Integrative Functional Genomics Identifies Systemic Lupus Erythematosus Causal Genetic Variant in the IRF5 Risk Locus

Abstract

Objective
IRF5 plays a crucial role in the development of lupus. Genome‐wide association studies have identified several systemic lupus erythematosus (SLE) risk single‐nucleotide polymorphisms (SNPs) enriched in the IRF5 locus. However, no comprehensive genome editing–based functional analysis exists to establish a direct link between these variants and altered IRF5 expression, particularly for enhancer variants. This study was undertaken to dissect the regulatory function and mechanisms of SLE IRF5 enhancer risk variants and to explore the utilization of clustered regularly interspaced short palindromic repeat interference (CRISPRi) to regulate the expression of disease risk gene to intervene in the disease.

Methods
Epigenomic profiles and expression quantitative trait locus analysis were applied to prioritize putative functional variants in the IRF5 locus. CRISPR‐mediated deletion, activation, and interference were performed to investigate the genetic function of rs4728142. Allele‐specific chromatin immunoprecipitation–quantitative polymerase chain reaction and allele‐specific formaldehyde‐assisted isolation of regulatory element–quantitative polymerase chain reaction were used to decipher the mechanism of alleles differentially regulating IRF5 expression. The CRISPRi approach was used to evaluate the intervention effect in monocytes from SLE patients.

Results
SLE risk SNP rs4728142 was located in an enhancer region, indicating a disease‐related regulatory function, and risk allele rs4728142‐A was closely associated with increased IRF5 expression. We demonstrated that an rs4728142‐containing region could act as an enhancer to regulate the expression of IRF5. Moreover, rs4728142 affected the binding affinity of zinc finger and BTB domain–containing protein 3 (ZBTB3), a transcription factor involved in regulation. Furthermore, in monocytes from SLE patients, CRISPR‐based interference with the regulation of this enhancer attenuated the production of disease‐associated cytokines.

Conclusion
These results demonstrate that the rs4728142‐A allele increases the SLE risk by affecting ZBTB3 binding, chromatin status, and regulating IRF5 expression, establishing a biologic link between genetic variation and lupus pathogenesis.

Full text

Integrative Functional Genomics Identifies Systemic Lupus
Erythematosus Causal Genetic Variant in the IRF5 Risk Locus
Guojun Hou,
1
Tian Zhou,
2
Ning Xu,
2
Zhihua Yin,
3
Xinyi Zhu,
2
Yutong Zhang,
2
Yange Cui,
4
Jianyang Ma,
2
Yuanjia Tang,
2
Zhaorui Cheng,
2
Yiwei Shen,
2
Yashuo Chen,
3
Ling-Hua Zou,
3
Yong-fei Wang,
5
Zihang Yin,
6
Ya Guo,
6
Huihua Ding,
2
Zhizhong Ye,
3
and Nan Shen
7
Objective. IRF5 plays a crucial role in the development of lupus. Genome-wide association studies have identified
several systemic lupus erythematosus (SLE) risk single-nucleotide polymorphisms (SNPs) enriched in the IRF5 locus.
However, no comprehensive genome editing–based functional analysis exists to establish a direct link between these
variants and altered IRF5 expression, particularly for enhancer variants. This study was undertaken to dissect the reg-
ulatory function and mechanisms of SLE IRF5 enhancer risk variants and to explore the utilization of clustered regularly
interspaced short palindromic repeat interference (CRISPRi) to regulate the expression of disease risk gene to
intervene in the disease.
Methods. Epigenomic profiles and expression quantitative trait locus analysis were applied to prioritize putative
functional variants in the IRF5 locus. CRISPR-mediated deletion, activation, and interference were performed to inves-
tigate the genetic function of rs4728142. Allele-specific chromatin immunoprecipitation–quantitative polymerase chain
reaction and allele-specific formaldehyde-assisted isolation of regulatory element–quantitative polymerase chain reac-
tion were used to decipher the mechanism of alleles differentially regulating IRF5 expression. The CRISPRi approach
was used to evaluate the intervention effect in monocytes from SLE patients.
Results. SLE risk SNP rs4728142 was located in an enhancer region, indicating a disease-related regulatory func-
tion, and risk allele rs4728142-A was closely associated with increased IRF5 expression. We demonstrated that an
rs4728142-containing region could act as an enhancer to regulate the expression of IRF5. Moreover, rs4728142
affected the binding affinity of zinc finger and BTB domain–containing protein 3 (ZBTB3), a transcription factor involved
in regulation. Furthermore, in monocytes from SLE patients, CRISPR-based interference with the regulation of this
enhancer attenuated the production of disease-associated cytokines.
Conclusion. These results demonstrate that the rs4728142-A allele increases the SLE risk by affecting ZBTB3
binding, chromatin status, and regulating IRF5 expression, establishing a biologic link between genetic variation and
lupus pathogenesis.
INTRODUCTION
Systemic lupus erythematosus (SLE) is a complex autoim-
mune disease, which is characterized by the breakdown of
tolerance to self antigens, with the presentation of autoantibody
production, inflammation, and organ damage (1). Although the
pathogenesis of SLE is not well characterized, the genetic factors
definitely contribute to disease etiology (2–4). Genome-wide
Supported by the National Natural Science Foundation of China (grants
31930037 and 32141004), the Shanghai Science and Technology Innovation
Plan (grant 21Y31900200), and the Sanming Project of Medicine in Shenzhen
(grant SZSM201602087).
Drs. Hou, Zhou, Xu, and Zhihua Yin contributed equally to this work.
1
Guojun Hou, PhD: Shanghai Institute of Rheumatology, Renji Hospital,
Shanghai Jiao Tong University School of Medicine, Shanghai, China, Shenzhen
Futian Hospital for Rheumatic Diseases, Shenzhen, China, and State Key Lab-
oratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji
Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China;
2
Tian Zhou, PhD, Ning Xu, MSc, Xinyi Zhu, BS, Yutong Zhang, BS, Jianyang
Ma, MSc, Yuanjia Tang, PhD, Zhaorui Cheng, BS, Yiwei Shen, BS, Huihua Ding,
MD: Shanghai Institute of Rheumatology, Renji Hospital, Shanghai Jiao Tong
University School of Medicine, Shanghai, China;
3
Zhihua Yin, PhD, Yashuo
Chen, MD, Ling-Hua Zou, MD, Zhizhong Ye, MD: Shenzhen Futian Hospital
for Rheumatic Diseases, and Joint Research Laboratory for Rheumatology of
Shenzhen University Health Science Center and Shenzhen Futian Hospital
for Rheumatic Diseases, Shenzhen, China;
4
Yange Cui, PhD: Shanghai Insti-
tute of Nutrition and Health, Shanghai Institutes for Biological Sciences, Uni-
versity of Chinese Academy of Sciences, Chinese Academy of Sciences,
Shanghai, China;
5
Yong-fei Wang, PhD: School of Life and Health Sciences,
School of Medicine, and Warshel Institute for Computational Biology, The Chi-
nese University of Hong Kong, Shenzhen, Guangdong, China;
6
Zihang Yin,
PhD, Ya Guo, PhD: Sheng Yushou Center of Cell Biology and Immunology,
Joint International Research Laboratory of Metabolic & Developmental Sci-
ences, School of Life Sciences and Biotechnology, Shanghai Jiao Tong Univer-
sity, Shanghai, China;
7
Nan Shen, MD, PhD: Shanghai Institute of
Rheumatology, Renji Hospital, Shanghai Jiao Tong University School of
574
Arthritis & Rheumatology
Vol. 75, No. 4, April 2023, pp 574–585
DOI 10.1002/art.42390
© 2022 American College of Rheumatology

association studies (GWAS) have identified >100 genetic variants
associated with SLE susceptibility (4,5). Most of these SNPs are
located in the noncoding regions of the genome, particularly in
enhancers (6,7), suggesting the important role of enhancers in
SLE development.
Enhancers are the specific DNA sequences that bind tran-
scription factors to increase the transcription of target genes.
Enhancers could shape the expression pattern of genes to con-
trol cell identity and cell fate. An increasing number of diseases
are linked to enhancer dysfunction (6,8,9). Identification of the
disease-associated enhancers and deciphering the underlying
mechanism involved in the disease will help us understand the
development of SLE pathogenesis. Notably, the disease func-
tional variants could pinpoint the disease-associated enhancers
(10–13). However, few studies have identified the functional
enhancer variants of SLE, let alone deciphered the mechanisms.
Interferon regulatory factor 5 (IRF5) is a transcription factor
that plays a critical role in mediating innate and adaptive immunity.
Many genetic studies have revealed a strong association between
IRF5 and SLE (14–18). The use of IRF5-knockout mice directly
demonstrated the critical role of IRF5 in the pathogenesis of SLE
(19,20). Moreover, IRF5 is abnormally expressed and activated
in SLE patients and affects various pathogenic pathways by regu-
lating the production of type I interferons (IFNs), proinflammatory
cytokines, autoantibodies, etc. (21–24). Genetic variants were
considered as an important factor that affects the expression of
IRF5. For example, rs2004640 is located in the 50untranslated
region (UTR) of IRF5 and creates an alternative splice site to regu-
late the expression of IRF5 different isoforms (14). Also,
rs10954213 is located in the 30UTR of IRF5 and alters a polyade-
nylation signal, influencing IRF5 expression (16,25).
In addition, a 5-bp CGGGG indel located at the 50UTR of
IRF5 creates an Sp-1 binding site involved in the regulation of
IRF5 expression (17). However, the genetic variants in the
enhancers of IRF5 are rarely studied, and the mechanism of
these variants acting in SLE remains elusive. To fill this gap, we
focused our study on the enhancer variants at the IRF5 locus.
By integrating genetic studies, epigenomic analysis, and clus-
tered regularly interspaced short palindromic repeat (CRISPR)
editing, we found that rs4728142 is an SLE-associated causal
genetic variant, and the genomic region containing rs4728142
regulates the expression of IRF5 as a functional enhancer.
Moreover, the rs4728142 alleles differentially bind with zinc fin-
ger and BTB domain–containing protein 3 (ZBTB3) and alter
the chromatin state to fine-tune IRF5 expression involved in dis-
ease pathogenesis.
SUBJECTS AND METHODS
Study design. The overall study design is shown in
Figure 1. First, we integrated public genetic data, epigenomic
data, and expression quantitative trait locus (eQTL) data to iden-
tify the candidate variants. Next, we performed functional stud-
ies such as CRISPR activation assay, CRISPR interference
(CRISPRi) assay, CRISPR-mediated deletion, allele-specific
chromatin immunoprecipitation–quantitative polymerase chain
reaction (AS-ChIP-qPCR), and allele-specific formaldehyde-
assisted isolation of regulatory element–quantitative polymerase
chain reaction (AS-FAIRE-qPCR) to validate whether rs4728142
is a functional variant.
Cell culture. U937 and HEK 293T cells were purchased
from the Cell Bank of Shanghai Institutes for Biological Sciences.
U937 cells were cultured with RPMI 1640 (no. 22400105; Gibco)
together with 10% fetal bovine serum (FBS) (no. 10099141,
Gibco), and HEK 293T cells were cultured with Dulbecco’s mod-
ified Eagle’s medium (no. 11039047; Gibco) together with 10%
FBS. Cells were all cultured at 37Cin5%CO
2
.
RNA extraction and reverse transcriptase–
quantitative PCR (RT-qPCR) analysis. Total RNA was isolated
using Trizol reagent (no. 15596026; Invitrogen). Complementary
DNA (cDNA) was synthesized using PrimeScript RT reagent Kit
(no. RR037A; Takara) using 500 ng of RNA per cDNA reaction.
RT-qPCR reactions were performed using TB Green Premix Ex
Taq reagent (no. RR420A) according to the protocol of the manu-
facturer (Takara). Results were analyzed using the comparative
Ct method, and the GAPDH messenger RNA level was chosen
as the normalization. The primers used in the present study are
listed in Supplementary Table 1 (available on the Arthritis &
Rheumatology website at https://onlinelibrary.wiley.com/doi/
10.1002/art.42390).
Lentivirus production. Lentiviral particles were produced
in HEK 293T cells using the pMD2.G (no. 12259; Addgene) and
psPAX2 (no. 12260; Addgene) packaging plasmids. Briefly,
5×10
5
cells were seeded into the wells of 6-well plates. After
incubation overnight, cells were transfected with 1 μg of a plasmid
expressing single-guide RNA (sgRNA) or short hairpin RNA
(shRNA), 250 ng of pMD2.G, and 750 ng of psPAX2, using 3 μlof
Lipofectamine 2000 (no. 11668019; Thermo Fisher). After transfec-
tion for 6 hours, the media was changed. After transfection for
72 hours, the virus supernatant was collected and centrifuged at
Medicine, Shanghai, China, Shenzhen Futian Hospital for Rheumatic Diseases,
Shenzhen, China, State Key Laboratory of Oncogenes and Related Genes,
Shanghai Cancer Institute, Renji Hospital, Shanghai Jiao Tong University
School of Medicine, Shanghai, China, Center for Autoimmune Genomics and
Etiology, Division of Human Genetics, Cincinnati Children’s Hospital Medical
Center, Cincinnati, Ohio, and Department of Pediatrics, University of Cincin-
nati, Cincinnati, Ohio.
Author disclosures are available at https://onlinelibrary.wiley.com/action/
downloadSupplement?doi=10.1002%2Fart.42390&file=art42390-sup-0001-
Disclosureform.pdf.
Address correspondence via email to Nan Shen, MD, PhD, at
nanshensibs@gmail.com.
Submitted for publication July 11, 2022; accepted in revised form October
4, 2022.
SLE-ASSOCIATED RISK VARIANT REGULATES IRF5 EXPRESSION 575
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

4C for 10 minutes. The supernatant was aliquoted and stored
at −80C.
Short hairpin RNA knockdown assay. Single-guide
RNA expression vector pKLV-U6-gRNA-PGKpuro2ABFP plas-
mid (no. 50946; Addgene) was used to express shRNA. The plas-
mid was cut with restriction enzyme BbsI (no. R0539L; NEB) and
BamHI (no. R0136L; NEB), and then the large fragment was gel-
purified (no. DC301-01; Vazyme). Oligos were synthesized in
Tsingke (Shanghai), annealed, and subsequently cloned into the
digested plasmid. Short hairpin RNA lentiviral particles were pro-
duced as mentioned above. The virus particles were added into
2×10
5
cells, and centrifuged at 1,000gfor 90 minutes to trans-
duce the cells. After infection for 24 hours, the media was
changed and cells were cultured for another 72 hours with 1 μg/ml
puromycin (ant-pr-1; InvivoGen). Then, cells were collected and
RNA was extracted to detect target gene expression. The oligos
used in the present study are listed in Supplementary Table 2
(https://onlinelibrary.wiley.com/doi/10.1002/art.42390).
Genome editing in cell line. To delete the fragment har-
boring rs4728142 or introduce rs4728142 different alleles,
sgRNAs targeting the rs4728142 site were designed using online
CRISPR design tool CHOPCHOP. Single-guide RNA oligos were
annealed and subcloned into PX458 (no. 48138; Addgene) vec-
tor, which can express a chimeric guide RNA, a human codon-
optimized Cas9, and a green fluorescent protein (GFP). Plasmids
were transformed into Tstbl3 chemically competent Escherichia
coli (no. TSC-C06; Tsingke) and grown, and plasmid DNA was
extracted and purified. Next, 6 μg of CRISPR plasmid and 30 μg
of a 121-bp single-stranded oligodeoxynucleotide donor tem-
plate (Sango Biotech) were electroporated into 1.5 × 10
6
cells
using the 100-μl Neon Transfection System (Thermo Fisher),
under conditions of 1,400V, 10 msec, and 3 pulses. After trans-
fection for 12 hours, 1 μMSCR-7 (no. SML1546; Sigma-Aldrich)
was added to enhance homology-directed repair (HDR) effi-
ciency. After transfection for 3 days, single cells with high GFP
fluorescence was sorted into 96-well plates using flow cytometry
(FACS Aris II; BD Biosciences). After 14 days of cell growth, the
genomic DNA of individual clone was isolated using a TransDirect
Animal Tissue PCR Kit (no. AD201-02; Transgen Biotech), the
sequence containing rs4728142 was amplified, and the genotype
was identified by Sanger sequencing. Clones with different
rs4728142 alleles or rs4728142-containing region knockout
clones were chosen for further study. The oligos used in the pres-
ent study are listed in Supplementary Tables 3 and 4 (https://
onlinelibrary.wiley.com/doi/10.1002/art.42390).
CRISPRi assays. Cells stably expressingKruppel-associated
box (KRAB)/dCas9 were generated using the pHR-SFFV-KRAB-
dCas9-P2A-mCherry plasmid (no. 60954; Addgene). Briefly,
lentiviral particles were generated in HEK 293T cells using the
pMD2.G (no. 12259; Addgene) and psPAX2 (no. 12260; Addgene)
packaging plasmids. U937 cells were transduced by the lentivi-
ruses for 24 hours, the medium was changed, and cells were
cultured for another 48 hours. Next, cells with a strong mCherry
signal were sorted by fluorescence-activated cell sorting
(FACS). Single-guide RNAs targeting the rs4728142-containing
region were designed by CHOPCHOP. Oligos were synthesized
in Tsingke and subcloned into pKLV-U6-gRNA(BbsI)-
PGKpuro2ABFP plasmid (no. 50946; Addgene). Single-guide
RNA lentiviral particles were produced and transduced
KRAB/dCas9/mCherry U937 cells as mentioned above, and
cells were further treated with 1 μg/ml puromycin for 3 days.
Subsequently, cells were collected and RNA was extracted to
test target gene expression. The oligos used in the present study
Genome wide association studies
0
5
15
10
-log
10
(P)
GG GA AA
Expression
Tissue and cell-type
eQTL analysis
cell-type
Epigenetic modication
H3K27ac H3K4me1 DHS
SLE patients
Monocytes isolation
Transfect KRAB-dCas9
interference system
Inhibit IRF5 expression
IL-6 IFN-β
Proinammatory cytokines, Type I IFNs
HDR
Knock out Activation Interference
IRF5 mRNA expression
Chromatin accessebility
Transcription factor binding
Single base regulatory mechanism
RT-qPCR
AS-FAIRE-qPCR
AS-ChIP-qPCR
rs4728142 G/A
Enhancer verication by CRISPR
Figure 1. Study design and experimental steps. eQTL = expression quantitative trait locus; CRISPR = clustered regularly interspaced short
palindromic repeat; HDR = homology-directed repair; RT-qPCR = reverse–transcriptase quantitative polymerase chain reaction; AS-FAIRE-
qPCR = allele-specific formaldehyde-assisted isolation of regulatory element–qPCR; AS-ChIP-qPCR = allele-specific chromatin
immunoprecipitation–qPCR; SLE = systemic lupus erythematosus; KRAB = Kruppel-associated box; IL-6 = interleukin 6; IFNβ= interferon-β.
HOU ET AL576
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

are listed in Supplementary Table 5 (https://onlinelibrary.wiley.
com/doi/10.1002/art.42390).
Inhibition by CRISPRi of the expression of proin-
flammatory cytokines and type I IFNs in U937 cells. For
this assay, we first generated U937 cells stably expressing Toll-
like receptor 7 (TLR-7) and KRAB/dCas9. The lentivirus particles
of pLV-TLR7-GFPSpark plasmid (no. HG11204-ACGLN; Sino-
Biological, lnc.) were packaged and transduced into the U937/
KRAB/dCas9 cells. The cells with strong GFP signal were sorted
by FACS to generate cells stably expressing TLR-7. Single-guide
RNA lentiviral particles targeting the rs4728142 site were pro-
duced and transduced the cells, as mentioned above, and cells
were further treated with 1 μg/ml puromycin for 3 days. Then,
cells were stimulated with 1 μg/ml R837 (TLR-7 agonist tlrl-imqs;
InvivoGen) for 24 hours to induce the expression of proinflamma-
tory cytokines and type I IFNs. The cells were collected and RNA
was extracted to test target gene expression. The oligos used in
the present study are listed in Supplementary Table 1 (https://
onlinelibrary.wiley.com/doi/10.1002/art.42390).
CRISPR activation (CRISPRa) assay. Cells stably
expressing the CRISPRa system were generated using the
lenti-dCas-VP64-Blast plasmid (no. 61425; Addgene) and
lenti-MS2-P65-HSF1-Hygro plasmid (no. 61426; Addgene), as
mentioned above. Cells were transduced by the lentivirus and
treated with 10 μg/ml blasticidin (no. ant-bl-1; InvivoGen) and
300 μg/ml hygromcin B (no. 60224ES03; Yeasen) for 1 week to iden-
tify the cells stably expressing CRISPRa. Single-guide RNAs targeting
the rs4728142-containing region were subcloned into lenti-sgRNA
(MS2)-zeo backbone plasmid (no. 61427; Addgene). Single-guide
RNA lentivirus particles were produced, and the cells (stably express-
ing dCas/VP64 and MS2-P65-HSF1) were transduced as mentioned
above. Next, the cells were treated with 400 μg/ml Zeocin
(no. R25001; Thermo Fisher) for 72 hours. After that, the cells were
collected and RNA was extracted to test target gene expression.
The oligos used in the present study are listed in Supplementary
Table 5 (https://onlinelibrary.wiley.com/doi/10.1002/art.42390).
AS-ChIP-qPCR. ChIP assay was carried out using a Simple-
ChIP Plus Enzymatic Chromatin IP Kit (no. 9005; Cell Signaling
Technology). Briefly, 1 × 10
7
cells were crosslinked with 1%formal-
dehyde solution for 10 minutes at room temperature and quenched
with 0.125Mglycine. Cells were lysed in 1× buffer A and treated
with 1 μl of micrococcal nuclease for 30 minutes at 37Ctodigest
DNA. After digestion, pellet nuclei were resuspended in 1× ChIP
buffer and subsequently sonicated with a Bioruptor sonicator
(Diagenode) at high power for 5 cycles for 30 seconds, with
30 seconds between cycles. After removing insoluble debris, the
supernatant was separately incubated with specificantibodies
against rabbit IgG ZBTB3 (no. ab106536; Abcam), H3K27ac
(no. ab177178; Abcam), and Protein G Magnetic Beads at 4C
overnight. Beads were washed and DNA was reverse-crosslinked
and purified to detect the enrichment. Allele-specific qPCR primers
were designed to specifically amplify the rs4728142 region with a
G or A allele in theDNA samples from the ChIP experiment. Results
were analyzed in a manner similar to normal qPCR. The oligos used
in the present study are listed in Supplementary Table 4 (https://
onlinelibrary.wiley.com/doi/10.1002/art.42390).
AS-FAIRE-qPCR. The FAIRE DNA sample was prepared
using the aliquot from the crosslinked and sonicated ChIP chro-
matin. The chromatin lysate was treated with phenol/chloroform/
isoamyl alcohol and then with chloroform/isoamyl alcohol. Then
the aqueous phase was precipitated with ethanol and dissolved
in 10 mMTris HCL. After that, samples were reverse-crosslinked,
purified, and analyzed using AS-qPCR primers. Results were
analyzed in a manner similar to normal qPCR. The oligos used in
the present study are listed in Supplementary Table 4 (https://
onlinelibrary.wiley.com/doi/10.1002/art.42390).
SLE patients. Patients were diagnosed based on the 1997
update of the American College of Rheumatology revised SLE cri-
teria (26) in the rheumatology department at Shanghai Renji Hos-
pital. The clinical characteristics of the SLE patients are displayed
in Supplementary Table 6 (https://onlinelibrary.wiley.com/doi/10.
1002/art.42390). All patients provided written informed consent
according to the internal review and ethics boards of Renji Hospi-
tal and Shanghai Jiao Tong University.
CRISPRi in SLE monocytes. Blood samples from SLE
patients were collected with 10 ml vacuum sterile tube, and
peripheral blood mononuclear cells (PBMCs) were isolated by
Ficoll gradient centrifugation. After isolation, PBMCs were incu-
bated with CD14 microbeads (no. 130-050-201; Miltenyi Biotec)
to isolate CD14+ monocytes. Monocytes (3 × 10
5
) were trans-
fected with 1 μg KRAB/dCas9 plasmid and 1 μg sgRNA plasmid
using the Neon Transfection System under the following condi-
tions: 1,600V, 10 msec, and 3 pulses. After transfection for
24 hours, the cells were collected and RNA was extracted to
detect target gene expression.
Statistical analysis. All statistical analyses were per-
formed using GraphPad Prism 8 software and calculated using a
Student’s paired or unpaired 2-tailed t-test as indicated in the fig-
ure legends, unless otherwise mentioned. Pvalues less than 0.05
are considered significant.
Data availability statement. The data from GSE155555
(7) were used to analyze the assay for transposase-accessible
chromatin using sequencing (ATAC-seq) and H3K27ac signal of
U937 cells. All data relevant to the study are included in the article
or uploaded as supplementary information.
SLE-ASSOCIATED RISK VARIANT REGULATES IRF5 EXPRESSION 577
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

RESULTS
Significant association of rs4728142 with SLE and
with interferon regulatory factor 5 (IRF5) expression in
a tissue-dependent manner. IRF5 is a key transcription factor
involved in multiple steps of SLE pathogenesis (22). In SLE
patients, IRF5 is abnormally expressed and activated. This dys-
function is associated with genetic variants (14,16,17,21). Several
studies have shown that genetic variants, such as rs2004640
(14), rs10954213 (16,25), and 5-bp CGGGG indel (17), could reg-
ulate the expression of IRF5. However, these causal variants are
located in UTR region or promoter region (Figure 2A), and the func-
tional variants in enhancers are poorly studied. Given the impor-
tance of enhancers in controlling disease-critical gene expression,
we decided to focus our study on the enhancer variants of IRF5.
To identify the SLE causal variants in the enhancers of IRF5,we
first collected all SLE risk variants at IRF5 locus (GWAS catalog var-
iants and the variants that have been reported to affect IRF5 expres-
sion in SLE patients) (2,5,14,16,17,27–35). Next, we used the
SCREEN system (https://screen.encodeproject.org/), a tool for
searching candidate cis-regulatory elements derived from Encyclo-
pedia of DNA Elements (ENCODE) data, to analyze the enhancer
characters of these single-nucleotide polymorphisms (SNPs) (36).
Finally, we chose noncoding SNPs located in the enhancers as
our candidates (Figure 2B). After analysis, we identified 12 SLE risk
variants at this locus. Among them, 6 SNPs were intergenic vari-
ants, 3 SNPs were UTR variants, 2 SNPs affected the splicing of
IRF5, and 1 SNP was an intron variant (Figure 2C,Supplementary
Figures 1A–H, and Supplementary Table 7, https://onlinelibrary.
wiley.com/doi/10.1002/art.42390). Notably, only intergenic SNP
rs4728142 is located in the distal enhancer-like element
(Supplementary Figure 1A–H). rs4728142 is located in the
upstream region of IRF5 (Figure 2A); a genetic study (18)has
identified rs4728142-A as a risk allele that is associated with an
increased risk for SLE development at the IRF5 locus, and there
is no linkage disequilibrium with the reported functional variants
(rs2004640, rs10954213, and 5-bp CGGGG indel).
Meanwhile, a phenome-wide association study (PheWAS),
which is a powerful approach to comprehensively evaluate associ-
ations between genetic variants and different phenotypes, revealed
that rs4728142 has the strongest association with the SLE pheno-
type (n = 4,756 GWAS) (https://atlas.ctglab.nl/)(37,38) (Figure 2D
and Supplementary Table 8, https://onlinelibrary.wiley.com/doi/
10.1002/art.42390). In addition, eQTL data from the Genotype-
Tissue Expression (GTEx) project suggest that rs4728142 is
strongly associated with the expression of IRF5 (Supplementary
Figure 2 and Supplementary Table 9) and the effect of
rs4728142 different alleles on IRF5 expression is tissue-
Ex2 Ex3 Ex4 Ex6 Ex7 Ex8 Ex9Ex1a Ex1b Ex1c
rs2004640
Exon 1b
splicing site
rs10954213
Alter the
polyadenylation site
5 bp CGGGG
indel
Alters
SP1 binding
rs4728142
A
Activities Aging Body Structures Cardiovascular Cell Cognitive Connective Tissue Dermatological Endocrine Environment
Environmental Gastrointestinal Hematological Immunological Infection Metabolic Mortality Neoplasms Neurological Nutritional
Ophthalmolo
g
ical Psychiatric Reproduction Respiratory Skeletal Social Interactions
-log10 P-value
Systemic Lupus Erythematosus
Systemic Lupus Erythematosus
Estimated glomerular filtration rate
Estimated glomerular filtration rate
Primary biliary cirrhosis
Rheumatoid Arthritis
Mouth/teeth dental problems: Mouth ulcers
D
GWAS
SLE risk SNPs at IRF5 locus
12 SNPs
Analysis of the Enhancer characters
of SNP by SCREEN system
of ENCODE
SNP in the Enhancer region
as candidate
B
6
3
21
Intergenic region
UTR
Splicing site
Intron
region
C
IRF5
Figure 2. Identification of rs4728142 as a candidate enhancer variant at IRF5 locus. A, Locations of rs4728142, CGGGG indel, rs2004640, and
rs10954213 relative to IRF5.B, Flow chart identifying the enhancer variants at IRF5 locus. C, Pie chart showing the distribution of functional anno-
tation of systemic lupus erythematosus (SLE) risk variants at the IRF5 locus. D, Manhattan plot of phenome-wide association studies showing the
significance of association between single-nucleotide polymorphism (SNP) rs4728142 and different phenotypes, with phenotypes ordered within
each phenotype category by Pvalue. SLE was the most significant phenotypic association with rs4728142. Along the x-axis, different phenotypes
are color-coded. The y-axis indicates level of significance. SNPs with Pvalues >0.05 are not shown in the plot. There are 287 data points displayed
in the plot (Bonferroni corrected P= 1.74 × 10
−4
). The association results were retrieved from the genome-wide association study (GWAS) ATLAS
(ref. 36). See Supplementary Figures 1 and 2 (https://onlinelibrary.wiley.com/doi/10.1002/art.42390). SCREEN = Search Candidate cis-
Regulatory Elements by ENCODE; ENCODE = Encyclopedia of DNA Elements; UTR = untranslated region. Color figure can be viewed in the online
issue, which is available at http://onlinelibrary.wiley.com/doi/10.1002/art.42390/abstract.
HOU ET AL578
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

dependent (Supplementary Figure 2). More importantly, epige-
nomic analysis in different immune cell subsets shows that the
rs4728142-containing region is enriched with the signals of
H3K27ac modification, H3K4me1 modification, and DNase I hyper-
sensitivity sites occupancy (http://www.roadmapepigenomics.org/)
(Figure 3A), suggesting that this region is an active enhancer-like ele-
ment. Based on these observations, we focused our study on
rs4728142.
The rs4728142-containing region is a functional
regulatory element modulating IRF5 expression.
Expression QTL data indicate an association between
rs4728412 and IRF5, and epigenomic analysis shows that the
rs4728142-containing region is an active enhancer-like element.
To directly evaluate the regulatory function and target genes of
this region, we attempted to delete the enhancer fragment con-
taining rs4728142 using CRISPR/Cas9-mediated knockout.
Since the rs4728142-containing region has the strongest
enhancer marker signal in monocytes (Figure 3A) and the expres-
sion of IRF5 is highest in monocytes (Supplementary Figure 3A,
https://onlinelibrary.wiley.com/doi/10.1002/art.42390), we per-
formed this assay in U937 monocyte cells.
We designed a sgRNA targeting the rs4728142 site and
transfected the sgRNA/Cas9 expression vector into the U937 cell
with the Neon Transfection System. Then, single cells were sorted
by FACS, cultured, and the genotype was identified. After screen-
ing, we successfully identified rs4728142 knockout clones
(Figures 3B and C). Compared to rs4728142 wild-type clones,
deletion of the rs4728142-containing region decreased the
expression of IRF5 (Figure 3D), which is consistent with strong
signals of H3K27ac and chromatin accessibility of this region in
U937 cells (Figures 3E and F). Moreover, the expression of other
nearby genes such as TNPO3, TPI1P2, and ATP6V1F was not
affected by the deletion of this region (Supplementary
Figures 3B–D, https://onlinelibrary.wiley.com/doi/10.1002/art.
42390). Further, we used CRISPRa or CRISPRi to confirm the
regulatory function of this region (Figures 3G and H). As shown
in Figures 3I and J, the CRISPRa or CRISPRi assay successfully
up-regulated or down-regulated the expression of IRF5, respec-
tively. Taken together, these results demonstrate that the
rs4728142-containing region functions as a regulatory element
regulating the expression of IRF5.
IRF5 expression differentially affected by rs4728142
alleles. After verifying the regulatory function of the
rs4728142-containing region, we sought to explore whether the
genotype of rs4728142 could affect the IRF5 expression. Regulo-
meDB (https://regulomedb.org/regulome-search)(39), a data-
base that annotates SNPs with known or predicted regulatory
elements in the noncoding regions of the genome, ranked
rs4728142 as a potential function variant with a high score of 1f
(Supplementary Figure 4A, https://onlinelibrary.wiley.com/doi/
10.1002/art.42390). Meanwhile, data from the GTEx project
(https://gtexportal.org/home/)(40) and the ImmuNexUT project
(https://www.immunexut.org/)(41) suggest that rs4728142 is
strongly associated with the expression of IRF5, and the effect of
different rs4728142 alleles on IRF5 expression is tissue- or cell-
type–dependent, where the risk allele rs4728142-A is associated
with a higher expression of IRF5 relative to the nonrisk
allele rs4728142-G (Figures 4A and Band Supplementary
Figures 4B–G).
To establish the direct link between rs4728142 alleles and
the expression of IRF5, we performed CRISPR-mediated HDR
at the rs4728142 site to introduce different alleles of rs4728142
in U937 cells (Figure 4C). After screening 200 clones, we finally
identified 7 clones with the homozygous G allele and 7 clones with
the heterogenous GA allele. We then detected IRF5 expression in
these clones. As shown in Figure 4D, rs4728142 risk allele
A demonstrated higher IRF5 expression than the rs4728142
nonrisk allele G, which is consistent with the public eQTL results.
Collectively, these data suggest that rs4728142 is a functional
variant modulating the expression of IRF5 in a genotype-
dependent manner in monocytes.
Altered transcription factor ZBTB3 binding and
chromatin status via rs4728142 alleles to regulate IRF5
expression. Functional SNPs usually fine-tune the expression
of the target gene by mediating the critical transcription factors
binding (42). To identify possible transcription factors that bind
to rs4728142, we first used bioinformatic tools such as JASPAR
(43), the Catalog of Inferred Sequence Binding Preferences (44)
database, and the Human Transcription Factors catalog (45)to
predict the candidate transcription factors. We found that the
binding motif of ZBTB3 overlaps with the rs4728142 sequence
(Figure 4E). Notably, the ZBTB3 binding motif has a higher binding
affinity with the rs4728142-A risk allele relative to that of the
rs4728142-G nonrisk allele (Figure 4E). Further, we carried out
AS-ChIP-qPCR to confirm this genotype-dependent binding. As
expected, we observed that ZBTB3 prefers to bind to risk allele
A (Figure 4F). Consistent with this observation, AS-FAIRE-qPCR
data suggest that the rs4728142-A risk allele enriched more
FAIRE signal than nonrisk allele G (Figure 4G), indicating that
chromatin harboring risk allele A has higher chromatin accessibil-
ity than nonrisk allele G. In addition, knockdown of ZBTB3
reduced the expression of IRF5 in the U937 monocytes
(Figures 4H and I). These data reveal that the rs4728142 allele–
specific bind to ZBTB3 differentially regulates the expression
of IRF5.
KRAB/dCas9 system targeting the rs4728142 locus
reduces the production of proinflammatory cytokines
and type I IFNs by regulating the expression of IRF5.The
abnormal expression and activation of IRF5 induce the expression
of proinflammatory cytokines and type I IFNs, thus contributing to
SLE-ASSOCIATED RISK VARIANT REGULATES IRF5 EXPRESSION 579
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

B
Scale
chr7:
5 kb hg19
128
,
570
,
000 128
,
571
,
000 128
,
572
,
000 128
,
573
,
000 128
,
574
,
000 128
,
575
,
000 128
,
576
,
000 128
,
577
,
000 128
,
578
,
000
IRF5
DNaseI
50 _
1
H3K4me1
100 _
0
H3K27ac
25 _
0
DNaseI
175 _
1
H3K4me1
175 _
0
H3K27ac
175 _
0
DNaseI
50 _
1
H3K4me1
100 _
0
H3K27ac
50
0
CD3+T cellsCD14+Monocytes
CD19+B cells
rs4728142
A
Neon transfection system
sgRNA-Cas9
expression vector Single GFP+ cell sorting by FACS
2 weeks culture
TTCCAGGTCACACCCCAAAAAGCTCTGAGCCGGTGTTAGTAAGAAATGGGGAGG
TTCCAGGTCACA----------------------------------------------------------AAGAAATGGGGAGG
rs4728142
sgRNA
WT
KO
C
WT KO
0.0
0.5
1.0
1.5
**
IRF5 relative expression
D
050100150200
IgG
H3K27ac
H3K27ac ChIP-qPCR in rs4728142 region
Fold enrichment
***
E
F
rs4728142
0-56
0-35
0-51
0-47
U-937 H3K27ac ChIP-seq 1
U-937 H3K27ac ChIP-seq 2
U-937 ATAC-seq 1
U-937 ATAC-seq 2
inhibitor
dCas9 protein
genome sgRNA
CRISPRi
rs4728142
IRF5
activator
dCas9 protein
genome sgRNA
CRISPRa
rs4728142
IRF5
G
HJ
CRISPRa or CRISPRi U-937 cells
lentivirus infection
(sgRNA targeting rs4728142
or non-targeting region)
selection for 3 days
CRISPRa or CRISPRi expressed
and sgRNA expressed U-937 cells RT-qPCR detection the
expression of IRF5
I
sgNC sgRNA1sgRNA2
0
1
2
3
IRF5 relative expression
**
**
CRISPRa
sgNC sgRNA1sgRNA2
0.0
0.5
1.0
1.5
IRF5 relative expression
*
**
CRISPRi
Figure 3. The genomic region containing rs4728142 is a functional enhancer that regulates the expression of IRF5.A, Epigenomic analysis of
the rs4728142-containing region in different immune cell subsets. B, Flow chart for generating wild-type (WT) clones and knockout (KO) clones
using CRISPR/Cas9 technology. C, Genotype of WT clones and KO clones at the rs4728142 site. D, RT-qPCR analysis of IRF5 expression in
U937 WT and KO clones (n = 3 biologic sample replicates). E, ChIP-qPCR analysis of the enrichment of H3K27ac in the rs4728142-containing
region. F, ChIP-seq and the assay for transposase-accessible chromatin using sequencing (ATAC-seq) analysis of the enrichment of H3K27ac
and chromatin accessibility of rs4728142-containing region in U937 cells. G, Experimental design to activate or inhibit IRF5 expression by target-
ing the rs4728142-containing region using the CRISPR activation (CRISPRa) system or the CRISPR interference (CRISPRi) system. H, Compo-
nents of CRISPRa and CRISPRi. Iand J, RT-qPCR analysis of the expression of IRF5 in CRISPRa U937 cells and CRISPRi U937 cells (n = 3
biologic sample replicates). Bars show the mean ± SEM. * = P< 0.05; ** = P< 0.01; *** = P< 0.001, by Student’s unpaired 2-tailed t-test. See
Supplementary Figure 3 (https://onlinelibrary.wiley.com/doi/10.1002/art.42390). sgRNA = targeting rs4728142 enhancer single-guide RNA;
GFP = green fluorescent protein; FACS = fluorescence-activated cell sorting; sgNC = negative control sgRNA (see Figure 1for other definitions).
Color figure can be viewed in the online issue, which is available at http://onlinelibrary.wiley.com/doi/10.1002/art.42390/abstract.
HOU ET AL580
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

GA
0
2
4
6
8
AS-FAIRE-qPCR
*
Fold enrichment
GG
GA
0.0
0.5
1.0
1.5
2.0
**
IRF5 relative expression
G
EF
H
I
genome sgRNA
Double strands break
ssODN
rs4728142 GGrs4728142 AA
rs4728142
D
C
GCCGGTG
GCCAGTG
rs4728142-A
rs4728142-G
ZBTB3 motif
IRF5
(225) (326) (119)
GG GA AA
-3.0
-2.0
-1.0
0.0
1.0
2.0
3.0
Norm. Expression
Whole Blood
rs4728142
p value: 3.42e-78
B
shNC shZBTB3
0.0
0.5
1.0
1.5
ZBTB3 relative expression
***
shNC shZBTB3
0.0
0.5
1.0
1.5
IRF5 relative expression
**
GAGA
0
5
10
15 AS-ChIP-qPCR
Fold enrichment
IgG ZBTB3
✱
A
Figure 4. SLE risk single-nucleotide polymorphism rs4728142 affects zinc finger and BTB domain–containing protein 3 (ZBTB3) binding and
chromatin state to regulate gene expression. Aand B, Expression QTL analysis revealing genotype-dependent expression of IRF5 for
rs4728142 in different immune cell subpopulations (ImmuNexUT project) and whole blood (Genotype-Tissue Expression project). Data are shown
as box plots. Each box represents the range of values. Lines inside the boxes represent the mean. C, Flow chart for creating clones containing dif-
ferent rs4728142 alleles. D, RT-qPCR analysis showing increased IRF5 expression in G/A clones compared to G/G clones (n = 7 biologic sample
replicates). E, The ZBTB3 family DNA binding motif in the context of the DNA sequence surrounding rs4728142. Tall nucleotides above the x-axis
indicate preferred DNA bases. Bases below the x-axis are disfavored. F, Transcription factor ZBTB3 preference to bind to the A risk allele at
rs4728142 as determined by AS-ChIP-qPCR in rs4728142 heterozygous U937 cell clone (n = 3 biologic sample replicates). G, The
rs4728142-A risk allele showing higher chromatin accessibility than the nonrisk allele G, as detected by AS-FAIRE-qPCR (n = 3 biologic sample
replicates). Hand I, RT-qPCR showing the expression of ZBTB3 and IRF5 after ZBTB3 knockdown (n = 3 biologic sample replicates). Bars show
the mean ± SEM. * = P< 0.05; ** = P< 0.01; *** = P< 0.001, by Student’s unpaired 2-tailed t-test. See Supplementary Figure 4 (https://onlineli
brary.wiley.com/doi/10.1002/art.42390). shNC = negative control short hairpin; shZBTB3 = short hairpin ZBTB3 (see Figure 1for other defini-
tions). Color figure can be viewed in the online issue, which is available at http://onlinelibrary.wiley.com/doi/10.1002/art.42390/abstract.
SLE-ASSOCIATED RISK VARIANT REGULATES IRF5 EXPRESSION 581
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

SLE pathogenesis. Previous studies have demonstrated that IRF5
can act as a therapeutic target for SLE intervention (23,24) and
that inhibition of IRF5 could strongly down-regulate the expres-
sion of proinflammatory cytokine and type I IFNs, thereby improv-
ing the symptoms of SLE. Since the rs4728142-containing region
acts as an enhancer modulating the expression of IRF5 in mono-
cytes, we speculated that KRAB/dCas9 that targets the
rs4728142-containing region could decrease proinflammatory
cytokine and type I IFN production by reducing the expression of
IRF5. To test this hypothesis, we first delivered the KRAB/dCas9
system (targeting the rs4728142-containing region) to the U937
cells. Subsequently, the cells were stimulated with R837, a
TLR-7 agonist that can lead to lupus-like autoimmunity (46), and
cytokine expression induced by R837 was detected.
As expected, the expression of proinflammatory cyto-
kines and type I IFNs, such as IL6 and IFN
β
,wassignificantly
reduced (Figure 5A–C). Next, we attempted to apply the
KRAB/dCas9 system to SLE monocytes to test the disease
intervention effect. We recruited SLE patients and isolated
the CD14+ monocytes. Next, the KRAB/dCas9 system was
transduced into these cells using the Neon Transfection
System (Figure 5D). We found that IRF5 expression was
effectively inhibited (Figure 5E), and IL6 and IFN
β
expression
were also reduced (Figures 5F and G). Taken together,
SLE patients’ monocytes SLE patients’ monocytesSLE patients’ monocytes
ABC
E
FG
D
sgNC sg1
0.0
0.5
1.0
1.5 IRF5
Relative expression
**
sgNC sg1
0.0
0.5
1.0
1.5 IL6
Relative expression
**
sgNC sg1
0.0
0.5
1.0
1.5
IFNβ
Relative expression
**
rs4728142
Monocytes
High IRF5 expression
High IL6
High IFNβ
Monocytes
Decreased IRF5 expression
Decreased IL6
Decreased IFNβ
Target rs4728142-containing region by CRISPRi
dCas9 KRAB
IRF5
sgRNA
SLE patients
sgNC sgRNA
0.0
0.5
1.0
1.5
IRF5
Relative expression
✱
sgNC sgRNA
0.0
0.5
1.0
1.5
IL6
Relative expression
✱
sgNC sgRNA
0.0
0.5
1.0
1.5
IFNβ
Relative expression
✱✱
Figure 5. Targeting the rs4728142-containing region inhibits production of proinflammatory cytokines and type I IFNs by regulating IRF5 expres-
sion. A–C, KRAB/dCas9 system targeting rs4728142 site inhibits the expression of IRF5,IL6, and IFN
β
induced by R837 in U937 cells (n = 3 bio-
logic sample replicates). D, Experimental design to inhibit the production of proinflammatory cytokines and type I IFNs by the CRISPR interference
(CRISPRi) system in SLE patients is shown. E–G, CRISPRi therapy decreases the production of proinflammatory cytokines and type I IFNs in SLE
monocytes by inhibiting IRF5 expression through targeting the rs4728142 site (n = 5 biologic sample replicates). Bars show the mean ± SEM.
*=P< 0.05; ** = P< 0.01, by Student’s unpaired 2-tailed t-test (A–C) and by Student’s paired 2-tailed t-test (E–G). sgNC = negative control sin-
gle-guide RNA; sgRNA = targeting rs4728142 enhancer single-guide RNA (see Figure 1for other definitions). Color figure can be viewed in the
online issue, which is available at http://onlinelibrary.wiley.com/doi/10.1002/art.42390/abstract.
HOU ET AL582
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

these findings suggest that the rs4728142-containing region
could be a prospective target to regulate the expression
of IRF5 and modulate SLE etiopathogenesis–relevant gene
expression.
DISCUSSION
GWAS have identified hundreds of genetic variants that are
associated with SLE; however, defining the causal variant and
understanding the functional mechanism of genetic variants
underlying the pathologic process is a challenge, particularly for
the variants in the noncoding genome (5,47,48). In this study,
we identified that enhancer variant rs4728142 is a functionally
causal variant of SLE, by integrating genetic studies, epigenomic
analysis, and CRISPR editing. We investigated the functional
mechanism of rs4728142 that mediates SLE risk and found that
it may regulate IRF5 expression involving SLE pathogenesis
(Figure 6).
Genetic variants are widely involved in the regulation of
gene expression, and many genetic studies have indicated
a strong association between rs4718142 and IRF5 (17,18).
Through analysis of the epigenetic mark around the
rs4728142-containing region, we have demonstrated that the
rs4728142-harboring region has a potential regulatory role.
Using CRISPR/Cas9-mediated deletion, CRISPRa, and CRIS-
PRi, we identified that the rs4728142-containing region func-
tions as an enhancer regulating the expression of IRF5 in
monocytes. Notably, eQTL data and epigenomic analysis
revealed that the rs4728142-containing region also has poten-
tial regulatory functions in B cells and T cells. However, whether
this region could regulate IRF5 expression in these 2 cell types
still needs to be studied.
Expression QTL studies suggest an association between
rs4728142 alleles and IRF5 expression. Using CRISPR/
Cas9-mediated HDR, we constructed cell clones harboring differ-
ent rs4728142 alleles and confirmed the allele-specific regulation
of IRF5 expression. Furthermore, our findings revealed that tran-
scription factor ZBTB3 preferentially binds to the rs4728142 risk
allele, which might alter the chromatin state and thus lead to
genotype-dependent expression of IRF5, which is consistent with
a previous study that used electrophoretic mobility shift assays
(18). Our findings confirm the link between enhancer variant
rs4728142 and IRF5 for the first time and provide a plausible
mechanism by which rs4728142 modulates IRF5 expression.
SLE is accompanied by dysregulated production of proin-
flammatory cytokine and type I IFNs (49,50), and IRF5 plays a crit-
ical role in mediating the production of proinflammatory cytokines
and type I IFNs (22). Here, we directed the CRISPRi system to the
rs4728142-harboring region, effectively down-regulating expres-
sion of proinflammatory cytokines and type I IFNs by inhibiting
IRF5 expression in SLE monocytes, which indicates that targeting
the rs4872142 enhancer region might attenuate SLE develop-
ment. Our study provides new insights into the therapy of human
disease by targeting the enhancers of disease-critical genes. In
summary, we have provided evidence that the SLE-associated
enhancer risk variant regulates IRF5 expression and proves useful
in the treatment of SLE by targeting noncoding sequences.
ACKNOWLEDGMENT
We thank the participants in this study.
AUTHOR CONTRIBUTIONS
All authors were involved in drafting the article or revising it critically
for important intellectual content, and all authors approved the final ver-
sion to be published. Dr. Shen had full access to all of the data in the
study and takes responsibility for the integrity of the data and the accu-
racy of the data analysis.
Study conception and design. Hou, Ye, N. Shen.
Acquisition of data. Hou, Zhou, Xu, Zhihua Yin, Zhu, Zhang, Cui, Ma,
Tang, Cheng, Y. Shen, Chen, Zou, Wang, Zihang Yin, Guo, Ding, Ye,
N. Shen.
Analysis and interpretation of data. Hou, Zhou, Xu, Zhihua Yin, Ye,
N. Shen.
GCC
G
GTG
ZBTB3
GCCAGTG
ZBTB3
IRF
5
IRF
5
3.7 kb 3.7 kb
high IRF5
high IL-6
high IFNβ
low IRF5
low IL-6
low IFNβ
rs4728142 A/G
SLE risk allele SLE protective allele
Figure 6. The proposed model for rs4728142 alleles mediates SLE risk. The rs4728142-A risk allele has a high binding affinity with transcription
factor zinc finger and BTB domain–containing protein 3 (ZBTB3), resulting in the high expression of IRF5 and increasing SLE risk. In contrast, the
rs4728142-G nonrisk allele has a low binding affinity with ZBTB3, leading to the reduced expression of IRF5 and decreasing SLE risk. See Figure 1
for other definitions. Color figure can be viewed in the online issue, which is available at http://onlinelibrary.wiley.com/doi/10.1002/art.42390/abstract.
SLE-ASSOCIATED RISK VARIANT REGULATES IRF5 EXPRESSION 583
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

REFERENCES
1. Tsokos GC, Lo MS, Costa Reis P, et al. New insights into the immuno-
pathogenesis of systemic lupus erythematosus [review]. Nat Rev
Rheumatol 2016;12:716–30.
2. Bentham J, Morris DL, Graham DS, et al. Genetic association analy-
ses implicate aberrant regulation of innate and adaptive immunity
genes in the pathogenesis of systemic lupus erythematosus. Nat
Genet 2015;47:1457–64.
3. Ramos PS, Shedlock AM, Langefeld CD. Genetics of autoimmune
diseases: insights from population genetics. J Hum Genet 2015;60:
657–64.
4. Wang YF, Zhang Y, Lin Z, et al. Identification of 38 novel loci for sys-
temic lupus erythematosus and genetic heterogeneity between
ancestral groups. Nat Commun 2021;12:772.
5. Yin X, Kim K, Suetsugu H, et al. Meta-analysis of 208370 East Asians
identifies 113 susceptibility loci for systemic lupus erythematosus.
Ann Rheum Dis 2021;80:632–40.
6. Hnisz D, Brian JA, Tong IL, et al. Super-Enhancers in the control of cell
identity and disease. Cell 2013;155:934–47.
7. Nasser J, Bergman DT, Fulco CP, et al. Genome-wide enhancer
maps link risk variants to disease genes. Nature 2021;593:238–43.
8. Bulger M, Groudine M. Functional and mechanistic diversity of distal
transcription enhancers. Cell 2011;144:327–39.
9. Heinz S, Romanoski CE, Benner C, et al. The selection and function of
cell type-specific enhancers [review]. Nat Rev Mol Cell Bio 2015;
16:144.
10. Hou G, Harley IT, Lu X, et al. SLE non-coding genetic risk variant
determines the epigenetic dysfunction of an immune cell specific
enhancer that controls disease-critical microRNA expression. Nat
Commun 2021;12:135.
11. Zhou T, Zhu X, Ye Z, et al. Lupus enhancer risk variant causes dysreg-
ulation of IRF8 through cooperative lncRNA and DNA methylation
machinery. Nat Commun 2022;13:1855.
12. Gupta RM, Hadaya J, Trehan A, et al. A genetic variant associated
with five vascular diseases is a distal regulator of endothelin-1 gene
expression. Cell 2017;170:522–33.
13. Soldner F, Stelzer Y, Shivalila CS, et al. Parkinson-associated risk var-
iant in distal enhancer of alpha-synuclein modulates target gene
expression. Nature 2016;533:95–9.
14. Graham RR, Kozyrev SV, Baechler EC, et al. A common haplotype of
interferon regulatory factor 5 (IRF5) regulates splicing and expression
and is associated with increased risk of systemic lupus erythemato-
sus. Nat Genet 2006;38:550–5.
15. Kozyrev SV, Lewen S, Reddy PM, et al. Structural insertion/deletion
variation in IRF5 is associated with a risk haplotype and defines the
precise IRF5 isoforms expressed in systemic lupus erythematosus.
Arthritis Rheum 2007;56:1234–41.
16. Graham RR, Kyogoku C, Sigurdsson S, et al. Three functional variants
of IFN regulatory factor 5 (IRF5) define risk and protective haplotypes
for human lupus. Proc Natl Acad Sci U S A 2007;104:6758–63.
17. Sigurdsson S, Goring HH, Kristjansdottir G, et al. Comprehensive
evaluation of the genetic variants of interferon regulatory factor
5 (IRF5) reveals a novel 5 bp length polymorphism as strong risk factor
for systemic lupus erythematosus. Hum Mol Genet 2008;17:872–81.
18. Kottyan LC, Zoller EE, Bene J, et al. The IRF5-TNPO3 association with
systemic lupus erythematosus has two components that other auto-
immune disorders variably share. Hum Mol Genet 2015;24:582–96.
19. Savitsky DA, Yanai H, Tamura T, et al. Contribution of IRF5 in B cells to
the development of murine SLE-like disease through its transcriptional
control of the IgG2a locus. Proc Nat Acad Sci 2010;107:10154–9.
20. Ban T, Sato GR, Nishiyama A, et al. Lyn kinase suppresses the tran-
scriptional activity of IRF5 in the TLR-MyD88 pathway to restrain the
development of autoimmunity. Immunity 2016;45:319–32.
21. Feng D, Stone RC, Eloranta ML, et al. Genetic variants and disease-
associated factors contribute to enhanced interferon regulatory factor
5 expression in blood cells of patients with systemic lupus erythema-
tosus. Arthritis and Rheum 2010;62:562–73.
22. Lazzari E, Jefferies CA. IRF5-mediated signaling and implications for
SLE. Clin Immunol 2014;153:343–52.
23. Ban T, Kikuchi M, Sato GR, et al. Genetic and chemical inhibition of
IRF5 suppresses pre-existing mouse lupus-like disease. Nat Com-
mun 2021;12:4379.
24. Song S, De S, Nelson V, et al. Inhibition of IRF5 hyperactivation pro-
tects from lupus onset and severity. J Clin Invest 2020;130:6700–17.
25. Graham DS, Manku H, Wagner S, et al. Association of IRF5 in UK SLE
families identifies a variant involved in polyadenylation. Hum Mol
Genet 2007;16:579–91.
26. Hochberg MC, for the Diagnostic and Therapeutic Criteria Committee
of the American College of Rheumatology. Updating the American
College of Rheumatology revised criteria for the classification of sys-
temic lupus erythematosus [letter]. Arthritis Rheum 1997;40:1725.
27. MacArthur J, Bowler E, Cerezo M, et al. The new NHGRI-EBI catalog
of published genome-wide association studies (GWAS Catalog).
Nucleic Acids Res 2016;45:D896–901.
28. Tangtanatakul P, Thumarat C, Satproedprai N, et al. Meta-analysis of
genome-wide association study identifies FBN2 as a novel locus
associated with systemic lupus erythematosus in Thai population.
Arthritis Res Ther 2020;22:185.
29. Yang W, Tang H, Zhang Y, et al. Meta-analysis followed by replication
identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B
as associated with systemic lupus erythematosus in Asians.
Am J Hum Genet 2013;92:41–51.
30. Han JW, Zheng HF, Cui Y, et al. Genome-wide association study in a
Chinese Han population identifies nine new susceptibility loci for sys-
temic lupus erythematosus. Nat Genet 2009;41:1234–7.
31. Alarc
on-Riquelme ME, Ziegler JT, Molineros J, et al. Genome-wide
association study in an Amerindian ancestry population reveals novel
systemic lupus erythematosus risk loci and the role of European
admixture. Arthritis Rheumatol 2016;68:932–43.
32. Lessard CJ, Sajuthi S, Zhao J, et al. Identification of a systemic lupus
erythematosus risk locus spanning ATG16L2, FCHSD2, and P2RY2
in Koreans. Arthritis Rheumatol 2016;68:1197–1209.
33. Langefeld CD, Ainsworth HC, Graham DS, et al. Transancestral map-
ping and genetic load in systemic lupus erythematosus. Nat Commun
2017;8:16021.
34. Morris DL, Sheng Y, Zhang Y, et al. Genome-wide association meta-
analysis in Chinese and European individuals identifies ten new loci
associated with systemic lupus erythematosus. Nat Genet 2016;48:
940–6.
35. Gateva V, Sandling JK, Hom G, et al. A large-scale replication study
identifies TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10 as risk loci
for systemic lupus erythematosus. Nat Genet 2009;41:1228–33.
36. Moore JE, Purcaro MJ, Pratt HE, et al. Expanded encyclopaedias of
DNA elements in the human and mouse genomes. Nature 2020;
583:699–710.
37. Watanabe K, Stringer S, Frei O, et al. A global overview of pleiotropy
and genetic architecture in complex traits. Nat Genet 2019;51:
1339–48.
38. Ge T, Chen CY, Neale BM, et al. Phenome-wide heritability analysis of
the UK Biobank. PLoS Genet 2017;13:e1006711.
39. Boyle AP, Hong EL, Hariharan M, et al. Annotation of functional varia-
tion in personal genomes using RegulomeDB. Genome Res 2012;22:
1790–7.
HOU ET AL584
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

40. The GTEx Consortium. The GTEx Consortium atlas of genetic regula-
tory effects across human tissues. Science 2020,369:1318–30.
41. Ota M, Nagafuchi Y, Hatano H, et al. Dynamic landscape of immune
cell-specific gene regulation in immune-mediated diseases. Cell
2021;184:3006–21.
42. Abramov S, Boytsov A, Bykova D, et al. Landscape of allele-specific
transcription factor binding in the human genome. Nat Commun
2021;12:2751.
43. Fornes O, Castro-Mondragon JA, Khan A, et al. JASPAR 2020:
update of the open-access database of transcription factor binding
profiles. Nucleic Acids Res 2020;48:D87–92.
44. Weirauch MT, Yang A, Albu M, et al. Determination and inference of
eukaryotic transcription factor sequence specificity. Cell 2014;158:
1431–43.
45. Lambert SA, Jolma A, Campitelli LF, et al. The human transcription
factors. Cell 2018;172:650–65.
46. Yokogawa M, Takaishi M, Nakajima K, et al. Epicutaneous application
of toll-like receptor 7 agonists leads to systemic autoimmunity in wild-
type mice: a new model of systemic Lupus erythematosus. Arthritis
Rheumatol 2014;66:694–706.
47. Chen L, Wang YF, Liu L, et al. Genome-wide assessment of genetic
risk for systemic lupus erythematosus and disease severity. Hum
Mol Genet 2020;29:1745–56.
48. Sharon E, Chen SA, Khosla NM, et al. Functional genetic variants
revealed by massively parallel precise genome editing. Cell 2018;
175:544–57.
49. Umare V, Pradhan V, Nadkar M. Effect of proinflammatory cytokines
(IL-6, TNF-α, and IL-1β) on clinical manifestations in Indian SLE
patients. Mediators Inflamm 2014;2014:385297.
50. Pacheco Y, Acosta-Ampudia Y, Ramírez-Santana C, et al. Cytokines
and inflammatory mediators in systemic lupus erythematosus. Eur
Med J Rheumatol 2018;5:83–92.
SLE-ASSOCIATED RISK VARIANT REGULATES IRF5 EXPRESSION 585
23265205, 2023, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/art.42390 by Affiliated Hospitals, Wiley Online Library on [31/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License