Biodegradation of Methyl tert-Butyl Ether by Enriched Bacterial Culture

Abstract

Degradation of methyl tert-butyl ether (MTBE) as a sole carbon and energy source was investigated utilizing an enriched bacterial consortium derived from an old environmental MTBE spill. This enriched culture grew on MTBE with concentration up to 500 mg/l, reducing the MTBE in medium to undetectable concentrations in 23 days. Traces of tert-butyl alcohol were detected during MTBE degradation. The degradation was not affected by additional cobalt ions, whereas low concentration of glucose enhanced the rate of degradation. The bacterial community consisted of numerous bacterial genera, the majority being members of the phylum Acidobacteria and genus Terrimonas. The alkane 1-monooxygenase (alk) gene was detected in this consortium. Our findings suggest that environmental degradation of MTBE proceeds along the previously proposed pathway.

Full text

Biodegradation of Methyl tert-Butyl Ether by Enriched Bacterial
Culture
Haizhou Liu ÆJianping Yan ÆQin Wang Æ
Ulrich Gosewinkel Karlson ÆGang Zou Æ
Zhiming Yuan
Received: 19 January 2009 / Accepted: 19 February 2009 / Published online: 25 March 2009
ÓSpringer Science+Business Media, LLC 2009
Abstract Degradation of methyl tert-butyl ether (MTBE)
as a sole carbon and energy source was investigated uti-
lizing an enriched bacterial consortium derived from an old
environmental MTBE spill. This enriched culture grew on
MTBE with concentration up to 500 mg/l, reducing the
MTBE in medium to undetectable concentrations in
23 days. Traces of tert-butyl alcohol were detected during
MTBE degradation. The degradation was not affected by
additional cobalt ions, whereas low concentration of glu-
cose enhanced the rate of degradation. The bacterial
community consisted of numerous bacterial genera, the
majority being members of the phylum Acidobacteria and
genus Terrimonas. The alkane 1-monooxygenase (alk)
gene was detected in this consortium. Our findings suggest
that environmental degradation of MTBE proceeds along
the previously proposed pathway.
Introduction
Methyl tert-butyl ether (MTBE) is the most widely used
additive in gasoline, used to increase its octane rating
replacing tetraethyl lead, and to reduce carbon monoxide
and ozone levels in the air. According to the United States
Clean Air Act Amendment of 1990, there has to be a
minimum of 2.7% bound oxygen (w/v) in gasoline. Most
gasoline sold in 1990s in the United States, Europe and
China contained up to 15% MTBE [13]. MTBE, therefore,
has become the most produced synthetic chemical in the
world, with an annual production around 17 million tons in
2000 all over the world. In 2004, about 1.3 million metric
tons of MTBE were used as gasoline additive in China and
the consumption of MTBE has further increased in sub-
sequent years [3].
Because of its high solubility in water and low adsorp-
tion to soil and organic matter, underground tank leakage
or accidental spills have shown MTBE to be the most
commonly detected contaminant in groundwater in the
United States and Europe. After about 30 years’ con-
sumption, MTBE was detected at a frequency of 16.9% in
wells in urban areas and 3.4% in wells in rural areas in the
United States [21]. Furthermore, MTBE has been detected
in 7% of the drinking water samples, with 0.8% of the
detected samples over 20 lg/l. Thus, MTBE has been
partially or completely banned in 25 states of the United
States as of August 2007 [25], and cost-effective MTBE
remediation technology is in high demand.
MTBE was thought to be nondegradable in soil and
groundwater [7], due to the high dissociation energy (about
360 kJ/mol) of the ether bond and presence of the tertiary
carbon atom, making biodegradation enzymatically unfa-
vorable. However, in 1994 Salanitro reported a mixed
culture, BC-1, which slowly degraded MTBE as a sole
carbon and energy source [17]. Mo et al. reported pure
bacterial cultures which belonged to genera Methylobac-
terium,Rhodococcus, and Arthrobacter that were able to
grow on MTBE as a sole carbon source in 1997 [11]. The
first proposed MTBE, ETBE, and TAME degradation
pathway by propane-degrade strains was reported by
Steffan et al.[22]. Additional MTBE degradation cultures
have been reported recently. Besides bacteria genera
H. Liu J. Yan Q. Wang G. Zou Z. Yuan (&)
Wuhan Institute of Virology, Chinese Academy of Sciences,
Wuhan 430071, China
e-mail: yzm@wh.iov.cn
U. G. Karlson
National Environmental Research Institute, University of
Aarhus, Roskilde, Denmark
123
Curr Microbiol (2009) 59:30–34
DOI 10.1007/s00284-009-9391-1

mentioned above, Aquincola tertiaricarbonis L108 [12],
Hydrogenophaga flava ENV735 [23], Gordonia terrae
strain IFP 2001 [6], Methylibium petroleiphilum PM1 [14],
Mycobacterium austroafricanum IFP2012 [4], Pseudomo-
nas mendocina KR-1 [20], Pseudonocardia sp. strain
ENV478 [26], Rhodococcus rhodochrous [5], etc. have
also been reported to be able to degrade MTBE. A fila-
mentous fungus, Graphium sp., was also reported to
oxidize MTBE [19].
A proposed MTBE biodegradation pathway is available
from the Biocatalysis/Biodegradation Database at the
University of Minnesota (http://umbbd.msi.umn.edu/).
According to this pathway, MTBE is oxidized by alkane 1-
monooxygenase (EC 1.14.15.3) to produce either tert-butyl
formate (TBF) and formate, or tert-butyl alcohol (TBA)
and formaldehyde. TBF can be transformed to TBA by
carboxylesterase, and TBA can be oxidized by alkane 1-
monooxygenase to 2-methyl-2-hydroxy-1-propanol [10]. A
methylotroph, M. petroleiphilum PM1, which is able to
completely metabolize MTBE and degrade aromatic
(benzene, toluene, and xylene) and straight-chain (C
5
to
C
12
) hydrocarbons, was the first MTBE-degrading bacte-
rium from which the whole genome has been analysed [8].
So far, the recent advances in MTBE biodegradation
have not led to corresponding applications in MTBE
remediation technology, apparently due to non-suitability
of the isolated degraders to field applications. We suspect
that the degraders used so far do not representing the
microbial taxa that are responsible for MTBE degradation
in nature.
In this study, we enriched the groundwater sample that
has been contaminated by MTBE for several decades and
identified a bacterial consortium that rapidly degrades
MTBE as a sole carbon and energy source. This mixed
culture was mainly composed of Terrimonas sp. and
uncultured Acidobacteria. The alkane 1-monooxygenase
gene was detected in the consortium.
Materials and Methods
Strains and Media
The enriched culture was collected by suspending Bayvitec
polyurethane foam flakes (Bayer, Leverkusen, Germany) in
the collection basin of a groundwater pump-and-treat
facility in Leuna, Germany. The groundwater was con-
taminated with approx. 100 mg/l MTBE, its average
temperature was 10°C and its salinity measured at 2 dS/m.
The location most likely represents the oldest MTBE
contamination in the world, since its origin relates to large-
scale production of MTBE between approx. 1950 and
1990. After one year the foam flakes were transferred to 5-l
Erlenmeyer flasks, capped with a silicone stopper, and
incubated in 2 l original groundwater at 16°C for 4 years,
with repeated ventilation and spiking to 100 mg/l MTBE at
approx. every 4 weeks. The cobalt content of the medium,
after filtration through a 0.45-lm cellulose acetate filter
(Minisart, Sartorius, Hannover, Germany), measured at
6.1 lg/l total Co by inductively coupled plasma-mass
spectrometry.
Strain Escherichia coli DH5awas grown on Luria-
Bertani medium. All chemical reagents, if not specified,
were analytical grade. MTBE (99.8% purity) was pur-
chased from Sigma. Restriction endonucleases, T4 DNA
ligase and LA Taq polymerase were purchased form Ta-
KaRa Biotechnology (Dalian, China).
MTBE Degradation Assays
Fifty milliliter culture was transferred into a sterile 250-ml
serum flask. The MTBE concentration was adjusted, as
appropriate, using a 30 g/l stock solution, and the flask was
capped and crimped immediately using an aluminum cap
with PTFE/silicone septum (Agilent 5183–4478). The flask
was incubated on a shaker at 150 rpm at 30°C. In order to
investigate effects of additional ions and carbon sources,
the incubation medium was amended before MTBE addi-
tion with cobalt chloride at 0.1 and 1 mg Co
2?
/l, and
glucose at 81.7 mg/l.
Analytical Methods
MTBE was measured by ambient headspace-gas chroma-
tography method using an Agilent 6820 GC fitted with a
30 m DB-624 capillary column and FID detector. Culture
fluid was removed from the flask using a sterile syringe and
injected into a 2-ml sample vial (Agilent 5182-0716)
containing 0.25 g Na
2
SO
4
capped with a PTFE/silicone
septum (Agilent 5182–0721). The vial was vortexed for
30 s at room temperature and 500 ll headspace air were
injected into the GC by using an air-tight syringe. The
carrier gas was nitrogen and the column was maintained at
40°C. Analysis of intermediates was performed by direct
injection of 1 ll filtered culture into an Agilent 6890N GC
equipped with a 5973 mass-spectrometric detector.
Whole DNA Extraction and 16S rRNA Analysis
Whole consortium DNA was extracted according to the
procedure by Cho et al. [2]. DNA was purified by agarose
gel electrophoresis and retrieved using a Fermentas DNA
Extraction Kit (K0513). 16S rRNA gene amplification was
performed using universal PCR primer 27F (50-AGAGT
TTGATCATGGCTCAG-30) and 1492R (50-TACGGTTAC
CTTGTTACGACTT-30)[9]. PCR products were purified
H. Liu et al.: MTBE Degradation by Enriched Culture 31
123

by agarose gel electrophoresis and retrieved using an
Omega E.Z.N.A.
TM
Gel Purification Kit. PCR products
were then cloned onto a TA cloning vector pMD18-T
(TaKaRa Biotechnology, (Dalian) Inc., Dalian, China) and
transformed into strain E. coli DH5aby electroporation for
the construction of 16S rRNA fragment bank. In total, 110
single colonies were picked and the plasmids were pre-
pared using the plasmid mini-prep method [18]. Plasmids
were grouped by restriction fragment length polymorphism
(RFLP) using double digestion with restriction endonu-
cleases EcoRI and PstI. Both strands of randomly chosen
plasmids in each group were sequenced by Invitrogen
(Shanghai, China). The 16S rRNA gene sequence iden-
tity was determined by using the NCBI BLAST software
tool [1].
Detection of Alkane 1-Monooxygenase Gene
Alkane 1-monooxygenase (alk) gene sequences were
retrieved from GenBank and aligned by ClustalX [24].
PCR primers were designed using Primer Premier 5.0
(Premier Biosoft International, USA) based on the aligned
alk genes result. Because of the sequence variation of alk
genes, primers were designed in five groups (Table 1).
PCR products were detected by 1% agarose gel electro-
phoresis and retrieved using the Omega E.Z.N.A.
TM
Gel
Purification Kit (Omega Bio-Tek, USA). Then PCR prod-
ucts were cloned into the TA cloning vector pMD18-T, and
then sequenced by Invitrogen. DNA sequence was identi-
fied by program BLASTX of NCBI BLAST nr database.
Results
Growth of Bacterial Consortium
The consortium grew on MTBE as a sole source of carbon
and energy. It mineralized 40, 140, and 500 mg/l MTBE
completely in 7, 9, and 23 days, respectively (Fig. 1).
Traces of TBA were detected during MTBE degradation by
GC-MS analysis only when the culture was incubated on a
shaker. While the culture was incubated in static, TBA was
detected (data not shown). This result indicated that TBA,
the intermediate of MTBE degradation, was accumulated
in culture in shaking culture. Amendment with 0.1 and
1mgCo
2?
/l had no significant effect on MTBE minerali-
zation (Fig. 2a). Upon amendment with glucose equimolar
to MTBE, the rate of MTBE degradation approximately
doubled during the first 100 h (Fig. 2b). However, glucose
amendment at 10-fold molarity inhibited MTBE minerali-
zation and growth of this culture, resulting in the complete
loss of its MTBE degradation capacity (data not shown).
Composition of Bacterial Consortium
The whole bacterial consortium DNA was extracted and
purified and the 16S rRNA genes were amplified by PCR.
According to the RFLP results, eight clones were chosen
for sequencing. For each clone, about 1560 nucleotides
were sequenced. Blast results of these 16S rRNA sequen-
ces indicated that the clones could be affiliated as follows:
52.6% to the phylum Acidobacteria (identities 92–97%),
35.4% to Terrimonas sp. (92–97%), 3.6% to Hydrogen-
ophaga sp. (99%) and 1.8% to Bacillus fusiformis (98%).
Others were unidentified sequences. The GenBank acces-
sion numbers of these 8 16S rRNA genes are FJ713028 to
FJ713035.
Detection of Alkane 1-Monooxygenase Gene
The alk gene was detected in the consortium using PCR with
five different primer sets followed by agarose gel electro-
phoresis. The PCR product from the primers AMNB.1/
AMNB.2 were purified, cloned, and sequenced. The BLAST
results indicated that this 260 bp DNA fragment possessed
very low similarity in nucleic acid sequences level to known
Table 1 Primers pairs for alk
gene detection Primer Sequence (50–30) Annealing temperature
(°C)
Expected size of product
(bp)
AMNA.1 CGAACATTATGGGCTGACGCG 62 123
AMNA.2 TGGCGCTGCAGGTTGATCAG
AMNB.1 AATCGTTCTGGGCGTTCCTG 61 260
AMNB.2 CCCGTAGTGCTCGACGTAGTT
AMNGNP.1 CATCATGTTAACGTAGCAACGCC 60 319
AMNGNP.2 TGCAGCCCGTAGTGCTCAAT
AMNGP.1 TACGGGCACTTCTTCGTCGAGCA 64 477
AMNGP.2 TTGGCGTGGTGGTCGGAGTG
AMP.1 TGGTACGGCCACTTCTACATCGA 63 368
AMP.2 CTCGTGATGCCAGACGACGC
32 H. Liu et al.: MTBE Degradation by Enriched Culture
123

genes in the nt databases, but a high similarity (68% iden-
tities) in amino acids sequence level to a subunit of the
alkane-1 monooxygenase of Frankia sp. EAN1pec
(ZP_00569707). The GenBank accession number of this
partial alk gene sequence is FJ713036.
Discussion
Until now only a few pure cultures have been reported to
utilize MTBE as a sole source of carbon and energy,
whereas many more mixed cultures were found to grow on
MTBE. In a mixed culture, bacterial cooperation can
facilitate adaptation to xenobiotics due to the higher
genetic diversity of enzymes available. In this consortium,
we found the majority of the bacteria to belong to the
Acidobacteria, which is a newly established phylum with
only three described species. In soil, 30–50% of the
sequences obtained in 16S rRNA clone libraries have been
reported to belong to the Acidobacteria [15]. Bacteria in
this phylum cannot grow on artificial media, and are
identified by 16S rRNA analysis only. Our attempts to
isolate MTBE-degrading bacteria from the mixed culture
failed because they tended to lose the degradation capacity
very easily even grew on media with very low concentra-
tion of nutrients (data not shown). The predominance of
acidobacterial microbes in this bacterial community might
account for the failure. However, since the strain Hy-
drogenophaga flava ENV735 was reported to degrade
MTBE [23], the Hydrogenophaga sp. in the culture might
also able to participate MTBE degradation.
Some reports indicated that MTBE degradation can be
stimulated by addition of cobalt ions at concentrations
between 0.45 and 1.0 mg/l to a cobalt-free medium [4,16].
This was attributed to cobalt-dependent bacterial growth on
0204060
80 100 120 140 160 180
0
10
20
30
40
Time (h)
MTBE concentration (mg/L)
0 25 50 75 100 125 150 175 200 225 250
0
20
40
60
80
100
120
140
160
0 50 100 150 200 250 300 350 400 450 500
0
100
200
300
400
500
600
A
B
C
Fig. 1 Degradation of MTBE under different concentration. Filled
circles, sterile control; open circles, consortium. Error bars represent
standard deviations. a40 mg/l MTBE; b140 mg/l MTBE, and c
500 mg/l MTBE
Time (h)
MTBE concentration (mg/L)
0 25 50 75 100 125 150 175 200
0
10
20
30
40
0 20 40 60 80 100 120 140 160
0
20
40
60
80
100
120
140
A
B
Fig. 2 Effect of glucose amendment (a) and cobalt amendment (b)
on MTBE degradation by the consortium. aFilled circles, sterile
control; open circles, unamended consortium; inverted triangle,
equimolar amendment with glucose (81.7 mg/l). bFilled circles,
sterile control; open circles, unamended consortium; upright triangle,
0.1 mg/l Co
2?
; inverted triangle, 1 mg/l Co
2?
H. Liu et al.: MTBE Degradation by Enriched Culture 33
123

2-hydroxy-isobuturate, a MTBE degradation intermediate,
which resulted in higher biomass. In this study, using
authentic groundwater from a historic MTBE spill and an
adapted bacterial consortium, bacterial growth was not
observed during MTBE degradation assays. The back-
ground concentration of Co
2?
, although 10- to 100-fold
lower than in the earlier pure culture studies, apparently
was high enough to exclude Co
2?
deficiency in the culture,
and amendment with Co
2?
did not enhance growth of
MTBE-degrading cells.
The production of TBA and the lack of any build-up
suggest that MTBE was mineralized by this bacterial
consortium along the same initial pathway as proposed
earlier. Successful detection of alk gene fragments in the
consortium further suggests that an alkane monooxygenase
protein might be involved in MTBE degradation.
The mixed bacterial culture reported in this study is able
to degrade MTBE as a sole carbon and energy source
relatively rapid and utilize MTBE concentration up to
500 mg/l. According to the known proposed MTBE deg-
radation pathway and detection of alk gene in the culture,
degradation of MTBE in this consortium might be initial-
ized by the alkane monooxygenase.
Acknowledgments We are grateful to Dr. Simon Rayner for critical
reading of the manuscript, and Dr. Martin M. Larsen for analyzing the
medium for cobalt. This work was supported by the National Natural
Science Foundation of China (Grant No. 30570038), Knowledge
Innovation Program of the Chinese Academy of Sciences (Grant No.
KSCX2-YW-G-009), and by the European Commission (Project
BIOTOOL, Grant No. GOCE-003998).
References
1. Altschul SF, Gish W, Miller W et al (1990) Basic local alignment
search tool. J Mol Biol 215:403–410
2. Cho JC, Lee DH, Cho YH et al (1996) Direct extraction of DNA
from soil for amplification of 16S rRNA gene sequences by
polymerase chain reaction. J Microbiol 34:229–235
3. Dong MX, Ma Z, Chang K (2007) MTBE production and tech-
nology and market prospect analyse. Petrochem Ind Appl 26:6–9
4. Francois A, Mathis H, Godefroy D et al (2002) Biodegradation of
methyl tert-butyl ether and other fuel oxygenates by a new strain,
Mycobacterium austroafricanum IFP 2012. Appl Environ
Microbiol 68:2754–2762
5. Goodfellow M, Jones AL, Maldonado LA et al (2004) Rhodo-
coccus aetherivorans sp. nov., a new species that contains methyl
t-butyl ether-degrading actinomycete. Syst Appl Microbiol
27:61–65
6. Hernandez-Perez G, Fayolle F, Vandecasteele JP (2001) Bio-
degradation of ethyl t-butyl ether (ETBE), methyl t-butyl ether
(MTBE) and t-amyl methyl ether (TAME) by Gordonia terrae.
Appl Microbiol Biotechnol 55:117–121
7. Jensen H, Arvin E (1990) Solubility and degradability of the
gasoline additive MTBE, methyl tert-butyl ether and gasoline
compounds in water. Contaminated Soil 90:445–448
8. Kane SR, Chakicherla AY, Chain PS et al (2007) Whole-genome
analysis of the methyl tert-butyl ether-degrading beta-
proteobacterium Methylibium petroleiphilum PM1. J Bacteriol
189:1931–1945
9. Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E,
Goodfellow M (eds) Nucleic acid techniques in bacterial sys-
tematics. Wiley, Chichester, pp 115–175
10. Lopes Ferreira N, Malandain C, Fayolle-Guichard F (2006)
Enzymes and genes involved in the aerobic biodegradation of
methyl tert-butyl ether (MTBE). Appl Microbiol Biotechnol
72:252–262
11. Mo K, Lora CO, Wanken AE et al (1997) Biodegradation of
methyl t-butyl ether by pure bacterial cultures. Appl Microbiol
Biotechnol 47:69–72
12. Muller RH, Rohwerder T, Harms H (2008) Degradation of fuel
oxygenates and their main intermediates by Aquincola tertiari-
carbonis L108. Microbiology 154:1414–1421
13. Nadim F, Zack P, Hoag GE et al (2001) United States experience
with gasoline additives. Energy Policy 29:1–5
14. Nakatsu CH, Hristova K, Hanada S et al (2006) Methylibium
petroleiphilum gen. nov., sp. nov., a novel methyl tert-butyl ether-
degrading methylotroph of the Betaproteobacteria. Int J Syst Evol
Microbiol 56:983–989
15. Quaiser A, Ochsenreiter T, Lanz C et al (2003) Acidobacteria
form a coherent but highly diverse group within the bacterial
domain: evidence from environmental genomics. Mol Microbiol
50:563–575
16. Rohwerder T, Breuer U, Benndorf D et al (2006) The alkyl tert-
butyl ether intermediate 2-hydroxyisobutyrate is degraded via a
novel cobalamin-dependent mutase pathway. Appl Environ
Microbiol 72:4128–4135
17. Salanitro JP, Diaz LA, Williams MP et al (1994) Isolation of a
bacterial culture that degrades methyl t-butyl ether. Appl Environ
Microbiol 60:2593–2596
18. Sambrook J, Russell DW (2002) Molecular cloning: a laboratory
manual, vol 3. Cold Spring Harbor Laboratory Press, New York
19. Skinner KM, Martinez-Prado A, Hyman MR et al (2008) Path-
way, inhibition and regulation of methyl tertiary butyl ether
oxidation in a filamentous fungus, Graphium sp. Appl Microbiol
Biotechnol 77:1359–1365
20. Smith CA, O’Reilly KT, Hyman MR (2003) Cometabolism of
methyl tertiary butyl ether and gaseous n-alkanes by Pseudo-
monas mendocina KR-1 grown on C5 to C8 n-alkanes. Appl
Environ Microbiol 69:7385–7394
21. Squillace PJ, Moran MJ, Lapham WW et al (1999) Volatile
organic compounds in untreated ambient groundwater of the
United States. Environ Sci Technol 33:4176–4187
22. Steffan RJ, McClay K, Vainberg S et al (1997) Biodegradation of
the gasoline oxygenates methyl tert-butyl ether, ethyl tert-butyl
ether, and tert-amyl methyl ether by propane-oxidizing bacteria.
Appl Environ Microbiol 63:4216–4222
23. Steffan RJ, Vainberg S, Condee CW (2000) Biotreatment of
MTBE with a new bacterial isolate. In: Wickramanayake GB,
Gavaskar AR, Alleman BC et al (eds) Bioremediation and phy-
toremediation of chlorinated and recalcitrant compounds. Battelle
Press, Columbus, OH
24. Thompson JD, Gibson TJ, Plewniak F et al (1997) The CLUS-
TAL_X windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic
Acids Res 25:4876–4882
25. United States Environmental Protection Agency (2007) State
actions banning MTBE (statewide). EPA420-B-07-013. EPA,
Washington, DC
26. Vainberg S, McClay K, Masuda H et al (2006) Biodegradation of
ether pollutants by Pseudonocardia sp. strain ENV478. Appl
Environ Microbiol 72:5218–5224
34 H. Liu et al.: MTBE Degradation by Enriched Culture
123