LMNA mutations identify a new genetic subset of subjects with progeroid features of werner syndrome

Abstract

Background Werner's syndrome is a progeroid syndrome caused by mutations at the WRN helicase locus. Some features of this disorder are also present in laminopathies caused by mutant LMNA encoding nuclear lamin A/C. Because of this similarity, we sequenced LMNA in individuals with atypical Werner's syndrome (wild-type WRN).

Full text

For personal use. Only reproduce with permission from The Lancet
MECHANISMS OF DISEASE
440 THE LANCET • Vol 362 • August 9, 2003 • www.thelancet.com
Summary
Background Werner’s syndrome is a progeroid syndrome
caused by mutations at the WRN helicase locus. Some
features of this disorder are also present in laminopathies
caused by mutant LMNA encoding nuclear lamin A/C.
Because of this similarity, we sequenced LMNA in individuals
with atypical Werner’s syndrome (wild-type WRN).
Methods Of 129 index patients referred to our international
registry for molecular diagnosis of Werner’s syndrome,
26 (20%) had wildtype WRN coding regions and were
categorised as having atypical Werner’s syndrome on the
basis of molecular criteria. We sequenced all exons of LMNA
in these individuals. Mutations were confirmed at the mRNA
level by RT-PCR sequencing. In one patient in whom an LMNA
mutation was detected and fibroblasts were available, we
established nuclear morphology and subnuclear localisation.
Findings In four (15%) of 26 patients with atypical Werner’s
syndrome, we noted heterozygosity for novel missense
mutations in LMNA, specifically A57P, R133L (in two people),
and L140R. The mutations altered relatively conserved
residues within lamin A/C. Fibroblasts from the patient with
the L140R mutation had a substantially enhanced proportion
of nuclei with altered morphology and mislocalised lamins.
Individuals with atypical Werner’s syndrome with mutations in
LMNA had a more severe phenotype than did those with the
disorder due to mutant WRN.
Interpretation Our findings indicate that Werner’s syndrome
is molecularly heterogeneous, and a subset of the disorder
can be judged a laminopathy.
Lancet 2003; 362: 440–45
See Commentary page 416
Departments of Pathology (L Chen PhD, L Lee BS, N Hanson CGC,
G M Martin
MD, J Oshima MD), Genome Sciences (G M Martin), and
Biochemistry (B A Kudlow
BS, B K Kennedy PhD), University of
Washington, Seattle, WA, USA; Medical Genetics Service, Santa
Maria Hospital, Lisbon, Portugal (H G Dos Santos
MD); Section of
Geriatrics, St Olav Hospital, Department of Neuroscience,
Norwegian University of Science and Technology, Trondheim,
Norway (O Sletvold
MD); University of Welfare Science and
Rehabilitation, Teheran, Iran (Y Shafeghati
MD); Emory University
School of Medicine, Atlanta, GA, USA (E G Botha
CGC); Department
of Internal Medicine, University of Texas Southwestern Medical
Center, Dallas, TX, USA (A Garg
MD); and Life Sciences Division,
Lawrence Berkeley National Laboratory, Berkeley, CA, USA
(I S Mian
PhD)
Correspondence to: Dr Junko Oshima, Department of Pathology,
Box 357470, HSB K-543, University of Washington, 1959 NE Pacific
Ave, Seattle, WA 98195–7470, USA
(e-mail: picard@u.washington.edu)
Introduction
Werner’s syndrome is an autosomal, recessively inherited,
segmental progeroid syndrome, in which multiple aspects
(or segments) of ageing phenotypes seem to be entailed.
The disorder is caused by mutations in WRN, which is a
member of the RECQ family of DNA
HELICASES.
1
We
used a set of clinical criteria to prospectively classify
patients enrolled in a positional cloning study that defined
the locus of this gene.
2
When we did not find any
mutations in WRN, we tentatively designated these
patients as having atypical Werner’s syndrome (or non-
WRN).
Several diseases that overlap partly with the phenotype
of Werner’s syndrome share mutations at the LMNA
(lamin A/C) gene; they have therefore been referred to as
laminopathies.
3
These diseases include Emery-Dreifuss
muscular dystrophy,
4,5
dilated cardiomyopathy type 1A,
6
limb-girdle muscular dystrophy type 1B,
7
familial partial
lipodystrophy,
7–10
Charcot-Marie-Tooth disease type 2,
9
mandibuloacral dysplasia,
11
and a rare childhood
syndrome of premature ageing, Hutchinson-Gilford
syndrome.
12–14
LMNA mutations causing familial partial
lipodystrophy, for example, are associated with insulin
resistance, type 2 diabetes, and atherosclerosis; these
features are similar to those seen in people with Werner’s
syndrome. These observations prompted us to investigate
the LMNA gene in our subset of individuals with atypical
(non-WRN) Werner’s syndrome.
Methods
Between January, 1987, and November, 2003, we
enrolled all patients diagnosed with Werner’s syndrome
via the international registry of Werner syndrome.
15
Criteria for diagnosis of Werner’s syndrome are
summarised in table 1. We enrolled controls from the
national long-term care survey (Department of Pathology,
University of Washington, Seattle, WA, USA), a
population-based sampling of US residents. Written
informed consent was sought at the time of enrolment
from both patients and controls.
We obtained blood samples from all participants. We
established lymphoblastoid cell lines from patients’ blood
samples with Epstein-Barr virus, and primary fibroblast
cultures were made from punch skin biopsy samples.
2
This protocol was approved by the internal review board
at the University of Washington, Seattle, WA, USA.
When we received the samples, we did initial
mutational analysis by amplification of LMNA exons from
genomic DNA with published primers,
5
followed by cycle
sequencing of the PCR product with Thermo Sequenase
(Bioline, Canton, MA, USA) with phosphorus-33
dideoxynucleoside triphosphate terminators (Amersham
Pharmacia, Piscataway, NY, USA). For confirmation,
poly(A) RNA was reverse transcribed, and we amplified
LMNA cDNA with primers shown in the panel, and
sequenced the product with internal primers.
LMNA mutations in atypical Werner’s syndrome
Lishan Chen, Lin Lee, Brian A Kudlow, Heloisa G Dos Santos, Olav Sletvold, Yousef Shafeghati, Eleanor G Botha,
Abhimanyu Garg, Nancy B Hanson, George M Martin, I Saira Mian, Brian K Kennedy, Junko Oshima
Mechanisms of disease

For personal use. Only reproduce with permission from The Lancet
anti--actin (clone AC-15, Sigma, St Louis, MO, USA),
then with secondary antibodies against mouse (BA-9200,
Vector Laboratories, Burlingame, CA, USA). We
visualised proteins by chemiluminescence.
We identified proteins that had sequence similarity to
human lamin A/C with the online version of PSI-BLAST,
with default variable settings.
16
We developed a statistical
model (hidden Markov model)
17
of resultant proteins and
a representative cytoplasmic intermediate filament protein
(vimentin) that was assessed with SAM, the sequence
alignment and modelling system software (Santa Cruz,
CA, USA).
18
We used this model to generate multiple
alignments of these sequences.
We did indirect immunofluorescence as previously
described.
19
We used a combination of two mouse
monoclonal antibodies—sc-7292 and sc-7293 (Santa
Cruz Biotechnology, Santa Cruz, CA, USA)—to detect
endogenous A-type lamins. All images were obtained with
deltavision deconvolution microscopy (Applied Precision,
Issaquah, WA, USA) at the Keck Center for Imaging,
University of Washington, Seattle, WA, USA.
Role of the funding source
The sponsors of the study had no role in study design,
data collection, data analysis, data interpretation, or
writing of the report.
Results
Of 129 adult index cases referred to the University of
Washington international registry of Werner syndrome,
26 (20%) did not have mutations in coding regions of
WRN. Of these, four were found to be heterozygous for
missense mutations in LMNA. The clinical features of
these four patients are summarised in table 1, and
abbreviated pedigrees are shown in figure 1.
Unlike patients with classic Werner’s syndrome, who
have a mean age of diagnosis of 39 years (SD 7·7),
20
those
diagnosed with atypical disease were diagnosed around
age 23 years (SD 7·5), with the mean age of initial
symptoms being 13 years (SD 4·0).
MECHANISMS OF DISEASE
THE LANCET • Vol 362 • August 9, 2003 • www.thelancet.com 441
For Western blot analysis, 20 g of total proteins were
separated on a 4–12% gradient Bis-Tris gel (Invitrogen,
Carlsbad, CA, USA) and transferred to nylon filters. We
did this process three times. Filters were incubated with
anti-lamin A/C (clone JoL2, Chemicon International,
Temecula, CA, USA), anti-WRN (clone 30, BD
Transduction Laboratories, San Diego, CA, USA), or
PORTU8010 ATLAN1010 NORWAY1010 IRAN1010
Mutation in LMNA R133L R133L L140R A57P
protein (gene) (813G→T) (813G→T) (834T→G) (584G→C)
Ethnic origin White African White Middle
European American European Eastern
Gender Female Female Male Female
Age (years) of 9 17 14 Early
initial symptoms teens
Initial presenting Short Fatigue Defined as Short
symptoms stature being stature
physically
inferior
Age (years) of 18 18 34 23
patient at diagnosis
Referring diagnosis Werner’s Werner’s Werner’s Progeroid
syndrome syndrome syndrome syndrome
Werner’s syndrome
key signs*
Cataracts No No Yes No
Scleroderma-like Yes Yes Yes Yes
skin
Short stature Yes Yes No Yes
Greying/thinning Yes Yes Yes Yes
of hair
Increased urinary NA NA NA Yes
hyaluronic acid
Other signs of
Werner’s syndrome*
Diabetes mellitus, Yes, at Yes, at No No
type 2 age 23 age 18
Hypogonadism Yes No Yes Yes
Osteoporosis Yes NA Yes Yes
Osteosclerosis NA NA NA Yes
of digits
Soft-tissue No NA Yes No
calcification
Premature No NA Yes No
atherosclerosis
Mesenchymal No NA No No
neoplasms
Voice changes Yes NA Yes No
Other – Paternal Aortic Dilated
manifestations inheritance stenosis/ cardiomyo-
insufficiency; pathy;
died at age sloping
36 years shoulders
Werner’s syndrome Possible Possible Probable Possible
diagnosis*
NA=not available. *Diagnosis of Werner’s syndrome is based on previously
described criteria.
2
Table 1: Characteristics of individuals with LMNA mutations
Primers used to amplify and sequence LMNA
cDNA
Forward primers
5 TTTCCGGGACCCCTGCCCCGCG 3
5 CAGCCCTAGGTGAGGCCAAGAA 3
Reverse primers
5 GCGACTGCTGCAGCTCCTC 3
5 GCCCCCTCCCATGACGTGCA 3
NORWAY1010
ATLAN1020
PORTU8010
IRAN1010
PORTU8020
PORTU8040
PORTU8050
ATLAN1010
Figure 1: Pedigrees of families with atypical Werner’s
syndrome
Filled-in symbols indicate affected individuals.
GLOSSARY
ALTERNATIVE SPLICING
A mechanism by which different forms of mature mRNAs are generated
from the same gene.
AMPHIPATHIC
A compound containing both hydrophobic and hydrophilic groups. An
amphipathic helix contains hydrophobic aminoacids at one side and
hydrophilic aminoacids at the other.
HAPLOINSUFFICIENCY
Arises when the normal phenotype requires the protein product of both
alleles, and reduction of 50% of gene function results in an abnormal
phenotype.
HELICASES
Enzymes that unwind double-strand DNA into two single DNA strands.

For personal use. Only reproduce with permission from The Lancet
MECHANISMS OF DISEASE
442 THE LANCET • Vol 362 • August 9, 2003 • www.thelancet.com
A base substitution in exon 2 (813G→T), which altered
aminoacid 133 by changing Arg (CGG) to Leu (CTG),
was seen in two affected individuals—ATLAN1010
and PORTU8010. We did not record this mutation
in either parent or in a younger sister
in the PORTU pedigree, indicating
that the R133L mutation was a de
novo mutation. A different mutation
(834T→G)—a Leu (CTG) to Arg
(CGG) substitution at aminoacid 140—
was seen in the NORWAY1010
individual. A third new mutation
(584G→C), which altered Ala (GCA)
to Pro (CCA) at aminoacid 57, was
recorded in the IRAN1010 patient. All
these heterozygous mutations were
detected by genomic PCR sequencing
and confirmed by sequencing RT-PCR
products (figure 2).
The dominant presenting features of
the four patients were their
appearances (looking older than their
age) and short stature, which was
especially striking for the IRAN1010
patient. Cardiovascular pathological
findings, osteoporosis, lipodystrophy,
and muscular atrophy were also
typical. Doctors reported atrophic skin,
loss of subcutaneous tissues, and
various degrees of muscle atrophy in
these patients. Grey or sparse hair was
also reported in all patients. Insulin-
resistant diabetes mellitus was seen in
both patients with the R133L mutation
(ATLAN1010 and PORTU8010).
The deceased father, paternal aunt,
and paternal grandmother of ATLAN1010 were also
diagnosed with severe insulin deficiency syndrome,
suggesting that the R133L mutation might have been
paternally inherited (figure 1).
NORWAY1010
PORTU8020
PORTU8040
PORTU8050
IRAN1010
PORTU8010
ATLAN1010
ATLAN1020
NORWAY1010
IRAN1010
ATLAN1010
PORTU1010
A
B C
*** **
GATCGATCGATC
GA TCGATC
PORTU8010
PORTU8020
PORTU8050
NORWAY1010
82-6
IRAN1010
ATLAN1010
ATLAN1020
Lamin A
Lamin C
WRNp
 actin
74 kD
65 kD
180 kD
42 kD
Figure 2: LMNA mutations in patients with atypical Werner’s syndrome
(A) Genomic PCR sequencing result. Arrows show the presence of 813G→T substitution in ATLAN1010 and PORTU8010 (causing R133L mutation), 834T→G
in NORWAY1010 (causing L140R mutation), and 584G→C in IRAN1010 (causing A57P mutation). *Individuals with wildtype LMNA. (B) RT-PCR sequencing of
index cases. (C) Western-blot analysis of lamin A/C, WRN protein, and  actin in lymphoblastoid cell lines from IRAN, ATLAN, and PORTU pedigrees, and
primary fibroblasts from the NORWAY patient. 82-6 is a line of control primary skin fibroblasts. The autoradiograph with the highest exposure is shown here.
1A 2A 2B11B 2B2
Globular
head
domain
Globular
tail
domain
Flexible
linker
-helical coiled coil domains
Heptad
repeat
A57P R133L L140R
HsLaminA
GgLaminA
XlLaminA
HsLaminB1
DmLaminC
CeLamin
TlaminA
CaLaminB3
HsVim
A57P
SLETENAGLRLRITE
SLELENAGLRLRITE
SLELENARLRLRITE
SLETENSALQLQVTE
NLENENSRLTQELNL
QLEQENNRLQVQIRD
HLEEQNSKLRSEVTT
QLENDKSSLQLLVEE
FLEQQNKILLAEL--
R133L L140R
GDLIAAQARLKELEALLNSKEAA
ADLLAAQARLKDLEALLNSKEAA
SDLLETQARLKDLEALLNSKDAA
SDLNGAQIKLREYEAALNSKDAA
KEATVAENNARLYENRANELNGK
RELAGAEEQALHAQSIADQSQAK
KELDAAFKRIQALEASLGEKDGR
SELSTAVGHWRNLEAALNSKEAD
-----------------------
51
50
47
52
66
65
6
57
123
125
124
121
126
140
139
80
131
A
B
Figure 3: Structure of lamin A and disease mutants
(A) Domain organisation of lamin A and locations of A57P, R133L, and L140R mutations. (B) Multiple
sequence alignment of selected nuclear lamins in the vicinity of these mutation sites (yellow). Columns
in grey depict invariant positions. Boxes correspond to the -helical, coiled-coil segments. Red marks
the first and fourth positions of a coiled-coil heptad repeat; in dimeric coiled-coils, they are usually
apolar or hydrophobic and are internalised to stabilise the structure. The selected lamin sequences
shown are HsLaminA, Homo sapiens lamin A/C (databank code LAMA_HUMAN); GgLaminA, Gallus
gallus lamin A (LAMA_CHICK); XlLaminA, Xenopus laevis lamin A (LAMA_XENLA); HsLaminB1, Homo
sapiens lamin B1 (LAM1_HUMAN); DmLaminC, Drosophila melanogaster lamin C (LAMC_DROME);
CeLamin, Caenorhabditis elegans lamin (S42257); TLamin, Tealia sp lamin (CAB43352); CaLaminB3,
Carassius auratus lamin B3 (BAB32977); and HsVim, H sapiens vimentin (VIME_HUMAN).

For personal use. Only reproduce with permission from The Lancet
cell types—eg, lymphoblastoid cell lines and primary
fibroblasts—irrespective of the presence of heterozygous
mutations. In lymphoblastoid cell lines, lamin C was
expressed, on average, at concentrations 47% higher than
lamin A. In fibroblasts, lamin C was expressed at
amounts 2·6-fold higher than lamin A (figure 2). We
detected normal WRN expression in LMNA mutant cells
(figure 2).
To elucidate the pathological importance of the three
LMNA mutations, we investigated sequence conservation
in homologous proteins (figure 3). Multiple sequence
alignment indicated that invariant portions are confined
largely to -helical coiled-coil segment 1A and the
C-terminus of segment 2B2 (data not shown; figure 3).
The A57P site is usually occupied by hydrophilic
aminoacids, R133L is generally polar, and L140R can
tolerate a range of substitutions (figure 3). The R133L
and L140R mutations are located in a heptad repeat
region of 1B (figure 3) that seems to be unique to nuclear
lamins.
22
Many laminopathy-associated LMNA mutations
lead to perturbed nuclear structure.
3,11
We therefore
did DAPI (diaminophenylindole) staining on primary
fibroblasts from the NORWAY1010
patient to examine whether LMNA
mutations leading to atypical Werner’s
syndrome caused a similar phenotype.
Labelling indices of control primary
fibroblasts and NORWAY1010
fibroblasts were comparable (65%
and 72%, respectively). To determine
the correlation between misshapen
nuclei and absence of intranuclear
lamin A/C, cells were first scored
for nuclear shape and then examined
for intranuclear lamin A/C foci.
We recorded that most of the
NORWAY1010 cells showed altered
nuclear structure compared with
the control primary fibroblasts
(61% vs 25%, p=0·0037; table 2).
Many nuclei were irregularly
shaped and some displayed apparent
leakage of DAPI into the cytoplasm
(figure 4).
We also examined lamin A/C
localisation. Normally in fibroblasts,
lamin A/C localises to both the nuclear
envelope and internal foci of
undefined function.
23
These internal
foci often surround nucleoli.
19
In the
subset of NORWAY1010 cells with
nuclei that seemed normal, lamin
A/C localisation was also normal.
In cells with abnormally shaped
nuclei, lamin A/C remained associated
with the nuclear envelope, but
was usually not detected at internal
foci (figure 4). This finding is in
sharp contrast to that of control
fibroblasts, in which lamin A/C
staining was normal even in the most
irregularly shaped nuclei (figure 4).
The percentage of cells without
intranuclear lamin A/C foci in
those with misshapen nuclei differed
significantly between NORWAY1010
cells and control primary fibroblasts
(p=0·0344; table 2).
MECHANISMS OF DISEASE
THE LANCET • Vol 362 • August 9, 2003 • www.thelancet.com 443
We sequenced LMNA in 116 controls, who were
mainly of white ethnic origin. None of the alterations
described was seen in these individuals (p<0·0001).
The LMNA gene encodes gene products produced by
ALTERNATIVE SPLICING, lamin A and lamin C.
21
Results of
the three independent Western-blot analyses showed that
lamins A/C are expressed at similar amounts in the same
Mean percentage Mean percentage of
of misshapen cells lacking
nuclei (SD) intranuclear lamin
A/C foci (SD)
Control primary fibroblasts (82-6) 24·7 (0·4) ··
NORWAY1010 60·7 (2·2) ··
Control primary fibroblasts (82-6)
Cells with normal nuclei ·· 4·3 (1·6)
Cells with misshapen nuclei ·· 9·0 (2·0)
NORWAY1010
Cells with normal nuclei ·· 9·3 (1·1)
Cells with misshapen nuclei ·· 46·7 (6·9)
Data represent the mean (SD) from three independent experiments. In every
experiment, 100 cells were counted for every phenotype in three independent
experiments.
Table 2: Nuclear morphology and lamin localisation
Figure 4: Nuclear structure and subcellular localisation of lamin A/C
DAPI staining was used to establish nuclear shape in control (A) and NORWAY1010 primary
fibroblasts (B, C). Indirect immunofluorescence in control (D–I) and NORWAY1010 (J–L) primary
fibroblasts (green). DAPI staining marks DNA (blue). Volume views are shown, which are composites
of several images taken at distances of 0·2 m apart through most of the nucleus.

For personal use. Only reproduce with permission from The Lancet
MECHANISMS OF DISEASE
444 THE LANCET • Vol 362 • August 9, 2003 • www.thelancet.com
Discussion
We have shown that a subset of patients with Werner’s
syndrome without mutations at the WRN locus have
mutations at the LMNA locus that cause the disorder.
These observations, however, do not preclude the
possibility that a WRN function or functions could be
altered.
Imura and colleagues
24
grouped patients with Werner’s
syndrome according to similar clusters of clinical features.
They inferred that there were at least three distinct clinical
types of the disease, with type 2 Werner’s syndrome being
the least typical and having the earliest age of onset—
resembling the LMNA-type Werner’s syndrome we report
here.
The age at initial signs in patients with atypical
Werner’s syndrome was 6 years earlier than the mean age
for the appearance of grey hair, which is usually the
earliest sign of classic Werner’s syndrome, aside from the
short stature, which is recognised only retrospectively.
20
The rates of progression of disease in this group of
patients with atypical Werner’s syndrome could be greater
than is typically the case for those with classic disease.
At least six polymorphisms have been identified in
LMNA, which do not change the encoded aminoacids.
These polymorphisms include 1276T→C (A287A),
1753T→C (D446D), and 2113C→T (H566H) in the
coding region, and IVS4–13T→A and 2393C→T (398
bases downstream from stop codon) in the 3 untranslated
region.
9,25
These polymorphisms were noted in some of
the patients with atypical Werner’s syndrome and
controls.
Segment 1A of LMNA protein is believed to form one
AMPHIPATHIC  helix in the monomeric (open) form and a
coiled-coil in the dimeric (closed) form.
26
Thus, any
disruption of the helix induced by the proline in the A57P
mutation might not be important for the lamin A/C
segment 1A monomer. A57P could affect the assembly,
dynamics, or both of a filamentous network because this
(subtle) conformational change could affect how 1A
segments interact in the dimer. Segments 1B, 2A, 2B1,
and 2B2 constitute the central rod domain and are the
primary building blocks of the coiled-coil dimer.
26
An
locations of R133L and L140R at the surface position of a
heptad repeat suggests the mutations might not affect the
structure of the lamin A/C dimer itself, but rather perturb
intermolecular interactions.
Most of the mutations reported in patients with
autosomal dominant Emery-Dreifuss muscular dystrophy,
dilated cardiomyopathy type 1A, limb-girdle muscular
dystrophy type 1B, and familial partial lipodystrophy are
heterozygous missense mutations. They map throughout
the LMNA exons.
3
Many of these are predicted to cause
failure of nuclear lamina assembly. The observation of an
unaffected father bearing one of the compound
heterozygous mutations in a patient with Emery-Dreifuss
muscular dystrophy suggests that a threshold of lamin
abnormality might exist for lamina assembly.
5
Alternatively, a patient with Emery-Dreifuss muscular
dystrophy with a heterozygous stop codon mutation at
aminoacid 6 raises the possibility that
HAPLOINSUFFICIENCY
of lamins may partly account for the nuclear fragility.
4
An
R133P substitution—similar to the R133L mutation
reported in atypical Werner’s syndrome—has been
reported in a 40-year-old patient with Emery-Dreifuss
muscular dystrophy who had disease onset at age 7 years
and atrial fibrillation at age 32 years.
5
LMNA mutations
were not detected in the parents and siblings of two of our
patients, indicating that they most probably arose de
novo.
5
The overlapping syndromes of Emery-Dreifuss
muscular dystrophy, dilated cardiomyopathy type 1A, and
limb-girdle muscular dystrophy type 1B have been widely
noted,
7,10,27
which could be due to alterations in lamina
structure. For example, the homozygous A298C mutation
reported in autosomal recessive Charcot-Marie-Tooth
disease type 2, resides at the -helical rod domain, which
probably perturbs the lateral interactions of lamin A.
28
The NORWAY1010 individual, who died of uraemia at
age 36 years, had extensive arterial calcifications
consistent with premature atherosclerosis. Coronary
atherosclerosis is the major cause of death in patients with
either Werner’s syndrome or Hutchinson-Gilford
syndrome, but happens at a much earlier age in those with
Hutchinson-Gilford syndrome. Sloping shoulders and
osteosclerosis of finger phalanges—characteristics of
mandibuloacral dysplasia—were noted in the IRAN1010
patient. Osteosclerosis of the distal phalanges has also
been described in patients with typical Werner’s
syndrome.
29
Dilated cardiomyopathy is not a feature of
mandibuloacral dysplasia, caused by homozygous
mutation at R527H. The location of the mutation in the
IRAN1010 patient, A57P, is close to mutations seen in
dilated cardiomyopathy type 1A and Emery-Dreifuss
muscular dystrophy, which might also present with
cardiomyopathies.
Clinical features of our patients are distinct from classic
Hutchinson-Gilford syndrome. Onset of this disorder is
during the first year of life, and mean age of death is
13 years. Five different mutations have been reported in
Hutchinson-Gilford syndrome—G608G, G608S, E145K,
R471C, and R527C.
12–14
The most typical mutation,
G608S, results in an in-frame deletion of 50 aminoacids
in the C-terminal region of LMNA, including the
endoproteolytic cleavage site.
12–14
The E145K mutation is
within the heptad repeat of LMNA, and is close to the
R133L and L140R mutations. The clinical phenotype of
E145K was unusual for Hutchinson-Gilford syndrome in
that scalp hair and ample subcutaneous tissues over arms
and legs were present.
14
Why do LMNA missense mutations lead to so many
diseases that in some cases show little phenotypic overlap?
Two non-exclusive models have been suggested.
3
In one,
general alterations in nuclear structure resulting from
mutations in LMNA lead to cell instability and ultimately
tissue atrophy. This model does not clearly account for
tissue specificity. Moreover, since most mutations are
associated with similar proportions of nuclear shape
anomalies when expressed in fibroblasts, the reason why
the range of affected tissues would differ so widely from
one mutation to the next is not evident. The second
model is that lamins A and C act to regulate several
important nuclear components whose activities are
important to prevent disease onset.
30
The range of
phenotypes with respect to each missense mutation would
then depend on which interactions were affected. Our
structural analysis suggests that phenotypic differences in
our patients may result from the specific tissue or cell-type
nature of regulatory or cross-bridging partners. Despite
the appeal of this model, only a few of these possible
interacting factors—such as emerin, lamin-associated
protein, and nesprin —have been identified to date.
Why might mutation of LMNA promote progeroid
phenotypes? One obvious possibility is that WRN function
is impaired. Although we find that LMNA mutant
fibroblasts have normal WRN protein amounts, to
establish whether WRN protein localisation and activity is
normal will be important before we can rule out this
hypothesis. A second possibility is that retinoblastoma

For personal use. Only reproduce with permission from The Lancet
MECHANISMS OF DISEASE
THE LANCET • Vol 362 • August 9, 2003 • www.thelancet.com 445
protein function is altered in patients with atypical
Werner’s syndrome that contain LMNA mutations. We
have discovered that lamin A/C, a known retinoblastoma
protein binding-protein, is needed to maintain
retinoblastoma protein stability (Johnson B, Kennedy B K,
unpublished). Also, interference with function of this
retinoblastoma protein is known to delay the onset of
senescence in cell culture.
31
These LMNA mutations
might enhance retinoblastoma activity leading to an
accelerated senescence programme. Whatever the cause,
our findings suggest that proper nuclear organisation is
important to prevent or delay the progeroid features noted
in patients with LMNA mutations.
Most (82·9%) patients with Werner’s syndrome have
mutations in either WRN or LMNA. Molecular diagnosis
can stratify and complement a clinical diagnosis when the
phenotype is unclear. Candidate genes that may account
for these remaining cases would include those coding for
the growing family of proteins that have been reported to
interact with various domains of the WRN protein,
including DNA-PK complex, TRF2, and TP53.
32
The
LMNA or WRN mutations could also be secondary to a
mutation in another mutator gene, since several pedigrees
of the LMNA mutations were not inherited from the
parents and arose only in the germlines of parents.
Contributors
L Chen did sequencing and protein analysis. L Lee did sequencing and
established cell lines. B A Kudlow did immunofluorescence studies.
G Dos Santos provided the PORTU pedigree. O Sletvold provided the
NORWAY case. Y Shafeghati provided the IRAN case. E G Botha
provided the ATLAN pedigree. A Garg initiated LMNA mutation
screening and provided necessary scientific and technical information.
N B Hanson organised shipment of samples and corrected necessary
clinical and laboratory information. G M Martin checked every patient for
the clinical diagnosis of Werner’s syndrome. S I Mian did structural
studies. B K Kennedy did analyses of immunofluorescence studies and
contributed substantially to the Discussion section of the report. J Oshima
analysed sequencing results and designed the experimental plans.
Conflict of interest statement
None declared.
Acknowledgments
This work was supported by grants from the National Institute of Health
and the Progeria Research Foundation.
References
1 Yu CE, Oshima J, Fu YH, et al. Positional cloning of the Werner’s
syndrome gene. Science 1996; 272: 258–62.
2 Nakura J, Wijsman EM, Miki T, et al. Homozygosity mapping of the
Werner syndrome locus (WRN). Genomics 1994; 23: 600–08.
3 Burke B, Stewart CL. Life at the edge: the nuclear envelope and
human disease. Nat Rev Mol Cell Biol 2002; 3: 575–85.
4 Bonne G, Di Barletta MR, Varnous S, et al. Mutations in the gene
encoding lamin A/C cause autosomal dominant Emery-Dreifuss
muscular dystrophy. Nat Genet 1999; 21: 285–88.
5 Brown CA, Lanning RW, McKinney KQ, et al. Novel and recurrent
mutations in lamin A/C in patients with Emery-Dreifuss muscular
dystrophy. Am J Med Genet 2001; 102: 359–67.
6 Fatkin D, MacRae C, Sasaki T, et al. Missense mutations in the rod
domain of the lamin A/C gene as causes of dilated cardiomyopathy
and conduction-system disease. N Engl J Med 1999; 341: 1715–24.
7 Muchir A, Bonne G, van der Kooi AJ, et al. Identification of
mutations in the gene encoding lamins A/C in autosomal dominant
limb girdle muscular dystrophy with atrioventricular conduction
disturbances (LGMD1B). Hum Mol Genet 2000; 9: 1453–59.
8 Cao H, Hegele RA. Nuclear lamin A/C R482Q mutation in canadian
kindreds with Dunnigan-type familial partial lipodystrophy.
Hum Mol Genet 2000; 9: 109–12.
9 Speckman RA, Garg A, Du F, et al. Mutational and haplotype
analyses of families with familial partial lipodystrophy (Dunnigan
variety) reveal recurrent missense mutations in the globular C-terminal
domain of lamin A/C. Am J Hum Genet 2000; 66: 1192–98.
10 Garg A, Speckman RA, Bowcock AM. Multisystem dystrophy
syndrome due to novel missense mutations in the amino-terminal head
and alpha-helical rod domains of the lamin A/C gene. Am J Med 2002;
112: 549–55.
11 Novelli G, Muchir A, Sangiuolo F, et al. Mandibuloacral dysplasia is
caused by a mutation in LMNA-encoding lamin A/C.
Am J Hum Genet 2002; 71: 426–31.
12 Cao H, Hegele RA. LMNA is mutated in Hutchinson-Gilford
progeria (MIM 176670) but not in Wiedemann-Rautenstrauch
progeroid syndrome (MIM 264090). J Hum Genet 2003; 48: 271–74.
13 De Sandre-Giovannoli A, Bernard R, Cau P, et al. Lamin A
truncation in Hutchinson-Gilford progeria. Science 2003; 300: 2055.
14 Eriksson M, Brown WT, Gordon LB, et al. Recurrent de novo point
mutations in lamin A cause Hutchinson-Gilford progeria syndrome.
Nature 2003; 423: 293–98.
15 International Registry of Werner Syndrome. http://www.pathology.
washington.edu/research/werner/registry/frame2.html (accessed
June 19, 2003).
16 Altschul SF, Madden TL, Schaffer AA, et al. Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res 1997; 25: 3389–402.
17 Hughey R, Krogh A. Hidden Markov models for sequence analysis:
extension and analysis of the basic method. Comput Appl Biosci 1996;
12: 95–107.
18 UCSC Computational Biology Group. Sequence alignment and
modeling system. http://www.cse.ucsc.edu/research/compbio/sam.html
(accessed July 15, 2003).
19 Kennedy BK, Barbie DA, Classon M, Dyson N, Harlow E. Nuclear
organization of DNA replication in primary mammalian cells. Genes
Dev 2000; 14: 2855–68.
20 Epstein CJ, Martin GM, Schultz AL, Motulsky AG. Werner’s
syndrome a review of its symptomatology, natural history, pathologic
features, genetics and relationship to the natural aging process.
Medicine (Baltimore) 1966; 45: 177–221.
21 Lin F, Worman HJ. Structural organization of the human gene
encoding nuclear lamin A and nuclear lamin C. J Biol Chem 1993;
268: 16321–26.
22 Hutchison CJ. Lamins: building blocks or regulators of gene
expression? Nat Rev Mol Cell Biol 2002; 3: 848–58.
23 Bridger JM, Kill IR, O’Farrell M, Hutchison CJ. Internal lamin
structures within G1 nuclei of human dermal fibroblasts. J Cell Sci
1993; 104 (Pt 2): 297–306.
24 Imura H, Nakao Y, Kuzuya H, Okamoto M, Okamoto M,
Yamada Y. Clinical, endocrine and metabolic aspects of the
Werner syndrome compared with normal aging. In: Salk D, Fujiwara Y,
Martin GM, eds. Werner’s syndrome and aging. New York: Plenum
Press, 1985: 171–86.
25 Hegele RA, Cao H, Harris SB, Zinman B, Hanley AJ, Anderson CM.
Genetic variation in LMNA modulates plasma leptin and indices of
obesity in aboriginal Canadians. Physiol Genomics 2000; 3: 39–44.
26 Strelkov SV, Herrmann H, Geisler N, et al. Conserved segments 1A
and 2B of the intermediate filament dimer: their atomic structures and
role in filament assembly. EMBO J 2002; 21: 1255–66.
27 Bonne G, Mercuri E, Muchir A, et al. Clinical and molecular genetic
spectrum of autosomal dominant Emery-Dreifuss muscular dystrophy
due to mutations of the lamin A/C gene. Ann Neurol
2000; 48: 170–80.
28 De Sandre-Giovannoli A, Chaouch M, Kozlov S, et al. Homozygous
defects in LMNA, encoding lamin A/C nuclear-envelope proteins,
cause autosomal recessive axonal neuropathy in human (Charcot-
Marie-Tooth disorder type 2) and mouse. Am J Hum Genet 2002; 70:
726–36.
29 Goto M, Takeuchi F, Tanimoto K, Miyamoto T. Clinical,
demographic, and genetic aspects of the Werner syndrome in Japan.
Adv Exp Med Biol 1985; 190: 245–61.
30 Wilson KL. The nuclear envelope, muscular dystrophy and gene
expression. Trends Cell Biol 2000; 10: 125–29.
31 Shay JW, Pereira-Smith OM, Wright WE. A role for both RB and p53
in the regulation of human cellular senescence. Exp Cell Res 1991; 196:
33–39.
32 Brosh RM Jr, Bohr VA. Roles of the Werner syndrome protein in
pathways required for maintenance of genome stability. Exp Gerontol
2002; 37: 491–506.