Genome-wide analysis of the FleQ direct regulon in Pseudomonas fluorescens F113 and Pseudomonas putida KT2440

Abstract

Bacterial motility plays a crucial role in competitiveness and colonization in the rhizosphere. In this work, Chromatin ImmunoPrecipitation Sequencing (ChIP-seq) analysis has been used to identify genes putatively regulated by the transcriptional regulatory protein FleQ in Pseudomonas fluorescens F113 and Pseudomonas putida KT2440. This protein was previously identified as a master regulator of flagella and biofilm formation in both strains. This work has demonstrated that FleQ from both bacteria are conserved and functionally equivalent for motility regulation. Furthermore, the ChIP-seq analysis has shown that FleQ is a global regulator with the identification of 121 and 103 FleQ putative binding sites in P. fluorescens F113 and P. putida KT2440 respectively. Putative genes regulated by FleQ included, as expected, flagellar and motility-related genes and others involved in adhesion and exopolysaccharide production. Surprisingly, the ChIP-seq analysis also identified iron homeostasis-related genes for which positive regulation was shown by RT-qPCR. The results also showed that FleQ from P. fluorescens F113 shares an important part of its direct regulon with AmrZ, a global regulator also implicated in environmental adaption. Although AmrZ also regulates motility and iron uptake, the overlap occurred mostly with the iron-related genes, since both regulators control a different set of motility-related genes.

Full text

1
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
www.nature.com/scientificreports
Genome-wide analysis of the FleQ
direct regulon in Pseudomonas
uorescens F113 and Pseudomonas
putida KT2440
Esther Blanco-Romero1, Miguel Redondo-Nieto1, Francisco Martínez-Granero1,
Daniel Garrido-Sanz1, Maria Isabel Ramos-González2, Marta Martín
1 & Rafael Rivilla
1
Bacterial motility plays a crucial role in competitiveness and colonization in the rhizosphere. In this
work, Chromatin ImmunoPrecipitation Sequencing (ChIP-seq) analysis has been used to identify genes
putatively regulated by the transcriptional regulatory protein FleQ in Pseudomonas uorescens F113
and Pseudomonas putida KT2440. This protein was previously identied as a master regulator of agella
and biolm formation in both strains. This work has demonstrated that FleQ from both bacteria are
conserved and functionally equivalent for motility regulation. Furthermore, the ChIP-seq analysis has
shown that FleQ is a global regulator with the identication of 121 and 103 FleQ putative binding sites
in P. uorescens F113 and P. putida KT2440 respectively. Putative genes regulated by FleQ included, as
expected, agellar and motility-related genes and others involved in adhesion and exopolysaccharide
production. Surprisingly, the ChIP-seq analysis also identied iron homeostasis-related genes for which
positive regulation was shown by RT-qPCR. The results also showed that FleQ from P. uorescens
F113 shares an important part of its direct regulon with AmrZ, a global regulator also implicated in
environmental adaption. Although AmrZ also regulates motility and iron uptake, the overlap occurred
mostly with the iron-related genes, since both regulators control a dierent set of motility-related
genes.
Flagella biosynthesis in pseudomonads requires more than 50 genes subjected to four levels of hierarchical reg-
ulation1. In this regulatory cascade, the transcriptional regulator FleQ appears to be the master regulator2. e
function of FleQ in agella synthesis regulation has been studied in Pseudomonas aeruginosa1,2, in P. putida3–5
and in P. uorescens6–8. In these species, mutations in the eQ gene result in non-motile, aagellated bacteria.
FleQ is an atypical enhancer binding protein (EBP) from the NtrC family of bacterial transcription factors (TFs)
with three fundamental domains: a N-terminal REC domain which lacks the aspartic acid that serves as a phos-
phorylation site in other members of the same family, a central AAA+/ATPase σ54 (RpoN)-interaction domain
and a C-terminal helix-turn-helix DNA-binding domain9. It has been described that FleQ is able to activate
the expression of genes involved in agellar export (hA and iLMNOPQ operon), localization and regulation
of the agellar apparatus (hF and eN), structural components of the agellar basal body and motor switch
complex (iEFG) and the eSR genes2,10. In the regulation of agellar operons, FleQ works along with the alter-
native σ factor RpoN2. It also works together with the anti-activator FleN, another ATPase, by means of direct
protein-protein interactions11–15. It has also been shown that FleQ can specically bind the bacterial second mes-
senger cyclic di-guanosine monophosphate (c-di-GMP)16,17 and the crystal structure of FleQ bound to c-di-GMP
has been resolved18. Interestingly, most of the agellar genes are moderately regulated by c-di-GMP, showing a
downregulation when the intracellular level of this molecule is high13.
Besides the agellar operons, FleQ regulates the biosynthesis of P. aeruginosa exopolysaccharides (EPSs,pel
and psl operons) in a c-di-GMP-dependent manner, triggering either the activation or repression of these
genes14,18. In the regulation of these operons, FleQ does not rely on RpoN but on the vegetative sigma factor
1Departamento de Biología, Facultad de Ciencias, Universidad Autónoma de Madrid, Darwin, 2, 28049, Madrid,
Spain. 2Departamento de Protección Ambiental. Grupo de Microbiología Ambiental y Biodegradación, Estación
Experimental del Zaidín, CSIC, Profesor Albareda, 1, 18008, Granada, Spain. Correspondence and requests for
materials should be addressed to R.R. (email: rafael.rivilla@uam.es)
Received: 22 May 2018
Accepted: 8 August 2018
Published: xx xx xxxx
OPEN
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
2
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
(σ70)14. In the case of the pel operon the mechanism proposed incorporating structural and functional data
implies that FleQ binds to two sites in the promoter of the operon but the eect on gene expression depends
on the level of c-di-GMP. Without c-di-GMP, a hexamer of FleQ, although bound to two sites, relies on one of
the sites (FleQ box 2) to repress gene expression when bound to FleN in presence of ATP. On the other hand, in
response to c-di-GMP, the FleN/FleQ/DNA complex suers a conformational change turning the FleQ multimer
into an activator from the other promoter site (FleQ box 1)14. In addition, FleQ has been recently described as
regulator of two strain-specic EPSs in P. putida KT2440, Pea and Peb17, the rst being a key element of biolm
formation in this bacterium19–21. Other polysaccharide regulated by FleQ in a c-di-GMP dependent mode in P.
putida is cellulose, through transcriptional regulation of the bcs operon17,22. FleQ has also been shown to regulate
the expression of the cdrA and lapA genes, encoding adhesins required for biolm formation in P. aeruginosa23
and P. putida24 respectively, in a c-di-GMP-dependent way. Furthermore, FleQ has been shown to be essential for
biolm formation in P. putida25,26.
Another central node in environmental adaption in pseudomonads is the transcriptional regulator AmrZ27,28.
A ChIP-seq assay in P. uorescens F113 showed that at least 215 genes were putatively regulated by AmrZ. AmrZ
was shown to regulate genes required for iron homeostasis, synthesis and degradation of c-di-GMP and motil-
ity28. Similar results were obtained in P. aeruginosa29. AmrZ is an important determinant of c-di-GMP levels. In
F113, AmrZ transcriptionally regulates multiple genes encoding diguanylate cyclases and the amrZ mutant shows
enhanced motility, altered exopolysaccharides production, reduced biolm formation, lack of rhizosphere colo-
nization competence and reduced cytoplasmic levels of c-di-GMP30. It is important to note that AmrZ strongly
represses the expression of the eQ gene in both, P. aeruginosa and P. uorescens species27,31.
Considering that FleQ and AmrZ regulate similar traits such as motility, exopolysaccharides production and
biolm formation, the aim of this work was to identify the genes and operons regulated by FleQ in P. uorescens
F113 and P. putida KT2440 by using ChIP-seq and to analyze the possible overlap between the FleQ and AmrZ
regulons in P. uorescens F113.
Results
FleQ from P. uorescens F113 and P. putida KT2440 are functionally equivalent for motility reg-
ulation. FleQ is the master regulator for agella synthesis in pseudomonads and eQ mutants are non-motile
because they lack agella. In order to determine the functionality of HA-FleQ fusion proteins to be used for
ChIP-seq, we complemented the swimming motility phenotype of eQ mutant derivatives of F113 and KT2400
with their respective cloned fusion genes. As shown in Fig.1, both HA-FleQ fusions were functional and were
able to complement the motility defect of the eQ mutants in both strains. Figure1 shows that HA-FleQKT2440 was
also able to complement the motility of the F113 eQ mutant and HA-FleQF113 complemented the KT2440 eQ
mutant. ese results show not only the functionality of the HA fusions, but also that FleQ proteins from both
species are functionally equivalent, at least in the regulation of motility.
Figure 1. HA-FleQ proteins from P. uorescens F113 and P. putida KT2440 are functionally equivalent in the
regulation of agella synthesis. Swimming motility of Pseudomonas uorescens F113 WT and eQ mutant
harbouring the empty vector pVLT31, pBG1998 (pVLT31 HA-FleQF113 construct) or pMIR212 (pVLT31 HA-
FleQKT2440 construct) (a). Swimming motility of P. putida KT2440 WT and its eQ mutant harbouring the
empty vector pVLT31, pBG1998 or pMIR212 (b). Swimming haloes produced in SA or LB with 0.3% (w/v)
puried agar were observed 24–48 h aer inoculation. Similar results were obtained with both media. Each
experiment was done at least in triplicate. Typical results are shown.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
3
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
FleQ is a global bifunctional transcriptional regulator in P. uorescens F113 and P. putida KT2440.
Four independent ChIP assays with N-tagged FleQ (HA-FleQF113 in Pseudomonas fluorescens F113
and HA-FleQKT2440 in P. putida KT2440) were performed, yielding 10 ng of immunoprecipitated DNA.
Immunoprecipitated DNA from the four replicas was pooled and subjected to Illumina sequencing. Aer qual-
ity ltering, 6,653,248 reads (40.5% overall alignment rate) in the case of F113 and 20,558,997 (70.8% overall
alignment rate) in the case of KT2440 of 50 nts length were used for subsequent experiments. In the case of F113,
bioinformatic analysis yielded 496 peaks distributed along all the genome (Fig.2a). Using a threshold of ve-fold
enrichment, 121 peaks were selected. Eighty-nine of these peaks (73.55%) were located in intergenic regions and
94.2% of them upstream an open reading frame (ORF). Gene assignment to peaks was done according to the
nearest start codon. When two start codons were aected, both genes were selected as putative FleQ targets. In
this way, 159 genes appeared as putatively aected by FleQ in F113. Similar results were obtained for KT2440.
As shown in Fig.2b, 279 peaks were also distributed along the chromosome. By using the same ve-fold thresh-
old, 103 peaks were selected. A percentage equal to 69.31% of them was also located in intergenic regions, 98%
upstream an ORF, resulting in 160 genes likely regulated by FleQ in this strain. e genome-wide distribution
of peaks and the overrepresentation of intergenic regions clearly indicate the role of FleQ proteins as global
regulators. Supplementary Tables1 and 2, list all the genes putatively aected by FleQ direct regulation in F113
and KT2440, respectively. As shown in Fig.2c, an overlap of 41 promoter regions occur between the two species,
indicating that these orthologues are potentially FleQ regulated in both species. Furthermore, 56.1% of these
common genes corresponded to genes implicated in motility, iron homeostasis and cell wall formation (Fig.2d),
Figure 2. FleQ is a global transcriptional regulator that can act both as an activator and as repressor in P.
uorescens F113 and P. putida KT2440. FleQ binding sites distribution along the P. uorescens F113 (a) and
P. putida KT2440 genomes (b). Fold enrichment value for each of the peaks aer peak calling with MACS 1.4
is represented against the coordinates in which these accumulations are located. Red line marks the ve-fold
enrichment threshold xed in the analysis. Venn diagram representation of the genes predicted to be in FleQF113
and FleQKT2440 regulons (c). Pie chart depicting the functional classication of FleQ-regulated genes shared by
P. uorescens F113 and P. putida KT2440. Percentage of the 41 genes shared by both species in each functional
category according to Gene Ontology database is represented (d). Genes included in these graphs are listed in
Table1. Gene expression analysis of putative FleQ-regulated genes by RT-qPCR assays in P. uorescens F113 (e)
and P. putida KT2440 (f). Expression level in the wild-type strain was considered 1 for each of the tested genes.
Fold variation for each gene was determined by the 2−ΔΔCT method. RNA was extracted aer growth in SA
medium to an O.D.600 ≈ 0.8. e asterisks denote statistically signicant dierences (**P < 0.01, ***P < 0.001)
found with t-test for independent samples and Bonferroni-Dune method.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
4
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
indicating the similar roles of the FleQ proteins in P. uorescens and P. putida. Genes identied in this study com-
mon to both species are listed in Table1.
Gene expression analysis was performed in both species for a selected group of genes that have a peak in their
promoter region. As shown in Fig.2e,f all the tested genes showed regulation by FleQ. As expected, FleQ acts as
a bifunctional regulator, activating the expression of genes implicated in motility and adhesion (iC, lapA) and
as a repressor for the expression of genes implicated in exopolysaccharides production (bcsA, PSF113_1970) and
others, both in P. uorescens F113 and in P. putida KT2440. Interestingly, amrZ was negatively regulated by FleQ
both in P. uorescens F113 and in P. putida KT2440.
Since regulation by FleQ may be inuenced by the second messenger c-di-GMP, similar ChIP-seq experi-
ments to those reported above were performed in F113 and KT2440 backgrounds with altered c-di-GMP levels.
For F113, a bifA- background was used for high c-di-GMP levels and a sadC-wspR- for low levels of the second
FUNCTIONAL CLASS LOCUS GENE PRODUCT
c-di-GMP PSF113_5738/ PP_5263 —GGDEF/EAL domains containing protein
CELL WALL
PSF113_0208/ PP_0168 lapA Surface adhesion protein
PSF113_4136/ PP_1970 —Lipoprotein
PSF113_4752 PP_1288 algD GDP-mannose 6-dehydrogenase
IRON
PSF113_1274/ PP_1006 —TonB-dependent hemoglobin/transferrin/
lactoferrin family receptor
PSF113_2454/ PP_3086 —ECF family RNA polymerase sigma-70 factor
PSF113_2456/ PP_2590 —Outer membrane ferric siderophore receptor
PSF113_2589/ PP_4606 —T ferric siderophore receptor
PSF113_3151/ PP_4755 —TonB-dependent siderophore receptor
PSF113_3153/ PP_0704 —ECF subfamily RNA polymerase sigma factor
PSF113_4568/ PP_1083 —BFD(2Fe-2S)-binding domain-containing
protein
PSF113_4845/ PP_4611 —ECF family RNA polymerase sigma-70 factor
PSF113_4896/ PP_3325 —Outer membrane ferric siderophore receptor
PSF113_5412/ PP_0350 —Ferrichrome-iron receptor
PSF113_5691/ PP_0180 —Cytochrome C family protein
MOTILITY/CHEMOTAXIS
PSF113_0569/ PP_4888 —Methyl-accepting chemotaxis sensory
transducer
PSF113_1531/ PP_4386 gF Flagellar basal body rod protein FlgF
PSF113_1532/ PP_4385 gG Flagellar basal body rod protein FlgG
PSF113_1562/ PP_4370 iE Flagellar hook-basal body protein FliE
PSF113_1582/ PP_4344 hA Flagellar biosynthesis protein FlhA
PSF113_1583/ PP_4343 hF Flagellar biosynthesis regulator FlhF
PSF113_4454/ PP_4391 gB Flagellar basal-body rod protein FlgB
PSF113_4456/ PP_4393 cheV-3 Chemotaxis protein CheV
PSF113_4457/ PP_4394 gA Flagellar basal body P-ring biosynthesis protein
FlgA
OTHERS
PSF113_0351/ PP_5059 —Hypothetical protein
PSF113_0572/ PP_4880 vacB Ribonuclease R
PSF113_0711/ PP_4674 recC Exodeoxyribonuclease V subunit gamma
PSF113_1201/ PP_1638 fpr Oxidoreductase FAD/NAD(P)-binding
domain-containing protein
PSF113_1592/ PP_4334 —ParA family protein
PSF113_1815/ PP_2239 rhtA Cysteine transporter
PSF113_4204/ PP_1878 —Hypothetical protein
PSF113_4567/ PP_1084 —Anti-oxidant AhpCTSA family protein
PSF113_5315/ PP_0437 birA Biotin-protein ligase
PSF113_5482/ PP_4960 fda Fructose-1,6-bisphospate aldolase
PSF113_5739/ PP_5264 rep ATP-dependent DNA helicase Rep
REGULATION/SIGNAL TRANSDUCTION
PSF113_1200/ PP_1637 —LysR family transcriptional regulator
PSF113_1897/ PP_1978 —TetR family transcriptional regulator
PSF113_4470/ PP_4470 amrZ Arc domain-contaning protein DNA binding
domain-containing protein
TRANSPORT PSF113_0210/ PP_0167 —LapA Type I secretion system ATPase
PSF113_1510/ PP_4519 tolC TolC type I secretion outer membrane protein
VIRULENCE PSF113_5053/ PP_0685 —Hypothetical protein
Table 1. List of genes predicted to be regulated by FleQ both in P. uorescens F113 and in P. putida KT2440.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
5
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
messenger32. A bifA- background was used in KT2440 for elevated c-di-GMP in comparison to the WT33. e
results were not signicantly dierent from those in the wild-type strains. In the case of F113, 126 out of the 159
genes identied as putatively regulated in the wild-type strain, were also identied in the bifA- assay and 106 in
the sadC-wspR- assay. One hundred and eighty are common between bifA- and sadC-wspR-, that have extreme
levels of c-di-GMP. In the case of P. putida KT2440, in the bifA- background, 149 peaks with a fold enrichment
higher than 5 were detected. 107 genes were coincident with the genes in the wild-type assay. ese genes include
all of the genes implicated in c-di-GMP turnover and exopolysaccharide production and most of the genes impli-
cated in motility and iron homeostasis. It also included genes such as lapA and amrZ. Furthermore, ten other
genes that appeared as potential FleQ targets in the wild-type assay, were also identied in the bifA- background,
although the peaks ranged between four and ve-fold. ese results clearly show that c-di-GMP does not play a
relevant role in the binding of FleQ to promoters which is in agreement to the current proposed model of regula-
tion18. Supplementary Tables3–5, list the genes identied as putatively regulated by FleQ in each of these genetic
backgrounds.
Regulation of motility by FleQ is conserved in P. uorescens F113 and P. putida KT2440. As
expected, among the selected genes we found the agellar regions, known to be regulated by FleQ, in both species.
Our results show that regions regulated by FleQ such as the agellar regulon, contain more binding sites than
those detected in the bioinformatics analysis, due to a masking eect produced by overlapping regions (Fig.3)
or the stringent cut-o used. Considering the two main agellar regions in the F113 genome, 11 genes were
assigned according to MACS output (Supplementary Table1). A closer look at these regions (Fig.3a) showed
that 17 genes/gene clusters are likely regulated by FleQ: gF, gG, PSF113_1540, iC, aG, iD, iST, eQ, eSR,
iE, iK, iLM, hA, hF (Fig.3a; nts 1,784,390 to 1,845,595) and gBCDE, gA and gMNZ region (Fig.3a; nts
5,195,362 to 5,203,148). Despite the dierent organization of the agellar region in KT2440 (Fig.3b), mostly the
same genes/gene clusters than in F113 are likely regulated by FleQ, indicating a very similar regulatory pattern
in both species. e only remarkable dierence is the lack of a peak upstream the iST genes in KT2440. ese
results are consistent with the interchangeable functions of both eQ alleles shown in Fig.1.
FleQ activates the expression of iron homeostasis genes in P. uorescens F113 and P. putida
KT2440. Aer assignation of the selected peaks in both species (Supplementary Tables1 and 2), genes were
classied in dierent functional categories according to the Gene Ontology database. As shown in Fig.4a,b
there was an overrepresentation of genes related to “iron homeostasis” (16.35%, 14.38%), “motility/chemotaxis”
(9.43%, 9.38%), “regulation and signal transduction” (5.03%, 7.50%) and “cell wall” (5.66%, 8.13%) in both spe-
cies, representing together one third of the genes putatively regulated by FleQ.
Figure 3. FleQ binds to promoters of genes included in the agellar gene clusters from P. F113 and P. putida
KT2440. HA-FleQ immunoprecipitation (IP) reads were plotted against the number of reads from the non-
immunoprecipitated DNA (Input). Regions represented correspond to the agellar gene clusters of both strains:
nts 1,784,390 to 1,845,595 and nts 5,195,362 to 5,203,148 in the case of P. uorescens F113 (a) and from nt
4,905,067 to 5,013,886 in P. putida KT2440 (b). e genes or gene clusters presenting a peak in its promoter are
marked on the top of the graph. Artemis Sanger release 16.0.0 genome viewer was used for the representation.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
6
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
Other represented classes include “transport” (10.06%, 10.63%), “c-di-GMP” (3.14%, 1.88%) and “virulence”
(3.14%, 0%). e remaining genes were included in “others” category (34.59%, 28.75%) or their functions are
unknown (12.58%, 19.38%). In order to test the relevance of FleQ as a regulator of iron homeostasis, we analyzed
the expression of several iron related genes in iron decient conditions, in both backgrounds, in the wild-type
strain and in the eQ mutant. As shown in Fig.4c,d, FleQ inuences the transcription of these genes as an acti-
vator in both species.
DNA consensus binding sequence for FleQ remains undetermined. With the purpose of nding
a specic motif binding site for FleQ, the summit positions of the 121 peaks in the F113 ChIP-seq assay and
103 peaks for KT2440 and a region of 100 nts on each side were introduced in the MEME tool. However, it
was not possible to determine a robust motif for FleQ as many peaks were located in the promoter region of
iron-responding genes in both cases. erefore, the main resulting motif was the iron responsive Fur-box motif
(not shown). is motif was present in 44 of the peaks with an e-value of 1.5e−034 in F113. To avoid iron bias those
regions containing a Fur motif were removed from the dataset, resulting in 62 peaks that were, again, analyzed
with the same tools. Once more for this particular situation, it was not possible to obtain a FleQ DNA-binding
consensus motif, as sequences corresponding to the IHF and σ54 binding sites masked any other possible con-
served sequence. Similar results were found with the KT2440 peaks. In view of the fact that no conserved region
for FleQ binding site could be found, a FleQ consensus sequence (GTCaNTAAAtTGAC) that has been proposed
for P. aeruginosa23, was searched with MAST, BLASTn and FIMO in P. uorescens F113. e genes that included
this P.aeruginosa motif, such as lapA-like, PSF113_1970, iL, iE and hA, were found in our F113 analysis and
corresponded to peaks. However, a total of 536 matches were detected in the F113 genome, 490 of them with a
p-value below the 1e-5 range (the same value published for this motif in the selected sequences from P. aerugi-
nosa). Most of the matches corresponded to regions that were not present in our ChIP-seq output. Consequently,
we were not able to dene a robust FleQ consensus binding sequence in P. uorescens F113. More recently, a
consensus sequence for the FleQ binding site in P. putida KT2440 (GTCAaAAAAtTGAC) was proposed17 based
on the promoter regions of 15 selected genes and the previously proposed consensus for P. aeruginosa. e genes
included iE, lapA, algD, bcs, pea, peb, eS, hA. Similarly to F113, the FleQ binding site in KT2440 was searched
in the pool of 103 peaks obtained in the KT2440 ChIP-seq assay using FIMO and MAST tools. As a result, 18
matches were found (p-value < 0.0001) and were attributed to 15 peaks, as in some peaks the motif appeared
more than once. e 15 peaks were assigned to 15 genes. Five genes (29.5%) were classied in the “cell wall” cat-
egory while the remaining 10 genes were distributed in “motility/chemotaxis” (iE and hB), “iron”, “transport”,
Figure 4. FleQ is involved in the activation of iron homeostasis-related genes in P. uorescens F113 and P.
putida KT2440. Pie chart representation of the genes likely controlled by FleQ in P. uorescens F113 (a) and P.
putida KT2440 (b) divided in functional classes. Genes found in ChIP-seq analysis according to Gene Ontology
database and percentages are shown. Genes included in this graph are listed in Supplementary Table1 (a) and
Supplementary Table2 (b). Gene expression analysis of iron homeostasis-related genes in P. uorescens F113
(c) and P. putida KT2440 (d) by RT-qPCR. Selected iron homeostasis-related genes predicted to be regulated by
FleQ were tested in both P. uorescens F113 (pvdL, PSF113_2589 and PSF113_4845) (c) and P. putida KT2440
(PP_2590, PP_4606 and PP_4611) (d). Relative expression of the genes in eQ mutants compared to WT
strains grown in CAS medium supplemented with bipyridyl for F113 and SA for KT2440 is represented. RNA
was extracted at O.D.600 of 0.8. e asterisks denote statistically signicant dierences (*P<0.05, **P < 0.01,
***P < 0.001) with t-test analysis for independent samples and Bonferroni-Dune method.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
7
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
“regulation/signal transduction” (amrZ), “others” and “unknown” categories. Genes included in “cell wall” func-
tional class were lapA, algD and genes of the pea, peb and bcs operons, all of them previously identied in vitro17.
e same coincidence was observed with iE. e motif was found three times in the case of lapA and twice in
pea. Although this motif seems to be congruent in a specic set of genes, being most of them related with exopol-
ysaccharide synthesis, we were unable to propose a consensus sequence that might expand to a majority of the
genes identied as being regulated by FleQ in P. putida KT2440. Evaluation of intergenic peaks independently did
not provide further information in the search for the union consensus sequence in any of the strains.
FleQ and AmrZ share an important part of their direct regulon in P. uorescens F113. As shown
above, the amrZ gene appears to be repressed by FleQ both in P. uorescens and in P. putida. Since AmrZ has
been shown to be a global motility and iron regulator in F113, the 159 genes putatively regulated by FleQ in this
strain were compared with the 215 genes found to be putatively regulated by AmrZ28. e results showed an
overlap of 45 genes putatively regulated by both proteins in P. uorescens F113 (Table2). Overlap occurred in
genes related to “iron” (39.13%), followed by “motility/chemotaxis” (6.52%), “regulation/signal transduction”
(6.52%), unknown functions (6.52%), “virulence” (4.35%), “cell wall” (4.35%), “c-di-GMP” (2.17%) and “trans-
port” (2.17%) (Fig.5). It is important to notice that most of the iron uptake genes found in the AmrZ regulon are
also present in the FleQ regulon. is is not the case for the motility/chemotaxis-related genes, where the overlap
is small and the two transcriptional regulators seem to regulate a dierent set of genes (Table2).
Discussion
In this work, we have characterized the direct regulon of the master regulatory protein FleQ in P. uorescens
F113 and P. putida KT2440. FleQ is an EBP present in all pseudomonads and related bacteria. In this study FleQ
has been revealed as a global regulator implicated in the regulation of gene expression of probably more than
one hundred genes/gene clusters in both species. FleQ binding sites were distributed along the genomes and the
majority of them were located in intergenic regions, showing a strong bias of the binding of FleQ towards inter-
genic regions, where most of the promoters are placed. Distribution of binding sites is similar in both species and
a signicant number of orthologues are putatively regulated by FleQ both in F113 and in KT2440. Gene ontology
classication of putative FleQ regulated genes is also very similar. Furthermore, the cross-complementation of
the swimming motility phenotypes of eQ mutants with heterologous alleles, shown in Fig.1, strongly indicates
that eQ genes play similar roles in both species. Although c-di-GMP has been shown to play an important role
in regulation by FleQ, we have shown here that binding of this regulator to promoters is independent of the levels
of the second messenger in both species, since the FleQ binding sites identied are very similar in strains with
inactivated DGC/PDE. In this sense, Xiao et al.22, showed that in P. putida KT2440 binding of FleQ to the gcbA
promoter was inhibited by high levels of c-di-GMP. However, our results show binding of FleQ to the gcbA pro-
moter both in the wild-type strain and in the bifA mutant, which is in agreement with the observation made for
FleQ binding to pel promoter independently of the presence of c-di-GMP18. e discrepancy about reported for
gbcA could well be due to the dierent type of experiment performed: an in vitro binding assay versus an in vivo,
although not physiological experiment.
We have been unable to determine a consensus sequence for the binding of FleQ even when only interspecic
peaks were included in the bioinformatic analysis. Over the years, dierent attempts and in vitro techniques have
been carried out trying to dene a DNA-binding consensus sequence for FleQ, but no consistent results have been
obtained. DNase I footprinting has been performed in order to determine FleQ binding sites on the promoters of
a set of agellar genes10. ough no conserved binding site was found, two dierent acting ways were suggested
for FleQ: activation from a distance with a looping in the eSR promoter and binding in the vicinity of the pro-
moter without looping in the case of hA, iE and iL10. Furthermore, attempts to nd reproducible DNase I
footprints of FleQ at the agellar promoter eSR were unsuccessful14. More recent studies also using this approach
were able to dene a motif for the binding of this protein to a limited set of promoters in P. aeruginosa23. However,
we have shown here that this motif, although present in a few of the detected peaks, is also present hundreds of
times in other non-enriched regions of the genome and is therefore unreliable, at least in F113. Dierent is the
case of the consensus sequence proposed in P. putida KT244017 which resulted too stringent as to include most of
the experimentally FleQ-enriched sequences.
FleQ was originally described as the master regulator of agella synthesis in P. aeruginosa2 and eQ mutants
are non-motile11,12. It has been shown that it is required for the expression of agellar genes, including eSR, hA,
iE, and iL10. e role of FleQ in the regulation of agella synthesis has also been shown in other pseudomonads,
such as P. uorescens6–8, P. chlororaphis34 and P. syringae35. e results presented here have conrmed the direct
role of FleQ in the regulation of agellar genes in P. uorescens and P. putida and FleQ binding has been shown in
vivo to promoters of the agellar region, such as iC, iE, iL, hA, hD and hF, among others. e role of FleQ
as an activator of agella synthesis in these two bacteria was also evident by the lack of expression of the iC gene
in a eQ mutant background in both species and by the complementation of swimming defects of eQ mutants.
FleQ has also been found to be a negative regulator of the expression of genes with a role in exopolysac-
charide synthesis in P. aeruginosa. It has been previously shown that FleQ repressed the expression of the pel
genes involved in the synthesis of the Pel exopolysaccharide and that this repression was reversed by c-di-GMP13.
Similarly, the expression of the psl genes, required for the Psl exopolysaccharide is also regulated in a c-di-GMP
dependent way in the same bacterium23. Pseudomonas uorescens F113 does not produce any of these polysac-
charides. However, a peak was detected in the promoter region of PSF113_1970, the rst gene of an operon likely
to encode the genes for the synthesis of a specic EPS not produced by P. aeruginosa or P. putida. We have also
shown that the expression of PSF113_1970 is higher in a eQ mutant background, indicating that the synthesis of
this putative EPS is negatively regulated by FleQ. It has been shown previously that strain KT2440 produces four
exopolysaccharides: alginate (alg), cellulose-like (bcs) and two less characterized polysaccharides, Pea and Peb21.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
8
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
It is known that FleQ binds in vitro to the promoter region of the gene clusters encoding the synthesis of Bcs, Pea
and Peb and that this regulator strongly represses the synthesis of alginate under cell wall stress conditions17. Our
in vivo experiments have validated the binding of FleQ to the bcs, alg and peb promoters, since peaks have been
detected in these locations. We have not detected a peak upstream of PP_3132, the rst gene in the pea operon.
However, a strong peak was found close to this location, upstream of PP_3126, encoding a “polysaccharide bio-
synthesis/export protein” that might have a double functionality in the production of the Pea polysaccharide. We
have also conrmed in this work that FleQ is a strong repressor of bcsA expression. Regarding biolm formation,
FleQ has been shown to positively regulate the expression of the lapA gene, which encodes a large adhesin essen-
tial for biolm formation. Positive regulation of lapA and lapA-like genes has been shown in P. putida24 and P.
aeruginosa23. We have conrmed here the in vivo binding of FleQ to the lapA promoter and the transcriptional
FUNCTIONAL CLASS LOCUS GENE PRODUCT
c-di-GMP PSF113_4023 —Diguanylate cyclase phosphodiesterase with PAS/
PAC sensor
CELL WALL PSF113_0208 lapA LapA
PSF113_4752 algD GDP-mannose 6-dehydrogenase
IRON
PSF113_0933 fagA FagA
PSF113_1274 —TonB-dependent hemin, ferrichrome receptor
PSF113_1322 —Iron-regulated protein A precursor
PSF113_1749 pvdS PvdS
PSF113_1750 pvdL PvdL
PSF113_1837 pvdD PvdD
PSF113_1856 —Outer membrane pyoverdine eux protein
PSF113_2258 —Outer membrane ferripyoverdine receptor
PSF113_2454 —RNA polymerase sigma-70 factor, ECF subfamily
PSF113_2589 —Ferrichrome-iron receptor
PSF113_3151 —Ferrichrome-iron receptor
PSF113_3220 —Heme uptake regulator
PSF113_3734 —Ferrichrome-iron receptor
PSF113_4045 —Iron-regulated membrane protein
PSF113_4568 —Bacterioferritin-associated ferredoxin
PSF113_4845 —RNA polymerase sigma-70 factor, ECF subfamily
PSF113_5412 uA FiuA
PSF113_5657 pA FbpA
MOTILITY/CHEMOTAXIS
PSF113_0569 —Methyl-accepting chemotaxis protein
PSF113_0751 hD FlhD
PSF113_2159 —Methyl-accepting chemotaxis protein
OTHERS
PSF113_0079c —Phage-related replication protein-like protein
PSF113_1047 —Multicopper oxidase
PSF113_1201 —Ferredoxin–NADP( + ) reductase
PSF113_2126 —Dihydrodipicolinate synthase
PSF113_2158 nuoA NuoA
PSF113_2972 —Glycosaminoglycan degradation
PSF113_3889 —Zinc carboxypeptidase domain protein
PSF113_3918 tig Tig
PSF113_3922 folD FolD
PSF113_4083 —Sterol desaturase
PSF113_4204 —Protein binding
PSF113_4932 prs Prs
PSF113_4978 —Pentapeptide repeat-containing protein
REGULATION/SIGNAL TRANSDUCTION
PSF113_1200 —LysR family transcriptional regulator
PSF113_4024 —Transcriptional regulator, Cro/CI family
PSF113_4470 amrZ AmrZ
UNKNOWN
PSF113_2272 —Hypothetical protein
PSF113_2273 —Reticulocyte binding protein
PSF113_5053 —Hypothetical protein
VIRULENCE PSF113_1855 —RHS repeat-associated core domain-containing
protein
PSF113_2409 vgrG VgrG
Table 2. List of genes predicted to be regulated by both FleQ and AmrZ in P. uorescens F113.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
9
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
activation of this gene by the regulator in P. putida. We have extended this observation to P. uorescens by showing
that in F113, FleQ also binds to the lapA promoter and that lapA is transcriptionally activated by FleQ.
We have also found that FleQ is likely to regulate genes and operons in P. uorescens F113 and P. putida
KT2440 that have not been previously identied as regulated by FleQ in any pseudomonad. Among these genes
some are related with c-di-GMP turnover, regulation, transport and notably iron homeostasis. Gene ontology
analysis showed that genes with similar functions are putatively regulated by FleQ in both species, showing again
the functional homology of FleQ proteins. Regarding iron, we have shown binding of FleQ to the pvd promoters,
responsible for the synthesis of the major siderophore pyoverdine in F113. Peaks in the regions of these promoters
have also been found in the KT2440 genome, although at a lower signicance value than in F113 (not shown).
Many other iron-responsive genes implicated in iron uptake also showed binding of FleQ in their promoter
regions in both species. Expression analysis of several of these genes in F113, KT2440 and theirs eQ mutant
backgrounds, under iron limitation, has shown that deprived of iron these genes are under positive regulation by
FleQ in both species. ese results determine a novel role for FleQ proteins in pseudomonads, as positive regu-
lators of iron homeostasis.
Other novel gene regulated by FleQ in P. uorescens F113 and P. putida KT2440 is amrZ. In our ChIP-seq anal-
ysis with FleQ, enriched regions have been found upstream of the amrZ gene in both species. Furthermore, gene
expression analysis has shown that amrZ is under transcriptional repression by FleQ. It is important to notice that
eQ itself is under strong AmrZ repression both in P. aeruginosa31 and P. uorescens27. Since AmrZ is also a major
regulator of motility and biolm formation and has been found to negatively regulate iron homeostasis genes in
P. aeruginosa29 and P. uorescens F11328, we decided to compare the AmrZ and the FleQ direct regulons in F113.
We have found that 45 genes are putatively regulated by both TFs. Among these genes it is noteworthy that almost
every iron-related gene that is directly regulated by AmrZ, is also directly regulated by FleQ. For these iron home-
ostasis genes, AmrZ acts as a weak repressor28 and FleQ as a weak activator, showing therefore opposing roles. If
AmrZ and FleQ interact between them or whether they compete for same regions in the promoter of these genes
is currently unknown. In the case of motility and exopolysaccharides genes, most are regulated either by AmrZ
or by FleQ although a few of them are overlapping genes. e function of this reciprocal regulation is unclear,
although it could work as an oscillator, as indicated in Fig.6. In this model FleQ and AmrZ work as a central hub
for environmental adaption. AmrZ would be a negative regulator of motility and iron homeostasis genes and a
positive regulator of exopolysaccharide production. FleQ would play an opposing role, by activating iron home-
ostasis genes and motility, but repressing exopolysaccharides production. We have recently shown that AmrZ is
a major regulator of c-di-GMP levels in F113, by activating several diguanylate cyclases30. FleQ in turn has been
shown to bind c-di-GMP in P. aeruginosa13,16 and P. pu ti da 17 and it was revealed that this binding determines its
transcriptional activity.
Genome wide analysis of the FleQ regulon have been previously performed by microarray hybridization in P.
uorescens strains Pf0-136 and SBW2537. Although these strains and F113 belong to the P. uorescens complex of
species, they have been shown to be dierent species, belonging to dierent phylogenetic groups38. In both cases,
Pf0-1 and SBW25, more than one hundred genes were shown to be dierentially expressed in the wild-type strain
compared to the eQ mutant. ese dierentially expressed genes belong to dierent functional classes, showing
that in these strains, FleQ is also a global regulator. Although many genes are common with genes reported here
to be putatively regulated by FleQ in F113 and P. putida KT2440, iron homeostasis related genes were not found
to be regulated by FleQ in Pf-01 or SBW25. However, in the case of SBW25, experiments were performed in
iron-sucient medium (LB) where iron uptake genes are under strong repression by Fur and are not expressed.
Furthermore, the level of activation reported in our studies for several of these genes, would have been below the
threshold used in both microarrays studies. is indicates that ChIP-seq is valuable in identifying entire regulons
of master regulators.
FleQ is an atypical EBP. Being a global regulator, it acts both as a transcriptional activator and as a repressor.
Its activity depends on the levels of the second messenger c-di-GMP. Conversely to other EBPs, its activation does
Figure 5. FleQ and AmrZ share part of their regulons in P. uorescens F113. Pie chart showing the genes
predicted to be regulated both by FleQ and AmrZ in the strain F113. Classication in functional categories of
the 45 shared genes according to Gene Ontology database is represented. Genes included in this graph are listed
in Table2.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
10
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
not depend on phosphorylation by an histidine kinase18 and it seems to be able to function with dierent sigma
factors: σ54 in the case of most agellar genes10, σ28 in the case of iC8, and σ70 in the case of biolm genes14. In this
sense, it has been proposed a role for FleQ in interplay with c-di-GMP and several sigma factors in determining
P. pu t id a life-style, switching between agellar motility and biolm formation4. On the other hand, FleQ is widely
conserved among the pseudomonads and seems to regulate similar genes. e results presented here describe for
the rst time the implication of FleQ in the regulation of iron homeostasis. Whether FleQ might interact with
the subfamily of extracytoplasmic function (ECF) sigma factors in the regulation of iron homeostasis is subject
of current investigation. All in all, the results presented in this work allow to conclude that together with AmrZ,
FleQ is an important determinant for environmental adaption.
Methods
Bacterial strains, growth conditions, antibiotics and plasmids. In this study, four P. uorescens F113
strains were used, a WT strain (F113Rif)39 a eQ mutant constructed in this work by homologous recombination
using pK18mobsacB vector40, a bifA- and a sadC−wspR− strains32. Additionally, three P. putida KT2440 strains
were used, a WT strain, which is a plasmid-free derivative of P. putida mt-241, a eQ mutant26 and a bifA−strain33.
F113, KT2440 and derivatives were grown at 28 °C in Luria-Bertani (LB) medium42 for the ChIP-seq experi-
ments, sucrose-asparagine (SA)38 or LB media for swimming with P. uorescens F113 and P. putida KT2440 and
RT-qPCR assays with P. putida KT2440 or CAS medium (3.18 mM Ca(NO3)2, 1 mM MgSO4, 50 mM PIPES, pH
adjusted to 6.8, containing 1 mM K2HPO4, 1% (w/v), casamino acids, and 1% (w/v) glycerol) supplemented with
100 µM 2,2’-bipyridyl (low-Fe)43 for RT-qPCR analysis with P. uorescens F113. Escherichia coli strain DH5α
(Gibco-BRL) carrying the appropriate plasmids for each conjugation was grown in LB medium at 37 °C. When
solid growth medium was used, 1.5% (w/v) of puried agar was added. Antibiotics were supplemented to main-
tain or select for plasmids and mutants as follows: ampicillin (Amp) at 100 µg/mL, kanamycin (Km) at 50 µg/mL
for P. uorescens F113 or 25 µg/mL for P. putida KT2440, tetracycline (Tet) at 10 µg/mL for E. coli and 10–25 µg/
mL for P. uorescens F113 and P. putida KT2440.
e hemagglutinin peptide YPYDVPDYA (HA) was fused in-frame to the FleQ protein N-terminal domain by PCR
using the primer: HAFleQ (5′-ATGTCTTATCCATACGATGTTCCAGATTATGCTTGGCGTGAAACCAAAATTC
-3′) and FleQR (5′-TCAATCATCCGCCTGTTCAT-3′) in the case of P. fluorescens F113 and HAFleQ
(5′-ATGTCTTATCCATACGATGTTCCAGATTATGCTTGGCGTGAAACCAAGATT-3′) and FleQR
(5′-AAGCTTAATCCTCCGCCTGGTC-3′) for P. putida KT2440. e amplied fragments were cloned into the
IPTG-inducible expression vector pVLT3144 to generate the plasmids pBG1998 and pMIR212, respectively.
Complementation of the eQ mutants. e functionality of the HA-FleQ fusion constructs used in the
ChIP-seq experiments was validated by the restoration of motility in the eQ mutants of P. uorescens F113 and
P. putida KT2440. Mutant complementation was done by introducing the recombinant plasmid pVLT31 either
empty or carrying HA-FleQ into the corresponding mutant strain by triparental mating as reported previously26.
Swimming motility assays. Motility of either WT F113 or KT2440, eQ mutants and complemented eQ
mutants was tested by swimming assays. Cells were inoculated in triplicate in SA or LB media on 50 mm diameter
plates containing 0.3% (w/v) puried agar by introducing a toothpick with the strain to be analyzed from previous
solid cultures for F113 and liquid cultures for KT2440 and incubated at 28 °C. Haloes were observed aer 24 h
(LB) or 48 h (SA) incubation.
ChIP-seq assay. Protein-DNA interaction and binding sites of FleQ were surveyed by Next-Generation
Sequencing technology combined with chromatin immunoprecipitation (ChIP). In the ChIP experiment,
Figure 6. FleQ and AmrZ form a central hub for environmental adaption in P. uorescens F113. Proposed
model of the FleQ and AmrZ interplay in the regulation of traits implicated in environmental adaption.
According to this model, FleQ and AmrZ form an oscillator by its mutual transcriptional repression. FleQ acts
as an activator of motility and expression of iron homeostasis genes and as a repressor of exopolysaccharide
genes. Conversely, AmrZ activates EPSs production genes and represses motility and iron homeostasis genes.
e second messenger c-di-GMP participates in this circuit, since AmrZ activates the expression of diguanylate
cyclases and FleQ transcriptional regulation is modulated by c-di-GMP binding.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
11
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
transcriptions factors were cross-linked to DNA in their native state and immunoprecipitated (IP) following the
experimental procedure as detailed previously28. In this experiment, 20 mL of LB-cultures at OD600 of 0.5 from P.
uorescens F113 and derivatives (pBG1998) and P. putida KT2440 and derivatives (pMIR212) were induced for
3 h with 0.1 mM IPTG28. Before immunoprecipitation a sample was prepared to be used as input in order to detect
non-specic binding against the IP sample. Samples from four independent cultures per case were inmunopre-
cipitated and the DNA pooled. Sequencing of DNA samples was carried out by UT Health Science Center at San
Antonio Genome Sequencing Facility using Illumina HiSeq. 3000 System single end (50 bp each read).
Bioinformatic analysis. In order to remove Illumina adapters and low quality reads, sequences were clipped
and ltered with Trimmomatic45, dening a sliding window of 4 nucleotides (nts) with an average Phred quality
of 20 and 50 nts as minimum read length to be conserved.
With the aim to equalize the number of reads between input and IP samples, several steps were performed.
A dra alignment with P. uorescens F113 or P. putida KT2440 reference genome from GenBank (NC_016830
and NC_002947.4 respectively) was carried out using Bowtie v246. en, unmapped reads were cleaned with
SamTools47 and Picard tools 2.4.148. Reads number from input and IP les were equalized by random subsampling
(n = 3) using an own designed Python script. Subsequently, a nal alignment was conducted with Bowtie v2. Peak
calling was done with MACS 1.4.249 comparing input and IP les and specifying a q-value or false discovery rate
(FDR) of 0.01. Peak distribution was visualized in Artemis release 16.0.050 with the purpose of assigning a gene
to each peak. Peaks with a fold-enrichment equal or greater than ve were selected for P. uorescens F113 data
(Supplementary Tables1, 3 and 4) and P. putida KT2440 (Supplementary Tables2 and 5). Gene Ontology data-
base51 was used to classify the genes into functional categories.
Regarding the search of a conserved motif model, 100 nts to both sides of each peak summit position were
extracted using an own designed Python script and analyzed using MEME Suite 4.11.252. Thus, consensus
sequences were searched using MEME with a maximum length of 17 nts and compared to known transcription
factor binding sites with TomTom. Obtained and already described motifs models were examined in the whole P.
uorescens F113 and P. putida KT2440 genomes with MAST, FIMO or BLASTn algorithms53 and contrasted with
the sequences of the peaks with FIMO.
RNA isolation, cDNA synthesis and gene expression analysis. Total RNA from F113, KT2440 and
the eQ mutant strains, grown in SA liquid medium to an O.D.600 of 0.8, was extracted from 1 mL culture samples.
Additionally, total RNA from F113 and its eQ mutant grown in CAS medium supplemented with 100 µM of the
iron-chelator 2,2′-bipyridyl to an O.D.600 of 0.9 was obtained. Samples were subsequently centrifuged (14,000 × g,
2 min) at RT and supernatants were discarded. en, 100 µL of RNAlater (Ambion, Waltham, MA, USA) was
added to the cell pellets and these conserved at 4 °C.
RNA isolation was performed following the instructions of SV Total RNA Isolation System (Promega).
Concentration and quality of the samples was determined using Nanodrop® spectrophotometer. RNA integrity
was conrmed in 0.8% (w/v) denaturing agarose gels. In addition, genomic DNA contamination in the samples
was discarded by PCR (95 °C for 3 min, followed by 30 cycles of 95 °C for 30 s, 60 °C for 1 min, 72 °C for 1 min,
and a nal extension at 72 °C for 7 min) with the primers designed for RT-qPCR experiments (Supplementary
Table6).
Complementary DNA (cDNA) synthesis by reverse transcription (RT-PCR) was performed using Superscript
IV® Reverse Transcriptase (Invitrogen). en, qPCR reactions of the cDNA synthesized were carried out in quad-
ruplicate for each gene, using FastStart Universal SYBR Green Master Rox (Roche).
For both strains, two biological replicates were considered and gene expression was calculated using threshold
cycle (Ct) values. Data was normalized by using 16S rRNA expression as housekeeping and relativized to F113 or
KT2440 WT following the 2−ΔΔCt method54.
Statistical analysis. R Commander55 and VennDiagram56 package in R soware57 was used in the rep-
resentation of the plot for genomic distribution of peaks and Venn diagram respectively. GraphPad Prism version
7.00 for Windows (GraphPad Soware, La Jolla California USA, www.graphpad.com) was used in the statistical
analysis and representation of RT-qPCR data, the comparison was done using multiple t-test for independent
samples (p < 0.05) with Bonferroni-Dune method; and for the representation of the pie charts.
Data Availability
ChIP-seq raw data have been deposited to the NCBI Sequence Read Archive database and it is available under the
accession number SRP145465.
References
1. Dasgupta, N. et al. A four-tiered transcriptional regulatory circuit controls flagellar biogenesis in Pseudomonas aeruginosa.
Molecular microbiology 50, 809–824 (2003).
2. Arora, S. ., itchings, B. W., Almira, E. C., Lory, S. & amphal, . A transcriptional activator, FleQ, regulates mucin adhesion and
agellar gene expression in Pseudomonas aeruginosa in a cascade manner. Journal of bacteriology 179, 5574–5581 (1997).
3. ieboom, J., Bruinenberg, ., eizer-Gunnin, I. & De Bont, J. A. Transposon mutations in the agella biosynthetic pathway of the
solvent-tolerant Pseudomonas putida S12 result in a decreased expression of solvent eux genes. FEMS Microbiol Lett 198, 117–122
(2001).
4. Jimenez-Fernandez, A. et al. Complex interplay between FleQ, cyclic diguanylate and multiple sigma factors coordinately regulates
flagellar motility and biofilm development in Pseudomonas putida. PLoS One 11, e0163142, https://doi.org/10.1371/journal.
pone.0163142 (2016).
5. Wang, Y., Li, Y., Wang, J. & Wang, X. FleQ regulates both the type VI secretion system and agella in Pseudomonas putida. Biotechnol
Appl Biochem. https://doi.org/10.1002/bab.1611 (2017).
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
12
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
6. obleto, E. A., López-Hernández, I., Silby, M. W. & Levy, S. B. Genetic analysis of the AdnA regulon in Pseudomonas uorescens:
nonessential role of agella in adhesion to sand and biolm formation. Journal of bacteriology 185, 453–460 (2003).
7. Capdevila, S., Martínez-Granero, F. M., Sánchez-Contreras, M., ivilla, . & Martín, M. Analysis of Pseudomonas uorescens F113
genes implicated in agellar lament synthesis and their role in competitive root colonization. Microbiology 150, 3889–3897, https://
doi.org/10.1099/mic.0.27362-0 (2004).
8. edondo-Nieto, M. et al. Transcriptional organization of the region encoding the synthesis of the agellar lament in Pseudomonas
uorescens. Journal of bacteriology 190, 4106–4109, https://doi.org/10.1128/JB.00178-08 (2008).
9. Bush, M. & Dixon, . e role of bacterial enhancer binding proteins as specialized activators of sigma54-dependent transcription.
Microbiology and molecular biology reviews: MMB 76, 497–529, https://doi.org/10.1128/MMB.00006-12 (2012).
10. Jyot, J., Dasgupta, N. & amphal, . FleQ, the major agellar gene regulator in Pseudomonas aeruginosa, binds to enhancer sites
located either upstream or atypically downstream of the poN binding site. Journal of bacteriology 184, 5251–5260 (2002).
11. Dasgupta, N., Arora, S. . & amphal, . eN, a gene that regulates agellar number in Pseudomonas aeruginosa. Journal of
bacteriology 182, 357–364 (2000).
12. Dasgupta, N. & amphal, . Interaction of the antiactivator FleN with the transcriptional activator FleQ regulates agellar number
in Pseudomonas aeruginosa. Journal of bacteriology 183, 6636–6644, https://doi.org/10.1128/JB.183.22.6636-6644.2001 (2001).
13. Hicman, J. W. & Harwood, C. S. Identication of FleQ from Pseudomonas aeruginosa as a c-di-GMP-responsive transcription
factor. Molecular microbiology 69, 376–389, https://doi.org/10.1111/j.1365-2958.2008.06281.x (2008).
14. Baraquet, C., Muraami, ., Parse, M. . & Harwood, C. S. e FleQ protein from Pseudomonas aeruginosa functions as both a
repressor and an activator to control gene expression from the pel operon promoter in response to c-di-GMP. Nucleic acids research
40, 7207–7218, https://doi.org/10.1093/nar/gs384 (2012).
15. Nie, H. et al. FleN and FleQ play a synergistic role in regulating lapA and bcs operons in Pseudomonas putida T2440. Environmental
microbiology reports 9, 571–580, https://doi.org/10.1111/1758-2229.12547 (2017).
16. Baraquet, C. & Harwood, C. S. Cyclic diguanosine monophosphate represses bacterial agella synthesis by interacting with the
Waler A motif of the enhancer-binding protein FleQ. Proceedings of the National Academy of Sciences of the United States of America
110, 18478–18483, https://doi.org/10.1073/pnas.1318972110 (2013).
17. Molina-Henares, M. A., amos-Gonzalez, M. I., Daddaoua, A., Fernandez-Escamilla, A. M. & Espinosa-Urgel, M. FleQ of
Pseudomonas putida T2440 is a multimeric cyclic diguanylate binding protein that dierentially regulates expression of biolm
matrix components. es Microbiol 168, 36–45, https://doi.org/10.1016/j.resmic.2016.07.005 (2017).
18. Matsuyama, B. Y. et al. Mechanistic insights into c-di-GMP-dependent control of the biolm regulator FleQ from Pseudomonas
aeruginosa. Proceedings of the National Academy of Sciences of the United States of America 113, E209–218, https://doi.org/10.1073/
pnas.1523148113 (2016).
19. Matilla, M. A., Travieso, M. L., amos, J. L. & amos-Gonzalez, M. I. Cyclic diguanylate turnover mediated by the sole GGDEF/EAL
response regulator in Pseudomonas putida: its role in the rhizosphere and an analysis of its target processes. Environmental
microbiology 13, 1745–1766, https://doi.org/10.1111/j.1462-2920.2011.02499.x (2011).
20. Nielsen, L., Li, X. & Halverson, L. J. Cell-cell and cell-surface interactions mediated by cellulose and a novel exopolysaccharide
contribute to Pseudomonas putida biolm formation and tness under water-limiting conditions. Environmental microbiology 13,
1342–1356, https://doi.org/10.1111/j.1462-2920.2011.02432.x (2011).
21. Nilsson, M. et al. Inuence of putative exopolysaccharide genes on Pseudomonas putida T2440 biolm stability. Environmental
microbiology 13, 1357–1369, https://doi.org/10.1111/j.1462-2920.2011.02447.x (2011).
22. Xiao, Y. et al. C-di-GMP regulates the expression of lapA and bcs operons via FleQ in Pseudomonas putida T2440. Environmental
microbiology reports. https://doi.org/10.1111/1758-2229.12419 (2016).
23. B araquet, C. & Harwood, C. S. FleQ DNA binding consensus sequence revealed by studies of FleQ-dependent regulation of biolm
gene expression in Pseudomonas aeruginosa. Journal of bacteriology 198, 178–186, https://doi.org/10.1128/JB.00539-15 (2016).
24. Martínez-Gil, M., amos-González, M. I. & Espinosa-Urgel, M. oles of cyclic di-GMP and the Gac system in transcriptional
control of the genes coding for the Pseudomonas putida adhesins LapA and LapF. Journal of bacteriology 196, 1484–1495, https://doi.
org/10.1128/JB.01287-13 (2014).
25. Yousef-Coronado, F., Travieso, M. L. & Espinosa-Urgel, M. Dierent, overlapping mechanisms for colonization of abiotic and plant
surfaces by Pseudomonas putida. FEMS Microbiol Lett 288, 118–124, https://doi.org/10.1111/j.1574-6968.2008.01339.x (2008).
26. amos-Gonzalez, M. I. et al. Genetic dissection of the regulatory networ associated with high c-di-GMP levels in Pseudomonas
putida T2440. Front Microbiol 7, 1093, https://doi.org/10.3389/fmicb.2016.01093 (2016).
27. Martínez-Granero, F. et al. e Gac-sm and SadB signal transduction pathways converge on AlgU to downregulate motility in
Pseudomonas uorescens. PLoS One 7, e31765, https://doi.org/10.1371/journal.pone.0031765 (2012).
28. Martínez-Granero, F., edondo-Nieto, M., Vesga, P., Martín, M. & ivilla, . AmrZ is a global transcriptional regulator implicated
in iron uptae and environmental adaption in P. uorescens F113. BMC genomics 15, 237, https://doi.org/10.1186/1471-2164-15-237
(2014).
29. Jones, C. J. et al. ChIP-Seq and NA-Seq reveal an AmrZ-mediated mechanism for cyclic di-GMP synthesis and biofilm
development by Pseudomonas aeruginosa. PLoS pathogens 10, e1003984, https://doi.org/10.1371/journal.ppat.1003984 (2014).
30. Muriel, C. et al. AmrZ is a major determinant of c-di-GMP levels in Pseudomonas uorescens F113. Sci ep 8, 1979, https://doi.
org/10.1038/s41598-018-20419-9 (2018).
31. Tart, A. H., Wolfgang, M. C. & Woznia, D. J. e alternative sigma factor AlgT represses Pseudomonas aeruginosa agellum
biosynthesis by inhibiting expression of eQ. Journal of bacteriology 187, 7955–7962, https://doi.org/10.1128/JB.187.23.7955-
7962.2005 (2005).
32. Martínez-Granero, F. et al. Identication of gZ as a agellar gene encoding a PilZ domain protein that regulates swimming motility
and biolm formation in Pseudomonas. PLoS One 9, e87608, https://doi.org/10.1371/journal.pone.0087608 (2014).
33. Duque, E. et al. In Pseudomonas Vol. V (ed. amos, J. L. and Filloux, A.) 227–254 (Springer, London, 2007).
34. im, J. S., im, Y. H., Anderson, A. J. & im, Y. C. e sensor inase GacS negatively regulates agellar formation and motility in a
biocontrol bacterium, Pseudomonas chlororaphis O6. The plant pathology journal 30, 215–219, https://doi.org/10.5423/PPJ.
NT.11.2013.0109 (2014).
35. Nogales, J. et al. FleQ coordinates agellum-dependent and -independent motilities in Pseudomonas syringae pv. tomato DC3000.
Applied and environmental microbiology 81, 7533–7545, https://doi.org/10.1128/AEM.01798-15 (2015).
36. Mastropaolo, M. D., Silby, M. W., Nicoll, J. S. & Levy, S. B. Novel genes involved in Pseudomonas uorescens Pf0-1 motility and
biolm formation. Applied and environmental microbiology 78, 4318–4329, https://doi.org/10.1128/AEM.07201-11 (2012).
37. Taylor, T. B. et al. Evolution. Evolutionary resurrection of agellar motility via rewiring of the nitrogen regulation system. Science
347, 1014–1017, https://doi.org/10.1126/science.1259145 (2015).
38. Garrido-Sanz, D. et al. Genomic and Genetic Diversity within the Pseudomonas uorescens Complex. PLoS One 11, e0150183,
https://doi.org/10.1371/journal.pone.0150183 (2016).
39. Shanahan, P., O’Sullivan, D. J., Simpson, P., Glennon, J. D. & O’Gara, F. Isolation of 2,4-diacetylphloroglucinol from a uorescent
pseudomonad and investigation of physiological parameters inuencing its production. Applied and environmental microbiology 58,
353–358 (1992).
40. S chäfer, A. et al. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids p18 and p19:
selection of dened deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69–73 (1994).
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
13
SciEntific REPORTS | (2018) 8:13145 | DOI:10.1038/s41598-018-31371-z
41. Naazawa, T. Travels of a Pseudomonas, from Japan around the world. Environmental microbiology 4, 782–786 (2002).
42. Ber tani, G. Studies on lysogenesis. I. e mode of phage liberation by lysogenic Escherichia coli. Journal of bacteriology 62, 293–300
(1951).
43. Llamas, M. A. & Bitter, W. Iron gate: the translocation system. Journal of bacteriology 188, 3172–3174, https://doi.org/10.1128/
JB.188.9.3172-3174.2006 (2006).
44. de Lorenzo, V., Eltis, L., essler, B. & Timmis, . N. Analysis of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and
transposons that confer conditional phenotypes. Gene 123, 17–24 (1993).
45. Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a exible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120,
https://doi.org/10.1093/bioinformatics/btu170 (2014).
46. Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-ecient alignment of short DNA sequences to the
human genome. Genome biology 10, 25, https://doi.org/10.1186/gb-2009-10-3-r25 (2009).
47. Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079, https://doi.org/10.1093/
bioinformatics/btp352 (2009).
48. Wysoer, A. T., ., Fennell, T. Picard. Sourceforge. net. http://picard.sourceforge.net, Accessed20 April 2016 (2013).
49. Zhang, Y. et al. Model-based analysis of ChIP-Seq (MACS). Genome biology 9, 137, https://doi.org/10.1186/gb-2008-9-9-r137
(2008).
50. utherford, . et al. Artemis: sequence visualization and annotation. Bioinformatics 16, 944–945 (2000).
51. Ashburner, M. et al. Gene ontology: tool for the unication of biology. e Gene Ontology Consortium. Nature genetics 25, 25–29,
https://doi.org/10.1038/75556 (2000).
52. Bailey, T. L. et al. MEME SUITE: tools for motif discovery and searching. Nucleic acids research 37, W202–208, https://doi.
org/10.1093/nar/gp335 (2009).
53. Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. Journal of molecular biology 215,
403–410, https://doi.org/10.1016/S0022-2836(05)80360-2 (1990).
54. Liva, . J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PC and the 2(-Delta Delta
C(T)) Method. Methods 25, 402–408, https://doi.org/10.1006/meth.2001.1262 (2001).
55. Fox, J. et al. Pacage ‘cmdr’ (2018).
56. Chen, H. & Boutros, P. C. VennDiagram: a pacage for the generation of highly-customizable Venn and Euler diagrams in . BMC
Bioinformatics 12, 35, https://doi.org/10.1186/1471-2105-12-35 (2011).
57. Team, . C. : A language and environment for statistical computing. (2013).
Acknowledgements
We thank María L. Travieso for her help in the generation of some plasmids and contribution to swimming
assays. is work was supported by funding from MINECO/FEDER EU Grant BIO2015-64480R to RR and MM;
BFU2013-43469-P and BFU2016-80122-P to MIR-G. EB-R was the recipient of fellowships from Fundación Tatiana
Pérez de Guzmán el Bueno (Medioambiente 2016) and the FPU program from MECD (FPU16/05513). DG-S was
granted by FPU fellowship program (FPU14/03965) from Ministerio de Educación, Cultura y Deporte, Spain.
Author Contributions
E.B.-R., F.M.-G., M.I.R.-G. performed experiments; M.R.-N., D.G.-S. and E.B.-R. performed the bioinformatics
analysis; R.R., M.M. and M.I.R.-G. conceived and designed the study, supervised research and drafted the
manuscript. All authors read and approve the manuscript.
Additional Information
Supplementary information accompanies this paper at https://doi.org/10.1038/s41598-018-31371-z.
Competing Interests: e authors declare no competing interests.
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and
institutional aliations.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International
License, which permits use, sharing, adaptation, distribution and reproduction in any medium or
format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre-
ative Commons license, and indicate if changes were made. e images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the
material. If material is not included in the article’s Creative Commons license and your intended use is not per-
mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the
copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
© e Author(s) 2018
Content courtesy of Springer Nature, terms of use apply. Rights reserved

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com