Spermatogenesis in Bclw-Deficient Mice

Abstract

Bclw is a death-protecting member of the Bcl2 family of apoptosis-regulating proteins. Mice that are mutant for Bclw display progressive and nearly complete testicular degeneration. We performed a morphometric evaluation of testicular histopathology in Bclw-deficient male mice between 9 days postnatal (p9) through 1 yr of age. Germ cell loss began by p22, with only few germ cells remaining beyond 7 mo of age. A complete block to elongated spermatid development at step 13 occurred during the first wave of spermatogenesis, whereas other types of germ cells were lost sporadically. Depletion of Sertoli cells commenced between p20 and p23 and continued until 1 yr of age, when few, if any, Sertoli cells remained. Mitochondria appeared to be swollen and the cytoplasm dense by electron microscopy, but degenerating Bclw-deficient Sertoli cells failed to display classical features of apoptosis, such as chromatin condensation and nuclear fragmentation. Macrophages entered seminiferous tubules and formed foreign-body giant cells that engulfed and phagocytosed the degenerated Sertoli cells. Leydig cell hyperplasia was evident between 3 and 5 mo of age. However, beginning at 7 mo of age, Leydig cells underwent apoptosis, with dead cells being phagocytosed by macrophages. The aforementioned cell losses culminated in a testis-containing vasculature, intertubular phagocytic cells, and peritubular cell "ghosts." An RNA in situ hybridization study indicates that Bclw is expressed in Sertoli cells in the adult mouse testis. Consequently, the diploid germ cell death may be an indirect effect of defective Sertoli cell function. Western analysis was used to confirm that Bclw is not expressed in spermatids; thus, loss of this cell type most likely results from defective Sertoli cell function. Because Bclw does not appear to be expressed in Leydig cells, loss of Leydig cells in Bclw-deficient mice may result from depletion of Sertoli cells. Bclw-deficient mice serve as a unique model to study homeostasis of cell populations in the testis.

Full text

Spermatogenesis in Bclw-Deficient Mice
1
Lonnie D. Russell
2,4
, Jeff Warren
4
, Luciano Debeljuk
4
, Laura L. Richardson
3,5
, Patryce L.
Mahar
6
, Katrina G. Waymire
6
, Scott P. Amy
6
, Andrea J. Ross
6,7
, and Grant R.
MacGregor
2,6
4
Department of Physiology, Southern Illinois University School of Medicine, Carbondale, Illinois
62901-6512
5
Department of Biochemistry and Cellular and Molecular Biology, University of Tennessee,
Knoxville, Tennessee 37996
6
Center for Molecular Medicine, Emory University School of Medicine, Atlanta, Georgia 30322
7
Graduate Program in Biochemistry, Cell and Developmental Biology, Emory University, Atlanta,
Georgia 30322
Abstract
Bclw is a death-protecting member of the Bcl2 family of apoptosis-regulating proteins. Mice that
are mutant for Bclw display progressive and nearly complete testicular degeneration. We
performed a morphometric evaluation of testicular histopathology in Bclw-deficient male mice
between 9 days postnatal (p9) through 1 yr of age. Germ cell loss began by p22, with only few
germ cells remaining beyond 7 mo of age. A complete block to elongated spermatid development
at step 13 occurred during the first wave of spermatogenesis, whereas other types of germ cells
were lost sporadically. Depletion of Sertoli cells commenced between p20 and p23 and continued
until 1 yr of age, when few, if any, Sertoli cells remained. Mitochondria appeared to be swollen
and the cytoplasm dense by electron microscopy, but degenerating Bclw-deficient Sertoli cells
failed to display classical features of apoptosis, such as chromatin condensation and nuclear
fragmentation. Macrophages entered seminiferous tubules and formed foreign-body giant cells
that engulfed and phagocytosed the degenerated Sertoli cells. Leydig cell hyperplasia was evident
between 3 and 5 mo of age. However, beginning at 7 mo of age, Leydig cells underwent apoptosis,
with dead cells being phagocytosed by macrophages. The aforementioned cell losses culminated
in a testis-containing vasculature, inter-tubular phagocytic cells, and peritubular cell “ghosts.” An
RNA in situ hybridization study indicates that Bclw is expressed in Sertoli cells in the adult mouse
testis. Consequently, the diploid germ cell death may be an indirect effect of defective Sertoli cell
function. Western analysis was used to confirm that Bclw is not expressed in spermatids; thus, loss
of this cell type most likely results from defective Sertoli cell function. Because Bclw does not
appear to be expressed in Leydig cells, loss of Leydig cells in Bclw-deficient mice may result
from depletion of Sertoli cells. Bclw-deficient mice serve as a unique model to study homeostasis
of cell populations in the testis.
1
Supported by grants from the NIH (HD36437 to G.R.M. and HD35494 to L.D.R.). Part of this work was performed in the laboratory
of M.A. Handel with support from HD31376.
2
Correspondence: Lonnie D. Russell, Dept. of Physiology, Southern Illinois University, Life Sci II, Room 174, Lincoln Drive,
Carbondale, IL 62901-6501. FAX: 618 453 1517; lrussell@siumed.edu, Grant R. MacGregor, Center for Molecular Medicine, Emory
University School of Medicine, 1462 Clifton Rd. NE, 403-E, Atlanta, GA 30322. FAX: 404 727 8367; gmacgre@emory.edu.
3
Current address: Dept. of Anatomy and Cell Biology, Marshall University, Huntington, WV 25704.
NIH Public Access
Author Manuscript
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
Published in final edited form as:
Biol Reprod
. 2001 July ; 65(1): 318–332.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Keywords
aging; apoptosis; developmental biology; gametogenesis; Leydig cells; Sertoli cells; testes
INTRODUCTION
Mammalian spermatogenesis occurs in the testis, where germ cell development is intimately
supported by Sertoli cells, the somatic component of the seminiferous epithelium. Sertoli
cells are responsible for effecting the downstream process of male sexual differentiation [1].
During mouse development, Sertoli cells can be found in the developing gonad by
Embryonic Day 11.5 [1]. Sertoli cells are mitotic during embryogenesis, with the exception
of a brief period during organization of the testicular cords. In postnatal mice, Sertoli cells
complete exit from mitosis by Postnatal Day 17 (p17), concomitant with development of the
initial wave of spermatogenesis [2,3]. Exit from mitosis precedes terminal differentiation of
Sertoli cells, which includes development of specialized junctional complexes on the lateral
sides of the cell that are involved in forming the Sertoli cell barrier [4]. Postmitotic Sertoli
cells are not replaced during adult life, and little is currently known about the factors
required for survival of postmitotic Sertoli cells in vivo.
Insertional mutagenesis in the mouse is a powerful method for identifying genes that are
required for a developmental or homeostatic process. We previously used retro-viral gene
trapping to identify a requirement for Bclw in mouse spermatogenesis [5]. Bclw is a member
of the Bcl2 gene family, which is involved in regulation of apoptosis during development
and homeostasis in metazoans. At a simplistic level, the Bcl2 family of proteins is composed
of two classes of members: those that help to protect from cell death (e.g., A1, Bcl2, Bclw,
BclX
L
, and Mcl1), and those that help to promote cell death (e.g., Bad, Bak, Bax, Bid, Bik,
Bim, Bok, BclX
S
, Blk, and Hrk). Current models for the function of these two classes of
proteins are intricate but, at the fundamental level, involve regulation of the release of
cytochrome c from mitochondria [6]. The death-promoting members of the Bcl2 family
function to mediate release of cytochrome c, which is a cofactor for adaptor molecules that,
in turn, regulate activation of latent enzymes named caspases. The activated caspases digest
key proteins within the cell, which ultimately results in the apoptotic death of the cell.
Death-protecting members of the Bcl2 family can block the release of cytochrome c by the
death-promoting Bcl2 family members, at least in part by physically associating with the
death-promoting members [6–9].
Our initial report of Bclw-deficient mice involved characterization of the mutant allele,
identification of the testicular cells in which Bclw is expressed, and a preliminary
description of development of the mutant phenotype in adult animals [5]. In the present
study, we have used additional techniques to re-examine the pattern of Bclw expression in
the adult mouse testis. We provide evidence that Bclw is expressed in Sertoli cells, but not in
haploid spermatids. We have also extended the previous findings by performing a rigorous
quantitative analysis of the developmental course of testicular degeneration in Bclw-
deficient mice to more than 1 yr of age, including analysis of the ultrastructural features
associated with loss of Bclw-deficient Sertoli cells. We show that the Bclw-deficient mouse
has a unique phenotype, in which Sertoli cell loss occurs gradually during a period of 1 yr.
Bclw-deficient Sertoli cells do not display many of the classical features of apoptosis while
degenerating. Sertoli cells are first shed and then phagocytosed by macrophages that enter
seminiferous tubules to form highly phagocytic, multinucleate, foreign-body giant cells.
Depletion of Leydig cells via apoptosis follows loss of the Sertoli cell population. Sporadic
loss of germ cells begins around p19 and is essentially completed by 6 mo of age. Haploid
germ cells arrest at step 13 of spermiogenesis and are phagocytosed. Bclw is not expressed
Russell et al. Page 2
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

in haploid germ cells, suggesting that their loss is an indirect effect of Sertoli cell
dysfunction. The results provide further information regarding possible functions for Bclw in
male germ cell development, and they offer novel insight into potential roles for Sertoli cells
in regulating homeostasis of the adult Leydig cell population.
MATERIALS AND METHODS
Mice
The derivation and molecular characterization of the gene-trap mutation within the Bclw
gene (Bcl2l2 locus) in the ROSA41 strain of mouse has been reported elsewhere [5,10].
Analysis of RNA transcripts by reverse transcription-polymerase chain reaction (PCR) and
of proteins by Western blot analysis indicates that the mutant allele is null for a Bclw protein
product [5].
Animals used in this study were bred at Emory University, genotyped, and held until
specific ages, whereupon they were shipped to Southern Illinois University (SIU) at
Carbondale. The number of animals used at each time point was four, with the following
exceptions: the 9- to 180-day controls and 240-day mutant group had three animals; the 13-
day control group had eight animals; the 23-day control group and 210-day mutant group
had two animals; the 43-, 90-, and 240-day control groups had six animals; the 180-day
mutant group had one animal; and the 270-day mutant group had five animals. All
experiments involving mice were conducted using protocols approved by the Institutional
Animal Care and Use Committees of SIU and Emory University.
Assay for Genotyping Bclw
Gtrosa41
Allele
Genotyping was performed by PCR using a three-primer, two-allele assay. The DNA was
extracted from 3-mm, tail-tip biopsy specimens of animals between p9 and p12 by overnight
incubation at 55°C in 100 μl of a buffer containing 100 mM Tris-HCl (pH 8.0) at 55°C, 50
mM EDTA, 150 mM NaCl, and 0.5% SDS with proteinase K (Roche, Indianapolis, IN) at
100 μg/ml. Following phenol and chloroform extraction, DNA was precipitated by addition
of 2.5 volumes of ice-cold, 100% ethanol. Following washing in 70% ethanol and drying,
DNA was resuspended in 200 μl of 10 mM Tris-HCl (pH 7.3) and 1 mM EDTA.
Because excessive DNA resulted in poor PCR efficiency, DNA was diluted 10-fold before
use in a PCR. One microliter of DNA was used as template in a 30-μl PCR reaction with the
following conditions: 10 mM Tris-HCl (pH 9.0) at 25°C, 50 mM KCl, 0.1% Triton X-100,
1.67 mM MgCl
2
, 500 μM deoxyribonucleotide triphosphates, 500 nM of primer A (see
below), 500 nM of primer B, and 250 nM of primer C, with 1.5 U of Taq DNA polymerase
in storage buffer B (Promega, Madison, WI). The cycling conditions for the PCR were 94°C
for 30 sec, 55°C for 30 sec, 72°C for 60 sec, and a final extension of 7 min at 72°C, all
performed in an Ericomp Thermocycler (Ericomp, San Diego, CA). The sequences of the
primers used were (all indicated 5′-3′):
Primer A: GTGGCCAGCTGCTTATGCTCTGAA
Primer B: CGACGGGATCCGCCATGTCACAGA
Primer C: GATGCGGAGAGCAGCAATTGAGAA
Primer A hybridizes to both PCR templates, whereas primer B recognizes the mutant-allele
template and primer C the wild-type template.
Russell et al. Page 3
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Strain Composition of ROSA41 Mice
The ROSA41 mutation was generated in embryonic stem cells derived from a 129S5/
SvEvBrd mouse [10]. The animals used in this study were generated by intercross of
heterozygous ROSA41 mutants that were N3 (i.e., two backcross generations) for C57BL/
6J. Animals between p9 and more than 12 mo of age were used in the present study. No
phenotypic differences were observed between wild-type (+/+) and heterozygous mutant (+/
−) ROSA41 animals. Consequently, for this study, these two groups were considered as
“controls.”
Purification of Male Germ Cells by STA-PUT and Isolation of Testes for Prepubertal Study
Male ICR mice were obtained from Harlan Sprague Dawley, Inc. (In-dianapolis, IN).
Enriched germ cell fractions were separated by unit gravity sedimentation on a 2%–4% BSA
gradient as described elsewhere [11]. Adult (≥8 wk old) mice were used for collection of
round spermatids and residual bodies. Purity of the preparations (i.e., percentage of specific
cell type) was determined by differential interference contrast microscopy as described
elsewhere [12]. The purity of round spermatids used for Western blot analysis was 67%,
whereas the purity of the preparation used for Northern blot analysis was 68%. The main
contaminant in each case was residual bodies and/or cytoplasts. The purity of the residual
body preparations was 98% for Western and 87% for Northern blot analysis. To study the
onset of gene expression during prepubertal development, testes were dissected from p7,
p12, p17, p22, p27, and adult mice. In addition, testes were isolated from two mutant strains:
XX-sex reversed (XX Sxr), and atrichosis (at). The testes of these animals contain no germ
cells. The testes were removed, frozen in liquid nitrogen, and stored at −80°C until used for
RNA isolation.
Northern Blot Analysis
The RNA was extracted from the cell fractions and testes as described elsewhere [13]. For
each sample, 10 μg of total RNA were analyzed by Northern blot using standard techniques
[14]. The cDNA probe was labeled to a specific activity of 1–2 × 10
9
disintegrations/μg
DNA using the Megaprime Random Prime labeling kit (Amersham Pharmacia, Piscataway,
NJ). The blot was hybridized overnight at 60°C in 5× SSC (1× SSC: 0.15 M sodium chloride
and 0.015 M sodium citrate). After hybridization, the blot was washed briefly in 2× SSC at
room temperature, twice in 2× SSC plus 0.5% SDS for 30 min each at 60°C, and twice in
0.5× SSC plus 0.5% SDS for 30 min each at 60°C. The blot was then exposed to x-ray film
(Kodak Biomax MS with intensifying screen; Eastman Kodak, Rochester, NY) at −80°C for
5 days.
Western Blot Analysis
Isolated cell fractions were lysed in 1% (v/v) NP-40-Tris-NaCl buffer as described
elsewhere [15]. Protein concentration was determined using a Bradford assay (BioRad,
Hercules, CA). Twenty micrograms of total protein were electrophoresed through a 14% (w/
v) NuPage gel (Novex, San Diego, CA). Following electroblotting to nitrocellulose, the
transfer efficiency was determined by staining in 0.1% (w/v) Ponceau S. The affinity-
purified, polyclonal rabbit anti-mouse Bclw peptide antibody used has been described
previously [5]. In addition to Bclw (21 kDa), this antibody detects a nonspecific protein of
approximately 18 kDa. Membranes were blocked overnight, reacted with primary antibody
(1:100), washed, and signal detected using a horse radish peroxidase-conjugated secondary
antibody (donkey anti-rabbit; Amersham Pharmacia) in conjunction with enhanced
chemiluminescence (Amersham Pharmacia).
Russell et al. Page 4
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

In Situ Hybridization
Tissues were dissected, washed once in cold phosphate-buffered saline (PBS), and fixed in
4% (w/v) paraformaldehyde (EM Sciences, Fort Washington, PA) in 0.1 M PBS (pH 7.5)
for 16 h at 4°C with rocking. Subsequently, tissues were rinsed twice for 15 min each in 15
ml of PBS at 4°C, dehydrated through graded ethanols at room temperature, and cleared
twice for 30 min each in Histoclear (National Diagnostics, Atlanta, GA). Infiltration was
performed by immersion under 20 mm Hg vacuum using a 1:1 mixture of Paraplast
Plus:Histoclear, followed by three changes in Paraplast Plus (Oxford Labware, St. Louis,
MO) at 58°C under vacuum for 20 h total. Tissue sections (7 μm) were lifted on poly-lysine-
treated slides and incubated overnight on a slide warmer at 37°C.
To prepare digoxigenin (DIG)-labeled riboprobes, a 1537-base pair XhoI fragment from the
3′-untranslated region (UTR) of a mouse Bclw cDNA (GenBank accession no. AF030769)
was cloned into pBS KS-, linearized with an appropriate restriction enzyme, and synthesized
using in vitro transcription with a DIG RNA labeling kit (Roche) for 2 h at 37°C according
to the manufacturer’s instructions. Labeled probes were visualized on an agarose gel and
quantified by comparison to a known amount of λ HindIII DNA fragments.
Hybridization was performed as described elsewhere [16], but with the following
modifications: All washes were at room temperature unless otherwise specified. Sections
were deparaffinized twice in xylene for 10 min, rehydrated through graded ethanols, and
washed twice in reagent-grade H
2
O for 5 min each. Sections were immersed in 0.2 M HCl
for 20 min to increase accessibility of the riboprobe. After washing in PBS for 5 min, tissue
sections were fixed in 4% paraformaldehyde in 0.1 M PBS (pH 7.5) for 20 min. To facilitate
more efficient penetration of the riboprobe, tissue sections were treated with 20 μg/ml of
proteinase K in 50 mM Tris-HCl and 5 mM EDTA (pH 8.0) for 5 min. After washing in
PBS for 5 min, sections were postfixed in 4% paraformaldehyde in 0.1 M PBS (pH 7.5) for
20 min. To minimize nonspecific binding of the probe, tissue sections were washed for 5
min in PBS, then acetylated with a solution containing 0.63 ml of glacial acetic acid in 250
ml of triethanolamine hydrochloride (pH 8.0). Subsequently, sections were washed for 5 min
in PBS and dehydrated through graded ethanols. After air drying, sections were
prehybridized for a minimum of 2 h at 50°C in a solution of 50% deionized formamide, 3×
SSC, 500 μg/ml of yeast RNA, 1× Denhardt solution, 66 mM Na-phosphate buffer (pH 8.0),
and 5 mM EDTA. Hybridization was performed overnight for 16 h in a humidified (3× SSC,
50% formamide) chamber at 50°C using a hybridization buffer consisting of
prehybridization buffer plus 10% (w/v) dextran sulfate (Amersham Pharmacia) and 1 μg/ml
of DIG-labeled riboprobe.
Excess probe was removed by washing twice in solution I (50% form-amide, 5× SSC, 1%
SDS) at 60°C for 30 min each. After three washes of 5 min each at room temperature in
solution II (0.5 M NaCl, 10 mM Tris-HCl [pH 7.5], 0.1% Tween 20 [v/v]), tissue sections
were treated with 20 μg/ml of RNase A (Roche) in solution II for 45 min at 37°C.
Subsequently, sections were washed in solution II for 5 min at 37°C, washed twice in
solution III (50% formamide, 2× SSC) at 60°C for 30 min each, and then washed twice in
PBT (PBS containing 0.1% Tween 20 [v/v]) at room temperature for 20 min each.
Nonspecific antibody binding was minimized by preincubating sections in blocking solution
(10% sheep serum [v/v] in PBT) for a minimum of 2 h at room temperature. Sections were
incubated with an anti-DIG, alkaline phosphatase-conjugated antibody (Roche) diluted
1:1000 in 1% sheep serum (v/v) in PBT for 16 h at 4°C.
Excess antibody was removed by washing in PBT three times for 30 min each at room
temperature. Subsequently, sections were washed in NTMT (100 mM Tris-HCl [pH 9.5], 50
mM MgCl
2
, 100 mM NaCl, 0.1% Tween 20 [v/v], 2 mM levamisole) three times for 5 min
Russell et al. Page 5
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

each at room temperature. Sections were overlaid with 150 μl of freshly prepared color
solution consisting of 3.5 μl of 5-bromo-4-chloro-3-indolyl phosphate (50 mg/ml stock in
dimethylformamide) and 4.5 μl of nitroblue tetrazolium salt (75 mg/ml stock in 70%
dimethylformamide) and incubated in a humidified container in the dark at 37°C for up to 48
h until the desired signal intensity was achieved. The color reaction was stopped by washing
in PBT, the excess liquid removed, and the sections mounted under a coverslip using
Hydromount (National Diagnostics).
Immunohistochemistry
A rat monoclonal IgG against GATA-1 (catalog no. sc-265; Santa Cruz Biotechnology,
Santa Cruz, CA) was used for immunostaining. Testes were fixed and sectioned as for in situ
hybridization. Consecutive testicular sections (6 μm) were used for in situ hybridization and
anti-GATA-1 staining. The sections were cleared, rehydrated through a graded alcohol
series, and rinsed for 5 min in tap water. Sections were blocked in 1.5% rabbit serum in PBS
for 20 min at room temperature. After blocking, sections were incubated with primary
antibody diluted 1:50 in PBS overnight at 4°C and washed three times in PBS. Incubation
with secondary antibody and all subsequent steps were performed using the Vectastain Elite
ABC kit (catalog no. PK-6104; Vector Labs, Burlingame, CA) according to the
manufacturer’s instructions. Following final washes in PBS, testicular sections were
incubated in DAB (catalog no. SK-4100; Vector Labs) for 5–8 min until color developed
and then counterstained with hematoxylin, cleared, and mounted.
Testis and Seminal Vesicle Weights
The testes were weighed individually. Paired seminal vesicles of animals other than those
used for the structural study were dissected with the coagulation gland attached. The seminal
vesicle weight data provided here are from cohorts of males that are age-matched
littermates. Each bar in the figure represents a single data point.
Preparation of Tissue for Microscopy
Animals at or beyond 15 days of age were killed by administration of pentobarbital and,
during the perfusion procedure, used for fixation of the testis. Animals were perfused-fixed
by whole-body perfusion [17]. Briefly, after i.p. administration of heparin, mice were
anesthetized and the abdomen and thoracic cavity opened to expose the heart. A needle was
inserted into the heart and 0.9% saline used to clear blood vessels. After clearance of
vessels, a two-way valve apparatus was used to introduce 5% glutaraldehyde (EM Sciences)
into vessels without removal of the needle. Animals were perfused for 25–30 min,
whereupon the testes were removed, weighed, and prepared for embedding in epoxy using
standard techniques [18]. Tissues were examined by both light and electron microscopy.
Animals younger than 15 days of age were killed with pentobarbital and their testes excised,
bisected, and immersed-fixed in 5% gluteraldehyde for 4 h. The tissue preparation for
microscopy was as described above for perfused tissues.
Morphometry
The volume densities of various tissue components were determined by light microscopy of
0.92-μm thick sections using a 441-intersection grid in the ocular of the light microscope.
Three fields (1332 points) were scored for each animal at 200× magnification. Points were
classified as one of the following: intertubular space, Leydig cells, blood vessels, combined
interstitial and tubular macrophages, unidentified interstitial components or “other,”
peritubular tissue, Sertoli cells, germinal elements, or tubular lumen. The intertubular space
in some animals was exaggerated where swelling of this area had occurred during tissue
processing. Consequently, calculations from the determinations of volume densities for
Russell et al. Page 6
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

various components were undertaken in all cases without the inclusion of the intertubular
region where tissue components were absent. The volume density for a particular
compartment was determined by dividing the points over a desired object by the total points
from the field in which the object was present. The total area occupied by an object was the
product of the volume density and the testicular weight. Because the specific gravity of the
testis is nearly unity, we equated the testicular weight to an equivalent volume measurement.
Cell number was determined for both Sertoli and Leydig cells for animals of 90 days of age
(two wild-type and three homozygous mutant Bclw). Twenty serial sections (0.92 μm each)
of testis were prepared from each animal. Tracings were made of five randomly selected
Sertoli cells, and the combined volumes of all traced sections were calculated to yield a
nuclear volume (V
n
). For Leydig cells, a 441-point grid was placed over 50 randomly
selected Leydig cells. The points over the nucleus (N
p
) and over the cytoplasm (P
c
) were
then obtained, as were the total points (P
T
) over both the nucleus and cytoplasm. The cell
volume (V
c
) was obtained for Leydig cells using the following formula:
The mean number of Leydig cells in each group was determined by dividing the total
volume of the Leydig cells by the mean volume of an individual Leydig cell.
The criteria used to stage mouse spermatogenesis were those outlined by Oakberg [19], as
modified by Russell et al. [20].
Statistics
Statistics were performed with the SAS software package (SAS Institute, Inc, Clara, CA)
using the General Linear Models procedure. A threshold of P < 0.05 was used for
significance.
RESULTS
Analysis of Bclw Expression in Male Germ Cells and Adult Mouse Testis
We analyzed the pattern of expression of Bclw in germ cells during mouse spermatogenesis
using Northern blot analysis of total RNA isolated from testes of mice at specific stages
during prepubertal development as well as from enriched populations of haploid male germ
cells. The temporal development of spermatogenesis in prepubertal mice is well established
[21]. Thus, the former samples provide a reliable method of correlating cellular patterns of
gene expression with the development of specific stages of male germ cells.
The RNA isolated from testes that lacked germ cells (i.e., at/at and XX Sxr mice) had the
highest steady-state level of Bclw mRNA (Fig. 1A). This is consistent with previous reports
that Bclw is expressed in postmitotic mouse Sertoli cells [5,22]. The overall steady-state
level of Bclw mRNA is similar in testes from p7, p12, and p17 mice but is reduced in p22,
even lower in p27, and lowest in adult mice (Fig. 1A). This reduction most likely reflects the
decrease in the overall number of cells expressing Bclw during prepubertal development
rather than a reduction in expression of Bclw within Sertoli cells. Because the overall signal
is reduced with the onset of haploid germ cell proliferation, this suggests that Bclw is not
expressed in haploid male germ cells. To verify this result, we performed Northern blot
analysis using total RNA isolated from enriched populations of round spermatids and
residual bodies (Fig. 1A). The results confirm that little, if any, Bclw mRNA is found in
haploid round spermatid or residual bodies.
Russell et al. Page 7
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Several genes that are transcribed during the haploid stages of mouse spermatogenesis
undergo a temporal delay in translation [23,24]. To exclude the possibility that any Bclw
mRNA transcribed in diploid male germ cells was being translated in haploid germ cells,
extracts of purified diploid and haploid germ cells were subjected to Western blot analysis
for Bclw expression. Results (Fig. 1B) suggest that no Bclw can be detected in either round
spermatids or residual bodies, the latter of which contain protein from elongating germ cells.
Sertoli cells are known to express Bclw [5,22], and Sertoli cells were the major contaminant
of cell-separation preparations enriched for spermatogonia and spermatocytes.
Consequently, we were unable to assess the status of expression of Bclw RNA in these germ
cell types by this method. For this reason, we used RNA in situ hybridization as an
independent method to analyze expression of Bclw in the testis of adult mice. We used DIG-
labeled riboprobes to identify Bclw mRNA, because this methodology permits resolution at
the single-cell level [16]. Hybridization of an antisense riboprobe derived from the 3′-UTR
of a mouse Bclw cDNA to sections of adult wild-type mouse testis detected Bclw mRNA
only within the basal compartment of the testis (Fig. 2A). No signal over background was
detected in sections from an age-matched Bclw homozygous mutant animal (Fig. 2B).
Interestingly, not all tubules in wild-type mice appeared to express Bclw, with little or no
signal being observed between stages VII and VIII of the cycle (Fig. 2A). We have
previously reported expression of Bclw in Sertoli cells purified from p18 mice [5]. To
determine if Bclw was expressed in adult Sertoli cells, we analyzed serial sections of adult
mouse testis, with either RNA in situ hybridization using the same Bclw antisense ribo-
probe or immunohistochemistry using antibodies against GATA-1, a known marker of
Sertoli cells nuclei [25]. The results indicate that Bclw is expressed at highest steady-state
levels in Sertoli cells (Fig. 2, C and D). We were unable to detect Bclw mRNA in
spermatogonia or spermatocytes (Fig. 2C).
In summary, our results indicate that Bclw is expressed in postnatal Sertoli cells. If Bclw is
expressed in adult mouse germ cells, its expression is at levels below the limit of resolution
for the methods and reagents we used.
Testis and Seminal Vesicle Weights in Homozygous Mutant Bclw and Control Mice
No significant difference was observed in paired-testes weights between wild-type and
heterozygous mutant Bclw littermates at all ages examined. Similarly, no significant
difference was observed in the weights of paired testes from homozygous mutant Bclw
animals compared to control (wild-type or heterozygous mutant) animals between p9 and
p23 (Fig. 3A). However, beginning at p34, weights of paired testes from homozygous
mutant Bclw animals were always significantly less than those from control littermates. By 9
mo of age, paired-testes weights from homozygous mutant Bclw animals were dramatically
reduced, being only 12%–20% of those from control animals (Fig. 3A).
Seminal vesicle weights were measured in adult animals from 3 to 15 mo of age (Fig. 3B). A
trend toward decreasing seminal vesicle weights was first noticed between 7 and 7.5 mo.
From 7.5 mo onward, seminal vesicle weights declined progressively to approximately 10%
of their normal weight at 12 mo of age.
Comparative Histopathology of Homozygous Mutant Bclw and Control Littermates: The
Interstitial Compartment
Leydig cells—No significant difference was observed in the distribution and appearance
of fetal Leydig cells in homozygous mutant Bclw and control animals studied at p9, p17, and
p20 (Fig. 4, A and B). Similarly, both the Leydig cells that arose during pubertal
development and the adult generation of Leydig cells also appeared normal by light
Russell et al. Page 8
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

microscopy in young animals. The volume of the Leydig cell compartment did not appear to
differ between Bclw-deficient animals and their age-matched controls during prepubertal
development (Fig. 3C). In contrast, by 3 mo of age, a subjective analysis by light
microscopy (Fig. 4, C and D) suggested an increase in the Leydig cell compartment in
homozygous mutant Bclw animals that was confirmed by morphometry (Fig. 3C). In
animals between 3 and 8 mo of age, the total volume of the Leydig cell compartment in
homozygous mutants was almost twice as large as that in control, age-matched littermates
(Fig. 3C). However, measurement of Leydig cell size in 3-mo-old mutant (mean value of
1786.6 ± 164.3) and control animals (mean value of 1826.8 ± 196.7) suggested no difference
in the size of individual Leydig cells. The number of Leydig cells in wild-type animals was
13.346 ± 0.725 million, and the number in Bclw mutants was 21.582 ± 0.883 million. Thus,
hyperplasia, and not hypertrophy, appears to be the mechanism underlying the increase in
volume of the Leydig cell compartment. Histological examination (Fig. 4F) and
morphometric analysis of testes from Bclw-deficient mice older than 8 mo provided visual
and semiquantitative, but obvious, evidence for a gradual loss in Leydig cells until 12 mo of
age, by which time very few or no Leydig cells could be found (Fig. 4G). In contrast, the
Leydig cell population in control animals remained relatively stable at all ages (Fig. 3C).
Ultrastructural examination of Leydig cells in homozygous mutant Bclw animals revealed a
normal appearance during prepubertal development and up to approximately 7 mo of age
(Fig. 5A). However, in mutants 8 mo and older, Leydig cells were occasionally found
undergoing apoptosis (Fig. 5B). The apoptotic cells were identified as Leydig cells based on
the distinctive morphology of the mitochondria and the abundant, smooth endoplasmic
reticulum [26]. Leydig cells undergoing apoptosis were occasionally observed in the process
of being surrounded or phagocytosed by interstitial macrophages (Fig. 5C).
Blood vessels—No consistent difference was observed in the volume of the vascular
compartment in developing and adult mutant and control animals as a function of age (Fig.
3D). However, the volume of the vascular system appeared to differ (i.e., to be larger) when
compared with Bclw mutants at some ages.
Other interstitial cells—In homozygous mutants 1 mo of age and older, the interstitial
compartment contained a variety of cells not commonly seen in controls, some of which
could not be identified by light microscopy. However, by electron microscopy, these cells
often proved to be monocytic in appearance and were not observed in the age-matched,
control littermates (Fig. 5A). Ultrastructural analysis suggested that the majority of these
cells fell into three categories: 1) macrophages, both activated and inactivated forms, with
the activated forms containing abundant phagocytosed material; 2) mast cells (rare); and 3)
mesenchymal-appearing cells. For quantitative purposes, except for the macrophages, the
aforementioned cells were considered as “interstitial other.” There was no consistent
difference in the volume of the compartment of unidentified cells termed “interstitial other”
in homozygous mutant Bclw and control, age-matched animals of up to 8 mo of age (Fig.
3E). An apparent increase in the relative volume of these cell types was observed in
homozygous mutant mice between 9 and 12 mo of age. Macrophages appeared to increase
their relative volume on a consistent basis from 1 mo onward, although macrophage relative
volumes were not recorded specifically for the interstitial compartment.
Comparative Histopathology of Homozygous Mutant Bclw and Control Littermates: The
Tubular Compartment
Germ cells—Evidence of abnormal germ cell degeneration in homozygous mutant males
was first observed at p20 (Fig. 4, A and B). Cell degeneration appeared to affect all types of
germ cells; however, massive degeneration of elongated spermatids arrested at step 13 of
Russell et al. Page 9
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

development was noted at p34 (Fig. 6). The overall effect of this pattern of cell degeneration
led to a reduction in the number of spermatogonia, spermatocytes, and round spermatids and
a near or complete absence of germ cells past step 13 of spermiogenesis. Degenerating germ
cells in homozygous mutants were phagocytosed by Sertoli cells. At p34, symplasts of round
spermatids were also observed (Fig. 6A). Germ cell degeneration continued to deplete the
epithelium during late prepubertal development and in adult animals. In mutants older than 7
mo, only a few spermatogonia were found among the sparse population of remaining Sertoli
cells (Fig. 4, F and G; see next section).
Sertoli cells—In wild-type and heterozygous mutant Bclw animals, the relative volume of
the Sertoli cell nuclear compartment increased during development (i.e., until p43–90) and,
thereafter, appeared to be relatively stable throughout the period studied (Fig. 3F). There
appeared to be no difference in the relative volume of the Sertoli cell nuclear compartment
in mutants and control animals between p9 and p20. However, beginning at p23, the volume
of this compartment was significantly less in homozygous mutants compared to controls. By
p90, a greater than 60% relative reduction was observed in the total volume of the Sertoli
cell nuclear compartment in homozygous mutants compared to controls. This reduction
increased with time until the Sertoli relative nuclear volume approached or, in some cases,
reached zero at 12 mo of age (Fig. 3F). Morphometric data obtained for animals 90 days of
age revealed no difference in the size of Sertoli cell nuclei throughout this period (data not
shown), indicating that the decrease resulted from reduced numbers of Sertoli cells.
From a qualitative standpoint, most Sertoli cells in homozygous mutants showed normal
ultrastructural features, although some showed nuclear vacuolation (Fig. 7A) and
mitochondrial swelling (Fig. 7, A and C). Interestingly, regardless of age, Sertoli cells in
Bclw-deficient animals never displayed chromatin condensation on the circumference of the
nucleus, nor did they show nuclear condensation and fragmentation. The ultrastructure of
Sertoli cells in p90 Bclw-deficient mice suggested that they had maintained an intact Sertoli
cell barrier. Evidence to support this conclusion includes linear electron opacities in the
Sertoli-Sertoli junctional regions that are characteristic of membrane fusion in these animals
(Fig. 7B). Although only a small fraction of Sertoli-Sertoli junctions could be examined
using this technique, the results were consistent. In contrast, in animals 5.5 mo and older,
Sertoli cell detachment from the basal lamina was noted (Fig. 7, C and D), making the loss
of the functional integrity of the barrier obvious. In many cases, contact by adjacent Sertoli
cells via their lateral surfaces was lost, representing clear evidence for the disruption of the
Sertoli cell barrier (Fig. 7C).
In adult homozygous mutants of all ages, a small number of Sertoli cells detached from the
basal lamina and formed “balls,” as previously described in c-kit mutant mice both before
and following transplantation of germ cells [27]. Such balls of Sertoli cells were never
observed in testes from wild-type or heterozygous mutants. Occasional Sertoli cells
displayed degenerative features in Bclw mutant mice between 3 and 7 mo of age, but such
features were evident in all such animals older than 7 mo. Sertoli cells were observed that
had detached from the basal lamina (Fig. 8A), that had increased in cytoplasmic density, and
that were located in the center of the tubule. Such “densified” cells were identified as Sertoli
cells based on their mitochondria [28].
In animals 5.5 mo and older, dying or dead Sertoli cell masses occupied a large space in the
center of the tubule (Figs. 4E and 8A). Macrophages entered the tubule (Fig. 8C) to form the
foreign-body giant cells (Fig. 9, A and B) that actively phagocytosed the centrally located,
densified Sertoli cells. As Sertoli cell loss progressed, the tunica propria with the innermost
basal lamina became either partially free (Figs. 7, C and D; 8, A and B; and 9C) or
completely free of cellular contact. Although considerable animal-to-animal variability was
Russell et al. Page 10
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

observed, peritubular cell ghosts were the most commonly encountered seminiferous tubular
profile (Figs. 4G and 9D).
It was difficult to resolve germ from Sertoli cells in our morphometric determinations.
Consequently, the relative volumes of these two cell types (i.e., Sertoli cell cytoplasm and
germ cells) were combined and termed “remainder” to distinguish them from those
determinations made for Sertoli cell nuclei. Similar to the timing of the onset of germ cell
degeneration and reduction in the volume of the Sertoli nuclear compartment, the
“remainder” relative volume in homozygous mutants first began to differ from that in
control animals between p20 and p23 (Fig. 3G). After p23, the relative volume of this
compartment declined progressively until 12 mo of age, when it was approximately 1% of
normal. In contrast, in control animals, the combined volumes of Sertoli cell cytoplasm and
germ cells increased steadily during pubertal development and remained stabilized at 1 yr of
age (Fig. 3G).
Tubular lumen—The volume of the tubular lumen compartment increased sharply in p34
control animals and remained relatively stable in adult animals. In contrast, a dramatically
smaller tubular lumen volume was observed in the testes of both developing and adult
homozygous mutant Bclw males compared to control littermates (Fig. 3H). The data shown
in Figure 3H appear to suggest that the volume of the lumen compartment in homozygous
mutants 7 mo and older is larger than that in p43–180 animals. However, lumen was defined
as being anything internal to the peri-tubular cell ghosts. Thus, this larger lumen in the older
homozygous mutants is an artifact that results from the absence of Sertoli cells.
Intertubular macrophages—Interstitial macrophages were abundant in the testes of
adult Bclw mutants, and from the extent of engulfed material, they appeared to phagocytose
extratubular material. Macrophages were observed within the lumen of seminiferous tubule
in mutants as young as 5.5 mo of age, although they were never found in control animals. In
animals 5.5 mo of age, intertubular macrophages apparently fused to form foreign-body
giant cells (Fig. 9, A and B), which appeared to engulf and phagocytose the dying/dead
intratubular Sertoli cells. In some tubules, foreign-body giant cells were the only cell type
remaining within the tubular lumen following the loss of germ cells and Sertoli cells (Figs.
4, F and G, and 9A).
The relative volume of the macrophage compartment (i.e., macrophages both within and
outside of the seminiferous tubules of normal animals) was routinely increased in
homozygous mutant animals (Fig. 3I). In 8- to 12-mo-old animals, total (i.e., intra- and
extratubular) macrophage relative volume was approximately eightfold increased in
homozygous mutants compared with control, age-matched littermates (Fig. 3I).
Peritubular tissue—No significant difference was observed in the relative volume of the
peritubular tissue compartment in homozygous mutant and control animals as a function of
age (Fig. 3J). Electron microscopy revealed that the peritubular tissue in homozygous
mutants appeared to be infolded and thickened, as is commonly seen in animals whose
tubules are small because of the depletion of germ cells (Fig. 9D). The innermost basal
lamina was duplicated. After depletion of Sertoli and germ cells, the peritubular cells were
the only remnants of the seminiferous tubules (Figs. 4G and 9D).
DISCUSSION
We have performed detailed histologic, cytologic, and morphometric analyses of the onset,
progression, and presumed end point of testicular degeneration in Bclw-deficient mice. This
study extends previous findings regarding testicular degeneration in these animals [5,22].
Russell et al. Page 11
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Specifically, we have quantified the successive changes in populations of testicular cells in
Bclw-mutant and control animals from shortly after birth to more than 1 yr of age. In
addition, we have used Northern and Western blot analyses and in situ hybridization to
correct and refine our knowledge regarding the pattern of Bclw expression in adult mouse
testis. Together, these data enable us to develop models for the function of Bclw during male
germ cell development and provide novel insight regarding the role of the Sertoli cell in
regulating adult testicular homeostasis.
Pattern of Expression of Bclw in Adult Mouse Testis
The null mutant allele of Bclw in the ROSA41 strain of mice was generated using a
retroviral gene trap system [5,10]. With this particular system, transcriptional activity of the
mutated gene in different cells of mice can be detected using the RNA splice acceptor-
bacterial β-galactosidase (lacZ) function of the gene trap vector in conjunction with X-gal
staining. Using this criterion, one of our group (G.R.M.) previously reported expression of
Bclw in Sertoli cells and elongate germ cells in adult mice [5]. Two additional methods were
used to determine whether the β-gal activity reflected the pattern of Bclw gene expression in
testis. First, Western blot analysis was performed on purified mouse Sertoli cells using two
independent, affinity-purified antisera that had been generated against synthetic peptides
from the NH
2
and COOH termini of mouse Bclw. Second, immunohistochemistry was
performed using testicular histopathology from wild-type and homozygous mutant ROSA41
animals using the same antipeptide antisera. The results supported the data generated by X-
gal staining: that Bclw was expressed in both Sertoli cells and elongate germ cells [5].
In contrast to these findings, another study used RNA in situ hybridization to demonstrate
that Bclw transcripts were not found at significant levels in elongate spermatids or mature
sperm but were, instead, found at highest levels in spermatogonia, with lower levels in
Sertoli cells [22]. Significantly, no evidence was found for expression of Bclw in Leydig
cells based on in situ hybridization and Western blot analysis of protein from an established
Leydig cell line.
To understand the mechanism for development of a mutant phenotype in an organ requires
knowledge regarding the cellular pattern of expression of the gene product in question. Such
information is particularly important when the gene is expressed in both the germ cell and
the supporting somatic cells in a gonad, which is the case with testicular expression of Bclw.
The present study suggests that Bclw is not transcribed, and that Bclw protein is not found in
haploid germ cells. This indicates that the expression of β-gal in elongate germ cells in
ROSA41 mice does not reflect expression of the mutated Bclw gene within this specific cell
type [5].
The ROSAβ-gal provirus used to generate this mutant allele of Bclw contains a
phosphoglycerate kinase gene promoter-neomycin phosphotransferase gene (PGK-neo)
cassette, which serves as a selectable marker following infection of embryonic stem cells
[10]. Two recent reports have demonstrated convincingly that integration of this minigene
within a transcription unit can influence expression of the transcription unit itself [29,30].
Thus, the erroneous expression of lacZ observed in elongate germ cells in heterozygous
Bclw
Gtrosa41
may be due to the PGK-neo cassette in this mutant allele. We also conclude
that the two independent, affinity-purified peptide antisera used in this previous study may
have cross-reacted with a nonspecific antigen, which is found in elongate germ cells of wild-
type but not homozygous mutants.
We used in situ hybridization with DIG-labeled probes to evaluate expression of Bclw
mRNA in adult mouse testis. Our results confirmed that Sertoli cells express Bclw. In
contrast to previous reports [22,31], we could find no evidence of Bclw mRNA in
Russell et al. Page 12
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

spermatogonia. The level of expression of Bclw mRNA in diploid male germ cells may have
been below the limits of sensitivity for the in situ assay we used.
In summary, the results from this and previous studies are in agreement that Bclw is
expressed in Sertoli cells, but not at appreciable levels in haploid germ cells, in adult mice.
Bclw has also been reported to be expressed in adult [22,31] and prepubertal [32] diploid
male germ cells in rodents, although we were unable to detect this during the present study
using in situ hybridization.
Interpretation of the Timing and Pattern of Germ Cell Loss in Bclw Mutants
Consideration of the expression pattern of Bclw in the testis, and of the timing and extent of
male germ cell death during postnatal development of Bclw-deficient animals, enables the
formation of models regarding the function of Bclw in murine spermatogenesis and the
mechanism of germ cell loss in Bclw-deficient mice.
Germ cell loss from Bclw-deficient male mice was categorized in two discrete classes. First,
death of spermatogonia, spermatocytes, and round spermatids was sporadic. That is,
degenerating cells were found in tubules without regard to cycle stage, and they were found
not to degenerate in clones. Assuming that Bclw is expressed in diploid male germ cells, the
sporadic death of spermatogonia and spermatocytes may be a direct consequence of loss of
Bclw function in these cells. Alternatively, loss of these cells types may result from
dysfunctional Bclw-deficient Sertoli cells. However, because Bclw does not appear to be
expressed in haploid germ cells, it is doubtful that the death of round spermatids results from
loss of Bclw function in this cell type. Instead, it appears to be more probable that the
multinucleation and death of round spermatids results from Bclw-deficient Sertoli cell
dysfunction.
The second form of germ cell death was a nonsporadic arrest and stage-specific
degeneration of elongating spermatids. At step 13 of spermiogenesis, virtually 100% of step
13 spermatids underwent a synchronous (i.e., clonal) process of cell death. During this
process, cytoplasmic bridges were lost, and the cytoplasm of clonal cells rounded up and
densified. As with round spermatids, the absence of Bclw expression in elongate spermatids
makes it likely that loss of this cell type results from Sertoli cell dysfunction. Interestingly,
mice deficient in Desert hedgehog (Dhh) or retinoid X receptor beta (RXRβ) also display
defects in germ cell development during the late stages of spermio-genesis [33,34]. Germ
cells in Dhh mutant mice arrest at step 15, whereas those in RXRβ mutant mice complete
differentiation but fail to undergo spermiation. As with Bclw, neither Dhh or RXRβ is
expressed in elongating spermatids, although both are expressed in Sertoli cells [33,34].
Thus, arrest during elongate spermatid development in these mutants presumably results
from the loss of gene function in Sertoli or other somatic cells, although the mechanism
responsible for such arrest is currently unclear. Experiments are underway to determine
whether germ cells have an intrinsic requirement for Bclw during spermatogenesis by
transplantation of Bclw-deficient male germ cells into a wild-type testicular environment
using the spermatogonial transplantation techniques pioneered by Brinster and colleagues
[35].
Loss of Sertoli Cells in Bclw-Deficient Mice
Clearly, Bclw is expressed in adult Sertoli cells [5,22,31,32]. Moreover, Bclw is also
required for long-term survival of Sertoli cells in the normal adult mouse [5,22]. In the
present study, an apparent increase in numbers of degenerating germ cells was first observed
in the testes of homozygous mutant Bclw mice at p20. This is consistent with previous
findings regarding timing of the onset of germ cell degeneration in Bclw-deficient animals
Russell et al. Page 13
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

[5,22]. Significantly, in the present study, an effect of loss of Bclw function on the Sertoli
cell population also first manifested at p20–23. We are unaware of a precedence for loss of
male germ cells in mice causing extensive depletion of Sertoli cells. Indeed, loss of all germ
cells leads to what is commonly called “Sertoli cell-only syndrome.” Consequently, loss of
Sertoli cells at p20–23 likely is the direct result of a deficiency of Bclw within this cell type.
We are currently testing this hypothesis by analysis of long-term survival of Sertoli cells in
Bclw-deficient mice, which lack germ cells from birth.
During normal mouse development, Sertoli cells complete exit from mitosis by p17 [2]. It is
interesting that an effect on the Sertoli cell population in Bclw-deficient mice is first noted
shortly after this time. Bclw is expressed in mitotic Sertoli cells in the neonatal rodent [31].
We found no evidence for loss of Sertoli cells in Bclw-deficient mice before their exit from
mitosis. Thus, it appears that the death-protecting function of Bclw is only required in post-
mitotic Sertoli cells, and that other death-protecting members of the Bcl2 family or survival-
signaling molecules can sustain mitotic, Bclw-deficient Sertoli cells.
Bclw-deficient mice provide a unique opportunity to observe the characteristics of cellular
degeneration associated with Sertoli cells in vivo. Sertoli cells are often removed from the
basal lamina during early adulthood in several mutant strains of mice, including Bax-
deficient [36] (unpublished results), kit-ligand-deficient [27], and several others
(unpublished results). However, despite loss of contact with the basal lamina, these balls of
Sertoli cells do not appear to undergo apoptosis but, instead, remain viable yet structurally
abnormal [27] (unpublished results).
Such balls of Sertoli cells were occasionally observed in Bclw-deficient animals. In
addition, in other Sertoli cells that lost contact with the basal lamina, the cytoplasm appeared
to be greatly densified, and the cell became positioned centrally within the seminiferous
tubule. The densification observed within Bclw-deficient Sertoli cells has not been observed
in Sertoli cells from Bax-deficient, kit-deficient, or several other lines of mutant mice with
defective spermatogenesis (unpublished results). Sertoli cells in Bclw-deficient animals
ultimately degenerated and were phagocytosed. However, while degenerating, they did not
display all of the classical features normally associated with apoptosis, such as chromatin
condensation on the nuclear envelope and shrinkage and fragmentation of the nucleus.
Instead, the cytoplasm of Bclw-deficient Sertoli cells appeared to condense, and whereas
evidence was found of mitochondrial swelling, cytoplasmic organelles remained relatively
intact. In addition, the demise of Bclw-deficient Sertoli cells was not immediately
accompanied by phagocytosis of the dying cells by other Sertoli cells. Instead, macrophages
in the form of foreign-body giant cells invaded the seminiferous tubules to ingest the
massive amount of Sertoli cell debris formed by the loss of the entire population of Sertoli
cells. We are unaware of any other cases in which macrophages enter the seminiferous
tubule.
A major question that arises from this study is why Bclw-deficient Sertoli cells die over such
an extended period of time in vivo. Apoptosis is usually a rapid and efficient process, as is
required for effective remodeling of tissues during embryogenesis or removal of potentially
dangerous, precancerous cells. Indeed, mitotic Sertoli cells are competent to undergo
apoptosis within a few hours either following x-irradiation in vivo [37] or after explant in
vitro [38]. In contrast, postmitotic Sertoli cells are resistant to x-irradiation [39,40]. Neither
wild-type or Bclw-deficient postmitotic Sertoli cells display classical features of apoptosis
(i.e., margination of the chromatin against the nuclear membrane, condensation of the
nucleus and cytoplasm, fragmentation of the nucleus, and formation of apoptotic bodies
[41]) in vivo following release from the basement membrane. Thus, prolonged survival of
such Sertoli cells in vivo may, at least in part, result from their postmitotic status. The
Russell et al. Page 14
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

densification of the cytoplasm and swelling of the mitochondria observed in Bclw-deficient
Sertoli cells, but not in wild-type Sertoli cells, is likely a direct consequence of the loss of
function of Bclw in this cell type, which could produce an imbalance in death-protecting
Bcl2 family members, such as Bax. An imbalance in levels of Bax activity in mammalian
cells often leads to apoptosis. Interestingly, the ability of Bax to mediate classical apoptosis
in mammalian cells in vitro can be blocked by inclusion of caspase inhibitors [42]. In such
cases, chromatin condensation and nuclear fragmentation is inhibited, although caspase-
independent activities of Bax, including a fall in the mitochondrial membrane potential and
mitochondrial swelling, still occur, which ultimately leads to cell death [42]. Thus, one
possibility is that Bclw-deficient post-mitotic Sertoli cells might also fail to undergo
classical apoptosis due to a failure to produce or activate caspases. Additional possibilities
for the protracted loss of Bclw-deficient postmitotic Sertoli cells include a gradual, age-
related decline in expression of other death-protecting molecules.
Changes in the Leydig Cell Compartment of Bclw-Deficient Mice
Leydig cells initially become hyperplastic after changes have occurred in the compartment
volumes of the germ and Sertoli cells [5]. This is a normal response to elevated levels of
gonadotropins, which are expected to rise due to a deficiency in spermatogenesis. However,
by approximately 7 mo of age, fewer Leydig cells are present in homozygous mutant
animals than in controls. This trend continues until 11 mo of age, at which time Leydig cells
are essentially absent from homozygous mutant animals. Interestingly, the decrease in the
Leydig cell compartment is observed when few, if any, Sertoli cells remain in the
seminiferous tubules. Literature is accumulating that suggests the size of the Leydig cell
population is influenced by the size of the Sertoli cell population [43–46]. Loss of Leydig
cells in aged, Bclw-deficient males appears to be an apoptotic event, because several classic
morphological features of apoptosis are observed: condensation of chromatin on the nuclear
envelope, fragmentation of the nucleus, shrinkage of the cell, and phagocytosis by adjacent
macrophages. Rarely has apoptosis been noted in Leydig cells, because this population is
usually relatively stable in wild-type animals. Perhaps the most notable example is following
administration of rats with ethane dimethane sulfonate (EDS), which results in loss of the
adult Leydig cell population via apoptosis [47]. However, unlike the situation using EDS,
Leydig cells in Bclw-deficient animals do not regenerate.
These findings support a role for Sertoli cells in regulation of adult testicular homeostasis.
Specifically, Sertoli cells may provide signals that regulate proliferation and survival of
Leydig cells in adult mice. Two attractive candidates for such signaling mechanisms are the
kit-ligand/kit-receptor and Hedgehog/Patched ligand-receptor pathways. Kit ligand is
produced by Sertoli cells; kit receptor is expressed by both germ and Leydig cells [48]. Kit
ligand may be a survival factor for both adult and immature Ley-dig cells [49]. Desert
hedgehog is expressed only by Sertoli cells in the testis, whereas the Patched-1 receptor is
likely expressed in Leydig cells [33,50]. On a mixed genetic background, Dhh-mutant mice
lack adult Leydig cells [50]. It will be of interest to determine whether introduction of
exogenous Desert hedgehog or kit ligand in Sertoli cell-depleted testes of aged, Bclw-
deficient mice is sufficient to mediate repopulation of Leydig cells from the lymphatic
endothelium.
Bclw-deficient mice provide a unique opportunity to analyze the consequence of loss of
Sertoli cells on adult testicular homeostasis. Future experiments should provide novel
insight regarding the molecular and cellular mechanisms involved in regulating adult Leydig
cell homeostasis.
Russell et al. Page 15
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Acknowledgments
We thank Bruce L. Tetzlaff for help with the statistical analysis, Ying Li and Angie Raymer for technical
assistance, Neville Whitehead for animal husbandry, and Mary Ann Handel for comments on the manuscript as
well as support and advice on cell-separation techniques.
References
1. Capel B. The battle of the sexes. Mech Dev 2000;92:89–103. [PubMed: 10704890]
2. Vergouwen RPFA, Jacobs SGPM, Huiskamp R, Davids JAG, de Rooij DG. Proliferative activity of
gonocytes, Sertoli cells and interstitial cells during testicular development in mice. J Reprod Fertil
1991;93:233–243. [PubMed: 1920294]
3. Steinberger A, Steinberger E. Replication pattern of Sertoli cells in maturing rat testis in vivo and in
organ culture. Biol Reprod 1971;4:84–87. [PubMed: 5110903]
4. Russell LD, Bartke A, Goh JC. Postnatal development of the Sertoli cell barrier, tubular lumen, and
cytoskeleton of Sertoli and myoid cells in the rat, and their relationship to tubular fluid secretion
and flow. Am J Anat 1989;184:179–189. [PubMed: 2750675]
5. Ross A, Waymire KG, Moss JE, Parlow AF, Skinner MK, Russell LD, MacGregor GR. Testicular
degeneration in Bclw-deficient mice. Nat Genet 1998;18:251–255. [PubMed: 9500547]
6. Minn AJ, Swain RE, Ma A, Thompson CB. Recent progress on the regulation of apoptosis by Bcl-2
family members. Adv Immunol 1998;70:245–279. [PubMed: 9755339]
7. Chao DT, Korsmeyer SJ. Bcl2 family: regulators of cell death. Annu Rev Immunol 1998;16:395–
419. [PubMed: 9597135]
8. Antonsson B, Martinou JC. The Bcl2 protein family. Exp Cell Res 2000;256:50–57. [PubMed:
10739651]
9. Tsujimoto Y, Shimizu S. Bcl2 family: life-or-death switch. FEBS Lett 2000;466:6–10. [PubMed:
10648802]
10. Friedrich G, Soriano P. Promoter traps in embryonic stem cells: a genetic screen to identify and
mutate developmental genes in mice. Genes Dev 1991;5:1513–1523. [PubMed: 1653172]
11. Bellvé AR, Millette CF, Bhatnagar YM, O’Brien DA. Dissociation of the mouse testis and
characterization of isolated spermatogenic cells. J Histochem Cytochem 1977;25:480–494.
[PubMed: 893996]
12. Bellvé AR. Purification, culture, and fractionation of spermatogenic cells. Methods Enzymol
1993;225:84–113. [PubMed: 8231890]
13. Chomczynski P, Saachi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-
phenol-chloroform extraction. Anal Biochem 1987;162:156–159. [PubMed: 2440339]
14. Ausubel, FM.; Brent, R.; Kingston, RE.; Moore, DD.; Seidman, JG.; Smith, JA.; Struhl, K. Current
Protocols in Molecular Biology. New York: Wiley Interscience; 1994.
15. Cobb J, Cargile B, Handel MA. Acquisition of competence to condense metaphase I chromosomes
during spermatogenesis. Dev Biol 1999;205:49–64. [PubMed: 9882497]
16. Wilkinson, DG.; Nieto, MA. Detection of mRNA by in situ hybridization to tissue sections and
whole mounts. In: Wassarman, PM.; De-Pamphilis, ML., editors. Methods in Enzymology, vol
225: Guide to Techniques in Mouse Development. San Diego: Academic Press; 1993. p. 361-373.
17. Sprando, RL. Perfusion of the rat testis through the heart using heparin. In: Russell, LD.; Ettlin,
RA.; Sinha Hikim, AP.; Clegg, ED., editors. Histological and Histopathological Evaluation of the
Testis. Vienna, IL: Cache River Press; 1990. p. 277-280.
18. Russell LD, Burguet S. Ultrastructure of Leydig cells as revealed by secondary tissue treatment
with a ferrocyanide-osmium mixture. Tissue Cell 1977;9:751–766. [PubMed: 205012]
19. Oakberg EF. A description of spermiogenesis in the mouse and its use in analysis of the cycle of
the seminiferous epithelium and germ cell renewal. Am J Anat 1956;99:391–414. [PubMed:
13402725]
20. Russell, LD.; Ettlin, RA.; Sinha Hikim, AP.; Clegg, ED. Histological and Histopathological
Evaluation of the Testis. Vienna, IL: Cache River Press; 1990.
Russell et al. Page 16
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

21. Nebel BR, Mamarose AP, Hackett EM. Calendar of gametic development in the prepuberal male
mouse. Science 1961;134:832–833. [PubMed: 13728067]
22. Print CG, Loveland KL, Gibson L, Meehan T, Stylianou A, Wreford N, de Kretser D, Metcalf D,
Kontgen F, Adams JM, Cory S. Apoptosis regulator Bclw is essential for spermatogenesis but
appears otherwise redundant. Proc Natl Acad Sci U S A 1998;95:12424–12431. [PubMed:
9770502]
23. Braun RE, Peschon JJ, Behringer RR, Brinster RL, Palmiter RD. Protamine 3′-untranslated
sequences regulate temporal translational control and subcellular localization of growth hormatids
of transgenic mice. Genes Dev 1989;3:793–802. [PubMed: 2744463]
24. Hecht NB. Regulation of ‘haploid expressed genes’ in male germ cells. J Reprod Fertil
1990;88:679–693. [PubMed: 2182846]
25. Yomogida K, Ohtani H, Harigae H, Ito E, Nishimune Y, Engel JD, Yamamoto M. Developmental
stage- and spermatogenic cycle-specific expression of transcription factor GATA-1 in mouse
Sertoli cells. Development 1994;120:1759–1766. [PubMed: 7924983]
26. Russell, LD. Leydig cell structure. In: Payne, AH.; Hardy, MP.; Russell, LD., editors. The Leydig
Cell. Vienna, IL: Cache River Press; 1995. p. 43-96.
27. Parreira GG, Ogawa T, Avarbock MR, Franca LR, Brinster RL, Russell LD. Development of germ
cell transplants in mice. Biol Reprod 1998;59:1360–1370. [PubMed: 9828179]
28. Russell LD, Brinster RL. Transplants of rat spermatogonia into mice seminiferous tubules:
preliminary ultrastructural observations 17. J Androl 1996;17:615–627. [PubMed: 9016391]
29. Gerard M, Hernandez L, Wevrick R, Stewart CL. Disruption of the mouse necdin gene results in
early post-natal lethality. Nat Genet 1999;23:199–202. [PubMed: 10508517]
30. Kissel H, Timokhina I, Hardy MP, Rothschild G, Tajima Y, Soares V, Angeles M, Whitlow SR,
Manova K, Besmer P. Point mutation in kit receptor tyrosine kinase reveals essential roles for kit
signaling in spermatogenesis and oogenesis without affecting other kit responses. EMBO J
2000;19:1312–1326. [PubMed: 10716931]
31. Yan W, Samson M, Jegou B, Toppari J. Bclw forms complexes with Bax and Bak, and elevated
ratios of Bax/Bcl-w and Bak/Bcl-w correspond to spermatogonial and spermatocyte apoptosis in
the testis. Mol Endocrinol 2000;14:682–699. [PubMed: 10809232]
32. Yan W, Suominen J, Samson M, Jégou B, Toppari J. Involvement of Bcl2 family proteins in germ
cell apoptosis during testicular development in the rat and pro-survival effect of stem cell factor on
germ cells in vitro. Mol Cell Endocrinol 2000;165:115–129. [PubMed: 10940490]
33. Bitgood MJ, Shen L, McMahon AP. Sertoli cell signaling by Desert hedgehog regulates the male
germline. Curr Biol 1996;6:298–304. [PubMed: 8805249]
34. Katner P, Mark M, Leid M, Gansmuller A, Chin W, Grondona JM, Décimo D, Krezel W, Dierich
A, Chambon P. Abnormal spermatogenesis in RXRβ mutant mice. Genes Dev 1996;10:80–92.
[PubMed: 8557197]
35. Brinster RL, Zimmerman JW. Spermatogenesis following male germ-cell transplantation. Proc
Natl Acad Sci U S A 1994;91:11298–11302. [PubMed: 7972053]
36. Knudson CM, Tung KS, Tourtellotte WG, Brown GA, Korsmeyer SJ. Bax-deficient mice with
lymphoid hyperplasia and male germ cell death. Science 1995;270:96–99. [PubMed: 7569956]
37. Allan DJ, Gobé GC, Harmon BV. Sertoli cell death by apoptosis in the immature rat testis
following x-irradiation. Scanning Microsc 1988;2:503–512. [PubMed: 3368774]
38. Dirami G, Ravindranath N, Kleinman HK, Dym M. Evidence that basement membrane prevents
apoptosis of Sertoli cells in vitro in the absence of known regulators of Sertoli cell function.
Endocrinology 1995;136:4439–4447. [PubMed: 7664664]
39. Harding LK. The survival of germ cells after irradiation of the neonatal male rat. Int J Radiat Biol
1961;3:539–551. [PubMed: 13711488]
40. Erickson BH, Blend MJ. Response of the Sertoli cell and stem germ cell to
60
Co γ irradiation (dose
and dose rate) in the testis of immature rats. Biol Reprod 1976;14:641–650. [PubMed: 1276328]
41. Wylie AH, Kerr JFR, Currie AR. Cell death: the significance of apoptosis. Int Rev Cytol
1980;68:251–306. [PubMed: 7014501]
Russell et al. Page 17
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

42. Xiang J, Chao DT, Korsmeyer SJ. BAX-induced cell death may not require interleukin 1β-
converting enzyme-like proteases. Proc Natl Acad Sci U S A 1996;93:14559–14563. [PubMed:
8962091]
43. Kerr JB, Sharpe RM. Stimulatory effect of follicle-stimulating hormone on rat Leydig cells. A
morphometric and ultrastructural study. Cell Tissue Res 1985;239:405–415. [PubMed: 3919952]
44. Van Haaster LH, de Jong FH, Docter R, de Rooij D. The effect of hypothyroidism on Sertoli cell
proliferation and differentiation and hormone levels during testicular development in the rat.
Endocrinology 1992;131:1574–1576. [PubMed: 1505485]
45. França LR, Silva VA Jr, Chiarini-Garcia H, Garcia SK, Russell LD. L. D. Cell proliferation and
hormonal changes during post-natal development of the testis in the pig. Biol Reprod 63:1629–
1636. [PubMed: 11090429]
46. França LR, Hess R, Cook P, Russell LD. Neonatal hypothyroidism causes delayed Sertoli cell
maturation in rats treated with propylthio-uracil: evidence that the Sertoli cell dictates testis
growth. Anat Rec 1995;242:57–69. [PubMed: 7604982]
47. Kerr JB, Bartlett JM, Donachie K. Acute response of testicular interstitial tissue in rats to the
cytotoxic drug ethane dimethanesulphonate. An ultrastructural and hormonal assay study. Cell
Tissue Res 1986;243:405–414. [PubMed: 3004734]
48. Loveland KL, Schlatt S. Stem cell factor and c-kit in the mammalian testis: lessons originating
from Mother Nature’s gene knockouts. J Endocrinol 1997;153:337–344. [PubMed: 9203987]
49. Yan W, Kero J, Huhtaniemi I, Toppari J. Stem cell factor functions as a survival factor for mature
Leydig cells and a growth factor for precursor Leydig cells: implication of a role of the stem cell
factor/c-Kit system in Leydig cell development. Dev Biol 2000;227:169–182. [PubMed:
11076685]
50. Clark AM, Garland KK, Russell LD. Desert hedgehog (Dhh) gene is required in the mouse testis
for formation of adult-type Leydig cells and normal development of peritubular cells and
seminiferous tubules. Biol Reprod 2000;63:1825–1838. [PubMed: 11090455]
Russell et al. Page 18
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 1.
Expression of Bclw mRNA and protein in male mouse germ cells. A) RNA was extracted
from preparations of enriched germ cells, from testes of heterozygous or homozygous
mutant atrichosis (at) mice, from testes of normal (X/Y) or sex-reversed mice (XX Sxr), or
from testes of mice at Postnatal Day 7, 12, 17, 22, and 27 during prepubertal development
and from adults. The percentage of contaminants in the enriched germ cell preparations is as
described in Materials and Methods. Testes from at/at and XX Sxr animals contain
extremely few or no germ cells, respectively; thus, any signal is derived from somatic cells
of the testis. The RNAs were subjected to Northern blot analysis using a full-length Bclw
cDNA probe. To determine whether equal amounts of total RNA had been loaded, the gel
was stained with ethidium bromide (EtBr), photographed under ultraviolet (UV) light before
transfer, and the blots hybridized with an actin cDNA (lower and middle panels,
respectively). A, Testes from adult mouse; RB, residual bodies; RS, round spermatids; at/+,
testis from heterozygote atrichosis mouse; at/at, testis from homozygote atrichosis mouse;
X/Y, testis from wild-type mouse; XX Sxr, testis from sex-reversed mouse; 7, 12, 17, 22,
and 27, testes from Postnatal Day 7, 12, 17, 22, and 27 mice. B) Western blot analysis of
total protein in preparations of enriched germ cells. Cell preparations enriched for round
spermatids (RS) or residual bodies (RB) from adult animals were solubilized, and total
protein was analyzed by Western blot analysis using affinity-purified rabbit antisera against
a peptide sequence from mouse Bclw [5]. The positive and negative controls include
extracts of COS cells transfected with either a mammalian expression vector with a mouse
Bclw cDNA insert (COS + Bclw) or the same vector without a cDNA insert (COS).
Arrowheads indicate the position of the Bclw-specific band. Note the absence of Bclw
protein in both RS and RB. C) To determine whether equal amounts of protein had been
loaded, the blot shown in B was stained with Ponceau S before reacting with antisera.
Arrowheads denote the approximate size of Bclw (22 kDa). c, COS cells; cb, COS cells
transfected with vector expressing Bclw; m, molecular weight markers; rb, enriched for
residual bodies; rs, enriched for round spermatids.
Russell et al. Page 19
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 2.
In situ hybridization analysis of expression of Bclw mRNA in mouse testis. A) Section of
testis from adult wild-type mouse hybridized with an antisense ribo-probe derived from the
3′-UTR of Bclw cDNA. A significant positive signal (a purple precipitate) is observed only
over nuclei of Sertoli cells. Significant signal was observed in all stages of tubules, except
those between stages VII and VIII of the seminiferous cycle (arrowhead). ×200. B) Section
of testis from adult Bclw homozygous mutant prepared and analyzed simultaneously under
identical conditions as those in A. Only background purple precipitate is seen. ×200. C)
Higher magnification of a single seminiferous tubule from a wild-type mouse, hybridized
with anti-sense Bclw 3′-UTR riboprobe. Sertoli cell nuclei (black arrowheads) stain
relatively intensely purple. In contrast, a spermatogonium (red arrowhead) does not display
any significant staining over background. ×640. D) Serial section from that shown in C
reacted with antibody for GATA-1, a marker of Sertoli cell nuclei. The brown staining
denotes presence of the antibody. The blue counterstain is hematoxylin. Black and red
arrowheads denote the same cells as identified in C. ×640.
Russell et al. Page 20
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 3.
Quantitative and morphometric analysis of testicular composition in Bclw mutant and
control mice. Except for B, in each graph the wild-type (WT) and heterozygous mutant
(Het) animals are pooled, because no significant difference was found in testicular
morphology between these two genotypes. No significant difference was found in weights of
seminal vesicles between WT and Het animals, but the values in B are presented separately,
with each value representing an individual animal. For the remaining graphs, an asterisk
indicates that only two animals were in these groups, hence the omission of a bar denoting
SEM.
Russell et al. Page 21
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 4.
Light micrographs showing development of the mutant testicular phenotype in Bclw-
deficient mice, emphasizing the general appearance of the testis and the Leydig cells. A and
B) Testes at 20 days of age showing the similar appearance of control (A) and Bclw-mutant
animals (B) with respect to Leydig cells (L). As previously described [5], approximately
sevenfold more degenerating cells (arrowheads) are seen in the seminiferous tubules (ST)
from mutants than in the control. ×70 and ×60, respectively. C and D) Testes from 3-mo-old
animals showing development of the Leydig cells (L) in control (C) and Bclw-mutant
animals (D). Intertubular clusters of Leydig cells are extensive in Bclw mutants. ×80 and
×350, respectively. E) Testes from 5.5-mo-old mutants showing the prominent presence of
Leydig cells (L). Large masses in seminiferous tubules (ST) were composed of sloughed
dead and or dying Sertoli cells (SC). ×155. F) Testes from 8-mo-old mutants showing small
“strings” of Leydig cells (L) among extremely small seminiferous tubules (ST), with the
latter containing some Sertoli cells (S) or foreign-body giant cells (F). A seminiferous
tubules devoid of cellular contents (peritubular “ghosts”) is marked (E). ×75. G) Testes from
12-mo-old mutants with absence of Leydig cells. The scattered cells between peritubular
“ghosts” are connective tissue elements and phagocytic elements. A few foreign-body giant
cells (F) are seen within seminiferous tubules (ST). ×100.
Russell et al. Page 22
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 5.
Ultrastructural appearance of Leydig cells in Bclw-mutants. A) At 34 days of age, Leydig
cells (darker cells in the lower left) appeared normal. Often, a mononuclear infiltrate was
seen in the interstitium (lighter cells in the upper right). A macrophage is also indicated
(Ma). ×4500. B) Beginning around 8 mo of age, Leydig cells in mutants were observed
undergoing apoptosis, as evidenced by the fragmented nuclei (n) and accumulation of
associated peripheral heterochromatin (arrowheads). The Leydig cell could be recognized as
such by the abundant smooth endoplasmic reticulum and mitochondria possessing tubular
cristae and by comparison with relatively normal-appearing, adjacent Leydig cells (top
right). ×7200. C) Phagocytosis of degenerating Leydig cell (asterisk) by an interstitial
macrophage (M). The phagocytosed cell appears dense and contains mitochondria
characteristic of those found in Leydig cells. ×14 000.
Russell et al. Page 23
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 6.
Degeneration of elongate spermatids in Bclw-deficient mice. A) Light micrograph showing
degeneration of step 13 spermatids (white arrowheads), appearing as very dense material, in
seminiferous tubules from a Bclw homozygous mutant. Symplasts of round spermatids (S)
were also commonly seen in mutants. ×275. B) Light micrograph showing a comparable
stage I tubule in a control animal. Normally developing round (black arrowheads) and
elongate (white arrowheads) spermatids are marked. ×170. C) Electron micrograph of a
stage VI seminiferous tubule from a Bclw-deficient animal. Step 6 (6) spermatids are
associated with a dense, degenerating symplast of step 13 (13) spermatids (lower left) that is
contained in a single, dense cytoplasmic mass in contact with Sertoli cells (S). Step 13
spermatid nuclei (n) are indicated. ×3200.
Russell et al. Page 24
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 7.
Morphological features of Sertoli cells in Bclw-deficient animals. A) Nuclear vacuolation
(arrowheads) within the nucleus of a Sertoli cell located centrally within the micrograph.
Many mitochondria appear swollen. ×3300. B) En face section of Sertoli-Sertoli junctions in
p90 Bclw-deficient animal showing both actin filament bundles (gray parallel amorphous
material running from lower left to upper right) and translucent linearities (small black
arrowheads) in the areas of occluding junction representing fusions of membranes. ×85 000.
C) Loss of attachment of Sertoli cells from the seminiferous tubule and from each other in a
Bclw-mutant more than 6 mo of age. Spaces where the Sertoli cell (S) has not maintained
contact with the highly infolded and duplicated basal lamina (arrowheads) are indicated
(SP). No other Sertoli cell was seen at the lateral borders of this Sertoli cell (not shown).
Many mitochondria in the Sertoli cytoplasm appear swollen (arrows). ×10 000. D) Light
micrograph of a single Sertoli cell (S) in a greatly shrunken tubule from a Bclw mutant more
than 6 mo of age containing only peritubular cells of the tunica propria (arrow). No other
Sertoli cell was seen at its lateral borders. Note the vacuolation within the Sertoli cell
cytoplasm. No Leydig cells are shown. ×1200.
Russell et al. Page 25
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 8.
Electron micrographs illustrating degenerating Sertoli cell masses located centrally within
seminiferous tubules in 9-mo-old Bclw mutants. A) A large, dense Sertoli cell mass (Sd) is
located in the center of a germ cell-depleted tubule adjacent to a viable Sertoli cell (Sv).
×4000. B) The interface of a highly densified, dying or dead Sertoli cells (upper right) with
normal-appearing, viable Sertoli cells (lower left) shows the mitochondria of both to be
characteristic, mouse-type Sertoli cell mitochondria (arrows). ×18 000. C) Inactivated
macrophage (M) within the seminiferous tubule among Sertoli cells and a spermatogonium
(sg). The tunica propria (TP) of the tubule is at the bottom of the figure. ×5500.
Russell et al. Page 26
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

FIG. 9.
Formation of foreign-body giant cells in seminiferous epithelium of Bclw-mutants. A) Light
micrograph showing a foreign-body giant cell (F) in the seminiferous tubules of a Bclw-
deficient mouse. ×1100. B) Electron micrograph of a foreign-body giant cell. These
extremely large, phagocytic foreign-body giant cells (arrow, F) contain phagocytosed
material and were seen primarily in tubules depleted of cells, with only the peritubular cells
of the tunica propria (TP) at the left remaining. Ultrastructurally, foreign-body giant cells
display multiple nuclei (n), microvillous processes (small arrows at bottom), and an
abundance of semidigested cellular remnants (D) contained within residual bodies. ×5000.
C) Seminiferous tubule with only a tunica propria (TP) lining and intratubular macrophages
(M). Both an inactivated macrophage (M) and a portion of a foreign-body giant cell showing
multiple nuclei (n) are seen. ×5000. D) Electron micrograph of the peritubular cell tunica
propria forming the wall of a seminiferous tubule lacking cellular contents. Identified are the
tubular lumen (Lu), the myoid cell (M), a thin and lymphatic endothelial cell (L), and the
infolded and duplicated basal lamina (arrow) lying internal to the myoid cell. Also identified
is a macrophage (Ma) within the tunica propria. ×6000.
Russell et al. Page 27
Biol Reprod. Author manuscript; available in PMC 2011 March 7.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript