for heterologous expression of these
allergens. E. coli BL21 codon plus (DE3) RIL as a host
contain extra copy of tRNA for leucine, isoleucine and
argenin. So all respected allergens with high content of
mentioned amino acids were expressed in high yields [34].
Then, rChe a 1, rChe a 2 and rChe a 3 after successfully
expression purified by metal affinity chromatography. The
purity of each of recombinant allergens was checked by
SDS-PAGE which no contamination with other molecules
was found. Although, each of recombinant allergens had a
defined concentration, we calculated molarity of each
allergen according to its molecular weight and concentra-
tion. Consequently, the allergenic cocktail with equimolar
concentration of each of recombinant allergens was made.
In spite of allergenic extracts which were only appli-
cable in determination of the type of allergenic sources in
allergy diagnosis methods, recombinant allergens, make it
possible to identify the disease-eliciting allergen molecules
[21]. In this study, profile of antibody responses in
C. album allergic patients was investigated via immunoblot-
ting and ELISA. IgE binding capacity of purified rChe a 1,
rChe a 2 and rChe 3 checked via performing western blot
test on sera from allergic patients. IgE binding profile of
each patient to the recombinant allergens has been shown
in Fig. 2a. We resulted that all of the patients have specific
sensitization profile to the identified allergens in C. album
pollen extract. In the other hand, application of immuno-
blotting inhibition assays confirmed that the allergenic
cocktail inhibits IgE-binding to natural Che a 1, Che a 2
and Che a 3 completely (Fig. 2c). The obtained data from
ELISA inhibition experiments are in agreement with those
obtained from immunoblotting assays. As shown in Fig. 4,
lack of complete inhibition of IgE binding by the allergenic
cocktail might be explained through the presence of
unknown allergens in pollen extract. The results of inhi-
bition assay revealed this possibility that IgE epitopes of
rChe a 1, rChe a 2 and rChe a 3 in the allergenic cocktail
are similar to their natural counterparts in the C. album
extract. The above mentioned theory is corroborated by
obtaining a high correlation (Supplementary Fig. 1)
between measured specific IgE levels of total extract and
the allergenic cocktail-specific IgE.
In two separate studies by Rodrigo Barderas and his
colleagues, 77, 55 and 46% IgE reactivity with isolated
Che a 1, Che a 2 and Che a 3 respectively, has been
reported in Spanish C. album allergic patients [2,6]. Up to
date, in other studies there is no data about the IgE rec-
ognition patterns in sera of different populations. However,
in this study through the component-resolved diagnosis
concept, we successfully determined the exact sensitization
profile of C. album allergic patients in Mashhd, northeast
of Iran. Approximately 72, 81 and 41% of C. album
allergic patients showed IgE reactivity to rChe a 1, rChe a 2
and rChe a 3, respectively. It is clear that patients from
different geographical areas who exposed to the various
species of C. album, produce different kinds of IgE pro-
files. Accordingly, it is uncovered that, in any population
there is a variety of IgE recognition patterns. Among three
identified allergens of C. album, Che a 2 had the maximum
reactivity with serum IgE which was determined by wes-
tern blot and ELISA assays. Therefore, in the future it may
use as a gatekeeper allergen for detection of primary sen-
sitization to Chenopodiacea pollen in allergic patients.
Almost all of allergic patients to C. album are detect-
able by applying direct ELISA on the respective aller-
genic cocktail. Furthermore we found patients who had
positive SPT to C. album extract (supplementary Table 1
patient no. 7 and 11) with no significant specific IgE
against C. album extract or the allergenic cocktail.
Analysis of sera of two C. album allergic patients with the
allergenic cocktail and each of the rChe a 1, rChe a 2 and
rChe a 3 allergens revealed that they have very low levels
of specific IgE (OD
450nm
\0.4) against each of the
mentioned recombinant allergens and the allergenic
cocktail. Also, they showed no IgE reactivity to rChe a 1,
rChe a 2 and rChe a 3 which blotted to PVDF membrane.
These results point out the necessity of provocation assays
(SPT) to involve in evaluation of allergenic activity of an
allergen molecule. Hence, provocation test was interfered
in this study and the capacity of the allergenic cocktail to
induce immediate skin reactions was investigated in 15
C. album allergic patient.
3176 Mol Biol Rep (2012) 39:3169–3178
123
It found that 15 lg/ml of the allergenic cocktail was
able to induce significant immediate skin reactions in
almost all of allergic patients. In addition, the skin reac-
tivity of allergic patients to the allergenic cocktail and the
natural allergen extract has been compared in Fig. 4. The
intensity of induced skin reactivity against the allergenic
cocktail was significantly equal to obtained results of SPT
against the natural allergens in C. album pollen extract in
almost all of the enrolled C. album allergic patients in this
study. No false positive result was found in negative con-
trol patients. Additionally, we investigated about the exis-
tence of any association between allergen-specific IgE
antibody levels in serum and skin sensitivity to the aller-
genic cocktail, extract or both in C. album allergic patients.
We found that although, positive skin reactions to the
allergenic cocktail were observed in the patients who had
specific serum IgE antibodies against C. album but, there
was a patient (supplementary Table 1, patient no 26) with
high level of specific IgE that had negative skin reactivity
to the allergenic cocktail and C. album pollen extract. So
we resulted that allergen specific IgE levels and skin sen-
sitivity were poorly correlated (supplementary Table 2).
The recent result and other mentioned consequences cor-
roborate that, it is important to perform SPT and serologic
tests simultaneously to recognize the allergenic activity of
allergen molecules.
Finally, data analysis from this study points out that
reliable in vivo and in vitro diagnosis of C. album allergy is
now possible with the allergenic cocktail and rChe a 1,
rChe a 2 and rChe a 3. Therefore, we propose use of the
allergenic cocktail for a new form of component-resolved
diagnosis tools in diagnosis of C. album allergic patients.
In addition, diagnostic tests that establish on the recombi-
nant allergens are able to determine the disease-eliciting
allergens. So careful formulation of the allergenic cocktail
with the use of responsible allergens improve the CRIT in
adjacent future.
Acknowledgments This study was supported by Research admin-
istration of Mashhad University of Medical Sciences.
References
1. Nicole A, Prem LB, Mohan BS (2002) Aeroallergens and polli-
nosis: molecular and immunological characteristics of cloned
pollen allergens. Aerobiologia 18:87–106
2. Barderas R, Villalba M, Lombardero M, Rodriguez R (2002)
Identification and characterization of Che a 1 allergen from
Chenopodium album pollen. Int Arch Allergy Immunol
127:47–54
3. Fereidouni M, Hossini RF, Azad FJ, Assarehzadegan MA, Var-
asteh A (2009) Skin prick test reactivity to common aeroallergens
among allergic rhinitis patients in Iran. Allergol Immunopathol
37:73–79
4. Suliaman FA, Holmes WF, Kwick S, Khouri F, Ratard R (1997)
Pattern of immediate type hypersensitivity reactions in the east-
ern province, Saudi Arabia. Ann Allergy Asthma Immunol
78:415–418
5. Ezeamuzie CI, Thomson MS, Al-Ali S, Dowaisan A, Khan M,
Hijazi Z (2000) Asthma in the desert: spectrum of the sensitizing
aeroallergens. Allergy 55:157–162
6. Barderas R, Villalba M, Pascual CY, Batanero E, Rodriguez R
(2004) Profilin (Che a 2) and polcalcin (Che a 3) are relevant
allergens of Chenopodium album pollen: isolation, amino acid
sequences, and immunologic properties. J Allergy Clin Immunol
113:1192–1198
7. Kay AB (2001) Allergy and allergic diseases. First of two parts.
N Engl J Med 344:30–37
8. Casolaro V, Georas SN, Song Z, Ono SJ (1996) Biology and
genetics of atopic disease. Curr Opin Immunol 8:796–803
9. Heiss S, Mahler V, Steiner R, Spitzauer S, Schweiger C, Kraft D,
Valenta R (1999) Component-resolved diagnosis (CRD) of type I
allergy with recombinant grass and tree pollen allergens by skin
testing. J Invest Dermatol 113:830–837
10. Seppala U, Dauly C, Robinson S, Hornshaw M, Larsen JN, Ipsen
H (2011) Absolute quantification of allergens from complex
mixtures: a new sensitive tool for standardization of allergen
extracts for specific immunotherapy. J Proteome Res
10(4):2113–2122. doi:10.1021/pr101150z
11. Becker WM, Vogel L, Vieths S (2006) Standardization of aller-
gen extracts for immunotherapy: where do we stand? Curr Opin
Allergy Clin Immunol 6:470–475
12. Valenta R, Lidholm J, Niederberger V, Hayek B, Kraft D,
Gronlund H (1999) The recombinant allergen-based concept of
component-resolved diagnostics and immunotherapy (CRD and
CRIT). Clin Exp Allergy 29:896–904
13. Barber D, de la Torre F, Feo F et al (2008) Understanding patient
sensitization profiles in complex pollen areas: a molecular epi-
demiological study. Allergy 63:1550–1558
14. Skamstrup Hansen K, Poulsen LK (2010) Component resolved
testing for allergic sensitization. Curr Allergy Asthma Rep
10:340–348
15. Vahedi F, Sankian M, Moghadam M, Mohaddesfar M, Ghobadi
S, Varasteh AR (2010) Cloning and expression of Che a 1, the
major allergen of Chenopodium album in Escherichia coli. Appl
Biochem Biotechnol 163(7):895–905. doi:10.1007/s12010-010-
9093-y
16. Laemmli UK (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227:680–685
17. Bradford MM (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal Biochem 72:248–254
18. Dreborg S (1989) The skin prick test in the diagnosis of atopic
allergy. J Am Acad Dermatol 21:820–821
19. Amini A, Sankian M, Assarehzadegan MA, Vahedi F, Varasteh A
(2010) Chenopodium album pollen profilin (Che a 2): homology
modeling and evaluation of cross-reactivity with allergenic
profilins based on predicted potential IgE epitopes and IgE
reactivity analysis. Mol Biol Rep. 38(4):2579–2587. doi:10.1007/
s11033-010-0398-2
20. Assarehzadegan MA, Sankian M, Jabbari F, Tehrani M, Falak R,
Varasteh A (2011) Identification of methionine synthase (Sal k
3), as a novel allergen of Salsola kali pollen. Mol Biol Rep
38:65–73
21. Chapman MD, Smith AM, Vailes LD, Arruda LK, Dhanaraj V,
Pomes A (2000) Recombinant allergens for diagnosis and therapy
of allergic disease. J Allergy Clin Immunol 106:409–418
Mol Biol Rep (2012) 39:3169–3178 3177
123
22. Scheurer S (2006) Improvement of the diagnosis of allergy by
using purified allergens. Clin Exp Allergy 36:1483–1486
23. Salcedo G, Diaz-Perales A (2010) Component-resolved diagnosis
of allergy: more is better? Clin Exp Allergy 40:836–838
24. Lidholm J (2009) The importance of molecular allergens for in
vitro testing: a critical evaluation of component-resolved diag-
nostics. Arb Paul Ehrlich Inst Bundesamt Sera Impfstoffe Frankf
A M 96:157–161
25. Goikoetxea MJ, Cabrera-Freitag P, Sanz ML, Fernandez-Benitez
M (2010) The importance of in vitro component-resolved diag-
nosis in paediatric patients. Allergol Immunopathol 38:37–40
26. Pittner G, Vrtala S, Thomas WR et al (2004) Component-
resolved diagnosis of house-dust mite allergy with purified nat-
ural and recombinant mite allergens. Clin Exp Allergy 34:
597–603
27. Cudowska B, Kaczmarski M (2004) Diagnostic value of birch
recombinant allergens (rBet v1, profilin rBet v2) in children with
pollen-related food allergy. Rocz Akad Med Bialymst 49:
111–115
28. Laffer S, Spitzauer S, Susani M et al (1996) Comparison of
recombinant timothy grass pollen allergens with natural extract
for diagnosis of grass pollen allergy in different populations.
J Allergy Clin Immunol 98:652–658
29. De Amici M, Alesina R, Moratti R, Ciprandi G (2010) Compo-
nent-resolved diagnosis for phleum allergy: the role of recom-
binants. J Asthma 47:750–753
30. Gonzalez-Rioja R, Ferrer A, Arilla MC et al (2007) Diagnosis of
Parietaria judaica pollen allergy using natural and recombinant
Par j 1 and Par j 2 allergens. Clin Exp Allergy 37:243–250
31. Barber D, de la Torre F, Lombardero M et al (2009) Component-
resolved diagnosis of pollen allergy based on skin testing with
profilin, polcalcin and lipid transfer protein pan-allergens. Clin
Exp Allergy 39:1764–1773
32. Tehrani M, Sankian M, Assarehzadegan MA, Falak R, Jabbari F,
Varasteh A (2010) Immunochemical characterization of Ama-
ranthus retroflexus pollen extract: extensive cross-reactive aller-
genic components among the four species of Amaranthaceae/
Chenopodiaceae. Iran J Allergy Asthma Immunol 9:87–95
33. Assarehzadegan MA, Amini A, Sankian M, Tehrani M, Jabbari F,
Varasteh A (2010) Sal k 4, a new allergen of Salsola kali,is
profilin: a predictive value of conserved conformational regions
in cross-reactivity with other plant-derived profilins. Biosci
Biotechnol Biochem 74:1441–1446
34. Galles C, Gomez RL, Spampinato CP (2011) PMS1 from Ara-
bidopsis thaliana: optimization of protein overexpression in
Escherichia coli. Mol Biol Rep 38:1063–1070
3178 Mol Biol Rep (2012) 39:3169–3178
123
