ChapterPDF Available

Recent Advances and Perspectives in Metagenomic Studies of Soil Microbial Communities

January 2013

January 2013

DOI:10.1007/978-94-007-5931-2_7

In book: Management of Microbial Resources in the Environment (pp.141-166)

Authors:

Elizaveta Evdokimova

All-Russian Research Institute for Agricultural Microbiology

Nikolai Provorov

All-Russian Research Institute for Agricultural Microbiology

Metagenomics is a modern and rapidly growing field of molecular genetics and ecology that studies the “collective” genome of the microbial community and is based on the analysis of environmental DNA, extracted directly from a variety of natural habitats. The advent of high-throughput sequencing techniques had opened the principally new opportunities in studies of the genetic structure of microbial communities, but at the same time highlighted significant difficulties, arising particularly during the investigation of the soil metagenome.

Content uploaded by Elizaveta Evdokimova

Content may be subject to copyright.

Management of Microbial Resources

in the Environment

Abdul Malik • Elisabeth Grohmann

Madalena Alves

Editors

Management of Microbial

Resources in the

Environment

Editors

Abdul Malik

Department of Agricultural Microbiology

Faculty of Agricultural Sciences

Aligarh Muslim University

Aligarh, India

Visiting Professor/Scientist

Division of Infectious Diseases

University Medical Center Freiburg

Freiburg, Germany

Madalena Alves

Center of Biological Engineering

University of Minho

Braga, Portugal

Elisabeth Grohmann

Division of Infectious Diseases

University Medical Center Freiburg

Freiburg, Germany

ISBN 978-94-007-5930-5 ISBN 978-94-007-5931-2 (eBook)

DOI 10.1007/978-94-007-5931-2

Springer Dordrecht Heidelberg New York London

Library of Congress Control Number: 2013933022

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of

the material is concerned, speci ﬁ cally the rights of translation, reprinting, reuse of illustrations, recitation,

broadcasting, reproduction on micro ﬁ lms or in any other physical way, and transmission or information

storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology

now known or hereafter developed. Exempted from this legal reservation are brief excerpts in connection

with reviews or scholarly analysis or material supplied speci ﬁ cally for the purpose of being entered and

executed on a computer system, for exclusive use by the purchaser of the work. Duplication of this

publication or parts thereof is permitted only under the provisions of the Copyright Law of the Publisher’s

location, in its current version, and permission for use must always be obtained from Springer. Permissions

for use may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to

prosecution under the respective Copyright Law.

The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication

does not imply, even in the absence of a speci ﬁ c statement, that such names are exempt from the relevant

protective laws and regulations and therefore free for general use.

While the advice and information in this book are believed to be true and accurate at the date of

publication, neither the authors nor the editors nor the publisher can accept any legal responsibility for

any errors or omissions that may be made. The publisher makes no warranty, express or implied, with

respect to the material contained herein.

Printed on acid-free paper

Springer is part of Springer Science+Business Media (www.springer.com)

Microorganisms are microscopic forms of life that include bacteria, protozoa, algae,

fungi and viruses, and comprise the greatest number of individual organisms on the

earth. At best, however, science has identi ﬁ ed and is aware of only a minute fraction

of them. Somewhere between 0.1 and 1.0% of all bacterial species have been

described and the vast majority of the remaining bacterial species is unknown.

Uncultured organisms comprise the vast majority of the microbial world. Although

culturing has been indispensable for increasing our understanding of speci ﬁ c organ-

isms, problems with using culturing for community analysis arise from the fact that

an arti ﬁ cial homogenous medium typically allows growth of only a small fraction

of the organisms. Culturing fails to reproduce the ecological niches and symbiotic

relationships encountered in complex natural environments that are required to

support the full spectrum of microbial diversity. Microorganisms are valuable

genetic resources, which contribute to the global economic and social development.

Microbial Resources include the exploration, collection, characterization, evalua-

tion and conservation of microbes for sustainable utilization in the development of

the global/national economy, i.e. Agriculture, Ecosystem, Environment, Industry

and Medicine. Microbes play a critical role in natural biogeochemical cycles and

make up about 60% of the Earth’s biomass. Many research institutes/universities

all over the world are carrying out microbiological and biotechnological research,

which results in generating lots of genomic resources like cDNA libraries, gene

constructs, promoter regions, transgenes etc. These are valuable resources for gene

discovery and transgenic product development.

In this book we provide up-to-date information about the management of micro-

bial resources in the environment. This book covers the ecology of microorganisms

in natural and engineered environments; genomic, metagenomic and molecular

advances in understanding of microbial interactions; microbial diversity and phylogeny;

ecological studies of human, animal and plant microbiology and disease; microbial

processes and interactions in the environment; and technological developments.

This book is not intended to serve as an encyclopedic review of the subject. However,

Preface

the various chapters incorporate both theoretical and practical aspects and may

serve as baseline information for future research through which signi ﬁ cant develop-

ment is possible.

The book has twenty chapters, with each focused on a speci ﬁ c topic to cover

diverse perspective topics. An introductory chapter on management of microbial

resources in the environment is included. Topics include : recent development in the

methods of studying microbial diversity, microbial resource centers towards har-

nessing microbial diversity for human welfare, polyphasic identi ﬁ cation and pres-

ervation of fungal diversity, fungal biodiversity: a potential tool in plant disease

management, bioinformatics approaches in studying microbial diversity, recent

advances in metagenomic studies of soil microbial communities, mobile genetic

elements (MGEs) carrying catabolic genes, conjugative plasmids in anthropogenic

soils, potential eco-friendly soil microorganisms, current aspects of metal resistant

bacteria in bioremediation, anaerobic digestion of the organic fraction of municipal

solid waste, microbial insecticides: food security and human health, microbes (PGPR)

in sustainable agriculture, antibiotic resistance gene pool and bacterial adaptation to

xenobiotics in the environment, synthetic lethal genetic interaction networks and

their utility for anticancer therapy, adaptation of Candida albicans for growth within

the host, role of marine anaerobic bacteria and archaea in bioenergy production,

bacteriocins: natural weapons for control of food pathogens, and anaerobic degra-

dation of lindane and other HCH isomers.

With great pleasure, we extend our sincere thanks to all our well-quali ﬁ ed and

internationally renowned contributors from different countries for providing the

important, authoritative and cutting edge scienti ﬁ c information/technology to make

this book a reality. All chapters are well illustrated with appropriately placed tables

and ﬁ gures and enriched with up to date information. We are also thankful to the

reviewers who carefully and timely reviewed the manuscripts. Dr. Abdul Malik is

also thankful to the Department of Biotechnology, Govt. of India, New Delhi for

DBT CREST award/Fellowship during the preparation of the book.

We are extremely thankful to Springer, Dordrecht, the Netherlands for completing

the review process expeditiously to grant acceptance for publication. We appreciate

the great efforts of the book publishing team, especially of Dr. Alexandrine Cheronet,

Senior Publishing Editor Environmental Sciences in responding to all queries very

promptly.

We express sincere thanks to our family members for all the support they provided,

and regret the neglect and loss they suffered during the preparation of this book.

Aligarh, India Abdul Malik

Freiburg, Germany Elisabeth Grohmann

Braga, Portugal Madalena Alves

Preface

vii

Contents

1 Management of Microbial Resources in the Environment:

A Broad Perspective ................................................................................ 1

Abdul Malik, Farhana Masood, and Elisabeth Grohmann

2 Recent Development in the Methods of Studying

Microbial Diversity ................................................................................. 17

Mohd Ikram Ansari and Abdul Malik

3 Microbial Resource Centers Towards Harnessing Microbial

Diversity for Human Welfare ................................................................. 51

Showkat Ahmad Lone, Abdul Malik, and Jasdeep Chatrath Padaria

4 Fungal Biodiversity: A Potential Tool in Plant

Disease Management .............................................................................. 69

Shabbir Ashraf and Mohammad Zuhaib

5 Polyphasic Identi ﬁ cation and Preservation of Fungal Diversity:

Concepts and Applications ..................................................................... 91

Marta F. Simões, Leonel Pereira, Cledir Santos, and Nelson Lima

6 Bioinformatics Approaches in Studying Microbial Diversity ............. 119

Mohammad Tabish, Shafquat Azim, Mohammad Aamir Hussain,

Sayeed Ur Rehman, Tarique Sarwar, and Hassan Mubarak Ishqi

7 Recent Advances and Perspectives in Metagenomic Studies

of Soil Microbial Communities .............................................................. 141

E. V. Pershina, E. E. Andronov, A. G. Pinaev, and N. A. Provorov

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes ........... 167

Masaki Shintani and Hideaki Nojiri

9 Conjugative Plasmids in Anthropogenic Soils ...................................... 215

Elisabeth Grohmann

viii

10 Potential Eco-friendly Soil Microorganisms: Road Towards

Green and Sustainable Agriculture ........................................................ 249

Surinder Kaur, Gurpreet Singh Dhillon, Satinder Kaur Brar,

Vijay Bahadur Chauhan, Ramesh Chand, and Mausam Verma

11 Current Aspects of Metal Resistant Bacteria in Bioremediation:

From Genes to Ecosystem ....................................................................... 289

Farhana Masood and Abdul Malik

12 Anaerobic Digestion of the Organic Fraction

of Municipal Solid Waste ........................................................................ 313

Muna Albanna

13 Microbial Insecticides: Food Security and Human Health ...................... 341

M. Sha ﬁ q Ansari, Salman Ahmad, Nadeem Ahmad, Tufail Ahmad,

and Fazil Hasan

14 Plant Growth Promoting Rhizobacteria (PGPR):

Microbes in Sustainable Agriculture ..................................................... 361

Jay Shankar Singh and D. P. Singh

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation

to Xenobiotics in the Environment ......................................................... 387

Mohd Ikram Ansari and Abdul Malik

16 Synthetic Lethal Genetic Interaction Networks and Their

Utility for Anticancer Therapy .............................................................. 413

Saman Khan, Amit Kumar Sonkar, and Shakil Ahmed

17 Adaptation of Candida albicans for Growth Within the Host ............. 429

Zuraini Zakaria, Basma Rajeh Mohammad Abu Arra,

and Sumathi Ganeshan

18 The Role of Marine Anaerobic Bacteria and Archaea

in Bioenergy Production ......................................................................... 445

A.J. Cavaleiro, A. A. Abreu, D. Z. Sousa, M. A. Pereira,

and M. M. Alves

19 Bacteriocins: Natural Weapons for Control of Food Pathogens .............. 471

Nabil Ben Omar, Hikmate Abriouel, Ismail Fliss, Miguel Ángel

Ferandez-Fuentes, Antonio Galvez, and Djamel Drider

20 Anaerobic Degradation of Lindane and Other HCH Isomers ................. 495

Farrakh Mehboob, Alette A. M. Langenhoff, Gosse Schraa,

and Alfons J. M. Stams

Index ................................................................................................................. 523

Contents

Contributors

A. A. Abreu IBB – Institute for Biotechnology and Bioengineering, Centre

of Biological Engineering , University of Minho , Braga , Portugal

Hikmate Abriouel Área de Microbiología, Departamento de Ciencias de la Salud,

Facultad de Ciencias Experimentales, Edif. B3 , Universidad de Jaén , Jaén , Spain

Nadeem Ahmad Department of Plant Protection, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , India

Salman Ahmad Department of Plant Protection, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , India

Tufail Ahmad Department of Plant Protection, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , India

Shakil Ahmed Molecular and Structural Biology Division , CSIR – Central Drug

Research Institute , Lucknow , India

Muna Albanna Water and Environmental Engineering Department, School

of Natural Resources Engineering , German Jordanian University , Amman , Jordan

M. M. Alves IBB – Institute for Biotechnology and Bioengineering, Centre of

Biological Engineering , University of Minho , Braga , Portugal

E. E. Andronov All-Russia Research Institute for Agricultural Microbiology ,

Saint-Petersburg , Russia

M. Sha ﬁ q Ansari Department of Plant Protection, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , India

Mohd Ikram Ansari Department of Agricultural Microbiology, Faculty of

Agricultural Sciences , Aligarh Muslim University , Aligarh , India

Basma Rajeh Mohammad Abu Arra Biology Programme, School of Distance

Education , Universiti Sains Malaysia , Minden , Penang , Malaysia

Shabbir Ashraf Department of Plant Protection, Faculty of Agriculture Sciences ,

Aligarh Muslim University , Aligarh , Uttar Pradesh , India

Shafquat Azim Department of Biochemistry, Faculty of Life Sciences , Aligarh

Muslim University , Aligarh , Uttar Pradesh , India

Satinder Kaur Brar

INRS-ETE , Université du Québec , Québec , Canada

A. J. Cavaleiro IBB – Institute for Biotechnology and Bioengineering, Centre of

Biological Engineering , University of Minho , Braga , Portugal

Ramesh Chand Department of Mycology & Plant Pathology, Institute of Agricultural

Sciences , Banaras Hindu University (BHU) , Varanasi , Uttar Pradesh , India

Vijay Bahadur Chauhan Department of Mycology & Plant Pathology, Institute

of Agricultural Sciences , Banaras Hindu University (BHU) , Varanasi , Uttar Pradesh ,

India

Gurpreet Singh Dhillon INRS-ETE , Université du Québec , Québec , QC ,

Canada

Djamel Drider Laboratoire des Procédés Biologiques, Génie Enzymatique et

Microbien (ProBioGEM), UPRES-EA 1026, Polytech’Lille/IUTA , Université Lille

Nord de France , Villeneuve d’Ascq Cedex , France

Miguel Ángel Ferandez-Fuentes Área de Microbiología, Departamento de

Ciencias de la Salud, Facultad de Ciencias Experimentales, Edif. B3 , Universidad

de Jaén , Jaén , Spain

Laboratoire des Procédés Biologiques, Génie Enzymatique et Microbien

(ProBioGEM), UPRES-EA 1026, Polytech’Lille/IUTA , Université Lille Nord de

France , Villeneuve d’Ascq Cedex , France

Ismail Fliss STELA Dairy Research Center, Nutraceuticals and Functional Foods

Institute , Université Laval , Québec , QC , Canada

Antonio Galvez Área de Microbiología, Departamento de Ciencias de la Salud,

Facultad de Ciencias Experimentales, Edif. B3 , Universidad de Jaén , Jaén , Spain

Sumathi Ganeshan Biology Programme, School of Distance Education , Universiti

Sains Malaysia , Minden , Penang , Malaysia

Elisabeth Grohmann Division of Infectious Diseases , University Medical Center

Freiburg , Freiburg, Germany

Fazil Hasan Department of Plant Protection, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , India

Mohammad Aamir Hussain Department of Biochemistry, Faculty of Life

Sciences , Aligarh Muslim University , Aligarh , Uttar Pradesh , India

Hassan Mubarak Ishqi Department of Biochemistry, Faculty of Life Sciences ,

Aligarh Muslim University , Aligarh , Uttar Pradesh , India

Contributors

Surinder Kaur Department of Mycology & Plant Pathology, Institute of Agricultural

Sciences , Banaras Hindu University (BHU) , Varanasi , Uttar Pradesh , India

INRS-ETE , Université du Québec , Québec , Canada

Saman Khan

Molecular and Structural Biology Division , CSIR – Central Drug

Research Institute , Lucknow , India

Alette A. M. Langenhoff Sub-department of Environmental Technology, Wageningen

University, Wageningen, The Netherlands

Nelson Lima IBB – Biological Engineering Centre, Applied Mycology Group ,

University of Minho , Braga , Portugal

Showkat Ahmad Lone Biotechnology and Climate Change, National Research

Centre on Plant Biotechnology , New Delhi , India

Department of Agricultural Microbiology, Faculty of Agricultural Sciences , Aligarh

Muslim University , Aligarh , Uttar Pradesh , India

Abdul Malik Department of Agricultural Microbiology, Faculty of Agricultural

Sciences , Aligarh Muslim University , Aligarh , Uttar Pradesh , India

Farhana Masood Department of Agricultural Microbiology, Faculty of Agricultural

Sciences , Aligarh Muslim University , Aligarh , Uttar Pradesh , India

Farrakh Mehboob Laboratory of Microbiology , Wageningen University ,

Wageningen , The Netherlands

Ecotoxicology Research Programme , National Institute of Bio-remediation, National

Agriculture Research Centre , Islamabad , Pakistan

Hideaki Nojiri Biotechnology Research Center , The University of Tokyo ,

Bunkyo-ku, Tokyo , Japan

Agricultural Bioinformatics Research Unit , The University of Tokyo , Bunkyo-ku,

Tokyo , Japan

Nabil Ben Omar Área de Microbiología, Departamento de Ciencias de la Salud,

Facultad de Ciencias Experimentales, Edif. B3 , Universidad de Jaén , Jaén , Spain

Jasdeep Chatrath Padaria Biotechnology and Climate Change, National Research

Centre on Plant Biotechnology , New Delhi , India

Leonel Pereira IBB – Biological Engineering Centre, Applied Mycology Group ,

University of Minho , Braga , Portugal

M. A. Pereira IBB – Institute for Biotechnology and Bioengineering, Centre

of Biological Engineering , Universidade do Minho , Braga , Portugal

E. V. Pershina All-Russia Research Institute for Agricultural Microbiology ,

Saint-Petersburg , Russia

A. G. Pinaev All-Russia Research Institute for Agricultural Microbiology ,

Saint-Petersburg , Russia

Contributors

xii

N. A. Provorov All-Russia Research Institute for Agricultural Microbiology ,

Saint-Petersburg , Russia

Sayeed Ur Rehman Department of Biochemistry, Faculty of Life Sciences ,

Aligarh Muslim University , Aligarh , Uttar Pradesh , India

Cledir Santos

IBB – Biological Engineering Centre, Applied Mycology Group ,

University of Minho , Braga , Portugal

Tarique Sarwar Department of Biochemistry, Faculty of Life Sciences , Aligarh

Muslim University , Aligarh , Uttar Pradesh , India

Gosse Schraa Laboratory of Microbiology , Wageningen University , Wageningen ,

The Netherlands

Masaki Shintani Department of Materials Science and Chemical Engineering ,

Faculty of Engineering, Shizuoka University , Shizuoka , Japan

Japan Collection of Microorganisms, RIKEN BioResource Centre, Tsukuba, Ibaraki

305-0074, Japan

Marta F. Simões IBB – Biological Engineering Centre, Applied Mycology Group ,

University of Minho , Braga , Portugal

D. P. Singh Department of Environmental Science , Babasaheb Bhimrao Ambedkar

(Central) University , Lucknow , Uttar Pradesh , India

Jay Shankar Singh Department of Environmental Microbiology , Babasaheb

Bhimrao Ambedkar (Central) University , Lucknow , Uttar Pradesh , India

Amit Kumar Sonkar Molecular and Structural Biology Division , CSIR – Central

Drug Research Institute , Lucknow , India

Diana Sousa IBB – Institute for Biotechnology and Bioengineering, Centre

of Biological Engineering , University of Minho , Braga , Portugal

Alfons J. M. Stams Laboratory of Microbiology , Wageningen University ,

Wageningen , The Netherlands

Centre of Biological Engineering , University of Minho , Braga , Portugal

Mohammad Tabish Department of Biochemistry, Faculty of Life Sciences ,

Aligarh Muslim University , Aligarh , Uttar Pradesh , India

Mausum Verma Institut de recherche et de développement en agroenvironnement

inc. (IRDA) , Québec , QC , Canada

Zuraini Zakaria Biology Programme, School of Distance Education , Universiti

Sains Malaysia , Minden , Penang , Malaysia

Mohammad Zuhaib Department of Plant Protection, Faculty of Agriculture

Sciences , Aligarh Muslim University , Aligarh , Uttar Pradesh , India

Contributors

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_1, © Springer Science+Business Media Dordrecht 2013

Abstract The earth contains a huge number of largely uncharacterized Bacteria

and Archaea. Microbiologists are struggling to summarize their genetic diversity

and classify them, which has resulted in heated debates on methods for de ﬁ ning

species, mechanisms that lead to speciation and whether microbial species even

exist. New molecular microbiological techniques allow for environmental screening

to determine the presence of nucleic acids in environmental samples. These molecu-

lar genetic techniques allow screening for organisms that could be maintained in

culture along with those that cannot be identi ﬁ ed by standard non molecular means

as they cannot be cultured. Although not allowing the description of speci ﬁ c organ-

isms, this technique permits determining numbers and lineages of microorganisms

in environmental samples, notably phylogenetic relationships and genetic similarity

to sequences in established databases. Recent progress has revealed that the capture

of genetic resources from complex microbial communities allows the discovery of

a richness of new enzymatic diversity that had not previously been imagined.

This new diversity, constitutes a large potential of new and improved applications in

industry, medicine, agriculture, bioenergy etc., and promises to facilitate in a

signi ﬁ cant manner, our transition to a sustainable society, by contributing to the

transition to renewable sources of energy, chemicals and materials, the reduction of

pollutant burdens. Hiding within the as-yet-undiscovered microorganisms are cures

A. Malik (*) • F. Masood

Department of Agricultural Microbiology, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , Uttar Pradesh 202002 , India

e-mail: ab_malik30@yahoo.com ; farhanamasud4@gmail.com

E. Grohmann

Division of Infectious Diseases , University Medical Center Freiburg ,

Hugstetter Strasse 55 , Freiburg 79106 , Germany

e-mail: elisabeth.grohmann@uniklinik-freiburg.de

Chapter 1

Management of Microbial Resources

in the Environment: A Broad Perspective

Abdul Malik , Farhana Masood , and Elisabeth Grohmann

A. Malik et al.

for diseases, means to clean polluted environments, new food sources, and better

ways to manufacture products daily used in modern society. This chapter focuses on

the structural and functional diversity of the microbes around the globe, which are

the primary and richest source of natural genetic resources that can be utilized

for the improvement of agriculture, food production, and human health as well as

for the welfare of the environment and ecosystems.

Keywords Microbial resources • Environment • Genetic diversity • Molecular tools

• Metagenomics

1 Introduction

Microorganisms are a highly diverse group of organisms and constitute about 60%

of the Earth’s biomass (Singh et al. 2009 ) . In aquatic environments, such as the

oceans, the number of microbial cells has been estimated to be approximately

1.2 × 10

, while in terrestrial environments, soil sustains as many as 4–5 × 10

microbial cells (Singh et al. 2009 ) . Owing to such enormous numbers, microorgan-

isms are essential components of the Earth’s biota and represent a large unexplored

reservoir of genetic diversity. Understanding this unexplored genetic diversity is a

high-priority issue in microbial ecology from perspectives such as global climate

change and the greenhouse effect. In fact, all organisms in the biosphere either

directly or indirectly depend on microbial activities. In soil ecosystems, microor-

ganisms are pivotal in suppressing soil-borne plant diseases, promoting plant

growth, and in promoting changes in vegetation (Garbeva et al. 2004 ) . An under-

standing of microbial dynamics and their interactions with biotic and abiotic factors

is indispensable in bioremediation techniques, energy generation processes, and in

pharmaceuticals, food, chemical and mining industries.

A plethora of biochemical and molecular methods have been applied to reveal the

microbial community composition over time and space in response to environmental

changes. These new approaches allow linkage between ecological processes in the envi-

ronment with speci ﬁ c microbial populations and help us to answer important questions

in microbial ecology such as what factors and resources govern the enormous genetic

and metabolic diversity in an environment. In this context, it is important to review to

what extent microbial ecology, particularly the management of the various kinds of

microbial resources, can offer great new potentials to address these super challenges.

2 Microbial Resources

Microbial culture collections currently contain more than a million different strains

(Verstraete et al. 2007 ) and thus are a testimony of the efforts made for the conserva-

tion of biodiversity and the desire to make these potentials available to the public.

1 Management of Microbial Resources in the Environment…

To what extent these collections can and need to be expanded is debatable, since it

is generally accepted that microorganisms tend to act not alone but in association

with others, it is obvious therefore, that at present considerable effort should be

devoted to the preservation and collection of novel microbial associations in natural

samples and enrichment cultures. However, preservation of the habitats in which

they thrive is also needed. Up to now, attention has mainly been focused on various

unique sites such as hot springs or pristine places (e.g., the Arctic/Antarctic region).

The latter, for instance, has given rise in the last decade to an enormous expansion

in the knowledge of novel polar microbial taxa (van Trappen et al.

2005 ) which in

turn has led to industrial applications such as cold-adapted enzymes (Siddiqui and

Cavicchioli 2006 ) , anti-freeze products (Gilbert et al. 2004 ) and strains capable to

bioremediate in cold soils (Margesin et al. 2003 ) . We should explore new frontier

habitats such as the deep sea, the deep underground and the deep intestine. Indeed,

such environments harbor a wealth of putatively useful processes and products.

Most importantly, not only these “natural” habitats are of value, but also a num-

ber of sites altered by industrial actions, often unwanted, are now to be earmarked

as “resources” of microbial diversity. Examples are sites with acid mine drainage,

which recently showed potentials for the production of anti-cancer drugs (Yamada

et al. 2004 ) and aquifers polluted with chloro-organics which have yielded very

interesting halo-respiring micro-organisms (de Wildeman and Verstraete 2003 ;

Smidt and de Vos 2004 ) . It becomes obvious that not only the maintenance of micro-

bial culture collections can be justi ﬁ ed, but just as well the preservation of special

sites, as sources of ongoing microbial evolution, selection and development of spe-

cial microbial interactions, processes and products.

3 Storage of Microbial Resources

For the effective conservation and utilization of microbial resources which have been

found, all developed countries have established microbial culture collections, some

of which have history up to 100 years. They take sound management mechanisms,

act relatively independently, and have strong research capabilities. Not only micro-

bial resources are available in the culture collection, technical services can also be

provided. Microbial resource centers (MRCs) harbour collections of culturable

organisms (e.g. algae, bacteria, fungi, including yeasts, protozoa and viruses), their

replicable parts (e.g. genomes, plasmids, viruses, cDNAs), viable but not yet cultur-

able organisms, cells and tissues, databases containing molecular, physiological and

structural information relevant to these collections and allied bioinformatics.

3.1 Role of Culture Collections

The major culture collections throughout the world have as their primary

commission, the preservation and distribution of germplasm that has been

A. Malik et al.

demonstrated to have signi ﬁ cance to the microbiology community. The

importance of a particular strain may be as a reference for medical or taxonomic

research, as an assay organism for testing or screening, or as an essential compo-

nent of a patent application for a product or process in which it is involved.

Alternatively, the strain may be placed in a collection with reference to the

publication in which it was cited as part of the investigation. This latter form of

deposition is essential on account of the inherent transience of researchers and

their research programs, making it possible for later investigators to repeat or

advance published research that would be impossible in the absence of the strains

involved. As mentioned above, the many national reference and service collec-

tions have succeeded in preserving, for later generations of microbiologists,

many of the private and specialized collections of microorganisms that may

represent an entire career of one microbiologist. In other cases, however, the

acquisition of a collection of strains may well result from a change in the direc-

tion of the research program in a scientist’s laboratory.

The major culture collections of the world also serve as centers for excellence in

research in systematics and taxonomy. In large part the identi ﬁ cation and character-

ization of strains is an integral function of collections, and the availability of a large

collection of strains is essential for this type of research. Culture collections that

have contract identi ﬁ cation services are also continually searching for faster and

more reliable methods to characterize unknown strains for their clients. In many

cases, the strains maintained in any collection will directly re ﬂ ect the taxonomic

interests of the curators, in terms of the depth and breadth of particular taxonomic

groups.

3.2 Bioinformatics and Culture Collection

The meticulous and thorough characterization of microorganisms, the storage and

analysis of the generated information and its intelligent interrogation will provide

us with microbial solutions to critical challenges of the twenty ﬁ rst century. It is

imperative that scientists, researchers in biosystematics and taxonomy employ

modern tools of informatics and data processing to make best use of our microbial

resources. The elements of taxonomy such as species description, development of

identi ﬁ cation keys, scienti ﬁ c nomenclature, treatment of morphological, nutri-

tional and physiological traits, are increasingly being computerized to meet the

challenge.

The process of storage of genetic information with digital techniques for

archiving, interpreting and quantifying of data in arti ﬁ cial systems is an important

feature of bioinformatics (Wuyts et al.

2001, 2002 ) . Microbial taxonomists and

curators must take full advantage of the available technology that has been so ably

adopted in other biological ﬁ elds. Sequence data available on the web for many

years for public access and utilization ( http://www.ncbi.nih.gov/Genbank/

GenbankSearch.html ); EMBL ( http://www.ebi.ac.uk/embl/ ) are two key resources.

1 Management of Microbial Resources in the Environment…

However, Bridge et al. ( 2003 ) suggested that up to 20% of publicly available,

taxonomically important DNA sequences for three randomly chosen groups of

fungi were probably incorrectly named, chimaeric, of poor quality or incomplete

for reliable comparison. MRCs have a role to play, in providing information based

on authentic and stable strains with validated sequence data. MRCs need to har-

ness the new bioinformatics technologies and begin with networking processes to

establish a global network. The groundwork can be laid by stimulating collabora-

tive molecular taxonomic research and novel database development.

4 Microbial Resource Management (MRM)

In order to deal with MRM in environmental practice, a number of approaches are

currently in use. We can at present link high throughput/quick scan molecular anal-

yses with performance data. We can for instance line up data obtained by DGGE,

T-RFLP, micro-arrays, etc., to biomolecular databases resp. to diagnoses/predic-

tion/prevention/control (Denef et al. 2004 ; van der Gast et al. 2006 ) . Yet, although

the “omic” methods are capable to provide an “avalanche” of information, the lat-

ter is dif ﬁ cult to interpret. In case one is interested in straightforward information

on process performance and end product output, the process engineer will continue

to ﬁ nd the conventional physical/chemical parameters to be the best source of

information. However, in case the in-depth questions about the coherence of the

microbial community are of interest, then the molecular analyses can provide

information, which is not so much of direct tactical importance but rather essential

in terms of strategic considerations on the behavior of the “health” of the microbial

community.

Verstraete et al. ( 2007 ) developed the Microbial Resource Management (MRM)

concept. This is a practical mindset that has been developed as a concept to solve

practical problems through the use of microorganisms. For this reason, the inception

of MRM was shortly followed by a complementary set of tools to deal with it

(Marzorati et al. 2008 ) which come in the form of a three stage analysis independent

of the technique and its settings. These tools help to provide an ecological and pre-

dictive value of the analysis which incorporates the structure and diversity of the

microbial community being examined.

The most popular molecular ﬁ ngerprinting techniques including temperature

gradient gel electrophoresis (TGGE) and denaturing-gradient gel electrophoresis

(DGGE), terminal-restriction fragment length polymorphism (t-RFLP), 16S rRNA

gene clone libraries, and length heterogeneity-polymerase chain reaction (LH-PCR)

are commonly used to study the structure and composition of the microbial com-

munities. Interpreting and comparing this type of data became easier due to the

initiation of MRM and the three-stage tool set developed by Marzorati et al. ( 2008 ) .

The parameters within the tool set include range weighted richness (Rr), dynamics

(Dy), and functional organization (Fo). When using these tools in combination, they

can provide us with an ecological interpretation of the raw data describing the

A. Malik et al.

structure of the community. This has been demonstrated successfully in various

environments over the last few years including the human gut (Grootaert et al. 2009 ;

van den Abbeele et al. 2010 ) ; wastewater treatment systems (Wittebolle et al. 2008,

2009a, b ; Vlaeminck et al. 2009 ) ; prebiotics and human gut microbial diversity

(Marzorati et al. 2010b ; Possemiers et al. 2010 ) ; microbial community related to

celiac health issues (Schippa et al. 2010 ) ; drinking water (Lautenschlager et al.

2010 ) ; anaerobic digestion (Carballa et al. 2011 ; Pycke et al. 2011 ) ; aquaculture

(Qi et al. 2009 ; De Schryver et al. 2010, 2011 ; Crab et al. 2009 ; Prol-Garcia et al.

2010 ) ; these above mentioned studies, which commonly used ﬁ ngerprinting tech-

niques such as DGGE, fatty acid methyl ester (FAME), clone libraries, and t-RFLP,

have helped us to elucidate unknown characteristics of natural prokaryotic ecosys-

tems in these various areas utilizing MRM. The ﬁ rst parameter, Rr, was originally

introduced to establish a technique-speci ﬁ c range of values which indicate the rich-

ness and genetic diversity (based on the polymorphism of the 16S rRNA gene

sequence) of species within an indigenous bacterial community (Marzorati et al.

2008 ) . Rr was based on the DGGE gel patterns derived from the GC content and

positioning of the sequences from complex microbial communities. A high Rr value

indicates an environment with a high carrying capacity, an environment that can

host several species with a wide GC variability. It has been successfully used with

rRNA intergenic spacer analysis (RISA; Rojas-Oropeza et al. 2010 ) , TGGE (Schippa

et al. 2010 ) , and clone libraries (Marzorati et al. 2010a ) .

Dy, the second parameter in the tool set, was used to determine the rate of change

within the same community over a ﬁ xed time interval. It refers to the number of

species, on average, that are detected to be of signi ﬁ cance in a given environment at

a certain time point, thus providing a large picture of the dynamics within a com-

munity. Dy can be used as a standalone parameter as seen previously in a study

looking at the changing community during bioaugmentation of activated sludge

(Bathe et al. 2009 ) .

The third complementary parameter is the functional organization (Fo; Marzorati

et al. 2008 ) . This parameter initially was designed to determine the resulting action

of which microorganisms were suited to the ongoing environmental-microbiologi-

cal interactions. This should inevitably give them a selective advantage over the

other bacteria, thus increasing their dominance among the other species in the

microbial community being examined. Similarly, Fo was successfully used to dem-

onstrate changes in evenness in various areas of research including wastewater and

MFCs. Fo was renamed as community organization (Co), as a parameter that

describes the microbial community in terms of degrees of evenness.

4.1 Advances in Microbial Resource Management

The recent development of new technologies providing high-throughput, low-cost

sequencing methods has provided us with alternatives including Lynx Therapeutics’

Massively Parallel Signature Sequencing (MPSS; Reinartz et al. 2002 ) , 454

1 Management of Microbial Resources in the Environment…

pyrosequencing (Edwards et al. 2006 ) , Illumina (Solexa) sequencing (Whiteford

et al. 2009 ) , and ABI SOLiD (Sequencing by Oligonucleotide Ligation and

Detection) sequencing (Valouev et al. 2008 ) . These technologies are more sensitive

than the traditional DGGE and other ﬁ ngerprinting methods and provide us with a

broader taxonomic coverage of the unknown and often unculturable microbial com-

munities. Therefore, the basic parameters of the MRM tool set have to be reengi-

neered and adapted to provide a universal platform with which to compare and

contrast this new immense amount of data. Rr, based on community ﬁ ngerprinting

methods, was often limited in comparing richness in complex communities due to

their low detection limit (Bent et al.

2007 ) . These techniques often considerably

underestimate the actual richness of communities and hence the actual diversity,

which is why we must now be more vigilant in the face of new sequencing technolo-

gies. In fact, high throughput sequencing provides a much deeper insight of the

actual diversity of the analyzed microbial community. As a result, the analysis pro-

vides not only the sequences of the dominant microorganisms but also of all those

less abundant microorganisms normally not detected with the above mentioned

ﬁ ngerprinting techniques due to the low detection limit.

To know about the speci ﬁ c community dynamics a new technique, stable isotope

probing (SIP) combined with DGGE is used. SIP is based on an ultracentrifugation

step that fractionates a microbial sample previously incubated with, the compound

of interest which was isotopically labelled (Neufeld et al. 2007 ) . The result is a

separation of the microbial sample according to its weight, which is dependent on

its isotope content. SIP is an excellent technique to identify key microbial players in

mixed communities and to look at a speci ﬁ c process in a controlled environment.

With the key players identi ﬁ ed, their physiology and ecology can be investigated,

therefore providing important tools for MRM. Through SIP, we can determine

which microorganisms are responsible for the process of interest in addition to

interactions within the community providing us with information on the functional

organization of the community.

5 Utilization of Microbial Resources

In modern times, as biotechnology advances constantly, microorganisms have been

applied to all aspects of industrial and agricultural production. Microorganisms have

generated enormous social and economic bene ﬁ ts. It mainly refers to green chemis-

try and engineering, environmental bioremediation, renewable energy, natural medi-

cine, food production and processing. Developing agricultural microbial resources is

of vital importance. In recent years, research and development on new agricultural

production technology have made great progress. It is mainly represented by micro-

bial feed, microbial fertilizers, microbial pesticides, and microbial food.

As people seize natural resources crazily and over depend on fossil energy, issues

such as severe energy depletion, resources shortage and environmental pollution have

come up. Industrial production and discharge by traditional chemical method are also

A. Malik et al.

one of the major reasons for environmental pollution. A sustainable society should be

less dependent on unsustainable resources and pollution caused by fossil resources

should be reduced. It’s vital to make full use of the abundant natural resources, to replace

backward, polluted chemical industry with innovative and advanced bioeconomy.

5.1 Environmental Management

Microbial resources will become an important force in solving the environmental prob-

lems. Microbes play an important role in water environment, such as puri ﬁ cation and

pollution. Stabilization lagoons and bio-membranes are two classic approaches dealing

with polluted water. When the polluted water is pumped into the reaction pool, microbes

in it transform organics into inorganics by degradation, nitri ﬁ cation and also photosyn-

thesis. Usually several pools are used together, including facultative anaerobic, anaero-

bic and aerobic ones. For bio-membranes, various kinds of microbes will attach to the

membrane and form an ecosystem, which results in a very high speed of the degradation

of organic matter and also in a very high quality of the water obtained.

Waste is an unavoidable by product of human activities. Rapid population growth,

urbanization and industrial growth have led to increase the quantity and complexity

of generated waste and severe waste management problems in most cities of third

world countries. The large quantity of waste generated necessitates a system of col-

lection, transportation and disposal. Land ﬁ ll and composting methods could be used

in dealing with solid waste. Land ﬁ lling involves the controlled disposal of wastes on

or in the earth’s mantle. Land ﬁ lls are used to dispose of solid waste that cannot be

recycled and is of no further use, the residual matter remaining after solid wastes

have been pre-sorted at a materials recovery facility and the residual matter remain-

ing after the recovery of conversion products or energy. It is by far the most com-

mon method of ultimate disposal for waste residuals. Many countries use uninhabited

land, quarries, mines and pits as land ﬁ ll sites. Biological reprocessing methods like

composting and anaerobic digestion are natural ways to decompose solid organic

waste. Composting is nature’s way of recycling organic wastes. Composting is a

method of decomposing waste for disposal by microorganisms (mainly bacteria and

fungi) to produce a humus-like substance that can be used as a fertilizer. This pro-

cess converts waste which is organic in nature to inorganic materials that can be

returned to the soil as fertilizer i.e. biological stabilization of organic material in

such a manner that most of the nutrient and humus that are so necessary for plant

growth are returned to the soil.

5.2 Energy Development

Microorganisms will play an irreplaceable role in the process of searching for new

energy, compounding new energy and energy re-synthesis. Modi ﬁ cation and utilization

1 Management of Microbial Resources in the Environment…

of the existing microorganisms and the exploration of new microorganisms resources

for renewable bio-energy manufacturing are the new novel perspectives. By the year

2120, 3.6% of electric power and 6–7% of the total energy will come from renew-

able resources (Lakó et al.

2008 ).

The waste generated in the process of industrial and agricultural production,

such as crop straw, weeds, manure, sludge, organic industrial waste, garbage,

etc., can be used as raw materials, and transformed into combustible gas or liquid

bio-fuels by the microorganisms. Fatty acid esters (fatty acid methyl ester or

ethyl ester) are major components of biodiesel. The current bio-diesel limited to

the sources of animal fats or vegetable oil has certain limitations in its develop-

ment. New technologies that transform the biomass directly into fatty acid ester

through microbial fermentation need to be developed, at the same time, micro-

bial resources, such as microalgae which can synthesize oil naturally, yeast, etc.,

should be explored.

The main component of biogas is methane, which is the product of organic mat-

ter decomposed by microorganisms under strict anaerobic conditions. Methane fer-

mentation can release about 90% of the chemical energy in organic matter, which

can be transformed into mechanical energy, electrical energy and heat energy. At

present, gas as a fuel source has been transported around the world through pipe-

lines for domestic and industrial use or converted to methanol as a supplementary

fuel for internal combustion engines.

5.3 Bio-chemical Re ﬁ ning

The biore ﬁ ning concept is an analogue of today’s petroleum re ﬁ neries producing

multiple fuels and products from petroleum. By combining chemistry, biotechnol-

ogy, engineering and systems approach, biore ﬁ nery could produce food, fertilizers,

industrial chemicals, fuels, and power from biomass (Kamm and Kamm 2004 ).

With the rapid consumption of fossil resources and the increasingly serious issue of

the environment security, the re ﬁ ning of bio-based chemicals has become more and

more popular. Many chemical companies are increasing their investments to pro-

duce ‘green’ chemicals through the utilization of microbial genes and enzyme

resources as well as the biotransformation method in place of bio-chemical conver-

sion. Bio-based chemicals have many types, including biological ethylene, optically

pure D-or L-lactic acid, 1, 3-propanediol, 1, 4-butanediol, 3-hydroxy-propionic

acid, acrylic acid, n-butanol, butyric acid, succinic acid, adipic acid, etc. They are

not only important chemicals, but also important chemicals after being transformed.

In addition, microbes can utilize biomass to synthesize lots of compounds that

possess potential application value. As a result, further exploiting microbial

resources and accelerating the biore ﬁ nery of the above chemicals will play an

important role in development of bio-economy. Besides, exploration of the genes

and enzymes from microorganisms and replacement of chemical transformation by

bio-transformation are also important future directions.

A. Malik et al.

5.4 Industrial Enzymes and Biocatalysts

The variety of microorganisms able to degrade natural and synthetic organic

compounds can be used for applications in environmental biotechnology as well as

in industrial synthetic chemistry. In particular, the latter approach to use enzymes

for biotransformation is of growing interest. Biotransformations are chemical reac-

tions that are catalyzed by microorganisms in terms of growing or resting cells or

that are catalyzed by isolated enzymes. Because of the high stereo- or regioselectiv-

ity combined with high product purity and high enantiomeric excesses, biotransfor-

mations can be technically superior to traditional chemical synthesis. The use of

biotransformations for industrial synthetic chemistry is an interdisciplinary, and

therefore very exciting, ﬁ eld that needs the close cooperation of microbiologists,

molecular biologists, chemists, and engineers. Besides classical methods, new tech-

nologies including the screening for non-culturable microorganisms and high

throughput screening techniques are speeding up the discovery of new biocatalysts.

The key of biotransformation is to develop highly ef ﬁ cient, highly selective biologi-

cal catalysts, which can be realized by combining basic genomic technology with

high-throughput screening technology and genome database mining. Meanwhile,

further improvement and optimization of the directed evolution technology is

another important force.

5.5 Utilization of Microbial Resources in Extreme Environments

The microbial resources in extreme environments which have a unique type of

genes, special physiological mechanisms and metabolic products, are a kind of trea-

sure-house of new resources. Enzymes from extreme environments have a very

strong catalytic effect on environmental friendly products, and can be applied to a

variety of special reaction systems. Psychrophilic enzymes can reduce the energy

consumption in industry, while thermophilic enzymes are the important source of

thermo stable enzymes and leaching bacteria. Its application in food, energy, envi-

ronment, metabolic projects, mineral exploration, etc. can provide opportunities for

the development of new chemicals, drugs and biological products.

6 Recent Development in Microbial Resource Utilization

6.1 Isolation and Microorganism Culture Technology

and Metagenomics Technology

Microorganisms play an important role in recycling of materials and life continu-

ance, their diversity is used to monitor and predict environmental changes. Lots of

1 Management of Microbial Resources in the Environment…

unknown microorganisms have never been cultured. In recent years, scientists have

developed several new methods to isolate and culture microorganisms. The key

point of acquiring new functional microorganisms is to create high throughput,

rapid and ef ﬁ cient technologies towards isolation and culture of microorganisms.

Meanwhile, genomics and modern molecular biology technologies are getting

more mature. These modern technologies gradually in ﬁ ltrate into the entire ﬁ eld of

life sciences. They also represent new research methods for microbiological

research. A recently developed metagenomic approach employs cloning of the total

microbial genome, the so-called ‘metagenome’, directly isolated from natural envi-

ronments in culturable bacteria such as Escherichia coli (Beja et al.

2000 ;

Handelsman et al. 1998 ; Rondon et al. 1999, 2000 ) and discovering novel microbial

resources (Handelsman 2004 ) . The basis of metagenomic approach originated from

the molecular ecological studies of microbial diversity, indicating that majority

of micro-organisms in nature was not cultivated by standard cultivation techniques.

In addition, the combination of phylogenetic marker screening of metagenomic

libraries and genomics could reveal the physiology of as-yet-uncultured microor-

ganisms, only identi ﬁ ed by culture-independent studies (Quaiser et al. 2002 ; Liles

et al. 2003 ).

A series of engineering systems and technical platforms have been built for

genetic engineering, protein engineering, metabolic engineering, synthetic biology,

and bioprocess studies. In 1990s, with the development of gene function studies by

applying functional genomics, molecular biology, molecular pathology and cell

biology, the number of targets for drug screening has been growing in an unprece-

dented rate. High-throughput screening (HTS) is one of the newest techniques used

in drug design and may be applied in biological and chemical sciences. This method,

due to utilization of robots, detectors and software that regulate the whole process,

enables a series of analyses of chemical compounds to be conducted in a short time

and the af ﬁ nity of biological structures which is often related to toxicity to be

de ﬁ ned. The HTS method is more frequently utilized in conjunction with analytical

techniques such as NMR or coupled methods e.g., LC-MS/MS.

6.2 Combinatorial Biochemistry Technology

Combinatorial biochemistry and combinatorial biosynthesis make use of microor-

ganisms to synthesize a wide range of compounds at the gene level. Combinatorial

biosynthesis has been successfully employed for e.g. carotenoid- and antibiotic

polyketide-producing micro-organisms. It involves interchanging secondary metab-

olism genes between micro-organisms to create unnatural gene combinations or

hybrid genes. Novel metabolites can be made due to the effect of new enzyme-

metabolic pathway combinations or to the formation of proteins with new enzy-

matic properties. Combinatorial biosynthesis technology can help us to discover

new compounds. Combinatorial biosynthesis combined with genetic engineering

and high-throughput screening technology will make it possible to carry out drug

A. Malik et al.

development in vivo by microorganisms via modern biology and chemistry. By this

approach, we will ﬁ nd better strategies to synthesize new drugs and get more com-

pounds with new structure.

6.3 Directed Evolution Technology

The development of industrial biotechnology focusing on biocatalysis needs to

exploit new ef ﬁ cient biocatalysts. These biocatalysts should meet the demands of

new catalytic activity and high productivity. They can adapt to unsuitable environ-

ments and satisfy industrial development. To this end, we can utilize microbial

resources to develop new enzymes. And we can arti ﬁ cially modify enzymes’ bio-

logical activity in accordance with special needs.

In recent years, with the development of directed evolution technology, there is

no need to solve the protein’s three dimensional structure and enzymatic mecha-

nism in advance. The natural evolution mechanism of arti ﬁ cial simulation (random

mutation, recombination, natural selection) modi ﬁ ed enzyme genes in vitro . It can

directly select for enzyme mutants whose function might meet special requirements.

By this way, we can get such enzymes in a few days or weeks, much quicker than

millions of years nature needs to achieve it. It is an important method of ﬁ nding

novel bioactive molecules and biotransformation pathways. The newborn directed

evolution technology has greatly expanded the range of protein engineering research

and application. It has opened up a new way for enzyme’s structure and function

research. Meanwhile, it gradually demonstrates its vitality in the ﬁ elds of industry,

agriculture, medicine, etc.

6.4 Biological Information Technology

Modern biological technologies result in an enormous accumulation of biological data,

including microbial strain resources and related genetic resources. They enable us to

restudy biological problems on basis of the whole genome, which will lead to major

scienti ﬁ c discoveries. The huge amount of data generated from genomics research

(transcriptomics, proteomics, and metabolomics) is what traditional methods cannot

do, so bioinformatics came into being. Future development direction is to utilize ongo-

ing biological information technologies and develop new software algorithms.

7 Conclusions

Microorganisms are an almost unlimited source of metabolic capabilities ready to be

exploited for multiple purposes. A combination of several techniques should be applied

to interrogate the diversity, function, and ecology of microorganisms. Culture-based

1 Management of Microbial Resources in the Environment…

and culture-independent molecular techniques are neither contradictory nor excluding

and should be considered as complementary. An interdisciplinary systems approach

embracing several “omics” technologies to reveal the interactions between genes, pro-

teins, and environmental factors will be needed to provide new insights into environ-

mental microbiology. Environmental metagenomic libraries have proved to be great

resources for new microbial enzymes and antibiotics with potential applications in

biotechnology, medicine, and industry respectively. Massive construction of metage-

nomic libraries and development of high throughput screening technologies will be

necessary to obtain valuable microbial resources. Development of multi-“omics”

approaches will be a high-priority area of research in the coming years. Microbial

resource management is the basis of a number of new developments in domains such

as environmental safety and health, renewable energy production, closing environmen-

tal cycles and providing new materials.

References

Bathe S, Schwarzenbeck N, Hausner M (2009) Bioaugmentation of activated sludge towards

3-chloroaniline removal with a mixed bacterial population carrying a degradative plasmid.

Bioresour Technol 100:2902–2909

Beja O, Suzuki MT, Koonin EV, Aravind L, Hadd A, Nguyen LP, Villacorta R, Amjadi M, Garrigues

C, Javanovich SB, Feldman RA, Delong EF (2000) Construction and analysis of bacterial

arti ﬁ cial chromosome libraries from a marine microbial assemblage. Environ Microbiol

2:516–529

Bent SJ, Pierson JD, Forney LJ, Danovaro R, Luna GM, Dell’anno A, Pietrangeli B (2007)

Measuring species richness based on microbial community ﬁ ngerprints: the emperor has no

clothes. Appl Environ Microbiol 73:2399–2401

Bridge PD, Roberts PJ, Spooner BM, Panchal G (2003) On the unreliability of published DNA

sequences. New Phytol 160:43–48

Carballa M, Smits M, Etcherbehere C et al (2011) Correlations between molecular and operational

parameters in continuous lab scale anaerobic reactors. Appl Microbiol Biotechnol 89:303–314

Crab R, Kochva M, Verstraete W, Avnimelech Y (2009) Bio- ﬂ ocs technology application in over-

wintering of tilapia. Aquacult Eng 40:105–112

De Schryver P, Sinha AK, Kunwar PS, Baruah K, Verstraete W, Boon N, De Boeck G, Bossier P

(2010) Poly-beta-hydroxybutyrate (PHB) increases growth performance and intestinal bacte-

rial range weighted richness in juvenile European sea bass, Dicentrarchus labrax . Appl

Microbiol Biotechnol 86:1535–1541

De Schryver P, Dierckens K, Thi QQ, Amalia R, Marzorati M, Bossier P, Boon N, Verstraete W

(2011) Convergent dynamics of the juvenile European sea bass gut microbiota induced by

poly-beta-hydroxybutyrate. Environ Microbiol 13:1042–1051

de Wildeman S, Verstraete W (2003) The quest for microbial reductive dechlorination of C

to C

chloroalkanes is warranted. Appl Microbiol Biotechnol 61:94–102

Denef V, Park J, Tsoi T, Rouillard J, Zhang H, Wibbenmeyer JA, Verstraete W, Gulari E, Hashsham

SA, Tiedje JM (2004) Biphenyl and benzoate metabolism in a genomic context: outlining

genome-wide metabolic networks in Burkholderia xenovorans LB400. Appl Environ Microbiol

70:4961–4970

Edwards RA, Rodriguez-Brito B, Wegley L, Haynes M, Breitbart M, Peterson DM, Saar MO,

Alexander S, Alexander EC Jr, Rohwer F (2006) Using pyrosequencing to shed light on deep

mine microbial ecology. BMC Genomics 7:57

A. Malik et al.

Garbeva P, van Veen JA, van Elsas JD (2004) Microbial diversity in soil: selection microbial

populations by plant and soil type and implications for disease suppressiveness. Annu Rev

Phytopathol 42:243–270

Gilbert JA, Hill PJ, Dodd CER, Laybourn-Parry J (2004) Demonstration of antifreeze protein

activity in Antarctic lake bacteria. Microbiology 150:171–180

Grootaert C, van den Abbeele P, Marzorati M, Broekaert WF, Courtin CM, Delcour JA, Verstraete

W, van de Wiele T (2009) Comparison of prebiotic effects of arabinoxylan oligosaccharides

and inulin in a simulator of the human intestinal microbial ecosystem. FEMS Microbiol Ecol

69:231–242

Handelsman J (2004) Metagenomics: application of genomics to uncultured microorganisms.

Microbiol Mol Biol Rev 68:669–685

Handelsman J, Rondon MR, Brady SP, Clady J, Goodman RM (1998) Molecular biological access

to the chemistry of unknown soil microbes: a new frontier for natural products. Chem Biol

5:245–249

Lakó J, Hancsók J, Yuzhakova T, Marton G, Utasi A, Rédey Á (2008) Biomass – a source of

chemicals and energy for sustainable development. Environ Eng Manag J 7:499–509

Lautenschlager K, Boon N, Wang Y, Egli T, Hammes F (2010) Overnight stagnation of drinking

water in household taps induces microbial growth and changes in community composition.

Water Res 44:4868–4877

Liles MR, Manske BF, Bintrim SB, Handelsman J, Goodman RM (2003) A census of rRNA genes

and linked genomic sequences within a soil metagenomic library. Appl Environ Microbiol

69:2684–2691

Kamm B, Kamm M (2004) Principles of biore ﬁ neries. Appl Microbiol Biotechnol 64:137–145

Margesin R, Gander S, Zacke G, Gounot AM, Schinner F (2003) Hydrocarbon degradation and

enzyme activities of cold adapted bacteria and yeast. Extremophiles 7:451–458

Marzorati M, Wittebolle L, Boon N, Daffonchio D, Verstraete W (2008) How to get more out of

molecular ﬁ ngerprints: practical tools for microbial ecology. Environ Microbiol

10:1571–1581

Marzorati M, Balloi A, de Ferra F, Corallo L, Carpani G, Wittebolle L, Verstraete W, Daffonchio D

(2010a) Bacterial diversity and reductive dehalogenase redundancy in a 1,2-dichloroethanede-

grading bacterial consortium enriched from a contaminated aquifer. Microb Cell Fact 19:9–12

Marzorati M, Verhelst A, Luta G, Sinnott R, Verstraete W, Van de Wiele T, Possemiers S (2010b)

In vitro modulation of the human gastrointestinal microbial community by plant-derived

polysaccharide-rich dietary supplements. Int J Food Microbiol 139:168–176

Neufeld JD, Vohra J, Dumont MG, Lueders T, Mane ﬁ eld M, Friedrich MW, Murrell JC (2007)

DNA stable-isotope probing. Nat Protoc 2:860–866

Possemiers S, Marzorati M, Verstraete W, Van de Wiele T (2010) Bacteria and chocolate: a suc-

cessful combination for probiotic delivery. Int J Food Microbiol 141:97–103

Prol-Garcia MJ, Planas M, Pintado J (2010) Different colonization and residence time of Listonella

anguillarum and Vibrio splendidus in the rotifer Brachionus plicatilis determined by real-time

PCR and DGGE. Aquaculture 302:26–35

Pycke B, Etcherbehere C, Van de Caveye P, Negroni A, Verstraete W, Boon N (2011) A time course

analysis of four full-scale anaerobic digesters in relation to the dynamics of change of their

microbial communities. Water Sci Technol 63:769–775

Qi ZZ, Dierckens K, Defoirdt T, Sorgeloos P, Boon N, Bao ZM, Bossier P (2009) Analysis of the

evolution of microbial communities associated with different cultures of rotifer strains belong-

ing to different cryptic species of the Brachionus plicatilis species complex. Aquaculture

292:23–29

Quaiser A, Ochsenreiter T, Klenk H-P, Kletzin A, Treusch AH, Meurer G, Eck J, Sensen CW,

Schleper G (2002) First insight into the genome of an uncultivated crenarchaeote from soil.

Environ Microbiol 4:603–611

Reinartz J, Bruyns E, Lin JZ, Burcham T, Brenner S, Bowen B, Kramer M, Woychik R (2002)

Massively parallel signature sequencing (MPSS) as a tool for in-depth quantitative gene expres-

sion pro ﬁ ling in all organisms. Brief Funct Genomic Proteomic 1:95–104

1 Management of Microbial Resources in the Environment…

Rojas-Oropeza M, Dendooven L, Garza-Avendano L, Souza V, Philippot L, Cabirol N (2010)

Effects of biosolids application on nitrogen dynamics and microbial structure in a saline-sodic

soil of the former Lake Texcoco (Mexico). Bioresour Technol 101:2491–2498

Rondon MR, Goodman RM, Handelsman J (1999) The earth’s bounty: assessing and accessing

soil microbial diversity. Trends Biotechnol 17:403–409

Rondon MR, August PR, Bettermann AD, Brady SF, Grossman TH, Liles MR, Loiacono KA,

Lynch BA, MacNeil IA, Minor C, Tiong CL, Gilman M, Osburne MS, Clardy J, Handelsman

J, Goodman RM (2000) Cloning the soil metagenome: a strategy for accessing the genetic and

functional diversity of uncultured microorganisms. Appl Environ Microbiol 66:2541–2547

Schippa S, Iebba V, Barbato M, Di Nardo G, Totino V, Checchi MP, Longhi C, Maiella G, Cucchiara

S, Conte MP (2010) A distinctive ‘microbial signature’ in celiac pediatric patients. BMC

Microbiol 17:175

Siddiqui KS, Cavicchioli R (2006) Cold-adapted enzymes. Annu Rev Biochem 75:403–433

Singh BK, Campbell CD, Sorenson SJ, Zhou J (2009) Soil genomics. Nat Rev Microbiol 7:756.

doi:

10.1038/nrmicro2119-c1

Smidt H, de Vos WM (2004) Anaerobic microbial dehalogenation. Annu Rev Microbiol 58:43–73

Valouev A, Ichikawa J, Tonthat T, Stuart J, Ranade S, Peckham H, Zeng K, Malek JA, Costa G,

McKernan K, Sidow A, Fire A, Johnson SM (2008) A high-resolution, nucleosome position

map of C . elegans reveals a lack of universal sequence-dictated positioning. Genome Res

18:1051–1063

Van den Abbeele P, Grootaert C, Marzorati M, Possemiers S, Verstraete W, Gerard P, Rabot S,

Bruneau A, El Aidy S, Derrien M, Zoetendal E, Kleerebezem M, Smidt H, Van de Wiele T

(2010) Microbial community development in a dynamic gut model is reproducible, colon

region speci ﬁ c, and selective for Bacteroidetes and Clostridium Cluster IX. Appl Environ

Microbiol 76:5237–5246

van der Gast CJ, Jefferson B, Reid E (2006) Bacterial diversity is determined by volume in mem-

brane bioreactors. Environ Microbiol 8:1048–1055

van Trappen S, Vandecandelaere I, Mergaert J, Swings J (2005) Flavobacterium fryxellicola sp.

nov . and Flavobacterium psychrolimnae sp. nov , novel psychrophilic bacteria isolated from

microbial mats in Antarctic lakes. Int J Syst Evol Microbiol 55:769–772

Verstraete W, Wittelbolle L, Heylen K, Vanparys B, de Vos P, van de Wiele T, Boon N (2007)

Microbial resource management: the road to go for environmental biotechnology. Eng Life Sci

7:117–126

Vlaeminck SE, Terada A, Smets BF, Van der Linden D, Boon N, Verstraete W, Carballa M (2009)

Nitrogen removal from digested black water by one-stage partial nitritation and anammox.

Environ Sci Technol 43:5035–5041

Whiteford N, Skelly T, Curtis C, Ritchie ME, Lohr A, Zaranek AW, Abnizova I, Brown C (2009)

Swift: primary data analysis for the Illumina Solexa sequencing platform. Bioinformatics

25:2194–2199

Wittebolle L, Vervaeren H, Verstraete W, Boon N (2008) Quantifying community dynamics of

nitri ﬁ ers in functionally stable reactors. Appl Environ Microbiol 74:286–293

Wittebolle L, Verstraete W, Boon N (2009b) The inoculum effect on the ammonia-oxidizing bacte-

rial communities in parallel sequential batch reactors. Water Res 43:4149–4158

Wuyts J, De Rijk P, Van de Peer Y, Winkelmans T, De Wachter R (2001) The European large

subunit ribosomal RNA database. Nucleic Acids Res 29:175–177

Wuyts J, Van de Peen Y, Winkelmans T, De Wachter R (2002) The European database on small

subunit ribosomal RNA. Nucleic Acids Res 30:183–185

Yamada T, Hiraoka Y, Das Gupta TK, Chakrabarty AM (2004) Rusticyanin , a bacterial electron

transfer protein causes G (1) arrest in J774 and apoptosis in human cancer cells. Cell Cycle

3:1182–1187

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_2, © Springer Science+Business Media Dordrecht 2013

Abstract Soils harbor an exceptional diversity of prokaryotes that are largely

undescribed beyond the level of ribotype and are a potentially vast resource for

natural product discovery. It is estimated that in 1 g of soil there are 4,000 different

bacterial “genomic units” based on DNA–DNA reassociation. Approximately 1%

of the soil bacterial population can be cultured by standard laboratory practices. Soil

structure and physicochemical properties limit the applicability and value of meth-

ods involving direct observation, and ecological studies have focused on communi-

ties and populations, rather than single cells or microcolonies. Ecological studies of

soil microorganisms require reliable techniques for assessment of microbial com-

munity composition, abundance, growth, and activity. The methods for composition

and diversity analysis of soil microbes has advantaged in the past years. Traditionally,

taxonomic classi ﬁ cation of bacteria has been performed based on metabolic, mor-

phologic, and physiological traits. This approach emulates the methodological

approach of botanists and zoologists; however, it requires the isolation and cultiva-

tion of individual bacterial species. Assessments of bacterial communities from a

number of environments have found that the fraction of cells that may be cultured is

not representative of the abundance or diversity of the microbial community present

in the environment; it is often observed that direct microscopic counts exceed viable

cell counts by several orders of magnitude. The widespread use of molecular tech-

niques in studying microbial communities has greatly enhanced our understanding

of microbial diversity and function in the natural environment and contributed to an

M. I. Ansari (*)

Department of Agricultural Microbiology , Aligarh Muslim University ,

Aligarh , Uttar Pradesh 202002 , India

e-mail: ikram_ansari21@yahoo.com

A. Malik

Department of Agricultural Microbiology, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , Uttar Pradesh 202002 , India

e-mail: ab_malik30@yahoo.com

Chapter 2

Recent Development in the Methods of Studying

Microbial Diversity

Mohd Ikram Ansari and Abdul Malik

M.I. Ansari and A. Malik

explosion of novel commercially viable enzymes. The analysis of ampli ﬁ ed and

sequenced 16S rRNA genes has become the most important single approach for

microbial diversity studies. This chapter describes the methods used for studying

microbial diversity and the recent development in these methods. The new sequenc-

ing technologies used for sequencing thousands of reads in a single run and a cost-

effective method to run many samples.

Keywords Microbial diversity • Cultural methods • Molecular methods • Single

cell analysis • 16S rRNA • Sequencing

1 Introduction

Microbial diversity is a general term used to include genetic diversity, that is, the

amount and distribution of genetic information, within microbial species; diversity

of bacterial and fungal species in microbial communities; and ecological diversity,

that is, variation in community structure, complexity of interactions, number of

trophic levels, and number of guilds. Microbial diversity is measured by various

techniques such as traditional plate counting and direct counts as well as the newer

molecular-based procedures and fatty acid analysis (Hill et al. 2000 ; Kirk et al.

2004 ; Faulwetter et al. 2009 ) .

Microbial characteristics of soils are being evaluated increasingly as sensitive indi-

cators of soil health because of the clear relationships between microbial diversity, soil

and plant quality, and ecosystem sustainability (Doran et al. 1994 ) . While the under-

standing of microbial properties such as biomass, activity, and diversity are important

to scientists in furthering knowledge of the factors contributing to soil health, results

of such analyses may also be useful to extension personnel and farmers in devising

practical measures of soil quality (Hill et al. 2000 ) . The establishment of comparative

small subunit rRNA sequence analysis as initially introduced by Fox et al. ( 1977 )

certainly represents a major milestone in the concomitant ‘evolution’ of systematic

and methods for characterization. These molecules almost perfectly meet the basic

requirements of a general phylogenetic marker i.e. ubiquitous distribution, functional

constancy, low frequency of lateral gene transfer and recombination combined with a

comprehensive database of primary structures (Cole et al. 2007 ; Ludwig 2007 ) .

Over the past two decades, the approach to analyzing soil microbial communities

has changed dramatically. Many new methods and approaches are now available,

allowing soil microbiologists to gain access to more of the microorganisms residing

in soil and allowing for better assessments of microbial diversity (Nannipieri et al.

2003 ; Fierer and Lennon 2011 ) .

A number of methods are currently available for studies on soil microbial com-

munities. The use of molecular techniques for investigating microbial diversity in

soil communities continues to provide new understanding of the distribution and

diversity of organisms in soil habitats. The use of SSU rRNA or rDNA sequences,

combined with ﬂ uorescent oligonucleotide probes provides a powerful approach for

2 Recent Development in the Methods of Studying Microbial Diversity

studying soil microorganisms that may not be amenable to current culturing techniques

(Borneman and Becke 2007 ) .

Despite the utility of culture-independent techniques such as SSU rRNA or rDNA

analyses, there remains a general need to cultivate microorganisms from soil habitats

to better understand their role in soil processes. Future studies of soil microbial com-

munities must necessarily rely on a combination of both culture-dependent and cul-

ture-independent methods and approaches. Only then we will be able to develop a

more complete picture of the contribution of speci ﬁ c microbial communities to the

overall quality and health of agricultural soils. In this chapter, we brie ﬂ y discuss

some of the most important approaches for studying soil microbial communities. Our

goal is to place the newer methods in perspective with the traditional culture-based

approaches for assessing microbial diversity.

2 Culture-Dependent Methods of Community Analysis

About 99% of soil microorganisms are unculturable. Advances in molecular biol-

ogy methods have assisted our understanding of microbial functions, their interac-

tions with other organisms and their environment. These studies have primarily

been conducted in the laboratory, with less research on microorganisms in their

natural habitat. It was recently estimated that less than 1% of the 10

bacterial cells

in a gram of soil were culturable in laboratory media (Davis et al. 2005 ) . One can

appreciate the lack of knowledge on the unculturable 99% of the microbial popula-

tion, in terms of their contribution to nutrient and energy ﬂ ow, soil respiration, gene

transfer, degradation of pollutants, diseases and quorum sensing, all of whose

mechanisms have yet to be better understood. Researchers have developed new

methods that allow new knowledge to be forthcoming (Saleh-Lakha et al. 2005 ) .

Culture-based approaches, while extremely useful for understanding the physiolog-

ical potential of isolated organisms, do not necessarily provide a comprehensive

information on the composition of microbial communities. The results obtained by

culture-dependent techniques covered only those few organisms that could be culti-

vated. Due to this well documented disparity between cultivable and in situ diver-

sity, it is often dif ﬁ cult to assess the signi ﬁ cance of cultured members in microbial

communities. Several studies have employed culture-independent techniques to

show that cultivated microorganisms from diverse environments often may repre-

sent very minor components of the microbial community as a whole (Ward et al.

1990 ; Amann et al. 1995 ; Larsen et al. 2008 ) .

2.1 Dilution Plating and Culturing Methods

Traditionally, the analysis of soil microbial communities has relied on culturing

techniques using a variety of culture media designed to maximize the recovery of

M.I. Ansari and A. Malik

different microbial species. This is particularly the case for soil health studies.

There are numerous examples where these techniques have revealed a diversity of

microorganisms associated with various soil quality parameters such as disease

suppression and organic matter decomposition (Alvarez et al.

1995 ; van Hu and

Bruggen 1997 ; Maloney et al. 1997 ; Garbeva et al. 2004 ) . Although there have

been recent attempts to devise suites of culture media to maximize the recovery of

diverse microbial groups from soils (Balestra and Misaghi

1997 ; Mitsui et al.

1997 ) , it has been estimated that less than 0.1% of the microorganisms found in

typical agricultural soils are culturable using current culture media formulations

(Atlas and Bartha 1998 ) . This is based on comparisons between direct microscopic

counts of microbes in soil samples and recoverable colony forming units (Hill et al.

2000 ; Juan et al. 2008 ) .

Collado et al. ( 2007 ) found that high-throughput bacterial cultivation has

improved the recovery of slow-growing and previously uncultured bacteria. The

most robust high-throughput methods are based on techniques of ‘dilution to

extinction’ or ‘extinction culturing’. The low-density partitioning of Colony

Forming Units (CFUs) in tubes or micro-wells exploits the fact that the number of

culturable species typically increases as inoculum density decreases. Bacterial

high-throughput culturing methods were adapted to fungi to generate large num-

bers of fungal extinction cultures. The ef ﬁ ciency of extinction culturing was

assessed by comparing it with particle ﬁ ltration and automated plate-streaking.

Compared with plating methods using continuous surfaces, extinction culturing

distributes fungal propagules over partitioned surfaces. Inter colony interactions

are reduced, permitting longer incubation times, and colony initiation and recovery

improved. Efforts to evaluate and recover colonies from fungal isolation plates

were substantially reduced (Collado et al. 2007 ) .

2.2 Community-Level Physiological Pro ﬁ les

Traditionally, methods to analyze soil microorganisms have been based on cultivation

and isolation (van Elsas et al. 1998 ) ; a wide variety of culture media has therefore

been designed to maximize the recovery of diverse microbial groups. A Biolog-based

method for directly analyzing the potential activity of soil microbial communities,

denoted community-level physiological pro ﬁ ling (CLPP) (Garland 1996a ; Garbeva

et al. 2004 ) has also been introduced. Microbial community analyses based on CLPPs

have been corroborated by other microbial community measures, including plate

counts (Soderber et al.

2002 ) , fatty acid methyl ester and phospholipid fatty acid anal-

ysis (Widmer et al. 2001 ; Soderber et al. 2002 ) , API 20NE enzyme and C tests, and an

array of molecular assays (Ovreas and Torsvik 1998 ; Di Giovanni et al. 1999a ; Widmer

et al. 2001 ) . In addition, previous research has demonstrated that CLPPs are highly

reproducible (Haack et al. 1995 ; Di Giovanni et al. 1999b ; Classen et al. 2003 ) .

One of the more widely used culture-dependent methods for analyzing soil

microbial communities has been that of community-level physiological pro ﬁ les

2 Recent Development in the Methods of Studying Microbial Diversity

(Garland and Mills 1991 ; Konopka et al. 1998 ) . This technique takes advantage of

the traditional methods of bacterial taxonomy in which bacterial species are

identi ﬁ ed based on their utilization of different carbon sources. Community-level

physiological pro ﬁ les have been facilitated by the use of a commercial taxonomic

system, known as the BIOLOG system, which is currently available and has been

used extensively for the analysis of soil microbial communities (Lehman et al.

1995 ;

Garland 1996b ; Hill et al. 2000 ; Liu et al. 2006 ) .

This BIOLOG system is based on the utilization of a suite of 95 different

carbon sources (Garland and Mills 1991 ) . Utilization of each substrate is

detected by the reduction of a tetrazolium dye, which results in a color change

that can be quanti ﬁ ed spectrophotometrically. The pattern of substrates that are

oxidized can be compared among different soil samples from a series of times

or locations as an indication of differences in the physiological functions of

microbial communities. Most commonly, multivariate statistical techniques are

necessary to analyze the substrate utilization pro ﬁ le data (Hackett and Grif ﬁ ths

1997 ; Hitzl et al. 1997 ) .

The CLPP method provides an exciting opportunity to overcome the draw-

backs of alternative time consuming culture-based analyses or biochemical tests

(Schutter and Dick 2001 ; Preston-Mafham et al. 2002 ) . The CLPP approach is

frequently employed to determine the effect of various environmental factors on

the biological status of particular soil sites by following catabolic traits (Haack

et al. 1995 ) . On the other hand as (Garland 1996a, 1997 ) noticed, the metabolic

growth response, which involves cooperative as well as competitive effects in

BIOLOG Eco Plates wells, might be a major drawback of the CLPP method

(Frac et al. 2012 ) .

The metabolic diversity of microbial communities is fundamental for the mul-

tiple soil functions mediated by microorganisms. Community level physiological

pro ﬁ les based on sole C source oxidation have been used as a fast and reproducible

tool to study soil microbial functional diversity because the utilisation of available

carbon is the key factor governing microbial growth in soil. This study reveals that

signi ﬁ cantly different CLPP patterns can be generated on the basis of only 3–4

genera, as re ﬂ ected by PCR-DGGE analysis. Also for this reason, CLPPs based on

incubations of soil suspensions should just be used as a screening method and

always be accompanied by other techniques for community analysis. The CLPP

methods can discriminate between different soil microbial communities, CLPPs

may provide little insight about the function of the community in situ . The CLPPs

have the greatest utility when they are combined with other microbial methods that

do not rely on the culturing of the soil micro ﬂ ora (Classen et al.

2003 ; Ros et al.

2008 ) . Despite the fact that culture-dependent techniques are not ideal for studies

of the composition of natural microbial communities when used alone, they pro-

vide one of the most useful means of understanding the growth habit, development,

and potential function of microorganisms from soil habitats. A combination of

culture-based and culture-independent approaches is likely to reveal more com-

plete information regarding the composition of soil microbial communities (Liesack

et al. 1997 ) .

M.I. Ansari and A. Malik

3 Culture-Independent Methods of Community Analysis

Because of the inherent limitations of culture-based methods, soil microbial ecologists

are turning increasingly to culture-independent methods of community analysis. Using

culture-independent methods, the composition of communities can be inferred based

on the extraction, quanti ﬁ cation, and identi ﬁ cation of molecules from soil that are

speci ﬁ c to certain microorganisms or microbial groups; or advanced ﬂ uorescence

microscopic techniques. Useful molecules for such studies include phospholipid fatty

acids and nucleic acids (Morgan and Winstanley

1997 ) whereas the microscopic tech-

niques involve either the hybridization of ﬂ uorescent-labeled nucleic acid probes with

total RNA extracted from soils or hybridizations with cells in situ (Collins et al. 2006 ) .

Sequence analysis of the 16S rRNA gene is the dominant method of determining iden-

tity and phylogenetic relatedness of microorganisms (Curtis et al. 2006 ) , although other

genes, such as rpoB , may provide greater resolution in phylogenetic associations at the

species and subspecies levels (Case et al. 2007 ; Little et al. 2008 ) .

3.1 Phospholipid Fatty Acid Analysis

Phospholipid fatty acid (PLFA) analysis has been used as a culture-independent

method of assessing the structure of soil microbial communities and determining

gross changes that accompany soil disturbances such as cropping practices (Zelles

et al. 1995 ) , pollution (Frostegard et al. 1993 ) , fumigation (Macalady et al. 1998 ) ,

and changes in soil quality (Petersen et al. 1998 ) . Phospholipid fatty acids are

potentially useful signature molecules due to their presence in all living cells. In

microorganisms, phospholipids are found exclusively in cell membranes and not in

other parts of the cell as storage products (Mathew et al. 2012 ) . Our knowledge of

such signature molecules comes from the use of fatty acid analysis for bacterial

taxonomy, in which speci ﬁ c fatty acid methyl esters (FAMEs) have been used as an

accepted taxonomic discriminator for species identi ﬁ cation. Furthermore, phos-

pholipid fatty acids are easily extracted from microbial cells in soil (Zelles and Bai

1993 ) allowing access to a greater proportion of the microbial community resident

in soil than would otherwise be accessed during culture-dependent methods of

analysis. The presence and abundance of these signature fatty acids in soil reveals

the presence and abundance of particular organisms or groups of organisms in

which those signatures can be found.

Phospholipid fatty acids have been widely used to characterize environmental

microbial communities, generating community pro ﬁ les that can distinguish phyloge-

netic or functional microbial groups within the community (Guckert et al. 1985 ) .

PLFAs have the potential to serve as biomarkers for changes in community composi-

tion following perturbation due to the rapid decomposition of PLFAs following cell

death. However, because neither speci ﬁ c PLFA molecules nor categories of PLFAs

have been consistently assigned to particular ecological categories, it can be dif ﬁ cult

to precisely ascribe PLFA biomarkers to community responses (Zelles 1997 ) , thus

2 Recent Development in the Methods of Studying Microbial Diversity

motivating biochemical research to resolve this (Zelles 1997 ) . Examples of these

correlations with varied ecological categories include: cy19:0 is indicative of a con-

dition, microbial stress (Li et al. 2007 ) ; branched fatty acids are associated with a

physiological trait, Gram positive microorganisms (Haubert et al.

2006 ) , a physio-

logical requirement, anaerobes (Nakamura et al. 2003 ) , and a functional capability,

metal reducers (P ﬁ ffner et al. 2006 ; Schryver et al. 2006 ) ; and under speci ﬁ c growth

conditions, branched odd-chain fatty acids may indicate narrower taxonomic groups

of microorganisms, Desulfococcus or Desulfosarcina (Webster et al. 2006 ) . Using a

PLFA pro ﬁ le to describe the microbial community is also a daunting task, given that

many PLFA biomarkers are poorly validated or may be valid only under particular

conditions (Robertson et al. 2011 ) .

The conventional analysis of phospholipid fatty acids involves lipid extraction

and consecutive chromatographic separation of phospholipids from other lipid frac-

tions, which is time-consuming and costly. In recent years, different investigators

have tried to overcome these limitations by using other biological markers or by

modifying the analytical procedures used to assess n-3 fatty acid status (Klingler

and Koletzko 2012 ) .

Despite the usefulness of this method, there are some important limitations (Haack

et al. 1994 ) . First, appropriate signature molecules are not known for all organisms

in a soil sample and, in a number of cases, a speci ﬁ c fatty acid present in a soil

sample cannot be linked with a speci ﬁ c microorganism or group of microorganisms.

In general, the method cannot be used to characterize microorganisms to species

level. Second, since the method relies heavily on signature fatty acids to determine

gross community structure, any variation in these signatures would give rise to false

community estimates created by artifacts in the methods. Third, bacteria and fungi

produce widely different amounts of PLFA and the types of fatty acids vary with

growth conditions and environmental stresses. Although signature PLFAs can be

correlated with the presence of some groups of organisms, they may not necessarily

be unique to only those groups under all conditions. Consequently, this could give

rise to false community signatures (Frostegard et al. 2010 ) .

3.2 Nucleic Acid Techniques

Of all the cell component molecules tested to date, nucleic acids have been the

most useful in providing a new understanding of the structure of microbial com-

munities. For example, in studies of soil microbial diversity, Torsvik and colleagues

(Torsvik et al. 1996 ; Ovreas and Torsvik 1998 ) compared the re-association kinet-

ics of DNA isolated from soil with that of pure cultures of microorganisms. They

reasoned that the greater the sequence diversity of the DNA (and hence the micro-

bial diversity), the greater the DNA reannealing time. The greatest advantage of the

analysis of SSU rDNA is that microorganisms from natural habitats can be studied

and characterized without culturing. Various studies have shown that rDNA from

over 90% of the microorganisms that can be observed microscopically in situ can

M.I. Ansari and A. Malik

be extracted and analyzed (Porteous et al. 1997 ) as compared with less than 0.1%

of the microorganisms observed in soil that can be recovered on culture media.

Numerous studies have applied these techniques to the study of soil microbial

communities (Borneman and Triplett

1997 ; Grosskopf et al. 1998 ) .

All DNA extraction techniques are based on methods developed over the past

20 years. Once the microbial community rDNA is ampli ﬁ ed from soil samples using

PCR, individual amplicons must be separated prior to sequence analysis. Methods

used most commonly for the separation of individual amplicons have been standard

cloning procedures using a variety of Escherichia coli vectors. Recently, as a com-

plement to cloning procedures, the use of denaturing gradient and temperature gra-

dient gel electrophoresis (DGGE/TGGE) for separating individual amplicons has

been described (Heuer et al.

1997 ; Muyzer and Smalla 1998 ) . This technique allows

one to separate mixtures of PCR products that are of the same length but differ only

in sequence. The separation power of this technique rests with the melting behavior

of the double stranded DNA molecule. As DNA molecules are electrophoresed in

an increasing gradient of denaturant or in an increasing temperature gradient, they

remain double-stranded until they reach the denaturant concentration or tempera-

ture that melts the double-stranded molecule. As the DNA melts, it branches, thus

reducing the mobility in the gel. Since the melting behavior is largely dictated by

the nucleotide sequence, the separation will resolve individual bands, each corre-

sponding to a unique sequence. A number of different technologies are available for

nucleic acid based systematics and identi ﬁ cation. These methods can be assigned to

two major groups: direct approaches determining or targeting sequence stretches

and indirect procedures providing differentiating information without exact knowl-

edge of the respective primary structure regions or the sequence (Ludwig 2007 ) .

A selection of methods by which nucleic acid inherited information is visualised

without primary structure sequencing is described in the following section. Two

major groups can be de ﬁ ned. The ﬁ rst group comprises methods for measurement

of nucleic acid composition and similarity, the second concerns pattern techniques.

3.2.1 Nucleic Acid Composition and Similarity

Guanine Plus Cytosine (G + C) Content

Difference in the guanine plus cytosine (G + C) content of DNA can be used to study

soil microbial diversity. This procedure is based on the knowledge that microorgan-

isms differ in their G + C content and that taxonomically related groups only differ

between 3 and 5% (Tiedje et al. 1999 ; McCutcheon et al. 2009 ) . This method pro-

vides a coarse level of resolution as different taxonomic groups may share the same

mol percentage range of G + C. Determination and comparison of genomic DNA

G + C content were among the ﬁ rst approaches for characterisation of genomes. The

molar G + C composition of the respective genomic DNA is still an intrinsic param-

eter of the minimum description of taxonomic units. Determination of the transition

temperature of double stranded to single stranded DNA or the buoyant density of

2 Recent Development in the Methods of Studying Microbial Diversity

DNA in a density gradient is one of the most commonly applied methods (Tamaoka

1994 ) . The melting curves provide microbial community pro ﬁ les indicative of the

overall genetic diversity. Even if this analysis is considered to be low resolution, it

can be used to indicate overall changes in microbial community structure, espe-

cially when the diversity is low. An advantage of this approach is that no PCR is

used with all DNA extractions, quanti ﬁ cation, or detecting rare members in the

microbial populations. Thus, some of the less dominant microorganisms in the com-

munity that PCR might not detect without fractionation can be detected and ana-

lyzed. However, it requires large quantities of DNA (Tiedje et al.

1999 ; Medlin and

Kooistra 2010 ) .

The G + C approach does not provide any phylogenetic information nor allows to

assign an organism to a certain taxon, it rather shows discriminating capacity.

Different G + C contents indicate different organisms, whereas identical values per

se do not necessarily characterise closely related taxa. The base composition of

DNA expressed in mol% G + C widely varies among the prokaryotes ranging from

24 to 76 mol% (Tamaoka 1994 ; Ludwig 2007 ) .

Quantitative Nucleic Acid Hybridization

DNA reassociation methods roughly allow estimating genomic similarity of pairs

of strains or closely related species. The underlying principle quanti ﬁ es the reas-

sociation of complementary regions or stretches of single stranded DNA of heter-

ologous origin. A variety of alternative techniques and formats has been developed

measuring the amount of heterologous hybrids (end point measurement) (Grimont

et al. 1980 ) , the kinetics of heterologous hybridization (Huss et al. 1983 ) , or the

stability of heterologous hybrids (De Ley et al. 1973 ) . Initially rather laborious

techniques requiring large amounts of puri ﬁ ed DNA have been miniaturised.

Nowadays micro plate formats are mainly in use for endpoint (Ziemke et al. 1998 ;

Christensen et al. 2000 ) and stability measurement (Mehlen et al. 2004 ) . In both

cases target DNA is immobilised in the cavities and labelled driver DNA is added

for hybridisation. After removing not bound driver DNA the retained label is mea-

sured or the melting behaviour of the hybrids is followed applying temperature or

denaturing buffer gradients for end point or stability measurement, respectively.

The differences in binding capacity or melting temperature ( Δ Tm) of homologous

and heterologous settings allow estimating overall similarity. The amount of

puri ﬁ ed DNA needed for the measurements can be reduced by linker mediated

PCR ampli ﬁ cation of driver and target DNA (Mehlen et al. 2004 ) . Large amounts

of highly puri ﬁ ed DNA are needed applying optical methods for comparative mon-

itoring of the kinetics of hybrid formation (Huss et al. 1983 ) . Therefore, the latter

methods currently are not in common use. Nucleic acid-based techniques have a

higher sensitivity, therefore requiring a higher level of quality control to prevent

contamination, increasing the importance of effective sample preparation as a criti-

cal step for successful detection. Consideration of contamination, inhibitors in the

specimen sample, and DNA degradation due to unfavorable conditions must be

M.I. Ansari and A. Malik

accounted for in the sensor design to help reduce the incidence of fal e positive or

false negative results (Liu et al. 2009 ) .

Estimating DNA similarity by quantitative hybridization, one has to be aware

that only the minor part of the genome contributes to the measured values. The real

sequence complementarity of the involved genomes has to be at least 80–85% to

allow formation of heterologous hybrids (Lengler et al.

2009 ) . There are some gen-

eral drawbacks of quantitative DNA–DNA hybridization methods. Differences in

genome size and DNA concentration heavily in ﬂ uence the obtained results except

in the case of hybrid stability determination. Furthermore, the results depend on the

experimental parameters and are not cumulative. Different experiments cannot

directly be compared. The respective references (type strains) have to be included in

every individual experiment. Reciprocal arrangements may produce similarity val-

ues differing by up to 10%. In addition, plasmid and chromosomal as well as core

genome and foreign DNA (acquired by horizontal gene transfer) are not discrimi-

nated. Despite all these drawbacks, quantitative DNA hybridization is the only gen-

erally applicable method to estimate relationships at lower taxonomic levels where

conserved phylogenetic markers fail. The current prokaryotic species concept is still

based on the 70% (measured) similarity or 5° Δ Tm criterion (Stackebrandt et al.

2002 ) . Quantitative DNA–DNA hybridization data are still essential components of

species description. Consequently, DNA reassociation techniques were also fre-

quently used for strain assignment and species description of acetic acid bacteria

(Yukphan et al. 2004 ; Tanasupawat et al. 2004 ; Dellaglio et al. 2005 ; Ishida et al.

2005 ; Muthukumarasamy et al. 2005 ; Lisdiyanti et al. 2006 ; Silva et al. 2006 ) .

3.2.2 Pattern Techniques

A number of approaches generating and visualising DNA fragments are available

for DNA based differentiation. In general, two groups of procedures can be distin-

guished: site speci ﬁ c fragmentation and primer directed PCR (polymerase chain

reaction) ampli ﬁ cation of puri ﬁ ed DNA.

Restriction Fragment Length Polymorphism (RFLP)

RFLP is a culture-independent technique for assessing microbial community diver-

sity using agarose gel electrophoresis. To obtain useful results, one must ensure

digestion completeness and the reproducibility of the RFLP banding pattern. In

general, PCR-ampli ﬁ ed rDNA is digested with speci ﬁ c restriction enzyme. Different

lengths are detected using agarose or non-denaturing polyacrylamide gel electro-

phoresis (PAGE) in the case of community analysis (Tiedje et al. 1999 ) . Digestion

of puri ﬁ ed genomic DNA using appropriate (mixtures of) restriction endonucleases

followed by pulsed ﬁ eld or conventional gel electrophoretic separation of the gener-

ated fragments results in usually rather complex patterns after visualisation by DNA

staining. Comparative analysis of these patterns by staining followed by software

2 Recent Development in the Methods of Studying Microbial Diversity

assisted interpretation of the resulting pro ﬁ les can be used for differentiation of even

closely related strains. The power of the method rather concerns differentiation than

identi ﬁ cation of closely related strains. Different patterns represent different organ-

isms, however, identical patterns do not necessarily indicate the same strain. Nucleic

acid fragments sharing the same size might substantially differ with respect to their

primary structures (Gonzalez et al.

2005 ) .

Ribotyping

The complexity of RFLP patterns can be substantially reduced by localising certain

genes performing Southern hybridization of the fragments. If hybridization probes

targeting rDNA are used, the procedure is known as ribotyping (Regnault et al. 1997 ) .

Given the ubiquitous occurrence of highly conserved rDNA targets, a set of a few gen-

eral probes allows to study diverse organisms. The great importance of the approach in

the past nowadays has been overcome by modern rapid rDNA sequencing techniques.

Random Ampli ﬁ ed Polymorphic DNA (RAPD)

Randomly ampli ﬁ ed polymorphic DNA polymerase chain reaction (RAPD-PCR) is

a simple and rapid method for identi ﬁ cation of useful genetic markers and determi-

nation of organismal genetic diversity at various taxonomic levels (Liu et al. 2006 ) .

With this technique, PCR is performed with random primers; the ampli ﬁ ed products

are analyzed with electrophoresis, the gels are stained with ethidum bromide; and

the gel images are analyzed with imaging systems. Speci ﬁ c DNA fragment patterns

can be generated by PCR using single primer pairs or mixtures of primers targeting

multiple sites on the genome. The primary structure of such primers can be designed

randomly or target speci ﬁ c. Binding to multiple targets of partial sequence comple-

mentarity on the genome is achieved by primer annealing at relaxed hybridization

conditions during initial PCR cycles. The resulting random fragments provide the

templates in subsequent PCR cycles following primer annealing at stringent hybridi-

sation conditions. Then RAPD bands are scored as binary presence or absence char-

acters, to assemble a matrix of RAPD phenotypes. The percentage of polymorphic

bands is utilized to measure genetic diversity. Compared with other molecular mark-

ers, advantages of this method are that it is simpler, fast, and genomic abundance.

Nevertheless, the short primers result in low repetition. High standardisation of the

experimental parameters and equipment is needed to ensure reproducibility of the

fragment patterns (Gonzalez et al.

2005 ; Ludwig 2007 ) .

Ampli ﬁ ed Fragment-Length Polymorphism (AFLP)

The AFLP (ampli ﬁ ed fragment-length polymorphism) procedure (Vos et al.

1995 )

combines DNA restriction and PCR ampli ﬁ cation. AFLPs are PCR-based markers

M.I. Ansari and A. Malik

for the rapid screening of genetic diversity. The restriction fragments are ligated to

linkers providing targets for PCR primers. These primers contain additional selec-

tive bases at their 3 ends reducing the number of perfectly matched targets in the

mixture of linker tailed restriction fragments. Thus, only a subset of the genomic

restriction fragments is ampli ﬁ ed by PCR. The complexity of the resulting patterns

is substantially reduced in comparison with RFLP and RAPD approaches. The key

feature of AFLP-PCR is its capacity for simultaneous screening of many different

DNA regions distributed randomly throughout the genome. In essence, AFLP meth-

ods allow PCR ampli ﬁ cation to detect polymorphisms of genomic restriction frag-

ments. AFLP markers have proven useful for assessing genetic differences among

individuals, populations, and independently evolving lineages, such as species (Vos

et al.

1995 ) . The main disadvantage of AFLP-PCR is the dif ﬁ culty in identifying

homologous markers (alleles), rendering this method less useful for studies that

require precise assignment of allelic states, such as heterozygosity analysis.

However, because of the rapidity and ease with which reliable, high-resolution

marks can be generated, AFLPs are emerging as a powerful addition to the molecu-

lar toolkit of ecologists and evolutionary biologists (Mueller and Wolfenbarger

1999 ) .

Automated Ribosomal Intergenic Spacer Analysis (ARISA) and Ribosomal

Intergenic Spacer Analysis (RISA)

Automated ribosomal intergenic spacer analysis (ARISA), a commonly used DNA-

based community ﬁ ngerprinting method (Ovreas 2000 ) , is a high-resolution, highly

reproducible technique for detecting differences among complex fungal communi-

ties (Ranjard et al. 2001 ) . RISA is based on the length polymorphism of the ribo-

somal intergenic spacer region between the 16S and 23srRNA genes (Borneman

and Triplett 1997 ) . The non-coding ribosomal internal spacer region is variable in

both size and nucleotide sequence even within closely related strains and the method

has been successfully used to characterize, classify, and type strains, as well as to

ﬁ ngerprint simple communities and mixed populations (Ranjard et al. 2000 ) .

Ribosomal intergenic spacer analysis (RISA) exploits variability in the length of the

internal transcribed spacer regions of rRNA genes to sort samples rapidly into oper-

ational taxonomic units (OTUs). Members of different species may share the same

ITS fragment size (Ranjard et al. 2001 ) . Although ARISA assays a different taxo-

nomic resolution than species level, it is a consistent measure of community com-

position. Consequently, differences between two OTU assemblages directly re ﬂ ect

changes in species composition (Green et al. 2004 ) .

Single-Strand Conformational Polymorphism (SSCP)

SSCP, based on separation of PCR-ampli ﬁ ed rRNA and rDNA molecules, has been

used successfully to analyze the structure and dynamics of microbial communities

2 Recent Development in the Methods of Studying Microbial Diversity

(Schwieger and Tebbe 1998 ) . The method is based on the differential intra-molecu-

lar folding of single-stranded DNA that is itself dependent upon DNA sequence

variations. Thus, DNA secondary structure alters the electrophoresis mobility of the

single-stranded PCR ampli ﬁ cations enabling them to be resolved. SSCP has been

used to differentiate between pure cultures of soil microorganisms and to distin-

guish community ﬁ ngerprints of uncultivated rhizospheric microbial communities

from different plants (Schwieger and Tebbe

1998 ) . SSCP analysis should, in prin-

ciple, be easier to carry out than DGGE or TGGE, as no primers with GC-clamp or

speci ﬁ c apparatus for gradient gels are required.

A limitation of the method, in addition to potential PCR bias, however, is that a

single bacterial species may yield several bands due to the presence of several oper-

ons or more than one conformation of the single-stranded PCR ampli ﬁ cations.

Another approach to identify community members is to apply speci ﬁ c enrichments

to enhance the growth of the microorganism of interest. This strategy is particularly

useful in studies of functional groups or guilds (Lynch et al. 2004 ) .

Ampli ﬁ ed DNA Restriction Analysis (ADRA)

The combined application of site speci ﬁ c PCR ampli ﬁ cation and restriction frag-

ment polymorphism analysis usually provides pro ﬁ les of low complexity. In

principle, the approach can be used for comparative analysis of any region of

genomic DNA carrying primer targets common to the desired target organisms

and appropriate for PCR ampli ﬁ cation. Whereas the former two techniques do

only provide anonymous patterns, the assignment of the resulting fragments to

given homologous genome regions is provided by the site speci ﬁ city of the PCR

ampli ﬁ cation. Ampli ﬁ ed rDNA restriction analysis (ARDRA) represents the

most commonly used special format of the methodology. The conserved charac-

ter of rDNA facilitates the design of general ampli ﬁ cation primers, however, lim-

its pattern variety. Consequently, the discriminatory power is limited. In many

cases, ADRA targeting the intergenic spacers of rRNA genes (ITS) allows dif-

ferentiation of closely related strains. This approach currently is popular for

strain differentiation of acetic acid bacteria (Tanasupawat et al. 2004 ; Yukphan

et al. 2004, 2006 ; Kretova and Grones 2005 ; Malimas et al. 2006 ) . Nevertheless,

ARDRA patterns are often overvalued and misinterpreted with respect to their

relevance for phylogeny inference. Although the presence or absence of a restric-

tion site may represent a valuable diagnostic feature, a potential phylogenetic

relevance cannot be postulated without assignment of the respective organism to

a given phylogenetic group. The latter, however, requires either knowledge of at

least neighboured sequence stretches or other appropriate data for phylogenetic

assignment. Thus, ARDRA patterns per se only provide differentiating informa-

tion. Anyway, the former importance of the technique has been overcome by the

modern methods of rapid sequencing rDNA and ITS DNA providing much more

information for identi ﬁ cation and phylogeny inference.

M.I. Ansari and A. Malik

Denaturing Gradient Gel Electrophoresis (DGGE) and Temperature Gradient Gel

Electrophoresis (TGGE)

DGGE and TGGE are two similar methods for studying microbial diversity. Theoretically,

DGGE can separate DNA with one base-pair difference (Miller et al.

1999 ) . TGGE uses

the same principle as DGGE except the gradient is temperature rather than chemical

denaturants. These techniques were originally developed to detect point mutations in

DNA sequences. Advantages of DGGE and TGGE include being reliable, reproducible,

rapid, and somewhat inexpensive; providing concurrent analysis of multiple samples;

and having the ability to follow changes in microbial populations (Muyzer

1999 ) .

DGGE is used to detect polymorphisms of DNA fragments not correlated with

fragment size. Small restriction or PCR generated fragments are separated by gel

electrophoresis while passing a low to high denaturant or temperature gradient.

Fragments differing in sequence composition may exhibit different melting behav-

iour when progressing into higher denaturing conditions. This can be monitored by

mobility shifts. Although this technique is of greater interest in microbial ecology

– as a rapid method for estimating complexity – it has been also successfully applied

for the identi ﬁ cation of pure cultures. In both cases most frequently an appropriate

part of usually PCR ampli ﬁ ed rDNA is subjected to denaturing electrophoresis

(Lopez et al. 2003 ; DeVero et al. 2006 ; Ludwig 2007 ) .

3.3 Phylogenetic Analysis

The success of any of the preceding methods for community characterization relies on

a suitable phylogenetic analysis because many of the organisms that are likely to be

described from soil communities have not been studied previously. A number of phy-

logenetic methods have been utilized in studies of microbial ecology (Woese 1987 ) .

While rDNA and rRNA are commonly used as characters in phylogenetic analysis,

the list of characters is extensive and can range from molecular to morphological traits

(Olsen and Woese 1993 ) . For microorganisms, molecular data often provide the great-

est wealth of information because microorganisms such as bacteria simply do not

have the large morphological diversity to make morphological characteristics useful

in establishing phylogenies. Aside from the derivation of taxonomies, phylogenetic

analyses are important in identifying similarities between organisms, leading to the

ability to understand the physiology and ecology of as yet non-culturable species.

Unfortunately for taxonomists, phylogenetic analyses have at least one major draw-

back. The fact that an analysis based on a single type of molecule results in a close

relationship between taxa. However the analysis on the same taxa with another equally

suitable molecule does not necessarily support the result (Olsen and Woese 1993 ) .

When based on a limited set of taxonomic criteria, it is dif ﬁ cult to say with certainty

whether or not those criteria can resolve an unknown microorganism from other

known microorganisms. Therefore, microbial phylogenies should be interpreted with

caution when used in soil microbial community analyses.

2 Recent Development in the Methods of Studying Microbial Diversity

3.4 Nucleic Acid Hybridization and Fluorescent In Situ

Hybridization (FISH)

Nucleic acid hybridization using speci ﬁ c probes is an important qualitative tool in

molecular bacterial ecology (Theron and Cloete 2000 ) . These hybridization tech-

niques can be performed on extracted DNA and RNA, or in situ hybridization can

be conducted at the cellular level. The FISH method has also been used successfully

to study the spatial distribution of bacteria in bio ﬁ lms (Thurnheer et al. 2004 ) .

However, with respect to sensitivity, some limitations to the standard FISH method

that prevents detection of cells with low ribosome content have been noted. Low

physiological activity was often correlated with low ribosome content per cell,

therefore slow-growing or starving cells may not be detected (Amann et al. 1995 ) .

To overcome this limitation, FISH has adopted a tyramime signal ampli ﬁ cation

technique, which allows the analysis of slow-growing microorganisms (Pernthaler

et al. 2002 ) . Also, a disadvantage of nucleic acid hybridization or FISH in particular

is the lack of sensitivity unless sequences are present in high copy number (Pernthaler

et al. 2002 ) .

Fluorescent in situ hybridization (FISH) has been used primarily with prokary-

otic communities and allows the direct identi ﬁ cation and quanti ﬁ cation of speci ﬁ c

and/or general taxonomic groups of microorganisms within their natural microhabitat

(Amann et al. 1995 ; Kenzaka et al. 1998 ) . In FISH, whole cells are ﬁ xed, their 16S

or 23S rRNA is hybridized with ﬂ uorescently-labeled taxon-speci ﬁ c oligonucle-

otide probes, and then the labeled cells are viewed by scanning confocal laser

microscopy (SCLM). Because whole cells are hybridized, artifacts arising from

biases in DNA extraction, PCR ampli ﬁ cation, and cloning are avoided (Ludwig

et al. 1997 ; Felske et al. 1998 ) . FISH has two advantages over immuno ﬂ uorescence

techniques. First, FISH can detect microorganisms across all phylogenetic levels,

whereas immuno ﬂ uorescence techniques are limited to the species and sub-species

levels. Second, FISH is more sensitive than immuno ﬂ uorescence because non-

speci ﬁ c binding to soil particles does not typically occur (Amann et al. 1995 ) . FISH

probes can be generated without prior isolation of the microorganism, whereas pure

cultures are needed in immuno ﬂ uorescence studies for generating speci ﬁ c antibod-

ies (Hahn et al. 1992 ) . Scanning confocal laser microscopy (SCLM) surpasses

epi ﬂ uorescence microscopy in sensitivity and has the ability to view the distribution

of several taxonomic groups simultaneously as a three-dimensional image (Assmus

et al. 1995 ; Kirchhof et al. 1997 ) . Use of distinctive ﬂ uorescent dyes and corre-

sponding ﬁ lter sets allows the observer to differentiate ﬂ uorescing microbes from

auto ﬂ uorescent soil particles and plant debris (Assmus et al. 1995 ; MacNaughton

et al. 1996 ) . FISH provides a more accurate quanti ﬁ cation of cells as compared to

the rough estimates obtained from dot blot assays (Amann et al. 1995 ) in which

microbial DNA is blotted onto a membrane than ﬂ uorescent oligonucleotide probe

is visualized.

The sensitivity of FISH has been greatly improved to afford the detection of

single cells within complex environments such as rhizosphere and bulk soils

M.I. Ansari and A. Malik

(MacNaughton et al. 1996 ; Zarda et al. 1997 ; Felske et al. 1998 ) . Strongly ﬂ uorescing

dyes can be used or multiple probes can be designed to target different regions of

the same 16S or 23S rRNA molecule, thus increasing the strength of the signal

(Amann et al.

1995 ; Ludwig et al. 1997 ) . Probes for kingdoms (Eubacteria, Archaea,

Eucarya), families, genera, species, or sub-species can be differentially labeled and

used in combination to view the occurrence and distribution of several taxo-

nomic groups simultaneously within a single soil sample (Amann et al.

1995 ; Zarda

et al. 1997 ) .

To be detected, soil microbes must be metabolically active and possess cell walls

suf ﬁ ciently permeable to allow penetration of the probe (Christensen and Poulsen

1994 ; Amann et al. 1995 ) . Penetration of cells with such probes is a problem in

nutrient-poor soils and in soils where microorganisms are dormant or quiescent

(Hahn et al. 1992 ; Fischer et al. 1995 ) because cells are generally smaller and cell

walls relatively thicker under these conditions. However, progress is being made to

overcome these problems with groups such as actinobacteria and Bacillus spores

(Fischer et al. 1995 ) . To address the problem of low metabolic activity in soil, some

researchers have added nutrients to stimulate microbial activity (Hahn et al. 1992 ) .

However, so as not to bias the community pro ﬁ le, the amendments should equally

stimulate all members of the community. FISH can be used to visualize soil micro-

organisms that have not yet been cultured, and is useful in studying the ecological

distribution of microorganisms throughout diverse habitats (Ludwig et al. 1997 ;

Zarda et al. 1997 ; van Wullings et al. 1998 ) . When using FISH to examine all mem-

bers within a given taxon, one must keep in mind that the probe being used is only

as good as the representative members that were used to generate it (Amann et al.

1995 ) . Other, non-cultured organisms may not be detected with this probe or cross-

hybridization to related organisms may occur (Hahn et al. 1992 ; MacNaughton

et al. 1996 ; Felske et al. 1998 ) .

FISH can be combined with cultivation techniques, immuno ﬂ uorescence, nucle-

otide probes targeting structural genes or mRNAs, reporter genes, microsensors, or

ﬂ ow cytometry to gain information regarding the structure and function of micro-

organisms within a complex microbial community (Amann and Kuhl 1998 ) . FISH

is a powerful tool that can be used not only for studying individuals within a popu-

lation, but also has potential uses for studying population dynamics, tracking

microorganisms released into the environment (e.g. for biological control or biore-

mediation), epidemiology, and microbial ecology of economically important plant

pathogens in agricultural soils (Hahn et al. 1992 ; Kirchhof et al. 1997 ; van Wullings

et al. 1998 ) .

4 Single-Cell Analysis Methods

Isolating and analyzing individual microbial cells from the total population have

enabled us to explore the taxonomy, physiology, and activity of microbes at the

single-cell level (Brehm-Stecher and Johnson 2004 ; Zengler 2009 ) . Single cell

2 Recent Development in the Methods of Studying Microbial Diversity

isolation techniques are the methods to physically separate individual cells from

each other and/or from matrix materials (e.g., soil particles) (Zengler 2009 ) .

Single-cell isolation techniques can be used for three major purposes in microbi-

ology and biotechnology: (1) to cultivate previously uncultured microbes; (2) to

assess and monitor cell physiology and function; and (3) to screen for novel micro-

biological products such as enzymes and antibiotics. Modern molecular approaches,

which are based primarily on ribosomal RNA gene sequences, have revealed the

enormous diversity of the microbial world present in soil, water, and other natural

and arti ﬁ cial environments (Keller and Zengler

2004 ; Christen 2008 ) . However, a

majority of microbes are still dif ﬁ cult to cultivate. Several approaches have been

applied to culture these previously uncultivated microbes, including media

re ﬁ nements, speci ﬁ c enrichment of target microorganisms, cultivation under simu-

lated natural conditions or low nutrient conditions, in situ cultivation, use of syn-

trophic interactions, and use of single-cell isolation techniques (Alain and Querellou

2009 ; Kikuchi 2009 ; Yamada and Sekiguchi 2009 ; Zengler 2009 ; Ishii et al. 2010 ) .

Single-cell isolation techniques produce an environment without resource competi-

tion, thereby allowing microbes, especially those that grow very slowly, to multiply

without the interference of fast-growing organisms.

4.1 Dilution-to-Extinction Method

Probably the simplest method to obtain single cells from heterogeneous populations

is to serially dilute a sample solution until only single cells remain (Button et al.

1993 ) . Growth is measured after incubating the diluted cultures. This approach is

similar to the most probable number technique in which populations of microbes

are measured by serially diluting a culture until they become extinct (Haas 1989 ) .

By using dilution-to-extinction culturing, single cells of the most abundant microbes,

rather than those of the most nutrient-tolerant and fast-growing organisms, can be

obtained (Button et al. 1993 ) . In addition, the use of microtiter plates allows rela-

tively high-throughput screening of dilution-to-extinction cultures (Connon and

Giovannoni 2002 ) .

4.2 Micromanipulation

A more technical approach to obtain single cells is to use a micromanipulator. There

are two types of micromanipulation: mechanical and optical micromanipulation

(Brehm-Stecher and Johnson 2004 ) . In mechanical micromanipulation, single cells

are individually captured from a heterogeneous population using microcapillary tubes

and transferred to a culture medium or other reaction solution (Fröhlich and König

2000 ) . The isolated single cells can be subsequently used for cultivation (Fröhlich and

König 2000 ; Ishoey et al. 2008 ; Ashida et al. 2010 ) or culture-independent analysis

M.I. Ansari and A. Malik

(Kvist et al. 2007 ) . Various microorganisms, including potentially novel strains, have

been isolated from termite guts (Fröhlich and König 2000 ) , hot spring samples (Ishoey

et al. 2008 ) , and wetland rice soils (Ashida et al. 2010 ) by using mechanical microma-

nipulators. In addition, endosymbiotic protozoans have also been isolated from the

termite gut (Hongoh et al.

2008 ; Sato et al. 2009 ; Ishii et al. 2010 ) .

4.3 Flow Cytometry and Cell Sorting

Flow cytometry (FCM) is an approach to quantitatively analyze multiple character-

istics of millions of single cells and other particulate matter from a heterogeneous

population (Brehm-Stecher and Johnson 2004 ) . The cell sample is mixed with a

carrier ﬂ uid called sheath ﬂ uid, which is forced through an ori ﬁ ce to generate a

stream. By controlling the pressure of the system and ori ﬁ ce size, a laminar ﬂ ow

regime is established. This hydrodynamic focusing allows only single cells to pass

through an illumination zone where forward and side light scatter, and several

ﬂ uorescence parameters can be measured (Link et al. 2007 ; Czechowska et al.

2008 ) . An important extension of FCM for microbiological and biotechnological

studies is cell sorting (Link et al. 2007 ) . The technique of sorting ﬂ uorescent-labeled

cells, which is most frequently used in combination with FCM, is called ﬂ uorescence-

activated cell sorting (FACS) (Czechowska et al. 2008 ) . Droplet de ﬂ ection is used

for high-throughput cell sorting. In this technique, drops, each containing only a

single cell, are formed by intense vibration of the stream. A droplet containing a cell

of interest is charged and de ﬂ ected into a collection tube or microtiter plate. Cells

are sorted as a population when collected in a tube; whereas single cells can be

obtained when cells are collected in a microtiter plate. The FCM and FACS systems

can perform high-throughput single-cell analysis and sorting with a rate of >10

cells/s. Isolated or sorted cells can be used for subsequent culture-based (Kalyuzhnaya

et al. 2008 ; Wang et al. 2009 ) or culture-independent analyses (Kalyuzhnaya et al.

2008 ; Fujii and Hiraishi 2009 ) . Wang et al. ( 2009 ) sorted low nucleic acid contents

(LNA) bacteria (as a population) by FACS with SYBR green-stained freshwater

samples. They applied the dilution-to-extinction culturing method to the sorted

populations and obtained a pure culture of LNA bacteria closely related to the

Polynucleobacter cluster (Wang et al. 2009 ; Ishii et al. 2010 ) .

4.4 Micro ﬂ uidics

Several micro ﬂ uidic devices have been developed to isolate single cells and to sort

cells of interest. Microfabricated FACS ( μ FACS) offers sorting of various particles

including E. coli cells (Fu et al. 1999 ) . In μ FACS, sorting is performed by changing

the ﬂ ow direction after detection of cells of interest (Fu et al. 1999 ) . Hu et al. ( 2005 )

developed a micro ﬂ uidic cell sorter using dielectrophoresis to separate target cells

2 Recent Development in the Methods of Studying Microbial Diversity

from the background population. In a dielectrophoresis-activated cell sorter (DACS),

target cells are labeled with antibody that is subsequently bound to polystyrene

beads. The bead-labeled cells are repelled from the electrodes and collected as they

ﬂ ow. This system offers high-throughput screening of cells with a rate of >10

cells/s

(Hu et al. 2005 ; Bessette et al. 2007 ) . High-throughput and sensitive detection make

it possible to detect a rare event (Hu et al.

2005 ) . A similar device was also devel-

oped and applied to separate airborne microbes and dust particles (Moon et al.

2009 ) . When magnetic beads, instead of polystyrene beads, are bound to cells, mag-

netic ﬁ elds can be used to de ﬂ ect and sort labeled cells (magnetic-activated cell

sorting; MACS) (Adams et al. 2008 ) . A label-free, micro ﬂ uidic device was recently

used to manipulate and sort cells (Kose et al. 2009 ) . This device utilizes a carrier

ﬂ uid containing magnetic nanoparticles (ferro ﬂ uid). When an external magnetic

ﬁ eld is produced by the electric current, magnetic nanoparticles are attracted toward

the electrode. As a result, non-magnetic particles (e.g., cells) are pushed away from

the electrode and collected in a speci ﬁ c location. The critical current frequency

causing movement of nonmagnetic particles depends on the particle size, thereby

allowing size-dependent cell sorting (Kose et al. 2009 ) .

In addition to cell sorting, micro ﬂ uidic devices also offer powerful single-

cell-based analysis. Ottesen et al. ( 2006 ) performed multigene PCR on single cells

separated and partitioned by a micro ﬂ uidic digital PCR system. Sequence analysis

of the PCR amplicons retrieved from each chamber allowed the linking of phylogeny

to the function of the previously uncultivated microorganisms. For example, using

this approach, it was discovered that the previously uncultivated Treponema , which

resides inside the guts of wood-feeding termites, harbored key metabolic enzymes

for CO

-reductive homoacetogenesis (Ottesen et al. 2006 ) .

Micro ﬂ uidic devices that allow single-cell isolation and incubation have also

been reported. Yamaguchi et al. ( 2009 ) developed a micro ﬂ uidic device to capture,

incubate, and release single cells by controlling the ﬂ ow rate of the device. Liu et al.

( 2009 ) developed a unique and potentially powerful device that allows single-cell

isolation, incubation, and separation of the clonal population for further analyses

using a plug-based micro ﬂ uidic approach (Boedicker et al. 2008 ) . In this device,

single cells from a mixed population are stochastically isolated into plugs. The

plugs are incubated to grow microcolonies of the isolated single cells, and the clonal

populations are split into subpopulations for further analyses, such as cultivation,

cryopreservation, physiological assays, and culture-independent analyses (Liu et al.

2009 ) .

4.5 Compartmentalization of Single Cells

Single cells can be partitioned into small compartments to physically separate them

from each other. Compartmentalization can be achieved by creating cell-like struc-

tures (Link et al. 2007 ; Bershtein and Taw ﬁ k 2008 ; Bergquist et al. 2009 ) . The com-

partments were initially created to screen the desired gene and protein mutants.

M.I. Ansari and A. Malik

In this technique, single genes, components required for in vitro transcription and

translation, and enzyme substrates were encapsulated in a water-in-oil emulsion. By

testing these compartments, enzymes that catalyze the desired reaction can be

detected. This technique was further improved to encapsulate single E. coli transfor-

mants in a water-in-oil-in-water emulsion so that FCM and FACS can be applied to

screen >10

mutants (Aharoni et al. 2005 ) . Compartmentalization is extremely pow-

erful when the ﬂ uorescent product of an enzymatic reaction is diffusible (Bershtein

and Taw ﬁ k 2008 ; Link et al. 2007 ) . This approach has the potential to be applied to

ﬁ elds beyond directed evolution; for example, to screen for potentially novel

enzymes from metagenome libraries and to isolate unique microbes with a target

function (Ishii et al. 2010 ) .

Cell compartmentalization (or encapsulation) was also used to cultivate yet-

uncultured microbes (Zengler et al. 2002 ; Keller and Zengler 2004 ) . Zengler

et al. ( 2002 ) used gel micro droplets to encapsulate single cells obtained from

environmental samples and incubated them under simulated natural conditions to

form microcolonies. Microcapsules containing the microcolonies were separated

from free-living cells and empty microcapsules, and individually placed in

96-well microtiter plates by FACS for further cultivation. By this approach, novel

and diverse bacteria were isolated (Zengler et al. 2002 ) . Detection of unique

microbial signatures in these microcapsules may facilitate screening for poten-

tially novel microbes (Bergquist et al. 2009 ) .

5 Combined Use with Other Techniques

The single-cell isolation techniques described above become more useful when

combined with other techniques, such as viable staining, direct viable count, anti-

body staining, in situ and in vivo hybridization, and those using auto ﬂ uorescence

protein reporters, depending on the purpose of the study. These techniques provide

information on the taxonomy, function, activity, and viability of microbes at the

single-cell level.

5.1 Viable-Cell Staining

Several ﬂ uorescent stains have been used to detect physiological activities in cells

(e.g., membrane integrity, enzyme activity, and intracellular pH), and thereby

assess cell viability (Joux and Lebaron 2000 ) . Several researchers have combined

these ﬂ uorescent stains with single-cell isolation and cell-sorting techniques. This

combination is especially useful when isolated single cells are subjected to cultiva-

tion, since cultivation is only possible if the isolated cells are alive and able to

multiply (Huber et al. 2000 ) . Ferrari and Gillings ( 2009 ) used the LIVE/DEAD

BacLight kit to stain viable microcolonies formed in the soil-substrate membrane

2 Recent Development in the Methods of Studying Microbial Diversity

system, which was previously shown to promote the growth of yet-uncultivated

soil bacteria (Ferrari et al. 2005 ) . The viable microcolonies were then individually

isolated using a micromanipulator and transferred to a culture medium (Ferrari and

Gillings

2009 ) . This approach allowed them to obtain diverse and novel isolates.

Similarly, Ashida et al. ( 2010 ) individually isolated viable cells stained with

CFDA-AM using a micromanipulator.

Flow cytometry and FACS have also been used to separate viable cells from the

total population. For example, Kalyuzhnaya et al. (

2008 ) used RSG to detect

actively respiring microbial populations in the presence or absence of C1 com-

pounds (e.g., methane). These actively respiring populations were separated from

the total population by FACS and then used as inocula for the enriched growth of

methylotrophs. Similarly, Fujii and Hiraishi ( 2009 ) sorted CTC-positive cells from

composting samples. DGGE of PCR-ampli ﬁ ed 16S rRNA gene fragments showed

that the FACS-sorted population has a different community structure from the total

population. These studies suggest the usefulness of the combination of viable-cell

staining and single-cell isolation and cell-sorting techniques.

5.2 Direct Viable Count

Kogure et al. ( 1979 ) reported a method to count viable and growing cells directly

under a microscope (direct viable count; DVC). In the DVC method, viable cells are

elongated by the addition of a growth-promoting substrate (e.g., yeast extract) and

cell-division inhibitors (e.g., nalidixic acid, cephalexin). After staining, elongated

viable cells can be clearly distinguished from non-elongated cells (Kogure et al.

1979, 1984 ; Joux and Lebaron 1997 ) .

Although the DVC method has been widely used for the quanti ﬁ cation of viable

bacteria, isolation of these viable bacteria was not achieved until recently. Ashida

et al. ( 2010 ) used the mechanical micromanipulator to isolate single cells that were

elongated under denitri ﬁ cation inducing conditions. The elongated cells were indi-

vidually captured and transferred to a medium for growth. Since single cells with a

speci ﬁ c function (e.g., denitri ﬁ cation) can be selectively isolated, Ashida et al.

( 2010 ) termed this method as functional single-cell (FSC) isolation.

5.3 Antibody Staining

Antibodies can recognize speci ﬁ c groups of microbes by binding to antigens, such as

capsular, ﬂ agellar, or cell wall antigens (Brehm-Stecher and Johnson 2004 ) . Antibodies

can be tagged with ﬂ uorophore ( ﬂ uorescent antibody or immuno ﬂ uorescence) so that

antibody-bound cells can be recognized by their ﬂ uorescence. Antibodies can be also

tagged with magnetic beads (immunomagnetic beads) or polystyrene beads, allowing

magnetic (Pernthaler et al. 2008 ) or dielectrophoretic (Hu et al. 2005 ) separation of

M.I. Ansari and A. Malik

the antibody-bound cells. Although the application of antibody-based detection of

microbes is limited because of its cross-reactivity, it can be used for live cells allowing

subsequent culture-based analyses. However, to develop antibodies speci ﬁ c to a group

of microorganisms, we need to have a population (dead or alive) of these microbes.

This requirement may limit the application of antibody-based analysis to study previ-

ously uncultivated microbes.

Fluorescent antibodies have been widely used to speci ﬁ cally detect pathogenic

bacteria, including infectious adenoviruses (Li et al.

2010 ) , Escherichia coli O157

serotype (Pyle et al. 1999 ; Shelton and Karns 2001 ) , and Salmonella (McClelland

and Pinder 1994 ) . When combined with ﬂ ow cytometry, ﬂ uorescent antibodies

provide rapid detection and quanti ﬁ cation of microbes of interest (Veal et al.

2000 ; Li et al. 2010 ) . Antibody-bound cells could also be sorted by FACS fol-

lowed by a culture-based analysis. Antibody-based cell recognition is also often

used in micro ﬂ uidic cell sorting. Cells with ﬂ uorophore-tagged, magnetic bead-

tagged, or polystyrene bead-tagged antibodies were ef ﬁ ciently separated from

background populations by μ FACS (Fu et al. 1999 ) , MACS (Adams et al. 2008 ) ,

or DACS (Hu et al. 2005 ) , respectively.

5.4 In Situ Hybridization and Other Culture-Independent

Analysis

In situ hybridization, especially ﬂ uorescence in situ hybridization (FISH), has been

widely used in combination with single-cell isolation techniques, since FISH can iden-

tify the taxonomy and potential function of microbes at the single-cell level (Amann and

Fuchs 2008 ) . In the FISH technique, ﬂ uorescently labeled nucleic acid probes are

hybridized to the target sequences within whole, permeabilized cells (Brehm-Stecher

and Johnson 2004 ) . Ribosomal RNA is most frequently used as a target for FISH probes

because taxonomic identi ﬁ cation is possible based on rRNA sequences. In addition,

rRNA is abundant in single cells (10

–10

copies); therefore, strong ﬂ uorescent signals

can be achieved by rRNA-based FISH analysis. However, recent methodological

improvements, including catalyzed reporter deposition-FISH (CARD-FISH; Schönhuber

et al. 1997 ) , development of individual genes-FISH (RING-FISH; Zwirglmaier et al.

2004 ) , and use of near-infrared dye (Coleman et al. 2007 ) , enable us to target functional

genes with low abundance (Pratscher et al. 2009 ; Kawakami et al. 2010 ) .

The amount of DNA in sorted or isolated single cells is often too small to perform

subsequent culture-independent analyses. Therefore, multiple displacement

ampli ﬁ cation (MDA) is frequently employed, which can amplify genomic DNA

from single cells using Phi29 DNA polymerase (Lasken

2007 ; Marcy et al. 2007a ) .

Stepanauskas and Sieracki ( 2007 ) sorted marine bacterial cells individually into a

96-well plate by FACS, and ampli ﬁ ed their genome by MDA. PCR analysis was

performed using the MDA product as a template. Since these MDA products origi-

nate from single cells, this approach could match the phylogeny and metabolism of

the uncultivated organism. The combination of FISH, single-cell isolation, and MDA

2 Recent Development in the Methods of Studying Microbial Diversity

also allows us to sequence the whole genome of uncultivated microorganisms.

Hongoh et al. ( 2008 ) successfully sequenced the whole genome of an uncultivated

symbiont of the wood-feeding termite. Similarly, ﬂ ow cytometry (Podar et al. 2007 ;

Rodrigue et al.

2009 ) and micro ﬂ uidic devices (Marcy et al. 2007b ) have been suc-

cessfully used to isolate single cells, including uncultivated TM7 microbes, which

are subsequently used for MDA and genome sequencing. This ﬁ eld of microbiology

is now called “single-cell genomics” (Walker and Parkhill

2008 ) .

Although the FISH process itself kills microbial cells, it can be applied to a sub-

population originating from single cells, while keeping other subpopulations for

subsequent culture-based analyses. This approach was used to verify the identity of

cells obtained by dilution-to-extinction culturing (Rappé et al. 2002 ) and

micro ﬂ uidics (Liu et al. 2009 ) . Since many oligotrophic bacteria do not produce

colonies on agar plates or turbidity in liquid media (Simu and Hagström 2004 ) ,

FISH-based, single-cell identi ﬁ cation is very useful (Ishii et al. 2010 ) .

5.5 In Vivo Hybridization

Silverman and Kool ( 2005 ) performed hybridization using quenched auto ligation

(QUAL) probes targeting alive, un ﬁ xed bacteria. They used a small amount of deter-

gent (0.05% SDS) to soften the bacterial cell wall and introduced the QUAL probes

into living cells, thereby allowing “ in vivo hybridization” (Czechowska et al. 2008 ) .

The ﬂ uorescence signal of the QUAL probes is exposed only after hybridization and

ligation; therefore, washing of unbound probe is not necessary, unlike conventional

FISH analysis. The QUAL probes used in the abovementioned study were speci ﬁ cally

hybridized with 16S rRNA sequences of E. coli , Salmonella , and Pseudomonas , and

the hybridized cells were successfully differentiated using FCM (Silverman and

Kool 2005 ) . However, there is a controversy whether the hybridized cells are alive

or not, since Amann and Fuchs ( 2008 ) reported that the SDS treatment killed the

majority of E. coli cell suspensions. More studies are necessary to establish in vivo

hybridization in microbial cells. In vivo hybridization is also possible with other

quenched probes, such as molecular beacons (Santangelo et al. 2004 ) , thiazole

orange “light-up” probes (Privat et al. 2001 ) , and reduction triggered ﬂ uorescence

probes (Abe et al. 2008 ; Franzini and Kool 2009 ) . In addition, the gene expression

level in live cells can be examined using in vivo hybridization targeting mRNA

(Tyagi 2009 ) . However, most of these studies targeted eukaryotic cells and used

microinjection to introduce probes.

5.6 Auto ﬂ uorescent Proteins

Auto ﬂ uorescent proteins (AFPs), such as green ﬂ uorescent protein (GFP), have

been broadly used to visualize protein expression, localization, and functionality

M.I. Ansari and A. Malik

in vivo (Link et al. 2007 ; Southward and Surette 2002 ) . Although applications of

AFPs are generally limited to microbes that are transformable, they are extremely

useful for studying microbial pathogenesis, biotechnology, and systems biology.

The combination of AFPs and FACS can be used to screen genes of pathogenic

microbes (e.g., Salmonella enterica serovar Typhimurium) that express preferen-

tially in host mammalian cells (Valdivia and Falkow

1997 ) . Their strategy was to

use Salmonella cells transformed with genomic fragments fused upstream of GFP

obtained from a plasmid library. Salmonella -infected mammalian cells that showed

strong ﬂ uorescence because of GFP expression were sorted by FACS. Bacteria were

isolated from the sorted mammalian cells and grown ex vivo (i.e., outside their host),

and then those showing low ﬂ uorescence were sorted by FACS. The resulting sorted

bacterial population would harbor plasmids that are preferentially expressed when

they infect mammalian host cells (Valdivia and Falkow 1997 ) . Similarly, AFPs and

FACS have also been used to screen substrate-induced genes in metagenome librar-

ies (Uchiyama et al. 2005 ) . Another interesting application of AFPs and FACS is to

study horizontal gene transfer (Sørensen et al. 2003 ; Musovic et al. 2006 ) . Musovic

et al. ( 2006 ) sorted indigenous rhizosphere bacteria that acquired GFP-encoding

plasmid through horizontal gene transfer from a Pseudomonas putida donor. Diverse

bacterial populations were sorted, indicating that the plasmid can be transferred to

various indigenous bacteria (Musovic et al. 2006 ) .

6 Conclusion

Molecular techniques can enhance our understanding of phytoplankton biodiversity in

an environment as vast as the world’s oceans and in organisms so tiny that they can

only be reliably counted using ﬂ ow cytometry. We can never set a universal standard

judging each method because every molecular biologic technique ﬁ nds its own (or

shared) advantages. Various single-cell isolation techniques have been developed and

applied in combination with other techniques for microbiological and biotechnologi-

cal studies. Each technique has its advantages and disadvantages; therefore, the choice

of technique depends on the purpose of the study. These technologies continue to be

improved for high-throughput, precision, and low-cost analysis. Phylogenetic diver-

sity can be recovered without dependence on more traditional, often biased, preserva-

tion or culturing methods. Molecular techniques can reconstruct the phylogenetic

history of a group and can document the spatial and temporal structuring of genetic

diversity, i.e. , biodiversity below the species level. A variety of molecular tools may

need to be invoked in order to ﬁ nd the resolution needed to separates species, popula-

tions or individuals. The incorporation of all facets of the biology of the phytoplank-

ton is essential to formulate a multidisciplinary de ﬁ nition of a species and to reconstruct

its phylogenetic history.

The modern high throughput sequencing and microarray techniques most prob-

ably will allow rapid full genome sequencing of new isolates in the near future.

2 Recent Development in the Methods of Studying Microbial Diversity

The perspectives to gain this information from single cells certainly will open new

horizons in the study of complex microbial communities. Bioinformatics tools

have to be developed for data mining in the enormous amount of data to be expected.

Only powerful tools which can be trained (machine learning) will enable the

researchers to extract and interpret that parts of information which describe and

identify an organism.

References

Abe H, Wang J, Furukawa K, Oki K, Uda M, Tsuneda S, Ito Y (2008) A reduction-triggered

ﬂ uorescence probe for sensing nucleic acids. Bioconjug Chem 19:1219–1226

Adams JD, Kim U, Soh HT (2008) Multitarget magnetic activated cell sorter. Proc Natl Acad Sci

105:18165–18170

Aharoni A, Amitai G, Bernath K, Magdassi S, Taw ﬁ k DS (2005) High-throughput screening of

enzyme libraries: thiolactonases evolved by ﬂ uorescence-activated sorting of single cells in

emulsion compartments. Chem Biol 12:1281–1289

Alain K, Querellou J (2009) Cultivation the uncultured: limits advances and future challenges.

Extremophiles 13:583–594

Alvarez MAD, Gagne S, Antoun L (1995) Effect of compost on rhizosphere micro ﬂ ora of the

tomato and on the incidence of plant growth-promoting rhizobacteria. Appl Environ Microbiol

61:194–199

Amann R, Fuchs BM (2008) Single-cell identi ﬁ cation in microbial communities by improved

ﬂ uorescence in situ hybridization techniques. Nat Rev Microbiol 6:339–348

Amann R, Kuhl M (1998) In situ methods for assessment of microorganisms and their activities.

Curr Opin Microbiol 1:352–358

Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identi ﬁ cation and in situ detection of

individual microbial cells without cultivation. Appl Environ Microbiol 59:143–169

Ashida N, Ishii S, Hayano S, Tago K, Tsuji T, Yoshimura Y, Otsuka S, Senoo K (2010) Isolation of

functional single cells from environments using a micromanipulator: application to study deni-

trifying bacteria. Appl Microbiol Biotechnol 85:1211–1217

Assmus B, Hutzler P, Kirchhof G, Amann R, Lawrence JR, Hartmann A (1995) In situ localization

of Azospirillum brasilense in the rhizosphere of wheat with ﬂ uorescently labeled rRNA-tar-

geted oligonucleotide probes and scanning confocal laser microscopy. Appl Environ Microbiol

61:1013–1019

Atlas RM, Bartha R (1998) Microbial ecology: fundamentals and applications. Benjamin/

Cummings, Redwood City, 694 pp

Balestra GM, Misaghi IJ (1997) Increasing the ef ﬁ ciency of the plate counting method for estimat-

ing bacterial diversity. J Microbiol Methods 30:111–117

Bergquist PL, Hardiman EM, Ferrari BC, Winsley T (2009) Applications of ﬂ ow cytometry in

environmental microbiology and biotechnology. Extremophiles 13:389–401

Bershtein S, Taw ﬁ k DS (2008) Advances in laboratory evolution of enzymes. Curr Opin Chem

Biol 12:151–158

Bessette PH, Hu X, Soh HT, Daugherty PS (2007) Micro ﬂ uidic library screening for mapping

antibody epitopes. Anal Chem 79:2174–2178

Boedicker JQ, Li L, Kline TR, Ismagilov RF (2008) Detecting bacteria and determining their sus-

ceptibility to antibiotics by stochastic con ﬁ nement in nanoliter droplets using plug-based

micro ﬂ uidics. Lab Chip 8:1265–1272

Borneman J, Becke JO (2007) Identifying microorganisms involved in speci ﬁ c pathogen suppres-

sion in soil. Annu Rev Phytopathol 45:153–172

M.I. Ansari and A. Malik

Borneman J, Triplett EW (1997) Molecular microbial diversity in soils from eastern Amazonia:

evidence for unusual microorganisms and microbial population shifts associated with defores-

tation. Appl Environ Microbiol 63:2647–2653

Brehm-Stecher BF, Johnson EA (2004) Single-cell microbiology: tools technologies and applica-

tions. Microbiol Mol Biol Rev 68:538–559

Button DK, Schut F, Quang P, Martin R, Robertson BR (1993) Viability and isolation of marine

bacteria by dilution culture: theory procedures and initial results. Appl Environ Microbiol

59:881–891

Case RJ, Boucher Y, Dahllof I, Holmstrom C, Doolittle WF, Kjelleberg S (2007) Use of 16S rRNA

and rpoB genes as molecular markers for microbial ecology studies. Appl Environ Microbiol

73:278–288

Christen R (2008) Global sequencing: a review of current molecular data and new methods avail-

able to assess microbial diversity. Microbes Environ 23:253–268

Christensen H, Poulsen LK (1994) Detection of Pseudomonas in soil by rRNA targeted in situ

hybridization. Soil Biol Biochem 26:1093–1096

Christensen H, Angen Ø, Olsen JE, Bisgaard M (2000) DNA–DNA hybridization determined in

micro-wells utilizing covalent attachment of DNA. Int J Syst Evol Microbiol 50:1095–1102

Classen AT, Boyle SI, Haskins KE, Overby ST, Hart SC (2003) Community-level physiological

pro ﬁ les of bacteria and fungi: plate type and incubation temperature in ﬂ uences on contrasting

soils. FEMS Microbiol Ecol 44:319–328

Cole JR, Chai B, Farris RJ, Wang Q, Kulam-Syed-Mohideen AS, McGarrell DM, Bandela AM,

Cardenas E, Garrity GM, Tiedje JM (2007) The ribosomal database project (RDP-II): intro-

ducing myRDP space and quality controlled public data. Nucleic Acids Res 35:D169–D172

(Database issue)

Coleman JR, Culley DE, Chrisler WB, Brockman FJ (2007) mRNA-targeted ﬂ uorescent in situ

hybridization (FISH) of gram-negative bacteria without template ampli ﬁ cation or tyramide

signal ampli ﬁ cation. J Microbiol Methods 71:246–255

Collado J, Platas G, Paulus B, Bills GF (2007) High-throughput culturing of fungi from plant litter

by a dilution-to-extinction technique. FEMS Microbiol Ecol 60(3):521–533

Collins G, Kavanagh S, McHugh S, Connaughton S, Kearney A, Rice O, Carrigg C, Scully C,

Bhreathnach N, Mahony T, Madden P, Enright AM, Flaherty VO (2006) Accessing the black

box of microbial diversity and ecophysiology: recent advances through polyphasic experi-

ments. J Environ Sci Health Part A 41:897–922

Connon SA, Giovannoni SJ (2002) High-throughput methods for culturing microorganisms in very-

low-nutrient media yield diverse new marine isolates. Appl Environ Microbiol 68:3878–3885

Curtis TP, Head IM, Lunn M, Woodcock S, Schloss PD, Sloan WT (2006) What is the extent of

prokaryotic diversity? Philos Trans R Soc Lond Ser B 361:2023–2037

Czechowska K, Johnson DR, van der Meer JR (2008) Use of ﬂ ow cytometric methods for single-

cell analysis in environmental microbiology. Curr Opin Microbiol 11:205–212

Davis KER, Joseph SJ, Janssen PH (2005) Effects of growth medium inoculum size and incubation

time on culturability and isolation of soil bacteria. Appl Environ Microbiol 71:826–834

De Ley J, De Tijtgart R, Smedt J, Michiels M (1973) Thermal stability of DANN–DANN hybrids

within the genus Agrobacterium . J Gen Microbiol 78:241–252

Dellaglio F, Cleenwerck I, Felis GE, Engelbeen K, Janssens D, Marzotto M (2005) Description of

Gluconacetobacter swingsii sp nov and Gluconacetobacter rhaeticus sp nov isolated from

Italian apple fruit. Int J Syst Evol Microbiol 55:2365–2370

DeVero L, Gala E, Gullo M, Solieri L, Landi S, Giudici P (2006) Application of denaturing gradi-

ent gel electrophoresis (DGGE) analysis to evaluate acetic acid bacteria in traditional balsamic

vinegar. Food Microbiol 23:809–813

Di Giovanni GD, Watrud LS, Seidler RJ, Widmer F (1999a) Comparison of parental and transgenic

alfalfa rhizosphere bacterial communities using Biolog GN metabolic ﬁ ngerprinting and enter-

obacterial repetitive intergenic consensus sequence-PCR (ERIC-PCR). Microb Ecol 37:129–139

2 Recent Development in the Methods of Studying Microbial Diversity

Di Giovanni GD, Watrud LS, Seidler RJ, Widmer F (1999b) Fingerprinting of mixed bacterial

strains and Biolog gramnegative (GN) substrate communities by enterobacterial repetitive

intergenic consensus sequence-PCR (ERIC-PCR). Curr Microbiol 38:217–223

Doran JW, Coleman DC, Bezdicek DF, Stewart BA (1994) De ﬁ ning soil quality for a sustainable

environment. Am Soc Agro SSSA Special Publication No. 35. Soil Science Society of America,

Madison

Faulwetter JL, Gagnon V, Sundberg C, Chazaren F, Burra MD, Brisson J, Campera AK, Stein OR

(2009) Microbial processes in ﬂ uencing performance of treatment wetlands: a review. Ecol Eng

35:987–1004

Felske A, Akkermans ADL, De Vos W (1998) In situ detection of an uncultured predominant

Bacillus in Dutch grassland soils. Appl Environ Microbiol 64:4588–4590

Ferrari BC, Gillings MR (2009) Cultivation of fastidious bacteria by viability staining and micro-

manipulation in a soil substrate membrane system. Appl Environ Microbiol 75:3352–3354

Ferrari BC, Binnerup SJ, Gillings M (2005) Microcolony cultivation on a soil substrate mem-

brane system selects for previously uncultured soil bacteria. Appl Environ Microbiol

71:8714–8720

Fierer N, Lennon JT (2011) The generation and maintenance of diversity in microbial communi-

ties. Am J Bot 98(3):439–448

Fischer K, Hahn D, Honerlage W, Schonholzer F, Zeyer J (1995) In situ detection of spores and

vegetative cells of Bacillus megaterium in soil by whole cell hybridization. Syst Appl Microbiol

18:265–273

Fox GE, Pechman KR, Woese CR (1977) Comparative cataloging of 16S ribosomal ribonucleic

acid: molecular approach to prokaryotic systematic. Int J Syst Bacteriol 27:44–57

Frac M, Oszust K, Lipiec J (2012) Community level physiological pro ﬁ les (CLPP) characteriza-

tion and microbial activity of soil amended with dairy sewage sludge. Sensors 12:3253–3268

Franzini RM, Kool ET (2009) Ef ﬁ cient nucleic acid detection by templated reductive quencher

release. J Am Chem Soc 131:16021–16023

Fröhlich J, König H (2000) New techniques for isolation of single prokaryotic cells. FEMS

Microbiol Rev 24:567–572

Frostegard A, Tunlid A, Baath E (1993) Phospholipid fatty acid composition biomass and activity

of microbial communities from two soil types experimentally exposed to different heavy met-

als. Appl Environ Microbiol 59:3605–3617

Frostegard A, Tunlid A et al (2010) Use and misuse of PLFA measurements in soils. Soil Biol

Biochem. doi:

101016/jsoilbio201011021

Fu AY, Spence C, Scherer A, Arnold FH, Quake SR (1999) A microfabricated ﬂ uorescence-

activated cell sorter. Nat Biotechnol 17:1109–1111

Fujii Y, Hiraishi A (2009) Combined use of cyanoditolyl tetrazolium staining and ﬂ ow cytometry

for detection of metabolically active bacteria in a fed-batch composting process. Microbes

Environ 24:57–63

Garbeva P, van Veen JA, van Elsas JD (2004) Microbial diversity in soil: selection of microbial

populations by plant and soil type and implications for disease suppressiveness. Annu Rev

Phytopathol 42:243–270

Garland JL (1996a) Analytical approaches to the characterization of samples of microbial com-

munities using patterns of potential C utilization. Soil Biol Biochem 28(213)

Garland JL (1996b) Patterns of potential C source utilization by rhizosphere communities. Soil

Biol Biochem 28:223–230

Garland J (1997) Analysis and interpretation of community-level physiological pro ﬁ les in micro-

bial ecology. FEMS Microbiol Ecol 24:289–300

Garland JL, Mills AL (1991) Classi ﬁ cation and characterization of heterotrophic microbial com-

munities on the basis of patterns of community-level sole-carbon-source utilization. Appl

Environ Microbiol 57:2351–2359

Gonzalez A, Hierro N, PobletMMas A, Guillamon JM (2005) Application of molecular methods to

demonstrate species and strain evolution of acetic acid bacteria population during wine produc-

tion. Int J Food Microbiol 102:295–304

M.I. Ansari and A. Malik

Green JL, Holmes AJ, Westoby M, Oliver L, Briscoe D, Danger ﬁ eld M, Gillings M, Beattie

AJ (2004) Spatial scaling of microbial eukaryote diversity. Nature 432:747–750

Grimont PAD, Popoff MY, Grimont F, Coynault C, Lemelin M (1980) Reproducibility and cor-

relation study of three deoxyribonucleic acid hybridization procedures. Curr Microbiol

4:325–330

Grosskopf R, Stubner S, Liesack W (1998) Novel euryarchaeotal lineages detected on rice roots and

in the anoxic bulk soil of ﬂ ooded rice microcosms. Appl Environ Microbiol 64:4983–4989

Guckert JB, Antworth CP, Nichols PD, White DC (1985) Phospholipid ester linked fatty acid

pro ﬁ les as reproducible assays for changes in prokaryotic community structure of estuarine

sediments. FEMS Microb Ecol 31:147–158

Haack SK, Garchow H, Odelson DA, Forney LJ, Klug MJ (1994) Accuracy reproducibility and

interpretation of fatty acid methyl ester pro ﬁ les of model bacterial communities. Appl Environ

Microbiol 60:2483–2493

Haack SK, Garchow H, Klug M, Forney LJ (1995) Analysis of factors affecting the accuracy

reproducibility and interpretation of microbial community carbon source utilization patterns.

Appl Environ Ecol 61:1458–1468

Haas CN (1989) Estimation of microbial densities from dilution count experiments. Appl Environ

Microbiol 44:1934–1942

Hackett CA, Grif ﬁ ths BS (1997) Statistical analysis of the time course of Biolog substrate utiliza-

tion. J Microbiol Methods 30:63–69

Hahn D, Amann RI, Ludwig W, Akkermans ADL, Schleifer KH (1992) Detection of microorgan-

isms in soil after in situ hybridization with rRNA-targeted ﬂ uorescently labeled oligonucle-

otides. J Gen Microbiol 138:879–887

Haubert D, Haggblom MM, Langel R, Scheu S, Ruess L (2006) Trophic shift of stable isotopes

and fatty acids in Collembola on bacterial diets. Soil Biol Biochem 38:2004–2007

Heuer H, Krsek M, Baker P, Smalla K, Wellington EMH (1997) Analysis of actinomycete com-

munities by speci ﬁ c ampli ﬁ cation of genes encoding 16S rRNA and gel-electrophoretic separa-

tion in denaturing gradients. Appl Environ Microbiol 63:3233–3241

Hill GT, Mitkowskia NA, Aldrich-Wolfe L, Emelea LR, Jurkonie DD, Ficke A, Maldonado-

Ramireza S, Lyncha ST, Nelson EB (2000) Methods for assessing the composition and diver-

sity of soil microbial communities. Appl Soil Ecol 15:25–36

Hitzl W, Henrich M, Kessel M, Insam H (1997) Applications of multivariate analysis of variance and

related techniques in soil studies with substrate utilization tests. J Microbiol Methods 30:81–89

Hongoh Y, Sharma VK, Prakash T, Noda S, Taylor TD, Kudo T, Sakaki Y, Toyoda A, Hattori M,

Ohkuma M (2008) Complete genome of the uncultured Termite Group 1 bacteria in a single

host protest cell. Proc Natl Acad Sci USA 105:5555–5560

Hu S, van Bruggen AHC (1997) Microbial dynamics associated with multiphasic decomposition

C-labeled cellulose in soil. Microb Ecol 33:134–143

Hu X, Bessette PH, Qian J, Meinhart CD, Daugherty PS, Soh HT (2005) Marker-speci ﬁ c sorting

of rare cells using dielectrophoresis. Proc Natl Acad Sci USA 102:15757–15761

Huber R, Huber H, Stettera KO (2000) Towards the ecology of hyperthermophiles: biotopes new

isolation strategies and novel metabolic properties. FEMS Microbiol Rev 24:615–623

Huss VAR, Festl H, Schleifer KH (1983) Studies on the spectrophotometric determination of DNA

hybridization from renaturation rates. Syst Appl Microbiol 4:184–192

Ishida T, Yokota A, Umezawa Y, Toda T, Yamada K (2005) Identi ﬁ cation and characterization of

lactococcal and Acetobacter strains isolated from traditional Caucasusian fermented milk. J

Nutr Sci Vitaminol 51:187–193

Ishii S, Tago K, Senoo K (2010) Single-cell analysis and isolation for microbiology and biotech-

nology: methods and applications. Appl Microbiol Biotechnol 86:1281–1292

Ishoey T, Woyke T, Stepanauskas R, Novotny M, Lasken RS (2008) Genomic sequencing of single

microbial cells from environmental samples. Curr Opin Microbiol 11:198–204

Joux F, Lebaron P (1997) Ecological implications of an improved direct viable count method for

aquatic bacteria. Appl Environ Microbiol 63:3643–3647

2 Recent Development in the Methods of Studying Microbial Diversity

Joux F, Lebaron P (2000) Use of ﬂ uorescent probes to assess physiological functions of bacteria at

single-cell level. Microbes Infect 2:1523–1535

Juan Z, Weihua G, Renqing W, Xuemei H, Qiang W (2008) Microbial community diversity in the

pro ﬁ le of an agricultural soil in northern China. J Environ Sci 20:981–988

Kalyuzhnaya MG, Lidstrom ME, Chistoserdova L (2008) Real-time detection of actively metabo-

lizing microbes by redox sensing as applied to methylotroph populations in Lake Washington.

ISME J 2:696–706

Kawakami S, Kubota K, Imachi H, Yamaguchi T, Harada H, Ohashi A (2010) Detection of single

copy genes by two-pass tyramide signal ampli ﬁ cation ﬂ uorescence in situ hybridization (Two-

Pass TSA-FISH) with single oligonucleotide probes. Microbes Environ 25:15–21

Keller M, Zengler K (2004) Tapping into microbial diversity. Nat Rev Microbiol 2:141–150

Kenzaka T, Yamaguchi N, Tani K, Nasu M (1998) rRNA-Targeted ﬂ uorescent in situ hybridization

analysis of bacterial community structure in river water. Microbiology 144:2085–2093

Kikuchi Y (2009) Endosymbiotic bacteria in insects: their diversity and culturability. Microbes

Environ 24:195–204

Kirchhof G, Schloter M, Assmus B, Hartmann A (1997) Molecular microbial ecology approaches

applied to diazotrophs associated with non-legumes. Soil Biol Biochem 29:853–862

Kirk JL, Beaudette LA, Hart M, Moutoglis P, Klironomos JN, Lee H, Trevors JT (2004) Methods

of studying soil microbial diversity. J Microbiol Methods 58:169–188

Klingler M, Koletzko B (2012) Novel methodologies for assessing omega-3 fatty acid status – a

systematic review. Br J Nutr 107:S53–S63

Kogure K, Shimidu U, Taga N (1979) A tentative direct microscopic method for counting living

marine bacteria. Can J Microbiol 25:415–420

Kogure K, Shimidu U, Taga N (1984) An improved direct viable count method for aquatic bacteria.

Arch Hydrobiol 102:117–122

Konopka A, Oliver L, Turco RF Jr (1998) The use of carbon substrate utilization patterns in

environmental and ecological microbiology. Microb Ecol 35:103–115

Kose AR, Fischer B, Mao L, Koser H (2009) Label-free cellular manipulation and sorting via

biocompatible ferro ﬂ uids. Proc Natl Acad Sci USA 106:21478–21483

Kretova M, Grones J (2005) Molecular analysis of 16S–23S spacer regions of Acetobacter species.

Folia Microbiol 50:288–292

Kvist T, Ahring BK, Lasken RS, Westerman P (2007) Speci ﬁ c single-cell isolation and genomic

ampli ﬁ cation of uncultured microorganisms. Appl Microbiol Biotechnol 74:926–935

Larsen MKS, Thomsen TR, Moser C, Høiby N, Nielsen PH (2008) Use of cultivation-dependent

and -independent techniques to assess contamination of central venous catheters: a pilot study.

BMC Clin Pathol 8:10

Lasken RS (2007) Single-cell genomic sequencing using multiple displacement ampli ﬁ cation.

Curr Opin Microbiol 10:510–516

Lehman RM, Colwell FS, Ringelberg DB, White DC (1995) Combined microbial community-

level analyses for quality assurance of terrestrial subsurface cores. J Microbiol Methods

22:263–281

Lengler JW, Drews G, Schlegel HG (eds) (2009) Prokaryotic diversity and systematics. In: Biology

of the Prokaryotes. Blackwell Science Ltd, Oxford. doi:

10.1002/9781444313314.ch29

Li YL, Peacock AD, White DC, Geyer R, Zhang CLL (2007) Spatial patterns of bacterial signature

biomarkers in marine sediments of the Gulf of Mexico. Chem Geol 238:168–179

Li D, He M, Jiang SC (2010) Detection of infectious adenoviruses in environmental waters by

ﬂ uorescence-activated cell sorting assay. Appl Environ Microbiol 76:1442–1448

Liesack W, Janssen PH, Rainey FA, Ward-Rainey NL, Stackenbrandt E (1997) Microbial diversity

in soil: the need for a combined approach using molecular and cultivation techniques. In: van

Elsas JD, Trevors JT, Wellington EMH (eds) Modern soil microbiology. Marcel Dekker, New

York, pp 375–439

Link AJ, Jeong KJ, Georgiou G (2007) Beyond toothpicks: new methods for isolating mutant

bacteria. Nat Rev Microbiol 5:680–688

M.I. Ansari and A. Malik

Lisdiyanti P, Navarro RR, Uchimura T, Komagata K (2006) Reclassi ﬁ cation of Gluconacetobacter

hansenii strains and proposals of Gluconacetobacter saccharivorans sp nov and Gluconacetobacter

nataicola sp nov. Int J Syst Evol Microbiol 56:2101–2111

Little AEF, Robinson CJ, Peterson SB, Raffa KF, Handelsman J (2008) Rules of engagement:

interspecies interactions that regulate microbial communities. Annu Rev Microbiol 62:

375–401

Liu BR, Jia GM, Chen J, Wang G (2006) A review of methods for studying microbial diversity in

soils. Pedosphere 16(1):18–24

Liu W, Kim HJ, Lucchetta EM, Du W, Ismagilov RF (2009) Isolation incubation and parallel func-

tional testing and identi ﬁ cation by FISH of rare microbial single-copy cells from multi-species

mixtures using the combination of chemistrode and stochastic con ﬁ nement. Lab Chip

9:2153–2162

Lopez I, Ruiz-Larrea F, Cocolin L, Orr E, Phister T, Marshall M, VanderGheynst J, Mills DA

(2003) Design and evaluation of PCR primers for analysis of bacterial populations in wine by

denaturing gradient gel electrophoresis. Appl Environ Microbiol 69:6801–6807

Ludwig W (2007) Nucleic acid techniques in bacterial systematics and identi ﬁ cation. Int J Food

Microbiol 120:225–236

Ludwig W, Bauer SH, Bauer M, Held I, Kirchhof G, Schulze R, Huber I, Spring S, Hartmann A,

Schleifer KH (1997) Detection and in situ identi ﬁ cation of representatives of a widely distrib-

uted new bacterial phylum. FEMS Microbiol Lett 153:181–190

Lynch JM, Benedetti A, Insam HM, Nuti P, Smalla K, Torsvik V, Nannipieri P (2004) Microbial

diversity in soil: ecological theories the contribution of molecular techniques and the impact of

transgenic plants and transgenic microorganisms. Biol Fertil Soils 40:363–385

Macalady JL, Fuller ME, Scow KM (1998) Effects of metan sodium fumigation on soil microbial

activity and community structure. J Environ Qual 27:53–63

MacNaughton SJ, Booth T, Embley TM, O’Donnell AG (1996) Physical stabilization and confocal

microscopy of bacteria on roots using 16S rRNA targeted ﬂ uorescent-labeled oligonucleotide

probes. J Microbiol Methods 26:279–285

Malimas T, Yukphan P, Takahashi M, Potacharoen W, Tanasupawat S, Nakagawa Y, Tanticharoen

M, Yamada Y (2006) Heterogeneity of strains assigned to Gluconobacter frateurii Mason and

Claus 1989 based on restriction analysis of 16S–23S rDNA internal transcribed spacer regions.

Biosci Biotechnol Biochem 70:684–690

Maloney PE, van Bruggen AHC, Hu S (1997) Bacterial community structure in relation to the carbon

environments in lettuce and tomato rhizospheres and in bulk soil. Microb Ecol 34:109–117

Marcy Y, Ishoey T, Lasken RS, Stockwell TB, Walenz BP, Halpern AL, Beeson KY, Goldberg

SMD, Quake SR (2007a) Nanoliter reactors improve multiple displacement ampli ﬁ cation of

genomes from single cells. PLoS Genet 3:e155

Marcy Y, Ouverney C, Bik EM, Losekann T, Ivanova N, Martin HG, Szeto E, Platt D, Hugenholtz

P, Relman DA, Quake SR (2007b) Dissecting biological “dark matter” with single-cell genetic

analysis of rare and uncultivated TM7 microbes from the human mouth. Proc Natl Acad Sci

USA 104:11889–11894

Mathew RP, Feng Y, Githinji L, Ankumah R, Balkcom KS (2012) Impact of no-tillage and conven-

tional tillage systems on soil microbial communities. Appl Environ Soil Sci. doi:101155/

2012/548620

McClelland RG, Pinder AC (1994) Detection of Salmonella typhimurium in dairy products with

ﬂ ow cytometry and monoclonal antibodies. Appl Environ Microbiol 60:4255–4262

McCutcheon JP, McDonald BR, Moran NA (2009) Origin of an alternative genetic code in the

extremely small and GC–rich genome of a bacterial symbiont. PLoS Genet 5(7):e1000565.

doi:

101371/journalpgen1000565

Medlin LK, Kooistra WHCF (2010) Methods to estimate the diversity in the marine photosynthetic

protist community with illustrations from case studies: a review. Diversity 2:973–1014

Mehlen A, Goeldner M, Ried S, Stindl S, Ludwig W, Schleifer KH (2004) Development of a fast

DNA–DNA hybridization method based on melting pro ﬁ les in microplates. Syst Appl Microbiol

27:689–695

2 Recent Development in the Methods of Studying Microbial Diversity

Miller KM, Ming TJ, Schulze AD, Withler RE (1999) Denaturing gradient gel electrophoresis

(DGGE): a rapid and sensitive technique to screen nucleotide sequence variation in popula-

tions. Biotechniques 27:1016–1030

Mitsui H, Gorlach K, Lee H-J Hattori R, Hattori T (1997) Incubation time and media requirements

of culturable bacteria from different phylogenetic groups. J Microbiol Methods 30:103–110

Moon HS, Nam YW, Park JC, Jung HI (2009) Dielectrophoretic separation of airborne microbes

and dust particles using a micro ﬂ uidic channel for real-time bioaerosol monitoring. Environ Sci

Technol 43:5857–5863

Morgan JAW, Winstanley C (1997) Microbial biomarkers. In: van Elsas JD, Trevors JT, Wellington

EMH (eds) Modern soil microbiology. Marcel Dekker, New York, pp 331–352

Mueller V, Wolfenbarger V (1999) AFLP genotyping and ﬁ ngerprinting. Trends Ecol Evol

14:389–394

Musovic S, Oregaard G, Kroer N, Sørensen SJ (2006) Cultivation independent examination of

horizontal transfer and host range of an incP-1 plasmid among gram-positive and gram-nega-

tive bacteria indigenous to the barley rhizosphere. Appl Environ Microbiol 72:6687–6692

Muthukumarasamy R, Cleenwerck I, Revathi G, Vadivelu M, Janssens D, Hoste B, Gum KU,

Park KD, Son CY, Sa T, Caballero-Mellado JC (2005) Natural association of Gluconacetobacter

diazotrophicus and diazotrophic Acetobacter peroxydans with wetland rice. Syst Appl

Microbiol 28:277–286

Muyzer G (1999) DGGE/TGGE a method for identifying genes from natural ecosystems. Curr

Opin Microbiol 2:317–322

Muyzer G, Smalla K (1998) Application of denaturing gradient gel electrophoresis (DGGE)

and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Van

Leeuwenhoek 73:127–141

Nakamura A, Tun CC, Asakawa S, Kimura M (2003) Microbial community responsible for the

decomposition of rice straw in a paddy ﬁ eld: estimation by phospholipid fatty acid analysis.

Biol Fertil Soils 38:288–295

Nannipieri P, Ascher J, Ceccherini MT, Landi L, Pietramellara G, Renella G (2003) Microbial

diversity and soil functions. Eur J Soil Sci 54:655–670

Olsen GJ, Woese CR (1993) Ribosomal RNA: a key to phylogeny. FASEB J 7:113–123

Ottesen EA, Hong JW, Quake SR, Leadbetter JR (2006) Micro ﬂ uidic digital PCR enables multi-

gene analysis of individual environmental bacteria. Science 314:1464–1467

Ovreas L (2000) Population and community level approaches for analyzing microbial diversity in

natural environments. Ecol Lett 3:236–251

Ovreas L, Torsvik V (1998) Microbial diversity and community structure in two different agricul-

tural soil communities. Microb Ecol 36:303–315

Pernthaler A, Pernthaler J, Amann R (2002) Fluorescence in situ hybridization and catalyzed

reporter deposition for the identi ﬁ cation of marine bacteria. Appl Environ Microbiol

68:3094–3101

Pernthaler A, Dekas AE, Brown CT, Goffredi SK, Embaye T, Orphan VJ (2008) Diverse syn-

trophic partnerships from deep-sea methane vents revealed by direct cell capture and metage-

nomics. Proc Natl Acad Sci USA 105:7052–7057

Petersen SO, Debosz K, Schjonning P, Christensen BT, Elmholt S (1998) Phospholipid fatty acid

pro ﬁ les and C availability in wet-stable macro-aggregates from conventionally and organically

farmed soils. Geoderma 78:181–196

P ﬁ ffner SM, Cantu JM, Smithgall A, Peacock AD, White DC, Moser DP, Onstott TC, van Heerden

E (2006) Deep subsurface microbial biomass and community structure in Witwatersrand Basin

mines. Geomicrobiol J 23:431–442

Podar M, Abulencia CB, Walcher M, Hutchison D, Zengler K, Garcia JA, Holland T, Cotton D,

Hauser L, Keller M (2007) Targeted access to the genomes of low-abundance organisms in

complex microbial communities. Appl Environ Microbiol 73:3205–3214

Porteous LA, Seidler RJ, Watrud LS (1997) An improved method for purifying DNA from soil

for polymerase chain reaction ampli ﬁ cation and molecular ecology applications. Mol Ecol

6:787–791

M.I. Ansari and A. Malik

Pratscher J, Stichternoth C, Fichtl K, Schleifer KH, Braker G (2009) Application of recognition of

individual genes- ﬂ uorescence in situ hybridization (RING-FISH) to detect nitrite reductase

genes (nirK) of denitri ﬁ ers in pure cultures and environmental samples. Appl Environ Microbiol

75:802–810

Preston-Mafham J, Boddy L, Randerson P (2002) Analysis of microbial community functional

diversity using sole-carbon-source utilization pro ﬁ les – a critique. FEMS Microbiol Ecol

42(1)

Privat E, Melvin T, Asseline U, Vigny P (2001) Oligonucleotide conjugated thiazole orange probes

as “light-up” probes for messenger ribonucleic acid molecules in living cells. Photochem

Photobiol 74:532–541

Pyle BH, Broadaway SC, McFeters GA (1999) Sensitive detection of Escherichia coli O157:H7 in

food and water by immunomagnetic separation and solid-phase laser cytometry. Appl Environ

Microbiol 65:1966–1972

Ranjard L, Brothier E, Nazaret S (2000) Sequencing bands of RISA ﬁ ngerprints for the character-

ization and the microscale distribution of soil bacterial populations responding to mercury

spiking. Appl Environ Microbiol 66:5334–5339

Ranjard L, Poly F, Lata J-C Mougel C, Thioulouse J, Nazaret S (2001) Characterization of bacterial

and fungal soil communities by automated ribosomal intergenic spacer analysis ﬁ ngerprints:

biological and methodological variability. Appl Environ Microbiol 67:4479–4487

Rappé MS, Connon SA, Vergin KL, Giovannoni SJ (2002) Cultivation of the ubiquitous SAR11

marine bacterioplankton clade. Nature 418:630–633

Regnault B, Grimont F, Grimont PAD (1997) Universal ribotyping method using a chemically

labelled oligonucleotide probe mixture. Res Microbiol 148:649–659

Robertson BJW, Bunn AL, Bailey VL (2011) Phospholipid fatty acid biomarkers in a freshwater

periphyton community exposed to uranium: discovery by non-linear statistical learning. J

Environ Radioact 102(1):64–71

Rodrigue S, Malmstron RR, Berlin AM, Birren BW, Henn MR, Chisholm SW (2009) Whole

genome ampli ﬁ cation and de novo assembly of single bacterial cells. PLoS One 4:e6864

Ros M, Goberna M, Pascual JA, Klammer S, Insam H (2008) 16S rDNA analysis reveals low

microbial diversity in community level physiological pro ﬁ le assays. J Microbiol Methods

72(3):221–226

Saleh-Lakha S, Miller M, Campbell RG, Schneider K, Elahimanesh P, Harta MM, Trevors JT

(2005) Microbial gene expression in soil: methods applications and challenges. J Microbiol

Methods 63:1–19

Santangelo PJ, Nix B, Tsourkas A, Bao G (2004) Dual FRET molecular beacons form RNA detec-

tion in living cells. Nucleic Acids Res 32:e57

Sato T, Hongoh Y, Noda S, Hattori S, Ui S, Ohkuma M (2009) Candidatus desulfovibrio tricho-

nymphae a novel intracellular symbiont of the ﬂ agellate Trichonympha agilis in termite gut.

Environ Microbiol 11:1007–1015

Schönhuber W, Fuchs B, Juretschko S, Amann R (1997) Improved sensitivity of whole-cell hybrid-

ization by the combination of horseradish peroxidase-labeled oligonucleotides and tyramide

signal ampli ﬁ cation. Appl Environ Microbiol 63:3268–3273

Schryver JC, Brandt CC, P ﬁ ffner SM, Palumbo AV, Peacock AD, White DC, McKinley JP, Long

PE (2006) Application of nonlinear analysis methods for identifying relationships between

microbial community structure and groundwater geochemistry. Microb Ecol 51:177–188

Schutter M, Dick R (2001) Shifts in substrate utilization potential and structure of soil microbial

communities in response to carbon substrates. Soil Biol Biochem 33:1481–1491

Schwieger F, Tebbe CC (1998) A new approach to utilize PCR single-strand-conformation poly-

morphism for 16s rRNA gene-based microbial community analysis. Appl Environ Microbiol

64:4870–4876

Shelton DR, Karns JS (2001) Quantitative detection of Escherichia coli O157 in surface waters by

using immunomagnetic electrochemiluminescence. Appl Environ Microbiol 67:2908–2915

Silva LR, Cleenwerck I, Rivas R, Swings J, Trujillo ME, Willems A, Velazquez E (2006)

Acetobacter oeni sp nov isolated from spoiled red wine. Int J Syst Evol Microbiol 56:21–24

2 Recent Development in the Methods of Studying Microbial Diversity

Silverman AP, Kool ET (2005) Quenched autoligation probes allow discrimination of live bacterial

species by single nucleotide differences in rRNA. Nucleic Acids Res 33:4978–4986

Simu K, Hagström A (2004) Oligotrophic bacterioplankton with a novel single-cell life strategy.

Appl Environ Microbiol 70:2445–2451

Soderber KH, Olsson PA, Ba ﬁ a ﬁ th E (2002) Structure and activity of the bacterial community in

the rhizosphere of different plant species and the effect of arbuscular mycorrhizal colonization.

FEMS Microbiol Ecol 40:223–231

Sørensen SJ, Sørensen AH, Hansen LH, Oregaard G, Veal D (2003) Direct detection and

quanti ﬁ cation of horizontal gene transfer by using ﬂ ow cytometry and gfp as a reporter gene.

Curr Microbiol 47:0129–0133

Southward CM, Surette MG (2002) The dynamic microbe: green ﬂ uorescent protein brings bacte-

ria to light. Mol Microbiol 45:1191–1196

Stackebrandt E, Frederiksen W, Garrity GM, Grimont PAD, Kämpfer P, Maiden MCJ, Nesme X,

Rossello-Mora R, Swings J, Trüper HG, Vauterin L, Ward AC, Whitman WB (2002) Report of

the adhoc committee for the re-evaluation of the species de ﬁ nition in bacteriology. Int J Syst

Evol Microbiol 52:1043–1047

Stepanauskas R, Sieracki ME (2007) Matching phylogeny and metabolism in the uncultured

marine bacteria one cell at a time. Proc Natl Acad Sci USA 104:9052–9057

Tamaoka J (1994) Determination of DNA base composition. In: Goodfellow M, O’Donnell AG

(eds) Chemical methods in prokaryotic systematics. Wiley, Chichester, pp 463–469

Tanasupawat S, Thawai C, Yukphan P, Moonmangmee D, Itoh T, Adachi O, Yamada Y (2004)

Gluconobacter thailandicus sp nov an acetic acid bacterium in the alpha-Proteobacteria. J Gen

Appl Microbiol 50:159–167

Theron J, Cloete TE (2000) Molecular techniques for determining microbial diversity and com-

munity structure in natural environments. Crit Rev Microbiol 26:37–57

Thurnheer T, Gmur R, Guggenheim B (2004) Multiplex FISH analysis of a six-species bacterial

bio ﬁ lm. J Microbiol Methods 56:37–47

Tiedje JM, Asuming-Brempong S, Nusslein K, Marsh TL, Flynn SJ (1999) Opening the black box

of soil microbial diversity. Appl Soil Ecol 13:109–122

Torsvik V, Sorheim R, Goksoyr J (1996) Total bacterial diversity in soil and sediment communities — a

review. J Ind Microbiol 17:170–178

Tyagi S (2009) Imaging intracellular RNA distribution and dynamics in living cells. Nat Methods

6:331–338

Uchiyama T, Abe T, Ikemura T, Watanabe K (2005) Substrate-induced gene-expression screening

of environmental metagenome libraries for isolation of catabolic genes. Nat Biotechnol

23:88–93

Valdivia RH, Falkow S (1997) Fluorescence-based isolation of bacterial genes expressed within

host cells. Science 277:2007–2011

van Elsas JD, Duarte GE, Rosado AS, Smalla K (1998) Microbiological and molecular methods

for monitoring microbial inoculants and their effects in the environment. J Microbiol Methods

32:133–154

Veal DA, Deere D, Ferrari B, Piper J, Att ﬁ eld PV (2000) Fluorescence staining and ﬂ ow cytometry

for monitoring microbial cells. J Immunol Methods 243:191–210

Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Friters A, Pot J, Paleman J,

Kuiper M, Zabeau M (1995) AFLP: a new technique for DNA ﬁ ngerprinting. Nucleic Acids

Res 23:4407–4414

Walker A, Parkhill J (2008) Single-cell genomics. Nat Rev Microbiol 6:176–177

Wang Y, Hammes F, Boon N, Chami M, Egli T (2009) Isolation and characterization of low nucleic

acid (LNA)-content bacteria. ISME J 3:889–902

Ward DM, Weller R, Bateson MM (1990) 16S rRNA sequences reveal numerous uncultured

microorganisms in a natural community. Nature 345:63–65

Webster G, Watt LC, Rinna J, Fry JC, Evershed RP, Parkes RJ, Weightman AJ (2006) A comparison of

stable-isotope probing of DNA and phospholipid fatty acids to study prokaryotic functional diver-

sity in sulfate-reducing marine sediment enrichment slurries. Environ Microbiol 8:1575–1589

M.I. Ansari and A. Malik

Widmer F, FlieMbach A, Laczko E, Schulze-Aurich J, Zeyer J (2001) Assessing soil biological

characteristics: a comparison of bulk soil community DNA- PFLA- and Biolog-analyses. Soil

Biol Biochem 33:1029–1036

Woese CR (1987) Bacterial evolution. Microbiol Rev 51:221–271

Wullings BA, van Beuningen AR, Janse JD, Akkermanns ADL (1998) Detection of Ralstonia

solanacearum which causes brown rot of potato by ﬂ uorescent in situ hybridization with 23S

rRNA-targeted probes. Appl Environ Microbiol 64:4546–4554

Yamada T, Sekiguchi Y (2009) Cultivation of uncultured Chloro ﬂ exi subphyla: signi ﬁ cance and

ecophysiology of formerly uncultured Chloro ﬂ exi ‘Subphylum I’ with natural and biotechno-

logical relevance. Microbes Environ 24:205–216

Yamaguchi Y, Arakawa T, Takeda N, Edagawa Y, Shoji S (2009) Development of a poly-dimethyl-

siloxane micro ﬂ uidic device for single cell isolation and incubation. Sens Actuators B Chem

136:555–561

Yukphan P, Potacharoen W, Nakagawa Y, Tanticharoen M, Yamada Y (2004) Identi ﬁ cation of

strains assigned to the genus Gluconobacter Asai 1935 based on the sequence and the restric-

tion analyses of the 16S–23S rDNA internal transcribed spacer regions. J Gen Appl Microbiol

50:9–15

Yukphan P, Malimas T, Potacharoen W, Tanasupawat S, Tanticharoen M, Yamada Y (2006)

Identi ﬁ cation of strains assigned to the genus Asaia Yamada et al. 2000 based on restriction

analysis of 16S–23S rDNA internal transcribed spacer regions. J Gen Appl Microbiol

52:55–62

Zarda B, Hahn D, Chatzinotas A, Schonhuber W, Neef J, Amann RI, Zeyer J (1997) Analysis of

bacterial community structure in bulk soil by in situ hybridization. Arch Microbiol

168:185–192

Zelles L (1997) Phospholipid fatty acid pro ﬁ les in selected members of soil microbial communi-

ties. Chemosphere 35:275–294

Zelles L, Bai QY (1993) Fractionation of fatty acids derived from soil lipids by solid phase extrac-

tion and their quantitative analysis by GC-MS. Soil Biol Biochem 25:495–507

Zelles L, Rackwitz R, Bai QY, Beck T, Beese F (1995) Discrimination of microbial diversity by

fatty acid pro ﬁ les of phospholipids and lipopolysaccharides in differently cultivated soils. Plant

Soil 170:115–122

Zengler K (2009) Central role of the cell in microbial ecology. Microbiol Mol Biol Rev 73:712–729

Zengler K, Toledo G, Rappé M, Elkins J, Mathur EJ, Short JM, Keller M (2002) Cultivating the

uncultured. Proc Natl Acad Sci USA 99:15681–15686

Ziemke F, Ho ﬂ e MG, Laculat J, Rossello-Mora R (1998) Reclassi ﬁ cation of Shewanella putrefa-

ciens Owen’s genomic group II as Shewanella baltica sp nov. Int J Syst Bacteriol 48:179–186

Zwirglmaier K, Ludwig W, Schleifer KH (2004) Recognition of individual genes in a single bacte-

rial cell by ﬂ uorescence in situ hybridization – RING-FISH. Mol Microbiol 51:89–96

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_3, © Springer Science+Business Media Dordrecht 2013

Abstract Microbes are known to play an important role in numerous metabolic

processes like nutrient cycling, environmental detoxi ﬁ cation, production of antibiot-

ics, vitamins, industrial enzymes etc. Therefore it is important to ef ﬁ ciently harness

and utilize the biologically important properties of microbes and their products to

tackle the ever growing challenges of food security, healthcare and environmental

pollution. A complete knowledge of these microbes with respect to the role played

by them in ecosystem function is essential to fully exploit them for the bene ﬁ t of

mankind. Unfortunately only 4–5% of the microbes have been explored so far

whereas the rest ≈95% is are still un-culturable. A number of uncertainties still exist

with respect to the microbial diversity as knowledge regarding the number of species

of microorganisms that exist, their distribution, stability in the environment and the

important roles played by them are lacking to a greater extent. Microbial diversity is

an unseen global resource that deserves to be conserved and utilized judiciously.

Microbial resource centers play an important role in this regard as they act as living

libraries holding microorganisms. The primary function of these centers is to collect,

S. A. Lone

Biotechnology and Climate Change, National Research Centre

on Plant Biotechnology , New Delhi 110012 , India

Department of Agricultural Microbiology, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , Uttar Pradesh 202002 , India

e-mail: showkat.microbio@gmail.com

A. Malik

Department of Agricultural Microbiology,

Faculty of Agricultural Sciences , Aligarh Muslim University , Aligarh ,

Uttar Pradesh 202002 , India

e-mail: ab_malik30@yahoo.com

J. C. Padaria (

Biotechnology and Climate Change, National Research Centre

on Plant Biotechnology , New Delhi 110012 , India

e-mail: jasdeep_kaur64@yahoo.co.in

Chapter 3

Microbial Resource Centers Towards

Harnessing Microbial Diversity for Human

Welfare

Showkat Ahmad Lone, Abdul Malik , and Jasdeep Chatrath Padaria

S.A. Lone et al.

maintain and distribute microbial strains and/or their products to researchers and

industrialists all over the world. The role of microbial Culture Collections with

respect to conservation and propagation of microbial resources and the dif ﬁ culties

and uncertainties of conservation faced are discussed.

Keywords Microbial resource centers (MRCs) • World Data Centre for

Microorganisms (WDCM) • World Federation for Culture Collections (WFCC)

3.1 Introduction

Microorganisms –Bacteria, Viruses, Viroids, Filamentous Fungi, Yeast, Microalgae

and Protozoa comprise the group containing the highest number of organisms on

the Earth (Colwell 1997 ) . They are ubiquitous in distribution, occurring in a wide

range of environments such as hydrothermal vents (deep sea smokers) (Kato et al.

2009 ) , hot springs (Kumar et al. 2004 ) , acid mine drainages and rivers (Amils

et al. 2007 ) , in gypsum halite crusts and in NaCl crystals (Mancinelli et al. 2004 ) ,

in polar regions (Deming 2002 ) and even in nuclear reactors (Rothschild and

Mancinelli 2001 ) . Microorganisms are indispensable as they perform numerous

functions to support life on this planet. The increasing world population has put

enormous pressure on our natural resources which are depleting at an alarming

rate. Microbial Biotechnology and the management of natural processes have a

vital role to play in protecting these depleting resources. Microorganisms also

play a key role in addressing big challenges in health care (Production of new

antibiotics and vaccines), nutritional security (Single cell proteins and production

of dairy products), and climate change (Production of effective Biofertilizers and

Biopesticides). But to harness above bene ﬁ ts, less than 1% of the estimated num-

ber of microbial species are described and available to man. As new species are

discovered, the expertise is dif ﬁ cult to locate to ensure their correct identi ﬁ cation

as a result this human resource is diminishing day by day. It is thus crucial that the

microbial diversity of the world is not lost and that it is identi ﬁ ed, characterized

and exploited in a sustainable way for the bene ﬁ t of humankind. Culture

Collections have an important role in safeguarding of microbial diversity for

future use, thereby providing the biological resource to underpin research and

development. Culture Collection Centers, or Microbial Resource Centers or

Microbial Gene Banks are centers where microorganisms of scienti ﬁ c or indus-

trial research are maintained in viable form. In addition to collection and mainte-

nance of microorganisms, microbial resource centers also distribute authentic

microbial strains (algae, bacteria, fungi, yeast, protozoa and viruses) and/or their

products (Genomes, Plamids, cDNAs) to the researchers and industrialists all over

the world. Microbial resource centers are regarded as living libraries holding

microbes and represent dynamic institutions of learning, research, scienti ﬁ c culture

and information (Arora et al. 2005 ) . There is a need to ensure that these centers

take advantage of the latest technologies available and the constraints faced by

3 Microbial Resource Centers Towards Harnessing…

them in terms of ﬁ nancial support be overcome so that they can deliver long lasting

solutions to the aforementioned problems in addition to the enhancement of

knowledge. The increasing demand for microbial resource and the size of this rela-

tively untapped and hidden resource offers justi ﬁ cation for an increase in number,

scope and quality of Microbial Resource Centers. For the sake of convenience the

term “Culture Collection Centers” instead of “Microbial Resource Centers” will

be used here after.

3.2 History of Culture Collections

Collection of microorganisms have come a long way, from beginnings in the 1890s

with Kral’s collection in Prague and the collection at the Institute Pasteur, Paris, to

the resource centers of 2010 driven by excellence. The discovery of the pure culture

technique by Robert Koch lead to the idea of Culture Collections Centers, and the

ﬁ rst Culture Collection to provide services was established by Prof. Frantisek Král

in 1890 at the German University of Prague (Czech Republic) (Kocur 1990 ) . Kral

(1846–1911) worked for about 30 years for the glass manufacturing company

Venceslaw Batka; afterwards, he worked as a technician at the Institute of Hygiene

of the German University of Prague. His experience with manufacturing laboratory

glass products was the reason he was subsequently chosen as director of the bacte-

rial collection by Prof. Soyka. Then because of his experience in isolating, cultivat-

ing and maintaining microorganisms, he was appointed Associate Professor of

Bacteriology. In 1900, Kral published the ﬁ rst catalogue of microorganisms from a

Culture Collection (Uruburu 2003 ) . After his death in 1911, the charge was taken

over by Professor Ernst Pribham who transferred it to the University of Vienna

where he issued several catalogues listing the holdings of the collection. Part of this

collection was brought to Loyola University in Chicago by Prof. Pribham in the

1930s. After Prof. Pribhams death many of the collection’s cultures were subse-

quently transferred to the American Type Culture Collection (ATCC). Unfortunately,

the Vienna portion of the Pribham’s Collection was largely lost during World War II

(Brenner et al. 2005 ) . Following Kral’s collection, many Culture Collection centers

were established. Currently, the oldest known collections are the Mycothèque de

l’Universitée Catholique de Louvain (MUCL) established in 1894, in Louvain,

Belgium, and the Collection of the Centraalbureau voor Schimmelcultures (CBS)

founded in 1906, in Utrecht, the Netherlands (Uruburu 2003 ) .

3.2.1 Establishment of the World Federation of Culture

Collections (WFCC)

The foundation stone for coordination among Culture Collections was laid down by

Prof. P. Hauduroy in 1946 with the establishment of the centralized information

facility at the University of Lausanne, Switzerland (Uruburu 2003 ) . The facility

S.A. Lone et al.

maintained information about the strains deposited in different collections and also

published an information bulletin regarding the same. The Lausanne Center later

became associated with the International Association of Microbiological Societies

(IAMS, now named the International Union of Microbiological Societies, IUMS)

and in cooperation with it; an International Federation of Type Cultures was formed

with the aim of repairing the damage caused to Culture Collections during World

War II. In 1962, a Culture Collections Conference was held in Ottawa (Canada), and

the IAMS was recommended that a section on Culture Collections be set up, which

came into being in 1963. Prof. Skerman (Australia) was the ﬁ rst chairman of the

section; other members of the steering committee were Krasilnikow (Russia), Asai

(Japan), Van Beverwijk (Netherlands), Martin (Canada), Donovick (USA) and Steel

(UK). After reorganization of IAMS in the year 1970, this section became the World

Federation for Culture Collections (WFCC), which has been active since then. The

World Federation for Culture Collections (WFCC) is a COMCOF (Committees,

Commissions and Federations) of the International Union of Microbiological

Societies (IUMS) and a scienti ﬁ c member of the International Union of Biological

Sciences (IUBS). Its key objective is the promotion and development of collections

of cultures of microorganisms and cultured cells. Retention and support of existing

collections, as well as assistance and advice to help new collections become estab-

lished remain key activities. The World Data Center for Microorganisms (WDCM)

was set up as a data center of WFCC; the WDCM is a vehicle for networking micro-

bial resource centers of various types of microbes. It also serves as an information

resource for the customers of the microbial resource centers. WFCC consists of

several committees and organizes the International Congress of Culture Collections

(ICCC) every 4 years.

3.3 Status of Culture Collections

There are 619 Culture Collection centers in 71 countries registered in the World

Data Center for Microorganisms (WDCM) (Table 3.1 ). The WDCM holds informa-

tion of 2,015,030 microorganisms among which 958,973 are bacteria, 534,464 are

fungi, 32,916 are viruses and 8,703 are cell lines. The numbers of representative and

type strains of microorganisms held in Culture Collections of the world are shown

in Table 3.2 . These collections are supported by different sources of funding

(Table 3.3 ). Two hundreden sixty one collections out of 619 produce catalogues of

holdings and update it at regular intervals. The number of cultures maintained in

each collection varies from country to country depending upon the type of microor-

ganisms they preserve, and the number of cultures they receive. As per WDCM the

top 20 countries holding the largest number of cultures are (Table

3.4 ). The WDCM

data re ﬂ ect the world-wide imbalance in collection holdings. While most countries

such as classi ﬁ ed as mega diverse countries host 60–70% of the planets biodiversity,

while greatest diversity lies outside these regions. As an example Europe has a lower

presence of biodiversity compared to other continents, this lower biodiversity is

3 Microbial Resource Centers Towards Harnessing…

Table 3.1 Culture Collection centers registered with WDCM

Country Culture collections Cultures

Europe

Armenia 1 17,805

Austria 2 6,070

Belarus 1 1,175

Belgium 6 58,252

Bulgaria 4 13,354

Czech Republic 13 9,251

Denmark 3 86,951

Estonia 4 13,300

Finland 2 7,713

France 37 67,257

Germany 13 51,582

Greece (Hellenic Rep.) 6 5,292

Hungary 8 11,390

Ireland 1 380

Italy 10 14,670

Kazakhstan 2 199

Latvia 1 692

Netherlands 6 79,775

Norway 2 2,602

Poland 9 8,464

Portugal 5 7,035

Romania 2 760

Russian Federation 17 48,920

Slovakia 3 4,916

Slovenia 2 4,160

Spain 4 9,027

Sweden 3 52,700

Switzerland 3 3,598

Turkey 9 4,364

U.K. 18 82,132

Ukraine 7 4,583

Uzbekistan 3 1,443

Yugoslavia 2 897

Total 209 680,709

Africa

Egypt 1 1,808

Morocco 1 913

Nigeria 2 223

Senegal 1 210

South Africa 3 10,860

Uganda 1 550

Zimbabwe 2 702

Total 11 15,266

(continued)

S.A. Lone et al.

Table 3.1

(continued)

Country Culture collections Cultures

America

Alaska 2 NA

Argentina 12 7,073

Brazil 60 145,992

Canada 19 77,841

Chile 1 NA

Colombia 2 4,347

Cuba 11 7,791

Mexico 16 7,824

U.S.A. 21 210,276

Venezuela 3 258

Total 147 461,402

Asia

Bangladesh 2 NA

China 24 88,373

Hong Kong 1 60

India 25 215,359

Indonesia 17 10,505

Iran 8 6,517

Israel 4 776

Japan 25 232,717

Korea (Rep. of) 21 122,096

Malaysia 6 2,513

Mongolia 1 1,500

Pakistan 6 2,653

Philippines 6 3,392

Singapore 3 1,389

Sri Lanka 4 136

Taiwan 2 29,692

Thailand 59 43,106

Vietnam 1 6,449

Total 215 767,233

Oceania

Australia 34 72,040

New Zealand 7 16,947

Papua New Guinea 1 270

Total 42 89,257

Source : WDCM (

2012 ) , NA data not available

attributed to its small size, distance from tropics and mountain ranges resulting in

less species migration (Steck and Pautasso 2008 ) . Despite less biodiversity European

countries hold 33% of the Culture Collections and 41% of the microorganisms. On

the other hand Colombia is one of the 17 countries of mega diversity, but it has only

two Culture Collections holding a total of 4,092 cultures. Similarly, China has a

huge biodiversity because of a vast territory of complex climates and very diverse

geography. China is also one of the largest countries with respect to agricultural

3 Microbial Resource Centers Towards Harnessing…

Table 3.2 Representative and type strains of microorganisms collected

in the world

Strain No. of species/sub-species

Algae 3,060

Archaea 460

Bacteria 16,495

c DNA 15

Cell lines_animal 401

Cell lines_plants 0

Fungi 25,592

Hybridomas_animal 0

Hybridomas_plants 0

Lichens 0

Plasmids 648

Protozoa 60

Vectors 1,783

Viruses_animal 66

Viruses_bacteria 976

Viruses_plants 84

Yeasts 1,200

Source : WDCM (

2012 )

Table 3.3 Type of ﬁ nancial sources of the Culture Collections regis-

tered with WDCM

Type of support No. of collections

Governmental 245

University 232

Semi-governmental 58

Private 35

Industry 17

Source : WDCM (

2012 )

productivity harboring more than 30,000 ﬂ owering plants, 30 species of grain, 200

types of vegetables and 300 types of fruit trees. With respect to microbial diversity

China harbors 30,000 fungi and 16,000 bacteria. However according to Hawksworth’s

(Hawksworth 2001 ) formula for 30,000 ﬂ owering plants there must be 180,000

fungi (Smith 2003 ) . But there are only 24 collections registered at WDCM with

88,373 strains of bacteria and fungi. India is one among the 12 countries of megad-

iversity endowed with enormous variability with respect to microbes (bacteria,

cyanobacteria, fungi and viruses) (Arora et al. 2005 ) . But lack of adequate support

and expertise hampers the discovery of novel microbes and their products. There are

25 Culture Collections in India registered with WDCM holding 215,359 microbes.

Despite a large number of new microbial genera and species being discovered and

their biotechnological potential being emphasized, the data on Indian microbial

resources remain mostly with the investigators and in papers published by them

(Arora et al. 2005 ) . There is no cohesive information available about how many of

these potential microbes have been preserved for future use; as a result the status of

S.A. Lone et al.

Table 3.4 Top 20 strain holders registered with WDCM

Rank Country Total hold

1 Japan 232,717

2 India 215,359

3 U.S.A. 210,276

4 Brazil 145,992

5 Korea (Rep. of) 122,096

6 China 88,373

7 Denmark 86,951

8 U.K. 82,132

9 Netherlands 79,775

10 Canada 77,841

11 Australia 72,040

12 France 67,257

13 Belgium 58,252

14 Sweden 52,700

15 Germany 51,582

16 Russian Federation 48,920

17 Thailand 43,106

18 Taiwan 29,692

19 Armenia 17,805

20 New Zealand 16,947

Source : WDCM (

2012 )

the culture preservation remains unclear. There is an urgent need for awareness

among researchers regarding importance of culture preservation in India; the same

can be achieved by conducting workshops and trainings regarding the importance of

strain conservation by Culture Collections of the country in a coordinated manner.

Meanwhile a database containing collective information of the existing microbial

diversity should be developed and made public. This will help researchers to avoid

repetition with respect to microbial isolation and to focus on existing but unex-

plored taxa and their exploitation.

3.4 Roles of Culture Collections

Since the beginning of microbiology as science, a huge number of microorganisms

was isolated from a wide variety of natural sources, and used for scienti ﬁ c research

and the industrial fermentation. However, a large number of important microorgan-

isms had been lost in the past due to the change of interest of researchers and/or

dif ﬁ culties in maintaining the cultures in their original form. Though potential prop-

erties of microorganisms have been developed over a period of time by studying the

microbial cultures maintained in Culture Collections, adequate and reliable sources

of properly preserved cultures are needed to conduct application oriented research.

In order to maintain a large number of microorganisms being isolated through various

3 Microbial Resource Centers Towards Harnessing…

microbial diversity programs and to cope up with the improvement of existing

strains, well-organized collections are needed as depositories and for the promotion

of research. Collections serve as repositories for valuable isolates of historical,

geographical, taxonomic, agricultural, medical, veterinary, or industrial signi ﬁ cance

(Sigler 2004 ) . Roles of Culture Collections are to collect, maintain and distribute

authentic cultures and information about them to the researchers all over the world

(Fig. 3.1 ).

The range of services provided by individual collections may vary considerably; the

services offered by some major Culture Collections worldwide are summarized as:

3.4.1 Accession and Deposition of Cultures

Acquisition of new strains and/or their genetic elements forms an essential part of

Culture Collections. Each collection has developed certain criteria for accepting

new strains depending upon interests, resources and assessment of probable future

needs. Speci ﬁ c groups of microorganisms are dealt by specialized curators, who

conduct research in their particular ﬁ eld of interest, maintain contact with active

workers in the ﬁ eld and are responsible for enhancement of their collections with

new acquisitions. Some general categories of microorganisms considered for acqui-

sition are as follows

(A) Published strains of newly named taxa

(B) Type, neotype and selected reference strains, speci ﬁ c and unique biotypes

tance test, degradation etc.)

(D) Strains of special signi ﬁ cance to agriculture, biotechnology, medicine,

education etc.

Collect

Preserve

Roles

Deposit

Identify/

Verify

Analyze/

Research

Educate/

Train

Distribute

Fig. 3.1 Roles of culture

collections ( Source : Sigler

2004 )

S.A. Lone et al.

(E) Strains mentioned in patent applications

(F) Genetically manipulated strains, plasmid carriers, special mutants etc.

According to the International Code of Bacteriological Nomenclature , for a

valid publication of a new species its type strain must be designated and be depos-

ited in one or more of the established Culture Collections. Similarly, for adequate

documentation of each newly isolated strain, the editors of scienti ﬁ c journals rec-

ommend proper deposition of new isolates before publication. Most of the culture

collections require completion of a requisition form for each deposit in which

speci ﬁ c information such as the source of isolation, history, taxonomic status, pub-

lished data, special properties, reason(s) for deposit, growth medium, incubation

temperature and generation time, pH and optimum procedure for long term preser-

vation are to be given.

3.4.2 Preservation

In nature microorganisms occur in mixed populations of diverse or closely related

species. Different strains or species exhibit different properties, thus require special

preservation methods to ensure optimal viability, storage, and purity. In order to min-

imize the probability of strains being lost, each strain should, whenever practical, be

maintained by at least two different procedures. At least one of these should be by

freeze-drying (lyophilisation) or storage at ultra low temperature in liquid nitrogen or

mechanical freezers maintaining temperatures of −140° C or lower (cryopreserva-

tion); these are the best methods for minimizing the risks of genetic change. In some

cases, for example cell lines, where only freezing is available, duplicates should be

stored in separate refrigerators with different electrical supplies.

3.4.3 Supply of Culture

Since the Culture Collections are authentic repositories for proper maintenance of

valuable microbes and their products, it is expected that they supply viable and

authentic strains for research; teaching or applied purposes and they do so with high-

est level of accuracy. Normally, a nominal fee is charged for each culture supplied but

as a general rule, Culture Collections supply cultures to other collections on an

exchange basis. Patent strains are usually restricted and are supplied to only autho-

rized persons under certain conditions (Crespr

1985 ) . Cultures purchased from a

collection are guaranteed for viability, purity and to certain extent, according to the

properties cited in publications or collections’ catalogue. However, the characteris-

tics of certain strains having plasmid(s), mutants and phage hosts may change during

storage and may differ from the properties cited in literature. For this reason, Culture

Collections often emphasize that recipients of strains should report discrepancies if

any faced by them.

3 Microbial Resource Centers Towards Harnessing…

Certain regulations must be observed while importing cultures from other countries:

license or import permits may be required for this purpose. Universal Postal Union lays

down common regulations about packing and shipping of cultures. The details on

export and import restrictions of microorganisms are often published in the News Letter

of WFCC .

3.4.4 Research, Consultancy and Training

In addition to service functions, Culture Collections carry out research on taxonomy

and identi ﬁ cation of microorganisms. Several collections offer training facilities in

their ﬁ eld of specialization and provide advisory and consultation services on such

matters to the collections’ staff from medical, environmental, industry, or government

laboratories, who have responsibilities for isolating and identifying microorganisms,

diagnosing disease, quality control, fermentation and collection management.

Training courses on management of Culture Collections in general, modern preservation

techniques and in applied microbiological research are organized and conducted by

experienced staff of major Culture Collections of national and international level.

Under the auspices of WFCC such training courses are mostly linked with the

International Conference on Culture Collections (ICCC).

3.4.5 Strain Data and Information

As per WFCC guidelines it is mandatory for a Culture Collection to maintain the

records of their holdings. Records of each strain held should at least contain following

categories of information:

Place •

Substrate or host •

Date of isolation •

Name of person isolating the strain •

Depositor (or other source of the strain, such as from another Collection) •

Name of the person identifying the strain •

Preservation procedures used •

Optimal growth media and temperatures •

Data on biochemical or other characteristics •

Regulatory conditions applying (relating for example to quarantine, containment •

levels and patent status)

WDCM provides for an ef ﬁ cient coding of the strains by de ﬁ ning a collection

acronym and WFCC number which allows each Culture Collection to give a Globally

Unique Identi ﬁ er (GUID) to each strain of its holding, combining their acronym with

their own internal numbering. The pioneering work of WDCM enables an appropriate

S.A. Lone et al.

recording and management of the documentation related to the strains. Collections

should use this system to be part of the WDCM network and to be connected to the

international scienti ﬁ c community.

Printed or on line catalogues of the strains containing above mentioned informa-

tion should be produced and updated at regular intervals. Cultures with restricted

distribution should be clearly marked and the ones that are not available for distribu-

tion should not be mentioned in catalogues or publicly accessible databases.

Whenever resources permit, the records should be computerized also.

3.5 Constraints Faced by Culture Collection Centers

The effective curation and management of a Culture Collection is a demanding task.

Since growth patterns and preservation methods vary among microorganisms, spe-

cial attention has to be paid to each and every individual microbe in order to ensure

optimal viability and ultimate purity during storage. Commitment to the mainte-

nance of the collection and its services in the long-term should therefore be included

in the strategic plans or objectives of the parent organization as appropriate.

Following are a few major constraints faced by microbial Culture Collections with

respect to providing up to date facilities for strain acquisition, preservation and dis-

tribution of strains.

3.5.1 Funding Levels

Culture Collection centers are critical components of the scienti ﬁ c infrastructure.

The consequence of inadequate funding of Culture Collections on the scienti ﬁ c

community would result in inadequately characterized and documented biological

materials, and inadequately specialized expertise in preservation, maintenance and

characterization of biological materials. This could ultimately lead to piling up of

unrecognized errors. Moreover, the scienti ﬁ c community depends upon research done

by individual workers that includes cultures also, unnecessary duplications would

occur resulting in squandering of public investment into biological research. Finally,

inadequate support of such an important and dynamic scienti ﬁ c infrastructure could

lead to the loss of important microbes of commercial importance. Moreover lack of

research training opportunities as a result of limited funds could lead to disintegration

of research in Culture Collection (isolation and rapid identi ﬁ cation of strains and

microbial systematics) with other ﬁ elds of research (genomics, ecology and molecular

evolution). Keeping in mind the potential threats posed to the microbial resources it is

of immense importance the federal agencies put in more efforts in terms of providing

suf ﬁ cient funds to the resource centers so that microbes of importance can be stored

and propagated in the most ef ﬁ cient way.

3 Microbial Resource Centers Towards Harnessing…

3.5.2 Orphaned Collections

With the change in research directions or priorities and/or loss of the key position

associated, Culture Collections are often rendered vulnerable to being orphaned, i.e.

abandoned by the institution holding it. Once abandoned it becomes hard to mount

an effective campaign to save them, which ultimately results in the loss of a natural

bounty of microorganisms and the decades of toil that have been put in the collection,

characterization and establishment of effective strains goes astray.

3.5.3 Staff

Since most of the living materials/microorganisms are sensitive they must be dealt

in a timely manner or else there is a chance of losing them. Since routine accessions,

preservation, maintenance and viability checking are time consuming and often

involve expertise, an adequate number of well trained permanent technical staff

must be recruited to perform the job. Untrained or poorly trained individuals are

often an impediment to short-staffed collections because if left unsupervised, they

may introduce contamination or replacement errors that may not be discovered until

it is too late to avoid permanent loss. Such errors undermine the credibility of the

collection as scientists are reluctant to acquire misidenti ﬁ ed material. As noted

above, professional staff, especially taxonomists, are crucial to the long-term future

and viability of collections. They are required to secure funding, provide advisory

or consulting services, keep accessions taxonomically up-to-date, and ensure con-

tinued development of the collection through acquisition of new material.

3.5.4 Space and Equipment

In order to accommodate a large number of collections large space and equipment

is required. Most Collection Centers in general and the ones at universities in

particular are short of suf ﬁ cient space and equipment, the latter are required for

basic work like, autoclaving, microscopy, refrigeration and cryopreservation of

the obtained cultures.

3.5.5 Information and Website Management

In order to allow users easy and rapid access to information on microbial resources,

database searching, access to protocols, preserved stocks, shipping forms and cata-

logues should be made easier and user friendly. Moreover the information regarding

S.A. Lone et al.

acquisition of new strains should be updated periodically. Though major collections

have searchable internet databases that are easily accessible by users worldwide,

from the user’s prospective there is a disadvantage that Web-based data from different

collections are not harmonized, and it may be dif ﬁ cult for users to accumulate the

data from different sources. Keeping the above dif ﬁ culty in mind, it is of prime

importance that the information in a particular database of a Culture Collection

synchronizes with that of the other Collections i.e. the web layout, formats and

procedures for availing stains must be uni ﬁ ed across all collection centers.

3.5.6 Culture Exchange

Distribution of cultures is a fundamental role of any Culture Collection, but this

important feature is negatively impacted by regulations governing safe handling,

containment, classi ﬁ cation of agents according to risk, packaging and shipping of

biological materials and infectious agents, and prohibitions governing agents

deemed as possible biological weapons. Although need for some regulations with

respect to safe handling and transport of microorganisms is understood, at the same

time the regulations must be harmonized with respect to stringency. As regulations

become more stringent, the suppliers (Collections) as well as the users (Scientists)

become over burdened with the increasing administrative procedures and cost

involved (see Padhye et al. 1998 ) . Priorities for collections at both the international

and national level are to (1) develop consensus in risk (hazard) classi ﬁ cation of

organisms, (2) change regulations governing transport of Risk level 2 organisms,

and (3) provide a more streamlined system for permits (Sigler 2004 ) .

3.6 Related Links

Biological Resource Centers (BRCs) : are both service providers and repositories

of living cells, genomes of organisms, and information relating to heredity and the

functions of biological systems. BRCs contain collections of culturable organisms

(e.g. microorganisms, plants, animal and human cells), replicable parts of these

(e.g. genomes, plasmids, viruses, and cDNAs), viable but not yet culturable organ-

isms, cells and tissues, as well as databases containing molecular, physiological

and structural information relevant to these collections and related bioinformatics

(

http://www.oecd.org/document/51/0,3343,fr_2649_37437_33791027_1_1_1_37

437,00.html ).

Global Biological Resource Centre Network (GBRCN) : a network designed

to accommodate the future needs of biotechnology and biomedicine ( http://www.

gbrcn.org/ ).

Convention on Biological Diversity (CBD) : an international treaty (1992) to

sustain the diversity of life on Earth ( http://www.cbd.int/convention/ ).

3 Microbial Resource Centers Towards Harnessing…

World Data Centre for Microorganisms (WDCM) : an electronic gateway to

databases on microbes and cell lines and resources on biodiversity, molecular biology

and genomes ( http://www.wfcc.info/datacenter.html ).

European Consortium of Microbial Resources Centers (EMbaRC) : an EU

funded project that aims to improve, coordinate and validate microbial resource

centre delivery to researchers from both public and private sectors. The EMbaRC

project is a mixture of networking, access, training and research (

http://www.

embarc.eu/ ).

Organization for Economic Cooperation and Development (OECD) : an

international organization helping governments tackle the economic, social and

governance challenges of a global economy. OECD Best Practice Guidelines for

BRCs are given in ( www.oecd.org ).

World Federation for Culture Collections (WFCC) : a federation within the

International Union of Microbiological Societies (IUMS) concerned with the

collection, authentication, maintenance and distribution of cultures of microor-

ganisms and cultured cells ( http://www.wfcc.info/datacenter.html ).

Common Access to Biological Resources and Information (CABRI) : a previ-

ously funded EU project aiming at providing biological resources and quality guide-

lines to users ( http://www.cabri.org/ ).

European Culture Collections’ Organization (ECCO) : a consortium of

European collections to promote collaboration and exchange of ideas and informa-

tion about all aspects of Culture Collection activity ( http://www.eccosite.org/ ).

European Biological Resource Centers Network (EBRCN) : a previously

funded EU project dealing with issues raised by the OECD Initiative on BRCs

( http://www.cabri.org/FAQ/faq.html ).

International Code of Nomenclature of Prokaryotes : governs the scienti ﬁ c

names for prokaryotes and the rules for naming taxa of bacteria ( http://www.ncbi.

nlm.nih.gov/bookshelf/br.fcgi?book=icnb&part=A185 ).

Knowledge-based bioeconomy : a concept that transforms life-sciences knowl-

edge into new, sustainable, eco-ef ﬁ cient and competitive products ( http://cordis.

europa.eu/fp7/kbbe/about-kbbe_en.html ).

3.7 Conclusion and Future Prospects

In summary, Culture Collections differ with respect to diversi ﬁ cation and focus of

phylogenetic and metabolic diversity of the taxa maintained. Financial support and

history of collections are the two main criteria that determine size of individual

holdings and the expertise of curators.

The World Data Centre for Microorganisms (WDCM) currently lists 619 collec-

tions, some public, others academic or commercial, in 71 countries, but this appar-

ently impressive number does not re ﬂ ect the ongoing struggle of the vast majority

of collections, for at least medium term funding. Only a few collections established

in the early era of microbiology survived the politically and scienti ﬁ cally turbulent

S.A. Lone et al.

twentieth century. There is no data available on the number of microbial collections,

their founding and their shut- down dates over the 120 year history of microbial

holdings. No one can estimate the number of once properly maintained, irrecover-

able valuable strains that were discarded due to the abandonment of facilities. These

ﬁ gures re ﬂ ect a major loss and mankind has suffered, as many of these strains would

have been exploited for various purposes related to agricultural productivity, crop

protection, health care and bioremediation aspects. It is thus essential that special-

ized databases on microbial genetic diversity be established and integrated in a more

coordinated manner in order to prevent loss of valuable microbial strains.

With focus on biodiversity and bio-prospecting, Culture Collections of micro-

organisms play an important role in an ongoing exploration of the microbial

world. In such a situation Culture Collections are encouraged to implement the

best techniques available (both biochemical and molecular) for prospecting of

novel microorganisms with novel bene ﬁ cial attributes, which can later be tailor

made to ﬁ nd solutions to problems humanity is facing in terms of nutritional secu-

rity and environmental resilience. In order to strengthen the status of microbial

collections, following key issues are to be addressed (1) collections that aim to

receive the status of being a Biological Resource Center (BRC) need improvement

and expansion in research, training, bioinformatics and data management, (2) any

expansion to the areas mentioned therefore will need more expert curators and

technical staff, (3) strategies that encourage authors to deposit a larger number of

strains to the public domain are to be devised and executed, (4) the possibility that

many collections cover the same range of microorganisms may be excluded by

expanding collections in a speci ﬁ c area, availing diverse funding schemes and by

varying collections’ focus. Moreover, the Culture Collection centers must be in

touch with all microbiologists, collection users, editors and research program

funders to ensure that all important strains with key attributes arising from differ-

ent research programs are preserved for future use.

References

Amils R, Gonzalez-Toril E, Fernandez-Remolar D, Gomez F, Aguilera A, Rodrıguez N, Malki M,

Garcıa-Moyano A, Fairen AG, de la Fuente V, Sanz JL (2007) Extreme environments as mars

terrestrial analogs: the Rio Tinto case. Planet Space Sci 55:370–381

Arora DK, Saikia R, Dwievdi R, Smith D (2005) Current status, strategy and future prospects of

microbial resource collections. Curr Sci 89(3):488–495

Brenner DJ, Krieg NR, Staley JT, Garrity GM (2005) Bergey’s manual of systematic bacteriology,

2nd edn. Springer, New York, pp 111–112

Cnespr RS (1985) Microbiological inventions and the patent law-the international dimension.

In: Russel GE (ed) Biotechnology and genetic engineering reviews, vol 3. Intercept, New

Castle upon Tyne, 37 pp

Colwell RR (1997) Microbial diversity: the importance of exploration and conservation. J Ind

Microbiol Biotechnol 18:302–307

Deming JW (2002) Psychrophiles and polar regions. Curr Opin Microbiol 5:301–309

Hawksworth DL (2001) The magnitude of fungal diversity: the 1.5 million species estimate revisited.

Mycol Res 105:1422–1432

3 Microbial Resource Centers Towards Harnessing…

Convention on Biological diversity (2012) Home pages of History of Convention.

http:// www.cbd.

int/history/

. Accessed 24 June 2012

Kato S, Hara K, Kasai H, Teramura T, Sunamura M, Ishibashi J, Kakegawa T, Yamanaka T, Kimura

H, Maruma K, Urabe T, Yamagishi A (2009) Spatial distribution, diversity and composition of

bacterial communities in subsea ﬂ oor ﬂ uids at a deep-sea hydrothermal ﬁ eld of the Suiyo

Seamount. Deep-Sea Res 56:1844–1855

Kocur M (1990) History of the Kral collection. In: Sly L, Kirsop B (eds) 100 years of culture

collections. Institute for Fermentation, Osaka

Kumar B, Trivedi P, Mishra AK, Pandey A, Palni LMS (2004) Microbial diversity of soil from two

hot springs in Uttaranchal Himalaya. Microbiol Res 159:141–146

Mancinelli RL, Fahlen TF, Landheim R, Klovstad MR (2004) Brines and evaporites: analogs for

Martian life. Adv Space Res 33:1244–1246

Padhye AA, Bennett JE, McGinnis MR, Sigler L, Flis A, Salkin IF (1998) Biosafety considerations

in handling medically important fungi. Med Mycol 36:258–265

Rothschild LJ, Mancinelli RL (2001) Life in extreme environments. Nature 409:1092–1101

Sigler L (2004) Culture collections in Canada: perspectives and problems. Can J Plant Pathol

26:39–47

Smith D (2003) Culture collections over the world. Int Microbiol 6:95–100

Steck CE, Pautasso M (2008) Human population, grasshopper and plant species richness in

European countries. Acta Oecol 34:303–310

Uruburu F (2003) History and services of culture collections. Int Microbiol 6:101–103

World Data Center for Microorganisms (WDCM) (2012) Home pages of culture collections in the

world.

http://wdcm.nig.ac.jp/hpcc.html . Accessed 23 June 2012

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_4, © Springer Science+Business Media Dordrecht 2013

Abstract Fungal ﬂ ora is considerably rich and diverse. Biodiversity of fungal ﬂ ora

in a region is represented by a number of taxonomic groups in different habitats.

The rich diversity of fungus in the form of fungal biocontrol agents are now being

potentially explored as an important tool in the management of plant diseases.

Excessive use of pesticides results in the form of pest resistance, disturbance in

ecosystem due to destruction of natural enemies and environmental pollution which

leads to health problems. Thus fungal biocontrol agents have high potential to

replace the use of synthetic chemicals. Some of the most widely used biocontrol

agents in the world belong to the fungal genus Trichoderma . In particular isolates of

Trichoderma harzianum , T. virens , T. hamatum , are used against diseases in a wide

variety of economically important crops. They have been used with success against

soilborne, seedborne, storage rots and diseases in the phyllosphere. T. harzianum

and Gliocladium viren s have been successfully used against Botrytis cineria in dif-

ferent crops. Many other fungi have been shown to antagonize and inhibit numerous

fungal pathogens of aerial plant parts. Chaetomium , Tuberculina maxima , Verticillium

lecanii , Ampelomyces quisqualis , Tilletiopsis and Gonatobotrys simplex are some of

the most effectively used biocontrol agents against Athelia bombacina , Venturia

inequalis , Cronartium ribicola , Puccinia , Erysiphe ovata , Sphaerotheca fuliginea

and Alternaria alternata respectively. This review provides a broad perspective on

the range of diversity of fungal biocontrol agents available for commercial exploita-

tion, mechanism, commercial formulations in use and bottle necks in biocontrol of

plant diseases. The fungal bioagents are expected to have great potential in addressing

some of the key pest problems in the near future.

Keywords Fungal biodiversity • Biocontrol agent • Plant disease management

• Hyperparasitism

S. Ashraf (*) • M. Zuhaib

Department of Plant Protection, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh , Uttar Pradesh 202002 , India

e-mail: shabbiragri@yahoo.co.uk

Chapter 4

Fungal Biodiversity: A Potential Tool

in Plant Disease Management

Shabbir Ashraf and Mohammad Zuhaib

S. Ashraf and M. Zuhaib

1 Introduction

Presently “fungi” as a mega-diverse group, span three kingdoms, most belonging to

the Fungi (Eumycota), while others are classi ﬁ ed in the Protozoa and Chromista

( Straminipila ) (Cavalier-Smith

1998 , James et al. 2006b ) . In the history of mycology,

it was predicted that the fungi are the most diverse, in terms of species richness and

render mycology to be larger than the rest of botany (Fries 1825 ). While Pascoe

( 1990 ) gave particular reference of Australia and suggested that there were at least

ten times as many fungi as vascular plants. Data from 25 studies in different parts of

Asia, Europe and North America were analyzed statistically by Schmitt and Mueller

and the results showed that fungal species richness was much higher than that of the

plants, and were consistent with the high estimates of species numbers made by

Hawksworth ( 1991 ) which was about 1.5 M species and the ﬁ gure has been widely

cited and accepted. Based on information in the US National Fungus Collection data-

base, Rossman ( 1994 ) studied thoroughly on fungal diversity by estimating the num-

ber of particular species found worldwide (Table 4.1 ). Among the fungal groups

discussed, Basidiomycetes, Gasteromycetes, Ascomycetes, Myxomycetes and

Chytridiomycetes comprise of important fungi responsible for plant diseases which

are the major constraints in the pro ﬁ table cultivation of crops. Potentially immortal

fungi spread their tentacles everywhere. In 1845, when potato late blight fungus

caused havoc in Ireland and soon after downey mildew fungus, Plasmopara viticola

threatened the wine industry in France. Apple scab, which threatened apple cultiva-

tion, Panama disease of banana, Wilt disease of pigeonpea, chickpea, castor and

guava, rust and smut of cereals are some of the serious fungal diseases.

For the management of fungal diseases, synthetic fungicides are usually applied

as effective, dependable and economical control measures. However, the indis-

criminate use of chemical fungicides has resulted in several problems, such as

toxic residues in food, water and soil and disruption of the ecosystem, leading to

the fear that their regular use may pollute the environment further. Hardly 0.1% of

the agrochemicals used in crop protection reach the target pest, leaving the remain-

ing 99.9% to enter the environment to cause hazard to non-target organisms,

including humans (Pimentel and Levitan 1986 ). At present about 150 different

fungicidal compounds, formulated and sold in several fold larger number of differ-

ent proprietary products, are used in the agriculture world. The value of fungicides

of the major crop groups and the importance of the dynamic nature of the fungicide

market was reported by Phillips McDougall ( 2006 ) and who also gave the total

value of fungicide sales which is approximately 7,491 million US dollars. According

to WHO estimates, approximately 0.75 million people get ill every year with pes-

ticide poisoning. Moreover resistance of pathogens to fungicides has rendered

many fungicides ineffective, giving rise to new physiological races ( forma specia-

lis ) of pathogen. Biological control is potentially a sustainable solution to manage

plant disease in developing as well as developed countries, due to its long term

effect and without any side effects. Host resistance augmented with biological con-

trol measures, especially with mycoparasites can be most useful and ecofriendly for

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

controlling important fungal diseases. The biological control agents act against

plant pathogens through different modes of action. Antagonistic interaction may

include antibiosis, competition and hyperparasitism (Cook and Baker 1983 ). There

is competition when two or more microorganisms compete for the same resources

may be space, nutrition and oxygen. Antibiosis is release of antibiotics or toxic

metabolites which have direct inhibitory effect on another (pathogen).

Hyperparasitism or predation results from biotrophic or necrotrophic interactions

that lead to parasitism of plant pathogen by the biological control agent. The most

important well studied antagonists against several plant pathogens are fungi like

Trichoderma spp . (particularly T. hamatum , T. harzianum , T. viride ), Ampelomyces

quisqualis , Aspergillus , (particularly A. niger , A. terreus ), Chaetomium globosum ,

Coniothyrium minitans , Fusarium spp ., Gliocladium virens , Penicillium citrinum ,

Peniophora gigantea , and Sporodesmium spp .

It was no doubt to say that fungal biodiversity is a potential tool in plant disease

management. This review will focus on the recent developments in the ﬁ eld of

Table 4.1 Major groups of fungi and estimated world species numbers as

compiled by Rossman (

1994 )

Group Species world wide

Well-known

Aphyllophorales s . lat . 20,000

Macrolichens 20,000

Moderately well-known

Agaricales s . lat . 80,000

Dematiaceous and aquatic hyphomycetes 80,000

Uredinales 50,000

Hypocreales and Xylariales 50,000

Ustilaginales 15,000

Gasteromycetes 10,000

Erysiphales 10,000

Jelly fungi s . lat . 5,000

Pezizales 3,000

Myxomycetes 1,500

Endomycetales (true yeasts) 1,000

Poorly known

Non-dematiaceous hyphomycetes 200,000

Coelomycetes 200,000

Other perithecioid ascomycetes 100,000

Helotiales 70,000

Insect-speci ﬁ c fungi 50,000

Crustose lichens 20,000

Mucorales 20,000

Oomycetes 20,000

Chytridiomycetes 20,000

Endogonales and Glomales 1,000

Total 10,28,500

S. Ashraf and M. Zuhaib

biological control of plant diseases through fungal biocontrol agents, which will

emphasize on the mechanism, commercialization and bottle necks of biological

control of plant diseases (Fig. 4.1 ).

2 Biological Control of Plant Diseases

The use of microorganisms as biological control agents to control plant disease is a

potentially powerful alternative method (Kulkarni et al. 2007 ) . Because of their rich

diversity, complexity of interactions and numerous metabolic pathways, microbes

are an amazing resource for biological activity (Tejesvi et al. 2007 ; Mitchell et al.

2008 ; Raghukumar 2008 ) . Biological control of pathogens is the total or partial

destruction of the pathogen population by other organisms which occurs routinely

in nature. There are many examples of management of several diseases in which the

pathogen cannot develop in certain areas because the soil contains microorganisms

antagonistic to these pathogens. It was also observed that the plant attacked by the

pathogen has also been naturally inoculated with antagonistic microorganisms

before or after the pathogen attack. Sometimes the antagonistic microorganisms

may consist of avirulent strains of the same pathogen that destroy or inhibit the

development of the pathogen, as happens in hypo virulence and cross protection.

Total Fungicide Market 2005 = $ 7491 m

other

Fruit & Vegetables

22.1

Pome Fruit

5.5

grapevine

10.9

Potato

7.1

Soybean

8.3

Cereals

22.4

Rice

8.4

Other

15.3

Fig. 4.1 Global fungicides market share for the major crop groups for 2005. Pome fruits: A ﬂ eshy

fruit, such as apple, pear, or quince, having several seed chambers and an outer ﬂ eshy part largely

derived from the hypanthium ( Source : Phillips McDougall

2006 )

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

In some cases even higher plants reduce the amount of inoculum either by trapping

available pathogens (trap plants) or by releasing into the soil a substance toxic to the

pathogens. Agriculturists have increased their efforts to take advantage of such nat-

ural biological control against several plant diseases. Biological antagonism,

although subject to numerous ecological limitations is expected to become an

important part of the control measures employed against many more diseases.

Numerous kinds of antagonistic microorganisms have been found to increase in

suppressive soils most commonly. However, pathogen and disease suppression have

been shown to be caused by fungi, such as Trichoderma and Sporidesmium sp .

Suppressive soil added to conducive soil can reduce the severity of disease by intro-

ducing microorganisms antagonistic to the pathogen.

Biological control practices for direct protection of plants from pathogen involve

the deployment of antagonistic microorganisms at the infection court before and

after infection takes place. Although hundreds, possibly thousands of microorgan-

isms have been shown to interfere with the growth of plant pathogens in the labora-

tory, greenhouse, or ﬁ elds and to provide some protection from the diseases caused

by them, so far only six microorganisms have been registered and are commercially

available for use. The six microorganisms include three fungi: Gliocladium virens ,

for control of seedling disease of ornamental and bedding plants; Trichoderma har-

zianum for control of several soil borne plant pathogenic fungi and Trichoderma

harzianum / T. polysporum for the control of wood decays (Adam 1990; Swati and

Adholeya

2008 ) . Over the past 30 years, microorganisms have been described, char-

acterized, and tested for their use as biocontrol agents against diseases caused by

plant pathogens. Biocontrol agents and especially antagonistic fungi have been used

to control plant diseases with 90% of applications being formulated using different

strains of Trichoderma , e.g . T. harzianum , T. virens , T. viride (Benítez et al. 2004 ) .

Many species of Chaetomium e.g . Chaetomium globosum , C. cochlioides , C. cupreum

can also be antagonistic against various soil microorganisms (Soytong et al. 2005 ;

Kanokmedhakul et al. 2002 , 2006 ). Some of the important genera of fungi used as

biocontrol agents are Trichoderma , Gliocladium , Aspergillus , Penicillium ,

Neurospora , Chaetomium , Dactylella , Arthrobotrys , Ampelomyces quisqualis ,

Glomus , etc.

2.1 Classi ﬁ cation of Biocontrol Agents

Mycoparasitism is the parasitism of one fungus by another fungus (Hawksworth

et al. 1983 ). Mycoparasitism appears to be a complex process, involving recognition

of plant pathogens by chemotropism, coiling around the pathogen and appresorial

formation, followed by production of cell wall-degrading enzymes and peptaibols,

mediated by heterotrimeric G-proteins and mitogen-activated protein (MAP)

kinases (Druzhinina et al. 2011 ) . Mycoparasitic fungi are widespread today and

recognized as potential biological control agents of economically important plant

pathogenic fungi (Baker and Cook 1974 ) they have been observed both under

S. Ashraf and M. Zuhaib

laboratory and ﬁ eld conditions (Jeffries and Young 1994 ) . Barnett and Binder ( 1973 )

divided mycoparasites into two main categories depending on their mode of

nutrition.

2.1.1 Necrotrophic or Destructive Mycoparasites

In this relationship, mycoparasites kill their host as a result of their parasitic activity,

whereas biotrophic mycoparasites obtain their nutrients directly from the living

mycelium of the hosts. In necrotrophic relationships the antagonistic action of the

mycoparasite is strongly aggressive and the mycoparasites dominate the associa-

tion. Hyphae of the parasite contact and grow in contact association with those of

the host, sometimes coiling around them, and frequently penetrating. Secretion of

hyphal wall degrading enzymes or exotoxins may cause the death of the cytoplasm

of the host prior to hyphal contact, or alternatively cytoplasmic death may not occur

until contact has been established. Necrotrophic parasites tend to have a broad range

of host fungi, and are relatively unspecialized in their mechanism of parasitism, for

example, they often release toxins and lytic enzymes into the environment, are

overtly destructive and usually lack specialized infection structures. In this way

their behavior parallels that of the necrotrophic fungi which parasitize plants.

2.1.2 Biotrophic Mycoparasites

In this relationship, the living host supports the growth of the parasites for an

extended period of time, may not appear diseased, while its growth rate, sporulation

and metabolism may appear overtly to be little affected, at least in the early stages

of the relationship. The parasitic relationship is physiologically balanced and the

parasite appears to be highly adapted to this mode of life. Biotrophic mycoparasites

tend to have more restricted host ranges than necrotrophs, and often form special-

ized infection structures or a host parasite interface. Exotoxin production has not

been demonstrated in any biotrophic mycoparasitic interaction.

2.2 Biocontrol Agent Antagonistic to Foliar Pathogen

Many fungi have been shown to antagonize and inhibit numerous foliar fungal

pathogens of aerial plant parts, viz., Chaetomium sp. and Athelia bombaciana sup-

press Venturia enequalis ascospores and conidia production in fallen and growing

leaves, respectively. Tuberculina maxima parasitizes the white pine blister rust fun-

gus Cronartium rubicola ; Verticillium lecanii and Darluca ﬁ lum parasitize several

rusts; Ampelomyces quisqualis parasitizes several powdery mildews, Tilletiopsis

parasitizes cucumber powdery mildew fungus Sphaerotheca fuliginea and

Cladosporium herbarum is reported antagonistic to Alternaria sp. ( A. alternata and

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

A. porii ) in ﬁ eld condition while strains of T. harzianum (Imtiaz and Lee 2008) and

Myrothecium sp. (Chawda and Rajasab 1992 ; Kumar 2007 ) were found effective

in-vitro respectively. Powdery mildew fungi (Erysiphaceae) are one of the most

conspicuous groups of plant pathogens, comprising more than 500 species that

attack more than 1,500 plant genera. The pathogen is widely distributed and causes

heavy losses while it was estimated that fungicide treatments against powdery mil-

dews can cost as much as US$6,000 per hectare per year in rose production in

Canada (Paulitz and Belanger 2001 ) , $70–150 per hectare per year in apple orchards

in Virginia, USA (Yoder 2000 ) and in Europe, the largest area of fungicide use is for

the control of powdery mildews (Hewitt 1998 ; Legler et al. 2011 ) . Ampelomyces

and Pseudozyma species , Verticillium lecanii , Tilletiopsis spp. and Acremonium

alternatum have been thoroughly studied fungal antagonists of powdery mildews

(Belanger and Labbe 2002 ) . Some of the fungi listed in Table 4.2 are well-known

natural antagonists of powdery mildews. Ampelomyces spp. (Kiss 1998 ; Kiss et al.

2004 ) and Tilletiopsis spp. (Urquhart et al. 1994 ) were repeatedly isolated from

Table 4.2 A list of fungi tested as potential biocontrol agents against powderymildews

Antagonist Powdery mildew Host plant References

Acremonium

byssoides

Oidium heveae Hevea brasiliensis Hawksworth (

1981 )

Alternaria

alternatum

Sphaerotheca

fuliginea

Cucurbitaceae Hijwegen ( 1989 )

A. strictum S. fuliginea Cucumis sativus Hijwegen (

1988 , 1989 )

Ampelomyces spp. Many species Many species Jarvis et al. (

1977 );

Hofstein et al. (

1996 ) ;

Philipp et al. (

1990 )

Aspergillus

fumigatus

E. cichoracearum Cucurbita maxima Srivastava and Bisht

(

1986 )

Cladosporium

oxysporum

Phyllactinia

corylea

Morus alba Raghavendra Rao and

Pavgi (

1978 )

C. spongiosum Phyllactinia

dalbergiae

Dalbergia sissoo Mathur and Mukerji

(

1981 )

Cephalosporium

sp.

Leveillula taurica Capsicum annuum Diop-Bruckler and

Molot (

1987 )

Pseudozyma spp. Erysiphe polygoni Trifolium pratense Traquair et al. (

1988 )

Tilletiopsis

albescens

Sphaerotheca

fuliginea

C. sativus Knudsen and Skou

(

1993 ) ; Hijwegen

(

1988 , 1989 )

T. minor E. martii L. polyphyllus Hijwegen and

Buchenauer (

1984 )

S. fuliginea C. sativus Hijwegen (

1992 )

Verticillium

lecanii

Oidium tingtanium Citrus spp. Raghavendra Rao and

Pavgi (

1978 )

Sphaerotheca

fuliginea

C. sativus Hijwegen (

1988 , 1989 ) ;

Askary et al. (

1998 )

Uncinula necator Vitis vinifera Heintz and Blaich (

1990 )

Source : Kiss (

2003 )

S. Ashraf and M. Zuhaib

plants infected with powdery mildew worldwide. In a study of evaluation of effective

Trichoderma species against Alternaria porii , causing onion blotch, the percent

inhibition of mycelial growth and conidial growth is highest for Trichoderma virens

followed by T. harzianum and T. pseudokoningii (Imtiaz and Lee 2008).

2.3 Biocontrol Agents Antagonistic to Soil-Borne

Fungal Pathogens

The principal fungi used as biological control agents against soilborne diseases

include the two mentioned above as being used commercially, namely, Trichoderma

harzianum and Gliocladium virens . They are effective against damping-off, root rot

and wilt diseases of ornamental plants, vegetables and cereals caused by Pythium ,

Phytophthora , Sclerotium , Fusarium and some other fungi. In addition Sporidesmium

sclerotiorum , Conithyrium minitants , Talaromyces ﬂ avus and others have been

tested for control of some diseases caused by Sclerotinia , Verticillium and

Rhizoctonia. Some species of Pythium , such as Pythium nunn and P. oligandrum ,

protect potted ornamental plants and vegetables from plant pathogenic species of

Pythium and Talaromyces ﬂ avus. Some binucleate non-pathogenic strains of

Rhizoctonia have been found to protect plants from the pathogenic Rhizoctonia

solani. In another study two isolates of T. koningii reduced seedling death caused by

R. solani and Pythium ultimum var. sporangiiferum . Neither isolate of T. koningii

suppressed damping-off caused by either pathogen ( Pythium and R.solani ) as con-

sistently as the binucleate strains of Rhizoctonia (Harris 1999 ) . Experimental con-

trol of several other soil borne diseases has been obtained with many other fungi.

There are many reports in literature of soil borne fungi which are susceptible to

antagonism or mycoparasitism by other soil fungi. A well known example is the

genus Rhizoctonia , the non sporulating anamorph of the mycelium of numerous

isolates from soil and infected host plants. The pathogen infects the root tip region

of young roots and can continue to infect newly produced root tips as the plant

grows. The plants not killed by the pathogen may successfully outgrow the disease

as Rhizoctonia is essentially a parasite of young tissues which have not developed

resistance to the attack. The pathogenic R. solani is susceptible to attack by myco-

parasitic fungi. Some of the parasites of R. solani are summarized in the Table 4.3 .

In another study, hyphae coiling of R. solani with the strains of T. harzianum was

studied and only one of them (Th-9) was chosen for visualization via SEM. After

3 days of contact between the mycoparasites and the pathogen complete coloniza-

tion of R. solani with several strains of Trichoderma was observed. The parasitic

hyphae reached the host hyphae and grew on the surface always with coiling and

later they penetrated the cell wall directly without formation of appressorium-like

structures. The invaded hyphae of R. solani looked disintegrated. Furthermore, total

disappearance of the host hyphae after 7 days of interaction was observed. Lytic

enzymes seem to be capable of degrading the cell walls of R. solani , as discussed

above (strain Th-9), which produces high amounts of β -glucosidase (Melo et al. 1997 ),

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

is an example of cell wall degrading enzymes involved in antagonistic mechanism.

A variety of extracellular lytic enzymes play an important role in the antagonistic

mechanism by the parasite. High chitinase and β -(1,3)-glucanase activities have

been reported to be produced by T. harzianum (Sivan and Chet 1989 ; Harman et al.

1981; Abubaker 2010 ) and there is a relationship between the production of these

enzymes and the ability to control plant diseases (Ridout et al. 1988 ; Adams

2004 ). Fusarial wilts of several crops, such as celery, cucumber, and sweet potato,

caused by the respective formae specialis of Fusarium oxysporum have been

reported to be successfully controlled by inoculating transplants or cutting with

nonpathogenic strains of the same fungus. Some of these strains have been isolated

from the vascular tissues of host plants that remained healthy while nearby plants

had been killed by the wilt inducing strains of the fungus. It is believed that the

nonpathogenic strains not only compete with the pathogenic ones in the rhizosphere

and for infection sites, but they also enhance the resistance of the host towards the

pathogenic strains (Agrios 2005 ) .

3 Mechanism Involved in Antagonism

Several mechanisms, operating alone or in concert are known to be involved in antago-

nistic interactions in the rhizosphere and as well as in phyllosphere. Nutrient competi-

tion, antibiosis and mycoparasitism are the major mechanisms. Additional mechanism

such as induced resistance, interference with pathogen related enzymes, and a number

of still unknown mechanisms, may complete the microbial arsenal (Elad 1996 ).

Knowledge of mechanisms involved in biocontrol is important for estimating

Table 4.3 Some parasites of Rhizoctonia solani

Mycoparasite Reference

Arthrobotrytis oligospora Persson (

1991 )

Gliocladium catenulatum Jager et al. (

1979 )

Gliocladium spp. Molan (

2009 )

G. roseum Jager et al. (

1979 )

G.virens

Pythium oligandrum Boosalis (

1956 )

Trichoderma hamatum Chet et al. (

1981 ) ; Chet

and Baker (

1981 ) ;

Elad et al. (

1983b )

Trichoderma harzianum Melo and Faull (

2000 )

T. koningii Melo and Faull (

2000 )

Verticillium biguttatum Boogert van den (

1989 )

V. chlamydosporium Turhan (

1990 )

V. lamellicola Kuter (

1984 )

V. lecani Kuter (

1984 )

V. nigrescens Kuter (

1984 )

S. Ashraf and M. Zuhaib

and predicting its reliability and selection of better strains. Besides other criteria, the

choice of an antagonist with its characteristic mechanisms depends on the stage of the

life cycle of the pathogen the antagonist is aimed at. Allowable interaction times and

niche characteristics determine the suitability of certain modes of action during differ-

ent development stages of the pathogen. The mechanisms of biocontrol mainly include

antibiosis, competition, mycoparasitism, cell wall degrading enzymes, and induced

resistance (Harman et al.

1998 ; Heidi and Abo-Elnaga 2012 ) . These mechanisms are

probably never mutually exclusive; these terms are meant to organize the examples into

general groups to facilitate comparisons. A summarized data is given in Table 4.4 .

3.1 Antibiosis

Antibiosis plays an important role in plant disease suppression by most of the fungi.

The process has been de ﬁ ned as the interactions that involve a low-molecular weight

compound or an antibiotic produced by a microorganism that has a direct effect on

another microorganism (Weller 1988 ) . Several antibiotic producing fungi have been

used in biocontrol studies. Examples include Epicoccum nigrum which produces

antibiotic compounds effective against Botrytis cineria (Hannusch and Boland

1996a ) and Sclerotinia sclerotiorum (Hannusch and Boland 1996b ) while; Monilinia

laxa (Madrigal et al. 1994 ) and Chetomium globosum are effective antagonists of

Venturia inaequalis (Boudreau and Andrews 1987 ) . Trichoderma virens , which

controls damping-off of cotton caused by Pythium ultimum , produces gliovirin.

Mutant analysis has been used to demonstrate that the antibiotic gliovirin plays a

role in biocontrol (Fravel 1988 ; Prasad et al. 2008 ) . The importance of gliotoxin

produced by Trichoderma virens in the suppression of Pythium damping-off of cot-

ton seedlings has been con ﬁ rmed by mutational analysis (DiPietro et al. 1993 ) .

Chaetomin is produced by Chaetomium globosum , peptaibols are produced by

Trichoderma harzianum , and pyrones are produced by Trichoderma spp. (Schirmbock

et al. 1994 ; Mukherjee et al. 2011 ) . The antagonism of a strain of Trichoderma

harzianum also seems to be based on antibiotics causing disorganization of the

cytoplasm within 12 h and cause subsequent cell death of B. cineria (Belanger et al.

1995 ) . The role of antibiotic production by antagonistic fungi has been less studied

than antagonistic bacteria. One reason may be that these substances have merely

been identi ﬁ ed; currently scientists are now showing interest in exploiting the anti-

biotic synthesized during fungal interaction through molecular tools.

3.2 Competition

The nutrient sources in the soil and rhizosphere are frequently not suf ﬁ cient for

microorganisms. For a successful colonization of phyllosphere and rhizosphere a

microbe must effectively compete for the available nutrients (Loper and Buyer 1991 ;

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

Table 4.4 Mechanisms of speci ﬁ c biocontrol agents for controlling plant pathogen

Biocontrol agents Strain

Possible process/

metabolite Target pathogen Crop Evidence for involvement

Antibiosis

Chaetomium globosum Cg-13 Chaetomin P.ultimum Sugarbeet In-vitro demonstration

Trichoderma

( Gliocladium )

Gliovirin P.ultimum Cotton Geneticanalysis In-vivo

Trichoderma virens G-20 Gliotoxin P.ultimum Cotton Geneticanalysis In-vivo

Trichoderma harzianum ,

Trichoderma

koningii

Akylpyrones Various fungi Various crops Antibiotics isolated

In-vitro

Trichoderma harzianum ATCC-36042 Peptaibol antibiotics Botrytiscinerea ,

otherfungi

Grape vine Antibiotics isolated

in-vitro

Competition

Trichoderm harzianum Nutrientsand space Various fungi Grapevine Inferred from In-vivo

activity

Phlebia ( Peniophora )

gigantea

Infection sites Heterobasidion

( Fomesannosum ),

( Fomes ) annosum

Pine conifers In ﬁ eld demonstration

Cell-wall degrading

enzymes

Serratia marcescens Chitinolytic enzyme Various fungi Soybean Geneticanalysis

heteroexpression

Trichoderma harzianum ATCC-36042 Chitinolytic enzymes,

Glucanases

Various fungi Pea, soybean In-vitro demonstration

Mycoparasitism

Coniothyrium

minitans Mycoparasitism Sclerotinia Sun ﬂ ower In ﬁ eld

Pythium spp Mycoparasitism Pythium spp. Various crops In-vitro demonstration

Trichoderma spp. Mycoparasitism Various and

numerous fungi

Various crops In -vitro demonstration

Induced resistance

Binucleate rhizoctoctnia BNR-AG-K Induced resistance Rhizoctonia solani

AG-4

Soybean In vitro demonstration

S. Ashraf and M. Zuhaib

Pal and Gardener 2006 ) . On plant surfaces, host-supplied nutrients include exudates,

leachates, or senesced tissue. There is a general belief that competition between

pathogens and non-pathogens for nutrient resources is an important issue in biocon-

trol (Elad and Baker

1985 ; Kaur et al. 2010 ) . In early studies (Fokkema 1971 ) on the

role of pollen on infection of rye leaves by Cochliobolus sativus , Saptoria nodorum

and Puccinia recondita , spore germination and super ﬁ cial growth of mycelium of

two necrotrophic pathogens was highly stimulated by the presence of pollens, result-

ing in more penetration sites and up to a tenfold increase of necrotic leaf area where

as the infection by the biotrophic rust fungus was not enhanced. There was a positive

correlation between the super ﬁ cial mycelium density of C. stivus 2–3 days after

inoculation and the necrotic leaf area. Annosus root disease caused by the fungus

Heterobasidion annosum has been recognized as a worldwide problem in conifer

forests for decades. H. annosum causes root and butt rot of conifers, infects freshly

cut pine stumps and then spreads into the roots of the standing trees, which it kills.

If the stump surface is inoculated with oidia of the fungus Peniophora gigantea

immediately after the tree is felled Peniophora occupies the cut surface and spreads

through the stump into the lateral roots and successfully competes with and replaces

the pathogenic Heterobasidion in the stump, thus protecting nearby trees. It is also

believed that competition for nutrients is more critical for soil borne pathogens,

including Fusarium and Pythium species that infect through mycelial contact than

foliar pathogens that germinate directly on plant surfaces and infect through appres-

soria and infection pegs (Keel et al. 1989 ) . Sivan and Chet (1989) demonstrated that

competition for nutrients is the major mechanism used by T. harzianum to control

F. oxysporum f.sp . melonis. T. harzianum is able to control B. cinerea on grapes by

colonizing blossom tissue and excluding the pathogen from its infection site (Gullino

1992 ; Vinalea et al. 2008 ) . Moreover, Trichoderma has a strong capacity to mobilize

and take up soil nutrients, thus making it more ef ﬁ cient and competitive than many

other soil microbes (Benítez et al. 2004 ) . Results of a study by Anderson et al. ( 1988 )

revealed that production of a particular plant glycoprotein called agglutinin was cor-

related with potential of pathogen to colonize the root system. The pathogen mutants

de ﬁ cient in this ability exhibited reduced capacity to colonize the rhizosphere and a

corresponding increase in soilborne diseases.

3.3 Mycoparasitism

Mycoparasitism appears to be a complex process, involving recognition of plant

pathogens by chemotropism, coiling around the pathogen and appresorial formation,

followed by production of cell wall-degrading enzymes and peptaibols, mediated by

heterotrimeric G-proteins and mitogen activated protein (MAP) kinases (Druzhinina

et al. 2011 ) . Parasitism is aimed at pathogenic mycelium already established and

to reduce sporulation of the pathogen and hence to limit its dissemination.

Enzymes degrading fungal cell walls such as chitinases and β -glucanases are com-

monly produced by hyperparasites while secretion of lytic enzymes including

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

β -1,3-g1ucanases, proteinases, chitinases and lipases, by Trichoderma spp. was also

reported by Harman ( 2001 ). Involvement of β -1,6-g1ucanases and β -1,4-g1ucanases

may also play an important role in mycoparasitism (Thrane et al . 1997 ). Parasitism

depends on close contact between antagonist and host, on the secretion of enzymes,

and on the active growth of the hyperparasite into the host. These processes need

time so it is unlikely that infection structures of pathogens can be parasitized and

killed rapidly enough to prevent penetration of the host plant. When studying the

chronological events during the interaction between T. harzianum and Botrytis

cinerea at the ultrastructural level, Belanger et al. (

1995 ) found evidence for antibio-

sis early during interaction within the ﬁ rst 12 h, but clear chitinolytic activity of the

antagonist could not be demonstrated before the 10th day of interaction. Trichoderma

recognizes signals from the host fungus, triggering coiling and host penetration.

Different strains can follow different patterns of induction, but the fungi apparently

always produce low levels of an extracellular exochitinase. The possible role of

agglutinins in the recognition process determining fungal speci ﬁ city has been exam-

ined recently. Barak et al. ( 1985 ) proposed that lectins of plant pathogenic fungi

might play a role in recognition. Inbar and Chet ( 1992 ) proved the role of lectins in

recognition during mycoparasitism using a biometric system. Ordentlinch et al.

( 1990 ) reported that there was no correlation between in-vivo and separated in-vitro

dual culture or enzyme assays. Mycelial development of necrotrophic pathogens also

can be controlled by mycoparasites. The mycoparasite Coniothyrium minitans pen-

etrates mycelium of S . sclerotiorum that subsequently collapses and becomes necrotic

(Whipps and Gerlagh 1992 ; Jones and Stewart 2011 ) . The production of β -1,3 gluca-

nases and chitinases enables the mycoparasite to utilize the host cells, and mycelium

of the mycoparasite proliferates around dead hyphae of the host fungus. Above all,

C. minitans is a potent parasite of sclerotia of S . sclerotiorum , as it reduces the sur-

vival of sclerotia, in ﬁ eld trials, by about 90% (Gerlagh et al. 1995 ). The antagonist

Limonomyces roseipellis has chitinolytic activity and mycoparasitism may be one of

the mechanisms involved in its antagonism against Pyrenophora tritici-repentis in

the debris of wheat crops (Pfender 1988 ).

4 Commercialization of Bioagents

As mentioned earlier there are approximately 61 biocontrol products (i.e. including

fungal and bacterial) being produced on a commercial basis all over the world.

A successful biocontrol requires considerable understanding of cropping system,

disease epidemiology, the biology, ecology, and population dynamics of biocontrol

organisms; and the interactions among these variables (Lo et al. 1998 ) . Understanding

the mechanisms or activities for antagonist pathogen interactions will be one of the

important steps because it may provide a reasonable basis for selection and con-

struction of more effective biocontrol agents (Lo et al . 1997; Heydari and Pessarakli

2010 ) . Over the past few years, the novel application s of molecular techniques

has broadened our insight into the basis of biological control of plant diseases.

S. Ashraf and M. Zuhaib

New molecular approaches have been available for assessment of interaction

between the antagonist and pathogen, ecological traits of antagonists in rhizosphere

and improving the ef ﬁ cacy of fungal biocontrol agents (Harman et al . 1998 ; Perveen

and Bokhari 2012 ) . There has been a signi ﬁ cant increase in the number of biological

control agents registered or on the market worldwide in the last few years (Whipps

1998 ) . Table 4.5 enlists the fungal bioagents with their trade and manufacturers name.

Table 4.5 List of fungal bioagents with their trade and manufacturers name

Commercial products Bioagents used Name of the manufacturer

AQ10 biofungicide Ampelomyces quisqualis

isolate M-10

Ecogen, Inc. Israel

Anti-Fungus Trichoderma spp. Grondortsmettingen De

Cuester, Belgium

Biofungus Trichoderma spp. Grondortsmettingen De

Cuester n. V.Belgium

Bas-derma T. viride Basarass Biocontrol Res.

Lab., India

Binab T Trichoderma harzianum

(ATCC 20476) and

Trichoderma polysporum

(ATCC 20475)

Bio-Innovation AB, UK

Bioderma Trichoderma viride/T.

harzianum

Biotech International

Ltd., India

Biofox C Fusarium oxysporum (Non-

pathogenic)

S. I. A. P. A., Italy

Prestop, Prirnastop Gliocladium catenulatum Kemira Agro. Oy, Finland

Root shield, Plant shield,

T-22 Planter box

Trichoderma harzianum

Rifai strain KRL-AG

(T-22)

Bioworks Inc., USA

Root Pro, Root Prota to

Soilgard

Trichoderma harzianum Efal Agr, Israel

Gliocladium virens strain

GL-21

Thermo Trilogy, USA

Supresivit Trichoderma harzianum Borregaard and Reitzel,

Czech Republic

T-22 G, T-22 HB Trichoderma harzianum

strain KRL-AG2

THT Inc., USA

Trichodex, Trichopel Trichoderma harzianum Makhteshim Chemical

Works Ltd., USA

Trichopel, Trichoject,

Trichodowels,

Trichoseal

Trichoderma harzianum

and Trichoderma viride

Agrimm Technologies

Ltd., New Zealand

Trichopel Trichoderma harzianum

and Trichoderma viride

Agrimm Technologies

Ltd., New Zealand

Trichoderma 2000 Trichoderma sp. Myocontrol Ltd., Israel

Tri-control Trichoderma spp. Jeypee Biotechs, India

Trieco Trichoderma viride Ecosense Labs Pvt. Ltd.,

Mumbai, India

TY Trichoderma

sp. Mycocontrol, Israel

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

Despite all the success stories of effective biological control of plant diseases

the rate of commercialization of biocontrol agents has been slow and therefore

their application in the ﬁ eld is restricted to the 33 commercial biocontrol products

listed by Fravel et al. (

1999 ). Over half of them have applications in nursery or

greenhouses and many were developed speci ﬁ cally for soil-borne plant pathogens

e.g. Pythium , Fusarium and Rhizoctonia. The world’s total greenhouse area is

307,000 ha including both plastic and glass (Gullinos et al.

1999 ) whereas the

total land area under cultivation in 1998 was 1.51 billion hectare (FAOSTAT

2000 ) . The use of biocontrol is more prevalent in green houses and protected

structures than in open ﬁ eld in developed countries. This is another area of con-

cern, which must be looked into before moving towards commercialization. Not

many products are available which are broad-spectrum so that, they can be used

on a large scale. Still, today important fungal plant diseases lacking commercial-

ized biocontrol management and large number of diseases are still not covered by

the commercialized biocontrol formulations. Thus, there is need for moving ahead

with selecting the effective strains of biocontrol fungi and developing them as

broad-spectrum formulations for use against a large number of soil-borne diseases

in varying soil conditions. Another major obstacle is absence of infrastructure for

scale up and commercialization of biocontrol products in most of the countries

(Cook 1993 ) . A system similar to that developed for release of new cultivars by

breeders must be developed for commercialization and dissemination of biocon-

trol agents to the farmers.

4.1 Selection of Strain

Selection of a potential strain is the ideal condition required for the development of

a biocontrol agent and its subsequent commercialization. The relative ease of ﬁ nding

the right antagonist strain under laboratory and ﬁ eld conditions is an added advan-

tage but it does ensure that the agent would work consistently and effectively in

ﬁ eld. The search for an effective strain involves years of screening and testing. The

development of T-22 strain of Trichoderma harzianum by Harman and his associ-

ates took more than a decade and it was only in the last decade of last century that

the sale of its product, Root Shield, started to pick up (Harman 2000 ; Shoresh and

Harman 2008 ) . Genetic engineering of effective strains or those strains, which do

not have the desired traits, must also be tried. The demonstration by Huang et al.

( 1997 ) of the activity against Rhizoctonia root rot in addition to the ability of a phlo-

roglucinol producing strain to produce phenazine-l-carboxylate shows that it may

be possible to produce strains with ability to control more than one disease and

possibly more than one crop. This may broaden the market potential needed to jus-

tify costs of development and registration of commercialized biological control

products. There are some of the biological control agents like Plant Growth

Promoting Rhizobacteria (PGPR) and some strains of Trichoderma and Gliocladium ,

which besides controlling various soil borne diseases also enhance the yield of

S. Ashraf and M. Zuhaib

host crop (Nautiyal 2000 ; Kotamraju 2010 ) . It would be a boon to the industries

associated with development of biocontrol products, if a strain that possesses

both these properties and can be produced successfully on a large scale.

4.2 Shelf Life and Storage

For the establishment of a product containing microbial antagonists in the market it

is essential that it has long shelf life and can be stored at room temperature for at

least one crop season. Mathre et al. ( 1999 ) suggested that a shelf life of 18-months

is preferable for a commercial microbial product with a requirement of storage at

room temperature. The last condition is essential, as the end users can not afford to

store commercial biocontrol agents at any temperature other than room tempera-

ture. Besides, it will render the biocontrol product economically unviable due to

high cost of maintenance.

5 Conclusion

It has been already mentioned in the literature that presently, the “fungi” are a mega-

diverse group, estimates for the number of fungi in the world range up to 13.5 M

species (McNeely et al. 1990 ; Hawksworth 1991, 2001 ) . The role of fungal bio-

agents in the management of devastating fungal plant diseases is of great impor-

tance. It is the gift of nature that fungal antagonist of most plant pathogens are

commonly found in the vicinity or associated with the pathogens. It was the famous

scientist Weindling ( 1932 ) who made the world to know about mycoparasitism as a

remedy for plant diseases, now it is fruitful to say that fungal diversity is an impor-

tant tool in plant disease management. Still a large work has to be done in the ﬁ eld

of biological control of plant diseases. Although there is a large chunk of biocontrol

products commercialized all over the world for managing soil borne fungal diseases

of plants but the commercial bio products have the disadvantage of controlling only

one or two pathogens and have been tried on relatively few crops before being

released in the market. Since the commercialized products available in the world

market for disease management are either location speci ﬁ c or disease speci ﬁ c or

both so extensive performance trials should be conducted before accepting one

strain for advancement towards commercialization. The release of new wheat culti-

vars is done after conducting experiments for 100 site years (number of sites ×

number of years) so as to produce enough data extensively but only after being sure

about commercialization of microbial agents for use in agriculture. Trichoderma

spp. play a major role as biocontrol agents, owing to their capabilities of ameliorat-

ing crop-yields by a role of biopesticide, among fungal bipesticides they comprise

of 65% share. In order to enhance marketability of these fungi as BCAs, feasible

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

commercial production processes are of utmost importance. Their cheaper formulations

and alternative substrates for their mass production, ease of delivery and application,

compatibility with other bioagents are such bottle necks in biocontrol so strategies

should be made to rule out these problems.

References

Abubaker K (2010) Cell wall degrading enzymes and interaction between Trichoderma aggressivum

and Agaricus bisporus . Dissertation, University St. Catharines, St. Catharines

Adams PB (1990) The potential of mycoparasites for biological control of plant diseases. Annu

Rev Phytopathol 28:59–72

Adams DJ (2004) Fungal cell wall chitinases and glucanases. Microbiology 150:2029–2035

Agrios GN (2005) Plant pathology, 5th edn. Elsevier Academic Press, Amsterdam

Anderson AJ, Tari PH, Tepper CS (1988) Genetic studies on the role of an agglutinin in root colo-

nization by Pseudomonas putida . Appl Environ Microbiol 54:375–380

Askary H, Carriere Y, Bélanger RR, Brodeur J (1998) Pathogenicity of the fungus Verticillium

lecanii to aphids and powdery mildew. Biocontrol Sci Technol 8:23–32

Baker KF, Cook RJ (eds) (1974) Biological control of plant pathogens. W. H. Freeman, San

Francisco, 433 pp

Barak R, Elad Y, Mirelman D, Chet I (1985) Lectins: a possible basis for speci ﬁ c recognition in the

interaction of Trichoderma and Sclerotium rolfsii. Phytopathology 75:458–462

Belanger RR, Labbe C (2002) Control of powdery mildews without chemicals: prophylactic and

biological alternatives for horticultural crops. In: Belanger RR, Bushnell WR, Dik AJ, Carver

TLW (eds) The powdery mildews: a comprehensive treatise. American Phytopathological

Society, St. Paul, pp 256–267

Belanger RR, Dufour N, Caron J, Benhamou N (1995) Chronological events associated with the

antagonistic properties of Trichoderma harzianum against Botrytis cinerea : indirect evidence

for sequential role of antibiosis and parasitism. Biocontrol Sci Technol 5:41

Benítez T, Rincón MA, Limón MC, Codón CA (2004) Biocontrol mechanisms of Trichoderma

strains. Int Microbiol 7:249–260

Bernett HL, Binder FL (1973) The fungal host parasite relationship. Annu Rev Phytopathol

11:273–292

Boogert van den PHJF (1989) Nutritional requirement of the Mycoparasitism fungus. Verticillium

biguttatum . Neth J Plant Pathol 95:149–156

Boosalis MG (1956) Effect of soil temperature and green manure amendmend of unsterilized soil

on parasitism of Rhizoctonia solani by Penicillium vermiculatum and Trichoderma spp.

Phytopathology 46:473–478

Boudreau MA, Andrews JH (1987) Factors in ﬂ uencing antagonism of Chaetomium globosum to

Venturia inaequalis: a case study in failed biocontrol. Phytopathology 77:1470

Cavalier-Smith T (1998) A revised six-kingdom system of life. Biol Rev 73:203–266

Chawda HT, Rajasab AH (1992) Effect of culture ﬁ ltrate of Myrothecium verrucaria on the conid-

ial germination of some pathogens of onion. Onion Newsl Tropics 4:62–65

Chet I, Baker R (1981) Isolation and biocontrol potential of Trichoderma hamatum from soil natu-

rally suppressive to Rhizoctonia solani . Phytopathology 71:286–290

Chet I, Baker R, Harman GE (1981) Trichoderma hamatum : its hyphal interaction with Rhizoctonia

solani and Pythium sp. Microb Ecol 7:29–38

Cook RJ, Baker KF (1983) The nature and practice of biological control of plant pathogens. The

American Phytopathological Society, St. Paul

Cook RJ (1993) Making greater use of introduced microorganism for biological control of plant

pathogens. Ann Rev Phytopathol 81:53–80

S. Ashraf and M. Zuhaib

Diop-Bruckler M, Molot PM (1987) Intéret de quelques hyperparasites dans la lutte contre

Leveillula taurica , Sphaerotheca fuliginea . Bull OEPP 17:593–600

DiPietro A, Lorito M, Hayes CK, Broadway RM, Harman GE (1993) Endochitinase from

Gliocladium virens : isolation, characterization and synergistic antifungal activity in combina-

tion with gliotoxin. Phytopathology 83:308–313

Druzhinina IS, Seidl-Seiboth V, Herrera-Estrella A, Horwitz BA, Kenerle CM, Monte E, Mukherje

PK, Zeilinger S, Grigorie IV, Kubicek CP (2011) Trichoderma : the genomics of opportunistic

success. Nat Rev Microbiol 9(10):749–759

Elad Y, Chet I, Boyle P, Henis Y (1983) Parasitism of Trichoderma spp on Rhizoctonia solani and

Sclerotium rolfsii scanning electron microscopy and ﬂ uorescence microscopy. Phytopathology

73:85–88

Elad Y, Baker R (1985) In ﬂ uence of trace amounts of cations and siderophore-producing

pseudomonads on chlamydospore germination of Fusarium oxysporum . Ecol Epidemiol

75:1047–1052

Elad Y (1996) Mechanisms involved in the biological control of Botrytis cinerea incited diseases.

Eur J Plant Pathol 102:719–732

FAOSTA T (2000). Food and Agriculture Organization of United Nations.

http://apps.fao.org/ .

Fokkema NJ (1971) The effect of pollen in the phyllosphere of rye on colonization by Saprophytic

fungi and on infection by Helminthosporium sativum and other leaf Pathogens. Neth J Plant

Pathol 77(Suppl. 1):1–60

Fravel DR (1988) Role of antibiosis in the biocontrol of plant diseases. Annu Rev Phytopathol

26:75–91

Fravel DR, Rhodes DJ, Larkin RP (1999) Production and commercialization of biocontrol prod-

ucts. In: Albajes R, Gullino ML, van Lenteren JC, Elad Y (eds) Integrated pest and disease

management in greenhouse crops. Kluwer Academic Publishers, Dordrecht, 545, pp 365–376

Fries EM (1825) Systema Orbis Vegetabilis, vol 1. Typographia Academica, Lund

Gerlagh M, Goossen-van der geijn HM, Verdam B, Fokkema NJ (1995) Biological control of white

mould ( Scleotinia sclerotiorum ) in various crops by application of Coniothyrium minitans . In:

Whipps JM, Gerlagh T (eds) Biological control of Sclerotium forming fungi, IOBC/WPRS

Bulletin 18(3):13–17

Gullino ML (1992) Control of botrytis rot of grapes and vegetables with Trichoderma spp. In:

Tjamos EC, Papavizas GC, Cook RJ (eds) Biological control of plant diseases, progress and

challenges for the future. Plenum Press, New York, pp 125–132

Gullinos ML, Albajes R, van Lenteren JE (1999) Setting the stage: characteristics of protected

cultivation and tools for sustainable crop production. In: Albajes R, Lodovica Gullino M, van

Lenteren JE, Elad Y (eds) Integrated pest management in greenhouse crops. Kluwer Academic

Publishers, Dorcrecht, pp 1–15, 545

Hannusch DJ, Boland L (1996a) Humidity on biological control of white mould of bean ( Sclerotinia

sclerotiarum ). Phytopathology 86:156

Hannusch DJ, Boland GL (1996b) Humidity and biological control agents on grey mold bean.

Eur J Plant Pathol 102:133

Harman GE (2001) In: Tzeng DDS, Huang JW (eds) Proceedings of international symposium on

biological control of plant diseases for the new century – mode of action and application

technology. National Chung Hsing University, Taichung City, pp 71–84

Harman GE (2000) Myths and dogmas of biological control: change in perceptions desired from

research on Trichoderma harzianum T-22. Plant Dis 84(4):377–393

Harman GE, Björkman T (1998) Potential and existing uses of Trichoderma and Gliocladium for

plant disease control and plant growth enhancement. In: Kubicek CK, Harman GE (eds)

Trichoderma and Gliocladium, vol 2. Taylor and Francis, London, pp 229–265

Harris AR (1999) Biocontrol of Rhizoctonia solani and Pythium ultimumon Capsicum by

Trichoderma koningii in potting medium. Microbiol Res 154:333–337

Hawksworth DL (1981) A survey of the fungicolous conidial fungi. In: Cole GT, Kendrick B (eds)

Biology of conidial fungi, vol I. Academic, New York, pp 171–235

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

Hawksworth DL (1991) The fungal dimension of biodiversity: magnitude, signi ﬁ cance, and

conservation. Mycol Res 95:641–655

Hawksworth DL (2001) The magnitude of fungal diversity: the 1.5million species estimate revisited.

Mycol Res 105:1422–1432

Hawksworth DL, Sutton BC, Ainsworth GC (1983) Ainsworth & Bisby’s dictionary of the fungi,

7th edn. Commonwealth Mycological Institute, Kew

Heidi IG Abo-Elnaga (2012) Biological control of damping off and root rot of wheat and sugar

beet with Trichoderma harzianum . Plant Pathol J 11:25–31

Heintz C, Blaich R (1990) Verticillium lecanii als hyperparasit des rebmehltaus (uncinula necator).

Vitis 29:229–232

Hewitt HG (1998) Fungicides in crop protection. CABI Publishing, Wallingford

Heydari A, Pessarakli M (2010) A review on biological control of fungal plant pathogens using

microbial antagonists. J Biol Sci 10:273–290

Hijwegen T (1989) Effect of culture ﬁ ltrates of seventeen fungicolous fungi on sporulation of

cucumber powdery mildew. Neth J Plant Pathol 95(Suppl 1):95–98

Hijwegen T (1992) Biological control of cucumber powdery mildew with Tilletiopsis minor under

greenhouse conditions. Neth J Plant Pathol 98:221–225

Hijwegen T, Buchenauer H (1984) Isolation and identi ﬁ cation of hyperparasitic fungi associated

with Erysiphaceae. Neth J Plant Pathol 90:79–84

Hijwegen T (1988) Effect of seventeen fungicolous fungi on sporulation of cucumber powdery

mildew. Neth J Plant Pathol 94:185–190

Hofstein R, Daoust RA, Aeschlimann JP (1996) Constraints to the development of biofungicides: the

example of ‘AQ-10’, a new product for controlling powdery mildews. Entomophaga 41:455–460

Huang JW, Chen J, Berti WR, Cunningham S (1997) Phytoremediation of lead contaminated soils:

role of synthetic chelates in lead phytoextraction. Environ Sci Technol 31:800–805

Imtiaj A, Tae L (2008) Antagonistic effect of three Trichoderma species on the Alternaria porri

Pathogen of onion Blotch. World J Agric Sci 4:13–17

Inbar J, Chet I (1992) Biomimics of fungal cell – cell recognition by use of lectin-coated nylon

ﬁ bers. J Bacteriol 174:1055–1059

Jager G, Ten Hoopen A, Velvis H (1979) Hyperparasites of Rhizoctonia solani in Dutch potatoe

feilds. Neth J Plant Pathol 85:253–268

James TY, Kauff F, Schoch CL et al (2006) Reconstructing the early evolution of the fungi using a

six gene phylogeny. Nature 443:818–822

Jarvis W R, Slingsby K (1977) The control of powdery mildew of greenhouse cucumber by water

sprays and Ampelomyces quisqualis . Plant Dis Rep 61:728–730

Jeffries P, Young TWK (1994) Interfungal parasitic relationship. CAB International, Oxon, pp 9–12

Jones EE, Stewart A (2011) Coniothyrium minitans survival in soil and ability to infect sclerotia of

Sclerotinia sclerotiorum . N Z Plant Prot 64:168–174

Kanokmedhakul S, Kanokmedhakul K, Phonkerd N, Soytong K, Kongsaree P, Suksamrarn A

(2002) Antimycobacterial anthraquinonechromanone compound and diketopiperazine alkaloid

from the fungus Chaetomium globosum KMITL-N0802. Planta Med 68:834–836

Kanokmedhakul S, Kanokmedhakul K, Nasomjai P, Loungsysouphanh S, Soytong K, Isobe M,

Kongsaeree K, Prabpai S, Suksamran A (2006) Antifungal azaphilones from the fungus;

Chaetomium cupreum . J Nat Prod 69:891–895

Kaur R, Kaur J, Singh RS (2010) Nonpathogenic Fusarium as a biological control agent. Plant

Pathol J 9:79–91

Keel C, Voisard C, Berling CH, Kahir G, Defago G (1989) Iron suf ﬁ ciency is a prerequisit for sup-

pression of tobacco black root rot by Pseudomonas ﬂ uorescnes strain CHA0 under gnotobiotic

contiditions. Phytopathology 79:584–589

Kiss L (1998) Natural occurrence of Ampelomyces mycoparasites in mycelia of powdery mildew

fungi. New Phytol 140:709–714

Kiss L (2003) A review of fungal antagonists of powdery mildews and their potential as biocontrol

agents. Pest Manag Sci 59:475–483

S. Ashraf and M. Zuhaib

Kiss L, Russell JC, Sznentivanyi O, Xu X, Jeffries P (2004) Biology and biocontrol potential of

Ampelomyces mycoparasites , natural antagonists of powdery mildew fungi. Biocontrol Sci

Technol 17:635–651

Knudsen IMB, Skou JP (1993) The affectivity of Tilletiopsis albescens in biocontrol of powdery

mildew. Ann Appl Biol 123:173–185

Kotamraju VKK (2010) Management of sheath blight and enhancement of growth and yield of rice

with plant growth-promoting rhizobacteria. Dissertation, Auburn University Alabama

Kulkarni M, Chaudhari R, Chaudhari A (2007) Novel tensio-active microbial compounds for bio-

control applications. In: Ciancio A, Mukerji KG (eds) General concepts in integrated pest and

disease management. Springer, Dordrecht, pp 295–304

Kumar P (2007) Biological management of Alternaria blight of onion. Dissertation, University of

Agricultural Science, Dharwad

Kuter GA (1984) Hyphal interaction of Rhizoctonia solani and some Verticillium spp. Mycologia

76:936–940

Legler et al. (2011) New perspectives for the use of Ampelomyces -based biofungicides for effec-

tive control of powdery mildew on grapevine. Paper presented at the 4th international confer-

ence on non chemical crop protection methods, Lille, 8–10 Mar 2011

Lo CT, Nelson EB, Harman GE (1997) Biological control of Pythium, Rhizoctonia and Sclerotinia

infected diseases of turfgrass with Trichoderma harzianum . Phytopathology 84:1372–1379

Lo CT, Nelson EB, Hayes CK, Harman GE (1998) Ecological studies of transformed Trichoderma

harzianum strain 1295–22 in the rhizosphere and on the phylloplane of creeping bentgrass.

Phytopathology 88:129–136

Loper JE, Buyer JS (1991) Siderophores in microbial interactions of plant surfaces. Mol Plant

Microbe Interact 4:5–13

Madrigal C, Pascual S, Melgarejo P (1994) Biological control of peach twig blight ( Monilinia

laxa ) with Epicoccum nigrum . Plant Pathol 43:554

Mathre DE, Cook RJ, Callan NW (1999) From discovery to use: traversing the world of commer-

cializing biocontrol agents for plant disease control. Plant Dis 83:972–983

Mathur M, Mukerji KG (1981) Antagonistic behaviour of Cladosporium spongiosum against

Phyllactinia dalbergiae on Dalbergia sissoo . Angew Bot 55:75–77

McDougall P. (2006) Agriservice Report. Pathhead, Midlothian, Scotland

McNeely JA, Miller KR, Mittermeier R, Werner TB (1990) Conserving the world’s biological

diversity. International Union for Conservation of Nature and Natural Resources, Gland

Melo IS, Faull JL (2000) Parasitism of Rhizoctonia solani by strains of Trichoderm

Melo IS, Faull JL, Graeme-Cook KA (1997) Relationship between in vitro cellulose production of

UV-induced mutants of Trichoderma harzianum and their bean rhizosphere competence. Mycol

Res 101:1389–1392

Mitchell AM, Strobel GA, Hess WM, Vargas PN, Ezra D (2008) Muscodor crispans , a novel endo-

phyte from Ananas ananassoides in the Bolivian Amazon. Fungal Divers 31:37–43

Molan YY (2009) Detection of presumptive mycoparasites in soil placed on host-colonized agar

plates in Riyadh region, Saudi Arabia. Asian J Plant Pathol 3:22–26

Mukherjee PK et al (2011) Secondary metabolism in Trichoderma – a genomic perspective.

Microbiology 158:35–45. doi:

10.1099/mic. 0.053629-0

Nautiyal CS (2000) Plant bene ﬁ cial rhizosphere competent bacteria. Proc Natl Acad Sci India

70:107–123

Ordentlinch A, Nachmias A, Chet I (1990) Integrated control of Verticillium dahlia in potatoe by

Trichoderma harzianum and captan. Crop Prot 9:363–366

Pal KK, Mc Spadden Gardener B (2006) Biological control of plant pathogens. Plant Health

Instructor. doi:

10.1094/PHI-A-2006-1117-02

Pascoe IG (1990) History of systematic mycology in Australia. In: Short PS (ed) History of sys-

tematic botany in Australia. Australian Systematic Botany Society, South Yarra, pp 259–264

Paulitz TC, Belanger RR (2001) Biological control in greenhouse systems. Annu Rev Phytopathol

39:103–133

4 Fungal Biodiversity: A Potential Tool in Plant Disease Management

Persson Y (1991) Mycoparasitism by the nematode trapping fungus Arthrobotrys oligospora .

Ph.D. thesis, University of Lund, Lund

Perveen K, Bokhari NA (2012) Antagonistic activity of Trichoderma harzianum and Trichoderma

viride isolated from soil of date palm ﬁ eld against Fusarium oxysporum African. J Microbiol

Res 6(13):3348–3353

Pfender WF, Wootke SL (1988) Microbial communities of Pyrenophora-infested wheat straw as

examined by multivariate analysis. Microb Ecol 15:95–113

Philipp WD, Beuther E, Hermann D, Klinkert F, Oberwalder C, Schmidtke M, Straub B (1990) Zur

Formulierung des Mehltauhyperparasiten Ampelomyces quisqualis Ces. Z P ﬂ krankh P ﬂ schutz

97:120–132

Pimentel D, Levitan L (1986) Pesticides: amounts applied amounts reaching pests. Biosciences

36:86–91

Prasad V et al (2008) Microorganism mediated management of plant pathogens. In: Maheshwari

DK, Dubey RC (eds) Potential microorganism for sustainable agriculture. IK International

Publishing House, New Delhi

Raghavendra Rao NN, Pavgi MS (1978) Two mycoparasites on powdery mildews. Sydowia

30:145–147

Raghukumar C (2008) Marine fungal biotechnology: an ecological perspective. Fungal Divers

31:19–35

Ridout CJ, Coley-Smith JR, Lynch JM (1988) Fractionation of extracellular enzymes from a

mycoparasitic strain of Trichoderma harzianum . Enzyme Microb Technol 10:180–187

Rossman AY (1994) A strategy for an all-taxa inventory of fungal diversity. In: Peng CI, Chen CH

(eds) Biodiversity and terrestrial ecosystems. Institute of Botany, Academia Sinica, Taipei,

pp 169–194

Schirmbock M, Lorito M, Wang YL, Hayes CK, Arisan AI, Scala F, Harman GE, Kubicek C (1994)

Parallel formation and synergism of hydrolytic enzymes and peptaibol antibiotics, molecular

mechanisms involved in the antagonistic action of Trichoderma harzianum against phytopatho-

genicfungi. Appl Environ Microbiol 60:4364–4370

Shoresh M, Harman GE (2008) The molecular basis of shoot responses of maize seedlings to

Trichoderma harzianum T22 inoculation of the root: a proteomic approach. Plant Physiol

147(4):2147–2163

Sivan A, Chet I (1989) The possible role of competition between Trichoderma harzianum and

Fusarium oxysporum on rhizosphere colonization. Phytopathology 79:198–203

Soytong K, Srinon W, Rattanacherdchai K, Kanokmedhakul S, Kanokmedhakul K (2005) Application

of antagonistic fungi to control antracnose disease of grape. Int J Agric Technol 1:33–41

Srivastava SL, Bisht S (1986) Inhibitory effect of some phylloplane fungi on powdery mildew

disease development. Indian Phytopathol 39:83–86

Swati S, Adholeya A (2008) Biological control alternative paradigm for commercialization. In:

Maheshwari DK, Dubey RC (eds) Potential microorganism for sustainable agriculture. IK

International Publishing House, India

Tejesvi MV, Kini KR, Prakash HS, Subbiah V, Shetty HS (2007) Genetic diversity and antifungal

activity of species of Pestalotiopsis isolated as endophytes from medicinal plants. Fungal

Divers 24:37–54

Thrane C, Tronsmo A, Jensen DF (1997) Endo-1, 3-b-glucanase and cellulose from Trichoderma

harzianum : puri ﬁ cation and partial characterization, induction by and biological activity

against plant pathogenic Pythium spp. Eur J Plant Pathol 103:331–344

Traquair JA, Shaw LA, Jarvis WR (1988) New species of Stephanoascus with Sporothrix

anamorphs . Can J Bot 66:926–933

Turhan G (1990) Further hyperparasitism of rhizoctonia solani as promising candidate for biological

control. Zeitshrift P ﬂ anzenkrankheiten P ﬂ anzenshutz 97:208–215

Urquhart EJ, Menzies JG, Punja ZK (1994) Growth and biological control activity of Tilletiopsis

species against powdery mildew ( Sphaerotheca fuliginea ) on greenhouse cucumber.

Phytopathology 84:341–351

S. Ashraf and M. Zuhaib

Vinalea F, Sivasithamparamb K, Emilio L, Ghisalbertic MR, Sheridan L, Lorito WM (2008)

Review article trichoderma–plant–pathogen interactions. Soil Biol Biochem 40:1–10

Weindling R (1932) Studies on a lethal principle defective in the parasitic action of Trichoderma

lignorum on Rizoctonia solani and other soil fungi. Phytopathology 26:1068–1070

Weller DM (1988) Biological control of soil borne plant pathogens in the rhizosphere with bacteria.

Annu Rev Phytopathol 26:379–407

Whipps JM, Gerlagh M (1992) Mycol Res 96:897–907

Whipps JM (1998) Microbial interactions as basis for biological control of fungi diseases. In: 7th

international congress of plant pathology, invited papers abstract, vol 1:2.10.1S. BSPP,

Edinburgh, Scotland, 1998

Yoder KS (2000) Effect of powdery mildew on apple yield and economic bene ﬁ ts of its manage-

ment in Virginia. Plant Dis 84:1171–1176

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_5, © Springer Science+Business Media Dordrecht 2013

Abstract Fungi are a diverse group of unique eukaryotic organisms currently accepted

as the Eumycota kingdom. The (under) estimated number of fungal species is 1.5 × 10

of which only a small number have been identi ﬁ ed ( ca . 8–10%). They are ubiquitous

in nature with an extraordinary ability to decompose plant wastes while also causing

much spoilage of food and other relevant commodities. Certain species are used directly

as food and others in the manufacture of foodstuffs, antibiotics, enzymes, organic acids

and alcohol. Still others can infect humans, animals and crops. Information about each

microorganism (e.g. morphological and molecular descriptions, including modern

spectral data – MALDI-TOF MS, physiological and biochemical features, ecological

roles, and societal risks or bene ﬁ ts) is the key element in fungal identi ﬁ cation. In order

to attain a sound fungal identi ﬁ cation a polyphasic approach is required. It is achieved

through the integration of all biological traits data. Fungal service culture collections

have well established management systems and preservation techniques that are of

elemental importance and guarantee the proper identi ﬁ cation and characterisation of

environmental fungal isolates. They also assure the continuity of taxonomic and com-

parative studies and fungal availability for biotechnological exploitation. To foster

bio-economy and sustain the biotechnological developments new demands for quality

control of fungal holdings preserved in culture collections are in course. The quality

control system is associated with new guidelines for the culture collections to operate

at global level and to adapt the traditional fungal repositories into the new OECD

concept of Biological Resource Centres (BRCs).

Keywords Fungal diversity • Polyphasic identi ﬁ cation • Biological Resource

Centres (BRCs) • Preservation • Culture Collections

M. F. Simões • L. Pereira • C. Santos • N. Lima (*)

IBB – Biological Engineering Centre, Applied Mycology Group ,

University of Minho , Campus of Gualtar , 4710-057 Braga , Portugal

e-mail: m ﬁ lipa@deb.uminho.pt ; leoneljpp@deb.uminho.pt ;

cledir.santos@deb.uminho.pt ; nelson@ie.uminho.pt

Chapter 5

Polyphasic Identi ﬁ cation and Preservation

of Fungal Diversity: Concepts and Applications

Marta F. Simões , Leonel Pereira , Cledir Santos , and Nelson Lima

M.F. Simões et al.

1 Introduction: The Eumycota Kingdom

1.1 Phyla and Diversity

Fungi are eukaryotic organisms with a cell wall rich in glucans and chitin that grow

by absorption of nutrients after extracellular digestion of organic materials (organo-

chemo-heterotrophism). They range in size from species with massive underground

structures to microscopic single-celled yeasts. In addition, a large group is character-

ised by hyphal growth which absorbs nutrients and supports spores and are referred

to as ﬁ lamentous fungi.

Fungi are a ubiquitous and very diverse organisms referred as the Eumycota king-

dom or, sometimes, as the “ ﬁ fth kingdom”. The concept of the Fungi as one of six

kingdoms of life was introduced by Jahn and Jahn ( 1949 ) and a ﬁ ve kingdom system

was advanced later by Whittaker ( 1959 ) . However, from the formal point of view,

neither of these works included a Latin diagnosis as required by the International

Code of Botanical Nomenclature and the name “kingdom of Fungi” was therefore

invalid until Moore ( 1980 ) has published it. This kingdom comprises seven currently

recognised phyla: namely, Basidiomycota (mushrooms, rusts, smuts, etc.) and

Ascomycota (sac fungi, yeasts, etc.) which belong both to the subkingdom Dikarya,

and the basal fungi Glomeromycota (arbuscular mycorrhizal fungi and relatives),

Microsporidia (microscopic parasitic group), Blastocladiomycota (zoosporic fungi

found in soil and fresh water habitats) and its “sister” Neocallimastigomycota (micro-

scopic anaerobic fungi), and the most ancient phyla, Chytridiomycota (microscopic

and zoosporic fungi) (Hibbett et al. 2007 ) . At this stage, this kingdom accepts one

subkingdom, 10 subphyla, 35 classes, 12 subclasses, and 129 orders. However, fungal

classi ﬁ cation is very dynamic and the recent discovery reported by Jones and co-

authors ( 2011 ) of the new proposed phyla Cryptomycota (fungi isolated from aquatic

environments which include the genus Rozella considered one of the earliest diverging

lineages of fungi) shows that even today we have only a scarce knowledge about

fungi. The fungal taxonomy evolves continuously with successive rede ﬁ nitions of the

fungal tree of life. The constant changes on fungal taxonomic schemes as well as

the new proposed concept of “one fungus one name”, to avoid different names for the

anamorphic and teleomorphic fungal states (Hawksworth 2011a, b ) , show that the fungal

identi ﬁ cation and classi ﬁ cation remain dif ﬁ cult and for specialised experts only.

1.2 Facts and Numbers

In order to answer the question “How many fungal species exist in the Earth?” several

series of scienti ﬁ c papers have been reported concerning the great gap between

known and estimated species richness (Hawksworth and Rossman 1997 ; Hawksworth

2001 ; Schmit and Mueller 2007 ; May 2010 ; Bass and Richards 2011 ; Blackwell

2011 ; Mora et al. 2011 ) .

5 Polyphasic Identi ﬁ cation and Preservation...

Fungi are cryptic, understudied and hyper diverse organisms, and due to these

peculiar features the information currently available for most of the species is very

limited and incomplete and estimations of the number of species differ considerably

(Branco 2011 ) . Until now, there have been several attempts to estimate the total spe-

cies richness of fungi (Table 5.1 ) that were based on different assumptions.

The most commonly accepted estimation is the 1.5 million species hypothesised

by Hawksworth ( 1991 ) and revised 10 years later by himself (Hawksworth 2001 ) .

This assumption was based on the observed ratio between ﬂ owering plant diversity

and fungal diversity growing in particularly well-studied European countries

(Finland, Switzerland and United Kingdom), where fungi have been suf ﬁ ciently

well studied to enable a reasonable estimate of true diversity.

The ratio obtained by DL Hawksworth was 5:1–7:1 of fungal species to ﬂ owering

plant species in these particular locations. Since the estimative of plant species

diversity was 300,000; the extrapolated fungal species number was 1,500,000 for

the ratio 5:1. Although this number is very large when compared with more conser-

vative estimations such as of May ( 2000 ) and Schmit and Mueller ( 2007 ) , DL

Hawksworth admitted that the value achieved was also underestimated by the fol-

lowing reasons: (1) the ratio of fungal species to plant was based on the lower world

region of ﬂ owering plant species richness when compared with other regions like

North America and Central America; (2) it does not consider interactions with other

organisms, such as insects; (3) ratios are based on data from geographical areas with

few mycological information; and (4) no extrapolation is made for higher ratios like

in tropical and polar regions (Hawksworth 1991, 2001 ) .

An extensive survey of the fungi associated with six individual palms in the

genus Licuala in Australia and Brunei Darussalam (Borneo) performed by Fröhlich

and Hyde ( 1999 ) suggested an estimate of 1.5 million species of fungi. However,

these authors have considered this estimation very conservative. On the other hand,

analyses by Cannon ( 1997 ) based on similar studies in two small Caribbean areas

of Puerto Rico and the Dominican Republic, using data from the Ascomycete family

Phyllachoraceae pointed out that the Eumycota kingdom would have 9.9 million

Table 5.1 Most popular world fungal species number estimations

Publication Estimated species number

Hawksworth (

1991 ) 1,500,000

Hammond (

1992 ) 1,000,000

Rossman (

1994 ) 1,000,000

Hammond (

1995 ) 1,500,000

Cannon (

1997 ) 9,900,000

Fröhlich and Hyde (

1999 ) 1,500,000

May (

2000 ) 500,000

Hawksworth (

2001 ) 2,270,000

O’Brein et al. (

2005 ) 3,500,000–5,100,000

Schmit and Mueller (

2007 ) 712,000

Mora et al. (

2011 ) 611,000

M.F. Simões et al.

of species (Cannon 1997 ) . Moreover, O’Brein and co-authors ( 2005 ) , using the

assumption internal transcribed spacer (ITS)-based, estimated soil fungal richness

collected from pine and mixed hardwood, and from the vascular plant richness of

the pine and the mixed hardwood, they reached a fungal species richness ranging

from 3.5 to 5.1 million. However, they assumed that the richness was underesti-

mated because of the conservative 97% ITS similarity clustering, used to designate

Operational Taxonomic Units (OTUs), and the richness estimators continue to

increase with increasing sampling.

Mueller and Schmit (

2007 ) combined published and unpublished data on the

diversity and geographic distribution of the Eumycota kingdom to estimate a min-

imum ratio between the number of fungi and plants from different regions of the

world. In order to avoid the risk of overestimation they deliberately used conser-

vative assumptions at all stages of their analyses. In this study authors reached a

ﬁ nal value of 712,000 species (Schmit and Mueller 2007 ) . Mora and co-authors

( 2011 ) using a predictive algorithm based on a correlation between the number of

higher taxa and taxonomic rank across the tree of life, came up with a number of

611,000 species of fungi in the world. Because the higher taxa have not been fully

identi ﬁ ed until now, this dependence leads to an underestimation of the number of

fungal species.

Most recent data from the Dictionary of Fungi reported about 100,000 different

fungal species, this means that we know, at best, 16% of the fungus species on

Earth, or probably, in true reality, only around 1%. In addition, most of these species

belong to the Basidiomycetes and Ascomycetes groups which emphasize how much

remains to be discovered in the Eumycota kingdom. New high level taxa have been

detected and described, for example the phylum Cryptomycota as previously men-

tioned. The acceptance of Cryptomycota alone could radically increase the size of

the Eumycota kingdom (Blackwell 2011 ) .

1.3 Fungal Diversity and Culture Collections

This huge diversity (but at the same time small) can be exploited to provide solutions

for many of the challenges that threaten the world today, such as climate change and

global warming, loss of biodiversity, invasive alien species, population growth and

over-exploitation, pollution, etc., all of them underpin biotechnology, sustainable

development and sustainable agriculture. On the other hand, the exploitation of this

resource is only possible if the diversity can be analysed, identi ﬁ ed, characterised and

authenticated by expert taxonomists, and other scientists (e.g., fungi conservationists,

food, environmental and medical mycologists, mycotechnologists, etc.), within e.g.,

culture collections (Scoble

2010 ) .

Culture collections are distributed worldwide and are responsible for holding

the fungal diversity primary data. The size and organisation of this kind of infra-

structures vary broadly, ranging from collections with small sets of strains to large,

structured, well-documented and maintained collections. Examples of Culture

5 Polyphasic Identi ﬁ cation and Preservation...

Collections that preserve fungi are listed in Table 5.2 . For a more comprehensive

and detailed information, the World Data Centre of Microorganisms (WDCM,

www.wdcm.org ) which is the data centre of the World Federation of Culture

Collections (WFCC, www.wfcc.info ) gives several possibilities to ﬁ nd culture col-

lections and information about fungal holdings around the world. From more than

600 Culture Collections distributed in 70 countries, one fourth fungal strains out of

about two million microorganisms are available to be supplied to the different user

communities.

The identi ﬁ cation, characterisation, correct preservation, stable storage and sup-

ply of viable and authentic microorganisms in Culture Collections are a major con-

tribution to the knowledge-based bio-economy. In addition, Culture Collections are

becoming even more important with the necessity of authentication the fungal

strains to avoid the frequent fungal misidenti ﬁ cations.

The authentication of fungal strains will be a step forward to decrease the fungal

misidenti ﬁ cations that is pervasive within the scienti ﬁ c community. This problem

does not only concern the scienti ﬁ c community but also the general society.

For decades Culture Collections have provided their public service information

through their catalogues. Nowadays, computerisation of catalogues is becoming

increasingly imperative. The most straightforward way to make the access to

strain data more open and easier are web databases that are vital to distribute

information and in turn create knowledge (Canhos et al. 2004 ; Baird 2010 ) .

During the last decade numerous biodiversity information databases have been

launched for data collecting. The most important web databases for fungal diversity

Table 5.2 Culture Collections in the world that preserve fungal holdings

Acronym Name and country Website URL

ATCC American Type Culture

Collection, USA

http://www.atcc.org

BCCM/MUCL (Agro)Industrial Fungi &

Yeasts Collection, Belgium

http://bccm.belspo.be/about/

mucl.php

CBS Centraalbureau voor

Schimmelcultures, The

Netherlands

http://www.cbs.knaw.nl

FGSC Fungal Genetics Stock

Center, USA

http://www.fgsc.net

IMI CAB International, UK

http://cabi.bio-aware.com

MUM Micoteca da Universidade do

Minho, Portugal

http://www.micoteca.deb.

uminho.pt

NCPF National Collection of

Pathogenic Fungi, UK

http://www.hpacultures.org.

uk/collections/ncpf.jsp

NRRL National Center for

Agricultural Utilization

Research, USDA, USA

http://www.ncaur.usda.gov

URM University Recife Mycology,

Brazil

http://www.ufpe.br/micoteca

M.F. Simões et al.

are: MycoBank ( www.mycobank.org ), CABRI HyperCatalogue ( www.cabri.org ),

Index Fungorum ( www.indexfungorum.org ), StrainInfo ( www.straininfo.net ) and

GBIF ( www.gbif.org ).

2 Fungal Identi ﬁ cation

2.1 Polyphasic Approach

The identi ﬁ cation of species is an important goal in taxonomic microbiology. Information

about each microorganism (e.g., morphological description, physiological and bio-

chemical properties, ecological roles, and societal risks or bene ﬁ ts) is a key element in

this process. Identi ﬁ cations can be a long and seemingly never-ending process with

frequent revisions of the taxonomic schemes. These changes make identi ﬁ cation even

more complicated for non-specialised researchers as every taxonomic group has specia-

lised literature, terminology and features. This dif ﬁ culty occur even a basic level that

fungal identi ﬁ cations can only be undertaken by a narrow group of scientists especially

skilled in the “art”. The concept of species is clearly abstract and delimitations are very

dif ﬁ cult, and often not consensual. Taking this into account, microbial taxonomy (more

evident in fungal taxonomy) and their associate data can often be best applied at the

moment where the data are used for a speci ﬁ c purpose: A pragmatic de ﬁ nition is “data

ﬁ t for use”. It is gradually becoming clearer that microbial identi ﬁ cation and authentica-

tion require a multiple steps approach to generate accurate and useful data (Keys et al.

2004 ) . In reality, this means that is necessary to combine more traditional phenotypic

and physiological approaches with modern molecular biology (Rodrigues et al. 2009,

2011 ) . Restriction fragment length polymorphism (RFPLs), random ampli ﬁ cation of

polymorphic DNA (RAPDs), ampli ﬁ ed fragment length polymorphism-PCR (AFLPs-

PCR), and DNA ﬁ ngerprinting have all been used to distinguish microbial taxa that are

dif ﬁ cult to characterise by traditional morphological means. It is assumed that the geno-

type of the species is only an indirect indication of phenotype and ecological adaptation.

In other words, microbial species can be de ﬁ ned as the smallest aggregation of popula-

tion with a common lineage that share unique diagnosable phenotypic features.

Recently, consistent identi ﬁ cation and characterisation of species of ﬁ lamentous

fungi has been developed by application of the so-called polyphasic approach. The

polyphasic approach consists of the use of different techniques based on the system-

atisation of the scienti ﬁ c knowledge. Different methodologies such as micro- and

macro-morphology, biochemical and molecular biology analyses are applied.

Microbial spectral analysis based on mass spectrometry (particularly matrix assisted

laser desorption/ionisation time-of- ﬂ ight mass spectrometry//MALDI-TOF MS) has

been developed and used as an important step in the polyphasic identi ﬁ cation of

ﬁ lamentous fungi from different ﬁ elds (Santos and Lima 2010 ; Santos et al. 2010 ;

Rodrigues et al. 2011 ; Dias et al. 2011 ) . Information obtained by each technique pre-

sented above is compared with each other in a step-by-step based approach. The ﬁ rst

5 Polyphasic Identi ﬁ cation and Preservation...

approach commonly used in this process is morphology followed by biochemistry,

spectral analysis and molecular biology. Due to the higher costs and longer answer

time, when compared with MALDI-TOF MS, molecular biology in our polyphasic

approach is normally used as the last methodology (Fig. 5.1 ). According to Santos and

Lima ( 2010 ) molecular biology has been recognised as the gold standard technique

in the modern polyphasic methodology of ﬁ lamentous fungi identi ﬁ cation.

2.2 Morphology

Internationally based culture collections are obliged to guarantee the authenticity of

the fungi that they hold (Santos and Lima 2001 ) . Identi ﬁ cations are time-consuming,

and decisions regarding what represents a species tend to be subjective. The standard

method for identifying and classifying ﬁ lamentous fungi remains morphology

because, in general, ﬁ lamentous fungi have more distinctive morphology traits

than, for example, single-cell bacteria and yeast (Santos et al. 2010 ) . Moreover,

identi ﬁ cation of ﬁ lamentous fungi by morphology is generally regarded to be very

dif ﬁ cult, as features used for delimitation of species within a genus often show min-

ute differences that can only be reliably evaluated by experienced mycologists. Even

so, fungal identi ﬁ cations based on morphology only are prone of misidenti ﬁ cations.

Furthermore, taxonomy of some ﬁ lamentous fungi genera is subjected to frequent

revision. Table 5.3 shows an example of taxonomy revision evolution for Aspergillus

sub-genus, section and species within the last 25 years.

In general, however, ﬁ lamentous fungi as a whole remain dif ﬁ cult to identify

because of the biological complexity: classi ﬁ cation undergoes almost continual

change, particularly since the introduction of nucleic acid-based methodology

(Hibbett et al. 2007 ) where ‘cryptic species’ are revealed. To illustrate the points

Fig. 5.1 Modern polyphasic methodology of ﬁ lamentous fungi identi ﬁ cation according to Santos

and Lima (

2010 ) . This scheme recognises molecular biology as the gold standard technique in the

step-by-step identi ﬁ cation

M.F. Simões et al.

made, some important penicillia, Cordyceps and Ganoderma remain problematic

despite decades of study (Santos et al. 2010 ) .

Daily routine identi ﬁ cation of ﬁ lamentous fungi genera with high relevance in

the environmental ﬁ eld, such as Aspergillus , Fusarium , Penicillium , Trichoderma ,

among others, has been traditionally based on morphological characterisation.

Conidial wall ornamentation is regarded as the primary morphological diagnostic

character for identi ﬁ cation of ﬁ lamentous fungi species. For some of the known

ﬁ lamentous fungi, genera and/or species differentiation can be achieved through

different growth conditions (Rodrigues et al. 2009 ) . Once morphology and colony

colour vary among media, use of standard culture media is crucial for the fungal

morphology-based identi ﬁ cation (Santos et al. 1998 ) . Pitt ( 1988 ) used a loopful of

spores suspended in 0.2% agar for Penicillium species identi ﬁ cation. In this case, a

suspension of spores is used for three-point inoculations on plates containing three

different growth media that are incubated at three different temperatures. Cultures

Table 5.3 Taxonomical revision evolution for Aspergillus sub-genus, section and species within

the last 25 years

Taxonomy after Gams et al. ( 1985 ) Taxonomy after Peterson ( 2000 )

Sub-genus Section Sub-genus Section Species

Aspergillus Aspergillus Aspergillus Aspergillus

Restricti Restricti

Cervini

Terrei

Flavipedis

Wentii

Flavi

Nigri

Circundati

Candidi

Cremei

Fumigati Fumigati Fumigati Fumigati More than 250

species

Cevini Clavati

Ornati Ornati – –

Clavati Clavati – –

Nidulantes Nidulantes Nidulantes Nidulantes

Versicolores Ornati

Usti Sparci

Terrei

Flavipedes

Circundati Wentii – –

Flavi

Nigri

Circundati

Candidi

Cremei

Sparci

5 Polyphasic Identi ﬁ cation and Preservation...

are grown for (a) 7 days on Czapek Yeast Autolysate agar (CYA) at 5, 25 and 37°C;

(b) Malt Extract agar (MEA) and (c) Glycerol Nitrate agar (G25N) both at 25°C. On

the other hand, media commonly suggested for Aspergillus identi ﬁ cation based on

three-point inoculations are CYA, CYA with 20% saccharose (CY20S), Potato

Dextrose Agar (PDA) and MEA (Fig. 5.2 ). Medium G25N can be useful for induc-

tion of sporulation in case of fungi isolated on “dry” substrates (xerophilic fungi).

In both cases cultures are grown for 7 days in the dark at 25°C. Other important

medium for Aspergillus species identi ﬁ cation is Aspergillus ﬂ avus and parasiticus

agar (AFPA; Pitt et al. 1983 ) . The latter is used to con ﬁ rm the identi ﬁ cation of a

ﬁ lamentous fungi group based on colony reverse colour (e.g. A . ﬂ avus , A . parasiticus

and A . nomius are distinguished by bright orange yellow reverse colour in contrast

with the cream reverse colour of A . tamarii ).

Conidia ornamentation of Aspergillus and Penicillium species are features that

are independent of growth conditions (Santos et al. 1998 ) and can be used for spe-

cies diagnosis. In addition, these fungi can produce different pigments depending

on the growth conditions. Such pigments sometimes help in the fungal identi ﬁ cation

(Klich 2002 ; Samson et al. 2004 ) .

2.3 Biochemical Features and Secondary Metabolites

The incorporation of biochemical features (e.g., enzymes and secondary metabo-

lites such as mycotoxins) into fungal taxonomy has helped to solve morphological

limitations (Petisco et al. 2008 ) . Rapid and reliable physiological tests are available

only for a limited number of taxa. Different classes of enzymes have been used as

important biochemical traits for the characterisation of fungi. Generally fungi can

live in limited conditions because they are able to produce a set of enzymes such as

lignin peroxidases, manganese peroxidases, laccases, cellulases, pectinases, xyla-

nases, esterases and lipases capable to convert wood, plastic, paints and jet fuel,

among other materials, into useful nutrients.

White rot fungi, for instance, are able to produce several enzymes that have been

related to their ability to degrade natural polymers, such as lignin and cellulose, and

different synthetic chemicals, usually compounds recalcitrant to biodegradation

(Martins et al. 2003 ) . These enzymes are one of the fungal features used for the

development of the fungal biochemical pro ﬁ le.

Fig. 5.2 Example of

Aspergillus ibericus MUM

03.49 growth in CYA ( left ),

PDA ( middle ) and MEA ( right )

media at 25°C for 7 days

100

M.F. Simões et al.

Another important biomarkers used in fungal identi ﬁ cation are mycotoxins.

Mycotoxins are toxic secondary metabolites produced by fungi, which have adverse

health effects on animals and humans. Currently, hundreds of fungal toxins are

known although only a small number are taken seriously as mycotoxins and an

estimate of ten would be reasonable (Nielsen and Smedsgaard

2003 ; Paterson and

Lima

2010 ) . Most of them are produced by the genera Aspergillus , Fusarium ,

Penicillium and Claviceps . The most serious threats are from mycotoxins having

signi ﬁ cant oral toxicity and occurring naturally in crops, processed foods, and feed

ingredients (Abramson et al. 2009 ) .

Some mycotoxins produced by fungal species belonging to the genus Aspergillus

section Flavi , for instance, are widely used in fungal species identi ﬁ cation. A ﬂ atoxins

(AFs) B and G (AFBs and AFGs), cyclopiazonic acid (CPA), aspergillic acid and

kojic acid (Hong et al. 2005 ; Samson et al. 2007 ; Varga et al. 2007a, b ; Rodrigues

et al. 2011 ) are the most common mycotoxins produced by this group of fungi.

Generally, each fungal species is usually characterised by its speci ﬁ c mycotoxigenic

pro ﬁ le (Frisvad 1989 ; Larsen et al. 2005 ) . However, cases have been reported where

different isolates belonging to the same species do not produce the expected second-

ary metabolites, and this is especially common regarding AFs production (Vaamonde

et al. 2003 ; Giorni et al. 2007 ; Pildain et al. 2008 ; Rodrigues et al. 2009 ) .

Another important mycotoxin used as biomarker in the biochemical identi ﬁ cation

of ﬁ lamentous fungi species is ochratoxin A (OTA). Some of species belonging to

Aspergillus and Penicillium are able to produce this secondary metabolite. Nowadays,

there are about 20 species accepted as OTA producers, which are distributed in three

phylogenetically related but distinct groups of aspergilli of the subgenus Aspergillus

(e.g., A . carbonarius , A . niger , A . ochraceus , etc.) and in only two species of the

subgenus Penicillium . At the moment, P . verrucosum and P . nordicum are the only

OTA producing species accepted in the genus Penicillium (Cabañes et al. 2010 ) .

The three major classes of mycotoxins produced by Fusarium species that have

been proven to cause animal disease outbreaks are: trichothecenes, fumonisins, and

zearalenones. In addition, mycotoxins belonging to the class of trichothecenes have

been most strongly associated with chronic and fatal toxicoses of humans and ani-

mals, including Alimentary Toxic Aleukia in Russia and Central Asia, Akakabi-byo

(red mold disease) in Japan, and swine feed refusal in the central United States

(Desjardins and Proctor 2007 ).

2.4 New Spectral Analysis by MALDI-TOF MS

MALDI-TOF MS emerged in the late 1980s as a sound technique to investigate

high molecular mass organic compounds. It runs through a soft ionisation of mole-

cules resulting in minimum fragmentation (Tanaka et al. 1988 ) . MALDI-TOF MS

involves subjecting a sample covered with an UV-absorbing matrix that functions as

an energy mediator, to a pulsed nitrogen laser. Matrices are chemical compounds

generally containing aromatic moieties that transfer the absorbed photoenergy from

101

5 Polyphasic Identi ﬁ cation and Preservation...

the irradiation source to the surrounding sample molecules, resulting in minimum

fragmentation (Hillenkamp and Peter-Katalinić 2007 ; Santos et al. 2010 ) . Several

matrices are commercially available and the choice depends on the laser wavelength

used in each MALDI-TOF MS instrument (Table

5.4 ). Choosing the appropriate

matrix for the identi ﬁ cation of ﬁ lamentous fungi is crucial. Matrices are used as

liquid solution and its ﬁ nal composition is constituted by the organic chemical com-

pound that is the matrix properly dissolved in an organic solvent, generally ethanol

and/or acetonitrile, and water. In order to help analyte ionisation a strong acid such

as tri ﬂ uoroacetic acid (TFA) is normally employed during matrix liquid solution

preparation. The use of the appropriate matrix leads to an optimal signal/noise ratio

with narrowest analyte peaks and little signal suppression. Further details for

identi ﬁ cation of ﬁ lamentous fungi by MALDI-TOF MS can be obtained elsewhere

(Rodrigues et al. 2011 ) .

Currently, the two most commonly used matrices for ﬁ lamentous fungi

identi ﬁ cation are 2,5-dihydroxybenzoic acid (DHB) and a -cyano-4-hydroxycin-

namic acid (CHCA). Both DHB and CHCA matrices are appropriate for the analy-

sis of molecules with a mass range between 2 and 20 kDa. Constantly expressed and

highly abundant proteins, such as ribosomal proteins that appear in this speci ﬁ c

mass range can be used as biomarkers. Based on this knowledge, different studies

have demonstrated the high potential of this technique for species and strain

identi ﬁ cation of ﬁ lamentous fungi (Santos and Lima 2010 ; Santos et al. 2010 ; Dias

et al. 2011 ; Rodrigues et al. 2011 ) .

The seminal paper by Cain et al. ( 1994 ) , where authors presented bacterial

identi ﬁ cation by MALDI-TOF MS based on a methodology with previous sample

preparation with minimal puri ﬁ cation of cell contents, was the important milestone

for the use of MALDI-TOF MS technique in modern fungal taxonomy. Two years

later Holland et al. ( 1996 ) described by the ﬁ rst time a method for the rapid identi ﬁ cation

of whole bacteria. In this work bacteria were sampled from colonies on an agar plate,

mixed with the matrix, air-dried, and introduced in batches into the MALDI-TOF

apparatus for analysis. This work represents the ﬁ rst reported example of successful

bacterial chemotaxonomy by MALDI-TOF MS analysis of whole cells.

MALDI-TOF MS for the identi ﬁ cation and classi ﬁ cation of microorganisms

needs dedicated software and database [e.g., BioTyper™ (Bruker Daltonics Inc.,

Bremen, Germany), SARAMIS™ (AnagnosTec GmbH, Potsdam-Golm, Germany)

or VITEK® MS (bioMérieux, Craponne, France)] to enable comparisons of the

unknown proteins with reference molecular masses. Ribosomal proteins are used

normally as reference molecular masses as they are the most abundant ones in the

cells, as described above.

External MALDI-TOF MS calibration has been performed by use of well char-

acterised proteins from Escherichia coli strain K-12 (Ryzhov and Fenselau 2001 ) .

From tens of ribosomal proteins of intact E . coli K-12 cells 12 well de ﬁ ned proteins

are used as MALDI-TOF MS standard (4,365.4, 5,096.8, 5,381.4, 6,241.4, 6,255.4,

6,316.2, 6,411.6, 6,856.1, 7,158.8, 7,274.5, 7,872.1, 9,742 and 12,227.3 Da). The

low costs, simple growth conditions, and reliability found in the E . coli biomarkers

make them the ﬁ rst choice to be use in microbial identi ﬁ cation.

102

M.F. Simões et al.

Table 5.4 Most common MALDI-TOF MS matrices commercially available and best laser wavelength where each matrix operates

Name Abbreviation Wavelength MW Chemical structure

a -cyano-4-hydroxy-

cinnamic acid

CHCA UV 337, 353 nm 189.1675

C N

COOH

2,5-di-hydroxy-

benzoic acid

DHB UV 337, 353 nm 154.1201

COOH

Sinapinic acid SA UV 337, 353 nm 224.2100

HC COOH

103

5 Polyphasic Identi ﬁ cation and Preservation...

Nicotinic acid NA UV 266 nm 123.1094

COOH

Succinic acid SCA IR 2.94, 2.79 m m 118.0266

CHCA and DHB are the most used matrices for identi ﬁ cation of fungi by MALDI-TOF MS

104

M.F. Simões et al.

2.5 Molecular Biology

Advances in molecular tools, in particularly the advent of polymerase chain reaction

(PCR) have formed the basis for a boost in studies concerning fungal diversity and

allowed a much more straightforward and sensible approach to the study of cryptic

organisms, such as fungi. With molecular data information a better understanding of

the fungal relationships and the process of a more natural classi ﬁ cation are possible

(Begerow et al.

2010 ; Branco 2011 ) . For example, cryptic species that are common

in the Eumycota kingdom are only liable to be differentiated and correctly identi ﬁ ed

through the tools of molecular biology. An example was reported by Perrone and

co-authors ( 2011 ) that recognised the cryptic species Aspergillus awamorii by phy-

logenetic analysis of DNA sequence data.

With the help of bioinformatics tools, new genetic databases are being created

and used as sources for molecular barcodes. DNA barcoding is a technique for a

simple characterisation of organisms at species level using a short DNA sequence

from a standard and agreed-upon position in the genome. The technique is charac-

terised for being accurate, rapid, cost-effective, culture-independent, universally

accessible and usable by non-experts (Frezal and Leblois 2008 ) . A fraction of the

mitochondrial cytochrome c oxidase 1 (COX1) gene has become the ﬁ rst of ﬁ cial

DNA barcode for animals (Hebert et al. 2004 ; www.barcoding.si.edu ) and for plants

(Hollingsworth et al. 2009 ) . However, since some fungal species possess distinct

genotypes at the mtDNA COI locus, no of ﬁ cial consensus DNA fragment was

de ﬁ ned for fungi (Samson and Varga 2000 ; Seifert et al. 2007 ) . Therefore, it becomes

important to pinpoint genes which characterise fungal organisms at different taxo-

nomic levels in a straightforward and standardised way.

The most frequently studied markers are one or more of the nuclear rRNA genes,

for example, small subunit (SSU) rRNA gene (Wubet et al. 2006 ) , the internal tran-

scribed spacer (ITS) rDNA region including the 5.8S rRNA gene (Hempel et al.

2007 ; Sykorova et al. 2007 ) , and a part of the large subunit (LSU) rRNA gene

(Gollotte et al. 2004 ; Pivato et al. 2007 ; Rosendahl et al. 2009 ) , as represented in the

Fig. 5.3 .

The most widely accepted and used DNA fragment for identifying fungi at the

species level is the ITS region. In addition to the standard ITS1 + ITS4 primers used

by most research groups, several taxon-speci ﬁ c primers have been described that

allow selective ampli ﬁ cation of fungal sequences (Table 5.5 ).

ITS can be used as universal fungal barcode locus for several reasons. Genomes

include numerous ribosomal DNA encoding genes distributed in tandem arrays

along the same or different chromosomes and they are assumed to be extremely

similar (Rooney and Ward 2005 ) . In addition, the ITS fragment is easily ampli ﬁ ed

by PCR, even from low-quality samples that make it a fast and easy tool to describe

fungal diversity (Nilsson et al. 2010 ) . However, there are also disadvantages in the

choice and use of the ITS region since the capacity to discriminate at the species

level differs considerably among fungal groups that in some cases the identi ﬁ cation

at species level could be ambiguous (Soares et al.

2012 ) .

105

5 Polyphasic Identi ﬁ cation and Preservation...

3 Fungal Preservation

3.1 Preservation Techniques of Ex Situ Environmental

Fungal Strains

Nowadays, it is a must to preserve our biological resources. Maintaining and pre-

serving are essential elements of systematic and biodiversity studies. Environmental

fungal strains can be used in research, as reference strains in diagnostic laboratories,

for teaching purposes, in bio-industries (e.g., enzyme production, fermentation, bio-

conversion) and environmental biotechnology (e.g., bioremediation). Since fungi

are such a diverse group, several different methods of cultivation and preservation

are required to ensure the viability and morphological, physiological and genetic

Fig. 5.3 Schematic representation of the internal transcribed spacer (ITS) in the ribosomal operon,

the nuclear ribosomal repetitive unit used to describe fungi to the species level and the ITS primers.

SSU small subunit rRNA gene, LSU large subunit rRNA gene

Table 5.5 Primers for ITS region

Primer name/Reference Sequence (5 ¢ →3 ¢ )

ITS1 (White et al.

1990 ) TCCGTAGGTGAACCTGCGG

ITS2 (White et al.

1990 ) GCTGCGTTCTTCATCGATGC

ITS3 (White et al.

1990 ) GCATCGATGAAGAACGCAGC

ITS4 (White et al.

1990 ) TCCTCCGCTTATTGATATGC

ITS5 White et al. (

1990 ) GGAAGTAAAAGTCGTAACAAGG

ITS1-F (Gardes and Bruns

1993 ) CTTGGTCATTTAGAGGAAGTAA

ITS4-B (Gardes and Bruns

1993 ) CAGGAGACTTGTACACGGTCCAG

5.8S (Vilgalys and Hester

1990 ) CGCTGCGTTCTTCATCG

5.8SR (Vilgalys and Hester

1990 ) TCGATGAAGAACGCAGCG

SR6R (Vilgalys and Hester

1990 ) AAGWAAAAGTCGTAACAAGG

106

M.F. Simões et al.

integrity of the cultures over time. The cost effectiveness and robustness of each

preservation method are also important aspects to be taken into consideration.

“Off-site” or ex - situ preservation of fungal strains means conserving the fungi

outside their natural environment and this can be done by several methods. The primary

methods of culture preservation are continuous growth, drying and freezing. Continuous

growth methods, in which cultures are grown on agar-solid media, are typically used

for short-term storage. Such cultures are stored at room temperature between 5 and

25°C, or they may be frozen to increase the interval between subcultures. The methods

are simple and inexpensive because specialised equipment is not required.

Drying is the most useful method of preservation for cultures that produce spores

or other resting structures. Silica-gel, glass beads and soil are substrates commonly

used in drying. The preservation of fungi on silica-gel has been successfully per-

formed for periods over 10 years (Smith and Onions

1983 ) . Drying methods are

technically simple and do not require expensive equipment. Freezing methods,

including cryopreservation, are versatile and widely applicable. Most fungi can be

preserved, with or without cryoprotectants, in liquid nitrogen or in standard home

freezers. With freeze-drying the fungal cultures are frozen and subsequently dried

under vacuum. The method is highly successful with cultures that produce conidial

forms. Freeze-drying and freezing are excellent methods for long-term preserva-

tion. However, both methods require specialised and expensive equipment. The

choice of preservation methods depends on the species of concern, the resources

available and the desired time of preservation. Some low cost methods of preserva-

tion are: storage in distilled water and silica-gel though they are not long-term

preservation methods, the maximum duration for these methods is described as

being 10 years or less (Nakasone et al. 2004 ) .

It is important that biological resources are preserved in a physiological and

genetically stable state; this is why, whenever possible, strains should be preserved

with one of the permanent methods, like freeze-drying or cryopreservation, these

being essential for strains with economically important characteristics and for type

strains (Nagai et al. 2005 ) . There are several points to ponder when choosing a

preservation method, these being:

viability maintenance, with minimal loss of viability during proceedings and •

protocols of preservation;

prevention of changes in population, keeping characteristics close to the original •

in the viable population;

prevention of genetic changes, with maintenance of genetic integrity of each strain; •

assurance of purity, with preservation without any contaminants; •

costs, evaluate the relation between capital costs with the labour costs associated •

with the preservation method;

number of cultures, since a large number of cultures affects costs, storage space •

and manipulation time;

value of the cultures, since important cultures must be preserved through more •

than one technique in order to minimise their possible loss and to guarantee a

safe deposit of strains;

107

5 Polyphasic Identi ﬁ cation and Preservation...

frequency of usage, compromise between the regular or not so often use of the •

strains;

supply and transport of cultures, must be done according to national and inter-•

national norms and rules, under the present legislation.

To help in the decision making of preservation and storage method one can use

decision-based keys, but it is important to consider that no preservation method should

be assumed to guarantee total physiological and genetic stability of an isolate; this is

why many scientists wish to preserve many replicates of their fungus and use more

than one technique to reduce the chance of strain deterioration (Ryan et al.

2000 ) .

Preservation techniques can be differentiated based on several parameters like

the storage period, being short- or long-term, as described in Table 5.6 .

The best way to preserve fungi and assure their long-term stability is to ﬁ nd con-

ditions where storage guarantees that after retrieval there has not been any growth

or reproduction. Furthermore, all the structural and functional characteristics shall

be maintained. However, many parameters can in ﬂ uence or alter this goal. As dis-

cussed above, different studies and investigations aim to minimise the number of

generations from the initial isolate and reduce to a minimal the cellular activity.

Research in this area concerns the optimisation of existing protocols to achieve

optimal survival and stability (e.g., delicate and recalcitrant strains), and the devel-

opment of new methods to ful ﬁ l the demands of quality and stability for general

research and Biological Resource Centres (BRCs) (Ryan et al. 2001 ; Santos et al.

2002a, b ; Ryan et al. 2012 ) .

3.2 Management Systems for Microbial Diversity

Ex situ Preservation

From the social, industrial, economic and scienti ﬁ c point of view the biodiversity is

very important for the world. There is a demand to assure and guarantee the conser-

vation of biodiversity. Its sustainable uses and the equitable share of bene ﬁ ts, arising

from the use of biodiversity through ethical sourcing practices between all the different

BRCs and stakeholders. Efforts are being made to help diminish or stop the loss of

biodiversity. One of these efforts is the CBD – Convention on Biological Diversity

adopted in 1992 at Rio de Janeiro, Brazil ( http://www.cbd.int/history ). This is an

international convention for the (1) conservation of biodiversity (see articles 8 and 9

for in situ and ex situ conservation, respectively); (2) sustainable use of the compo-

nents of biodiversity (see article 10) and, (3) the equitable sharing of the bene ﬁ ts

derived from the use of genetic resources (see article 15). The CBD has a universal

participation of 193 parties (

http://www.cbd.int/convention/text ). Additionally, sev-

eral protocols were created: the Cartagena Protocol was created in order to protect

the biological diversity from the potential risks posed by living modi ﬁ ed organisms

which means any living organism that possesses a novel combination of genetic

material obtained through the use of modern biotechnology (Mackenzie et al. 2003 ;

108

M.F. Simões et al.

Table 5.6 Description of the main features of the most common methods of fungal preservation in the context of culture collections

Method References

Serial transfer or

subculturing

Short description : Growth in appropriate media and conditions; transfer an inoculum from the vigorous,

healthy and actively growing fungus culture to test tubes or Petri dishes containing an agar medium

of choice, in determined time periods; keeping the samples at room temperature or at 4°C in-between

the transfer that usually occurs every 2 months.

Smith and Onions (

1983,

1994 ) ; Smith et al.

(

2001 ) ; Nakasone

et al. (

2004 )

Advantages : Simple procedure, inexpensive and widely used.

Disadvantages : Short-term preservation technique. Time consuming and labour intensive. Cultures

require constant specialist supervision.

Preservation with

mineral oil

Short description : Fungal cultures are grown on agar slants in tubes and afterwards covered with

sterilised mineral oil or liquid paraf ﬁ n.

Smith and Onions

(

1994 ) ; Sharma

and Smith (

1999 ) ;

Nakasone et al. (

2004 )

Advantages : Simple procedure. Low-cost and low-maintenance method. Appropriate for mycelial or

nonsporulating cultures that are not adequate to be preserved by freezing or freeze-drying.

Disadvantages : Subculturing the colony several times might be necessary in order to get a vigorous

oil-free culture. Growth rates slow down as storage time increases. Requires enough storage space.

Preservation in

water

Short description : First described by Castellani ( 1967 ) . Cut disks from growing colony edges are

transferred to sterile cotton-plugged or screw-cap test tubes ﬁ lled with several millilitres of water; or

cryovials are ﬁ lled with several discs and topped with sterile distilled water. The tubes are stored at

room temperature or at 4°C.

Castellani (

1967 ) ; Capriles

et al. (

1989 ) ; Smith

and Onions (

1994 ) ;

Nakasone et al. (

2004 )

Advantages : Inexpensive and low-maintenance method. It has been described that water suppresses

morphological changes in most fungi. Avoids mite contamination.

Disadvantages : Viability decreases with the increasing of storage time. Requires enough storage space.

Silica gel

Short description : Screw-cap tubes are partially ﬁ lled with silica without indicator dye, which has been

sterilised by dry heat. Spores are suspended in a cooled solution of skimmed milk (5%). Silica gel is

chilled and placed in an ice-water bath. The spore suspension is added to the silica gel to wet the gel.

Tubes are stored with the caps loose at 25 or 30°C for several days. Viability is checked and if the

cultures are viable, caps are tightened and the tubes are stored.

Perkins (

1962 ) ; Grivell

and Jackson (

1969 ) ;

Smith and Onions

(

1994 ) ; Sharma and

Smith (

1999 ) ;

Nakasone et al. (

2004 )

Advantages : Storage at low temperatures can increase the survival period twofold to threefold over

storage at room temperature. Therefore, it can be used as a medium term storage method, especially

for sporulating fungi. It is an inexpensive, rapid and simple technique to use.

Disadvantages : Some fungi such as Pythium , Phytophthora and some Oomycota species, do not survive

to this process. It is limited to some fungi with delicate spores. Requires enough storage space.

109

5 Polyphasic Identi ﬁ cation and Preservation...

Deep-Freezing Short description : Cultures are grown on agar slants in bottles or test tubes with screw-caps and can be

placed directly in the freezer. However, in a different process, vigorous cultures can be grown in

tubes and ﬂ ooded with a solution containing 10% glycerol in water. In order to produce a suspension

with spores and mycelium, cultures are scraped and then applied into cryovials with sterile glass

beads inside. Finally, they are frozen at −80°C, with a cooling rate of −1°C per minute.

Smith and Onions (

1994 ) ;

Baker and Jeffries

(

2006 )

Advantages : The retrieval procedure is very simple. It is a long-term preservation technique where most

fungal cultures frozen at −20 to −80°C remain viable and successfully preserved for up to 5 years.

Disadvantages : Repeated freezing and thawing will signi ﬁ cantly reduce the culture viability and several

factors can affect the retrieval viability and effectiveness.

Cryopreservation

in liquid

nitrogen

Short description : For fungal cultures that do not sporulate or produce mycelia growing deep into the

agar, sterilised screw-cap vials are ﬁ lled with one quarter to half volume with a 10% glycerol

solution. Plugs are cut from vigorously growing cultures and placed in a cryovial which is placed

directly into the vapour phase of a liquid-nitrogen tank.

Nakasone et al. (

2004 ) ;

Smith and Onions

(

1994 )

Advantages : Storage of fungi using plastic straws instead of vials or tubes has been reported. Procedures

used to harvest materials differ depending on whether the fungi sporulate, have mycelia that

penetrate below the surface of the agar, or grow only in liquid culture. It is an effective, timesaving

and reduced labour requirements. Method with increased assurance of long-term availability.

Disadvantages : It is an expensive method due to constant maintenance by re ﬁ lling of liquid nitrogen and

high costs of the apparatus. It needs constant surveillance. Also there are space requirements for the

refrigeration units.

Freeze-drying

Short description : The procedure involves a two-stage process: (1) ampoules containing the cultures as

suspensions are cooled to −60°C; air pressure in the ampoules is reduced and water is removed by

ablation as the temperature is allowed to rise; (2) the ampoules are placed on a vacuum manifold for

secondary drying, evacuated, and sealed under vacuum. Finished freeze-dried ampoules are stored.

Fry and Greaves (

1951 ) ;

Schipper and

Bekker-Holtman

(

1976 ) ; Sharma and

Smith (

1999 ) ;

Nakasone et al. (

2004 ) ;

Uzunova-Doneva and

Donev (

2005 ) ;

Miyamoto-Shinohara

et al. (

2006 )

Advantages : Long-term storage at room temperature. Low-cost form of permanent preservation. It is the

method of choice for many spore-forming fungi that produce large numbers of small (10- m m or less

in diameter) spores.

Disadvantages : Not appropriate for all fungi. The technique is used primarily with species that form

numerous, relatively small propagules.

110

M.F. Simões et al.

http://bch.cbd.int/protocol ); the Nagoya Protocol on Access and Bene ﬁ t Sharing is a

new international agreement under the CBD, adopted in 2010, that intends to facili-

tate the implementation of resolved principles (Convention on Biological Diversity

2011 ) . These principles include the fact that research and development of biodiver-

sity-based products can only take place with the approval of countries and communi-

ties involved as contracting parties, which must also share in the bene ﬁ ts. For these

reasons, public and general participation and awareness of biodiversity is a must that

is considered in all the actions taken and to be made in the future (Smith

2003 ) .

Culture collections aim to collect, maintain and distribute microbial strains

among microbiologists and are considered to be a means to preserve microbial

diversity ex situ . Microbial collections originated when Koch’s school introduced

pure culture techniques in bacteriology, and the ﬁ rst culture collection to provide

services was established by Professor Král, in 1890, at the German University of

Prague, who published the ﬁ rst catalogue of strains from a culture collection in

1900. After the ﬁ rst collection of Král, many others were developed, being

Mycothèque de l’Uiversitée Catholique de Louvain (BCCM/MUCL, see Table 5.2 )

in Belgium and the Collection of the Centraalbureau voor Schimmelcultures (CBS)

in the Netherlands, two of the oldest working culture collections established. Since

then, many others have been established, some preserving high diversity of micro-

organisms, others specialised in particular groups of microorganisms. In 1925, the

ATCC – American Type Culture Collection was created in Washington and is now

located in Manassas, Virginia. With time, international cooperation between culture

collections were started (Uruburu 2003 ) .

Nowadays, there is an increase in the global efforts in the identi ﬁ cation, conser-

vation, data generation and quality management of microorganisms.

Areas of the world rich in biodiversity (e.g., tropical regions), have few facilities

for the ex situ preservation that is essential for compliance with the requirements of

the CBD and that enable them to take advantage of the potential of microorganisms

(Smith 2003 ) .

Organisations such as the WFCC and the ECCO – European Culture Collections’

Organization ( www.eccosite.org ), bring together a critical mass of culture collec-

tions and users to try and co-ordinate activities as well as to exchange information

and technologies that facilitate progress. The WFCC was founded in 1968. It seeks

to promote activities supporting the interests of culture collections and their users.

In its newsletter the WFCC discloses the access to updated information on matters

relevant to collections as well as committees reporting on patent depositions; postal,

quarantine and safety regulations; the safeguarding of endangered collections; edu-

cation, publicity, standards and biodiversity (Smith

2003, 2012 ) . The ECCO was

established in 1981. Its mission is to bring the managers of the major public service

collections in Europe together to discuss common policy, exchange technologies

and seek collaborative projects. It comprises above 60 members from 22 European

countries that hold a total number over 350,000 strains representing ﬁ lamentous

fungi, yeasts, bacteria and also archaea, phages and plasmids, including plasmid

bearing strains. ECCO also comprises members from the animal cells ﬁ eld, includ-

ing human and hybridoma cell lines, as well as animal and plant viruses, plant cells,

111

5 Polyphasic Identi ﬁ cation and Preservation...

algae and protozoa. ECCO members have helped produce practical approaches to

international rules and regulation ( www.eccosite.org ).

From ECCO, several actions have been developed and from the effort of all the

members, other projects such as EMbaRC and MIRRI were established.

The EMbaRC – European Consortium of Microbial Resources Centres is a European

Union funded project. It aims to facilitate the access of researchers from both public

and private sectors, to improved, coordinated and validated microbial resources. This

project is based on networking, access, training and research that count with the partici-

pation of all European Union members and associated countries (

www.embarc.eu ).

MIRRI – Microbial Resource Research Infrastructure is a European research

infrastructure that intends to provide microorganisms services. It aims to facilitate

access to high quality microorganisms, their derivatives (e.g., genomic DNA, cDNA,

total mRNA, plasmids, etc.) and associated data for research, development and

application. In order to deliver the resources and services more effectively and

ef ﬁ ciently in biotechnology, MIRRI was developed with the main goal of connect-

ing resource holders with researchers and policy makers. The infrastructure will

work with over 70 microbial domain resource centres from all of the European

Union members and associated countries. Collectively, they provide access to more

than 350,000 strains of microorganisms. MIRRI is established on the ESFRI –

European Strategy Forum for Research Infrastructures road map, to improve access

to the microbial resources and services that are needed to accelerate research

and discovery processes ( www.mirri.org ). In addition, MIRRI together with other

activities supports a framework designated: GBRCN – Global Biological Resource

Centre Network. The GBRCN is a project that followed the work done in the OECD –

Organisation for Economic Cooperation and Development. In order to support

research and biotechnology as a platform for a knowledge-based bio-economy,

a strategy by OECD was developed to improve the access to high quality biological

resources and information. This project implies the collaboration with existing

networks such as ACM – Asian Consortium for Microorganisms, ECCO, WFCC, plus

stakeholders and users to demonstrate the value of networking activities. Finally, it

aims to develop common approaches and enhance coverage of available organisms

and information to meet all the requirements of all users ( www.gbrcn.org ).

3.3 Culture Collections Versus Biological Resource

Centres (BRCs)

Culture collections have been providing and maintaining organisms for over a century.

They are the scaffold of scienti ﬁ c development in many areas of knowledge. In the

beginnings, infrastructures and capabilities were very limited. Catalogues, when

available, only existed in a printed version and most collections served only national

users. Nowadays, science turns to new technologies and information that implies

culture collections to adapt in order to provide products and services to their

customers in a way that will facilitate their use.

112

M.F. Simões et al.

The adoption of international scienti ﬁ c and performance criteria encouraged by

several organisations adds value to strain holdings and enables networks to share

strategies. These bases distinguish the BRCs from the culture collections. Today,

culture collections must deal with the vast diversity of new genetic entities gener-

ated by scienti ﬁ c work. Due to the latest advances in ﬁ elds such as genomics and

proteomics, there is a continuous increase in the generation of large amounts of

information and scienti ﬁ c data. These technological advances foster BRCs to have

the responsibility of storing, maintaining, and disseminating biological material and

generated information. All of these responsibilities require a different approach in

both material and data management. Adoption of new methodologies to ensure sta-

bility of procedures and proceedings are also required. In addition, they have differ-

ent customers and different ﬁ nancing sources. However, in general, all of the culture

collections share the same goals and face the same challenges. Transition from cul-

ture collections to BRCs is the process of overcoming those challenges and reaching

those goals. It shall be based on different steps such as: (1) assuring sustainability

with creation and implementation of business plans supported by adequate business

models; (2) compliance with legislation in order to operate on the national and inter-

national legal framework with special attention to the code of conduct for biosecu-

rity; (3) implementation of quality management systems to be able to guarantee the

minimal level required to operate in a global BRCs network; (4) guarantee of infor-

mation and technology; (5) training and capacity building with main focus in cre-

ation of a new generation of fungal taxonomists able to incorporate different and

modern technologies and bioinformatics; (6) taxonomic expertise; (7) application

of new technologies and massive incorporation of biodiversity items (Smith and

Ryan

2012 ) .

It becomes obvious that BRCs are a key element for a sustainable international

scienti ﬁ c infrastructure, which is necessary to underpin successful delivery of bio-

technological bene ﬁ ts.

A common strategy is needed to address the incorporation of biodiversity.

An example of the current gap in coverage is given by fungi. There are currently

about 100,000 species of fungi named. However, there is still an estimated huge amount

of fungal species yet to be discovered and described for the Science (Hawsworth

2001 ; Smith and Ryan 2012 ) . New described fungal species require sound preservation

technology. Acquired knowledge about these fungal species requires advances in

preservation techniques. Moreover, establishment and maintenance of BRCs depend

on the implementation of reliable preservation techniques and appropriate quality

assurance to allow them to become effective and ef ﬁ cient.

Although it can be argued that sustainability is the prime challenge, there are

many examples of how this can be achieved. Quality management has been addressed

through OECD initiative and also EMbaRC and GBRCN activities. The network

itself helps in accessing new technologies and available expertise through partner-

ships (Smith and Ryan

2012 ) . Within this context, several guidelines were devel-

oped mainly by WFCC ( 2010 ) and OECD ( 2001, 2007 ) , as well as by speci ﬁ c

consortiums such as CABRI – Common Access to Biological Resources and

Information ( www.cabri.org ). Special legislation for this context has been created.

113

5 Polyphasic Identi ﬁ cation and Preservation...

In order to be applied to microbial laboratories, different standards such as the

French norm NF S96-900, the ISO 9001, the ISO/IEC 17025 (IPAC 2010 ) and the

ISO Guide 34, have been developed.

Acknowledgements The research leading to this work has received funding from the European

Community’s Seventh Framework Programme (FP7, 2007–2013), Research Infrastructures action,

under the grant agreement No. FP7-228310 (EMbaRC project). M.F. Simões acknowledges FCT –

Portugal for the scholarship SFRH/BD/64260/2009.

References

Abramson D, Lombaert G, Clear RM, Sholberg P, Trelka R, Rosin E (2009) Production of patulin

and citrinin by Penicillium expansum from British Columbia (Canada) apples. Mycotoxin Res

25:85–88

Baird R (2010) Leveraging the fullest potential of scienti ﬁ c collections through digitization.

Biodivers Inform 7:130–136

Baker M, Jeffries P (2006) Use of commercially available cryogenic vials for long-term preserva-

tion of dermatophyte fungi. J Clin Microbiol 44:617–618

Bass D, Richards TA (2011) Three reasons to re-evaluate fungal diversity ‘on Earth and in the

ocean’. Fungal Biol Rev 25:159–164

Begerow D, Nilsson H, Unterseher M, Maier W (2010) Current state and perspectives of fungal

DNA barcoding and rapid identi ﬁ cation procedures. Appl Microbiol Biotechnol 87:99–108

Blackwell M (2011) The fungi: 1, 2, 3 … 5.1 million species? Am J Bot 98:426–438

Branco S (2011) Fungal diversity – an overview. In: Venora G, Grillo O (eds) The dynamical

processes of biodiversity – case studies of evolution and spatial distribution. InTech, Rijeka,

pp 211–226

Cabañes FJ, Bragulat MR, Castellá G (2010) Ochratoxin a producing species in the genus

Penicillium . Toxins 2:1111–1120

Cain TC, Lubman DM, Webber WJ Jr (1994) Differentiation of bacteria using protein pro ﬁ les from

MALDI-TOF-MS. Rapid Commun Mass Spectrom 8:1026–1030

Canhos VP, Souza S, Giovanni R, Canhos D (2004) Global biodiversity informatics: setting the

scene for a “new world” of ecological modeling. Biodivers Inform 1:1–13

Cannon PF (1997) Diversity of the Phyllachoraceae with special reference to the tropics. In: Hyde KD

(ed) Biodiversity of tropical microfungi. Hong Kong University Press, Hong Kong, pp 255–278

Capriles CH, Mata S, Middelveen M (1989) Preservation of fungi in water (Castellani): 20 years.

Mycopathogia 106:73–79

Castellani A (1967) Maintenance and cultivation of common pathogenic fungi of man in sterile

distilled water. Further researches. J Trop Med Hyg 70:181–184

Convention on Biological Diversity, United Nations (2011) Nagoya protocol on access to genetic

resources and the fair and equitable sharing of bene ﬁ ts arising from their utilization to the

convention on biological biodiversity – text and annex. Secretariat of the Convention on

Biological Diversity, Montreal

Desjardins AE, Proctor RH (2007) Molecular biology of Fusarium mycotoxins. Int J Food

Microbiol 119:47–50

Dias N, Santos C, Portela M, Lima N (2011) Toenail onychomycosis in a Portuguese geriatric

population. Mycopathologia 172:55–61

Frezal L, Leblois R (2008) Four years of DNA barcoding: current advances and prospects. Infect

Genet Evol 8:727–736

Frisvad JC (1989) The use of high-performance liquid chromatography and diode array detection

in fungal chemotaxonomy based on pro ﬁ les of secondary metabolites. Botanical J Linnean Soc

99:81–95

114

M.F. Simões et al.

Fröhlich J, Hyde KD (1999) Biodiversity of palm fungi in the tropics: are global fungal diversity

estimates realistic? Biodivers Conserv 8:977–1004

Fry RM, Greaves RIN (1951) The survival of bacteria during and after drying. J Hyg 49:220–246

Gams W, Christensen M, Onions AH, Pitt JI, Samson RA (1985) Infrageneric taxa of Aspergillus .

In: Samson RA, Pitt JI (eds) Advances in Penicillium and Aspergillus systematics. Plenum

Press, New York, pp 55–62

Gardes M, Bruns TD (1993) ITS primers with enhanced speci ﬁ city for basidiomycetes – application

to the identi ﬁ cation of mycorrhizae and rusts. Mol Ecol 2:113–118

Giorni P, Magan N, Pietri A, Bertuzzi T, Battilani P (2007) Studies on Aspergillus section Flavi

isolated from maize in northern Italy. Int J Food Microbiol 113:330–338

Gollotte A, Van Tuinen D, Atkinson D (2004) Diversity of arbuscular mycorrhizal fungi colonising

roots of the grass species Agrostis capillaris and Lolium perenne in a ﬁ eld experiment.

Mycorrhiza 14:111–117

Grivell AR, Jackson JF (1969) Microbial culture preservation with silica gel. J Gen Microbiol

58:423–425

Hammond PM (1992) Species inventory. In: Groombridge B (ed) Global biodiversity: status of the

Earth’s living resources. Chapman and Hall, London, pp 17–39

Hammond PM (1995) The current magnitude of biodiversity. In: Heywood VH (ed) Global biodi-

versity assessment. Cambridge University Press, Cambridge, pp 113–138

Hawksworth DL (1991) The fungal dimension of biodiversity: magnitude, signi ﬁ cance, and con-

servation. Mycol Res 95:641–655

Hawksworth DL (2001) The magnitude of fungal diversity: the 1.5 million species estimate revisited.

Mycol Res 105:1422–1432

Hawksworth DL (2011a) Naming Aspergillus species: progress towards one name for each

species. Med Mycol 49:70–76

Hawksworth DL (2011b) A new dawn for the naming of fungi: impacts of decisions made in Melbourne

in July 2011 on the future publication and regulation of fungal names. IMA Fungus 2:155–162

Hawksworth DL, Rossman AY (1997) Where are all the undescribed fungi? Phytopathology

87:888–891

Hebert PD, Stoeckle MY, Zemlak TS, Francis CM (2004) Identi ﬁ cation of birds through DNA

barcodes. PLoS Biol 2:1657–1663

Hempel S, Renker C, Buscot F (2007) Differences in the species composition of arbuscular mycor-

rhizal fungi in spore, root and soil communities in a grassland ecosystem. Environ Microbiol

9:1930–1938

Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF et al (2007) A higher-level phylogenetic

classi ﬁ cation of the Fungi. Mycol Res 111:509–547

Hillenkamp F, Peter-Katalinic J (eds) (2007) MALDI MS: a practical guide to instrumentation,

methods and applications. Wiley-VCH, Münster

Holland RD, Wilkes JG, Ralli F, Sutherland JB, Persons CC, Voorhees KJ, Lay JO Jr (1996) Rapid

identi ﬁ cation of intact whole bacteria based on spectral patterns using matrix-assisted laser

desorption/ionization with time-of- ﬂ ight mass spectrometry. Rapid Commun Mass Spectrom

10:1227–1232

Hollingsworth ML, Clark A, Forrest LL, Richardson J, Pennington RT, Long DG, Cowan R, Chase

MW, Gaudeul M, Hollingsworth PM (2009) Selecting barcoding loci for plants: evaluation of

seven candidate loci with species-level sampling in three divergent groups of land plants. Mol

Ecol Resour 9:439–457

Hong S-B, Go S-J, Shin H-D, Frisvad JC, Samson RA (2005) Polyphasic taxonomy of Aspergillus

fumigatus and related species. Mycologia 97:1316–1329

IPAC (2010) Guia para a aplicação da NP EN ISO/IEC 17025.

http://www.ipac.pt/docs/publicdocs/

regras/OGC001.pdf.

Cited 01 Jun 2012

Jahn TL, Jahn FF (1949) How to know the protozoa. Wm C Brown, Dubuque

Jones MDM, Forn I, Gadelha C, Egan MJ, Bass D, Massana R, Richards TA (2011) Discovery of

novel intermediate forms rede ﬁ nes the fungal tree of life. Nature 474:200–203

Keys CJ, Dare DJ, Sutton H, Wells G, Lunt M, McKenna T, McDowall M, Shah HN (2004)

Infection. Genet Evol 4:221–242

115

5 Polyphasic Identi ﬁ cation and Preservation...

Klich MA (2002) Identi ﬁ cation of common Aspergillus species. CBS, Utrecht

Larsen TO, Smedsgaard J, Nielsen KF, Hansen ME, Frisvad JC (2005) Phenotypic taxonomy and

metabolite pro ﬁ ling in microbial drug discovery. Nat Prod Rep 22:672–693

Mackenzie R, Burhenne-Guilmin F, La Viña AGM, Werksman JD, Ascencio A, Kinderlerer J,

Kummer K, Tapper R (2003) An explanatory guide to the Cartagena protocol on biosafety.

IUCN, Gland/Cambridge, p xvi + 295 pp

Martins MAM, Lima N, Silvestre AJD, Queiroz MJ (2003) Comparative studies of fungal degrada-

tion of single or mixed bioaccessible reactive azo dyes. Chemosphere 52:967–973

May RM (2000) The dimensions of life on Earth. In: Raven PH, Williams T (eds) Nature and human

society: the quest for a sustainable world. National Academy, Washington, DC, pp 30–45

May RM (2010) Ecology. Tropical arthropod species, more or less? Science 329:41–42

Miyamoto-Shinohara Y, Sukenobe J, Imaizumi T, Nakahara T (2006) Survival curves for microbial

species stored by freeze-drying. Cryobiology 52:27–32

Moore RT (1980) Taxonomic proposals for the classi ﬁ cation of marine yeasts and other yeast-like

fungi including the smuts. Botanica Marina 23:361–373

Mora C, Tittensor DP, Adl S et al (2011) How many species are there on Earth and in the ocean?

PLoS Biol 9:1–8

Mueller G, Schmit JP (2007) Fungal biodiversity: what do we know? What can we predict?

Biodivers Conserv 16:1–5

Nagai T, Tomioka K, Takeuchi K, Ilda M, Kawada M, Sato T (2005) Evaluation of preservation

techniques of microorganism resources in the MAFF Genebank. Jpn Agric Res Q 39:19–27

Nakasone KK, Peterson SW, Jong SC (2004) Preservation and distribution of fungal cultures. In:

Foster MS, Bills GF, Mueller GM (eds) Biodiversity of fungi: inventory and monitoring meth-

ods. Elsevier Academic Press, Amsterdam, pp 37–47

Nielsen KF, Smedsgaard J (2003) Fungal metabolite screening: database of 474 mycotoxins and

fungal metabolites for dereplication by standardised liquid chromatography–UV–mass spec-

trometry methodology. J Chromatogr A 1002:111–136

Nilsson RH, Abarenkov K, Veldre V, Nylinder S, DE Wit P, Brosché S, Alfredsson JF, Ryberg M, Kristiansson

E (2010) An open source chimera checker for the fungal ITS region. Mol Ecol Resour 10:1076–1081

O’Brien HE, Parrent JL, Jackson JA, Moncalvo J-M, Vilgalys R (2005) Fungal community analysis

by large-scale sequencing of environmental samples. Appl Environ Microbiol 71:5544–5550

OECD (2001) Biological resource centres underpinning the future of life sciences and biotechnology.

http://www.oecd.org/LongAbstract/0,3425,en264934797316857261111,00.html. Cited 01 Jun 2012

OECD (2007) OEDC best practice guidelines for biological resource centres. Organisation for

Economic Co-operation and Development.

http://www.oecd.org/sti/biotechnologypolicies/

38777417.pdf.

Cited 01 Jun 2012

Paterson RRM, Lima N (2010) Toxicology of mycotoxins. In: Luch A (ed) Molecular, clinical and

environmental toxicology, vol 2, Clinical toxicology. Birkhauser Verlag Ag, Basel, pp 31–63

Perkins DD (1962) Preservation of Neurospora stock cultures with anhydrous silica gel. Can J

Microbiol 8:591–594

Perrone G, Stea G, Epifani F, Varga J, Frisvad JC, Samson RA (2011) Aspergillus niger contains

the cryptic phylogenetic species A . awamori . Fungal Biol 115:1138–1150

Peterson SW (2000) Phylogenetic relationships in Aspergillus based on rDNA sequence analysis.

In: Pitt JI, Samson RA (eds) Integration of modern taxonomic methods for Penicillium and

Aspergillus classi ﬁ cation. Harwood Academic Publishers, Amsterdam, pp 323–355

Petisco C, Downey G, Murray I, Zabalgogeazcoa I, García-Criado B, García-Ciudad A (2008)

Direct classi ﬁ cation of related species of fungal endophytes ( Epichloe spp.) using visible and

near-infrared spectroscopy and multivariate analysis. FEMS Microbiol Lett 284:135–141

Pildain MB, Frisvad JC, Vaamonde G, Cabral D, Varga J, Samson RA (2008) Two novel a ﬂ atoxin-

producing Aspergillus species from Argentinean peanuts. Int J Syst Evol Microbiol 58:725–735

Pitt JI (1988) A laboratory guide to common Penicillium species. Commonwealth Scienti ﬁ c and

Industrial Research Organization, Division of Food Processing, Australia

Pitt JI, Hocking AD, Glenn DR (1983) An improved medium for the detection of Aspergillus ﬂ avus

and A . parasiticus . J Appl Microbiol 54:109–114

116

M.F. Simões et al.

Pivato B, Mazurier S, Lemanceau P, Siblot S, Berta G, Mougel C, van Tuinen D (2007) Medicago

species affect the community composition of arbuscular mycorrhizal fungi associated with

roots. New Phytol 176:197–210

Rodrigues P, Venâncio A, Kozakiewicz Z, Lima N (2009) A polyphasic approach to the identi ﬁ cation

of a ﬂ atoxigenic and non-a ﬂ atoxigenic strains of Aspergillus section Flavi isolated from

Portuguese almonds. Int J Food Microbiol 129:187–193

Rodrigues P, Santos C, Venâncio A, Lima N (2011) Species identi ﬁ cation of Aspergillus section

Flavi isolates from Portuguese almonds using phenotypic, including MALDI-TOF ICMS, and

molecular approaches. J Appl Microbiol 111:877–892

Rooney AP, Ward TJ (2005) Evolution of a large ribosomal RNA multigene family in ﬁ lamentous

fungi: birth and death of a concerted evolution paradigm. Proc Natl Acad Sci 102:5084–5089

Rosendahl S, McGee P, Morton JB (2009) Lack of global population genetic differentiation in the

arbuscular mycorrhizal fungus Glomus mosseae suggests a recent range expansion which may

have coincided with the spread of agriculture. Mol Ecol 18:4316–4329

Rossman AY (1994) A strategy for an all-taxa inventory of fungal biodiversity. In: Peng CL, Chou

CH (eds) Biodiversity and terrestrial ecosystems, Academia Sinica monograph series no. 14.

Academia Sinica, Taipei, pp 169–194

Ryan MJ, Smith D, Jeffries P (2000) A decision-based key to determine the most appropriate

protocol for the preservation of fungi. World J Microbiol Biotechnol 16:183–186

Ryan MJ, Jeffrie P, Bridge PD, Smith D (2001) Developing cryopreservation protocols to secure

fungal gene function. Cryo Letters 22:115–124

Ryan MJ, Verkleij G, López-Ocaña L, Munaut F, Arahal DR, Simões MF et al (2012) Inter-laboratory

evaluation, development and validation of fungal preservation regimes used in different European

biological resources centres (BRCs). In: Paterson R, Simões MF, Pereira L, Santos C, Lima N

(eds) Biological resource centres: closing the gap between science and society, Abstract book.

Micoteca da Universidade do Minho, Braga, p 57

Ryzhov V, Fenselau C (2001) Characterization of the protein subset desorbed by MALDI from

whole bacterial cell. Anal Chem 73:746–750

Samson RA, Varga J (2000) Molecular systematics of Aspergillus and its teleomorphs. In: Samson

RA, Pitt JI (eds) Aspergillus molecular biology and genomics. Harwood Academic Publishers,

Sendai, pp 9–49

Samson RA, Hoekstra ES, Frisvad JC (2004) Introduction to food- and airborne Fungi, 7th edn.

CBS, Wageningen

Samson RA, Noonim P, Meijer M, Houbraken J, Frisvad JC, Varga J (2007) Diagnostic tools to

identify black aspergilli. Stud Mycol 59:129–145

Santos IM, Lima N (2001) Criteria followed in the establishment of a ﬁ lamentous fungi culture collec-

tion – Micoteca da Universidade do Minho (MUM). World J Microbiol Biotechnol 17:215–220

Santos C, Lima N (2010) A Identi ﬁ cação de fungos pela espectrometria de massa através da técnica de

MALDI-TOF ICMS. In: Dianese JC, Santos LTP (eds) Proceedings of the 6th Brazilian congress of

mycology, Brazilian Society of Mycology, CD-Rom, Brasilia, Brazil, 29th Nov to 2nd Dec 2010

Santos IM, Venâncio A, Lima N (1998) Fungos contaminantes na indústria alimentar. Micoteca da

Universidade do Minho, Braga, pp 1–128

Santos IM, Abrunhosa L, Venâncio A, Lima N (2002a) The effect of culture preservation techniques on

patulin and citrinin production by Penicillium expansum link. Lett Appl Microbiol 35:272–275

Santos IM, Lima N, Ryan MJ, Smith D (2002b) Metabolic response of ﬁ lamentous fungi to

preservation stress. In: Santos IM, Venâncio A, Lima N (eds) Ecologia dos fungos. Micoteca

da Universidade do Minho, Braga, pp 55–66

Santos C, Paterson RMR, Venâncio A, Lima N (2010) Filamentous fungal characterisations by

matrix-assisted laser desorption/ionisation time of ﬂ ight mass spectrometry. J Appl Microbiol

108:375–385

Schipper MAA, Bekker-Holtman J (1976) Viability of lyophilized fungal cultures. Antonie Van

Leeuwenhoek 42:325–328

Schmit JP, Mueller GM (2007) An estimate of the lower limit of global fungal diversity. Biodivers

Conserv 16:99–111

117

5 Polyphasic Identi ﬁ cation and Preservation...

Scoble MJ (2010) Natural history collections digitization: rationale and value. Biodivers Inform

7:77–80

Seifert KA, Samson RA, deWaard JR, Houbraken J, Lévesque CA, Moncalvo J-M, Louis-Seize G,

Hebert PDN (2007) Prospects for fungus identi ﬁ cation using CO1 DNA barcodes, with

Penicillium as a test case. Proc Natl Acad Sci 104:3901–3906

Sharma B, Smith D (1999) Recovery of fungi after storage for over a quarter of a century. World J

Microbiol Biotechnol 15:517–519

Smith D (2003) Culture collections over the world. Int Microbiol 6:95–100

Smith D (2012) Culture collections. In: Saraslani S, Gadd GM (eds) Advances in applied microbi-

ology, vol 79. Academic, Burlington, pp 73–118

Smith D, Onions AHS (1983) A comparison of some preservation techniques for fungi. Trans Br

Mycol Soc 81:535–540

Smith D, Onions AHS (1994) The preservation and maintenance of living fungi. IMI technical

handbooks: No. 1, 2nd edn. International Mycological Institute, CAB International,

Oxfordshire

Smith D, Ryan M (2012) Implementing best practices and validation of cryopreservation techniques

for microorganisms. Scienti ﬁ c World Journal. doi:

10.1100/2012/805659

Smith D, Ryan MJ, Day JG (eds) (2001) The UK National Culture Collection (UKNCC) biological

resource: properties, maintenance and management. UKNCC, Surrey, United Kingdom

Soares C, Rodrigues P, Peterson SW, Lima N, Venâncio A (2012) Three new species of Aspergillus

section Flavi isolated from almonds and maize in Portugal. Mycologia 104:682–697

Sykorova Z, Ineichen K, Wiemken A, Redecker D (2007) The cultivation bias: different communities

of arbuscular mycorrhizal fungi detected in roots from the ﬁ eld, from bait plants transplanted

to the ﬁ eld, and from a greenhouse trap experiment. Mycorrhiza 18:1–14

Tanaka K, Waki H, Ido Y, Akita S, Yoshida Y, Yoshida T (1988) Protein and polymer analyses up to

m/z 100000 by laser ionization time-of- ﬂ ight mass spectrometry. Rapid Commun Mass

Spectrom 2:151–153

Uruburu F (2003) History and services of culture collections. Int Microbiol 6:101–103

Uzunova-Doneva T, Donev T (2005) Anabiosis and conservation of microorganisms. J Cult Collect

4:17–28

Vaamonde G, Patriarca A, Pinto VF, Comeria R, Degrossi C (2003) Variability of a ﬂ atoxin and

cyclopiazonic acid production by Aspergillus section Flavi from different substrates in

Argentina. Int J Food Microbiol 88:79–84

Varga J, Due M, Frisvad JC, Samson RA (2007a) Taxonomic revision of Aspergillus section

Clavati based on molecular, morphological and physiological data. Stud Mycol 59:89–106

Varga J, Frisvad JC, Samson RA (2007b) Polyphasic taxonomy of Aspergillus section Candidi

based on molecular, morphological and physiological data. Stud Mycol 59:75–88

Vilgalys R, Hester M (1990) Rapid genetic identi ﬁ cation and mapping of enzymatically ampli ﬁ ed

ribosomal DNA from several Cryptococcus species. J Bacteriol 172:4238–4246

WFCC (2010) The WFCC guidelines for the establishment and operation of Culture Collections.

http://www.wfcc.info/guidelines. Cited 01 Jun 2012

White TJ, Bruns T, Lee S, Taylor JW (1990) Ampli ﬁ cation and direct sequencing of fungal ribo-

somal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds)

PCR protocols: a guide to methods and applications. Academic, New York, pp 315–322

Whittaker RH (1959) On the broad classi ﬁ cation of organisms. Q Rev Biol 34:210–226

Wubet T, Weiss M, Kottke I, Teketay D, Oberwinkler F (2006) Phylogenetic analysis of

nuclear small subunit rDNA sequences suggests that the endangered African Pencil

Cedar, Juniperus procera , is associated with distinct members of Glomeraceae. Mycol

Res 110:1059–1069

119

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_6, © Springer Science+Business Media Dordrecht 2013

Abstract Proper understanding of molecular sequences, identi ﬁ cation and

phylogenetics of microorganisms are very important in many branches of biological

science. Generation of genomic DNA sequence data from different organisms

including microbes requires the application of bioinformatics tools for their analysis.

Bioinformatics tools including BLAST, multiple sequence alignment tools etc. are

used to analyze nucleic acid and amino acid sequences for phylogenetic af ﬁ liation.

The emerging ﬁ elds of comparative genomics and phylogenomics require the sub-

stantial knowledge and understanding of computational methods to handle the large

scale data involved. The introduction of comparative rRNA sequence analysis

represents a major milestone in the history of microbiology. Also single gene based

phylogenetic inference and alternative global markers including elongation and

initiation factors, RNA polymerase subunits, DNA gyrases, heat shock and RecA

proteins are of immense importance. The analysis of the sequence data involves four

general steps including: (i) selection of a suitable molecule or molecules, (ii) acqui-

sition of molecular sequences, (iii) multiple sequence alignment and (iv) phyloge-

netic evaluation. This chapter explains in detail how raw data of molecular sequences

from any microbe may be used for the detection and identi ﬁ cation of microorganisms

using computer based bioinformatics tools.

Keyword Bioinformatics tool • BLAST • Sequence alignment • DNA Chips • Gene

identi ﬁ cation

M. Tabish (*) • S. Azim • M. A. Hussain • S. U. Rehman • T. Sarwar • H. M. Ishqi

Department of Biochemistry, Faculty of Life Sciences , Aligarh Muslim University ,

Aligarh , Uttar Pradesh 202002 , India

e-mail: tabish.biochem@gmail.com

Chapter 6

Bioinformatics Approaches in Studying

Microbial Diversity

Mohammad Tabish , Shafquat Azim , Mohammad Aamir Hussain , Sayeed

Ur Rehman , Tarique Sarwar , and Hassan Mubarak Ishqi

120

M. Tabish et al.

1 Introduction

There has been a ﬂ ood of nucleic acid sequence information, bioinformatics tools

and phylogenetic inference methods in public domain databases, literature and

World Wide Web space. Last 20 years has seen the rapid development of prokaryotic

genomics. Since the sequencing of Haemophilus in ﬂ uenzae in 1985 (Johnston

2010 ;

Fleischmann et al. 1995 ) , currently over 11,364 whole genome sequences organized

in three major groups of organisms i.e. eukaryota, prokaryota (archaea and bacteria)

and viruses are available in Genome database of NCBI including complete chromo-

somes, organelles and plasmids as well as draft genome assemblies. Out of 11,364

whole genome sequences, 7,473 genome projects running across the world belong

only to microbes with 1,696 completed microbial genomes projects whereas assem-

bly is being done for 2,247 organisms and 3,531 genome project are still un ﬁ nished

(Benson et al. 2002 ) . The developing technology of nucleic acid sequencing,

together with the recognition that sequences of building blocks in informational

macromolecules (nucleic acids, proteins) can be used as ‘molecular clocks’ that

contain historical information, led to the development of the three-domain model in

the late 1970s, primarily based on small subunit ribosomal RNA sequence compari-

sons. The information currently accumulating from complete genome sequences of

an ever increasing number of prokaryotes are now leading to further modi ﬁ cations

of our views on microbial phylogeny. Prokaryotic genomics has had a revolutionary

impact on our view of the microbial world and also on the methodologies for micro-

biological studies.

2 Complexity of Microbial Genomes

Analysis of genomic sequences has revealed that microbial genomes are very

diverse. This is due to the complicated nature of microbial evolution. Mutations

play a key role in evolution of eukaryotic genomes whereas, the contents of prokary-

otic genomes are also changed by gene losses, gene rearrangements, horizontal

gene transfer, and so on (McHardy et al. 2007 ; Doolittle 1999 ; Woese 1987 ) . This

means that even strains from the same species can differ signi ﬁ cantly. For example,

two Escherichia coli strains O157:H7 and K-12 have more than 1,000 different

genes (Perna et al. 2001 ) . The dynamic nature of microbial genomes complicates

several tasks in microbiological studies. One of these is the development of strate-

gies to prevent and treat microbe related diseases. Since microbe related diseases

are common threats to the public health, microbes especially bacteria have been

studied for many years. One point of progress was the introduction of antibiotics to

treat bacterial infections. However, the use of antibiotics has been challenged by the

emergence of antibiotic resistance among bacteria.

Plasmids play an important role in conferring antibiotic resistance in microbes.

It is believed that antibiotic resistance evolves via natural selection. However, anti-

biotic resistance can also be introduced to bacteria via horizontal gene transfer

121

6 Bioinformatics Approaches in Studying Microbial Diversity

(Boerlin and Reid-Smith 2008). Plasmids are extra-chromosomal genetic elements

that constitute upto 10% of the total DNA found in many species of bacteria (Mølbak

et al. 2003 ; Thomas 2000 ) . Because plasmids are capable of cell-to-cell transfer

between bacterial species, genes harboured by plasmids are widely shared, playing

a critical role in the evolution of bacteria (Feinbaum

2001 ; Summers 1996 ) .

Establishing accurate relationships between plasmids will help us to understand an

important factor in the dissemination of antibiotic resistance genes, and establishing

accurate relationships between bacteria will help us to identify the factors that cause

diseases, the risks of outbreaks, and methods for preventing disease transmission.

Unfortunately, the complexity of microbial genomes is apparent when we try to

compare the genetic contents of strains and to build a phylogeny tree from them

(McHardy et al.

2007 ; Doolittle 1999 ) .

3 Obtaining Data (Wet Lab Approach)

One characteristic of microbiological studies in the genomics era is that we can

generate a huge amount of data ef ﬁ ciently. Numerous different genomics based

experimental methods are available. These methods are usually called molecular

methods since they are often based on genetic characteristics. Compared to tradi-

tional phenotype-based methods, molecular methods are cost effective, easy to

implement, and generate highly discriminatory data (Foxman et al. 2005 ; Tenover

et al. 1997 ) . Of these methods, the most widely used method for nucleic acid

ampli ﬁ cation is the polymerase chain reaction assay i.e., PCR. This assay includes

a speci ﬁ c primer pair to amplify a unique genomic target nucleotide sequence for

analysis. Following PCR, a variety of post-ampli ﬁ cation methods are used to eval-

uate the product such as direct sequence analysis, use of genus or species speci ﬁ c

probes, and utilization of restriction enzymatic analysis of the product, e.g., restric-

tion fragment length polymorphism analysis (RFLP). Pulse- ﬁ eld gel electrophore-

sis (PFGE) is also considered as the gold standard. Multiple locus variable-number

tandem repeat analysis (MLVA) assays are also a potentially powerful alternative

or complementary tool. Another most powerful technique is DNA microarrays

which provide a powerful high-throughput genomic method that has been widely

used in biological studies. To construct a DNA microarray, single-strand fragments

of DNA (also called probes) representing the genes of an organism are attached to

a surface of glass or plastic. Each fragment can bind to a complementary DNA or

RNA strand. Typically, more than 30,000 spots can be put on one slide, and it is

possible to create a microarray representing every gene in a genome. Thus, microar-

rays can provide genome wide information which allows a comprehensive genetic

analysis of an organism or a sample. DNA microarrays have been used for geno-

typing, expression analysis, and studies of protein-DNA interactions (Bilitewski

2009 ) . When used for assessing the genetic relationships of bacterial strains,

microarrays may be prepared for whole genome composed of open reading frames

(ORFs) of one complete genome sequence (Zhou 2003 ) . However, this type of

122

M. Tabish et al.

microarray is limited by the requirement of representing one complete reference

sequence which may not contain genetic content speci ﬁ c to nonsequenced strains.

One possible improvement is to include speci ﬁ c genes from multiple whole-genome

sequences or to use mixed-genome microarrays (MGMs) which use randomly-

selected gene fragments from many strains of bacteria as probes (Wan et al.

2007 ;

Borucki et al.

2004 ; Call et al. 2003 ) .

From the enormous data to knowledge of microbial genomic information makes it

possible to study microorganisms systematically. Sequence-based identi ﬁ cation

requires the recognition of a molecular target that is large enough to allow discrimina-

tion of a wide variety of microbes. One such target area that has been recognized is the

rDNA gene complex which is present in all microbial pathogens. In bacteria, this com-

plex is composed of a 16S rRNA gene and a 23S rRNA gene separated by a genomic

segment called the internal transcribed spacer (ITS). Within fungi there are three genes

(18S, 5.8S, and 28S) with spacers located between the genes (ITS1 and ITS2). Located

in the rDNA gene complex are highly variable sequences that provide unique signa-

tures for the identi ﬁ cation of species and also conserved regions that contain genomic

codes for the structural restrains that are present within organism groups. It has been

shown that the ITS regions contain the most variability and that these regions are useful

under most circumstances for species recognition. The availability of these variable

sequence regions (ITS) surrounded by conserved sequences (16S/23S and 18S/5.8S/28S)

allows for the utilization of an ampli ﬁ cation system using universal (or consensus)

bacterial or fungal primers. Once ampli ﬁ cation has occurred using the consensus

primers, the sequence is determined and comparison analysis of the unknown sequence

to known sequences contained within a large database (such as the National Center

for Biological Information (NCBI), GenBank databases) can be done to determine

similarity and subsequently may lead to species identi ﬁ cation. However, how to

manipulate the massive amount of available data, how to retrieve genomic information

effectively, and how to process the large scale data ef ﬁ ciently are all challenging prob-

lems. Because of these problems, the ﬁ eld of bioinformatics has emerged and has

become an integral part of microbial studies (Foster et al. 2012 ) .

4 Bioinformatics

Bioinformatics has evolved into a full- ﬂ edged multidisciplinary subject that inte-

grates developments in information and computer technology as applied to biotech-

nology and biological sciences. Bioinformatics uses computer software tools for

database creation, data management, data warehousing, data mining and global

communication networking. In this, knowledge of many branches are required like

biology, mathematics, computer science, laws of physics & chemistry, and sound

knowledge of information technology to analyze the data. Bioinformatics is not

limited to the computing data, but in reality it can be used to solve many biological

problems and ﬁ nd out how living things work. It is the comprehensive application

of mathematics (e.g., probability and statistics), science including biochemistry,

123

6 Bioinformatics Approaches in Studying Microbial Diversity

molecular biology and a core set of problem-solving methods e.g. computer algorithms

to the understanding of living systems. Bioinformatics is the recording, annotation,

storage, analysis, and searching/retrieval of nucleic acid sequence genes, RNAs, pro-

tein sequences and structural information. This includes databases of the sequences

and structural information as well methods to access, search, visualize and retrieve

the information.

Functional genomics, biomolecular structure, proteome analysis, cell metabolism,

biodiversity, drug and vaccine designs are some of the areas in which bioinformatics

is an integral component. Bioinformatics concern the creation and maintenance of

databases of biological information whereby researchers can both access existing

information and submit new entries. The most pressing tasks in bioinformatics

involve the analysis of sequence information. Computational Biology is the name

given to this process.

5 Bioinformatics and Its Scope

Bioinformatics has evolved into a full- ﬂ edged scienti ﬁ c discipline over the last

decade. The de ﬁ nition of Bioinformatics is not restricted to computational molecular

biology and computational structural biology. It now encompasses ﬁ elds such as

comparative genomics, structural genomics, transcriptomics, proteomics, cellunom-

ics and metabolic pathway engineering. Developments in these ﬁ elds have direct

implications to healthcare, medicine, discovery of next generation drugs, develop-

ment of agricultural products, renewable energy, environmental protection etc.

Bioinformatics integrates the advances in the areas of computer science, infor-

mation science and information technology to solve complex problems in life sci-

ences. The core data comprises of the genomes and proteomes of human to

microbes, 3-D structures and functions of proteins, microarray data, metabolic

pathways, cell lines, hybridoma and biodiversity etc. The sudden growth in the

quantitative data in biology has rendered data capture, data warehousing and data

mining as major issues for biotechnologists and biologist. Availability of enormous

data has resulted in the realization of the inherent biocomplexity issues which call

for innovative tools for synthesis of knowledge. Information technology, particu-

larly the internet, is utilized to collect, distribute and access ever-increasing data

which are later analyzed with mathematics and statistics-based tools. Bioinformatics

has a key role to play in the cutting edge research and development areas such as

functional genomics, proteomics, protein engineering, pharmacogenomics, discovery

of new drugs and vaccines, molecular diagnostic kits, agro-biotechnology etc. This

has attracted attention of several companies and entrepreneurs. As a result, a large

number of bioinformatics based start-ups have been launched and the trend is likely

to continue. A Bioinformatician must acquire/possess expertise in the essential multi-

displinary ﬁ elds that comprise the core of this new science. Quality research and

education in bioinformatics are vital not only to meet the existing challenges but

also to set and accomplish new goals in life sciences.

124

M. Tabish et al.

6 The Potential of Bioinformatics

The potential of bioinformatics in the identi ﬁ cation of useful genes leading to the

development of new gene products, drug discovery and drug development has led to

a paradigm shift in biology and biotechnology. These ﬁ elds are becoming more and

more computationally intensive. The new paradigm, now emerging, is that all the

genes will be known “in the sense of being resident in database available electroni-

cally”, and the starting point of biological investigation will be theoretical and a

scientist will begin with a theoretical conjecture and only then turning to experiment

to follow or test the hypothesis. With a much deep understanding of the biological

processes at the molecular level, the bioinformatics scientist have developed new

techniques to analyze genes on an industrial scale resulting in a new area of science

known as ‘Genomics’. This is the science that deals with the study of whole genome,

largely encompasses biology of genetics at molecular level i.e., the constitution of

DNA and RNA, its analysis, translation of the chemical information carried over by

these materials into biological data and digitizing that huge biological data through

computational means.

The shift from gene biology has resulted in the development of strategies from

lab techniques to computer programmes to analyze whole batch of genes at once.

Genomics is revolutionizing drug development, gene therapy, and our entire

approach to health care and human medicine. The genomic discoveries are getting

translated into practical biomedical results through bioinformatics applications.

Work on proteomics and genomics will continue using highly sophisticated soft-

ware tools and data networks that can carry multimedia databases. Thus, the research

will be in the development of multimedia databases in various areas of life sciences

and biotechnology. There will be an urgent need for development of software tools

for data mining, analysis and modelling, and downstream processing. It has now

been universally recognized that bioinformatics is the key to the new grand data-

intensive molecular biology that will lead us in this century.

7 Activities in Bioinformatics

We can split the activities in bioinformatics in two areas:

1 . The organization : this includes the creation of databases of biological information

and the maintenance of the databases. This is very important as we are sequencing

tens of millions of bases a year and undertaking to sequence whole organism

genomes. The growth of the sequence databases is an unbroken exponential.

2 . Analysis of the data : this includes the following:

Development of methods to predict the structure and/or function of newly •

discovered proteins and structural RNA sequences.

Clustering protein sequences into families of related sequences and the devel-•

opment of protein models.

125

6 Bioinformatics Approaches in Studying Microbial Diversity

Aligning similar proteins and generating phylogenetic trees to examine evolu-•

tionary relationships

The development of new algorithms and statistics with which to assess rela-•

tionships among members of large data sets.

The development and implementation of tools that enable ef ﬁ cient access and •

management of different types of information and

The analysis and interpretation of various types of data including nucleotide •

and amino acid sequences, protein domains, and protein structures in study-

ing microbial diversity.

8 The Need for Bioinformatics

Whole genome analysis and sequences •

Experimental analysis involving thousands of genes simultaneously •

DNA Chips and Array Analyses – expression arrays, Comparative analysis •

between species and strains

Proteomics: ‘Proteome’ of an organism. •

Medical applications: Genetic Disease – Pharmaceutical and Biotech Industry •

Forensic applications •

Agricultural applications •

9 Databases

Computational analysis and comparative microbial genomic studies are taking

shape at a faster rate leading to the development of different types of function pre-

diction concepts, most important of them being the gene context and gene content

analysis. Gene content analysis is a comparison of gene repertoires across different

genomes (Shah et al. 2005 ; Luscombe et al. 2001 ) . The postgenomic problems like

protein structural determination and issues of gene function identi ﬁ cation become

more promising (Gomez et al. 2008 ) with the rapidly increasing number of com-

pletely sequenced genomes. Predicting the structures of proteins encoded by genes

of interest provides subtle clues regarding the functions of these proteins (Idekar

et al. 2001 ) .

Various databases have been established for storing genomic data, and the inter-

net makes it possible for these data to be accessed and shared by the public. Since

there are different types of genomic data, it is impossible to build one database con-

taining all data. Currently there are two types of genomic databases. Primary data-

bases contain sequences and structures (for example, NCBI GenBank) and related

annotations, bibliographies, and cross-references to other databases and provide the

basis for biological studies; secondary databases contain biological knowledge

obtained by analyzing genomic sequences and structure data. The database of

126

M. Tabish et al.

Clusters of Orthologous Groups of proteins (COGs, http://www.ncbi.nlm.nih.gov/

COG ), for example, contains information for phylogenetic analysis (Tatusov et al.

1997, 2003 ) . The Ribosomal Database Project (RDP) provides ribosome related

data and annotated bacterial and archaeal small-subunit 16S rRNA sequences (Cole

et al.

2005, 2009 ; Larsen et al. 1993 ) . Knowledge from these databases can help to

process biological data ef ﬁ ciently. For example, the Gene Ontology database has

been used to process microarray datasets (Barrell et al.

2009 ; Harris et al. 2004 ) .

Nucleic acid sequence analysis has proven to be a valuable asset for organism

identi ﬁ cation in a number of applications. Some of the most interesting applica-

tions of this technology are for the identi ﬁ cations of variant strains of known spe-

cies, the identi ﬁ cation of un-cultivatable organisms in clinical samples and the

recognition of new species.

10 Web-Based Resources for Microbial Genomics

MicrobesOnline : MicrobesOnline is a website for browsing and comparing prokary-

otic genomes. MicrobesOnline is a product of the Virtual Institute for Microbial

Stress and Survival, which is sponsored by the US Department of Energy Genomic

Science Program.

Integrated Microbial Genomes (IMG) : The Integrated Microbial Genomes

(IMG) system serves as a community resource for comparative analysis and annota-

tion of all publicly available genomes from three domains of life, in a uniquely

integrated context.

CAMERA (Community Cyber infrastructure for Advanced Marine Microbial

Ecology Research and Analysis) : The aim of CAMERA is to serve the needs of the

microbial ecology research community by creating a rich, distinctive data repository

and a bioinformatics tools resource that will address many of the unique challenges of

metagenomic analysis.

DOE JGI Microbial Genomics Database : From this site we can get details

about JGI projects, or go directly to the individual microbial sites. All of the indi-

vidual sites include direct access to download sequence ﬁ le(s), BLAST, and view

annotations.

GOLD™ Genomes OnLine Database : GOLD is a World Wide Web resource

for comprehensive access to information regarding complete and ongoing genome

projects, as well as metagenomes and metadata, around the world.

JCVI Comprehensive Microbial Resource (formerly The Institute for

Genomic Research) : The Comprehensive Microbial Resource (CMR) is a free

website used to display information on all of the publicly available, complete

prokaryotic genomes.

Sanger Centre Bacterial Genomes : The Sanger Institute bacterial sequencing

effort is concentrated on pathogens and model organisms. The site provides a list of

projects funded, underway or completed; all data from these projects are immediately

and freely available.

127

6 Bioinformatics Approaches in Studying Microbial Diversity

Microbial Genomes from Genome Channel : Genome Channel is a computer-

annotated listing of genomes maintained by the Computational Biology group at

Oak Ridge National Laboratory.

Protein Data Bank : The RCSB PDB provides a variety of tools and resources

for studying the structures of biological macromolecules and their relationships to

sequence, function, and disease.

KEGG (Kyoto Encyclopaedia of Genes and Genomes) : A grand challenge in

the post-genomic era is a complete computer representation of the cell, the organ-

ism, and the biosphere, which will enable computational prediction of higher-level

complexity of cellular processes and organism behaviours from genomic and

molecular information. Towards this end a bioinformatics resource named KEGG

has been developed as part of the research projects of the Kanehisa Laboratories in

the Bioinformatics Centre of Kyoto University and the Human Genome Centre of

the University of Tokyo.

11 Data Retrieval Methods and Online Resources

for Microbial Diversity

In order to use the information available in databases, an ef ﬁ cient information

retrieval method should be used to obtain all related information quickly. Such

methods are different, depending on the type of data to be retrieved. FASTA and

BLAST are the two most widely used methods for retrieving sequence data. FASTA

was the ﬁ rst fast sequence searching algorithm used for comparing a query sequence

against a database (Plewniak 2008 ; Pearson 1990 ) . The FASTA algorithm per-

forms a rapid and approximate search for matched sequence segments followed by

application of the Smith-Waterman alignment algorithm (Plewniak 2008 ; Pearson

1991 ) to these segments. Depending upon the application there are several soft-

wares available online for free to retrieve the microbial data. Some of them are

brie ﬂ y described below:

11.1 Pairwise Alignment

A number of computational methods have been developed and used in genomic

studies. Of these methods, genetic sequence alignment is the foundation for many

other methods and widely used in comparative genomics. A good alignment method

should give biologically meaningful results and at the same time be computationally

ef ﬁ cient. There are two types of alignment methods, local alignments and global

alignments. The former methods try to identify similar segments between two

sequences while the latter try to align the entire length of two sequences. Methods

for aligning two sequences are called pairwise alignment methods. BLAST and

128

M. Tabish et al.

FASTA are two widely used pairwise alignment methods. BLAST (Basic Local

Alignment Search Tool) is a rapid sequence database search tool which is more

ef ﬁ cient than FASTA. The output of BLAST is a list of high-scoring segment pairs

(HSPs) and an “E value” which is an estimate of the probability of ﬁ nding an HSP

with score S. The E value is often used as a standardized measure for estimating the

statistical signi ﬁ cance of sequence similarity.

These methods can be extended to multiple sequences; however, multiple

sequence alignment (MSA) is more complicated. ClustalW (Larkin et al.

2007 ;

Thompson et al. 2002 ) is a widely used MSA method which is ef ﬁ cient for aligning

protein sequences and short nucleotide sequences. However, it may fail for distantly

related sequences (Lin et al. 2011 ) . PSI-BLAST (Lee et al. 2008 ; Schäffer et al.

2001 ; Altschul et al. 1997 ) is a very successful method for detecting weak similarities.

Two recently developed algorithms, MLAGAN (Brudno et al. 2003 ) and MAVID

(Dewey 2007 ; Bray and Pachter 2003, 2004 ) , are designed for global alignment of

both evolutionarily close and distant megabase length genomic sequences. However,

a phylogenetic tree is assumed to be known for use with MLAGAN. MAVID is a

progressive global alignment program that works by recursively aligning the ‘align-

ments’ at ancestral nodes of the guide phylogenetic tree. MAUVE is used for com-

paring long genome sequences ef ﬁ ciently and takes into account possible large-scale

evolutionary events among sequences (Darling et al. 2004 ) .

11.2 Phylogenetic Analysis

The goal of phylogenetic analysis is to reconstruct the evolutionary history of a set

of organisms. In molecular epidemiology, it helps to elucidate mechanisms that lead

to microbial outbreaks and epidemics. Phylogenetic analysis usually begins with

multiple sequence alignment of the sequences of a set of organisms. After obtaining

an MSA, a number of different phylogenetic methods can be used to compute

phylogenetic trees. These methods can be broadly classi ﬁ ed into maximum parsi-

mony, distance, and maximum likelihood methods (Stark et al. 2010 ; Takahashi and

Nei 2000 ) . The difference between these methods is how they de ﬁ ne which tree is

best among all possible trees. Maximum parsimony tries to ﬁ nd an evolutionary tree

or trees which require a minimum number of changes from the common ancestral

sequences. For maximum likelihood methods, given the MSA, the probability of a

speci ﬁ c tree occurring is computed, and the one or ones with the highest values are

considered to be the evolutionary tree or trees. Distance-based methods construct a

tree by hierarchical clustering methods using a distance matrix for all organisms

that is computed using MSA. To use MSA for phylogenetic analysis, it is necessary

to assume an underlying mutation model. Of the ones that have been proposed, the

Jukes-Cantor (JC) model (Som 2006 ; Takahashi and Nei 2000 ) is the simplest one.

In the JC model, each base in a DNA sequence has an equal mutation rate and all

complementary pairs of the four nucleotides A, T, C and G have equal substitution

rates. These assumptions are not realistic in practice, so many complex models have

129

6 Bioinformatics Approaches in Studying Microbial Diversity

been proposed and tried. Successful phylogenetic analysis requires a suitable model.

Phylogenetic analysis of microbial strains is problematic due to its dynamic nature

(Wilmes et al. 2009 ) . Different genes among strains may contain contradictory

information about their evolution. Consensus trees have been suggested as a solu-

tion. An alternative is the introduction of networks that represent the evolutionary

relationships between microbial strains.

11.3 AGeS: A Software System for Microbial Genome

Sequence Annotation

AGeS is genome sequence annotation software which is a fully integrated with

high performance software system to analyze DNA sequences and predict the protein-

coding regions for completed and draft bacterial genomes. It predicts genomic

features using a number of bioinformatics methods and provides visualization

based on the familiar genome browser.

11.4 SILVA: A Comprehensive Online Resource for Quality

Checked and Aligned Ribosomal RNA Sequence Data

Ribosomal RNA sequence data analyzing tool SILVA is available online at http://

www.arb-silva.de/ . Sequencing ribosomal RNA (rRNA) genes is currently the

method of choice for phylogenetic reconstruction, nucleic acid based detection and

quanti ﬁ cation of microbial diversity (Pruesse et al. 2007 ) . To cope with the ﬂ ood

of data, the SILVA system was implemented to provide a central, comprehensive

web resource for up to date, quality controlled databases of aligned small and large

subunit rRNA sequences from the bacteria and archaea domains. This programme

is designed as a central comprehensive resource by integrating multiple taxonomic

classi ﬁ cations and the latest validly described nomenclature as well as additional

information, such as if a sequence was derived from a cultivated organism, a type

strain, or belongs to a genome project.

11.5 16S and 23S Ribosomal RNA Mutation Database

Access to the expanded versions of the 16S and 23S Ribosomal RNA Mutation

Databases has been improved to permit searches of the lists of alterations for all the

data from (1) one speci ﬁ c organism, (2) one speci ﬁ c nucleotide position, (3) one

speci ﬁ c phenotype. The URL for the searchable version of the Databases is: http://

ribosome.fandm.edu .

130

M. Tabish et al.

11.6 5S Ribosomal RNA Database

5S Ribosomal RNA Database provides information on nucleotide sequences of 5S

rRNAs and their genes. The sequences for particular organisms can be retrieved as

single ﬁ les using a taxonomic browser or in multiple sequence structural alignments.

This programme is freely available at

http://biobases.ibch.poznan.pl/5SData/ .

11.7 Greengenes

This is an online full-length small-subunit (SSU) rRNA gene database called

greengenes available at < http://greengenes.lbl.gov/ > that keeps pace with public

submissions of both archaeal and bacterial 16S rDNA sequences has been estab-

lished (DeSantis et al. 2003 ) . It addresses a number of limitations currently associ-

ated with SSU rRNA records in the public databases by providing automated

chimera-screening, taxonomic placement of unclassi ﬁ ed environmental sequences

using multiple published taxonomies for each record, multiple standard alignments

and uniform sequence-associated information curated from GenBank records.

Greengenes also provides a suite of utensils for manipulation of sequences including

an alignment tool and has been streamlined to interface with the widely used ARB

program.

11.8 Ribosomal Database Project

The Ribosomal Database Project – II (RDP-II) (Maidak et al. 2001 ) available at

< http://rdp.cme.msu.edu/ > provides data, tools and services related to ribosomal

RNA sequences to the research community. It offers aligned and annotated rRNA

sequence data, analysis services, and phylogenetic inferences derived from these

data. Currently available on the RDP-II website as a beta release, 9.0 provides over

50,000 annotated (eu) bacterial sequences aligned with a secondary-structure based

alignment algorithm (Brown 2000 ) . Data subsets are available for sequences of

length 1,200 or greater and for sequences from type material. Annotation goals

include up-to-date name, strain and culture deposit information, sequence length

and quality information. In order to provide a phylogenetic context for the data,

RDP-II makes available over 100 trees that span the phylogenetic breadth of life.

Web based research tools are provided for comparing user submitted sequences to

the RDP-II database (Sequence Match), aligning user sequences against the nearest

RDP sequence (Sequence Aligner), examining probe and primer speci ﬁ city (Probe

Match), testing for chimeric sequences (Chimera Check), generating a distance

matrix (Similarity Matrix), analyzing T-RFLP data (T-RFLP and TAP-TRFLP), a

java-based phylogenetic tree browser (Sub Trees), a sequence search and selection

tool (Hierarchy Browser) and a phylogenetic tree building and visualization tool

(Phylip Interface). The latter tool has been enhanced to allow a choice of either the

131

6 Bioinformatics Approaches in Studying Microbial Diversity

Phylip neighbor-joining (Felsenstein 1993 ) or Weighbor weighted neighbor-joining

(Bruno et al. 2000 ) programs for tree construction.

11.9 RISSC – Ribosomal Internal Spacer Sequence Collection

This is a database of ribosomal 16S-23S spacer sequences intended mainly for

molecular biology studies in typing, phylogeny and population genetics. It compiles

more than 2,500 entries of edited DNA sequence data from the 16S-23S ribosomal

spacers present in most prokaryotes and organelles. Ribosomal spacers have proven

to be extremely useful tools for typing and identifying closely related prokaryotes

due to their high variability in size and/or sequence, much more so than the ﬂ anking

16S and 23S rRNA genes. These genes are commonly used to establish molecular

relationships among microbes at a taxonomic level of species or higher (e.g. genus,

domain). However their internal transcribed spacers (ITS) are much more useful to

discriminate at the species or even strain level (Iwen et al. 2002 ) . RISSC available

at < http://ulises.umh.es/RISSC > provides the scienti ﬁ c community with a compre-

hensive set of ribosomal spacer sequences, fully edited and characterized with a key

feature as is the presence/absence of tRNA genes within them, ready to be used and

compared with their own ITS sequences.

11.10 probeBase

probeBase is a curated database of annotated rRNA-targeted oligonucleotide probes

and supporting information (Loy et al. 2003, 2007 ) . Rapid access to probe, microarray

and reference data is achieved by powerful search tools and via different lists that are

based on selected categories such as functional or taxonomic properties of the target

organism(s), or the hybridization system in which the probes were applied. Additional

information on probe coverage and speci ﬁ city is available through direct submissions

of probe sequences from probeBase to RDP-II and Greengenes, two major rRNA

sequence databases.

ProbeBase available at < http://www.microbial-ecology.net/probebase > entries

increased from 700 to more than 1,200 during the past 3 years. Several options for

submission of single probes or entire probe sets, even prior to publication of newly

developed probes, should further contribute to keeping probeBase an up-to-date and

useful resource.

11.11 RRNDB

The Ribosomal RNA Operon Copy Number Database (RRNDB) available at < http://

rrndb.cme.msu.edu/ > contains annotated information on rRNA operon copy number

among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, however

132

M. Tabish et al.

rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of

16S rRNA gene sequences for identi ﬁ cation of prokaryotes, information on the number

and sequence of individual rRNA genes on a genome is not readily accessible. Each

entry in RRNDB contains detailed information linked directly to external websites

including the Ribosomal Database Project, GenBank, PubMed, and several culture

collections.

12 Identi ﬁ cation of New Species or Variant Strains

of Known Species

Bioinformatics has facilitated researchers to study microbial biodiversity because of

its direct interventions in molecular identi ﬁ cation, data storage and retrieval system

that were the objects and the worrisome of systematic research. The bioinformatics

driven approaches enabled people to work ef ﬁ ciently on microbial diversity,

identi ﬁ cation, characterization, molecular taxonomy and community analysis pat-

terns of both culturable and unculturable organisms. Description of new species,

genera and even molecular taxa emerged dramatically in the literature after 1990s

and these efforts are largely driven by advances in sequencing technologies. The

utilization of phenotypic identi ﬁ cation methods classically requires a probability-

based analysis to determine identity. In cases where identi ﬁ cation probabilities are

98% with known species, the identi ﬁ cation is generally considered acceptable.

The lower the probability percentage however, the less accurate the identi ﬁ cation

becomes, frequently resulting in supplemental testing to resolve discrepancies

among test results. It is not unusual for the laboratory to be unable to identify variant

strains of known species using phenotypic methods. DNA sequencing now allows

the laboratory a means to resolve those instances where phenotypic testing cannot

differentiate among closely related organisms.

The recognition of a species that does not match known schemes for phenotypic

identi ﬁ cation may represent a previously unrecognized species (Relman 2002 ) .

Sequencing of areas within the rDNA complex may be useful to suggest a new spe-

cies when there is a <98% of the sequence similarity with known species. The

ability to separate a new species from an atypical strain of a known species is how-

ever, dif ﬁ cult. The ﬁ rst approach to recognition of a new species is to determine the

phylogenetic position of the suspect new species compared to closely related

known species. Phylogenetic trees using the 16S gene for bacteria and the 18S

gene for fungi are commonly used for this type of analysis. The 16S rRNA approach

is rooted in the concept of point mutation due to their slow mutation rate. Before

microbial genomes were sequenced, using 16SrRNA database was considered and

bacteria, archaea, and eukaryotes were identi ﬁ ed.

A high degree of phenotypic consistency and rDNA sequence similarity as well

as, a signi ﬁ cant degree of DNA-DNA hybridization, is suggestive of a new

species.

133

6 Bioinformatics Approaches in Studying Microbial Diversity

13 Bioinformatics Challenges

Many bioinformatics tools have been borrowed from the ﬁ elds of arti ﬁ cial intelligence,

data mining, and statistical methods. However, the characteristics of biological data

may differ signi ﬁ cantly from those of the original data for which the methods were

developed. Though many computational methods have been introduced for genomic

data analysis based on these methods, several challenges still exist. Though public

databases such as GenBank are useful, the lack of quality sequences and the absence of

sequence information on a large number of species as well as the availability of com-

putational tools to reliably analyze the results are drawbacks to this technology. A typi-

cal DNA microarray might have thousands of features (probes) for, at most, one

hundred samples. Feature reduction is typically required before these sorts of analyses

can be performed (Al-Khaldi et al.

2012 ; Bier et al. 2008 ; Yauk and Berndt 2007 ) .

Another challenge is integrating data from different sources. These datasets might

show a high degree of heterogeneity and might also vary in quality. They might be

generated using different experimental platforms or based on different molecular meth-

ods. Using these data together ef ﬁ ciently requires developing suitable bioinformatics

methods. Of these methods, the simplest one is to put several datasets together to build

a larger dataset and then analyze this larger dataset. However, this method will not work

if the formats of the original datasets differ. Furthermore, the best processing methods

for different datasets are not the same. For example, Dice coef ﬁ cents work well for

some PFGE data but does not work well for some VNTR data. Thus, it might be an

impossible task to choose an optimal method for a combined dataset. An alternate

method is to process different datasets separately and then combine the results to obtain

the ﬁ nal result. The dif ﬁ culties with this kind of method, however, are determining the

extent to which the different sources of data should contribute and explaining the

combined results.

14 Conclusion

The development of computational methods based on the organized algorithms,

interpretational skills and high storage capacities facilitated comparison of entire

genomes and thus permit biologists to study more complex evolutionary trends like

gene duplication, horizontal gene transfer and prediction of factors important in

speciation (Nakashima et al. 2005 ) . Bioinformatics researchers have compared

extensively multiple genomes to correlate and classify the genomes into various

families and to study evolution. It has been established by many researchers that

overall evolution is a combination of point based mutation giving rise to restructuring

of genomes based upon gene duplications, gene insertion, gene deletion, horizontal

gene transfer etc. The ultimate aim of such studies lies in deciphering the evolutionary

lineages among the group of organisms in a quest to determine the tree of life and

the last universal common ancestor. The progress in bioinformatics and wet-lab

134

M. Tabish et al.

techniques has to remain interdependent and focused complementing each other for

their own progress and for the progress of biotechnology in future.

15 Some More Web Addresses for Bioinformatics Tools

Name of tool/database Web address

ASD

http://www.ebi.ac.uk/asd

AUGUSTUS

http://augustus.gobics.de/bin/npsa_automat.pl?page=

npsa_gor4.html

BLAST

http://www.ncbi.nlm.nih.gov/blast

CFSSP

http://www.biogem.org/tool/chou-fasman/

Clustal W

http://www.ebi.ac.uk/Tools/clustalw2/index.html

ComputpI/Mw

http://web.expasy.org/compute_pi/

CpG Island Searcher

http://www.uscnorris.com/cpgislands2/cpg.aspx

CpGPlot

http://www.ebi.ac.uk/Tools/emboss/cpgplot/index.html

DDBJ BLAST

http://blast.ddbj.nig.ac.jp

DNA tools

http://biology.semo.edu/cgi-bin/dnatools.pl

Entrez Gene

http://www.ncbi.nlm.nih.gov/sites/entrez

ESLPred2

http://www.imtech.res.in/raghava/eslpred2/

ExPaSy

http://expasy.org/tools/

FEX

http://www.softberry.ru/berry.phtml

FGENESH

http://www.softberry.ru/berry.phtml

GeneMark.hmm

http://www.itba.mi.cnr.it/webgene/

GOR

http://npsa-pbil.ibcp.fr/cgi -

HMMgene

http://www.cbs.dtu.dk/services/HMMgene/

MGI

http://www.informatics.jax.org/

MultiLoc2

http://abi.inf.uni-tuebingen.de/Services/MultiLoc2

Myristoylator

http://web.expasy.org/myristoylator/

NetAcet

http://www.cbs.dtu.dk/services/NetAcet/

NetOGlyc

http://www.cbs.dtu.dk/services/NetOGlyc

NetPhos

http://www.cbs.dtu.dk/services/NetPhos/

NetPhosK

http://www.cbs.dtu.dk/services/NetPhosK/

NetSurfP

http://www.cbs.dtu.dk/services/NetSurfP/

NMT

http://mendel.imp.ac.at/myristate/SUPLpredictor.htm

OligoCalc

http://www.basic.northwestern.edu/biotools/oligocalc.html

PSIPRED v3.0

http://bioinf.cs.ucl.ac.uk/psipred/

SherLoc2

http://abi.inf.uni-tuebingen.de/Services/SherLoc2

SIGSCAN

http://www-bimas.cit.nih.gov/molbio/signal/

SMS

http://www.bioinformatics.org/sms/

TermiNator

http://www.isv.cnrs-gif.fr/terminator3/index.html

TFBIND

http://tfbind.hgc.jp/

TFSEARCH

http://www.cbrc.jp/research/db/TFSEARCH.html

135

6 Bioinformatics Approaches in Studying Microbial Diversity

Glossary

Homology Searches: BLAST & FASTA Background Information: The three

BLAST programs that one will commonly use are BLASTN, BLASTP and

BLASTX. BLASTN will compare your DNA sequence with all the DNA

sequences in the nonredundant database (nr). BLASTP will compare your protein

sequence with all the protein sequences in nr. In BLASTX nucleotide sequence

of interest will be translated in all six reading frames and the products compared

with the nr protein database. A tutorial is also available at NCBI.

BLAST Homepage – (NCBI) Found at

http://blast.ncbi.nlm.nih.gov/Blast.cgi .

It is widely used for homology searches. BLAST stands for Basic Local Align-

ment Search Tool and it displays a number of organism and query speci ﬁ c blast.

Nucleotide BLAST (BLASTN) N.B. the default database is “human genomic and

transcript” not “nucleotide collection (nt/nr)”

Protein BLAST (BLASTP) This program is also coupled with a motif search.

If you suspect that your protein may only show weak sequence similarity to other

proteins, I would suggest clicking on the PSI-BLAST (Position-Speci ﬁ c Iter-

ated BLAST) feature. NCBI also provides a PSI-BLAST tutorial. PSI-BLAST

searches to yield better delineation of true and false positives.

Translated BLAST (BLASTX) TBLASTX searches translated nucleotide data-

bases using a translated nucleotide query; while TBLASTN searches translated

nucleotide databases using a protein query. These are useful resources if you

are interested in homologs in un ﬁ nished genomes. Undeter “Databases” select

“genomic survey sequences”, “High throughput genomic sequences” or “whole-

genome shotgun reads”

Blast with Microbial Genomes (BLASTN, TBLASTN, TBLASTX etc.). It per-

mits us to compare a nucleic acid or protein sequence against ﬁ nished archaeal

and bacterial genomes. Depending upon the time of day your results may appear

almost immediately or the search may be delayed or not accepted at all. For PSI-

BLAST, and other searches it is recommended to frequently enter information in

the “Entrez Query” section e.g. Escherichia coli [organism] or Viruses [organ-

ism] to see “hits” speci ﬁ cally to E. coli or viruses/bacteriophages. It is advisable

to always select “Show results in a new window”

EMB BLAST -(European Molecular Biology network). Very convenient since it

permits one to speci ﬁ cally search databases such as prokaryote, bacteriophage,

fungal, & 16S rRNA using BLASTN, and speci ﬁ c bacterial genomes or SwissProt

using BLASTX or BLASTN.

ParAlign It employs a heuristic method for sequence alignment. In essence, Par-

Align is about as sensitive as Smith-Waterman but runs at the speed of BLAST.

GTOP Sequence Homology Search (Laboratory for Gene-Product Informatics,

National Institute of Genetics, Japan) – offers BLASTP search capability against

individual archaea, bacteria, eukaryota, and viruses.

T4-like Phage NCBI MegaBLAST (Tulane Univ., New Orleans, U.S.A. &

CNRS, Toulouse, France) This includes a growing list of T4-like completed

phage sequences as well as those in the draft and contig stages of completion.

136

M. Tabish et al.

WU-BLAST (Washington University BLAST) The emphasis of this tool is to

ﬁ nd regions of sequence similarity quickly, with minimum loss of sensitivity.

This will yield functional and evolutionary clues about the structure and function

of the novel sequence.

Batch BLAST (Greengene web server; University of Massachusetts, Lowell,

U.S.A.) was developed by Michael V. Graves for DNA or protein BLAST

sequence analysis against the NCBI databases. It allows one to submit a ﬁ le that

contains multiple sequences and then will organize the results by each individual

sequence contained in the ﬁ le.

HHPred Homology detection & structure prediction is a method for database

searching and structure prediction that is as easy to use as BLAST but is much

more sensitive in ﬁ nding remote homologs. HHpred is the ﬁ rst server that is

based on the pairwise comparison of pro ﬁ le hidden Markov models (HMMs).

Whereas most conventional sequence search methods search sequence databases

such as UniProt or the NR, HHpred searches alignment databases, like Pfam or

SMART. This greatly simpli ﬁ es the list of hits to a number of sequence families

instead of a clutter of single sequences. HHpred accepts a single query sequence

or a multiple alignment as input.

PSI-BLAST or PHI-BLAST search Position-Speci ﬁ c Iterative BLAST creates a

pro ﬁ le after the initial search.

BLAST 2 BLAST two sequences against one another. This utilizes BLASTN, P, X

as well as TBLASTN and TBLASTX.

Gene Context Tool It is an incredible tool for visualizing the genome context of a

gene or group of genes.

TC-BLAST It scans the transport protein database (TC-DB) producing alignments

and phylogenetic trees. The TC-DB details a comprehensive classi ﬁ cation sys-

tem for membrane transport proteins known as the Transport Commission (TC)

system.

MEROPS BLAST This permits one to screen protein sequences against an exten-

sive database of characterized peptidases.

SEARCHGTr It is web-based software for the analysis of glycosyltransferases

involved in the biosynthesis of a variety of pharmaceutically important compounds

like adriamycin, erythromycin, vancomycin etc. This software has been developed

based on a comprehensive analysis of sequence/structural features of 102 GTrs

of known speci ﬁ city from 52 natural product biosynthetic gene clusters.

PipeAlign It offers an integrated approach to protein family analysis through a

cascade of different sequence analysis programs (BALLAST , DbClustal mul-

tiple alignment program, Rascal alignment analysis) removal of any sequences that

do not belong to the protein family are performed by the NorMD, and clustered into

potential functional subfamilies using Secator or DPC.

MPsrch (EMBL-EBI) This sequence sequence comparison tool implements the

true Smith and Waterman algorithm identifying hits in cases where Blast and Fasta

fail and also reports fewer false-positives. This software provides information

on Match %; % Query Match (% of the query sequence matched); Conservative

changes; Mismatches; Indels; and Gaps.

137

6 Bioinformatics Approaches in Studying Microbial Diversity

GOAnno This web tool automatically annotates proteins according to the Gene

Ontology using hierarchised multiple alignments. Positioning the query protein

in its aligned functional subfamily represents a key step to obtain highly reliable

predicted GO annotation based on the GOAnno algorithm.

COMPASS This is a pro ﬁ le-based method for the detection of remote sequence

similarity and the prediction of protein structure. The server features three major

developments: (i) improved statistical accuracy; (ii) increased speed from parallel

implementation; and (iii) new functional features facilitating structure predic-

tion. These features include visualization tools that allow the user to quickly

and effectively analyze speci ﬁ c local structural region predictions suggested by

COMPASS alignments.

MineBlast It performs BLASTP searches in UniProt to identify names and synonyms

based on homologous proteins and subsequently queries PubMed, using combined

search terms in order to ﬁ nd and present relevant literature.

Comparison of homology between two small genomes: SCAN2 (Softberry.

com) It provides one with a colour-coded graphical alignment of genome length

DNAs in Java. In the top panel regions of high sequence identity are presented in

red. By highlighting the grey yellow, green, black boxes one can select speci ﬁ c

regions for examination of the sequence alignment.

Advanced PipMaker It aligns two DNA sequences and returns a percent identity

plot of that alignment, together with a traditional textual form of the alignment.

We may need to download it for viewing and manipulating the output from pairwise

alignment programs such as PipMaker representations of the alignments.

JDotter: A Java Dot Plot Viewer (Viral Bioinformatics Resource Center, Uni-

versity of Victoria, Canada) – a dot matrix plotter for Java. It produces similar

diagrams to the above mentioned programs, but with better control on output.

multi-zPicture: multiple sequence alignment tool provides nice dotplot graphs

and dynamic visualizations. If simple gene locations are provided in the form

(e.g. >2,000–5,000 RNA_polymerase; indicates that the RNA polymerase gene

is found on the plus strand between bases 2,000 and 5,000) this data will be

added to the dynamic visualization. zPicture alignments can be automatically

submitted to rVista to identify conserved transcription factor binding sites.

GeneOrder 3.0 This is ideal for comparing small GenBank genomes (up to 2 Mb).

Each gene from the Query sequence is compared to all of the genes from the

Reference sequence using BLASTP. There are two display formats: graphical

and tabular.

CoreGenes This programme is designed to analyze two to ﬁ ve genomes simulta-

neously, generating a table of related genes – orthologs and putative orthologs.

These entries are linked to their GenBank data. It has a limit of 0.35 Mb, while

the newer version CoreGenes 2.0 extends the limit to approx. 2.0 Mb. If data is

not present in GenBank, using this site will be very helpful.

CoreGenes 3.0 This is the latest member in the CoreGenes family of tools. It deter-

mines unique genes contained in a pair of proteomes. This has proved extremely

useful in determining unique genes in comparisons between large Myoviridae.

138

M. Tabish et al.

References

Al-Khaldi SF, Mossoba MM, Allard MM, Lienau EK, Brown ED (2012) Bacterial identi ﬁ cation

and subtyping using DNA microarray and DNA sequencing. Methods Mol Biol 881:73–95

Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped

BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids

Res 25:3389–3402

Barrell D, Dimmer E, Huntley RP, Binns D, O’Donovan C, Apweiler R (2009) The GOA database

in 2009–an integrated gene ontology annotation resource. Nucleic Acids Res 37:D396–D403

Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Rapp BA, Wheeler DL (2002) GenBank.

Nucleic Acids Res 28:15–18

Bier FF, von Nickisch-Rosenegk M, Ehrentreich-Förster E, Reiss E, Henkel J, Strehlow R, Andresen

D (2008) DNA microarrays. Adv Biochem Eng Biotechnol 109:433–453

Bilitewski U (2009) DNA microarrays: an introduction to the technology. Methods Mol Biol

509:1–14

Boerlin P, Reid-Smith RJ (2008) Antimicrobial resistance: its emergence and transmission. Anim

Health Res Rev 2:115–126

Borucki MK, Kim SH, Call DR, Smole SC, Pagotto F (2004) Selective discrimination of Listeria

monocytogenes epidemic strains by a mixed-genome DNA microarray compared to discrimi-

nation by pulsed- ﬁ eld gel electrophoresis, ribotyping, and multilocus sequence typing. J Clin

Microbiol 42:5270–5276

Bray N, Pachter L (2003) MAVID multiple alignment server. Nucleic Acids Res 31:3525–3526

Bray N, Pachter L (2004) MAVID: constrained ancestral alignment of multiple sequences. Genome

Res 14:693–699

Brown MP (2000) Small subunit ribosomal RNA modeling using stochastic context free grammar.

Proc Int Conf Intell Syst Mol Biol 8:57–66

Brudno M, Do CB, Cooper GM, Kim MF, Davydov E, Green ED, Sidow A, Batzoglou S, NISC

Comparative Sequencing Program (2003) LAGAN and Multi-LAGAN: ef ﬁ cient tools for

large-scale multiple alignment of genomic DNA. Genome Res 13:721–731

Bruno WJ, Socci ND, Halpern AL (2000) Weighted neighbor joining: a likelihood-based approach

to distance-based phylogeny reconstruction. Mol Biol Evol 17:189–197

Call DR, Borucki MK, Besser TE (2003) Mixed-genome microarrays reveal multiple serotype

and lineage-speci ﬁ c differences among strains of Listeria monocytogenes. J Clin Microbiol

41:632–639

Cole JR, Chai B, Farris RJ, Wang Q, Kulam SA, McGarrell DM, Garrity GM, Tiedje JM (2005) The

ribosomal database project (RDP-II): sequences and tools for high-throughput rRNA analysis.

Nucleic Acids Res 33(Database issue)

Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ, Kulam-Syed-Mohideen AS, McGarrell

DM, Marsh T, Garrity GM, Tiedje JM (2009) The ribosomal database project: improved align-

ments and new tools for rRNA analysis. Nucleic Acids Res 37:D141–D145

Darling AC, Mau B, Blattner FR, Perna NT (2004) Mauve: multiple alignment of conserved

genomic sequence with rearrangements. Genome Res 14:1394–1403

DeSantis TZ, Dubosarskiy I, Murray SR, Andersen GL (2003) Comprehensive aligned sequence

construction for automated design of effective probes (CASCADE-P) using 16S rDNA.

Bioinformatics 19:1461–1468

Dewey CN (2007) Aligning multiple whole genomes with Mercator and MAVID. Methods Mol

Biol 395:221–236

Doolittle WF (1999) Phylogenetic classi ﬁ cation and the universal tree. Science 284:2124–2128

Feinbaum R (2001) Introduction to plasmid biology. Curr Protoc Mol Biol Chapter 1:Unit 1.5

Felsenstein J (1993) PHYLIP (phylogeny inference package) version 3.5c. Department of Genetics,

University of Washington, Seattle

139

6 Bioinformatics Approaches in Studying Microbial Diversity

Fleischmann RD, Adams MD, White O, Clayton RA, Kirkness EF, Kerlavage AR, Bult CJ, Tomb

JF, Dougherty BA, Merrick JM et al (1995) Whole-genome random sequencing and assembly

of Haemophilus in ﬂ uenzae Rd. Science 269:496–512

Foster JA, Moore JH, Gilbert JA, Bunge J (2012) Microbiome studies: analytical tools and

techniques. Pac Symp Biocomput 17:200–202

Foxman B, Zhang L, Koopman JS, Manning SD, Marrs CF (2005) Choosing an appropriate bacterial

typing technique for epidemiologic studies. Epidemiol Perspect Innov 25:2–10

Gomez SM, Choi K, Wu Y (2008) Prediction of protein-protein interaction networks. Curr Protoc

Bioinform Chapter 8:Unit 8.2

Harris MA, Clark J, Ireland A, Lomax J, Ashburner M, Foulger R, Eilbeck K, Lewis S, Marshall

B, Mungall C, Richter J, Rubin GM, Blake JA, Bult C, Dolan M, Drabkin H, Eppig JT, Hill DP,

Ni L, Ringwald M, Balakrishnan R, Cherry JM, Christie KR, Costanzo MC, Dwight SS, Engel

S, Fisk DG, Hirschman JE, Hong EL, Nash RS, Sethuraman A, Theesfeld CL, Botstein D,

Dolinski K, Feierbach B, Berardini T, Mundodi S, Rhee SY, Apweiler R, Barrell D, Camon

E, Dimmer E, Lee V, Chisholm R, Gaudet P, Kibbe W, Kishore R, Schwarz EM, Sternberg P,

Gwinn M, Hannick L, Wortman J, Berriman M, Wood V, de la Cruz N, Tonellato P, Jaiswal P,

Seigfried T, White R, Gene Ontology Consortium (2004) The gene ontology (GO) database

and informatics resource. Nucleic Acids Res 32:D258–D261

Idekar T, Galitski T, Hood L (2001) A new approach to decoding life: systems biology. Annu Rev

Genomics Hum Genet 2:343–372

Iwen PC, Hinrichs SH, Rupp ME (2002) Utilization of the internal transcribed spacer regions as

molecular targets to detect and identify human fungal pathogens. Med Mycol 40:87–109

Johnston JW (2010). Laboratory growth and maintenance of Haemophilus in ﬂ uenzae . Curr Protoc

Microbiol Chapter 6:Unit 6D.1

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,

Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and

Clustal X version 2.0. Bioinformatics 23:2947–2948

Larsen N, Olsen GJ, Maidak BL, McCaughey MJ, Overbeek R, Macke TJ, Marsh TL, Woese CR

(1993) The ribosomal database project. Nucleic Acids Res 21:3021–3023

Lee MM, Chan MK, Bundschuh R (2008) Simple is beautiful: a straightforward approach to

improve the delineation of true and false positives in PSI-BLAST searches. Bioinformatics

24:1339–1343

Lin HN, Notredame C, Chang JM, Sung TY, Hsu WL (2011) Improving the alignment quality of

consistency based aligners with an evaluation function using synonymous protein words. PLoS

One 6:e27872

Loy A, Horn M, Wagner M (2003) probeBase: an online resource for rRNA-targeted oligonucleotide

probes. Nucleic Acids Res 31:514–516

Loy A, Maixner F, Wagner M, Horn M (2007) probeBase – an online resource for rRNA-targeted

oligonucleotide probes: new features 2007. Nucleic Acids Res 35(Database issue):D800–D804

Luscombe NM, Greenbaum D, Gerstein M (2001) What is bioinformatics? A proposed de ﬁ nition

and overview of the ﬁ eld. Methods Inform Med 40:346–358

Maidak BL, Cole JR, Lilburn TG, Parker CT, Saxman PR, Farris RJ, Garrity GM, Olsen GJ, Schmidt

TM, Tiedje JM (2001) The RDP-II (Ribosomal Database Project). Nucleic Acids Res 29:173–174

McHardy AC, Martín HG, Tsirigos A, Hugenholtz P, Rigoutsos I (2007) Accurate phylogenetic

classi ﬁ cation of variable-length DNA fragments. Nat Methods 4:63–72

Mølbak L, Tett A, Ussery DW, Wall K, Turner S, Bailey M, Field D (2003) The plasmid genome

database. Microbiology 149:3043–3045

Nakashima N, Mitani Y, Tamura T (2005) Actinomycetes as host cells for production of recombinant

proteins. Microb Cell Fact 4:7

Pearson WR (1990) Rapid and sensitive sequence comparison with FASTP and FASTA. Methods

Enzymol 183:63–98

Pearson WR (1991) Searching protein sequence libraries: comparison of the sensitivity and selectivity

of the Smith-Waterman and FASTA algorithms. Genomics 11:635–650

140

M. Tabish et al.

Perna NT, Plunkett G 3rd, Burland V, Mau B, Glasner JD, Rose DJ, Mayhew GF, Evans PS, Gregor

J, Kirkpatrick HA, Pósfai G, Hackett J, Klink S, Boutin A, Shao Y, Miller L, Grotbeck EJ,

Davis NW, Lim A, Dimalanta ET, Potamousis KD, Apodaca J, Anantharaman TS, Lin J, Yen

G, Schwartz DC, Welch RA, Blattner FR (2001) Genome sequence of enterohaemorrhagic

Escherichia coli O157:H7. Nature 409:529–533

Plewniak F (2008) Database similarity searches. Methods Mol Biol 484:361–378

Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig WG, Peplies J, Glöckner FO (2007) SILVA: a

comprehensive online resource for quality checked and aligned ribosomal RNA sequence data

compatible with ARB. Nucleic Acids Res 35:7188–7196

Relman DA (2002) New technologies, human-microbe interactions, and the search for previously

unrecognized pathogens. J Infect Dis 186(Suppl 2):254–258

Schäffer AA, Aravind L, Madden TL, Shavirin S, Spouge JL, Wolf YI, Koonin EV, Altschul SF

(2001) Improving the accuracy of PSI-BLAST protein database searches with composition-

based statistics and other re ﬁ nements. Nucleic Acids Res 29:2994–3005

Shah SP, Huang Y, Xu T, Yuen MM, Ling J, Ouellette BF (2005) Atlas – a data warehouse for

integrative bioinformatics. BMC Bioinformatics 21:6–34

Som A (2006) Theoretical foundation to estimate the relative ef ﬁ ciencies of the Jukes-Cantor + gamma

model and the Jukes-Cantor model in obtaining the correct phylogenetic tree. Gene

385:103–110

Stark M, Berger SA, Stamatakis A, von Mering C (2010) MLTreeMap – accurate maximum likelihood

placement of environmental DNA sequences into taxonomic and functional reference phylog-

enies. BMC Genomics 5:11–461

Summers DK (1996) The biology of plasmids. Blackwell Science, Oxford

Takahashi K, Nei M (2000) Ef ﬁ ciencies of fast algorithms of phylogenetic inference under the

criteria of maximum parsimony, minimum evolution, and maximum likelihood when a large

number of sequences are used. Mol Biol Evol 17:1251–1258

Tatusov RL, Koonin EV, Lipman DJ (1997) A genomic perspective on protein families. Science

278:631–637

Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov DM, Mazumder

R, Mekhedov SL, Nikolskaya AN, Rao BS, Smirnov S, Sverdlov AV, Vasudevan S, Wolf YI,

Yin JJ, Natale DA (2003) The COG database: an updated version includes eukaryotes. BMC

Bioinformatics 4:41

Tenover FC, Arbeit RD, Goering RV (1997) How to select and interpret molecular strain typing

methods for epidemiological studies of bacterial infections: a review for healthcare epidemi-

ologists. Infect Control Hosp Epidemiol 18:426–439

Thomas CM (2000) The horizontal gene pool: bacterial plasmids and gene spread. Harwood

Academic, Amsterdam

Thompson JD, Gibson TJ, Higgins DG (2002) Multiple sequence alignment using ClustalW and

ClustalX. Curr Protoc Bioinform. Chapter 2:Unit 2.3

Wan Y, Broschat SL, Call DR (2007) Validation of mixed-genome microarrays as a method for

genetic discrimination. Appl Environ Microbiol 73:1425–1432

Wilmes P, Simmons SL, Denef VJ, Ban ﬁ eld JF (2009) The dynamic genetic repertoire of microbial

communities. FEMS Microbiol Rev 33:109–132

Woese CR (1987) Bacterial evolution. Microbiol Mol Biol Rev 51:221–271

Yauk CL, Berndt ML (2007) Review of the literature examining the correlation among DNA

microarray technologies. Environ Mol Mutagen 48:380–394

Zhou J (2003) Microarrays for bacterial detection and microbial community analysis. Curr Opin

Microbiol 6:288–294

141

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_7, © Springer Science+Business Media Dordrecht 2013

Abstract Metagenomics is a modern and rapidly growing ﬁ eld of molecular genetics

and ecology that studies the “collective” genome of the microbial community and is

based on the analysis of environmental DNA, extracted directly from a variety of

natural habitats. The advent of high-throughput sequencing techniques had opened

the principally new opportunities in studies of the genetic structure of microbial

communities, but at the same time highlighted signi ﬁ cant dif ﬁ culties, arising par-

ticularly during the investigation of the soil metagenome.

Soil is the most densely populated habitat on the planet, and can contain up to

1,000 Gbp of genetic information per gram suggesting the great misfortune during

the analysis of the soil metagenome consisting in the preferential analysis of only a

small fraction of the total soil metagenome with relatively low accuracy. We empha-

size the necessity for structuring of the soil metagenome and identi ﬁ cation of its

main components. Considering that modern metagenomics should ﬁ rst be addressed

to the “eternal” questions of soil microbiology, in this review we tried to identify the

meaningful parts of soil metagenome primarily by the analysis of soil microbial

communities. We discussed in detail the spatial organization of soil metagenome

associated with micro- and macrostructure of the soil matrix, the structural organi-

zation of soil metagenome associated with the presence of heterogeneous pools of

soil DNA, taxonomical and functional organization of the soil metagenome revealed

from the investigation of global patterns of distribution of microbial communities in

relation to the speci ﬁ c environmental factors.

We demonstrated that soil microbial communities are characterized by a pres-

ence of a restricted number of taxonomic organization types, which are based on

the most powerful ecological factors such as soil pH and moisture. Comparing to

more or less labile taxonomic structure, the functional structure of the soil metag-

enome is rather conservative and is maintained primarily by two factors – the

E. V. Pershina • E. E. Andronov • A. G. Pinaev • N. A. Provorov (*)

All-Russia Research Institute for Agricultural Microbiology ,

Saint-Petersburg , Russia

e-mail: provorov@newmail.ru

Chapter 7

Recent Advances and Perspectives

in Metagenomic Studies of Soil Microbial

Communities

E. V. Pershina , E. E. Andronov , A. G. Pinaev , and N. A. Provorov

142

E.V. Pershina et al.

microbial co-operation and the maintenance of high levels of genetic diversity.

Finally we come to a conclusion that the soil metagenome represents an integrative

hereditary system for maintenance of the basic soil functions under the variable

ecological conditions.

Keywords Metagenomics • Microbiome • Soil microbial communities • Gene

transfer • Soil DNA

1 What is the Metagenome?

It is quite dif ﬁ cult to give a precise de ﬁ nition of metagenomics. The term metage-

nomics usually means a number of molecular techniques involved in accession and

analysis of the genetic information of microbial community derived directly from

the environment. Thus we obtain a huge pool of genetic information that we call

metagenome – the “collective” genome of the microbial community. Describing

metagenomics we deal with DNA, that comparing to RNA molecules is more stable

and heterogeneous and generally contain much more information not only about

biologically-driven processes that currently take place in the environment but also

about genetic potential of microbial community. All this information is stored in

extremely large amount of environmental DNA (Vieites et al. 2010 ) .

Therefore if we simply de ﬁ ne the metagenome as a collection of the entire

genetic information present in e.g. 1 g of soil (and it must be said that the majority

of modern metagenomic projects is guided directly like this) we will deal, according

to various estimates, with enormous 10

–10

b of DNA (Vogel et al. 2009 ; Trevors

2010 ; Hirsch et al. 2010 ) . Sequencing of such a huge amount of soil DNA seems to

be dif ﬁ cult and even unsolvable problem. Nowadays it leads to sometimes pessimistic

forecasts that it is crucially impossible to analyse the whole soil metagenome

(Baveye 2009 ; Tringe and Hugenholtz 2009 ) .

Considering all this, we initiated the current review primarily to summarize all

the present information about genetic diversity of bacteria in soil and ﬁ nd some

reasonable traits for the future investigations. To run our work we must primarily

give a narrow de ﬁ nition of soil metagenome. We de ﬁ ne soil metagenome as a

complex system of at least four pools of the genetic material: the DNA of the living

cells, the DNA of the resting forms and ﬁ nally the DNA of the dead organisms and

extracellular DNA. All these genetic reservoirs are maintained in the dynamic equi-

librium depending on the environmental conditions. It will be absolutely insuf ﬁ cient

to restrict our scope to the living organisms alone. Giving credit to the importance

of measuring metabolically active microbes in the soil we must stress the signi ﬁ cance

of the “non-active” soil DNA.

Soil is considered to be the most populated environment on the Earth, but at the

same time, due to the highly changeable ecological conditions inherent to this habi-

tat, the majority of microorganisms are present here in the various resting forms

(the so called “microbiological pool” of soils). Instead of “microbiological pool”

143

7 Recent Advances and Perspectives…

the extracellular DNA and potentially the DNA of the dead microbes and viruses

can be treated as “genetic pool” of soils due to the well-known phenomenon of

genetic transformation. This process plays a signi ﬁ cant role particularly in soil due

to its spatial and temporal heterogeneity. Investigation of the transformation or other

processes involved in horizontal gene transfer could shed light on the rate of inter-

species interaction within the microbial community as well as on the responsibility

of soil microbes to act upon changing ecological conditions (adaptation potential of

microbial community).

It is worth mentioning here that the traditional microbiological plating methods

are basically irresponsible to gain any essential information either about soil “micro-

bial pool” or about natural genetic reservoir. Contrarily, application of new high

throughput molecular techniques that are sensitive to all the genetic material exposed

in the environment opens radically new perspectives in studying soil microbial

population. These new methods are applied not only to measure actual diversity of

microorganisms and to answer the intriguing question of “who is doing what in the

environment?” but even to elucidate the microbial and genetic potential hidden in

soil, which makes it a highly integrated and continuously evolving ecosystem.

In this paper we consider the metagenome of soil community as an integral

genetic system and give analysis of this system with respect to the taxonomic and

functional structures of the soil microbiota. This approach will enable us to describe

the correlation of the taxonomic structure of soil community and its functional

structure, and thus to give account of the adaptive processes in soil microbiota

responsible for soil sustainability and fertility.

2 Sources of Genetic Information in Soil

Before the great “molecular revolution” in microbial ecology, cultivation of microor-

ganisms on arti ﬁ cial media was the main source of information about the microbial

diversity. At the same time the data from microscopic studies testi ﬁ ed that there were

much more different bacterial species in the environment. Simultaneously, there was

an opinion that cultivation of microorganisms on the reach medium (relatively to the

naturally occurred) counted only for zymogenic soil microorganisms, which became

alive in soil after the sharp changes in environment, particularly after enrichment of

soil with organic matter.

Finally a plenty of methods for the analysis of environmental DNA molecules

showed that by culturing we obtained less than 1% of actual biodiversity and the

majority of microorganisms cannot be cultured in the laboratory. After the pioneer-

ing 16S rRNA based studies of microbial communities it was postulated that soil

appeared to be the most populated environment on the Earth (Torsvik et al. 1990 ;

Daniel 2005 ) . A characteristic property of soil community structure is low number

of dominant microbial species together with the “long tail” of rarely found species

(Elshahed et al. 2008 ; Bent and Forney 2008 ) . On the one hand, a lot of minor spe-

cies in microbial community could be directly related with the highly heterogeneous

144

E.V. Pershina et al.

nature of soil environment which produces many ecological niches, but, on the other

hand, there is strong evidence that the vast majority of microorganisms in soil are

staying in the resting forms due to the changeable surrounding conditions, and thus

the temporary inactive microbes could comprise the great part of the “long tail”.

This cornerstone question in soil ecology is still unsolved, primarily due to the lack

of DNA extraction techniques for the accurate separation of active cells from the

resting microbial population. Anyway, after the ﬁ rst decade of molecular ecology

studies it was shown, that microbial communities in natural environments possess

an unprecedented levels of biodiversity and probably have their speci ﬁ c ecological

characteristics.

The recent evidence of the stability of extracellular DNA (eDNA) in number of

natural environments argues much for the speci ﬁ c integrative structure of microbial

population in soil. Particularly it was shown that eDNA could comprise up to 60%

of the total DNA (Agnelli et al.

2004 ) .

Hence, now we are inclined to describe soil metagenome as a complex system

with spatially and temporary separated and at the same time intimately related com-

ponents, which play different roles in ecosystem functioning. First component

includes living cells and closely related second component – resting forms of micro-

organisms; the third consists of dead cells, whose DNA supplements constantly the

fourth pool of genetic information – eDNA (Levy-Bootha et al. 2007 ; Pietramellara

et al. 2009 ) . Finally, the ﬁ fth component (which also could be signed as eDNA, but

has its own speci ﬁ c features) includes fragments of microbial DNA packed in virus

particles. Of course, there are some more DNA sources in the soil, e.g. eukaryotic

DNA, DNA, which comes in the soil from some other environments. All these DNA

sources undoubtedly in ﬂ uence the soil microbial metagenome but they wouldn’t be

mentioned further in this paper.

Today we can only guess about the mechanisms of integration of soil microorgan-

isms and their DNA in soil metagenome, because our knowledge of the microbial

populations associated with each of the sources of soil DNA is still very poor.

Dif ﬁ culties in studying of these main sources of soil DNA are closely connected

to the problem of DNA extraction from soil. As opposed to other environments, e.g.

marine ecosystem, the total and particularly differential extraction of soil DNA has

a great obstacle mainly in the strong adhesion of cell as well as their DNA to different

components of soil matrix (Nielsen et al. 2006 ; Saeki and Kunito 2010 ; Bakken and

Frostegärd 2006 ) . That is why beginning in 80-s and till now a lot of methods for

DNA extraction were invented and reviewed (Bürgmann et al. 2001 ; Sagova-

Mareckova et al. 2008 ; Martin-Laurent et al. 2001 ; Robe et al. 2003 ) . The great

dilemma of any method for soil DNA extraction is inability of “mild” procedures to

extract representative portion of DNA and lack of speci ﬁ city together with degrada-

tion of DNA in “strong” methods (Bakken and Frostegärd

2006 ) . Thus today we are

lacking in the appropriate method for separation of living (or dead) cells from bacte-

rial resting stages. Partly it happens because very often the quantity and quality of

extracted DNA come to the fore and lead us away from the biological sense of DNA

extraction: too high percentage of soil DNA per gram is no better that too low,

because the only important thing is to whom it belongs. A good theoretical basis for

145

7 Recent Advances and Perspectives…

this is provided by the studies of physical and chemical parameters associated with

the persistence of all mentioned DNA sources in the soil. From this point of view,

the situation with eDNA seems to be relatively optimistic.

Not long ago there was a strong opinion that DNA coming from the cell to natural

environment is immediately degraded by nucleases. But after a number of studies

on the absorbance and stabilization of eDNA on mineral or organic materials and

different soil components it became clear that DNA can maintain in soil for a long

period of time (Wackernagel

2006 ; Cai et al. 2006 ) and probably could play

signi ﬁ cant role in functioning of soil ecosystem. The initial interest in studying free

soil DNA was the process of natural genetic transformation of bacteria by eDNA

and closely connected problem of dispersing the GMO genes in the environment.

Another point of interest was eDNA distribution in soil and sorption on clay minerals

which bridges soil DNA studies to the hypothetical processes of NA behaviour at

the dawn of biological evolution (Saeki and Kunito 2010 ) . Finally the very popular

direction of studies of eDNA is formation of microbial bio ﬁ lms (Böckelmann et al.

2007 ; Chiang and Tolker-Nielsen 2010 ) , which might be very actual especially

for soil microbial communities due to the uneven distribution of the polymeric

organic compounds and pronounced ability of soil microorganisms to adhere on soil

substances.

Together with these interdisciplinary topics, the knowledge about the amount

and composition as well as the rate of the genetic transfer of eDNA play crucial

role for understanding the organisation of soil metagenome. First of all, eDNA

represents the genetic potential of the microbial community, that could be treated

as connection between spatially and temporary isolated microbial populations and

undoubtedly gives a great contribution to the soil adaptive potential. Presently we

have many studies on the adsorption of DNA in soil (Saeki and Kunito 2010 ; Cai

et al. 2006 ) and its movement through soil capillaries (Ascher et al. 2005 ; Ceccherini

et al. 2007 ) , the lifetime of soil eDNA (Romanowski et al. 1992 ) , the number of

studies on the horizontal gene transfer (Lu et al. 2010 ) with special focus on transition

of genetic constructions from GMO to native soil microbiota (Paget et al. 1998 ;

Wackernagel 2006 ) .

As a result of these investigations we obtained many useful outcomes about the

behavior of eDNA in the environment. It was shown that the amount of eDNA in

soil can vary signi ﬁ cantly depending on soil horizon and type of soil and ranges

from 0.03 to 2 μ g per gram (of dried soil). It was pointed by Nielsen et al. ( 2007 )

that a high number of bacterial isolates could produce eDNA in pure cultures,

among them are bacteria which are commonly distributed in soil such as

Pseudomonas and Azotobacter . Moreover this DNA release can be enhanced by

presence of other bacteria or eukaryotes (Nielsen et al.

2007 ) . These experimen-

tally de ﬁ ned facts point on the possible integrative role of eDNA in interspecies

interactions between prokaryotes as well as between prokaryotes and eukaryotes in

soil microbial community.

Judging from the studies on adsorption of DNA molecules in soil it seems to be

true that most of eDNA is associated with soil organic matter, primarily to humus

components and clay-organic complexes, which signi ﬁ cantly promote its stability

146

E.V. Pershina et al.

(Cai et al. 2006 ; Nielsen et al. 2007 ) . Thus the vast majority of soil eDNA immediately

after living cell envelope tightly bounds on organic or clay-organic particles in closest

proximity to the metabolically active microorganisms. In the experiments of genetic

transformation of Azotobacter vinelandii by naked eDNA and eDNA adsorbed on

silica and on natural organic matter (NOM) Lu clearly showed detectable increase

in transformation frequency in the last case: from 6*10

−5

for naked eDNA to 2.5*10

−4

for eDNA coupled with NOM (Lu et al. 2010 ) .

Another fact that indicates the signi ﬁ cant role of eDNA in microbial community

functioning is stimulation of eDNA adhesion by low molecular weight organic acids

(Pietramellara et al. 2009 ) , which are known to be one of the general plant exudates.

According to this we could assume that eDNA concentrates within rhizosphere –

the most populated area in soil.

Summarizing all mentioned facts we may propose that eDNA constitutes the big

portion in total soil DNA and concentrates primarily on the soil organic matter in

the vicinity of cites with the highest microbial activity. These conditions seems to

be quite favourable primarily for the “gene transfer”, which naturally occurs in

microbial populations and probably for many other functions that eDNA might play

in soil e.g. the formation of bio ﬁ lms, modulation of the symbiotic (or pathogenic)

relationships between microorganisms, structuring of the soil matrix etc. The par-

ticular role that eDNA plays in regulation and maintaining the life of the soil micro-

bial community is still unrated, but it seems to be signi ﬁ cant.

Unfortunately until now we have much less information about the genetic com-

position of eDNA. There are only a few papers that showed the differences in the

DGGE pro ﬁ les of the microbial community in the total (tDNA) and eDNA (Agnelli

et al. 2004 ; Ceccherini et al. 2009 ) . From these papers the work of Agnelli et al.

( 2004 ) , who analysed DGGE pro ﬁ les from different horizons of forest soil deserves

special attention. It has been shown that, along with a steadily decreasing amount

of total DNA down through the soil pro ﬁ le, the eDNA dynamics was not linear.

The maximum amount of eDNA was detected in humus-reach horizon A2 (60% of

the total DNA), it was two-fold more than in the horizon A1 and a lot more than the

eDNA concentration in the underlying horizons. Also Agneli with co-workers noted

signi ﬁ cant differences in DGGE pro ﬁ les of A1 and A2 horizons: the bands associ-

ated with extracellular DNA were absent in total DNA at the same horizon and vice

versa. At the same time in A2 horizon was discovered two additional intense bands

which were absent in the total DNA in the A2 horizon, but present in the total DNA

of A1 horizon. Additionally the A1 horizon was characterized by a great mismatch

between total and extracellular DNA (only a small percentage of bands associated

with the total DNA extracted from the A1 horizon were present in eDNA). In the

underlying horizons the differences in the pro ﬁ les of eDNA and tDNA were minimal

(Agnelli et al. 2004 ) . This local accumulation of eDNA in A2 could be connected

both with the more active usage of eDNA by microorganisms in the A1 horizon

and what is more likely with vertical migration of eDNA and it enhanced ability to

bind to the humic substances. Thus, the accumulation of soil humic substances is

closely connected with the storage of extracellular DNA, which makes the humus

horizon a zone of intensive concentration of genetic information in soil.

147

7 Recent Advances and Perspectives…

Obviously, the interest in this problem will grow due to its practical and fundamental

importance and future metagenomic studies should make the major contribution to

determine the genetic composition of the eDNA.

3 Spatial Structure of the Soil Metagenome (Microbial

Distribution and Soil Macro- and Micro-morphological

Structure)

The important output for the metagenome research is dissection of the spatial struc-

ture of soil microbial community which is related to the microstructure of soil matrix

and vertical strati ﬁ cation exposed in a number of speci ﬁ ed horizons. The production

of soil aggregates plays a crucial role in many typical soil processes, especially in

degradation of organic matter and formation of humic substances (Chotte 2005 ) . Soil

sciences commonly divide soil aggregates on three groups depending on the their

sizes: microaggregates <0.25 mm, mesoaggregates 0.25–7 (10) mm and macroag-

gregates >7 (10) mm. To investigate the role of microorganisms in maintenance of

soil fertility the special attention must be given to the genesis and composition of the

microbial community within individual aggregate to de ﬁ ne differences microbial

composition in micro, meso and macroaggregates.

The process of aggregate formation is mediated by the closest interaction between

a wealth of different microorganisms and seems to be sequential. In the set of labora-

tory experiments it was shown that fungi and plant roots are mainly involved in the

formation of big aggregates and thus determine the initial stages of the aggregation

process, while bacteria produce smaller aggregates, which are further joined together

by fungi and form an active centre within the soil aggregate (Chotte 2005 ) .

Until now little is known about the taxonomic structure of microbial communities

inhabiting soil microenvironments. There are only few studies that characterized taxo-

nomic diversity of microbial communities in different aggregate fractions (Sessitsch

et al. 2001 ; Davinic et al. 2012 ) and microorganisms living inside and on the surface

of microaggregates (Mummey et al. 2006 ) using different molecular techniques.

Davinic et al. ( 2012 ) was the ﬁ rst who used pyrosequencing in studying micro-

bial composition in three multi-scale soil fractions: macro-(>250 μ m) and micro

(53–250 μ m)- soil aggregates and clay + silt particles (<53 μ m). The composition of

the microbial community, as well as simultaneously measured amounts of available

C and N, of these fractions differed signi ﬁ cantly. Macro-aggregates was character-

ized by high levels of available C and N and primarily contained Actinobacteria ,

Bacteroidetes , Verucomicrobia and δ - Proteobacteria as dominant bacterial divi-

sions. Micro-aggregates showed the lowest levels of biodiversity and were formed

by at least two big groups of bacteria – Rubrobacteriales and Chloro ﬂ exi . Clay-silt

particles cared large number of minor soil phyla such as Nitrospira , OP10, WS3

together with the most abundant soil phyla – Acidobacteria (which corresponds

with the result obtained by Sessitsch et al. 2001 ) and α - Proteobacteria . At the same

time clay-salt particles had the great amount of recalcitrant organic C.

148

E.V. Pershina et al.

Following to the present data macro-aggregate community was in part similar to

the whole bacterial diversity measurements, contrary, two other microenvironments,

especially micro-aggregates, showed unique bacterial pro ﬁ les (Davinic et al. 2012 ) .

It is very important to mention that Mummey and Stahl (

2004 ) also de ﬁ ned

Rubrobacteriales as the dominant group in the inner space of micro-aggregates of

the disturbed (reclaimed) soil, in opposite to the undisturbed soil where the inner-

micro-aggregate environment was populated by distinct groups of Actinobacteria –

Actinobacteridae . Considering that Davinic with co-workers investigated to some

extent extreme arid soil and actinobacteria belonging to the order Rubrobacteriales

is reported to be radiation-tolerant extremophile bacteria this group could serve as a

good predictor of the processes affecting soil health. Mummey and Stahl also

showed that outer micro-aggregate space is largely occupied by Proteobacteria ,

which richness also correlates with the soil status and shows the highest value of

70% in reclaimed soil (Mummey and Stahl

2004 ) . This fact is relative to the general

observation of the increased number of proteobacteria in agricultural soil comparing

with natural soil habitats (Spain et al. 2009 ) . Thus these bacteria could also be the

important indicators of anthropogenic soil treatment.

The aggregate formation studies is valuable not only for agricultural practice but

for understanding the processes of biodegradation of the organic material.

Considering the magisterial way of biodegradation of the plant matter in soil, where

substances obtained on the previous stages are degraded by the microorganisms of

the following levels, the formation of aggregates will be bene ﬁ cial to concentrate

the ﬁ nal products and thus to straighten out the whole process.

The formation of the isolated compartment within the soil aggregate is essential

to offer saving the secretion of exoferments. Soil aggregate can be considered as

speci ﬁ c and highly adaptive structure which is actively organized and maintained by

different microorganisms (Young and Crawford 2004 ) integrated into the smallest

ecological unit of soil microbiome – the aggregate-assosiated microbial community.

The process of its formation somewhat resembles the interactions between fungus

and photosynthetic microorganisms in lichens and tend to be substantially symbiotic.

From all these facts it is reasonable to deduce that the aggregates are not only and

perhaps not so much the structural units of the soil, as the structural units of the soil

microbial community and its metagenome and thus must be put in the focus of close

attention in the future metagenomic studies, especially for the success in functional

metagenomics.

In spite of the apparent necessity in this knowledge (Grundmann and Gourbiere

1999 ; Girvan et al. 2003 ) , and multiple evidences of biodiversity-forming role of

soil texture (Ettema and Wardle

2002 ; Chau et al. 2011 ; Dechesne et al. 2003 ,

Graundmann 2004 ; Nunan et al. 2003 ) there is a substantial lack of micro-scale

studies, particularly in metagenomic approaches. Until now, soil sampling efforts

present one of the most challenging questions of the modern molecular ecology, but

sampling of 1 g of soil from the upper horizon is widely met. Considering all the

given information about spatial structure of soil matrix the value of such mixed

sample is at least questionable.

149

7 Recent Advances and Perspectives…

The aggregate structure of the soil matrix is one of the lowest levels in the

morphological organisation of soils, moving upper we meet another important soil

structures – the soil horizons that along with the differences in composition of

the three types of soil aggregates are the main diagnostic features for the soil

classi ﬁ cation. In this review we concentrate our attention on the most populated soil

humus-accumulative horizon. The process of soil genesis inherently represents

the continuously evolving relationships between plants and microorganisms. The

ﬁ nishing point of this process is formation of two speci ﬁ ed soil environments – the

rhizosphere and humus. These two microbial habitats are closely connected to each

other and de ﬁ ne the fertility of soil, which tends to be one of the most important soil

characteristic. That is why they usually call enormous scienti ﬁ c interest (Kuske

et al.

2002 ; Andreetta et al. 2004 ) . Here we just put the main ideas of these studies.

The rhizospheral microbial community represent the example of direct interactions

between plant and microorganisms mediated mainly by co-production of metabo-

lites to the environment, while humus production represents the example of indirect

interaction between plant and microorganisms. Now, this is generally recognized

that microorganisms are metabolically involved in the production of speci ﬁ c humus

substances (Chotte 2005 ) and that humus can’t only be treated as the product of

biodegradation of plant material.

Thereby, humus horizon is a speci ﬁ c and highly adaptive soil environment both

for plants and microorganisms. Due to its porous structure, humus act as soil

“sponge” accumulating water and other vital substances, it is also serves as reser-

voir of nutrients and vital elements like nitrogen (Voroney 2010 ) . What is very

important in soil management, humus is involved in maintaining the soil structure

preventing the erosion processes. For microorganisms the formation of the humus

horizon seems to be an adaptive response to the existence in heterogeneous, con-

trast, and frequently changing living conditions in soil. Because humus remains to

be very stable environment it is inhabited mainly by the autochthonous microbial

community (Chotte 2005 ) . Relatively big proportion in studies of soil microbial

communities in any case address to humus reach soil layers, but only small propor-

tion of them treat humus-accumulative horizon as spatially and functionally isolated

and continuously developing soil structure. Among them are the studies describing

the microbial community changes along 130-years in the Fagus silvatica forest

chronosequence (Trap et al. 2011 ) . Measuring the great number of macromorpho-

logical characteristics of humus-accumulative horizon formed under the forest of

different stand age classes Trap with co-authors showed signi ﬁ cant changes in the

diversity and activity of fungi and heterotrophic bacteria depending on the humus

type. During the development of forest ecosystem from 15 to 130-years forest mull

humus, characterized by high nutrient cycling gave the way to the moder humus

with high number of recalcitrant substances and increased acidity. Despite of such

unfavourable conditions moder humus was inhabited by more diverse microbial

community. Trap et al. (

2011 ) attributed this phenomenon to the presence of oppor-

tunistic bacteria that uses readably degradable substrates in mull humus and limits

specialist bacteria which are capable to degrade the complex substances. In moder

150

E.V. Pershina et al.

humus the high relative concentration of the recalcitrant substrates forms the selective

pressure that favours the development of slow-growing specialized bacteria (Trap

et al. 2011 ) .

Unfortunately, in spite of the obvious signi ﬁ cance of microbiological studies of

humus-accumulative horizon and its development the research base on this topic is

poor. But the interest to this aspect continuously growing up and there is an example

of resent investigation of microbial community composition in upper soil horizons

(A horizons) and subsurface horizons (B horizons) performed by use of pyrose-

quencing technique (Will et al.

2010 ) . The microbial community in A horizon was

enriched with the high-abundant soil phyla such as Actinobacteria , Bacteroidetes ,

Cyanobacteria , Fibrobacteres , Firmicutes , Spirochaetes , Verrucomicrobia ,

Alphaproteobacteria , Betaproteobacteria , and Gammaproteobacteria , whereas B

horizons were dominated mostly by Acidobacteria and some minor soil phyla e.g.

Chloro ﬂ exi , Gemmatimonadetes , Nitrospira , TM7, and WS3. Interestingly the

microbial composition of upper horizons is quite similar to the composition of

macro-aggregates, at the same time subsurface soil community remains that of the

micro-aggregates and especially clay-silt particles. Mummey et al. ( 2006 ) also

reported Chloro ﬂ exi as inner-microaggregate population, while Bacteroidetes were

distributed mainly on aggregate surfaces (Mummey et al. 2006 ) . These ﬁ ndings join

the microstructure of soil matrix and vertical strati ﬁ cation of soil, separating the

litter (or humus) associated bacteria involved primarily in the ﬁ rst steps of carbon

cycling ( Bacteroidetes , Actinobacteria ) from the bacterial groups associated with

other soil processes such as nitri ﬁ cation ( Nitrospira ), or bacterial groups that are

attracted by microaerophylic or even anaerobic conditions ( Chloro ﬂ exi ,

Acidobacteria ).

We should stress here that analysed soils were characterized by nearly neutral

values of pH (from 6.03 to 7.40) and relatively low water content that, as it will be

shown in the next section, usually lead to the dominance of Proteobacteria and

Actinobacteria instead of Acidobacteria in upper soil horizons (Lauber et al. 2009 ) .

In this case Acidobacteria seems to be “removed” to the deeper soil layers by com-

petition for ecological niches with Proteobacteria more adapted to high pH rates.

4 Global Distribution of Soil Microbial Communities

and Their Response to the Major Environmental

Physicochemical Factors

Application of the molecular techniques for studying bacterial diversity in natural

environment fundamentally altered our traditional taxonomic and ecological concepts,

which were built primarily during the investigation of eukaryotic biodiversity in the

past century. Analysis of the 16S rRNA gene sequences in different regions of the

world, even in 1 g of soil revealed great microbial biodiversity of uncultured micro-

organisms within previously known phyla and opened the way to the discovering of

many previously unknown prokaryotic taxa of higher ranks. Together with low

151

7 Recent Advances and Perspectives…

abundant phyla containing at least some cultivable representatives, molecular ecology

approaches succeed in discovering of Acidobacteria phylum which seems to have

the same environmental characteristics and diverse physiology as it was proposed

for the well-known ubiquitous Proteobacteria (Lee et al.

2008 ) . The most common

soil phyla are (according to their abundance in soil samples): Proteobacteria ,

Acidobacteria , Actinobacteria , Verrucomicrobia , Bacteroidetes , Chloro ﬂ exi ,

Planctomycetes , Gemmatimonadetes and Firmicutes (Jannsen

2006 ) . The ratios

between these phyla could change depending on the environmental conditions

presented in a given soil and sometimes other phyla could be inserted in this list

(such as Nitrospira , Chlamydia and some other low-abundant bacteria highly

specialized to the local environmental conditions). Bacteria belonging to Nitrospira ,

Spirochaetes , TM7, OP10, WS3 etc. are usually considered to be minor soil phyla

(Podar et al. 2007 ) . Despite of mentioning at least nine phyla of soil abundant

bacteria, practically four phyla ( Proteobacteria , Acidobacteria , Actinobacteria and

Bacteroidetes ) form the great majority of bacteria inhabiting any kind of soil, these

groups could comprise sometimes up to 90% of overall biodiversity in the environ-

ment (Tsai et al. 2009 ) .

Making the description of global distribution of different groups of bacteria in

soil we should address to the problem of bias occurring in molecular studies. The

ﬁ rst source of the mistakes in measuring microbial diversity in soils is unequal

number of studies of upper and deeper soil horizons with the signi ﬁ cant superiority

of the ﬁ rst; the second is PCR induced bias, which causes a disproportion in detect-

able bacteria phyla due to the sequence-primer mismatches. These theses were

illustrated by Bergmann et al. ( 2011 ) in studies of the subsurface soil environ-

ments. Using taxon-speci ﬁ c primers for the phylum Verrucomicrobia , they showed

that the proportion of these microorganisms had been underestimated in previous

studies and could in fact comprise up to 23% of overall community composition

(Bergmann et al. 2011 ) . Finally, the relative abundance of several bacterial phyla

could be in ﬂ uenced by the DNA extraction bias. By making repeating extractions

of soil DNA from the soils which differed in clay, sand and organic composition,

Feinstein with co-workers showed a dominance of Acidobacteria , Gemmati-

monadetes and Verrucomicrobia in the ﬁ rst (mild) extracts, while Proteobacteria

and Actinobacteria were dominant in samples obtained from the sixth extraction

(Feinstein et al. 2009 ) .

In exceptional cases the Firmicutes can be added to the “big four”. This happens,

for example, in saline ecosystems, such as coasts of salt lakes, where Firmicutes

“takes the place” of Acidobacteria or Actinobacteria. And as a gradient of salinity

decreases the last two bacterial phyla reobtain their dominant position. These data

from our last studies corresponds well with other investigations of saline soils

(Hollister et al.

2010 ) . Considering these facts one could suggest that there should

be a strictly limited number of ecological factors that may in ﬂ uence the phyloge-

netic diversity of bacteria on the phylum level.

This idea was profoundly developed by Fierer and Lauber in a number of studies

(Fierer and Jackson 2006 ; Fierer et al. 2007 ; Lauber et al. 2008, 2009 ) , where they

tried to ﬁ nd the main patterns of bacterial distribution in soils with the broad range

152

E.V. Pershina et al.

of physical and geographical characteristics. The principal possibility of these studies

was largely supplied by the improved molecular new generation techniques (Roesch

et al. 2007 ) which provided simultaneous and rapid analysis of as much soil samples

as it was needed for the nearly complete description of the microbial community

changes induced by action of a given ecological factor. Now, we can summarize

data from these studies and make an effort to determine the major soil biodiversity-

forming factors.

Recently, primarily by using pyrosequencing techniques compiled with factor

analysis, a plenty of soil characteristics such as soil pH, texture, vegetation, amount

of acceptable C etc. were tested in their ability to in ﬂ uence soil biodiversity (Brockett

et al.

2012 ; Singh et al. 2009b ; Castro et al. 2010 ; King et al. 2010 ; Lauber et al.

2008 ) . Among them at least two widespread factors – soil pH and soil water content

were proposed to be most important for soil microorganisms (Bru et al. 2011 ;

Lauber et al. 2009 ) .

Soil pH strongly in ﬂ uences the relative abundance of two main soil phyla:

Acidobacteria is favoured with the acidic values of soil pH, whereas Proteobacteria

dominates at neutral or alkaline conditions (Lauber et al. 2009 ; Fierer and Jackson

2006 ) .

Soil water content determines the abundance of Actinobacteria , which reaches

its maximum value in arid soils (Connon et al. 2007 ; Brockett et al. 2012 ; Chowdhury

et al. 2009 ; Gomez-Silva et al. 2008 ) . This fact seems to be obvious due to certain

resistance of this group to the drought conditions. But the substantial impact of

water content to microbial diversity may be caused not only by the dominance of

ecologically adapted actinobacteria but also by the spatial reorganization of micro-

bial community. It is worth to mention here the studies addressed to in ﬂ uence of the

soil texture on the microbial community composition (Carson et al. 2010 ; Chau

et al. 2011 ) . During the comparison of clay and sandy-reach soils, it was postulated

that soil texture as well as soil water content determined the connectivity between

microhabitats. Weak connectivity promotes the increase of biodiversity levels and

vice versa (Torsvik and Ovreas 2002 ) . Thus the highest levels of microbial diversity

were detected in the sandy soils, in the contrast to the clay-based environments

(Chau et al. 2011 ) .

Surprisingly, soil biodiversity was not (or less) in ﬂ uenced by such factors as

geographical location, latitude, temperature and vegetation that usually are very

important in modelling the diversity of plants and animals (Bru et al. 2011 ;

Chong et al. 2012 ; Fierer and Jackson 2006 ) . This was proved by the investigation

of antarctic soils and soils from high mountains (Chu et al. 2010 ; King et al.

2010 ) . Despite of the extreme nature of these habitats it was shown that microbial

composition there was generally the same as in the typical soil of temperate

region. Investigating bacterial diversity in Colorado Mountains King tried to ﬁ nd

spatial patterns in distribution of the dominant bacterial taxa and found the most

powerful factors that might form bacterial diversity – these were pH, plant abun-

dance and snow depth. These factors determined the presence and proportion of

the four most abundant orders: Rhodospirillales , Rhizobiales , Acidobacteria G4

and Saprospirales . The ﬁ rst two orders showed high correlation with the density

153

7 Recent Advances and Perspectives…

of vegetation: Rhizobiales was mostly associated with different plants (as they

also do in Antarctic soils (Chu et al. 2010 ) and virtually in all types of soils all

over the world) whereas phototrophic Rhodospirillales dominated exclusively in

the areas with poor vegetation. Interestingly, Rhodospirillales was reported pre-

viously to appear in the marine environments and also was among dominant

groups, discussed in the studies of the terrestrial saline sites (Hollister et al.

2010 ) . Practically the same results were obtained by Bru et al. ( 2011 ) during the

studies of bacterial and archaeal communities involved in N-cycling. It was

shown that among ﬁ ve categories of environmental factors such as spatial distri-

bution, land use, climate, soil physics and soil chemistry the last factor (espe-

cially soil pH) played the main role in prediction of bacterial abundance. On the

second place Bru et al. ( 2011 ) put the land use category, while the role of the

climate changes or geographical location was minimal (Bru et al. 2011 ) . Authors

also showed latitude-dependent variability in microbial communities with the

predominance of bacterial diversity in north regions comparing to the south soils.

They associated these differences with the soil parent material (reported to be a

strong factor in determination of bacterial distribution) which was formed by

limestone in the north and crystalline rocks in the south. Besides, there was one

group of bacteria (ammonia oxidizers) that possessed unique pattern of abun-

dance, which wasn’t triggered by soil chemistry (Bru et al. 2011 ) . So, to estimate

the bacterial global distribution, it is important to assess not only the total biodi-

versity, but also the distribution of the main functional groups of microorgan-

isms. Thus, this study, giving the suggestion to at least 43–85% of variables in

bacterial community distribution (Bru et al. 2011 ) , was the ﬁ rst to stress clearly

the importance of geostatistical methods in microbial ecology.

A widespread distribution of bacterial taxons not even on the order level but also

on bacterial genera level seems to be the most important ecological characteristic of

microbial communities. If we compare differences in taxonomic structure among

two different soils (for example, Waseca farm soil and rain forest soil from Puerto

Rico, available at MG-RAST website: http://metagenomics.anl.gov/metagenomics.

cgi?page=Home ) we will ﬁ nd that there are too few differences in the number of

observed taxons among them. The differences between high Andean soil and Waseca

farm soil or rain forest soil are much more signi ﬁ cant, but the tendency in the pres-

ence of the same taxa in these extremely different environments (especially in the

phyla Proteobacteria and Acidobacteria ) is saved, in the contrast to the Eukaryotic

community portrait of these habitats which becomes more and more individual

when moving from the typical to xtreme soils. More than that, comparing a great

number of extreme soil habitats one could ﬁ nd that there are a lot of omnipres-

ent microorganisms, and the champions among them are bacterial genera

Pseudo monas ( Gammaproteobacteria ), Arthrobacter ( Actinobacteria ),

Sphingomonas ( Alphaproteobacteria ), Bacillus ( Firmicutes ), Rhodococcus

( Actinobacteria ), Flavobacterium ( Bacteroidetes ) and some others (Lucas et al.

2008 ; Wagner 2008 ; Ruberto et al. 2008 ). All these bacteria tend to be the most

common members of the soil microbial communities all over the world, exhibiting

the highest levels of functional diversity.

154

E.V. Pershina et al.

5 Main Outputs from the Modern Studies

of the Soil Metagenome

The topic pointed in the name of this section is the most popular among soil

microbiologists and was reviewed many times (Raes et al. 2007 ; Hirsch et al.

2010 ; Rondon et al. 2000 ; Simon and Daniel 2011 ; Handelsman 2004 ; Daniel

2005 ) . The main successes as well as the main problems of soil metagenome

analysis were discussed in detail as well. Here we just put the general questions

and give some idea for the future research.

The ﬁ rst “hot spot” to discuss is the size of soil metagenome. According to Vogel

et al. ( 2009 ) there is as much as 1,000 Gbp of genetic information presented in 1 g

of soil, which is about three orders of magnitude greater than in the more or less

completely studied environments such as Sargasso Sea or Acid mine drainage

(Vogel et al. 2009 ) . It is also important to note that members of microbial commu-

nity have different relative abundances with low number of dominant bacteria and a

plenty of low-populated groups. Tringe and co-workers ( 2005 ) reported that during

the investigation of soil metagenomic library, they obtained totally 150,000 reads

and it was enough to get overlapping sequences in less than 1% of cases. Authors

also predicted that eightfold coverage (the traditional number in genome assembly

procedures) of at least one genome belonging to the most abundant species requires

from 2 to 5 billions bp of sequence (Tringe et. al. 2005 ) . And it will be necessary to

analyse as much as 2 million clones to get more or less full information about

genomes of all members of microbial community (Singh et al. 2009a ) . Considering

the maximal volume of reads which could be obtained using the most resent sequenc-

ing machines built by Illumina or Applied Biosystems and estimated in average as

100Gb per run, sequencing of the whole soil metagenome seems to be very compli-

cated and probably even unsolvable problem. That is the reason why modern soil

metagenomic studies tend to result in complete (usually near-complete) investigation

of at least one or two dominant species.

The second problem arises due to some technical restrictions and, in turn, is

closely connected with the peculiarities of soil metagenome. It is the problem of

assemblage of the whole bacterial genomes or even parts of genomes from the raw

sequencing reads. The metadata processing includes a number of consequent steps,

starting with assemblage of sequences to contigs and following by gene “calling”

and gene “binning” procedures, which ﬁ nally bind sequences to the phylogenetic

groups (Kunin et al. 2008 ; Wooley and Ye 2009 ) . Today, assemblage seems to be the

most complicated and ambiguous procedure due to several reasons. The ﬁ rst is still

short length of sequencing reads, produced by the most precise sequencing machines,

the second is lack of repeated sequencing reads that minimizes the accuracy of the

analysis, and in the case of soil metagenome it leads to the practically total absence

of overlapping sequences (Chaisson and Pevzner 2008 ) . These reasons, together

with the presence of polymeric repeats and accidence of horizontal gene transfer

between unrelated groups of microorganisms, lead to the imperfect and sometimes

chimeric assemblages (Chaisson and Pevzner 2008 ; Kunin et al. 2008 ) . But probably

155

7 Recent Advances and Perspectives…

the main failure of assemblage procedures is inability to reconstruct complete

bacterial genomes. So, entirely all modern internet resources such as CARMA

(Gerlach et al. 2009 ) or MG-RAST (Meyer et al. 2008 ) or the most popular program

for metadata processing – MEGAN (Huson et al.

2007 ) operate with single genes,

more rarely with sequences containing multiple genes, and practically never with

genomes.

The last problem to mention is the problem of “binning” nucleotide sequences

to the speci ﬁ c phylogenetic groups, which origins from the biased and incomplete

databases (Kunin et al.

2008 ) . This problem again seems to be the most important

in the case of soil, which has the lowest number of genes with known function,

while the majority of sequences form the soil “black box” (Mocali and Benedetti

2010 ) . It seems to be true that precisely these genes are involved in integration

processes such as adhesion, bio ﬁ lm formation, signalling etc. According to their

speci ﬁ city to soil components (adhesion) or to the speci ﬁ c partner (symbiotic

genes) they were poorly studied as well as deposited in the databases. But these

genes in particular should be put on the forefront to discover the most fundamental

soil integrative processes such as aggregates formation, synthesis/degradation of

the speci ﬁ c humic substances etc.

Functional-based approaches (Lämmle et al. 2010 ; Lorenz et al. 2003 ; Voget

et al. 2003 ; Demanéche et al. 2009 ; Daniel 2004 ) are called to solve these mis-

matches. Lombard with co-workers described the main outputs in this ﬁ eld of

metagenomics and determined the main classes of environmental gene products

that attract special interest in the soil – these are broad range of enzymes and

antibiotics, gene products involved in bioremediation, as well as in common bio-

synthetic and catabolic pathways (Lorenz et al. 2002 ) . Studies of soil functional

genes revealed some principally new applications for industry and medicine such

as lactonase family proteins that tend to decrease bio ﬁ lm formation by pathogenic

Pseudomonas aeruginosa (Schipper et al. 2009 ) , anticancer drug production

(Pettit 2004 ) and some others (Lorenz et al. 2002 ) .

Still the unsolved problems of functional analysis are low number of clones con-

taining the gene of interest and restricted number of expression systems that don’t

ﬁ t the enormous biodiversity of functions present in soil (Wexler and Johnston

2010 ) . Interesting ﬁ ndings were obtained by Craig et al. ( 2010 ) , it was shown that

expression of genes from the same metagenomic library in different host proteobac-

teria results in different range of gene products (Craig et al. 2010 ) . Moreover, it is

reasonable to deduce that gene expression will be different if single bacteria host

strains and in multispecies (e.g. sin-trophic) systems. During the investigation of

organization of soil microbial communities a large data was compiled, which proves

that microorganisms exist in soil primarily in metabolically and genetically inte-

grated associations (Garbeva and de Boer

2009 ; Schink 2002 ) . The last experiments

in co-cultivation of microorganisms performed by Burmølle et al. 2009 revealed the

signi ﬁ cant increase in culturability of soil bacteria while plating with model strains

such as Pseudomonas putida and Arthrobacter globiformis . In the ﬁ rst case gram

negative pseudomonades stimulate growth of colonies of different gram-positive

bacteria belonging to the class Bacilli , while gram-positive Arthrobacter stimulates

156

E.V. Pershina et al.

primarily gram-negative bacteria such as Proteobacteria and Bacteroidetes

(Burmølle et al. 2009 ) . Thus growth and the main physiological features of soil

bacteria are highly variable and apparently require building the speci ﬁ c gene expres-

sion systems for the investigation of functional diversity in a given soil. While

describing the global distribution of the soil microbial communities (see Sect.

4 ) we

pointed that soil taxonomic diversity is restricted to the presence of only few bacte-

rial phyla, with prevalence of Proteobacteria and Acidobacteria . Creating the effec-

tive expression systems one must rely greatly on the taxonomic composition of the

microbial community to choose the most appropriate hosts for each type of soil.

It might help to intensify ﬁ ndings of new gene products. In this aspect the develop-

ment of new cultivation techniques to investigate uncultured microorganisms such

as ﬂ uorescence-activated cell sorting, FACS proposed by Zengler with co-workers

(

2002 ) seems to be very promising. Studying the uncultivable Acidobacteria , as the

second after proteobacteria most widespread bacterial phyla is of profound impor-

tance in having a glance on a hidden soil functions (Lee and Cho 2009 ) .

Sequence and functional based studies contribute to the systematic view on soil

metagenome that tends to be the main goal of existing metagenomic projects. There

are currently three major consortia – Microbial Genomics Program, speci ﬁ cally the

section MEP (Microbial Earth Project) sited on http://genome.jgi.doe.gov/programs/

bacteria-archaea/MEP/index.jsf , EMP (Earth Microbiome project) ( http://www.earth-

microbiome.org/ ), which respectively have sections devoted to soil metagenome. And a

special project, directed exclusively to the study of soil microcosm – the TerraGenome

(Vogel et al. 2009 ) . Among the main goals of TerraGenome project are identi ﬁ cation

of new prokaryotic producers of biocatalysts, microorganisms involved in bioreme-

diation and other substantial soil processes. The subject of the investigation is the

Park Grass at Rothamsted, UK – an internationally recognized agroecology ﬁ eld

experiment that has been running for more than 150 years (Vogel et al. 2009 ) .

TerraGenome was called mostly to join the forces of international community of

soil microbiologists; but immediately after announcement came under criticism

(Baveye 2009 ; Singh et al. 2009a ) mainly due to the problems associated with the

analysis of metagenomic data, which were brie ﬂ y discussed above.

After the last decade, that was greatly optimistic in adapting metagenomic sur-

veys to almost all natural environments (Gilbert and Dupont 2011 ; Riesenfeld et al.

2004 ; Gill et al. 2006 ) , many scientists came to understanding of the importance of

traditional methods, like cultivation or 16S rRNA gene pro ﬁ ling and gained the

qualitatively new level of the “way back” (Tyson and Ban ﬁ eld 2005 ; Kakirde et al.

2010 ; Lombard et al. 2011 ; Forney et al. 2004 ; Tringe and Hugenholtz 2009 ) .

The latest reviews made by Lombard et al. (

2011 ) and Kakirde et al. ( 2010 ) referred

soil metagenome researchers to the analysis of more simple ecosystems such as micro-

aggregates (Kakirde et al. 2010 ; Lombard et al. 2011 ) and extreme soils (Lombard

et al. 2011 ) . The authors point out the exceptional value of studying the microbio-

logical component in relation to soil texture and vertical strati ﬁ cation. But not only

these approaches could substantially decrease the value of the soil metagenome analy-

sed at a time. The separation of the ﬁ ve previously described (see Sect. 2 ) sources of

environmental DNA could contribute greatly to the future metagenomic surveys

157

7 Recent Advances and Perspectives…

making the procedure of analysis not even simpler but more precise. Inattention to

these problems induced great complexity in databases and associated computational

studies (Bietz and Lee 2009 ) , which became forced to work with enormous amounts

of information not even enriched with any biological sense. All mentioned perspec-

tives require integration of specialists from many scienti ﬁ c ﬁ elds not only from biol-

ogy and bioinformatics but especially from the soil sciences. It is worth recalling here

the strong system of characterization of soil microstructure as well as soil vertical

strati ﬁ cation that was made during the development of soil sciences and led to speci ﬁ c

understanding of soil as a unique “natural body” that might have structural and func-

tional modules (Young and Crawford

2004 ) .

Together with rising interest to the investigation of soil on discrete micro-scale

levels a noticeable tendency appears in intensi ﬁ cation of 16S rRNA-based approaches

(Roesch et al. 2007 ; Steven et al. 2012 ) , primarily in the studies of global and local

distribution of soil microorganisms (Fierer and Jackson 2006 ; Bru et al. 2011 ) . Despite

of probably the main drawback of these studies – the bias associated with choosing

speci ﬁ c primers for ampli ﬁ cation – 16S rRNA studies have essential bene ﬁ ts and until

now serve as the main source of information on community structural and even func-

tional diversity (Tringe and Hugenholtz 2009 ) .

6 Concluding Remarks and Opening Perspectives

in Soil Metagenomics

This review was initiated due to the growing understanding of the uniqueness of soil

metagenomics in comparison to data from the other environments. We were trying

to understand the main features of soil microbial community in order to identify key

areas for the further research of its metagenome.

The ﬁ rst most obvious problem that differ soil from the other environments is

enormous size of metagenome, which inevitably led researchers to the necessity of

dividing it into some reasonable parts. Here metagenomics should move into close

contact with soil science to accept already existent strict system for describing soil

micro- and macro-structure. This interdisciplinary partnership is maintaining

increasingly, and now we have some examples of bene ﬁ cial combinations of pedo-

logical and molecular techniques (Young and Crawford 2004 ; Mummey et al. 2006 ;

Eickhorst and Tippkötter 2008 ; Ceccherini et al. 2007 ) . Particularly, Eickhorst and

Tippkötter ( 2008 ) combined standard FISH techniques for visualising bacteria in

their natural environment with micropedological technology of ultrathin dissections

of soil matrix. Thus they have obtained the noise-free images of microbial colonies

and determined their spatial distribution within soil microenvironments (Eickhorst

and Tippkötter

2008 ) . The microbial composition associated with different types of

soil aggregates as well as studies of horizon-speci ﬁ c microbiota also induced a great

interest and recently was supplied with modern sequencing techniques (Davinic

et al. 2012 ; Will et al. 2010 ) .

158

E.V. Pershina et al.

Another important issue was discovery of the great pool of extracellular DNA,

persisting for a long time in stable complexes with different soil substances and in

some cases forming up to 60% of the total soil DNA (Agnelli et al. 2004 ) . The

exclusive role of eDNA in microbial community functioning was proved by the

studies of the natural genetic transformation in different groups of soil bacteria (Lu

et al.

2010 ; Nielsen et al. 2007 ; Mercier et al. 2006 ) . These ﬁ ndings highlighted the

exceptional role of HGT among other biodiversity-forming factors particularly in

soil ecosystem.

Finally, there is a growing body of research evaluating the contribution of different

environmental factors to the global distribution of bacterial taxa. These studies

revealed the priority of edaphic factors such as pH (Lauber et al. 2009 ) and humidity

(Brockett et al. 2012 ) as well as soil texture (Carson et al. 2010 ; Girvan et al. 2003 )

in regulation of soil microbial diversity. Such factors as vegetation, land use, climate

and some others were considered to have lesser in ﬂ uence on microbial community

composition. The most intriguing feature of soil microbial communities was their

suf ﬁ cient independence from such traditional global characteristics as landscape

and latitude. Thus, in contrast to eukaryotic organisms, microbial community of

tropical soils was characterized by relatively low levels of biodiversity (apparently

due to under-developed humus horizon) than the community of the temperate zone,

which in turn does not differ much from the communities of polar regions such as

antarctic soils (Chu et al. 2010 ) .

Despite of signi ﬁ cant progress in the application of geostatistical methods in the

studies of microbial communities, scientists have failed to de ﬁ ne a core set of bio-

diversity-forming factors. Perhaps this happened due to the multiple interactions

between described ecological factors in their in ﬂ uence on the soil metagenome. For

example, the soil texture (which along with the previously listed factors is one of the

most powerful determinants of biodiversity), interacts with the moisture and with

the soil nutrient status (Girvan et al. 2003 ) . At the same time, the value of soil pH

depends greatly on vegetation and land use strategies (Lauber et al. 2008 ) . Therefore,

further studies require precise determination and diversi ﬁ cation of the major and

minor biodiversity-shaping factors that respectively have strong or mild effects on

the structure of soil microbial communities.

Nevertheless, even on the basis of existing data it can be concluded that there are

a number of “architectural types” of microbial community organisation (and corre-

sponding taxonomic structures of metagenome) de ﬁ ned by several strong edaphic

factors such as pH and moisture (either could be treated as water potential that seems

to be more physiologically signi ﬁ cant characteristic). According to pH values, micro-

bial community could be divided into two architectural types – the one with the

dominance of Proteobacteria (neutral or alkaline conditions), and another one with

prevalence of Acidobacteria (sites with low pH values). The situation around mois-

ture is not as clear as for soil pH, but it was proved many times that the arid habitats

was dominated by phylum Actinobacteria (Connon et al.

2007 ; Brockett et al. 2012 ) ,

contrary sites with increase moisture rates were populated mostly by Firmicutes ,

Bacteroidetes . In the mentioned article the majority of Firmicutes and Bacteroidetes

was found in the shore of saline lakes in US (Hollister et al. 2010 ) , but, as it was

159

7 Recent Advances and Perspectives…

noted by the authors themselves, salinity probably is not the main factor determining

the structure of the microbial community in this area, because the biggest correlation

in performed statistical analysis was found for soil moisture and organic C content

(Hollister et al.

2010 ) . Recently we have obtained practically the same results during

the investigation of salt lake shore in Kazakhstan (Pershina et al. 2012 ) .

“Architectural types”, in turn include a number of “functional modules”, charac-

terizing tradeoffs between taxonomic and functional structures of metagenome.

These functional modules could be related to the speci ﬁ c taxa, or could be spread

among different groups of microorganisms. The last is caused by the paradox nature

of bacterial taxa, as well as developed role of horizontal gene transfer in microbial

populations, which together result in the existence of “common” pool of genes that

may be at a time carried by phylogenetically unrelated groups of microorganisms.

The process of denitri ﬁ cation is one of the examples. The ability of nitrate reduction

is common for many typical soil bacteria such as Pseudomonas and Bacillus . This

process is multistep and includes several consequent stages, which involve a number

of genes that can persist in the genomes of taxonomically different but metaboli-

cally interchangeable microorganisms (Ettema and Wardle

2002 ) .

As an example of taxon-speci ﬁ c functional modules we may call the processes

of nitri ﬁ cation, or symbiotic nitrogen ﬁ xation which genes are presented in the

genomes of the strictly limited range of soil bacteria. For the ﬁ rst process it was

shown that phylogeny constructed on the basis of the amoA gene sequences was

practically the same with 16S rRNA based phylogeny (Ettema and Wardle 2002 ) .

The second fact is partly proved by the investigation of the arid soil, where the

dominance of Actinobacteria and Acidobacteria were noted. In spite of the known

ability of some actinobacteria species to ﬁ x nitrogen this process was delegated not

for the dominant species but for the well-known groups of proteobacteria such as

Rhizobium , Pseudomonas and Azospirillum , which usually formed a minor part of

the microbial community (Chowdhury et al. 2009 ) .

From these two examples as well as from the data presented for extreme soils in

Sect. 4 (Gomez-Silva et al. 2008 ; Wagner 2008 ; Lucas et al. 2008), we could guess

that there are truly ubiquitious bacterial genera in soils, which show unprecedented

physiological adaptation. The most probable sources of this adaptation are “labile”,

highly variable nature of bacterial genomes, coupled with the large pool of entire

genetic information, stored in soil (eDNA). In this respect the most abundant soil

bacterial phyla Proteobacteria reveals an example of evolutionary young and to

greatest extent “paradoxal” bacterial taxon with the most variable genomes within

single species (Ussery et al. 2009 ; Spain et al. 2009 ) .

The other source of the enormous ecological potential of soil bacteria may be

represented by microbial co-operation. It can be classi ﬁ ed as a “protective symbiosis”

between dominant (e.g. acidity-resistant soil Acidobacteria ) and some specialized

groups of microorganisms, that for example might arose during the formation of

aggregates with more or less stable inner space.

Establishment of the correlation between “architectural models” of microbial

community, and their constituent “functional modules” represent the fundamental

goal of soil metagenomics.

160

E.V. Pershina et al.

Beside, by analogy with the genomes of individual species of microorganisms

(Ussery et al. 2009 ) , metagenome may contain the “core” and “accessory” parts

(core and pan-metagenome). Obviously, it is impossible to determine the composi-

tion of these parts, without an exhaustive comparison procedure performed for

at least two metagenomes. Therefore, at present time we can only speculate about

what genes are “common” for the communities of different soils, and which are

speci ﬁ c to a particular soil.

As it was revealed from the comparison of soil metagenomes deposited to

MG-RAST server, the taxonomic composition of seemingly unrelated Waseca farm

soil and rain forest soil from Puerto Rico (see Sect.

4 ) appeared to be very similar,

even at the genus level. The same can be said about the functional diversity of these

two metagenomes. This tells us that all the discovered functions belong to the “core

metagenome”. Then, what genes can constitute the accessory part of the soil meta-

genome and thereby can reveal the main differences between soils types? As noted

in the study made by Tringe and co-workers ( 2005 ) the soil metagenome, in contrast

to metagenomes from other habitats is characterized by the wide variety of genes

associated with processes involved in genomic variability and particularly in HGT

(Tringe et al. 2005 ) . Because of the immense value of these genes in the processes

of integration and ecological maintenance of the soil microbial communities one

could expect the high levels of genetic diversity among them. Apparently, this is the

particular group of genes that could be joined to the main biodiversity-forming

factors. For example, the HGT between active soil bacteria could be an example of

spatial integration of soil communities, while external DNA uptake (e.g. genetic

transformation by eDNA) could contribute to even more signi ﬁ cant process of tem-

poral integration of soil communities (DNA remaining in the soil from the previous

generation of microorganisms can “come alive” in the cells of living bacteria).

Other candidates for the role of “soil-speci ﬁ c” genes may be genes that provide

above-described processes of microbial co-operation and formation of stable inter-

species relationships. The facts revealing the exceptional importance of “interspe-

cies dialog” in life of microbial community was reviewed many times (Burmølle

et al. 2006 ; Schink 2002 ) and partly discussed in Sects. 2 and 3 . Integration of

individual organisms as well as their genomes can be made by genes involved in

interspecies and intraspecies signalling, speci ﬁ c adhesion, etc., which are still

poorly represented in soil libraries, because of signi ﬁ cant prevalence of studies on

pure cultures instead of multispecies systems of soil microorganisms. The main

task for the future research here is to increase the knowledge about these genes by

developing co-cultivation techniques, which undoubtedly will increase the percent

of uncultured microorganisms, such as for example, Acidobacteria that undergo

cultivation (Janssen et al.

2002 )

Apparently, these genes together with a number of genes associated with adapta-

tion to the major edaphic (pH, humidity) or structural (texture) factors, belong to the

accessory part of soil metagenome, and may form the frame for identi ﬁ cation of the

main types of organization (or “architectural models”) of soil microbial communities.

These types are not numerous and represent something like “plans of construction”

that are built on the basis of practically one or two bacterial phyla, among them are

161

7 Recent Advances and Perspectives…

ﬁ rst of all Proteobacteria , Acidobacteria and Actinobacteria followed by less

abundant Bacteroidetes , Firmicutes .

In summary, our review suggests that soil metagenome represents the integral

genetic system, which possesses more or less labile taxonomic structure combined

with a conservative functional structure. The metagenomic analysis may be used to

reveal the adaptive processes in soil ecosystems based mostly on reformatting the

phylogenetic composition of soil community and on the re-assortment of the eco-

logically important genes among different microbial genotypes. Following A.P.

Kostychev who considered the soil as a biological system based mostly on the activ-

ities of resident microbial communities (Kostychev

1937 ) , one can address the

metagenomes of these communities as the hereditary systems of soil microbial

communities, and of soil itself, responsible for the sustainability (reproducibility) of

its basic functions including fertility, as well as for the evolutionary potential and

maintenance of the global genetic resources in the soil ecosystem.

References

Agnelli A, Ascherb J, Cortia G, Ceccherini MT, Nannipieri P, Pietramellara G (2004) Distribution

of microbial communities in a forest soil pro ﬁ le investigated by microbial biomass, soil respi-

ration and DGGE of total and extracellular DNA. Soil Biol Biochem 36:859–868

Andreetta A, Macci C, Ceccherini MT, Cecchini G, Masciandaro G, Pietramellara G, Carnicelli S

(2004) Microbial dynamics in Mediterranean Moder humus. Biol Fertil Soils 48:259–270

Ascher J, Ceccherini MT, Nannipieri P, Pietramellara G (2005) Extracellular DNA rise up in soil

by water capillarity. Geophys Res Abstr 7:07946

Bakken L, Frostegård Ǻ (2006) Nucleic acid extraction from soil. In: Nannipieri P, Smalla K (eds)

Nucleic acids and proteins in soil. Springer, Berlin

Baveye PC (2009) To sequence or not to sequence the whole-soil metagenome? Nat Rev Microbiol

7(10):756

Bent SJ, Forney LJ (2008) The tragedy of the uncommon: understanding limitations in the analysis

of microbial diversity. ISME 2:689–695

Bergmann GT, Bates ST, Eilers KG, Lauber CL, Caporaso JG, Walters WA, Knight R, Fierer N

(2011) The under-recognized dominance of Verrucomicrobia in soil bacterial communities.

Soil Biol Biochem 43:1450–1455

Bietz MJ, Lee CP (2009) Collaboration in metagenomics: sequence databases and the organization

of scienti ﬁ c work. In: Balka E, Ciol ﬁ L, Simone C, Tellioğlu H, Wagner I (eds) ECSCW 2009:

Proceedings of the 11th European conference on computer supported cooperative work.

Springer, London

Böckelmann U, Lünsdorf H, Szewzyk U (2007) The detection of extracellular DNA as a structural

component in the EPS of bacterial strains. Geophys Res Abstr 9:01325

Brockett BFT, Prescott CE, Grayston SJ (2012) Soil moisture is the major factor in ﬂ uencing

microbial community structure and enzyme activities across seven biogeoclimatic zones in

Western Canada. Soil Biol Biochem 44:9–20

Bru D, Ramette A, Saby NP, Dequiedt S, Ranjard L, Jolivet C, Arrouays D, Philippot L (2011)

Determinants of the distribution of nitrogen-cycling microbial communities at the landscape

scale. ISME J 5:532–542

Bürgmann H, Pesaro M, Widmer F, Zeyer J (2001) A strategy for optimizing quality and quantity

of DNA extracted from soil. J Microbiol Methods 45:7–20

162

E.V. Pershina et al.

Burmølle M, Hansen LH, Sørensen SJ (2006) Reporter gene technology in soil ecology: detection

of bioavailability and microbial interactions. In: Nannipieri P, Smalla K (eds) Nucleic acids and

proteins in soil. Springer, Berlin

Burmølle M, Johnsen K, Abu Al-Soud W, Hansen LH, Sørensen SJ (2009) The presence of

embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria.

J Microbiol Methods 79:166–173

Cai P, Huang Q, Zhang X (2006) Interactions of DNA with clay minerals and soil colloidal parti-

cles and protection against degradation by DNase. Environ Sci Technol 40:2971–2976

Carson JK, Gonzalez-Quiñones V, Murphy DV, Hinz C, Shaw JA, Gleeson DB (2010) Low pore

connectivity increases bacterial diversity in soil. Appl Environ Microbiol 76:3936–3942

Castro HF, Classen AT, Austin EE, Norby RJ, Schadt CW (2010) Soil microbial community responses

to multiple experimental climate change drivers. Appl Environ Microbiol 76:999–1007

Ceccherini MT, Aschera J, Pietramellara G, Vogel TM, Nannipieri P (2007) Vertical advection of

extracellular DNA by water capillarity in soil columns. Soil Biol Biochem 39:158–163

Ceccherini MT, Ascher J, Agnelli A, Borgogni F, Pantani OL, Pietramellara G (2009) Experimental

discrimination and molecular characterization of the extracellular soil DNA fraction. Antonie

Van Leeuwenhoek 96:653–657

Chaisson MJ, Pevzner PA (2008) Short read fragment assembly of bacterial genomes. Genome

Res 18:324–330

Chau JF, Bagtzoglou AC, Willig MR (2011) The effect of soil texture on richness and diversity of

bacterial communities. Environ Forensics 12:333–341

Chiang W, Tolker-Nielsen T (2010) Extracellular DNA as matrix component in microbial bio ﬁ lms.

In: Kikuchi Y, Rykova EY (eds) Extracellular nucleic acids. Springer, Berlin

Chong CW, Pearce DA, Convey P, Yew WS, Tan IKP (2012) Patterns in the distribution of soil bacte-

rial 16S rRNA gene sequences from different regions of Antarctica. Geoderma 181–182:45–55

Chotte J (2005) Importance of microorganisms for soil aggregation. In: Buscot F, Varma A (eds)

Microorganisms in soils: roles in genesis and functions. Springer, Berlin

Chowdhury SP, Schmid M, Hartmann A, Tripathi AK (2009) Diversity of 16S-rRNA and nif H

genes derived from rhizosphere soil and roots of an endemic drought tolerant grass, Lasiurus

sindicus . Eur J Soil Biol 45:114–122

Chu H, Fierer N, Lauber CL, Caporaso JG, Knight R, Grogan P (2010) Soil bacterial diversity in

the Arctic is not fundamentally different from that found in other biomes. Environ Microbiol

12:2998–3006

Connon SA, Lester ED, Shafaat HS, Obenhuber DC, Ponce A (2007) Bacterial diversity in hyper-

arid Atacama Desert soils. J Geophys Res 112:G04S17. doi:

10.1029/2006JG000311

Craig JW, Chang F, Kim JH, Obiajulu SC, Brady SF (2010) Expanding small-molecule functional

metagenomics through parallel screening of broad-host-range cosmid environmental DNA

libraries in diverse Proteobacteria . Appl Environ Microbiol 76(5):1633–1641. doi:

10.1128/

AEM.02169-09

Daniel R (2004) The soil metagenome – a rich resource for the discovery of novel natural products.

Curr Opin Biotechnol 15:199–204

Daniel R (2005) The metagenomics of soil. Nat Rev Microbiol 3:470–478

Davinic M, Fultz LM, Acosta-Martinez V, Calderón FJ, Cox SB, Dowd SE, Allen VG, Zak JC,

Moore-Kucera J (2012) Pyrosequencing and mid-infrared spectroscopy reveal distinct aggre-

gate strati ﬁ cation of soil bacterial communities and organic matter composition. Soil Biol

Biochem 46:63–72

Dechesne A, Pallud C, Debouzie D, Flandrois JP, Vogel TM, Gaudet JP, Grundmann GL (2003) A

novel method for characterizing the microscale 3D spatial distribution of bacteria in soil. Soil

Biol Biochem 35:1537–1546

Demanèche S, David MM, Navarro E, Simonet P, Vogel TM (2009) Evaluation of functional gene

enrichment in a soil metagenomic clone library. JMicrobiol Methods 76:105–107

Eickhorst T, Tippkötter R (2008) Detection of microorganisms in undisturbed soil by combining

ﬂ uorescence in situ hybridization (FISH) and micropedological methods. Soil Biol Biochem

40:284–1293

163

7 Recent Advances and Perspectives…

Elshahed MS, Youssef NH, Spain AM, Sheik C, Najar FZ, Sukharnikov LO, Roe BA, Davis JP,

Schloss PD, Bailey VL, Krumholz LR (2008) Novelty and uniqueness patterns of rare members

of the soil biosphere. Appl Environ Microbiol 74:5422–5428

Ettema CH, Wardle DA (2002) Spatial soil ecology. Trends Ecol Evol 17:177–183

Feinstein LM, Sul WJ, Blackwood CB (2009) Assessment of bias associated with incomplete

extraction of microbial DNA from soil. Appl Environ Microbiol 75:5428–5433

Fierer N, Jackson RB (2006) The diversity and biogeography of soil bacterial communities. Proc

Natl Acad Sci USA 103:626–631

Fierer N, Bradford MA, Jackson RB (2007) Toward an ecological classi ﬁ cation of soil bacteria.

Ecology 88(6):1354–1364

Forney LJ, Zhou X, Brown CJ (2004) Molecular microbial ecology: land of the one-eyed king.

Curr Opin Microbiol 7:210–220

Garbeva P, de Boer W (2009) Inter-speci ﬁ c interactions between carbon-limited soil bacteria affect

behavior and gene expression. Microb Ecol 58:36–46

Gerlach W, Jünemann S, Tille F et al (2009) WebCARMA: a web application for the functional and

taxonomic classi ﬁ cation of unassembled metagenomic reads. BMC Bioinformatics 10:430

Gilbert JA, Dupont CL (2011) Microbial metagenomics: beyond the genome. Annu Rev Mar Sci

3:347–371

Gill SR, Pop M, DeBoy RT, Eckburg PB, Turnbaugh PJ, Samuel BS, Gordon JI, Relman DA,

Fraser-Liggett CM, Nelson KE (2006) Metagenomic analysis of the human distal gut micro-

biome. Science 312:1355–1359

Girvan MS, Bullimore J, Pretty JN, Osborn AM, Ball AS (2003) Soil type is the primary determinant

of the composition of the total and active bacterial communities in arable soils. Appl Environ

Microbiol 69:1800–1809

Gomez-Silva B, Rainey FA, Warren-Rhodes KA, McKay CP, Navarro-Gonzalez R (2008)

Atacama desert soil microbiology. In: Dion P, Nautiyal CS (eds) Microbiology of extreme

soils. Springer, Berlin

Grundmann GL (2004) Spatial scales of soil bacterial diversity – the size of a clone. FEMS

Microbiol Ecol 48:119–127

Grundmann LG, Gourbiere F (1999) A micro-sampling approach to improve the inventory of bac-

terial diversity in soil. Appl Soil Ecol 13:123–126

Handelsman J (2004) Metagenomics: application of genomics to uncultured microorganisms.

Microbiol Mol Biol Rev 68:669–685

Hirsch PR, Mauchline TH, Clark IM (2010) Culture-independent molecular techniques for soil

microbial ecology. Soil Biol Biochem 42:878–887

Hollister EB, Engledow AS, Hammett AJM, Provin TL, Wilkinson HH, Gentry TL (2010) Shifts

in microbial community structure along an ecological gradient of hypersaline soils and sedi-

ments. ISME 4:829–838

Huson DH, Auch AF, Qi J, Schuster SC (2007) MEGAN analysis of metagenomic data. Genome

Res 17:377–386

Janssen PH (2006) Identifying the dominant soil bacterial taxa in libraries of 16S rDNA and 16S

rRNA genes. Appl Environ Microbiol 72:1719–1728

Janssen PH, Yates PS, Grinton BE, Taylor PM, Sait M (2002) Improved culturability of soil bacteria

and isolation in pure culture of novel members of the divisions acidobacteria, actinobacteria,

proteobacteria, and verrucomicrobia. Appl Environ Microbiol 68:2391–2396

Kakirde KS, Parsley LC, Liles MR (2010) Size does matter: application-driven approaches for soil

metagenomics. Soil Biol Biochem 42:1911–1923

King AJ, Freeman KR, Mccormick KF, Lynch RC, Lozupone C, Knight R, Schmidt SK (2010)

Biogeography and habitat modelling of high-alpine bacteria. Nature Commun 1:53. doi:

10.1038/

ncomms1055

Kostychev PA (1937) The soils of chernozem region of Russia: their origin, composition and prop-

erties. Selchozgiz, Moscow-Leningrad

Kunin V, Copeland A, Lapidus A, Mavromatis K, Hugenholtz P (2008) A bioinformatician’s guide

to metagenomics. Microbiol Mol Biol Rev 72:557–578

164

E.V. Pershina et al.

Kuske CR, Ticknor LO, Miller ME, Dunbar JM, Davis JA, Barns SM, Belnap J (2002) Comparison

of soil bacterial communities in rhizospheres of three plant species and the interspaces in an

arid grassland. Appl Environ Microbiol 68(4):1854–1863. doi:

10.1128/AEM.68.4.1854-

1863.2002

Lämmle K, Zipper H, Breuer M, Hauer B, Buta C, Brunner H, Rupp S (2010) Identi ﬁ cation of novel

enzymes with different hydrolytic activities by metagenome expression cloning. J Biotechnol

127:575–592. doi:

10.1016/j.jbiotec.2006.07.036

Lauber CL, Strickland MS, Bradford MA, Fierer N (2008) The in ﬂ uence of soil properties on the

structure of bacterial and fungal communities across land-use types. Soil Biol Biochem

40:2407–2415

Lauber CL, Hamady M, Knight R, Fierer N (2009) Pyrosequencing-based assessment of soil pH

as a predictor of soil bacterial community structure at the continental scale. Appl Environ

Microbiol 75(15):5111–5120. doi:

10.1128/AEM.00335-09

Lee S, Cho J (2009) Distribution patterns of the members of phylum Acidobacteria in global soil

samples. J Microbiol Biotechnol 19:1281–1287

Lee S, Ka J, Cho J (2008) Members of the phylum Acidobacteria are dominant and metabolical-

lyactive in rhizosphere soil. FEMS Microbiol Lett 285:263–269

Levy-Bootha DJ, Campbell RG, Gulden RH, Harta MM, Powellc JR, Klironomos JN, Pauls KP,

Swanton CJ, Trevorsa JT, Dun ﬁ eldd KE (2007) Cycling of extracellular DNA in the soil envi-

ronment. Soil Biol Biochem 39:2977–2991

Lombard N, Prestat E, Elsas JDV, Simonet P (2011) Soil-speci ﬁ c limitations for access and analy-

sis of soil microbial communities by metagenomics. FEMS Microbiol Ecol 78:31–49

Lorenz P, Liebeton K, Niehaus F, Eck J (2002) Screening for novel enzymes for biocatalytic

processes: accessing the metagenome as a resource of novel functional sequence space. Curr

Opin Biotechnol 13:572–577

Lorenz P, Liebeton K, Niehaus F, Schleper C, Eck J (2003) The impact of non-cultivated biodiver-

sity on enzyme discovery and evolution. Biocatal Biotransfor 21(2):87–91

Lu N, Zilles JL, Nguyen TH (2010) Adsorption of extracellular chromosomal dna and its effects

on natural transformation of Azotobacter vinelandii . Appl Environ Microbiol 76(13):4179–

4184. doi:

10.1128/AEM.00193-10

Martin-Laurent F, Philippot L, Hallet S, Chaussod R, Germon JC, Soulas G, Catroux G (2001)

DNA extraction from soils: old bias for new microbial diversity analysis methods. Appl Environ

Microbiol 67:2354–2359

Mercier A, Kay E, Simonet P (2006) Horizontal gene transfer by natural transformation in soil

environment. In: Nannipieri P, Smalla K (eds) Nucleic acids and proteins in soil. Springer,

Berlin

Meyer F, Paarmann D, D’Souza MD, Olson R, Glass EM, Kubal M, Paczian T, Rodriguez A,

Stevens R, Wilke A, Wilkening J, Edwards RA (2008) The metagenomics RAST server – a

public resource for the automatic phylogenetic and functional analysis of metagenomes. BMC

Bioinformatics 9:386

Mocali S, Benedetti A (2010) Exploring research frontiers in microbiology: the challenge of meta-

genomics in soil microbiology. Res Microbiol 161:497–505. doi:

10.1016/j.resmic.2010.04.010

Mummey DL, Stahl PD (2004) Analysis of soil whole- and inner-microaggregate bacterial com-

munities. Microbial Ecol 48:41–50

Mummey D, Holben W, Six J, Stahl P (2006) Spatial strati ﬁ cation of soil bacterial populations in

aggregates of diverse soils. Microbial Ecol 51:404–411

Nielsen KM, Calamai L, Pietramellara G (2006) Stabilization of extracellular DNA and proteins

by transient binding to various soil components. In: Nannipieri P, Smalla K (eds) Nucleic acids

and proteins in soil. Springer, Berlin

Nielsen KM, Johnsen PJ, Bensasson D, Daffonchio D (2007) Release and persistence of extracel-

lular DNA in the environment. Environ Biosafety Res 6:37–53. doi:

10.1051/ebr:2007031

Nunan N, Wu K, Young IM, Crawford JW, Ritz K (2003) Spatial distribution of bacterial com-

munities and their relationships with the micro-architecture of soil. FEMS Microbiol Ecol

44:203–215

165

7 Recent Advances and Perspectives…

Paget E, Lebrun M, Freyssinet G, Simonet P (1998) The fate of recombinant plant DNA in soil.

Eur J Soil Biol 34(2):81–88

Pershina EV, Tamazyan GS, Dolnik AS, Pinaev AG, Sergaliev NH, Andronov EE (2012) Studying

the structure of soil microbial community in saline soils by high-throughput pyrosequencing.

Ecol Genet 2(10):31–38 (in russian)

Pettit RK (2004) Soil DNA libraries for anticancer drug discovery. Cancer Chemother Pharmacol

54:1–6. doi:

10.1007/s00280-004-0771-8

Pietramellara G, Ascher J, Borgogni F, Ceccherini MT, Guerri G, Nannipieri P (2009) Extracellular

DNA in soil and sediment: fate and ecological relevance. Biol Fertil Soils 45:219–235

Podar M, Abulencia CB, Walcher M, Hutchison D, Zengler K, Garcia JA, Holland T, Cotton D,

Hauser L, Keller M (2007) Targeted access to the genomes of low-abundance organisms

in complex microbial communities. Appl Environ Microbiol 73(10):3205–3214. doi:

10.1128/

AEM.02985-06

Raes J, Foerstner UK, Bork P (2007) Get the most out of your metagenome: computational analysis

of environmental sequence data. Curr Opin Microbiol 10:1–9

Riesenfeld CS, Schloss PD, Handelsman J (2004) Metagenomics, genomic analysis of microbial

communities. Annu Rev Genet 38:525–552

Robe P, Nalin R, Capellano C, Vogel TM, Simonet P (2003) Extraction of DNA from soil. Eur J

Soil Biol 39:183–190

Roesch LFW, Fulthorpe RR, Riva A, Casella G, Hadwin AKM, Kent AD, Daroub SH, Camargo

FAO, Farmerie WG, Triplett EW (2007) Pyrosequencing enumerates and contrasts soil micro-

bial diversity. ISME J 1:283–290

Romanowski G, Lorenz MG, Sayler G, Wackernagel W (1992) Persistence of free plasmid DNA

in soil monitored by various methods, including a transformation assay. Appl Environ Microbiol

58:3012–3019

Rondon MR, August PR, Bettermann AD, Brady SF, Grossman TH, Liles MR, Loiacono KA,

Lynch BA, MacNeil IA, Minor C, Tiong CL, Gilman M, Osburne MS, Clardy J, Handelsman

J, Goodman RM (2000) Cloning the soil metagenome: a strategy for accessing the genetic

and functional diversity of uncultured microorganisms. Appl Environ Microbiol

66:2541–2547

Ruberto LAM, Vazquez SC, Mac Cormack WP (2008) Bacteriology of extremely cold soils

exposed to hydrocarbon pollution. In: Dion P, Nautiyal CS (eds) Microbiology of extreme

soils. Springer, Berlin

Saeki K, Kunito T (2010) Adsorptions of DNA molecules by soils and variable-charged soil

constituents. In: Méndez-Vilas A (ed) Current research technology and education topics in

applied microbiology and microbial biotechnology. FORMATEX, Badajoz

Sagova-Mareckova M, Cermak L, Novotna J, Plhackova K, Forstova J, Kopecky J (2008) Innovative

methods for soil DNA puri ﬁ cation tested in soils with widely differing characteristics. Appl

Environ Microbiol 74:2902–2907

Schink B (2002) Synergistic interactions in the microbial world. Antonie Van Leeuwenhoek

81:257–261

Schipper C, Hornung C, Bijtenhoorn P, Quitschau M, Grond S, Streit WR (2009) Metagenome-derived

clones encoding two novel lactonase family proteins involved in bio ﬁ lm inhibition in Pseudomonas

aeruginosa . Appl Environ Microbiol 75(1):224–233. doi:

10.1128/AEM.01389-08

Sessitsch A, Weilharter A, Gerzabek MH, Kirchmann H, Kandeler E (2001) Microbial population

structures in soil particle size fractions of a long-term fertilizer ﬁ eld experiment. Appl Environ

Microbiol 67:4215–4224

Simon C, Daniel R (2011) Metagenomic analyses: past and future trends. Appl Environ Microbiol

77(4):1153–1161. doi:

10.1128/AEM.02345-10

Singh BK, Campbell CD, Sorenson SD, Zhou J (2009a) Soil genomics. Nat Rev Microbiol 7:756.

doi:

10.1038/nrmicro2119-c1

Singh BK, Dawson LA, Macdonald CA, Buckland SM (2009b) Impact of biotic and abiotic interc-

tion on soil microbial communities and functions: a ﬁ eld study. Appl Soil Ecol 41:239–248.

doi:

10.1016/j.apsoil.2008.10.003

166

E.V. Pershina et al.

Spain AM, Krumholz LR, Elshahed MS (2009) Abundance, composition, diversity and novelty of

soil Proteobacteria . ISME J 3:992–1000

Steven B, Gallegos-Graves LV, Starkenburg SR, Chain PS, Kuske SR (2012) Targeted and shotgun

metagenomic approaches provide different descriptions of dryland soil microbial communities

in a manipulated ﬁ eld study. Environ Microbiol Rep 4(2):248–256

Torsvik V, Ovreas L (2002) Microbial diversity and function in soil, from genes to ecosystems.

Curr Opin Microbiol 5:240–245

Torsvik V, Goksøyr J, Daae FL (1990) High diversity in DNA of soil bacteria. Appl Environ

Microbiol 56(3):782–787

Trap J, Laval K, Akpa-Vinceslas M, Gangneux C, Bureau F, Decaëns T, Aubert M (2011) Humus

macro-morphology and soil microbial community changes along a 130-yr-old Fagus sylvatica

chronosequence. Soil Biol Biochem 43:1553–1562. doi:

10.1016/j.soilbio.2011.04.005

Trevors JT (2010) One gram of soil: a microbial biochemical gene library. Antonie Van

Leeuwenhoek 97:99–106. doi:

10.1007/s10482-009-9397-5

Tringe SG, Hugenholtz P (2009) A renaissance for the pioneering 16S rRNA gene. Curr Opin

Microbiol 11:442–446

Tringe SG, von Mering C, Kobayashi A, Salamov AA, Chen K, Chang HW, Podar M, Short JM,

Mathur EJ, Detter JC, Bork P, Hugenholtz P, Rubin EM (2005) Comparative metagenomics of

microbial communities. Science 308:554–557

Tsai S, Selvam A, Chang Y, Yang S (2009) Soil bacterial community composition across different

topographic sites characterized by 16S rRNA gene clones in the Fushan Forest of Taiwan. Bot

Stud 50:57–68

Tyson GW, Ban ﬁ eld JF (2005) Cultivating the uncultivated: a community genomics perspective.

Trends Microbiol 13(9):411–415

Ussery DW, Wassenaar TM, Borini S (2009) Computing for comparative microbial genomics.

Springer, Berlin

Vieites JM, Guazzaroni ME, Beloqui A, Golyshin PN, Ferrer M (2010) Molecular methods to

study complex microbial communities. In: Streit WR, Daniel R (eds) Metagenomics. Methods

and protocols. Humana Press, c/o Springer Science + Business Media, New York

Vogel TM, Simonet P, Jansson JK, Hirsh PR, Tiedje JM, Van Elsas JD, Bailey MJ, Nalin R,

Philippot L (2009) TerraGenome: a consortium for the sequencing of a soil metagenome. Nat

Rev Microbiol 7:252

Voget S, Leggewie C, Uesbeck A, Raasch C, Jaeger KE, Streit WR (2003) Prospecting for novel

biocatalysts in a soil metagenome. Appl Environ Microbiol 69(10):6235–6242. doi:

10.1128/

AEM.69.10.6235-6242.2003

Voroney RP (2010) The soil habitat. In: Paul EA (ed) Soil microbiology, ecology, and biochemistry,

3rd edn. Academic, Burlington

Wackernagel W (2006) The various sources and the fate of nucleic acids in soil. In: Nannipieri P,

Smalla K (eds) Nucleic acids and proteins in soil. Springer, Berlin

Wagner D (2008) Microbial communities and processes in arctic permafrost environments. In:

Dion P, Nautiyal CS (eds) Microbiology of extreme soils. Springer, Berlin

Wexler M, Johnston AWB (2010) Wide host-range cloning for functional metagenomics. In: Streit

WR, Daniel R (eds) Metagenomics. Methods and protocols. Humana Press, c/o Springer

Science + Business Media, New York

Will C, Thürmer A, Wollherr A, Nacke H, Herold N, Schrumpf M, Gutknecht J, Wubet T, Buscot

F, Daniel R (2010) Horizon-speci ﬁ c bacterial community composition of german grassland

soils, as revealed by pyrosequencing-based analysis of 16S rRNA genes. Appl Environ

Microbiol 76(20):6751–6759. doi:

10.1128/AEM.01063-10

Wooley JC, Ye Y (2009) Metagenomics: facts and artifacts, and computational challenges. J Comp

Sci Technol 25:71–81

Young IM, Crawford JW (2004) Interactions and selforganization in the soil-microbe complex.

Science 304:1634–1637

Zengler K, Toledo G, Rappe M, Elkins J, Mathur EJ, Short JM, Keller M (2002) Cultivating the

uncultured. Proc Natl Acad Sci USA 99:15681–15686

167

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_8, © Springer Science+Business Media Dordrecht 2013

Abstract Mobile genetic elements (MGEs) are important “vehicles” of diverse genes

in the microbial genetic pool. Exchange of MGEs in the microbial community confers

new traits to their hosts and promotes their rapid adaptation to various environments. For

decades, a variety of bacteria capable of degrading “xenobiotic” compounds have been

isolated for their potential importance in the removal of these compounds from contami-

nated environments. The genes responsible for the catabolic turnover of xenobiotics are

sometimes located on MGEs such as plasmids, transposons, and integrative and conju-

gative elements (ICEs). This chapter summarizes our current knowledge of major MGEs

that carry catabolic genes, and brie ﬂ y describes their features. Recent works focused on

the behavior of MGEs in natural environmental samples have also been described here.

Keywords Mobile genetic elements (MGEs) • Horizontal gene transfer (HGT)

• Transposons • Catabolic plasmids • Xenobiotics

M. Shintani (*)

Present address: Department of Materials Science and Chemical Engineering,

Faculty of Engineering, Shizuoka University, 3-5-1 Johoku , Naka-ku, Hamamatsu ,

432-8561, Shizuoka, Japan

Japan Collection of Microorganisms, RIKEN BioResource Center

3-1-1 Kouyadai, Tsukuba, Ibaraki 305-0074, Japan

e-mail: tmshint@ipc.shizuoka.ac.jp

H. Nojiri

Biotechnology Research Center , The University of Tokyo ,

1-1-1 Yayoi , Bunkyo-ku, Tokyo 113-8657 , Japan

Agricultural Bioinformatics Research Unit , The University of Tokyo ,

1-1-1 Yayoi , Bunkyo-ku, Tokyo 113-8657 , Japan

Chapter 8

Mobile Genetic Elements (MGEs) Carrying

Catabolic Genes

Masaki Shintani and Hideaki Nojiri

168

M. Shintani and H. Nojiri

1 Introduction

Horizontal gene transfer (HGT) is one of the important mechanisms for rapid bacte-

rial evolution and adaptation. HGT proceeds mainly by conjugation (Frost et al.

2005 ; Heuer and Smalla 2007 ; Aminov 2011 ) and is mediated by mobile genetic

elements (MGEs), which are DNA segments that can move between bacterial cells

(intercellular mobility) (Frost et al. 2005 ) . The elements carry various kinds of genes,

such as antibiotic resistance genes, virulence genes, and catabolic genes, and thus,

MGEs are important “vehicles” of pathogenically- and environmentally-relevant

traits. Plasmids, integrative and conjugative elements (ICEs), and transposons are the

important MGEs. Since the 1960s, various bacteria capable of degrading “xenobi-

otic” compounds have been isolated because of their potential importance in the

removal of these compounds from contaminated environments. In this review, we use

the term “xenobiotic” compounds in a broad sense to signify compounds that are not

natural to the environment, but are rather “guest” chemicals, as de ﬁ ned by Leisinger

( 1983 ) . The genes involved in catabolic turnover of xenobiotic compounds are some-

times identi ﬁ ed on MGEs, especially on plasmids, ICEs, and transposons.

Plasmids are circular or linear extrachromosomal replicons, which are often

transmissible by conjugation (Sota and Top 2008 ; Frost et al. 2005 ) . ICEs are also self-

transmissible conjugative elements, but they are generally integrated into the host chro-

mosome (Burrus and Waldor 2004 ; Wozniak and Waldor 2010 ) . Conjugation can spread

genetic elements among bacteria effectively (Guglielmini et al. 2011 ) , and there-

fore, it is one of the most important mechanisms for rapid evolution and adaptation of

bacteria. On the other hand, transposons are genetic elements that are mobilized and trans-

ferred between replicons by the activity of a transposase (Mahillon and Chandler 1998 ) .

Once transposons integrate into plasmids or ICEs, they can also be transferred into other

cells (Frost et al. 2005 ) . Insertion sequences (IS) are a transposons that carry only

the transposase gene, and homologous recombination between multiple copies of the

same IS element can promote genomic rearrangements (Mahillon and Chandler 1998 ) .

Although many reviews have been published on MGEs that carry catabolic genes

for xenobiotic compounds (Tan 1999 ; Top et al. 2000, 2002 ; Top and Springael 2003 ;

van der Meer and Sentchilo 2003 ; Nojiri et al. 2004 ; Dennis 2005 ) , a large number

of new catabolic MGEs have since been reported due to the recent revolution in

nucleotide sequencing technology. This chapter summarizes recent studies of major

and/or new MGEs that carry catabolic genes, and brie ﬂ y describes their features.

2 Catabolic Plasmids

Plasmids have been classi ﬁ ed into incompatibility (Inc) groups on the basis of their

replication and partition systems. When two different plasmids cannot be maintained

in the same bacterial cell line, these two plasmids are called “incompatible” and are

considered to belong to the same “Inc” group. There are 27 Inc groups for the

Enterobacteriaceae (Carattoli

2009 ) , at least 14 groups for the Pseudomonas (Thomas

and Haines 2004 ) , and around 18 groups for the gram-positive bacteria (Frost et al. 2005 ;

169

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Sota and Top 2008 ) , although these groupings do not include all the identi ﬁ ed plas-

mids such as plasmids in Sphingomonas . Recently, a new classi ﬁ cation of plasmids

was proposed, which is based on their transfer systems generally composed of two

sets of proteins for mating pair formation (MPF) and mobilization (MOB) (Smillie

et al.

2010 ; Garcillán-Barcia et al. 2009, 2011 ) . Combination of four types of MPFs

(MPF

, MPF

, and MPF

) and six classes of MOBs (MOB

, MOB

MOB

, MOB

, and MOB

) enables us to classify a larger number of plasmids whose

sequences have been deposited in DNA databases.

Features of major catabolic plasmids, such as host, growth substrate of host, Inc

groups, MOB classes and MPF types, and transferability, are listed in Tables 8.1 ,

8.2 , 8.3 and 8.4 . They have been identi ﬁ ed in bacteria of the phylum Proteobacteria ,

such as Pseudomonas ( g - proteobacteria ), Achromobacter ( b - proteobacteria ), and

Sphingomonas ( a - proteobacteria ), and in gram-positive bacteria such as

Arthrobacter , Flavobacterium , and Rhodococcus , since the 1970s. Because detailed

features of IncP-1, IncP-7, and IncP-9 group plasmids have been already described

in our previous review (Shintani et al. 2010 ) , we focused especially on the catabolic

plasmids in sphingomonads or gram-positive bacteria in this chapter.

2.1 Catabolic Plasmids from Genus Pseudomonas and Those

Belonging to Pseudomonas Incompatibility Groups

Many catabolic plasmids are classi ﬁ ed into the IncP-1, IncP-2, IncP-7, and IncP-9

groups, which carry genes involved in the degradation of various xenobiotic com-

pounds, such as those for toluene/xylene ( xyl ), (chloro)benzoate ( cba ), (chloro)ani-

line ( dca ), 2,4-dichlorophenoxyacetic acid (2,4-D) ( tfd ), naphthalene ( nah ), and

carbazole ( car ), amongst others (Table 8.1 ). The complete nucleotide sequences of

several plasmids in these groups, except for the IncP-2 plasmids, have been deter-

mined, and an Inc group-speci ﬁ c plasmid backbone was proposed by comparative

analyses (Fig. 8.1 ). Dennis ( 2005 ) compared the genetic organization of IncP-1

plasmids and showed that most catabolic genes (or other genes, such as antibiotic

resistance genes) of IncP-1 plasmids were inserted between the trfA and oriV regions

and the parA and tra operons (Fig. 8.1a ; Dennis 2005 ) . Sota et al. ( 2007 ) showed

that the structural similarity of IncP-1 plasmids was a result of both the region-

speci ﬁ c insertion of transposons and the selective pressure for maintaining transfer-

ability and stability of the plasmids. Based on the comparisons of the nucleotide

sequences of plasmids, conserved regions of IncP-9 and IncP-7 plasmids (i.e., a

plasmid backbone) were also proposed (Fig.

8.1b, c ; Sota et al. 2006 ; Yano et al.

2010 ) . One important difference between these plasmids is their host range. IncP-1

plasmids are known to be broad host range plasmids that can transfer among bacte-

ria belonging to different classes, such as a -, b -, and g - proteobacteria . Indeed, the

host range of IncP-1 catabolic plasmids is broad, as listed in Table 8.1 . As for the

IncP-7 and IncP-9 plasmids, their host ranges are narrower than that of the IncP-1

plasmids, and most of their hosts belong to g - proteobacteria , and in particular, to

the genus Pseudomonas (Table 8.1 ).

170

M. Shintani and H. Nojiri

Table 8.1 Catabolic plasmids from genus Pseudomonas and those belonging to Pseudomonas incompatibility groups

Plasmid Host Substrate

Size

(kb)

Inc

group

MOB

class

T4SS

type

Genes Transferability References

pA81

Achromobacter

xylosocidans A8

Chlorobenzoate 98 P1 MOB

MPF

mocpRAB

CDhybRABCD

+ Jencova et al. ( 2008 )

pAC25 Pseudomonas putida

AC858

3-Chlorobenzoate 117 P1 NA NA NA + Chatterjee et al. (1981 )

pADP-1

Pseudomonas

sp. ADP

Atrazine 109 P1 MOB

MPF

atzABCDEF + de Souza et al. ( 1998 ) ;

Martinez et al. (

2001 )

pBRC60 Alcaligenes

sp. BR60

3-Chlorobenzoate 75 P1 NA NA cba + Fulthorpe and Wyndham

(

1991 )

pC1 Delftia acidovorans

CA28

3-Chloroaniline 100 P1 NA NA tdnQ + Boon et al. (

2001 )

pCNB1

Comamonas sp.

CNB-1

4-chloronitro-

benzene

91 P1 MOB

MPF

cnb , cat NA Wu et al. ( 2005, 2006 ) ;

Ma et al. (

2007 )

pEMT3 Unknwon soil

bacterium

2,4-D,

3-Chlorobenzoate

60 P1 NA NA tfdABC + Top et al. (

1995 ) ; Gstalder

et al. (

2003 )

pENH91 Ralstonia eutropha

NH9

3-Chlorobenzoate 78 P1 NA NA cbnABCD NA Ogawa and Miyashita

(

1995 )

pEST4011

Achromobacter

xylosoxidans

subsp.

denitri ﬁ cans

EST4002

2,4-D 70 P1 MOB

MPF

tfdCEBKA ,

tfdF , mdc

+ Mäe et al. ( 1993 ) ; Vedler

et al. (

2000, 2004 )

pIJB1

Burkholderia

cepacia 2a

2,4-D, malonate 102 P1 NA tfd , mdc , bph NA Xia et al. ( 1998 ) ; Poh

et al. (

2002 )

pJP4

Ralstonia eutropha

JMP134

2,4-D,

3-Chlorobenzoate

80 P1 MOB

MPF

tfdA , tfdB ,

tfdCDEF

+ Don and Pemperton

(

1981 ) ; Don et al.

(

1985 ) ; Trefault et al.

(

2004 )

171

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

(continued)

Plasmid Host Substrate

Size

(kb)

Inc

group

MOB

class

T4SS

type

Genes Transferability References

pNB2 Comamonas testos-

teroni I2

3-Chloroaniline 60 P1 NA NA tdnQ + Boon et al. (

2000, 2001 ) ;

Bathe (

2004 )

pNB8c

Delftia acidovorans

B8c

3-Chloroaniline 60 P1 NA NA dca + Boon et al. ( 2001 ) ;

Dejonghe et al.

(

2002 ) ; Król et al.

(

2012 )

pPS12-1 Burkholderia sp.

PS12

1,2,4,5-Tetrachloro-

benzene

85 P1 NA NA tecAB NA Beil et al. (

1999 )

pSS50 Alcaligenes sp. A5 4-Chlorobenzoate 53 P1 NA NA bph + Shields et al. (

1985 ) ;

Hooper et al. (

1989 ) ;

Layton et al. (

1992 )

pSS60 Achromobacter sp.

LBS1C1

4-chlorobenzoate 63 P1 NA NA bph + Burlage et al. (

1990 )

pTSA Comamonas testos-

teroni T-2

p -Toluenesulfonic

acid

85 P1 NA NA tsaMBCDR ,

psbAC

+ Junker and Cook (

1997 ) ;

Tralau et al. (

2001 )

pUO1

Delftia acidovorans

Haloacetates 65 P1 MOB

MPF

dehA1 , dehA2 + Kawasaki et al. ( 1981 ) ;

Sota et al. (

2003 )

pWDL7

Comamonas testos-

teroni WDL2

3-Chloroaniline P1 NA NA dcaRBA2A1TQ + Król et al. ( 2012 )

CAM Pseudomonas putida

PpG1

Camphor 500 P2 NA cam NA Chakrabarty (

1973 ) ;

Rheinwald et al.

(

1973 ) ; Tan ( 1999 )

OCT Pseudomonas

olevorans PpG6

Camphor 500 P2 NA alkBFGHJKL ,

alkST

+ Chakrabarty (

1973 )

pVI150 Pseudomonas sp.

CF600

Phenol NA P2 NA dmp + Bartilson et al. (

1990 )

pAK5 Pseudomonas putida

AK5

Naphthalene 115 P7 NA NA NA Izmalkova et al. (

2005 )

pCAR1

Pseudomonas

resinovorans CA10

Carbazole 199 P7 MOB

MPF

carABCDEF + Nojiri et al. ( 2001 ) ;

Maeda et al. (

2003 ) ;

Takahashi et al. (

2009 )

antABC

172

M. Shintani and H. Nojiri

Table 8.1 (continued)

Plasmid Host Substrate

Size

(kb)

Inc

group

MOB

class

T4SS

type

Genes Transferability References

pDK1

Pseudomonas putida

HS1

Xylene, toluene 180 P7 NA NA xyl + Kunz and Chapman

(

1981 ) ; Yano et al.

(

2010 )

pFME Pseudomonas

ﬂ uorescens

FME4

Naphthalene 77 P7 NA NA NA NA Izmalkova et al. (

2005 )

pME5 Pseudomonas

ﬂ uorescens

FME5

Naphthalene 80 P7 NA NA NA NA Izmalkova et al. (

2005 )

pND6-1

Pseudomonas

sp. ND6

Naphthalene 102 P7 – – nah – Li et al. ( 2004 )

pNK33 Pseudomonas

ﬂ uorescens

NK33

Naphthalene 100 P7 NA NA NA NA Izmalkova et al. (

2005 )

pNK43 Pseudomonas

ﬂ uorescens

NK43

Naphthalene 123 P7 NA NA NA NA Izmalkova et al. (

2005 )

pOS18 Pseudomonas

ﬂ uorescens

OS18P

Naphthalene 135 P7 NA NA NA NA Izmalkova et al. (

2005 )

pOS19 Pseudomonas

ﬂ uorescens

OS19P

Naphthalene 122 P7 NA NA NA NA Izmalkova et al. (

2005 )

pWW53

Pseudomonas putida

MT53

Xylene, Toluene 107 P7 – – xyl – Keil et al. ( 1985, 1987 ) ;

Tsuda and Genka

(

2001 ) ; Yano et al.

(

2007 )

173

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

(continued)

Plasmid Host Substrate

Size

(kb)

Inc

group

MOB

class

T4SS

type

Genes Transferability References

NAH7

Pseudomonas putida

Naphthalene,

Phenanthrene,

Anthracene

83 P9 MOB

MPF

nah + Dunn and Gunsalus

(

1973 ) ; Connors and

Barnsley (

1980 ) ; Sota

et al. (

2006 )

NPL-1 Pseudomonas putida

BS 202

Naphthalene 100 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

p15C Pseudomonas

sp. 15C

Naphthalene 110 P9 NA NA NA Sevastsyanovich et al.

(

2008 )

p8C Pseudomonas

sp. 8C

Naphthalene 110 P9 NA NA NA Sevastsyanovich et al.

(

2008 )

pBS1141 Pseudomonas putida

BS 3701

Naphthalene 120 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pBS1181 Pseudomonas putida

BS 3750

Naphthalene 120 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pBS1191 Pseudomonas putida

BS 3790

Naphthalene 100 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pBS240 Pseudomonas putida

BS 639

Naphthalene 160 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pBS243 Pseudomonas putida

BS 638

Naphthalene 160 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pBS265 Pseudomonas putida

BS 394

e -Caprolactam 130 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pBS267 Pseudomonas putida

BS 394

e -Caprolactam 130 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pBS268 Pseudomonas putida

BS 394

e -Caprolactam 85 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pDTG1

Pseudomonas putida

NCBI9816-4

Naphthalene 81 P9 MOB

MPF

nah – Simon et al. ( 1993 ) ;

Stuart-Keil et al.

(

1998 ) ; Dennis and

Zylstra (

2004 )

pFKY1

Unidenti ﬁ ed soil

bacterium

Naphthalene 200 P9 NA NA nah + Ono et al. ( 2007 )

174

M. Shintani and H. Nojiri

Table 8.1 (continued)

Plasmid Host Substrate

Size

(kb)

Inc

group

MOB

class

T4SS

type

Genes Transferability References

pFKY4

Unidenti ﬁ ed soil

bacterium

Naphthalene 80 P9 NA NA nah + Ono et al. ( 2007 )

pNAH20

Pseudomonas

ﬂ uorescens PC20

Naphthalene 83 P9 MOB

MPF

nag + Heinaru et al. ( 2009 )

pNL22 Pseudomonas

ﬂ uorescens 41a

Naphthalene 100 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pNL25 Pseudomonas putida

21a

Naphthalene 75 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pNL29 Pseudomonas sp. 58 Naphthalene NA P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pNL31 Pseudomonas

aeruginosa 56

Naphthalene NA P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pNL4 Pseudomonas putida

10a

Naphthalene 75 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pNL60 Pseudomonas

ﬂ uorescens 18d

Naphthalene 120 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pOV17 Pseudomonas

aureofaciens OV17

Naphthalene 85 P9 NA NA NA NA Sevastsyanovich et al.

(

2008 )

pSAH Alcaligenes sp. O-1 2-Aminobenzene-

sulfonate

180 P9 NA NA abs , scm + Jahnke et al. (

1990 ) ; Ruff

et al. (

2010 )

pSN11 Pseudomonas putida

SN11

Naphthalene 83 P9 NA NA NA Sevastsyanovich et al.

(

2008 )

pSVS15 Pseudomonas putida

SVS15

Toluene, Xylene 90 P9 NA NA NA Sevastsyanovich et al.

(

2008 )

pWW0

Pseudomonas putida

mt-2

Xylene, Toluene 117 P9 MOB

MPF

xyl + Williams and Murray

(

1974 ) ; Greated et al.

(

2002 )

175

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Plasmid Host Substrate

Size

(kb)

Inc

group

MOB

class

T4SS

type

Genes Transferability References

SAL1 Pseudomonas putida

Salicylate 85 P9 NA NA sal + Chakrabarty (

1972 )

NIC Pseudomonas convexa

Pc1

Nicotine, Nicotinate NA NA NA NA NA NA Thacker et al. (

1978 )

pAC27 Pseudomonas putida

AC867

3-Chlorobenzoate 110 NA NA NA clcABD , tfdC + Chatterjee and

Chakrabarty (

1982,

1984 ) ; Ghosal et al.

(

1985 ) ; Frantz and

Chacrabarty (

1987 ) ;

Ghosal and You

(

1988 )

pAM10.6 Pseudomonas

ﬂ uorescens biotype

F Cb36

Phenol 11 NA NA NA pheBA NA Peters et al. (

1997 )

pCg1 Pseudomonas putida

Cg1

Naphthalene 86 NA NA NA nah + Park et al. (

2003 )

pCINNP Pseudomonas putida

CINNP

Cinnamate 75 NA NA NA NA + Andreoni and Bestetti

(

1986 )

pCIT1 Pseudomonas sp. CIT1 Aniline 100 NA NA NA NA NA Anson and Mackinnon

(

1984 )

pCS1 Pseudomonas

diminuta

Parathion 66 NA NA NA opd NA Serdar et al. (

1982 ) ;

Mulbry et al. (

1986 )

pCT14

Pseudomonas sp.

CT14

Toluene 55 NA MOB

– cbz , bphK NA Bramucci et al. ( 2006 )

pDBT2 Pseudomonas

alcaligenes DBT2

Dibenzothiophene 80 NA NA NA NA NA Foght and Westlake

(

1990 ) ; Top et al.

(

2000 )

pEMT1

Unidenti ﬁ ed soil

bacterium

2,4-D,

3-Chlorobenzoate

84 NA NA NA tfdARCGEFB + Top et al. ( 1995 )

pEMT8

Unidenti ﬁ ed soil

bacterium

–

75 NA NA NA tfdA + Top et al. ( 1996 )

(continued)

176

M. Shintani and H. Nojiri

Table 8.1 (continued)

Plasmid Host Substrate

Size

(kb)

Inc

group

MOB

class

T4SS

type

Genes Transferability References

pEST1026 Pseudomonas putida

EST1020

Phenol 109 NA NA NA pheBA + Kivisaar et al. (

1990,

1991 )

pHMT112 Pseudomonas putida

ML2

Benzene NA NA NA NA bedC1C2BA , bedD NA Tan and Mason (

1990 ) ;

Fong et al. (

1996 )

pKA4 Pseudomonas pikettii

712

2,4-D 41 NA NA NA tfdA + Ka and Tiedje (

1994 )

pKJ1 Pseudomonas

sp. TA8

Toluene 225 NA NA NA NA + Yano and Nishi (

1980 )

pKW1 Pseudomonas putida

GJ31

Chlorocatechol 180 NA NA NA cbz NA Kunze et al. (

2009 )

pMH1 Pseudomonas sp.

HF-1

Nicotine 21 NA NA NA hsp – Wang et al. (

2009 )

pNB1 Pseudomonas putida

HS12

Nitrobenzene 59 NA NA NA nbzA , nbzCDE NA Park and Kim (

2000 )

pNB2 Pseudomonas putida

HS12

Nitrobenzene 44 NA NA NA nbzB NA Park and Kim (

2000 )

pP51 Pseudomonas

sp. P51

Chlorinated Benzene 110 NA NA NA tcbCDEF , tcbAB + van der Meer et al.

(

1991b )

pPGH1 Pseudomonas putida

Pheonol 220 NA NA NA phlABCDEFGH NA Herrmann et al. (

1988 )

pPOB Pseudomonas

pseudoalcaligenes

POB310

Carboxyldiphenyl

ethers

– NA NA NA pabAB NA Dehmel et al. (

1995 )

pRA500 Pseudomonas putida

NCIB 9869

3,5-Xylenol 500 NA NA NA pchACXFHG + Hopper and Kemp (

1980 ) ;

Top et al. (

2000 )

pRE4 Pseudomonas putida

RE204

Isopropyl benzene 105 NA NA NA ipbABCEGFHD + Eaton and Timmis (

1986 )

177

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Plasmid Host Substrate

Size

(kb)

Inc

group

MOB

class

T4SS

type

Genes Transferability References

pTDN1 Pseudomonas putida

UCC22

Aniline NA NA NA NA tdnQTA1A2BR NA Saint et al. (

1990 )

pTKO Pseudomonas putida

PPK1

Toluene 150 NA NA NA NA NA Keshavarz et al. (

1985 )

pUU204 Pseudomonas sp. E4 2-Chloropropionic acid 294 NA NA NA Dehalogenase – Hardman et al. (

1986 )

pWW100 Pseudomonas sp.

CB406

Biphenyl, Benzoate 200 NA NA NA bph – Lloyd-Jones et al. (

1994 )

pZWL0 Pseudomonas sp.

WBC-3

Methyl parathion,

p -Nitrophenol

~70 NA NA NA mph + Liu et al. (

2005 )

Several original plasmid hosts of IncP-1 and P-9 groups are not necessarily of the genus Pseudomonas

2,4-D represents 2,4-Dichlorophenoxyacetic acid

Classi ﬁ cation of MOB and MPF classes is based on the report of Smillie et al. ( 2010 ) . NA means not available

Whole nucleotide sequences are available

This plasmid was captured by performing exogenous plasmid isolation from soil bacteria, and its original host was therefore unidenti ﬁ ed

This plasmid was able to complement the de ﬁ ciency of 2,4-D metabolism of tfdA -disrupted-host

178

M. Shintani and H. Nojiri

Table 8.2 Catabolic plasmids in sphingomonads

Plasmid Host Substrate

Size

(kb)

Rep

type

MOB

class

T4SS

type

Genes Transferability References

pCAR3

Novosphingobium

sp. KA1

Carbazole 240 pNL1 MOB

MPF

car – Habe et al. ( 2002 ) ; Shintani

et al. (

2007 )

pCHQ1

Sphingobium

japonicum

UT26

g -HCH 191 pCHQ1 NA NA linRED + Nagata et al. (

2006, 2010, 2011 )

pISP1 Sphingomonas

sp. MM-1

g -HCH 200 NA NA NA lin NA Tabata et al. (

2011 )

pISP3

Sphingomonas

sp. MM-1

g -HCH 40 NA NA NA lin NA Tabata et al. ( 2011 )

pISP4 Sphingomonas

sp. MM-1

g -HCH 30 NA NA NA lin NA Tabata et al. (

2011 )

pLA1

Novosphingobium

pentaromativ-

orans US6-1

PAHs 188 pCHQ1 NA NA bph NA Luo et al. (

2012 )

pLA2

d,e

Novosphingobium

pentaromativ-

orans US6-1

PAHs pLB1 NA NA – NA Luo et al. (

2012 )

pLB1

Unidenti ﬁ ed soil

bacterium

g -HCH 66 pLB1 MOB

MPF

linB + Miyazaki et al. ( 2006 )

pNL1

Novosphingobium

aromaticivorans

DSM

12444

Biphenyl,

Naphthalene

184 pNL1 MOB

MPF

bph , xyl + Stillwell et al. ( 1995 ) ; Romine

et al. (

1999 )

pNL2

d,e

Novosphingobium

aromaticiv

orans DSM

12444

Biphenyl,

Naphthalene

487 NA – – – NA Fredrickson et al. (

1991 )

179

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

(continued)

Plasmid Host Substrate

Size

(kb)

Rep

type

MOB

class

T4SS

type

Genes Transferability References

pSLGP

d,e

Sphingobium sp.

SYK-6

Lignin pCHQ1 NA NA – NA Masai et al. ( 2010 )

pSPHCH01

d,e

Sphingobium

chlorophenoli

cum L-1

Pentachlorophenol pCHQ1 NA NA – NA Copley et al. (

2012 )

pSWIT01

d,e

Sphingomonas

wittichii RW1

Dibenzo- p -dioxin 310 Unclassi ﬁ ed NA NA – NA Miller et al. ( 2010 )

pSWIT02

Sphingomonas

wittichii RW1

Dibenzo- p -dioxin 223 pNL1 MOB

MPF

dxn NA Miller et al. ( 2010 )

pBN6 Sphingomonas

xenophaga

BN6

Naphthalenesulfonate 180 pNL1 NA NA nsa + Basta et al. (

2004 ) ; Keck et al.

(

2006 )

pCF01-05 Sphingomonas sp.

CF06

Carbofuran NA NA NA NA NA + Feng et al. (

1997a, b )

pKS14 Sphingomonas

sp. KS14

Phenanthrene,

naphthalene

>500 NA NA NA NA NA Cho and Kim (

2001 )

pZL Sphingomonas sp.

ZL5

PAHs ~60 NA NA NA NA + Liu et al. (

2004 )

Megaplasmid Sphingopyxis

sp. 113P3

Polyvinyl alcohol NA NA NA NA pvaA NA Hu et al. (

2008 )

Large

plasmid

Sphingopyxis

terrae

Polyethilene glycol NA NA NA NA pegB NA Tani et al. (

2007 )

Plasmid Sphingomonas

paucimobilis

TNE12

Fluoranthene 240 NA NA NA NA NA Shuttleworth et al. (

2000 )

Plasmid a Sphingobium

francense SP+

g -HCH <32 NA NA NA linB NA Cérmémonie et al. (

2006 )

180

M. Shintani and H. Nojiri

Table 8.2 (continued)

Plasmid Host Substrate

Size

(kb)

Rep

type

MOB

class

T4SS

type

Genes Transferability References

Plasmid b Sphingobium

francense SP+

g -HCH <32 NA NA NA linE NA Cérmémonie et al. (

2006 )

Plasmid e Sphingobium

francense SP+

g -HCH ~214 NA NA NA linA , linX NA Cérmémonie et al. (

2006 )

Plasmid Sphingobium

indicum B40

g -HCH ~214 NA NA NA linA NA Cérmémonie et al. (

2006 )

Plasmid Sphingomonas sp.

HH69

Dibenzofuran 240 pNL1 NA NA dxnA NA Basta et al. (

2004 )

g -HCH indicates g -hexachlorocyclohexane and PAHs indicate polycyclic aromatic hydrocarbons

Rep type is classi ﬁ ed on the basis of the amino acid sequence identity (>70%) of putative Rep genes of each sequenced plasmid. As for pBN6 and the plasmid

of Sphingomonas sp. HH69, the classi ﬁ cation is based on the Southern blot analysis of Basta et al. (

2005 )

Classi ﬁ cations of MOB classes and MPF types are based on the report of Smillie et al. ( 2010 ) . NA means not available

Whole nucleotide sequences are available

No catabolic genes have been reported in the plasmid so far

181

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Table 8.3 Catabolic plasmids in other gram-negative bacteria

Plasmid Host Substrate Size (kb) MOB class

T4SS type

Genes Transferability References

pWW174 Acinetobacter

calcoaceticus

RJE174

Benzene 200 NA NA cat + Winstanley et al. (

1987 )

pYA1 Acinetobacter

sp. YAA

Aniline NA NA NA atdA NA Fujii et al. (

1997 )

pCPE3 Alcaligenes

sp. CPE3

Chlorobenzoates 16 NA NA cbaABC + Di Gioia et al. (

1998 )

pKA2 Alcaligens

paradoxus

2811P

2,4-D

4 3 N A N A tfdA + Ka and Tiedje ( 1994 )

pCMS1 Brevundimonas

diminuta

Organophospate 66 NA NA opd + Mulbry et al. (

1987 ) ;

Pandeeti et al. (

2011 )

pTOM Burkholderia

cepacia G4

Toluene 108 NA NA tom + Shields et al. (

1995 )

pNF1 Burkholderia

sp. NF100

Methylhydroquinone 105 NA NA mhq + Hayatsu et al. (

2000 ) ;

Tago et al. (

2005 )

pOPH1 Comamonas

acidovorans

UCC61

Phtalate 70 NA NA pht NA Dutton et al. (

1995 )

pBS1010 Comamonas

testosteroni

BS1310

p -Toluenesulfonate 130 NA NA NA NA Top et al. (

2000 )

(continued)

182

M. Shintani and H. Nojiri

Table 8.3 (continued)

Plasmid Host Substrate Size (kb) MOB class

T4SS type

Genes Transferability References

pMC1 Delftia acidovoran s

MC1

Dichlorprop

NA NA NA rdpA NA Schleinitz et al. ( 2004 )

sdpA

pBRX1 Klebsiella

ozaenae

Bromoxynil 82 NA NA bxn NA Stalker and McBride

(

1987 )

pPNAP01

Polaromonas

naphthaleniv-

orans CJ2

Naphthalene 353 MOB

, MOB

MPF

bph , pht

NA Jeon et al. ( 2003, 2006 ) ;

Yagi et al. (

2009 )

pPNAP04

Polaromonas

naphthaleniv-

orans CJ2

Naphthalene 144 – – pht

NA Jeon et al. ( 2003, 2006 ) ;

Yagi et al. (

2009 )

pAC200 Rhizobium sp.

AC100

Carbaryl

2 5 B A N A cehA NA Hashimoto et al. ( 2002 )

Classi ﬁ cations of MOB classes and MPF types are based on the report of Smillie et al. ( 2010 ) . NA means not available

2,4-D represents 2,4-Dichlorophenoxyacetic acid

Dichlorprop represents 2(2,4-dichlorophenoxy)propionate

Whole nucleotide sequences are available

Putative biphenyl- and phthalate-degradative genes were located on pPNAP01 and pPNAP04, although naphthalene degradative genes were not detected

Carbaryl represents 1-naphtyl-N-methylcarbamate

183

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Table 8.4 Catabolic plasmids in gram-positive bacteria

Plasmid Host Substrate

Size

(kb) Linear/circular

MOB

class

T4SS

type

Genes Transferabllity References

pRE1 Arthrobacter

keyseri 12B

Phthalate 130 NA NA NA pht , pcm NA Eaton (

2001 )

pAO1

Arthrobacter

nicotinovorans

Nicotine 165 Circular NA NA ndh + Baitsch et al. ( 2001 ) ;

Igloi and

Brandsh (

2003 )

Plasmid Arthrobacter

nicotinovorans

HIM

Atrazine 96 NA NA NA atzABC NA Aislabie et al. (

2005 )

pAL1

Arthrobacter

nitroguajacolicus

Rü61a

2-Methylquinoline 113 linear NA NA qox , moq , hod ,

amq

+ Overhage et al.

(

2005 ) ; Parschat

et al. (

2007 )

Plasmid Arthrobacter

sp. DNS10

Atragine NA NA NA NA NA NA Zhang et al. (

2011b )

pRC1 Arthrobacter

sp. RC100

Carbaryl,

1-naphthol

130 NA NA NA NA + Hayatsu et al. (

1999 )

pRC2 Arthrobacter

sp. RC100

Carbaryl,

1-naphthol

120 NA NA NA NA + Hayatsu et al. (

1999 )

Plasmid Bacillus licheniformis Dimethoate 54 NA NA NA NA + Mandel et al. (

2005 )

pPDL2 Flavobacterium sp.

ATCC27551

Organophosphate 39 NA NA NA opd NA Mulbry et al. (

1987 ) ;

Siddavattam

et al. (

2003 )

pOAD2

Flavobacterium

sp. KI723T1

Nylon 46 Circular NA NA nylABC NA Negoro et al. ( 1980 ) ;

Negoro and

Okada (

1982 ) ;

Kato et al. (

1995 )

(continued)

184

M. Shintani and H. Nojiri

Table 8.4 (continued)

Plasmid Host Substrate

Size

(kb) Linear/circular

MOB

class

T4SS

type

Genes Transferabllity References

pLW1071

Geobacillus

thermodentri ﬁ cans

NG80-2

Long-chain alkane 58 Circular MOB

– ladA NA Feng et al. ( 2007 )

p174 Gordonia polyiso

prenivorans VH2

Rubber 174 Circular NA NA lcp2 NA Hiessl et al. (

2012 )

pGKT2

Gordonia sp. KTR9 Hexahydro-1,3,5-

trinitro-1,3,5-

trazine

182 Circular NA NA xplABglnA - xplB ,

xplA , xplR

NA Indest et al. (

2010 )

pKB1

Gordonia westfalica

Kb1

Poly ( cis -1,4-

isoprene)

101 Circular MOB

– cad + Bröker et al. ( 2004,

2008 )

Small

plasmid

Gordonia sp.

CC-NAPH129-6

Naphthalene 97 NA NA NA nar NA Lin et al. (

2012 )

Plasmid Nocardioides sp.

DF412

Dibenzofuran NA NA NA NA dfdA NA Miyauchi et al.

(

2008 )

pNC30 Rhodococcus

carallinus B-276

Propene 185 Linear NA NA amoABC NA Saeki et al. (

1999 )

pBD2

Rhodococcus

erythropolis BD2

Isopropylbenzene 210 Linear NA NA ipb + Darbrock et al.

(

1994 ) ; Kesseler

et al. (

1996 ) ;

Stecker et al.

(

2003 )

pREL1

Rhodococcus

erythropolis PR4

Alkane 272 Linear NA NA alk NA Sekine et al. ( 2006 )

pREC1

Rhodococcus

erythropolis PR4

Alkane 104 Circular MOB

– b -oxydation

enzymes

NA Sekine et al. ( 2006 )

pTSA421 Rhodococcus

erythropolis TA421

Biphenyl/PCBs 560 Linear NA NA bph NA Kosono et al. (

1997 )

185

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Plasmid Host Substrate

Size

(kb) Linear/circular

MOB

class

T4SS

type

Genes Transferabllity References

pLP6 Rhodococcus

globerulus P6

Biphenyl/PCBs 650 Linear NA NA bphC2 NA Kosono et al. (

1997 )

pRHL1

Rhodococcus jostii

RHA1

Biphenyl/PCBs,

ethylbenzene,

limonene,

carveol

1100 Linear NA NA bph , etb NA Masai et al. (

1997 ) ;

Shimizu et al.

(

2001 )

pRHL2

Rhodococcus jostii

RHA1

Biphenyl/PCBs,

ethylbenzene,

limonene,

carveol

450 Linear NA NA bph , etb + Masai et al. (

1997 ) ;

Shimizu et al.

(

2001 )

pRHL3

Rhodococcus jostii

RHA1

Biphenyl/PCBs,

ethylbenzene,

limonene,

carveol

330 Linear NA NA Limonene mono-

oxygenase

NA Warren et al. (

2004 )

p1CP Rhodococcus opacus

1CP

Chloroaromatic

compounds

740 Linear NA NA macA , clc NA König et al. (

2004 )

pNUO1 Rhodococcus opacus

M213

– ca 750 Linear NA NA edoD NA Uz et al. (

2000 )

Plasmid Rhodococcus

rhodochrous K37

PCBs 200 Linear NA NA bphC NA Taguchi et al. (

2004 )

pRTL1 Rhodococcus

rhodochrous

NCIMB 13064

1-Chloroalkane 100 NA NA NA dhaA , adhA ,

aldA

+ Kulakova et al.

(

1995, 1997 )

(continued)

186

M. Shintani and H. Nojiri

Table 8.4 (continued)

Plasmid Host Substrate

Size

(kb) Linear/circular

MOB

class

T4SS

type

Genes Transferabllity References

Plasmid Rhodococcus

sp. I24

Naphthalene,

toluene

50 NA NA NA nid + Priefert et al. (

2004 )

Plasmid Rhodococcus

sp. I24

Naphthalene,

toluene

340 NA NA NA Toluene inducible

dioxygenase

– Priefert et al. (

2004 )

pDBF1 Terrabacter

sp. DBF63

Dibenzofuran,

ﬂ uorene

160 Linear NA NA dbf - ﬂ n , pht , pca NA Nojiri et al. (

2002 ) ;

Habe et al. (

2005 )

pDBF2 Terrabacter

sp. DBF63

Dibenzofuran,

ﬂ uorene

190 Linear NA NA dbf - ﬂ n , pht , pca NA Nojiri et al. (

2002 ) ;

Habe et al. (

2005 )

pYK3 Terrabacter sp. YK3 Dibenzofuran NA NA NA NA dfdA NA Iida et al. (

2002 )

Carbaryl represents 1-naphtyl- N -methylcarbamate. PCBs represents polychlorinated biphenyls

Classi ﬁ cations of MOB classes and MPF types were based on the report of Smillie et al. ( 2010 ) . NA means not available

Whole nucleotide sequences are available

187

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

IncP-1(A)

(B)

(C)

pA81

atzABC

ohb, hyb, mocp

cnb, cot

bph, mdc, tfd

tfd

dehH (Tnhod2)

xyl (Tn4653 , Tn4651 )

nah (Tn4655)

nah

repA

ssb tra m

tra/trhpar

par

trfA parA tra

trb

dco (Tn6063)

pADP-1

pCNB1

pEST4011

pIJB1

pJP4

pNB8c

pUO1

pWDL7

deletion

IncP-7

IncP-9

pCAR1

pDTG1

pNAH20

pWW0

NAH7

pDK1

pND6-1

pWW53

ant, car (Tn4676)

xyl (Tn4663)

xyl (Tn4660)

nah

Fig. 8.1 Proposed IncP-1 ( a ), IncP-7 ( b ), and IncP-9 ( c ) backbones in conjunction with the insertion

sites ( vertical arrows ) of catabolic genes on each plasmid (see Table

8.1 ). Horizontal white arrows

indicate genes for replication and stability of the plasmid, and those in black indicate genes

for conjugative transfer. The ssb gene of the IncP-9 backbone is shown in gray . The tra / trh genes of

the IncP-7 backbone were deleted in pND6-1 and pWW53

On the other hand, many other catabolic plasmids have been isolated from

Pseudomonas . However, the nucleotide sequences of replication or transfer regions

for these plasmids are not available, and therefore, it is dif ﬁ cult to classify these

plasmids. One exception is pCT14, which carries several genes for a meta cleavage

188

M. Shintani and H. Nojiri

pathway for aromatic rings, including cbzTEXG , bphK , and tdnG (Bramucci et al.

2006 ) . Although the gene encoding its replication protein and the oriV region were

proposed, there are no genes of similar sequence in the GenBank/EMBL/DDBJ

database; this plasmid is predicted to be of the MOB

class (Table 8.1 ).

2.2 Catabolic Plasmids of Sphingomonads

Over the past decade, many catabolic plasmids from xenobiotic-degrading sphin-

gomonads (genera Sphingomonas , Sphingobium , Novosphingobium , and Sphingopyxis )

belonging to the class a - proteobacteria , have been identi ﬁ ed (Table 8.2 ). pNL1 was

isolated from Novosphingobium aromaticivorans DSM 12444 (its previous name

was N . aromaticivorans F199), and it is the ﬁ rst catabolic plasmid in sphingomonads

whose 184-kb nucleotide sequence has been reported (Romine et al. 1999 ) . Some

xenobiotic-degrading sphingomonads carry multiple plasmids in one cell (Basta

et al. 2004 ; Cérémonie et al. 2006 ; Tabata et al. 2011 ) .The strain DSM 12444 also

carries another plasmid of 487 kb, pNL2 (Fredrickson et al. 1991 ) . Basta et al.

( 2005 ) compared plasmids from 16 sphingomonad strains that degrade various

polycyclic aromatic hydrocarbons (PAHs). Based on Southern blot analyses, a plas-

mid of the naphthalenesulfonate-degrader Sphingomonas xenophaga BN6 and a

plasmid of the dibenzofuran-degrader Sphingomonas sp. HH69 were shown to pos-

sess a pNL1-type Rep (replication initiation protein) gene (Basta et al. 2005 ) .

Nucleotide sequence comparisons revealed that similar Rep genes were also found

in pCAR3, which also carries car genes, in the carbazole-degrader Novosphingobium

sp. KA1 (its previous name was Sphingomonas sp. KA1, Shintani et al. 2007 ) , and

in pSWIT02, which also carries dxn genes, in the dibenzo- p -dioxin degrader

Sphingomonas wittichii RW1 (Miller et al. 2010 ) . The Rep type is classi ﬁ ed based

on the amino acid sequence identity (>70%) of putative Rep gene products of each

sequenced plasmid.

Notably, many plasmids were identi ﬁ ed in g -hexachlorocyclohexane ( g -HCH)-

degrading sphingomonads (Table 8.2 , Nagata et al. 2007 ) . Sphingobium japonicum

UT26 is an archetypal g -HCH-degrading bacterium, and its whole genome sequence

has been determined (Nagata et al. 2010, 2011 ) . This strain has three plasmids, and

one of them is the 191-kb pCHQ1, which carries linRDEB (Nagata et al. 2007,

2010, 2011 ) . No Inc groups have been suggested for plasmids from sphingomonads;

however, several types of Rep genes are known to be conserved among these bacte-

ria. Indeed, there are other plasmids in sphingomonads that contain genes which

show high identities with the Rep gene of pCHQ1 (Table 8.2 ): pLA1, which was

identi ﬁ ed in a PAHs-degrader, Novosphingobium pentaromativorans US6-1, and

carries bph and xyl genes involved in biphenyl and toluene/xylene degradation (Luo

et al. 2012 ) ; pSLGP in a lignin-degrader, Sphingobium sp. SK-6 ( Masai et al. 2012 ) ;

and pSPHCH01, in a pentachlorophenol-degrader, Sphingobium chlorophenolicum

189

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

L-1 (Copley et al. 2012 ) . The last two plasmids, however, do not carry catabolic

genes. pLB1 also carries the linB gene, which was identi ﬁ ed by performing an

exogenous plasmid isolation technique from g -HCH-contaminated soil using a linB -

disrupted UT26 mutant. The original host of pLB1 was unidenti ﬁ able, but the plas-

mid can transfer to Sphingobium japonicum UT26 (Miyazaki et al.

2006 ) . The Rep

type of pLB1 is different from that of pCHQ1 because it shows compatibility to

pCHQ1 (Miyazaki et al.

2006 ) . Similarly, in addition to pLA1 (pCHQ1-type),

N . pentaromativorans US6-1 harbors another plasmid, pLA2, which carries the

pLB1-type Rep gene but has no catabolic genes. The conservation of the Rep genes

suggests that many plasmids in sphingomonads may be self-transmissible, although

this property has been experimentally proved to exist in only a few (Table 8.2 ).

Plasmids belonging to the same Pseudomonas incompatibility groups always

have the same types of genes for conjugative transfer (Table 8.1 ). In contrast, plas-

mids in sphingomonads have different types of genes for conjugative transfer,

whereas they have the same Rep genes, suggesting that they have “mosaic” genetic

structures. While the Rep gene of pSWIT02 is pNL1-like, the genes for plasmid

transfer show higher similarity to those of pCHQ1 than to those of pNL1. On the

other hand, putative plasmid transfer genes of pLA1 are more similar to those of

pNL1 than to those of pCHQ1, while its Rep gene is more similar to that of pCHQ1

(Luo et al. 2012 ) . In addition, several catabolic genes, such as bph on pNL1, car on

pCAR1, or lin on pCHQ1 are not organized in a single operon but dispersed on the

plasmid or host chromosome in sphingomonads (Romine et al. 1999 ; Shintani et al.

2007 ; Nagata et al. 2011 ) . The varied distribution of similar genes and dispersed

organization of genes indicate that catabolic plasmids in sphingomonads might have

been transferred among the genus, and might have undergone DNA rearrangements

with other plasmids and host chromosomes, resulting in the “mosaic” structure.

2.3 Catabolic Plasmids of Other Gram-Negative Bacteria

Catabolic plasmids have also been observed in other gram-negative bacteria belong-

ing to classes a -, b -, and g - proteobacteria , as listed in Table 8.3 , although they have

not been investigated in detail. The whole genome sequence of the naphthalene-

degrading Polaromonas naphthalenivorans CJ2 has been determined (Jeon et al.

2003, 2006 ; Yagi et al. 2009 ) . This strain possesses eight plasmids, and at least two

of them, pPNAP01 and pPNAP04, carry putative aromatic hydrocarbon-degradative

genes (Yagi et al. 2009 ) . The partial sequence of pCMS1, the organophosphate deg-

radative plasmid of Brevundimonas diminuta MG, revealed that its putative transfer

genes showed 67–74% identity with those of the IncP-1 plasmid pEST4011

(Pandeeti et al.

2011 ) . This fact implied an evolutionary relationship between

pCMS1 and IncP-1 plasmids. Analysis of the nucleotide sequences and identi ﬁ cation

of open reading frames on these plasmids will be important for elucidating the steps

in the evolution of these plasmids in gram-negative bacteria.

190

M. Shintani and H. Nojiri

2.4 Catabolic Plasmids of Gram-Positive Bacteria

Several plasmids have been identi ﬁ ed in xenobiotic-degrading gram-positive bacteria

belonging to classes Actinobacteria , Bacilli , and Flavobacteriia (Table

8.4 ). Some

of these bacteria carry circular plasmids and others harbor linear plasmids (Table 8.4 ).

The linear plasmids belong to a class of genetic elements called invertrons, which

carry terminal inverted repeats (TIRs) that are covalently bound to terminal proteins

at both 5 ¢ termini (Sakaguchi 1990 ) . Linear plasmids have been proposed to have

evolved from bacteriophages (Hinnebusch and Tilly 1993 ) . The details of the

mechanisms of plasmid transfer between gram-positive bacteria are still unclear

(Grohmann et al. 2003 ) .

Rhodococcus is one of the most important genera among gram-positive degrad-

ers of alkanes, PCBs, and naphthalene, and many plasmids have been identi ﬁ ed in

the Rhodococcus species (Table 8.4 ). pBD2 is a conjugative linear plasmid that car-

ries ipb genes for the catabolism of isopropylbenzene, and it was detected in R .

erythropolis BD2 (Dabrock et al. 1994 ; Stecker et al. 2003 ) . pREL1 and pREC1

were identi ﬁ ed in R . erythropolis PR4, an alkane-degrader (Sekine et al. 2006 ) .

Several DNA regions in pREL1 and pBD2 are conserved, including genes that

encode for terminal protein, lipoproteins, and heavy metal resistance. However, the

degradative genes for alkane (pREL1) and for isopropylbenzene (pBD2) are not

conserved (Sekine et al. 2006 ) .

R . jostii RHA1 can degrade polychlorinated biphenyls (PCBs) (Seto et al. 1995 ) ,

and its complete genome sequence has been determined (McLeod et al. 2006 ) . This

strain harbors three linear plasmids, pRHL1, pRHL2, and pRHL3 (Shimizu et al.

2001 ; Masai et al. 1997 ) , and most of the genes involved in the biphenyl degradative

pathway are located on the two larger plasmids, pRHL1 and pRHL2 (Shimizu et al.

2001 ) . Notably, many catabolic isozyme genes are distributed throughout the RHA1

genome (Kitagawa et al. 2001 ; Sakai et al. 2002 ; McLeod et al. 2006 ) . The four

replicons of RHA1, including the three plasmids and its linear chromosome, were

suggested to be similar types of linear elements, because their TIRs are highly simi-

lar (McLeod et al. 2006 ) .

Arthrobacter utilizes a wide and varied range of xenobiotic compounds and several

catabolic plasmids have been identi ﬁ ed in this genus (Table 8.4 ). pAL1 is a linear

catabolic plasmid that was detected in the 2-methylquinoline-degrading Arthrobacter

nitorguajacolicus Rü61a strain (Parschat et al. 2007 ; Overhage et al. 2005 ) . The rep-

lication region of pAL1 was analyzed in detail, and it revealed that this plasmid carries

a novel Rep gene (Kolkenbrock et al. 2010 ; Wagenknecht and Meinhardt 2011 ) .

Parschat et al. (

2007 ) showed that several regions of pAL1 are conserved in pAL1 and

the pBD2, pREL1, and pRHL2 plasmids mentioned above, and also in the dibenzo-

furan-degradative plasmid pDBF1 from Terrabacter sp. DBF63 (Nojiri et al. 2002 ;

Habe et al. 2005 ) . One of the regions includes putative genes for a secretion system

possibly involved in conjugation (Parschat et al. 2007 ) . Similarly, 2,3-dihydroxybi-

phenyl dioxygenase BphC genes are conserved on pLP6 and pTSA421 found in

R . globerulus P6 and R . erythropolis TA421 (Kosono et al. 1997 ) .

191

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Other types of catabolic plasmids have also been reported (Table 8.4 ). pLW1071

is a circular plasmid from Geobacillus thermodentri ﬁ cans NG80-2 that carries deg-

radative genes for long-chain alkanes (Feng et al. 2007 ) . This plasmid is unique in

comparison to other sequenced plasmids, except for a plasmid from Geobacillus

sp., G11MC16 (accession no. NZ_ABVH01000017). The putative Rep gene of the

plasmid of G11MC16 was similar to that of NG80-2. pGKT2 is a 182-kb circular

plasmid carrying xplAB genes found in the hexahydro-1,3,5-trinitro-1,3,5-triazine

degrader Gordonia sp. KTR9 (Indest et al.

2010 ) . Gordonia spp. are a metabolically

diverse group, with regards to their ability to degrade xenobiotic compounds, and

recently, two other catabolic plasmids have been reported in this genus (Table 8.4 ).

Catabolic genes in gram-positive bacteria may also be spread by self-transmissible

plasmids (listed in Table 8.4 ), similar to that observed in the case of gram-negative

plasmids, and have an important role in their HGT, although their host range remains

unclear.

3 Catabolic Transposons

In some cases, catabolic genes are ﬂ anked by two copies of the same or highly-

identical insertion sequences (ISs). These elements are known as composite trans-

posons. Tn 5280 (van der Meer et al. 1991a ) , Tn HadI ( Kawasaki et al. 1985 ) ; Sota

et al. 2002 ) , and DEH (Weightman et al. 2002 ) are composite transposons whose

transposition ability has been experimentally validated (Table 8.5 ). As for Tn- DhaI ,

it encodes pcrABCT which is involved in reductive dechlorination of tetrachlo-

roethene in Desul ﬁ tobacterium hafniense TCE1, and detection of the circular form

of the transposon strongly indicated that it could transpose (Maillard et al. 2005 ) . As

genome sequences of an increasing number of xenobiotic-degrading bacteria are

determined, many composite transposon-like genetic structures are being discov-

ered (Table 8.5 ). Homologous recombination events among several copies of the

identical ISs located on regions surrounding catabolic genes possibly increase the

plasticity of the genome. There are two kinds of ISs, IS 6100 and IS 1071 , which

were frequently associated with various catabolic genes. IS 6100 was originally iso-

lated as part of the composite transposon Tn 6100 from Mycobacterium fortuitum

(Martin et al. 1990 ) , and was found in a wide range of host bacteria, such as

Sphingomonas (Dogra et al. 2004 ) , Arthrobacter (Kato et al. 1994 ) , Pseudomonas

(Hall et al. 1994 ) , Xanthomonas (Sundin and Bender 1995 ) , Salmonella (Boyd et al.

2000 ) , and Corynebacterium (Tauch et al. 2002 ) . The IS elements were also found

in many kinds of xenobiotic-degrading bacteria, and some of them form composite

transposon-like structures (Table 8.5 ). IS 6100 was found in many g -HCH-degrading

sphingomonads in the region ﬂ anking the lin genes involved in g -HCH-degradation,

suggesting that this IS may have played a key role in the recruitment of the lin genes

in these bacteria (Nagata et al. 2011 ) .

IS 1071 was originally identi ﬁ ed in a chlorobenzoate-catabolic transposon,

Tn 5271 , from Comamonas testosteroni BR60 (Nakatsu et al. 1991 ) . IS 1071 belongs

192

M. Shintani and H. Nojiri

Table 8.5 Catabolic transposons

Elements

(plasmid) Substrates

Host

Size

(kb)

Transpos-

ability

IS Gene References

Class I composite transposons

Tn 5542

(pHMT112)

Benzene Pseudomonas

putida ML2

12 NA IS 1489 bed Fong et al. ( 2000 )

Tn 5280

(pP51)

Chlorobenzene Pseudomonas

sp. P51

9 + IS 1066 ,

IS 1067

tcbAaAbAcAdB van der Meer et al. (

1991a )

Tn 5707

(pENH91)

3-Chlorobenzoate Alcaligenes eutrophus

NH9

15 NA IS 1600 cbnRABCD Ogawa and Miyashita

(

1999 )

Tn Ppu - alk1 Pentane Pseudomonas

putida P1

22 NA IS Ppu4 alkST , alkBFGHJKLN van Beilen et al. (

2001 )

Tn 5271

(pBRC60)

Chlorobenzoates Comamonas

testosteroni

BR60

17 NA IS 1071 cbaABC Nakatsu et al. (

1991 )

Tn 5271 -like Chlorobenzoates Alcaligenes

sp. CPE3

16 NA IS 1071 cbaABC Di Gioia et al. (

1998 )

Tn Had1

(pUO1)

Haloacetate Delftia

acidovorans B

9 + IS 1071 dehH1 Sota et al. (

2002 )

DEH

a -Halocarboxylic

acids

Pseudomonas

putida PP3

10 + IS Ppu12 dehI , dehR Weightman et al. ( 2002 )

– c

(pWW0)

Xylene, Toluene Pseudomonas

putida mt-2

40 NA IS 1246 xyl Tsuda and Iino ( 1987 ) ;

Greated et al. (

2002 )

(pTDN1)

Aniline Pseudomonas

putida UCC22

26 NA IS 1071 tdnQA1A2B Saint et al. (

1990 ) ;

Fukumori and Saint

(

1997, 2001 )

(pTSA)

p -Toluenesulphonate Comamonas testos-

teroni T2

21 NA IS 1071 tsaMBCD Junker and Cook (

1997 ) ;

Tralau et al. (

2001 )

–c

(pADP-1)

Atrazine Pseudomonas

sp. ADP

13 NA IS 1071 atzA Martinez et al. (

2001 )

193

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Elements

(plasmid) Substrates

Host

Size

(kb)

Transpos-

ability

IS Gene References

–c

(pADP-1)

Atrazine Pseudomonas

sp. ADP

15 NA IS 1071 atzB Martinez et al. (

2001 )

(pPOB)

4-Carboxydiphenyl ether Pseudomonas

pseudoalcaligenes

POB310

NA NA IS 1071 pobAB Dehmel et al. (

1995 )

Tn- Dha1

Tetrachloroehene Desul ﬁ tobacterium

hafniense TCE1

10 +

I S Dha1 pcrABCT Maillard et al. ( 2005 )

Tn 6063

(pWDL2)

3-Chloroaniline Comamonas

testosteroni

WDL2

22 NA IS 1071 dcaQTA1A2BR Król et al. (

2012 )

Tn 6063

(pNB8c)

3-Chloroaniline Delftia acidovorans

B8c

22 NA IS 1071 dcaQTA1A2BR Król et al. ( 2012 )

Tn CNB1 4-Chloronitrobenzene Comamonas sp.

CNB-1

45 NA IS 1071 cnb Ma et al. (

2007 )

– c

Aniline Delftia tsuruhatensis

AD9

~25 NA IS 1071 tad Liang et al. ( 2005 )

– c

(pJP4)

2,4-D Ralstonia eutropha

JMP134

~44 NA IS 1071 tfd - I , tfd - II Trefault et al. ( 2004 )

–c

(pJP4)

2,4-D Ralstonia eutropha

JMP134

~10 NA IS JP4 tfd - II Trefault et al. (

2004 )

–c

(pEST4011)

2,4-D Achromobacter

xylosoxidans subsp.

denitri ﬁ cans

EST4002

48 NA IS 1071 ::

IS 1471

tfd Vedler et al. (

2004 )

Tn AxI (pA81) Chlorobenzoate Achromobacter

xylosocidans A8

39 NA IS Ax1a ,

IS Ax1b

mocpRABCD ,

hybRABCD

Jencova et al. (

2008 )

–c

(pSAH)

2-Aminobenzenesulfonate Alcaligenes sp. O-1 12 NA IS 1240 -like abs Ruff et al. (

2010 )

– c

Carbazole Sphingobium

yanoikuyae

XLDN2-5

8 N A I S 6100 carRAaBaBbCAc Gai et al. (

2010 )

(continued)

194

M. Shintani and H. Nojiri

Table 8.5 (continued)

Elements

(plasmid) Substrates

Host

Size

(kb)

Transpos-

ability

IS Gene References

–

Carbazole Sphingobium yanoi-

kuyae XLDN2-5

4 N A I S 6100 antRACAdAbAa Gai et al. ( 2010 )

–

Carbazole Sphingobium yanoi-

kuyae XLDN2-5

7 N A I S 6100 fdr Gai et al. ( 2010 )

–

2-Chloronitrobenzene Pseudomonas stutzeri

ZWLR2-1

9 N A I S 6100 cnbCEFAbAaD Liu et al. ( 2011 )

–

2-Chloronitrobenzene Pseudomonas stutzeri

ZWLR2-1

5 N A I S 6100 cnbAcAd Liu et al. ( 2011 )

–

2-Chloronitrobenzene Pseudomonas stutzeri

ZWLR2-1

12 NA IS 6100 cnbCEFAbAaD ,

cnbAcAd

Liu et al. ( 2011 )

Tn mph

(pZWL0)

Methyl parathion Pseudomonas sp.

WBC-3

4 + IS 6100 mph Wei et al. ( 2009 )

Tn opdA Organophosphate Agrobacterium

radiobacter P230

6 + IS 6100 opdA Horne et al. (

2003 )

–c

(pLB1)

g -HCH Unidenti ﬁ ed soil

bacterium

4 N A I S 6100 linB Miyazaki et al. (

2006 )

–c

(pOAD2)

Nylon oligomers Flavobacterium sp.

K172

15 NA IS 6100 nylABC Kato et al. (

1994, 1995 )

–c

(pCAR1)

Carbazole Pseudomonas

resinovorans CA10

6 N A I S Pre1 antABC Nojiri et al. (

2001 ) ; Maeda

et al. (

2003 ) ;

Takahashi et al. (

2009 )

IS Pre2

–c

(pCAR1)

Carbazole Pseudomonas

resinovorans

CA10

16 NA IS Pre1 carABCD Nojiri et al. (

2001 ) ;

Maeda et al. (

2003 ) ;

Takahashi et al.

(

2009 )

–

Carbazole Pseudomonas stutzeri

OM1

55 NA I SPst3 carABCDEF , antABC Shintani et al. ( 2003 )

195

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Elements

(plasmid) Substrates

Host

Size

(kb)

Transpos-

ability

IS Gene References

–c

(pCAR3)

Carbazole Novosphingobium

sp. KA1

82 NA ISSsp1 car , and , cat Shintani et al. (

2007 )

– Monobromoacetate X . autotrophicus

GJ10

N A + I S 1247 dhlB van der Ploneg et al.

(

1995 )

Class II transposon

Tn 4651

(pWW0)

Xylene, tolene Pseudomonas putida

mt-2

56 + – xyl Tsuda and Iino ( 1987 ) ;

Tsuda et al. (

1989 )

Tn 4653

(pWW0)

Xylene, toluene Pseudomonas putida

mt-2

70 + – xyl Tsuda and Iino ( 1988 ) ;

Tsuda et al. (

1989 )

Tn 4656

(pWW53)

Xylene, toluene Pseudomonas putida

MT53

37 + – xyl Tsuda and Genka ( 2001 )

Tn 4657

(pWW53)

Xylene, toluene Pseudomonas putida

MT53

86 + – xyl Yano et al. ( 2007 )

Tn 4660

(pWW53)

Xylene, toluene Pseudomonas putida

MT53

62 – – xyl Yano et al. ( 2007 )

Tn 4663

(pDK1)

Xylene, toluene Pseudomonas putida

HS1

41 + – xyl Yano et al. ( 2010 )

Tn 4655

(NAH7)

Naphthalene Pseudomonas putida

37 –

– xyl Tsuda and Iino ( 1990 ) ;

Sota et al. (

2006 )

Tn Had2

(pUO1)

Haloacetate Delftia

acidovorans B

16 + – dehH1 , dehH2 Sota et al. ( 2002 )

Tn 4676

(pCAR1)

Carbazole Pseudomonas

resinovorans

CA10

73 + – carABCDEF , Maeda et al. (

2003 ) ;

Shintani et al. (

2005,

2011 )

–c

(pKW1)

Chlorobenzene Pseudomonas putida

GJ31

15 NA – cbz Kunze et al. (

2009 )

2,4-D represents 2,4-Dichlorophenoxyacetic acid

NA means not available

Whole nucleotide sequences are available

Strong indications for the transposition activity of IS Dha1 were observed by PCR ampli ﬁ cation and sequencing of the intervening sequence located between

both IRs of IS Dha1 (Maillard et al.

2005 )

Tn 4655 did not carry the tnpA gene but was able to form a cointegrate when the tnpA gene from Tn 4653 was supplied in trans (Tsuda and Iino 1990 ; Sota et al. 2006 )

196

M. Shintani and H. Nojiri

to the class II transposons, which generally carry the genes for their transposition

( tnpA , tnpR , and res ) and one or more phenotypic traits between their terminal

inverted repeats (Grindley 2002 ) . This type of transposon generates a cointegrate of

donor and target molecules, and the cointegrate is then resolved at the resolution

( res ) sites by TnpR (resolvase). This resolution function, however, is lacking in

IS 1071 . The copy number of class II transposons doubles after their transposition

by means of a mechanism known as “copy and paste” transposition (Grindley

2002 ) .

Many IS 1071 sequences have been identi ﬁ ed in close proximity to various xenobi-

otic-degradative genes on self-transmissible plasmids from environmental bacteria

(Table 8.5 ). These data indicate that IS 1071 might have been involved in the recruit-

ment of catabolic genes to these plasmids and in the dissemination of these genes

among various host strains.

It should be noted that some class II transposons (Grindley 2002 ) that carry cata-

bolic genes are found in various xenobiotic-degrading bacteria (Table 8.5 ). In addi-

tion to the extensively characterized Tn 4651 /Tn 4653 in the toluene/xylene-degradative

plasmid pWW0 (IncP-9) (Tsuda and Iino 1987, 1988 ; Tsuda et al. 1989 ) , these types

of transposons are found in two other toluene/xylene-degradative plasmids, namely

pWW53 (IncP-7) and pDK1 (IncP-7), the carbazole degradative plasmid pCAR1

(IncP-7), and the naphthalene degradative plasmid NAH7 (IncP-9). Notably, the

transposition function of most of these transposons has been experimentally veri ﬁ ed

(Table 8.5 , Yano et al. 2007, 2010 ; Shintani et al. 2005, 2011 ) . Although Tn 4655 in

NAH7 lacks the tnpA gene (Sota et al. 2006 ) , it is able to form a cointegrate when the

tnpA gene of Tn 4653 is supplied in trans (Tsuda and Iino 1990 ; Sota et al. 2006 ) .

These class II transposons might have been ef ﬁ ciently spread among bacterial repli-

cons via their “copy and paste” transposition, and they can carry longer DNA regions

than class I composite transposons can.

4 Catabolic ICEs

ICEs are self-transmissible MGEs that are integrated in the chromosome. These

elements carry genes for conjugative transfer and also excision systems to excise

from the chromosome (Burrus and Waldor 2004 ; Wozniak and Waldor 2010 ) . They

are replicated as a part of the chromosome, they excise from the chromosome, cir-

cularize and then transfer to new hosts, sometimes leading to the integration into

these new host chromosomes (Burrus and Waldor 2004 ; Wozniak and Waldor 2010 ) .

ICEs are dif ﬁ cult to identify experimentally, because they are usually physically

linked to the host chromosome (Wozniak and Waldor 2010 ) . ICE

clc

(Ravatn et al.

1998a ) , bph - sal element (Nishi et al. 2000), and ICE

KKS

4677 (Ohtsubo et al. 2003,

2006, 2012 ) are the ICEs that have been veri ﬁ ed experimentally (Table 8.6 ). Among

these, the most in-depth analyses, such as on the mechanisms for excision, transfer,

and impact on the host cell, have been performed for ICE

clc

(Ravatn et al. 1998a, b ;

Gaillard et al. 2006, 2008, 2010 ; Sentchilo et al. 2009 ; Miyazaki and van der Meer

2011a, b ) .

197

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Table 8.6 Catabolic ICEs

ICE Host ICE family

Substrate

Size

(kb) Transferability

Gene References

ICE

KKS102

4677

Acirovorax

sp. KKS102

ICE

Tn 4371

Biphenyl 62 + bph Ohtsubo et al.

(

2003, 2006, 2012 )

ICE-GI1

Bordetella petrii

DSM 12804

ICE

clc

– 255 NA Putative

monooxygenase

Lechner et al. ( 2009 )

ICE-GI2

Bordetella petrii

DSMZ 12804

ICE

clc

– 143 NA ben , cat Lechner et al. ( 2009 )

ICE-GI3

Bordetella petrii

DSM 12804

ICE

clc

– 102 + cat Lechner et al. ( 2009 )

ICE Bxe LB400-1

Burkholderia xenovorans

LB400

ICE

clc

Biphenyl 123 NA clc Cain et al. ( 2006 ) ;

Gaillard et al.

(

2006 )

phn -island

Delftia sp. Cs1-4 Unclassi ﬁ ed Phenanthrene 232 NA phn , oph Hickey et al. ( 2012 )

bph - sal element P . putida KF715 Unclassi ﬁ ed Biphenyl/salicylate 90 + bph , nah Nishi et al. (

2000 )

ICE

Tn 4371

6065

Palaromonas

naphthalenivorans

CJ2 (pPNAP01)

ICE

Tn 4371

Naphthalene 70 NA bph , nah Ryan et al. ( 2009 )

ICE

clc

(B13)

Pseudomonas

knackmussii B13

ICE

clc

Chlorocatechol 105 + clc Ravatn et al. ( 1998a )

ICE

clc

(JS705) Ralstonia

eutropha JS705

ICE

clc

Chlorocatechol 115 NA clc , mcb Müller et al. ( 2003 )

ICE

Tn 4371

Ralstonia

oxalatica A5

ICE

Tn 4371

Biphenyl 55 NA bph Springael et al. ( 1993 ) ;

Merlin et al.

(

1999 ) ; Toussaint

et al. (

2003 )

Classi ﬁ cation based on ICEberg ( http://db-mml.sjtu.edu.cn/ICEberg/ ) and Bi et al. ( 2012 )

NA means not available

Whole nucleotide sequences are available

198

M. Shintani and H. Nojiri

Recently, in silico analyses of complete bacterial genomes have identi ﬁ ed putative

ICEs in several b - and g - proteobacteria . Indeed, such analyses of many complete

bacterial genomes showed that ICEs are spread among various bacterial subdivisions,

and more than 400 putative ICEs are listed in ICEberg (

http://db-mml.sjtu.edu.cn/

ICEberg/ ) (Bi et al. 2012 ) . Ryan et al. ( 2009 ) reported that an ICE

Tn 4731

-related ICE

was found in several bacterial genome sequences, and one of them, ICE

Tn 4371

6065 ,

carrying the bph gene, was found in a naphthalene degrader, Polaromonas naphtha-

lenivorans CJ2. Interestingly, Bordetella petrii DSM 12804 possesses at least seven

large ICEs mostly encoding metabolic functions involved in the degradation of aro-

matic compounds and detoxi ﬁ cation of heavy metals (Lechner et al. 2009 ) . Four of

them, ICE-GI1, ICE-GI2, ICE-GI3, and ICE-GI6, are closely related to ICE

clc

, and the

ﬁ rst three carry putative catabolic genes (Table 8.6 ). It should be noted that their cir-

cular intermediates have been detected, and that transmissibility of ICE-GI3 has been

con ﬁ rmed (Lechner et al. 2009 ) . Hichey et al. found a new ICE in the genome of the

PAHs-degrader, Delftia sp. Ds1-4, which carries all of the required phenanthrene cata-

bolic genes (Hickey et al. 2012 ) . Because ICEs are not necessarily replicated as circu-

lar forms after their integration into the host chromosome, host ranges of ICEs are not

dictated by whether the ICEs can be replicated in the host cells. Therefore, their host

ranges are likely to be wider than that of other MGEs.

5 Behaviors of Catabolic MGEs

Bioaugmentation by inoculation of highly ef ﬁ cient xenobiotic degraders into pol-

luted sites has been studied as an attractive approach to remove pollutants. However,

it is dif ﬁ cult to maintain the high levels of degradative ability of these inoculants,

because they are not necessarily able to compete or survive in natural environments

(Top et al. 2002 ) . The catabolic MGEs, especially conjugative elements, can be used

in alternative bioaugmentation by utilizing the transferability of MGEs into the

indigenous bacteria in the polluted sites. In bioaugmentation via inoculation with

degraders harboring MGEs, known as “gene bioaugmentation” or “plasmid-medi-

ated bioaugmentation,” the survival of the inoculated degraders is not needed (Bathe

2004 ; Bathe et al. 2005 ; Dejonghe et al. 2000 ; Pepper et al. 2002 ) . There are still,

however, large gaps between laboratory conditions and natural systems, and the

basic features of MGEs in laboratory conditions do not necessarily re ﬂ ect their

actual behavior in natural systems. Many trials have been conducted to bridge the

differences between these conditions by using arti ﬁ cial model environments, which

model natural habitats such as soil, plants, and water. While the behaviors of the

IncP-1, P-7, and P-9 group plasmids have been summarized recently (Shintani et al.

2010 ) , those of other plasmids, which belong to unknown Inc groups, have been

also reported. Detailed analyses have been performed to analyze the effect of con-

jugative transfer of two kinds of 2,4-D degradative plasmids in soil by using pEMT1

and IncP-1 plasmid pEMT3 in different donors (Top et al. 1995 ; Dejonghe et al.

2000 ; Goris et al. 2002 ) . Top et al. ( 2002 ) concluded that these catabolic plasmids

199

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

were most often transferred to, and their genes expressed in, strains that belong to

the genera Burkholderia , Ralstonia , and Pseudomonas . Transfer of the plasmid

pTOM carrying constitutively transcribed toluene-degradative genes ( tom ) was

shown from Burkholderia cepacia to different endogenous endophytic bacteria in

yellow lupine (Barac et al.

2004 ) or poplar cuttings (Taghavi et al. 2005 ) . Springael

et al. reported that ICE

clc

(B13) of P . putida BN210 was transferred to different

bacteria belonging to the class of b - proteobacteria in bio ﬁ lm reactors under non-

sterile conditions (Springael et al. 2002 ) .

These studies, together with those of IncP-1, P-7 and P-9 plasmids, strongly

indicate that HGT by means of catabolic MGEs generally occurs in natural environ-

ments. Nevertheless, it is still dif ﬁ cult to predict how the catabolic plasmids or their

hosts behave in these environments. A more in-depth understanding of HGT of

MGEs will be required for practical application of plasmid-mediated bioaugmenta-

tion. Behaviors of the MGEs should be analyzed in microbial communities that

include uncultivated and non-cultivable bacteria in natural environments. Several

cultivation-independent methods to monitor the behavior of environmental bacteria

have been reported. Metagenomic analysis combined with reverse-transcriptase

real-time PCR analysis revealed the changes in the bacterial community and in

abundant functional genes in contaminated environments (Yergeau et al. 2012 ) .

Ishii et al. ( 2011 ) identi ﬁ ed the active N

O reducers in rice paddy soil using stable

isotope probing and functional single-cell isolation by micromanipulation. In another

study, ﬂ uorescence-activated cell sorting (FACS) and micromanipulation enabled

the identi ﬁ cation and cultivation of independent plasmid transconjugants (Musovic

et al. 2006, 2010 ) . The combinations of these cultivation-independent and cultivation-

dependent methods will shed light on HGT in microbial communities in various

natural environments.

6 Conclusion and Perspectives

As an increasing number of whole genome sequences of bacteria capable of

degrading various kinds of xenobiotic compounds are analyzed, a large number of

catabolic MGEs have been discovered and studied recently. In silico analyses of

the genome sequences of these bacteria enable us to detect new ISs and ICEs;

however, experimental con ﬁ rmation of their ability to mobilize is still required to

further our understanding of how they are transmitted among bacteria or repli-

cons. On the other hand, nucleotide sequence information on other Inc group plas-

mids from Pseudomonas , such as IncP-2 or other plasmids not af ﬁ liated to any Inc

group (Table 8.1 ), is also required for further classi ﬁ cation of the newly-identi ﬁ ed

plasmids.

Jones and Marchesi ( 2007 ) developed a method for transposon-aided capture of

plasmids to discover novel plasmids in various bacterial habitats. This method

allowed them to identify plasmids that did not rely on the plasmids’ own replication

and transfer systems. Indeed, many novel MGEs have been identi ﬁ ed in various sites

200

M. Shintani and H. Nojiri

by the method mentioned above and by metagenomic analyses, such as in activated

sludge (Zhang et al. 2011a ) , river or sea sediments (Elsaied et al. 2011 ; Kristiansson

et al. 2011 ) , wastewater treatment plants (Szczepanowski et al. 2008 ) , human dental

plaque (Warburton et al.

2011 ) , and human gut (Jones et al. 2010 ) . These reports

suggest that a huge number of unidenti ﬁ ed MGEs exist in the environment. Detection

and analyses of new catabolic MGEs will help us to understand the mechanism by

which MGEs spread and also determine which MGEs are capable of spreading in

natural bacterial communities, including those that contain uncultivated and non-

cultivable bacteria. These MGEs can possibly be used as new tools for genetic analysis

of unidenti ﬁ ed bacteria.

Acknowledgement The writing of this book chapter was supported by the Special Postdoctoral

Researcher Program of Riken and by JSPS KAKENHI Grant Number 24780087 to M.S.

References

Aislabie J, Bej AK, Ryburn J, Lloyd N, Wilkins A (2005) Characterization of Arthrobacter nicoti-

novorans HIM, an atrazine-degrading bacterium, from agricultural soil New Zealand. FEMS

Microbiol Ecol 52:279–286

Aminov RI (2011) Horizontal gene exchange in environmental microbiota. Front Microbiol 2:158

Andreoni V, Bestetti G (1986) Comparative analysis of different Pseudomonas strains that degrade

cinnamic acid. Appl Environ Microbiol 52:930–934

Anson JG, Mackinnon G (1984) Novel pseudomonas plasmid involved in aniline degradation.

Appl Environ Microbiol 48:868–869

Baitsch D, Sandu C, Brandsch R, Igloi GL (2001) Gene cluster on pAO1 of Arthrobacter nicotino-

vorans involved in degradation of the plant alkaloid nicotine: cloning, puri ﬁ cation, and charac-

terization of 2,6-dihydroxypyridine 3-hydroxylase. J Bacteriol 183:5262–5267

Barac T, Taghavi S, Borremans B, Provoost A, Oeyen L, Colpaert JV, Vangronsveld J, van der Lelie

D (2004) Engineered endophytic bacteria improve phytoremediation of water-soluble, volatile,

organic pollutants. Nat Biotechnol 22:583–588

Bartilson M, Nordlund I, Shingler V (1990) Location and organization of the dimethylphenol cata-

bolic genes of Pseudomonas CF600. Mol Gen Genet 220:294–300

Basta T, Keck A, Klein J, Stolz A (2004) Detection and characterization of conjugative degradative

plasmids in xenobiotic-degrading Sphingomonas strains. J Bacteriol 186:3862–3872

Basta T, Buerger S, Stolz A (2005) Structural and replicative diversity of large plasmids from

sphingomonads that degrade polycyclic aromatic compounds and xenobiotics. Microbiology

151:2025–2037

Bathe S (2004) Conjugal transfer of plasmid pNB2 to activated sludge bacteria leads to 3-chloroaniline

degradation in enrichment cultures. Lett Appl Microbiol 38:527–531

Bathe S, Schwarzenbeck N, Hausner M (2005) Plasmid-mediated bioaugmentation of activated sludge

bacteria in a sequencing batch moving bed reactor using pNB2. Lett Appl Microbiol 41:242–247

Beil S, Timmis KN, Pieper DH (1999) Genetic and biochemical analyses of the tec operon suggest

a route for evolution of chlorobenzene degradation genes. J Bacteriol 181:341–346

Bi D, Xu Z, Harrison EM, Tai C, Wei Y, He X, Jia S, Deng Z, Rajakumar K, Ou HY (2012)

ICEberg: a web-based resource for integrative and conjugative elements found in Bacteria.

Nucleic Acids Res 40:D621–D626

Boon N, Goris J, De Vos P, Verstraete W, Top EM (2000) Bioaugmentation of activated sludge by

an indigenous 3-chloroaniline-degrading Comamonas testosteroni strain, I2 gfp . Appl Environ

Microbiol 66:2906–2913

201

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Boon N, Goris J, De Vos P, Verstraete W, Top EM (2001) Genetic diversity among 3-chloroaniline- and

aniline-degrading strains of the Comamonadaceae . Appl Environ Microbiol 67:1107–1115

Boyd DA, Peters GA, Ng L, Mulvey MR (2000) Partial characterization of a genomic island asso-

ciated with the multidrug resistance region of Salmonella enterica Typhymurium DT104.

FEMS Microbiol Lett 189:285–291

Bramucci M, Chen M, Nagarajan V (2006) Genetic organization of a plasmid from an industrial

wastewater bioreactor. Appl Microbiol Biotechnol 71:67–74

Bröker D, Arenskötter M, Legatzki A, Nies DH, Steinbüchel A (2004) Characterization of the

101-kilobase-pair megaplasmid pKB1, isolated from the rubber-degrading bacterium Gordonia

westfalica Kb1. J Bacteriol 186:212–225

Bröker D, Arenskötter M, Steinbüchel A (2008) Transfer of megaplasmid pKB1 from the rubber-

degrading bacterium Gordonia westfalica strain Kb1 to related bacteria and its modi ﬁ cation.

Appl Microbiol Biotechnol 77:1317–1327

Burlage RS, Bemis LA, Layton AC, Sayler GS, Larimer F (1990) Comparative genetic organiza-

tion of incompatibility group P degradative plasmids. J Bacteriol 172:6818–6825

Burrus V, Waldor MK (2004) Shaping bacterial genomes with integrative and conjugative ele-

ments. Res Microbiol 155:376–386

Carattoli A (2009) Resistance plasmid families in Enterobacteriaceae . Antimicrob Agents

Chemother 53:2227–2238

Cérémonie H, Boubakri H, Mavingui P, Simonet P, Vogel TM (2006) Plasmid-encoded gamma-

hexachlorocyclohexane degradation genes and insertion sequences in Sphingobium francense

(ex- Sphingomonas paucimobilis Sp+). FEMS Microbiol Lett 257:243–252

Chain PS, Denef VJ, Konstantinidis KT, Vergez LM, Agulló L, Reyes VL, Hauser L, Córdova M,

Gómez L, González M, Land M, Lao V, Larimer F, LiPuma JJ, Mahenthiralingam E, Malfatti

SA, Marx CJ, Parnell JJ, Ramette A, Richardson P, Seeger M, Smith D, Spilker T, Sul WJ,

Tsoi TV, Ulrich LE, Zhulin IB, Tiedje JM (2006) Burkholderia xenovorans LB400 harbors a

multi-replicon, 9.73-Mbp genome shaped for versatility. Proc Natl Acad Sci USA

103:15280–15287

Chakrabarty AM (1972) Genetic basis of the biodegradation of salicylate in Pseudomonas . J

Bacteriol 112:815–823

Chakrabarty AM (1973) Genetic fusion of incompatible plasmids in Pseudomonas . Proc Natl Acad

Sci USA 70:1641–1644

Chatterjee DK, Chakrabarty AM (1982) Genetic rearrangements in plasmids specifying total deg-

radation of chlorinated benzoic acids. Mol Gen Genet 188:279–285

Chatterjee DK, Chakrabarty AM (1984) Restriction mapping of a chlorobenzoate degradative plas-

mid and molecular cloning of the degradative genes. Gene 27:173–181

Chatterjee DK, Kellogg ST, Hamada S, Chakrabarty AM (1981) Plasmid specifying total degra-

dation of 3-chlorobenzoate by a modi ﬁ ed ortho pathway. J Bacteriol 146:639–646

Cho JC, Kim SJ (2001) Detection of mega plasmid from polycyclic aromatic hydrocarbon-degrading

Sphingomonas sp. strain KS14. J Mol Microbiol Biotechnol 3:503–506

Connors MA, Barnsley EA (1980) Metabolism of naphthalene by pseudomonads: salicylaldehyde

as the ﬁ rst possible inducer in the metabolic pathway. J Bacteriol 141:1052–1054

Copley SD, Rokicki J, Turner P, Daligault H, Nolan M, Land M (2012) The whole genome

sequence of Sphingobium chlorophenolicum L-1: insights into the evolution of the pentachlo-

rophenol degradation pathway. Genome Biol Evol 4:184–198

Dabrock B, Kesseler M, Averhoff B, Gottschalk G (1994) Identi ﬁ cation and characterization of a

transmissible linear plasmid from Rhodococcus erythropolis BD2 that encodes isopropylben-

zene and trichloroethene catabolism. Appl Environ Microbiol 60:853–860

de Souza ML, Wackett LP, Sadowsky MJ (1998) The atzABC genes encoding atrazine catabolism

are located on a self-transmissible plasmid in Pseudomonas sp. strain ADP. Appl Environ

Microbiol 64:2323–2326

Dehmel U, Engesser KH, Timmis KN, Dwyer DF (1995) Cloning, nucleotide sequence, and

expression of the gene encoding a novel dioxygenase involved in metabolism of carboxydiphe-

nyl ethers in Pseudomonas pseudoalcaligenes POB310. Arch Microbiol 163:35–41

202

M. Shintani and H. Nojiri

Dejonghe W, Goris J, El Fantroussi S, Höfte M, De Vos P, Verstraete W, Top E (2000) Effect of

dissemination of 2,4-dichlorophenoxyacetic acid (2,4-D) degradation plasmids on 2,4-D

degradation and on bacterial community structure in two different soil horizons. Appl

Environ Microbiol 66:3297–3304

Dejonghe W, Goris J, Dierickx A, De Dobbeleer V, Crul K, De Vos P, Verstraete W, Top EM

(2002) Diversity of 3-chloroaniline and 3,4-dichloroaniline degrading bacteria isolated from

three different soils and involvement of their plasmids in chloroaniline degradation. FEMS

Microbiol Ecol 42:315–325

Dennis JJ (2005) The evolution of IncP catabolic plasmids. Curr Opin Biotechnol 16:291–298

Dennis JJ, Zylstra GJ (2004) Complete sequence and genetic organization of pDTG1, the 83 kilo-

base naphthalene degradation plasmid from Pseudomonas putida strain NCIB 9816-4. J Mol

Biol 341:753–768

Di Gioia D, Peel M, Fava F, Wyndham RC (1998) Structures of homologous composite transpo-

sons carrying cbaABC genes from Europe and North America. Appl Environ Microbiol

64:1940–1946

Dogra C, Raina V, Pal R, Suar M, Lal S, Gartemann KH, Holliger C, van der Meer JR, Lal R (2004)

Organization of lin genes and IS 6100 among different strains of hexachlorocyclohexane-

degrading Sphingomonas paucimobilis : evidence for horizontal gene transfer. J Bacteriol

186:2225–2235

Don RH, Pemberton JM (1981) Properties of six pesticide degradation plasmids isolated from

Alcaligenes paradoxus and Alcaligenes eutrophus . J Bacteriol 145:681–686

Don RH, Weightman AJ, Knackmuss HJ, Timmis KN (1985) Transposon mutagenesis and cloning

analysis of the pathways for degradation of 2,4-dichlorophenoxyacetic acid and 3-chloroben-

zoate in Alcaligenes eutrophus JMP134(pJP4). J Bacteriol 161:85–90

Dunn NW, Gunsalus IC (1973) Transmissible plasmid coding early enzymes of naphthalene oxida-

tion in Pseudomonas putida . J Bacteriol 114:974–979

Dutton JR, Venables WA, Saint CP (1995) Comamonas acidovorans UCC61 catabolizes o -phthalate

via a 4,5-oxygenation pathway that is encoded on a 70 kbp section of plasmid pOPH1 bounded

by directly repeated sequences. Microbiology 141:1673–1682

Eaton RW (2001) Plasmid-encoded phthalate catabolic pathway in Arthrobacter keyseri 12B.

J Bacteriol 183:3689–3703

Eaton RW, Timmis KN (1986) Characterization of a plasmid-speci ﬁ ed pathway for catabolism of

isopropylbenzene in Pseudomonas putida RE204. J Bacteriol 168:123–131

Elsaied H, Stokes HW, Kitamura K, Kurusu Y, Kamagata Y, Maruyama A (2011) Marine integrons

containing novel integrase genes, attachment sites, attI , and associated gene cassettes in pol-

luted sediments from Suez and Tokyo Bays. ISME J 5:1162–1177

Feng X, Ou LT, Ogram A (1997a) Cloning and sequence analysis of a novel insertion element from

plasmids harbored by the carbofuran-degrading bacterium, Sphingomonas sp. CFO6. Plasmid

37:169–179

Feng X, Ou LT, Ogram A (1997b) Plasmid-mediated mineralization of carbofuran by Sphingomonas

sp. strain CF06. Appl Environ Microbiol 63:1332–1337

Feng L, Wang W, Cheng J, Ren Y, Zhao G, Gao C, Tang Y, Liu X, Han W, Peng X, Liu R, Wang L

(2007) Genome and proteome of long-chain alkane degrading Geobacillus thermodenitri ﬁ cans

NG80-2 isolated from a deep-subsurface oil reservoir. Proc Natl Acad Sci USA 104:5602–5607

Foght JM, Westlake DW (1990) Expression of dibenzothiophene-degradative genes in two

Pseudomonas species. Can J Microbiol 36:718–724

Fong KP, Goh CB, Tan HM (1996) Characterization and expression of the plasmid-borne bedD

gene from Pseudomonas putida ML2, which codes for a NAD+-dependent cis -benzene dihy-

drodiol dehydrogenase. J Bacteriol 178:5592–5601

Fong KP, Goh CB, Tan HM (2000) The genes for benzene catabolism in Pseudomonas putida ML2

are ﬂ anked by two copies of the insertion element IS 1489 , forming a class-I-type catabolic

transposon, Tn 5542 . Plasmid 43:103–110

Frantz B, Chakrabarty AM (1987) Organization and nucleotide sequence determination of a gene

cluster involved in 3-chlorocatechol degradation. Proc Natl Acad Sci USA 84:4460–4464

203

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Fredrickson JK, Brockman FJ, Workman DJ, Li SW, Stevens TO (1991) Isolation and characteriza-

tion of a subsurface bacterium capable of growth on toluene, naphthalene, and other aromatic

compounds. Appl Environ Microbiol 57:796–803

Frost LS, Leplae R, Summers AO, Toussaint A (2005) Mobile genetic elements: the agents of open

source evolution. Nat Rev Microbiol 3:722–732

Fujii T, Takeo M, Maeda Y (1997) Plasmid-encoded genes specifying aniline oxidation from

Acinetobacter sp. strain YAA. Microbiology 143(Pt 1):93–99

Fukumori F, Saint CP (1997) Nucleotide sequences and regulational analysis of genes involved in

conversion of aniline to catechol in Pseudomonas putida UCC22(pTDN1). J Bacteriol

179:399–408

Fukumori F, Saint CP (2001) Complete nucleotide sequence of the catechol metabolic region of

plasmid pTDN1. J Gen Appl Microbiol 47:329–333

Fulthorpe RR, Wyndham RC (1991) Transfer and expression of the catabolic plasmid pBRC60 in

wild bacterial recipients in a freshwater ecosystem. Appl Environ Microbiol 57:1546–1553

Gai Z, Wang X, Liu X, Tai C, Tang H, He X, Wu G, Deng Z, Xu P (2010) The genes coding for the

conversion of carbazole to catechol are ﬂ anked by IS 6100 elements in Sphingomonas sp. strain

XLDN2-5. PLoS One 5:e10018

Gaillard M, Vallaeys T, Vorhölter FJ, Minoia M, Werlen C, Sentchilo V, Pühler A, van der Meer JR

(2006) The clc element of Pseudomonas sp. strain B13, a genomic island with various catabolic

properties. J Bacteriol 188:1999–2013

Gaillard M, Pernet N, Vogne C, Hagenbüchle O, van der Meer JR (2008) Host and invader impact

of transfer of the clc genomic island into Pseudomonas aeruginosa PAO1. Proc Natl Acad Sci

USA 105:7058–7063

Gaillard M, Pradervand N, Minoia M, Sentchilo V, Johnson DR, van der Meer JR (2010)

Transcriptome analysis of the mobile genome ICE

clc

in Pseudomonas knackmussii B13. BMC

Microbiol 10:153

Garcillán-Barcia MP, Francia MV, de la Cruz F (2009) The diversity of conjugative relaxases and

its application in plasmid classi ﬁ cation. FEMS Microbiol Rev 33:657–687

Garcillán-Barcia MP, Alvarado A, de la Cruz F (2011) Identi ﬁ cation of bacterial plasmids based on

mobility and plasmid population biology. FEMS Microbiol Rev 35:936–956

Ghosal D, You IS (1988) Nucleotide homology and organization of chlorocatechol oxidation genes

of plasmids pJP4 and pAC27. Mol Gen Genet 211:113–120

Ghosal D, You IS, Chatterjee DK, Chakrabarty AM (1985) Genes specifying degradation of

3-chlorobenzoic acid in plasmids pAC27 and pJP4. Proc Natl Acad Sci USA 82:1638–1642

Goris J, Dejonghe W, Falsen E, De Clerck E, Geeraerts B, Willems A, Top E, Vandamme P, De Vos

P (2002) Diversity of transconjugants that acquired plasmid pJP4 or pEMT1 after inoculation

of a donor strain in the A- and B-horizon of an agricultural soil and description of Burkholderia

hospita sp. nov. and Burkholderia terricola sp. nov. Syst Appl Microbiol 25:340–352

Greated A, Lambertsen L, Williams PA, Thomas CM (2002) Complete sequence of the IncP-9

TOL plasmid pWW0 from Pseudomonas putida . Environ Microbiol 4:856–871

Grindley NDF (2002) The movement of Tn 3 -like elements: transposition and cointegrate resolution.

In: Craig NL, Craigie R, Gellert M, Lambowitz AM (eds) Mobile DNA II. American Society for

Microbiology, Washington, DC, pp 272–302

Grohmann E, Muth G, Espinosa M (2003) Conjugative plasmid transfer in gram-positive bacteria.

Microbiol Mol Biol Rev 67:277–301, table of contents

Gstalder ME, Faelen M, Mine N, Top EM, Mergeay M, Couturier M (2003) Replication functions

of new broad host range plasmids isolated from polluted soils. Res Microbiol 154:499–509

Guglielmini J, Quintais L, Garcillán-Barcia MP, de la Cruz F, Rocha EP (2011) The repertoire of

ICE in prokaryotes underscores the unity, diversity, and ubiquity of conjugation. PLoS Genet

7:e1002222

Habe H, Ashikawa Y, Saiki Y, Yoshida T, Nojiri H, Omori T (2002) Sphingomonas sp. strain KA1,

carrying a carbazole dioxygenase gene homologue, degrades chlorinated dibenzo- p -dioxins in

soil. FEMS Microbiol Lett 211:43–49

204

M. Shintani and H. Nojiri

Habe H, Chung JS, Ishida A, Kasuga K, Ide K, Takemura T, Nojiri H, Yamane H, Omori T (2005) The

ﬂ uorene catabolic linear plasmid in Terrabacter sp. strain DBF63 carries the beta-ketoadipate

pathway genes, pcaRHGBDCFIJ , also found in proteobacteria. Microbiology 151:3713–3722

Hall RM, Brown HJ, Brookes DE, Stokes HW (1994) Integrons found in different locations have

identical 5 ¢ ends but variable 3 ¢ ends. J Bacteriol 176:6286–6294

Hardman DJ, Gowland PC, Slater JH (1986) Large plasmids from soil bacteria enriched on

halogenated alkanoic acids. Appl Environ Microbiol 51:44–51

Hashimoto M, Fukui M, Hayano K, Hayatsu M (2002) Nucleotide sequence and genetic structure

of a novel carbaryl hydrolase gene ( cehA ) from Rhizobium sp. strain AC100. Appl Environ

Microbiol 68:1220–1227

Hayatsu M, Hirano M, Nagata T (1999) Involvement of two plasmids in the degradation of carbaryl

by Arthrobacter sp. strain RC100. Appl Environ Microbiol 65:1015–1019

Hayatsu M, Hirano M, Tokuda S (2000) Involvement of two plasmids in fenitrothion degradation

by Burkholderia sp. strain NF100. Appl Environ Microbiol 66:1737–1740

Heinaru E, Vedler E, Jutkina J, Aava M, Heinaru A (2009) Conjugal transfer and mobilization

capacity of the completely sequenced naphthalene plasmid pNAH20 from multiplasmid strain

Pseudomonas ﬂ uorescens PC20. FEMS Microbiol Ecol 70:563–574

Herrmann H, Janke D, Krejsa S, Roy M (1988) In vivo generation of R68.45-pPGH1 hybrid plas-

mids conferring a Phl+ (meta pathway) phenotype. Mol Gen Genet 214:173–176

Heuer H, Smalla K (2007) Horizontal gene transfer between bacteria. Environ Biosafety Res 6:3–13

Hickey WJ, Chen S, Zhao J (2012) The phn island: a new genomic island encoding catabolism of

polynuclear aromatic hydrocarbons. Front Microbiol 3:125

Hiessl S, Schuldes J, Thürmer A, Halbsguth T, Bröker D, Angelov A, Liebl W, Daniel R, Steinbüchel

A (2012) Involvement of two latex-clearing proteins during rubber degradation and insights

into the subsequent degradation pathway revealed by the genome sequence of Gordonia poly-

isoprenivorans strain VH2. Appl Environ Microbiol 74:2874–2887

Hinnebusch J, Tilly K (1993) Linear plasmids and chromosomes in bacteria. Mol Microbiol

10:917–922

Hooper SW, Dockendorff TC, Sayler GS (1989) Characteristics and restriction analysis of the

4-chlorobiphenyl catabolic plasmid, pSS50. Appl Environ Microbiol 55:1286–1288

Hopper DJ, Kemp PD (1980) Regulation of enzymes of the 3,5-xylenol-degradative pathway in

Pseudomonas putida : evidence for a plasmid. J Bacteriol 142:21–26

Horne I, Qiu X, Russell RJ, Oakeshott JG (2003) The phosphotriesterase gene opdA in

Agrobacterium radiobacter P230 is transposable. FEMS Microbiol Lett 222:1–8

Hu X, Mamoto R, Fujioka Y, Tani A, Kimbara K, Kawai F (2008) The pva operon is located on the

megaplasmid of Sphingopyxis sp. strain 113P3 and is constitutively expressed, although expres-

sion is enhanced by PVA. Appl Microbiol Biotechnol 78:685–693

Igloi GL, Brandsch R (2003) Sequence of the 165-kilobase catabolic plasmid pAO1 from

Arthrobacter nicotinovorans and identi ﬁ cation of a pAO1-dependent nicotine uptake system. J

Bacteriol 185:1976–1986

Iida T, Mukouzaka Y, Nakamura K, Kudo T (2002) Plasmid-borne genes code for an angular

dioxygenase involved in dibenzofuran degradation by Terrabacter sp. strain YK3. Appl Environ

Microbiol 68:3716–3723

Indest KJ, Jung CM, Chen HP, Hancock D, Florizone C, Eltis LD, Crocker FH (2010) Functional

characterization of pGKT2, a 182-kilobase plasmid containing the xplAB genes, which are

involved in the degradation of hexahydro-1,3,5-trinitro-1,3,5-triazine by Gordonia sp. strain

KTR9. Appl Environ Microbiol 76:6329–6337

Ishii S, Ohno H, Tsuboi M, Otsuka S, Senoo K (2011) Identi ﬁ cation and isolation of active N

reducers in rice paddy soil. ISME J 5:1936–1945

Izmalkova TY, Sazonova OI, Sokolov SL, Kosheleva IA, Boronin AM (2005) The P-7 incompati-

bility group plasmids responsible for biodegradation of naphthalene and salicylate in ﬂ uorescent

Pseudomonads . Microbiology (Pleiades publish) 74:342–348

205

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Jahnke M, El-Banna T, Klintworth R, Auling G (1990) Mineralization of orthanilic acid is a plas-

mid-associated trait in Alcaligenes sp. O-1. J Gen Microbiol 136:2241–2249

Jencova V, Strnad H, Chodora Z, Ulbrich P, Vlcek C, Hickey WJ, Paces V (2008) Nucleotide

sequence, organization and characterization of the (halo)aromatic acid catabolic plasmid pA81

from Achromobacter xylosoxidans A8. Res Microbiol 159:118–127

Jeon CO, Park W, Padmanabhan P, DeRito C, Snape JR, Madsen EL (2003) Discovery of a

bacterium, with distinctive dioxygenase, that is responsible for in situ biodegradation in

contaminated sediment. Proc Natl Acad Sci USA 100:13591–13596

Jeon CO, Park M, Ro HS, Park W, Madsen EL (2006) The naphthalene catabolic ( nag ) genes of

Polaromonas naphthalenivorans CJ2: evolutionary implications for two gene clusters and

novel regulatory control. Appl Environ Microbiol 72:1086–1095

Jones BV, Marchesi JR (2007) Transposon-aided capture (TRACA) of plasmids resident in the

human gut mobile metagenome. Nat Methods 4:55–61

Jones BV, Sun F, Marchesi JR (2010) Comparative metagenomic analysis of plasmid encoded

functions in the human gut microbiome. BMC Genomics 11:46

Junker F, Cook AM (1997) Conjugative plasmids and the degradation of arylsulfonates in

Comamonas testosteroni . Appl Environ Microbiol 63:2403–2410

Ka JO, Tiedje JM (1994) Integration and excision of a 2,4-dichlorophenoxyacetic acid-degradative

plasmid in Alcaligenes paradoxus and evidence of its natural intergeneric transfer. J Bacteriol

176:5284–5289

Kato K, Ohtsuki K, Mitsuda H, Yomo T, Negoro S, Urabe I (1994) Insertion sequence IS 6100 on

plasmid pOAD2, which degrades nylon oligomers. J Bacteriol 176:1197–1200

Kato K, Ohtsuki K, Koda Y, Maekawa T, Yomo T, Negoro S, Urabe I (1995) A plasmid encoding

enzymes for nylon oligomer degradation: nucleotide sequence and analysis of pOAD2.

Microbiology 141:2585–2590

Kawasaki H, Yahara H, Tonomura K (1981) Isolation and characterization of plasmid pUO1 medi-

ating dehalogenation of haloacetate and mercury resistance in Moraxella sp. B. Agric Biol

Chem 45:1477–1481

Kawasaki H, Takao M, Koiso A, Tonomura K (1985) Genetic rearrangement of plasmids: in vivo

recombination between a dehalogenation plasmid and multiple resistance plasmid RP4 in

Pseudomonas sp. Appl Environ Microbiol 49:1544–1546

Keck A, Conradt D, Mahler A, Stolz A, Mattes R, Klein J (2006) Identi ﬁ cation and functional

analysis of the genes for naphthalenesulfonate catabolism by Sphingomonas xenophaga BN6.

Microbiology 152:1929–1940

Keil H, Keil S, Pickup RW, Williams PA (1985) Evolutionary conservation of genes coding for

meta pathway enzymes within TOL plasmids pWW0 and pWW53. J Bacteriol 164:887–895

Keil H, Saint CM, Williams PA (1987) Gene organization of the ﬁ rst catabolic operon of TOL

plasmid pWW53: production of indigo by the xylA gene product. J Bacteriol 169:764–770

Keshavarz T, Lilly MD, Clarke PH (1985) Stability of a catabolic plasmid in continuous culture.

J Gen Microbiol 131:1193–1203

Kesseler M, Dabbs ER, Averhoff B, Gottschalk G (1996) Studies on the isopropylbenzene

2,3-dioxygenase and the 3-isopropylcatechol 2,3-dioxygenase genes encoded by the linear

plasmid of Rhodococcus erythropolis BD2. Microbiology 142:3241–3251

Kitagawa W, Suzuki A, Hoaki T, Masai E, Fukuda M (2001) Multiplicity of aromatic ring hydrox-

ylation dioxygenase genes in a strong PCB degrader, Rhodococcus sp. strain RHA1 demon-

strated by denaturing gradient gel electrophoresis. Biosci Biotechnol Biochem 65:1907–1911

Kivisaar M, Hõrak R, Kasak L, Heinaru A, Habicht J (1990) Selection of independent plasmids

determining phenol degradation in Pseudomonas putida and the cloning and expression of

genes encoding phenol monooxygenase and catechol 1,2-dioxygenase. Plasmid 24:25–36

Kivisaar M, Kasak L, Nurk A (1991) Sequence of the plasmid-encoded catechol 1,2-dioxyge-

nase-expressing gene, pheB , of phenol-degrading Pseudomonas sp. strain EST1001. Gene

98:15–20

206

M. Shintani and H. Nojiri

Kolkenbrock S, Naumann B, Hippler M, Fetzner S (2010) A novel replicative enzyme encoded by

the linear Arthrobacter plasmid pAL1. J Bacteriol 192:4935–4943

König C, Eulberg D, Gröning J, Lakner S, Seibert V, Kaschabek SR, Schlömann M (2004) A linear

megaplasmid, p1CP, carrying the genes for chlorocatechol catabolism of Rhodococcus opacus

1CP. Microbiology 150:3075–3087

Kosono S, Maeda M, Fuji F, Arai H, Kudo T (1997) Three of the seven bphC genes of Rhodococcus

erythropolis TA421, isolated from a termite ecosystem, are located on an indigenous plasmid

associated with biphenyl degradation. Appl Environ Microbiol 63:3282–3285

Kristiansson E, Fick J, Janzon A, Grabic R, Rutgersson C, Weijdegård B, Söderström H, Larsson

DG (2011) Pyrosequencing of antibiotic-contaminated river sediments reveals high levels of

resistance and gene transfer elements. PLoS One 6:e17038

Król JE, Penrod JT, McCaslin H, Rogers LM, Yano H, Stancik AD, Dejonghe W, Brown CJ,

Parales RE, Wuertz S, Top EM (2012) Role of IncP-1 b plasmids pWDL7:: rfp and pNB8c in

chloroaniline catabolism as determined by genomic and functional analyses. Appl Environ

Microbiol 78:828–838

Kulakova AN, Stafford TM, Larkin MJ, Kulakov LA (1995) Plasmid pRTL1 controlling 1-chloro-

alkane degradation by Rhodococcus rhodochrous NCIMB13064. Plasmid 33:208–217

Kulakova AN, Larkin MJ, Kulakov LA (1997) The plasmid-located haloalkane dehalogenase gene

from Rhodococcus rhodochrous NCIMB 13064. Microbiology 143:109–115

Kunz DA, Chapman PJ (1981) Isolation and characterization of spontaneously occurring TOL

plasmid mutants of Pseudomonas putida HS1. J Bacteriol 146:952–964

Kunze M, Zerlin KF, Retzlaff A, Pohl JO, Schmidt E, Janssen DB, Vilchez-Vargas R, Pieper DH,

Reineke W (2009) Degradation of chloroaromatics by Pseudomonas putida GJ31: assembled

route for chlorobenzene degradation encoded by clusters on plasmid pKW1 and the chromo-

some. Microbiology 155:4069–4083

Layton AC, Sanseverino J, Wallace W, Corcoran C, Sayler GS (1992) Evidence for 4-chloroben-

zoic acid dehalogenation mediated by plasmids related to pSS50. Appl Environ Microbiol

58:399–402

Lechner M, Schmitt K, Bauer S, Hot D, Hubans C, Levillain E, Locht C, Lemoine Y, Gross R

(2009) Genomic island excisions in Bordetella petrii . BMC Microbiol 9:141

Leisinger T (1983) Microorganisms and xenobiotic compounds. Experientia 39:1183–1220

Li W, Shi J, Wang X, Han Y, Tong W, Ma L, Liu B, Cai B (2004) Complete nucleotide sequence

and organization of the naphthalene catabolic plasmid pND6-1 from Pseudomonas sp. strain

ND6. Gene 336:231–240

Liang Q, Takeo M, Chen M, Zhang W, Xu Y, Lin M (2005) Chromosome-encoded gene cluster for

the metabolic pathway that converts aniline to TCA-cycle intermediates in Delftia tsuruhaten-

sis AD9. Microbiology 151:3435–3446

Lin CL, Shen FT, Tan CC, Huang CC, Chen BY, Arun AB, Young CC (2012) Characterization of

Gordonia sp. strain CC-NAPH129-6 capable of naphthalene degradation. Microbiol Res

167(7):395–404

Liu Y, Zhang J, Zhang Z (2004) Isolation and characterization of polycyclic aromatic hydrocarbons-

degrading Sphingomonas sp. strain ZL5. Biodegradation 15:205–212

Liu H, Zhang JJ, Wang SJ, Zhang XE, Zhou NY (2005) Plasmid-borne catabolism of methyl para-

thion and p -nitrophenol in Pseudomonas sp. strain WBC-3. Biochem Biophys Res Commun

334:1107–1114

Liu H, Wang SJ, Zhang JJ, Dai H, Tang H, Zhou NY (2011) Patchwork assembly of nag -like

nitroarene dioxygenase genes and the 3-chlorocatechol degradation cluster for evolution of the

2-chloronitrobenzene catabolism pathway in Pseudomonas stutzeri ZWLR2-1. Appl Environ

Microbiol 77:4547–4552

Lloyd-Jones G, de Jong C, Ogden RC, Duetz WA, Williams PA (1994) Recombination of the bph

(Biphenyl) catabolic genes from plasmid pWW100 and their deletion during growth on benzo-

ate. Appl Environ Microbiol 60:691–696

207

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Luo YR, Kang SG, Kim SJ, Kim MR, Li N, Lee JH, Kwon KK (2012) Genome sequence of

benzo(a)pyrene-degrading bacterium Novosphingobium pentaromativorans US6-1. J Bacteriol

194:907

Ma YF, Wu JF, Wang SY, Jiang CY, Zhang Y, Qi SW, Liu L, Zhao GP, Liu SJ (2007) Nucleotide

sequence of plasmid pCNB1 from Comamonas strain CNB-1 reveals novel genetic organi-

zation and evolution for 4-chloronitrobenzene degradation. Appl Environ Microbiol

73:4477–4483

Mäe A, Marits R, Ausmees N, Kõiv V, Heinaru A (1993) Characterization of a new 2,4-dichloro-

phenoxyacetic acid degrading plasmid pEST4011: physical map and localization of catabolic

genes. J Gen Microbiol 139:3165–3170

Maeda K, Nojiri H, Shintani M, Yoshida T, Habe H, Omori T (2003) Complete nucleotide sequence

of carbazole/dioxin-degrading plasmid pCAR1 in Pseudomonas resinovorans strain CA10

indicates its mosaicity and the presence of large catabolic transposon Tn 4676 . J Mol Biol

326:21–33

Mahillon J, Chandler M (1998) Insertion sequences. Microbiol Mol Biol Rev 62:725–774

Maillard J, Regeard C, Holliger C (2005) Isolation and characterization of Tn- Dha1 , a transposon

containing the tetrachloroethene reductive dehalogenase of Desul ﬁ tobacterium hafniense strain

TCE1. Environ Microbiol 7:107–117

Mandal MD, Mandal A, Pal NK (2005) Plasmid-mediated dimethoate degradation by Bacillus

licheniformis isolated from a fresh water ﬁ sh Labeo rohita . J Biomed Biotechnol 3:280–286

Martin C, Timm J, Rauzier J, Gomez-Lus R, Davies J, Gicquel B (1990) Transposition of an anti-

biotic resistance element in mycobacteria. Nature 345:739–743

Martinez B, Tomkins J, Wackett LP, Wing R, Sadowsky MJ (2001) Complete nucleotide sequence

and organization of the atrazine catabolic plasmid pADP-1 from Pseudomonas sp. strain ADP.

J Bacteriol 183:5684–5697

Masai E, Sugiyama K, Iwashita N, Shimizu S, Hauschild JE, Hatta T, Kimbara K, Yano K, Fukuda

M (1997) The bphDEF meta-cleavage pathway genes involved in biphenyl/polychlorinated

biphenyl degradation are located on a linear plasmid and separated from the initial bphACB

genes in Rhodococcus sp. strain RHA1. Gene 187:141–149

Masai E, Kamimura N, Kasai D, Oguchi A, Ankai A, Fukui S, Takahashi M, Yashiro I, Sasaki H,

Harada T, Nakamura S, Katano Y, Narita-Yamada S, Nakazawa H, Hara H, Katayama Y,

Fukuda M, Yamazaki S, Fujita N (2012) Complete genome sequence of Sphingobium sp. strain

SYK-6, a degrader of lignin-derived biaryls and monoaryls. J Bacteriol 194:534–535

McLeod MP, Warren RL, Hsiao WW, Araki N, Myhre M, Fernandes C, Miyazawa D, Wong W,

Lillquist AL, Wang D, Dosanjh M, Hara H, Petrescu A, Morin RD, Yang G, Stott JM, Schein JE,

Shin H, Smailus D, Siddiqui AS, Marra MA, Jones SJ, Holt R, Brinkman FS, Miyauchi K, Fukuda

M, Davies JE, Mohn WW, Eltis LD (2006) The complete genome of Rhodococcus sp. RHA1

provides insights into a catabolic powerhouse. Proc Natl Acad Sci USA 103:15582–15587

Merlin C, Springael D, Toussaint A (1999) Tn 4371 : a modular structure encoding a phage-like

integrase, a Pseudomonas -like catabolic pathway, and RP4/Ti-like transfer functions. Plasmid

41:40–54

Miller TR, Delcher AL, Salzberg SL, Saunders E, Detter JC, Halden RU (2010) Genome sequence

of the dioxin-mineralizing bacterium Sphingomonas wittichii RW1. J Bacteriol 192:6101–6102

Miyauchi K, Sukda P, Nishida T, Ito E, Matsumoto Y, Masai E, Fukuda M (2008) Isolation of

dibenzofuran-degrading bacterium, Nocardioides sp. DF412, and characterization of its diben-

zofuran degradation genes. J Biosci Bioeng 105:628–635

Miyazaki R, van der Meer JR (2011a) A dual functional origin of transfer in the ICE

clc

genomic

island of Pseudomonas knackmussii B13. Mol Microbiol 79:743–758

Miyazaki R, van der Meer JR (2011b) How can a dual oriT system contribute to ef ﬁ cient transfer

of an integrative and conjugative element? Mobile Genet Elem 1:82–84

Miyazaki R, Sato Y, Ito M, Ohtsubo Y, Nagata Y, Tsuda M (2006) Complete nucleotide sequence

of an exogenously isolated plasmid, pLB1, involved in gamma-hexachlorocyclohexane degra-

dation. Appl Environ Microbiol 72:6923–6933

208

M. Shintani and H. Nojiri

Mulbry WW, Karns JS, Kearney PC, Nelson JO, McDaniel CS, Wild JR (1986) Identi ﬁ cation of a

plasmid-borne parathion hydrolase gene from Flavobacterium sp. by southern hybridization

with opd from Pseudomonas diminuta . Appl Environ Microbiol 51:926–930

Mulbry WW, Kearney PC, Nelson JO, Karns JS (1987) Physical comparison of parathion hydro-

lase plasmids from Pseudomonas diminuta and Flavobacterium sp. Plasmid 18:173–177

Müller TA, Werlen C, Spain J, Van Der Meer JR (2003) Evolution of a chlorobenzene degradative

pathway among bacteria in a contaminated groundwater mediated by a genomic island in

Ralstonia . Environ Microbiol 5:163–173

Musovic S, Oregaard G, Kroer N, Sørensen SJ (2006) Cultivation-independent examination of hori-

zontal transfer and host range of an IncP-1 plasmid among gram-positive and gram-negative

bacteria indigenous to the barley rhizosphere. Appl Environ Microbiol 72:6687–6692

Musovic S, Dechesne A, Sørensen J, Smets BF (2010) Novel assay to assess permissiveness of a

soil microbial community toward receipt of mobile genetic elements. Appl Environ Microbiol

76:4813–4818

Nagata Y, Kamakura M, Endo R, Miyazaki R, Ohtsubo Y, Tsuda M (2006) Distribution of gamma-

hexachlorocyclohexane-degrading genes on three replicons in Sphingobium japonicum UT26.

FEMS Microbiol Lett 256:112–118

Nagata Y, Endo R, Ito M, Ohtsubo Y, Tsuda M (2007) Aerobic degradation of lindane (gamma-

hexachlorocyclohexane) in bacteria and its biochemical and molecular basis. Appl Microbiol

Biotechnol 76:741–752

Nagata Y, Ohtsubo Y, Endo R, Ichikawa N, Ankai A, Oguchi A, Fukui S, Fujita N, Tsuda M (2010)

Complete genome sequence of the representative g -hexachlorocyclohexane-degrading bacte-

rium Sphingobium japonicum UT26. J Bacteriol 192:5852–5853

Nagata Y, Natsui S, Endo R, Ohtsubo Y, Ichikawa N, Ankai A, Oguchi A, Fukui S, Fujita N, Tsuda

M (2011) Genomic organization and genomic structural rearrangements of Sphingobium

japonicum UT26, an archetypal g -hexachlorocyclohexane-degrading bacterium. Enzyme

Microb Technol 49:499–508

Nakatsu C, Ng J, Singh R, Straus N, Wyndham C (1991) Chlorobenzoate catabolic transposon

Tn 5271 is a composite class I element with ﬂ anking class II insertion sequences. Proc Natl

Acad Sci USA 88:8312–8316

Negoro S, Okada H (1982) Physical map of Nylon oligomer degradative plasmid pOAD2 harbored

in Flavobacterium sp. KI72. Agric Biol Chem 46:745–750

Negoro S, Shinagawa H, Nakata A, Kinoshita S, Hatozaki T, Okada H (1980) Plasmid control of

6-aminohexanoic acid cyclic dimer degradation enzymes of Flavobacterium sp. KI72. J

Bacteriol 143:238–245

Nishi A, Tominaga K, Furukawa K (2000) A 90-kilobase conjugative chromosomal element coding

for biphenyl and salicylate catabolism in Pseudomonas putida KF715. J Bacteriol

182:1949–1955

Nojiri H, Sekiguchi H, Maeda K, Urata M, Nakai S, Yoshida T, Habe H, Omori T (2001) Genetic

characterization and evolutionary implications of a car gene cluster in the carbazole degrader

Pseudomonas sp. strain CA10. J Bacteriol 183:3663–3679

Nojiri H, Kamakura M, Urata M, Tanaka T, Chung JS, Takemura T, Yoshida T, Habe H, Omori T

(2002) Dioxin catabolic genes are dispersed on the Terrabacter sp. DBF63 genome. Biochem

Biophys Res Commun 296:233–240

Nojiri H, Shintani M, Omori T (2004) Divergence of mobile genetic elements involved in the

distribution of xenobiotic-catabolic capacity. Appl Microbiol Biotechnol 64:154–174

Ogawa N, Miyashita K (1995) Recombination of a 3-chlorobenzoate catabolic plasmid from Alcaligenes

eutrophus NH9 mediated by direct repeat elements. Appl Environ Microbiol 61:3788–3795

Ogawa N, Miyashita K (1999) The chlorocatechol-catabolic transposon Tn 5707 of Alcaligenes

eutrophus NH9, carrying a gene cluster highly homologous to that in the 1,2,4-trichloroben-

zene-degrading bacterium Pseudomonas sp. strain P51, confers the ability to grow on 3-chloroben-

zoate. Appl Environ Microbiol 65:724–731

Ohtsubo Y, Shimura M, Delawary M, Kimbara K, Takagi M, Kudo T, Ohta A, Nagata Y (2003)

Novel approach to the improvement of biphenyl and polychlorinated biphenyl degradation

209

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

activity: promoter implantation by homologous recombination. Appl Environ Microbiol

69:146–153

Ohtsubo Y, Goto H, Nagata Y, Kudo T, Tsuda M (2006) Identi ﬁ cation of a response regulator gene

for catabolite control from a PCB-degrading beta-proteobacteria, Acidovorax sp. KKS102. Mol

Microbiol 60:1563–1575

Ohtsubo Y, Ishibashi Y, Naganawa H, Hirokawa S, Atobe S, Nagata Y, Tsuda M (2012) Conjugal

transfer of PCB/biphenyl degradation genes in Acidovorax sp. KKS102 located on integrative

and conjugative element. J Bacteriol 194(16):4237–4248

Ono A, Miyazaki R, Sota M, Ohtsubo Y, Nagata Y, Tsuda M (2007) Isolation and characterization

of naphthalene-catabolic genes and plasmids from oil-contaminated soil by using two cultiva-

tion-independent approaches. Appl Microbiol Biotechnol 74:501–510

Overhage J, Sielker S, Homburg S, Parschat K, Fetzner S (2005) Identi ﬁ cation of large linear

plasmids in Arthrobacter spp. encoding the degradation of quinaldine to anthranilate.

Microbiology 151:491–500

Pandeeti EV, Chakka D, Pandey JP, Siddavattam D (2011) Indigenous organophosphate-degrading

( opd ) plasmid pCMS1 of Brevundimonas diminuta is self-transmissible and plays a key role in

horizontal mobility of the opd gene. Plasmid 65:226–231

Park HS, Kim HS (2000) Identi ﬁ cation and characterization of the nitrobenzene catabolic plasmids

pNB1 and pNB2 in Pseudomonas putida HS12. J Bacteriol 182:573–580

Park W, Jeon CO, Hohnstock-Ashe AM, Winans SC, Zylstra GJ, Madsen EL (2003) Identi ﬁ cation

and characterization of the conjugal transfer region of the pCg1 plasmid from naphthalene-

degrading Pseudomonas putida Cg1. Appl Environ Microbiol 69:3263–3271

Parschat K, Overhage J, Strittmatter AW, Henne A, Gottschalk G, Fetzner S (2007) Complete

nucleotide sequence of the 113-kilobase linear catabolic plasmid pAL1 of Arthrobacter

nitroguajacolicus Rü61a and transcriptional analysis of genes involved in quinaldine degrada-

tion. J Bacteriol 189:3855–3867

Pepper IL, Gentry TJ, Newby DT, Roane TM, Josephson KL (2002) The role of cell bioaugmenta-

tion and gene bioaugmentation in the remediation of co-contaminated soils. Environ Health

Perspect 110(Suppl 6):943–946

Peters M, Heinaru E, Talpsep E, Wand H, Stottmeister U, Heinaru A, Nurk A (1997) Acquisition

of a deliberately introduced phenol degradation operon, pheBA , by different indigenous

Pseudomonas species. Appl Environ Microbiol 63:4899–4906

Poh RP, Smith AR, Bruce IJ (2002) Complete characterisation of Tn 5530 from Burkholderia

cepacia strain 2a (pIJB1) and studies of 2,4-dichlorophenoxyacetate uptake by the organism.

Plasmid 48:1–12

Priefert H, O’Brien XM, Lessard PA, Dexter AF, Choi EE, Tomic S, Nagpal G, Cho JJ, Agosto M,

Yang L, Treadway SL, Tamashiro L, Wallace M, Sinskey AJ (2004) Indene bioconversion by a

toluene inducible dioxygenase of Rhodococcus sp. I24. Appl Microbiol Biotechnol 65:168–176

Ravatn R, Studer S, Springael D, Zehnder AJ, van der Meer JR (1998a) Chromosomal integration,

tandem ampli ﬁ cation, and deampli ﬁ cation in Pseudomonas putida F1 of a 105-kilobase genetic

element containing the chlorocatechol degradative genes from Pseudomonas sp. Strain B13. J

Bacteriol 180:4360–4369

Ravatn R, Zehnder AJ, van der Meer JR (1998b) Low-frequency horizontal transfer of an element

containing the chlorocatechol degradation genes from Pseudomonas sp. strain B13 to

Pseudomonas putida F1 and to indigenous bacteria in laboratory-scale activated-sludge micro-

cosms. Appl Environ Microbiol 64:2126–2132

Rheinwald JG, Chakrabarty AM, Gunsalus IC (1973) A transmissible plasmid controlling cam-

phor oxidation in Pseudomonas putida . Proc Natl Acad Sci USA 70:885–889

Romine MF, Stillwell LC, Wong KK, Thurston SJ, Sisk EC, Sensen C, Gaasterland T, Fredrickson

JK, Saffer JD (1999) Complete sequence of a 184-kilobase catabolic plasmid from

Sphingomonas aromaticivorans F199. J Bacteriol 181:1585–1602

Ruff J, Smits TH, Cook AM, Schleheck D (2010) Identi ﬁ cation of two vicinal operons for the

degradation of 2-aminobenzenesulfonate encoded on plasmid pSAH in Alcaligenes sp. strain

O-1. Microbiol Res 165:288–299

210

M. Shintani and H. Nojiri

Ryan MP, Pembroke JT, Adley CC (2009) Novel Tn 4371 -ICE like element in Ralstonia pickettii

and genome mining for comparative elements. BMC Microbiol 9:242

Saeki H, Akira M, Furuhashi K, Averhoff B, Gottschalk G (1999) Degradation of trichloroethene

by a linear-plasmid-encoded alkene monooxygenase in Rhodococcus corallinus ( Nocardia

corallina ) B-276. Microbiology 145:1721–1730

Saint CP, McClure NC, Venables WA (1990) Physical map of the aromatic amine and m -toluate

catabolic plasmid pTDN1 in Pseudomonas putida : location of a unique meta -cleavage pathway.

J Gen Microbiol 136:615–625

Sakaguchi K (1990) Invertrons, a class of structurally and functionally related genetic elements

that includes linear DNA plasmids, transposable elements, and genomes of adeno-type viruses.

Microbiol Rev 54:66–74

Sakai M, Masai E, Asami H, Sugiyama K, Kimbara K, Fukuda M (2002) Diversity of 2,3-dihydroxy-

biphenyl dioxygenase genes in a strong PCB degrader, Rhodococcus sp. strain RHA1. J Biosci

Bioeng 93:421–427

Schleinitz KM, Kleinsteuber S, Vallaeys T, Babel W (2004) Localization and characterization of

two novel genes encoding stereospeci ﬁ c dioxygenases catalyzing 2(2,4-dichlorophenoxy)

propionate cleavage in Delftia acidovorans MC1. Appl Environ Microbiol 70:5357–5365

Sekine M, Tanikawa S, Omata S, Saito M, Fujisawa T, Tsukatani N, Tajima T, Sekigawa T, Kosugi

H, Matsuo Y, Nishiko R, Imamura K, Ito M, Narita H, Tago S, Fujita N, Harayama S (2006)

Sequence analysis of three plasmids harboured in Rhodococcus erythropolis strain PR4.

Environ Microbiol 8:334–346

Sentchilo V, Czechowska K, Pradervand N, Minoia M, Miyazaki R, van der Meer JR (2009)

Intracellular excision and reintegration dynamics of the ICE

clc

genomic island of Pseudomonas

knackmussii sp. strain B13. Mol Microbiol 72:1293–1306

Serdar CM, Gibson DT, Munnecke DM, Lancaster JH (1982) Plasmid involvement in parathion

hydrolysis by Pseudomonas diminuta . Appl Environ Microbiol 44:246–249

Seto M, Kimbara K, Shimura M, Hatta T, Fukuda M, Yano K (1995) A novel transformation of

polychlorinated biphenyls by Rhodococcus sp. strain RHA1. Appl Environ Microbiol

61:3353–3358

Sevastsyanovich YR, Krasowiak R, Bingle LE, Haines AS, Sokolov SL, Kosheleva IA, Leuchuk

AA, Titok MA, Smalla K, Thomas CM (2008) Diversity of IncP-9 plasmids of Pseudomonas .

Microbiology 154:2929–2941

Shields MS, Hooper SW, Sayler GS (1985) Plasmid-mediated mineralization of 4-chlorobiphenyl.

J Bacteriol 163:882–889

Shields MS, Reagin MJ, Gerger RR, Campbell R, Somerville C (1995) TOM, a new aromatic

degradative plasmid from Burkholderia ( Pseudomonas ) cepacia G4. Appl Environ Microbiol

61:1352–1356

Shimizu S, Kobayashi H, Masai E, Fukuda M (2001) Characterization of the 450-kb linear plasmid

in a polychlorinated biphenyl degrader, Rhodococcus sp. strain RHA1. Appl Environ Microbiol

67:2021–2028

Shintani M, Nojiri H, Yoshida T, Habe H, Omori T (2003) Carbazole/dioxin-degrading car gene

cluster is located on the chromosome of Pseudomonas stutzeri strain OM1 in a form different

from the simple transposition of Tn 4676 . Biotechnol Lett 25:1255–1261

Shintani M, Yoshida T, Habe H, Omori T, Nojiri H (2005) Large plasmid pCAR2 and class II

transposon Tn 4676 are functional mobile genetic elements to distribute the carbazole/dioxin-

degradative car gene cluster in different bacteria. Appl Microbiol Biotechnol 67:370–382

Shintani M, Urata M, Inoue K, Eto K, Habe H, Ornori T, Yamane H, Nojiri H (2007) The

Sphingomonas plasmid pCAR3 is involved in complete mineralization of carbazole. J Bacteriol

189:2007–2020

Shintani M, Takahashi Y, Yamane H, Nojiri H (2010) The behavior and signi ﬁ cance of degradative

plasmids belonging to Inc groups in Pseudomonas within natural environments and micro-

cosms. Microbes Environ 25:253–265

Shintani M, Matsumoto T, Yoshikawa H, Yamane H, Ohkuma M, Nojiri H (2011) DNA rearrange-

ment has occurred in the carbazole-degradative plasmid pCAR1 and the chromosome of its

unsuitable host, Pseudomonas ﬂ uorescens Pf0-1. Microbiology 157:3405–3416

211

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Shuttleworth KL, Sung J, Kim E, Cerniglia CE (2000) Physiological and genetic comparison of

two aromatic hydrocarbon-degrading Sphingomonas strains. Mol Cells 10:199–205

Siddavattam D, Khajamohiddin S, Manavathi B, Pakala SB, Merrick M (2003) Transposon-like

organization of the plasmid-borne organophosphate degradation ( opd ) gene cluster found in

Flavobacterium sp. Appl Environ Microbiol 69:2533–2539

Simon MJ, Osslund TD, Saunders R, Ensley BD, Suggs S, Harcourt A, Suen WC, Cruden DL,

Gibson DT, Zylstra GJ (1993) Sequences of genes encoding naphthalene dioxygenase in

Pseudomonas putida strains G7 and NCIB 9816-4. Gene 127:31–37

Smillie C, Garcillán-Barcia MP, Francia MV, Rocha EP, de la Cruz F (2010) Mobility of plasmids.

Microbiol Mol Biol Rev 74:434–452

Sota M, Top EM (2008) Horizontal gene transfer mediated by plasmids. In: Lipps G (ed) Plasmids:

current research and future trends. Horizon Scienti ﬁ c Press, Norfolk

Sota M, Endo M, Nitta K, Kawasaki H, Tsuda M (2002) Characterization of a class II defective

transposon carrying two haloacetate dehalogenase genes from Delftia acidovorans plasmid

pUO1. Appl Environ Microbiol 68:2307–2315

Sota M, Kawasaki H, Tsuda M (2003) Structure of haloacetate-catabolic IncP-1beta plasmid pUO1

and genetic mobility of its residing haloacetate-catabolic transposon. J Bacteriol 185:6741–6745

Sota M, Yano H, Ono A, Miyazaki R, Ishii H, Genka H, Top EM, Tsuda M (2006) Genomic

and functional analysis of the IncP-9 naphthalene-catabolic plasmid NAH7 and its trans-

poson Tn 4655 suggests catabolic gene spread by a tyrosine recombinase. J Bacteriol

188:4057–4067

Sota M, Tsuda M, Yano H, Suzuki H, Forney LJ, Top EM (2007) Region-speci ﬁ c insertion of

transposons in combination with selection for high plasmid transferability and stability accounts

for the structural similarity of IncP-1 plasmids. J Bacteriol 189:3091–3098

Springael D, Kreps S, Mergeay M (1993) Identi ﬁ cation of a catabolic transposon, Tn 4371 , carrying

biphenyl and 4-chlorobiphenyl degradation genes in Alcaligenes eutrophus A5. J Bacteriol

175:1674–1681

Springael D, Peys K, Ryngaert A, Van Roy S, Hooyberghs L, Ravatn R, Heyndrickx M, van der

Meer JR, Vandecasteele C, Mergeay M, Diels L (2002) Community shifts in a seeded 3-chlo-

robenzoate degrading membrane bio ﬁ lm reactor: indications for involvement of in situ hori-

zontal transfer of the clc -element from inoculum to contaminant bacteria. Environ Microbiol

4:70–80

Stalker DM, McBride KE (1987) Cloning and expression in Escherichia coli of a Klebsiella ozaenae

plasmid-borne gene encoding a nitrilase speci ﬁ c for the herbicide bromoxynil. J Bacteriol

169:955–960

Stecker C, Johann A, Herzberg C, Averhoff B, Gottschalk G (2003) Complete nucleotide sequence

and genetic organization of the 210-kilobase linear plasmid of Rhodococcus erythropolis BD2.

J Bacteriol 185:5269–5274

Stillwell LC, Thurston SJ, Schneider RP, Romine MF, Fredrickson JK, Saffer JD (1995) Physical

mapping and characterization of a catabolic plasmid from the deep-subsurface bacterium

Sphingomonas sp. strain F199. J Bacteriol 177:4537–4539

Stuart-Keil KG, Hohnstock AM, Drees KP, Herrick JB, Madsen EL (1998) Plasmids responsible

for horizontal transfer of naphthalene catabolism genes between bacteria at a coal tar-contam-

inated site are homologous to pDTG1 from Pseudomonas putida NCIB 9816-4. Appl Environ

Microbiol 64:3633–3640

Sundin GW, Bender CL (1995) Expression of the strA - strB streptomycin resistance genes in

Pseudomonas syringae and Xanthomonas campestris and characterization of IS 6100 in X .

campestris . Appl Environ Microbiol 61:2891–2897

Szczepanowski R, Bekel T, Goesmann A, Krause L, Krömeke H, Kaiser O, Eichler W, Pühler A,

Schlüter A (2008) Insight into the plasmid metagenome of wastewater treatment plant bacteria

showing reduced susceptibility to antimicrobial drugs analysed by the 454-pyrosequencing

technology. J Biotechnol 136:54–64

Tabata M, Endo R, Ito M, Ohtsubo Y, Kumar A, Tsuda M, Nagata Y (2011) The lin genes for

g -hexachlorocyclohexane degradation in Sphingomonas sp. MM-1 proved to be dispersed

across multiple plasmids. Biosci Biotechnol Biochem 75:466–472

212

M. Shintani and H. Nojiri

Taghavi S, Barac T, Greenberg B, Borremans B, Vangronsveld J, van der Lelie D (2005) Horizontal

gene transfer to endogenous endophytic bacteria from poplar improves phytoremediation of

toluene. Appl Environ Microbiol 71:8500–8505

Tago K, Sato J, Takesa H, Kawagishi H, Hayatsu M (2005) Characterization of methylhydroquinone-

metabolizing oxygenase genes encoded on plasmid in Burkholderia sp. NF100. J Biosci Bioeng

100:517–523

Taguchi K, Motoyama M, Kudo T (2004) Multiplicity of 2,3-dihydroxybiphenyl dioxygenase

genes in the Gram-positive polychlorinated biphenyl degrading bacterium Rhodococcus rhod-

ochrous K37. Biosci Biotechnol Biochem 68:787–795

Takahashi Y, Shintani M, Yamane H, Nojiri H (2009) The complete nucleotide sequence of pCAR2:

pCAR2 and pCAR1 were structurally identical IncP-7 carbazole degradative plasmids. Biosci

Biotechnol Biochem 73:744–746

Tan HM (1999) Bacterial catabolic transposons. Appl Microbiol Biotechnol 51:1–12

Tan HM, Mason JR (1990) Cloning and expression of the plasmid-encoded benzene dioxygenase

genes from Pseudomonas putida ML2. FEMS Microbiol Lett 60:259–264

Tani A, Charoenpanich J, Mori T, Takeichi M, Kimbara K, Kawai F (2007) Structure and con-

servation of a polyethylene glycol-degradative operon in sphingomonads. Microbiology

153:338–346

Tauch A, Götker S, Pühler A, Kalinowski J, Thierbach G (2002) The 27.8-kb R-plasmid pTET3

from Corynebacterium glutamicum encodes the aminoglycoside adenyltransferase gene

cassette aadA9 and the regulated tetracycline ef ﬂ ux system Tet 33 ﬂ anked by active copies

of the widespread insertion sequence IS 6100 . Plasmid 48:117–129

Thacker R, Rørvig O, Kahlon P, Gunsalus IC (1978) NIC, a conjugative nicotine-nicotinate degra-

dative plasmid in Pseudomonas convexa . J Bacteriol 135:289–290

Thomas CM, Haines AS (2004) Plasmids of the genus Pseudomonas. In: Ramos J-L (ed)

Pseudomonas . Kluwer Academic/Plenum Publishers, New York

Top EM, Springael D (2003) The role of mobile genetic elements in bacterial adaptation to xeno-

biotic organic compounds. Curr Opin Biotechnol 14:262–269

Top EM, Holben WE, Forney LJ (1995) Characterization of diverse 2,4-dichlorophenoxyacetic

acid-degradative plasmids isolated from soil by complementation. Appl Environ Microbiol

61:1691–1698

Top EM, Maltseva OV, Forney LJ (1996) Capture of a catabolic plasmid that encodes only

2,4-dichlorophenoxyacetic acid:alpha-ketoglutaric acid dioxygenase (TfdA) by genetic com-

plementation. Appl Environ Microbiol 62:2470–2476

Top EM, Moënne-Loccoz Y, Pembroke T, Thomas CM (2000) Phenotypic traits conferred by plas-

mids. In: Thomas CM (ed) The horizontal gene pool: bacterial plasmid and gene spread.

Harwood, New York, pp 249–285

Top EM, Springael D, Boon N (2002) Catabolic mobile genetic elements and their potential use in

bioaugmentation of polluted soils and waters. FEMS Microbiol Ecol 42:199–208

Toussaint A, Merlin C, Monchy S, Benotmane MA, Leplae R, Mergeay M, Springael D (2003) The

biphenyl- and 4-chlorobiphenyl-catabolic transposon Tn 4371 , a member of a new family of

genomic islands related to IncP and Ti plasmids. Appl Environ Microbiol 69:4837–4845

Tralau T, Cook AM, Ruff J (2001) Map of the IncP1beta plasmid pTSA encoding the widespread

genes ( tsa ) for p -toluenesulfonate degradation in Comamonas testosteroni T-2. Appl Environ

Microbiol 67:1508–1516

Trefault N, De la Iglesia R, Molina AM, Manzano M, Ledger T, Pérez-Pantoja D, Sánchez MA,

Stuardo M, González B (2004) Genetic organization of the catabolic plasmid pJP4 from

Ralstonia eutropha JMP134 (pJP4) reveals mechanisms of adaptation to chloroaromatic pollut-

ants and evolution of specialized chloroaromatic degradation pathways. Environ Microbiol

6:655–668

Tsuda M, Genka H (2001) Identi ﬁ cation and characterization of Tn 4656 , a novel class II transpo-

son carrying a set of toluene-degrading genes from TOL plasmid pWW53. J Bacteriol

183:6215–6224

213

8 Mobile Genetic Elements (MGEs) Carrying Catabolic Genes

Tsuda M, Iino T (1987) Genetic analysis of a transposon carrying toluene degrading genes on a

TOL plasmid pWW0. Mol Gen Genet 210:270–276

Tsuda M, Iino T (1988) Identi ﬁ cation and characterization of Tn 4653 , a transposon covering the

toluene transposon Tn 4651 on TOL plasmid pWW0. Mol Gen Genet 213:72–77

Tsuda M, Iino T (1990) Naphthalene degrading genes on plasmid NAH7 are on a defective trans-

poson. Mol Gen Genet 223:33–39

Tsuda M, Minegishi K, Iino T (1989) Toluene transposons Tn 4651 and Tn 4653 are class II trans-

posons. J Bacteriol 171:1386–1393

Uz I, Duan YP, Ogram A (2000) Characterization of the naphthalene-degrading bacterium,

Rhodococcus opacus M213. FEMS Microbiol Lett 185:231–238

van Beilen JB, Panke S, Lucchini S, Franchini AG, Röthlisberger M, Witholt B (2001) Analysis of

Pseudomonas putida alkane-degradation gene clusters and ﬂ anking insertion sequences: evolu-

tion and regulation of the alk genes. Microbiology 147:1621–1630

van der Meer JR, Sentchilo V (2003) Genomic islands and the evolution of catabolic pathways in

bacteria. Curr Opin Biotechnol 14:248–254

van der Meer JR, Zehnder AJ, de Vos WM (1991a) Identi ﬁ cation of a novel composite transposable

element, Tn 5280 , carrying chlorobenzene dioxygenase genes of Pseudomonas sp. strain P51. J

Bacteriol 173:7077–7083

van der Meer JR, van Neerven AR, de Vries EJ, de Vos WM, Zehnder AJ (1991b) Cloning and

characterization of plasmid-encoded genes for the degradation of 1,2-dichloro-, 1,4-dichloro-,

and 1,2,4-trichlorobenzene of Pseudomonas sp. strain P51. J Bacteriol 173:6–15

van der Ploeg J, Willemsen M, van Hall G, Janssen DB (1995) Adaptation of Xanthobacter auto-

trophicus GJ10 to bromoacetate due to activation and mobilization of the haloacetate dehalo-

genase gene by insertion element IS 1247 . J Bacteriol 177:1348–1356

Vedler E, Kõiv V, Heinaru A (2000) Analysis of the 2,4-dichlorophenoxyacetic acid-degradative

plasmid pEST4011 of Achromobacter xylosoxidans subsp. denitri ﬁ cans strain EST4002. Gene

255:281–288

Vedler E, Vahter M, Heinaru A (2004) The completely sequenced plasmid pEST4011 contains a

novel IncP1 backbone and a catabolic transposon harboring tfd genes for 2,4-dichlorophe-

noxyacetic acid degradation. J Bacteriol 186:7161–7174

Wagenknecht M, Meinhardt F (2011) Replication-involved genes of pAL1, the linear plasmid of

Arthrobacter nitroguajacolicus Rü61a – phylogenetic and transcriptional analysis. Plasmid

65:176–184

Wang M, Yang G, Min H, Lv Z (2009) A novel nicotine catabolic plasmid pMH1 in Pseudomonas

sp. strain HF-1. Can J Microbiol 55:228–233

Warburton PJ, Allan E, Hunter S, Ward J, Booth V, Wade WG, Mullany P (2011) Isolation of bacte-

rial extrachromosomal DNA from human dental plaque associated with periodontal disease,

using transposon-aided capture (TRACA). FEMS Microbiol Ecol 78:349–354

Warren R, Hsiao WW, Kudo H, Myhre M, Dosanjh M, Petrescu A, Kobayashi H, Shimizu S,

Miyauchi K, Masai E, Yang G, Stott JM, Schein JE, Shin H, Khattra J, Smailus D, Butter ﬁ eld

YS, Siddiqui A, Holt R, Marra MA, Jones SJ, Mohn WW, Brinkman FS, Fukuda M, Davies J,

Eltis LD (2004) Functional characterization of a catabolic plasmid from polychlorinated-

biphenyl-degrading Rhodococcus sp. strain RHA1. J Bacteriol 186:7783–7795

Wei M, Zhang JJ, Liu H, Wang SJ, Fu H, Zhou NY (2009) A transposable class I composite trans-

poson carrying mph (methyl parathion hydrolase) from Pseudomonas sp. strain WBC-3. FEMS

Microbiol Lett 292:85–91

Weightman AJ, Topping AW, Hill KE, Lee LL, Sakai K, Slater JH, Thomas AW (2002) Transposition

of DEH , a broad-host-range transposon ﬂ anked by IS Ppu12 , in Pseudomonas putida is associated

with genomic rearrangements and dehalogenase gene silencing. J Bacteriol 184:6581–6591

Williams PA, Murray K (1974) Metabolism of benzoate and the methylbenzoates by Pseudomonas

putida ( arvilla ) mt-2: evidence for the existence of a TOL plasmid. J Bacteriol 120:416–423

Winstanley C, Taylor SC, Williams PA (1987) pWW174: a large plasmid from Acinetobacter calcoa-

ceticus encoding benzene catabolism by the beta-ketoadipate pathway. Mol Microbiol 1:219–227

214

M. Shintani and H. Nojiri

Wozniak RA, Waldor MK (2010) Integrative and conjugative elements: mosaic mobile genetic

elements enabling dynamic lateral gene ﬂ ow. Nat Rev Microbiol 8:552–563

Wu JF, Sun CW, Jiang CY, Liu ZP, Liu SJ (2005) A novel 2-aminophenol 1,6-dioxygenase involved

in the degradation of p -chloronitrobenzene by Comamonas strain CNB-1: puri ﬁ cation, proper-

ties, genetic cloning and expression in Escherichia coli . Arch Microbiol 183:1–8

Wu JF, Jiang CY, Wang BJ, Ma YF, Liu ZP, Liu SJ (2006) Novel partial reductive pathway for

4-chloronitrobenzene and nitrobenzene degradation in Comamonas sp. strain CNB-1. Appl

Environ Microbiol 72:1759–1765

Xia XS, Aathithan S, Oswiecimska K, Smith AR, Bruce IJ (1998) A novel plasmid pIJB1 possessing

a putative 2,4-dichlorophenoxyacetate degradative transposon Tn 5530 in Burkholderia cepacia

strain 2a. Plasmid 39:154–159

Yagi JM, Sims D, Brettin T, Bruce D, Madsen EL (2009) The genome of Polaromonas

naphthalenivorans strain CJ2, isolated from coal tar-contaminated sediment, reveals physio-

logical and metabolic versatility and evolution through extensive horizontal gene transfer.

Environ Microbiol 11:2253–2270

Yano K, Nishi T (1980) pKJ1, a naturally occurring conjugative plasmid coding for toluene degra-

dation and resistance to streptomycin and sulfonamides. J Bacteriol 143:552–560

Yano H, Garruto C, Sota M, Ohtsubo Y, Nagata Y, Zylstra G, Williams P, Tsuda M (2007) Complete

sequence determination combined with analysis of transposition/site-speci ﬁ c recombination

events to explain genetic organization of IncP-7 TOL plasmid pWW53 and related mobile

genetic elements. J Mol Biol 369:11–26

Yano H, Miyakoshi M, Ohshima K, Tabata M, Nagata Y, Hattori M, Tsuda M (2010) Complete

nucleotide sequence of TOL plasmid pDK1 provides evidence for evolutionary history of

IncP-7 catabolic plasmids. J Bacteriol 192:4337–4347

Yergeau E, Sanschagrin S, Beaumier D, Greer CW (2012) Metagenomic analysis of the bioreme-

diation of diesel-contaminated Canadian high arctic soils. PLoS One 7:e30058

Zhang T, Zhang XX, Ye L (2011a) Plasmid metagenome reveals high levels of antibiotic resistance

genes and mobile genetic elements in activated sludge. PLoS One 6:e26041

Zhang Y, Jiang Z, Cao B, Hu M, Wang Z, Dong X (2011b) Chemotaxis to atrazine and detection

of a xenobiotic catabolic plasmid in Arthrobacter sp DNS10. Environ Sci Pollut Res Int

19(7):2951–8, Epub 2012 Feb 17

215

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_9, © Springer Science+Business Media Dordrecht 2013

Abstract Horizontal transfer of mobile genetic elements such as plasmids and

bacteriophages and their associated hitchhiking elements such as transposons, inte-

grative and conjugative elements and insertion sequences shapes bacterial chromo-

somes and enables their adaptation to changing environmental conditions. In soils,

a diversity of conjugative plasmids involved in microbial metabolism, coping with

stress factors or providing their carriers with traits outcompeting competitors in the

ecological niche have been detected by classical and molecular techniques. The

rhizosphere displays a hot spot for conjugative plasmid transfer in soil. Plasmid

transfer has been studied in a variety of soil habitats from pristine to heavily

polluted soils, such as heavy metal and radionuclide contaminated ones. In all of

these environments, plasmid transfer has been demonstrated to contribute to the

spread of genes that provide their recipients with ecological traits conferring adap-

tation to contaminant stress, to cope with the presence of toxic pharmaceuticals

(e.g. antibiotics) or enable them to degrade xenobiotic compounds. Transconjugants

harbouring the traits acquired by horizontal transfer were shown to survive in soil

and to spread the acquired bene ﬁ cial factors to both indigenous related and phylo-

genetically distant microorganisms. PCR screens have been developed to detect

conjugative plasmids of different incompatibility groups and virulence/pathoge-

nicity-encoded traits in a rapid, reliable and sensible way. This chapter summarizes

the state of the art of mobile genetic elements and their transmission in soils.

Keywords Conjugative plasmids • Mobilizable plasmids • Antibiotic resistance •

Molecular tools • Rhizosphere

E. Grohmann (*)

Division of Infectious Diseases, University Medical Centre Freiburg ,

Hugstetter Strasse 55 , 79106 Freiburg , Germany

e-mail: elisabeth.grohmann@uniklinik-freiburg.de

Chapter 9

Conjugative Plasmids in Anthropogenic Soils

Elisabeth Grohmann

216

E. Grohmann

1 Introduction

Soil is a very complex habitat dominated by the soil solid phase. In contrast to

aquatic systems, it is relatively recalcitrant to mixing, but soluble components of the

solid soil matrix may dissolve in soil water and reprecipitate at other sites (Daniel

2004 ) . The soil microorganisms are localized in close association with soil particles,

such as complexes of clay-organic matter (Foster 1988 ) . Microorganisms can be

found as single cells or microcolonies, which are often enclosed by a polysaccha-

ride matrix usually known as EPS (extracellular polymeric substances). Their

metabolism and interactions with other organisms and with soil particles is depen-

dent on the conditions at the microhabitat level, which often differ between micro-

habitats even at very small distances. The microhabitats in soil include micropores

and the surfaces of soil aggregates of various compositions and sizes (Banjard and

Richaume 2001 ; Torsvik et al. 2002 ; Daniel 2004 ) . Thus, soil can be regarded as

very heterogeneous with respect to conditions for microbial growth and for the dis-

tribution of microorganisms and matrix substances. This heterogeneity results in

multiple local chemical and physical microgradients, a wide variety of microbial

niches and a high diversity of soil microorganisms. This microbial diversity exceeds

that of other environments and is far greater than that of eukaryotic organisms: 1 g

of soil contains up to 10 billion microorganisms of possibly thousands of different

species (Roselló-Mora and Amann 2001 ; Daniel 2004 ) . The genetic complexity of

microbial soil communities has been estimated by re-association of community

DNA. This type of analyses has shown that the soil community size is equivalent to

6,000–10,000 Escherichia coli genomes (Torsvik et al. 1998 ; Øvreås 2000 ) .

Re-association kinetics of the total bacterial DNA in a 30 g soil sample revealed that

it contained more than 500,000 species (Doolittle 1999 ) . Thus, the genetic diversity

of the soil microbiota is a rich and widely unexplored resource for new enzymes and

bioactive compounds (Daniel 2004 ) .

Anthropogenic soils can be de ﬁ ned as human-altered and/or -transported soils

(ICOMANTH 2007 ) . The International Committee for Anthropogenic Soils

(ICOMANTH) suggests dividing them into six different categories, namely, Mine

and Dredge Soils, Urban Soils, Farmed/Altered Soils, Wet Soils, Polluted Soils, and

Other Anthropogenic Soils. In all these different types of soils mobile genetic ele-

ments (MGE) have been found: MGEs can be divided into the following major

groups: plasmids (subdivided into conjugative plasmids, mobilizable plasmids and

nonmobilizable plasmids), transposons (classical transposons and conjugative

transposons or integrative and conjugative elements (ICE)) and bacteriophages (e.g.

reviewed in Wozniak and Waldor 2010 ; Skippington and Ragan 2011 ) . Out of those,

of particular interest are the conjugative and mobilizable plasmids which are able to

self-transfer their genetic information (conjugative plasmids) or mobilize it with the

help of a conjugative helper plasmid (mobilizable plasmids) to closely and also

distantly related microorganisms via horizontal gene transfer (HGT). These plas-

mids can encode a variety of genetic information additionally to the genes required

for self-transfer or their conjugative mobilization. This information can include,

217

9 Conjugative Plasmids in Anthropogenic Soils

among others (i) antibiotic resistance genes (ii) heavy metal resistance genes,

(iii) degradative traits enabling the host harbouring the respective plasmid to degrade

xenobiotic substances, such as herbicides, fungicides or pesticides and (iv) “spite-

ful” traits, like the ones governing the production of bacteriocins to outcompete

bacterial neighbours.

This chapter will summarize the current knowledge on plasmids, in particular

mobilizable and conjugative ones from various anthropogenic soils and discuss

their potential applications in bioremediation and soil sanitation.

2 Horizontal Gene Transfer and Plasmid Types

HGT is a major source of phenotypic innovation and adaptation among bacteria.

Determinants for antibiotic resistance and other adaptive traits can spread rapidly,

particularly by conjugative plasmids (Skippington and Ragan 2011 ) . Plasmids

encode a range of phenotypic features and are important agents of HGT among

bacteria (Frost et al. 2005 ; Thomas and Nielsen 2005 ; Schlüter et al. 2007 ;

Barlow 2009 ) . As a class of MGEs, plasmids are de ﬁ ned by three key features:

the capacity to exist and replicate extra chromosomally, the ability to be transferred

between distinct hosts and the absence of genes essential to their hosts (Skippington

and Ragan 2011 ) . Plasmids are highly diverse in size, structure, transmission,

evolutionary history and accessory phenotypes (Slater et al. 2008 ; Carattoli

2009 ) . This diversity is due in part to the succession of HGT events, resulting in

size variation and mosaic structures (Mellata et al. 2009 ) . Plasmids are typically

mobilized by conjugative transfer. While not all plasmids encode the functions

essential for cell-to cell DNA transfer, mobilizable plasmids can be mobilized by

co-resident conjugative plasmids. Unlike conjugative plasmids, which can be

maintained and replicate autonomously in their host, most ICEs can be maintained

only through integration into the host replicon (Wozniak and Waldor 2010 ) . The

chromosome itself can be partially or completely transferred by conjugation,

provided it contains a conjugative element and the interbacterial junction is stable

long enough-up to an hour or more (Thomas and Nielsen 2005 ) . The remarkable

ability of conjugative transfer to mediate plasmid exchange between taxonomi-

cally and genetically unrelated bacterial hosts facilitates gene sharing within

broad genetic exchange communities (Ochman et al. 2000 ) . Conjugative transfer

commonly crosses species and genus boundaries (Davison 1999 ) and can extend

across biological domains (Buchanan-Wollaston et al.

1987 ; Heinemann and

Sprague 1989 ) . Due to general mechanisms such as exclusion, which restrain the

conjugative transfer of plasmids, not all strains or species within a community

are equally ef ﬁ cient as transfer donors. Some subpopulations of bacteria, including

bacteria harbouring plasmids carrying antibiotic resistance genes, have high

donor activity; these so-called ampli ﬁ ers (Dionisio et al. 2002 ) can accelerate the

spread of plasmids within their genetic exchange community (Skippington and

Ragan 2011 ) .

218

E. Grohmann

Successful conjugative transfer requires donor and recipient cells to be compatible,

as determined by surface proteins on the recipient (Thomas and Nielsen 2005 ) . Donor

cells encode a specialized multi-protein complex, termed the conjugation apparatus.

This conjugation apparatus is encoded by the so-called type IV secretion systems.

An important prerequisite for conjugative transfer is an intimate association between

the cell surfaces of the interacting donor and recipient cells. In gram-negative bacteria,

this physical contact is ﬁ rst established by complex extracellular ﬁ laments, desig-

nated “sex pili”. For the majority of gram-positive bacteria, the means to achieve this

intimate cell-cell contact have not yet been identi ﬁ ed but do not apparently involve

sex pili (Grohmann et al.

2003 ; Alvarez-Martinez and Christie 2009 ) .

Likely, the frequency of conjugation, however, depends primarily on the donor

bacterium; recipient E. coli cells, for example, contain no gene indispensable for

conjugation (Perez-Mendoza and de la Cruz 2009 ) .

Plasmids can be divided into incompatibility (Inc) groups (Novick 1987 ) .

Incompatibility has been described as a manifestation of relatedness: plasmids that

utilize common mechanisms for replication or stability cannot proliferate in the

same cell line (Carattoli et al. 2005 ) . Inc groups thus constrain plasmid host range.

Plasmids must nonetheless adapt to unfavourable hosts if they are to persist long

term within a Genetic Exchange Community (Skippington and Ragan 2011 ) . Some

plasmids can be maintained only in one or a few bacterial hosts (narrow-host-range

plasmids), others replicate in diverse bacterial genera (broad-host-range plasmids).

The latter may not be equally stable in all hosts, particularly as their ability to persist

in a bacterial population is determined in part by host-encoded traits (De Gelder

et al. 2007 ) . Under certain selective conditions, plasmids can extend their host

range, often via a relatively small number of genetic changes (De Gelder et al.

2008 ) . Plasmids in the same plasmid family can show very different host ranges

(Wu and Tseng 2000 ) , suggesting that broad-host-range plasmids can probably arise

selectively from those of narrower host ranges (Thomas and Nielsen 2005 ) . Fondi

et al. ( 2010 ) introduced the concept of the panplasmidome, the set of all plasmids

harboured by members of a taxonomic group. Based on analysis of plasmids from

the genus Acinetobacter , they concluded that plasmids likely mediate preferential

ﬂ ow of genetic information within and between Genetic Exchange Communities.

3 Traits Transferred via Horizontal Gene Transfer

Prokaryotic genomes are known to vary in their rates of gene gain and loss. Most

bacteria are highly dynamic, with high rates of gene gain and loss, whereas some,

typically those of obligatory endosymbionts, have stable or shrinking genomes

(Rankin et al. 2011 ) . Within genomes, genes differ in their aptitude to be mobile. In

addition to the core genome (approximately 2,000 genes in E. coli that are present in

the ﬁ rst 20 sequenced strains), non-core genes contribute signi ﬁ cantly to the overall

diversity of gene repertoires in a species, which together with the core are designated

the pan-genome (Rankin et al. 2011 ) . In a study of E. coli , these non-core genes

219

9 Conjugative Plasmids in Anthropogenic Soils

made up 90% of the pan-genome when 20 strains were put together (Touchon et al.

2009 ) . There is increasing information on important separations of functions between

the vertically transmitted core genome, which encodes fundamental cellular pro-

cesses, and the horizontally transmissible accessory genome, which encodes for a

variety of secondary metabolites conferring resistance to speci ﬁ c toxins or antibiot-

ics or the ability to exploit a speci ﬁ c niche (Hacker and Carniel

2001 ; Norman et al.

2009 ) . The accessory genome contains acquired functions, MGEs, non-expressed

genes and genes expressed under particular modes of selection (Rankin et al. 2011 ) .

Despite the large interest in research into the molecular mechanisms of HGT, the

ecological and evolutionary forces that drive the basic divisions of mobility and func-

tion are still poorly understood (see for example, Slater et al. 2008 ) .

Horizontally transferred genes can confer a variety of bene ﬁ cial and negative

effects on their bacterial hosts. The ﬁ tness costs of MGEs differ signi ﬁ cantly with

the element. The introduction of plasmids, ICEs, mobilizable islands or transpos-

able elements into the bacterial genome, does not pose the same life-or-death

dilemma as temperate and virulent phages respectively exert on their hosts (Rankin

et al. 2011 ) . However, these elements are most likely costly (Diaz Ricci and

Hernandez 2000 ) . MGE replication requires the synthesis of proteins, RNA and

DNA, which incur in a ﬁ tness cost. This cost can be low in general and can be easily

exceeded by other adaptive or addictive traits. However, HGT often involves the

creation of proteinaceous structures, such as conjugative pili, that can be costly

(Rankin et al. 2011 ) . MGEs can also be costly because of the genes they carry com-

pete with other genetic elements. For instance, F-like plasmids use exclusion pro-

teins to prevent super-infection by other closely related plasmids that are very highly

expressed (Achtman 1975 ) . MGEs may also carry genes coding for adaptive traits.

Thus, they have been denominated “agents of open source evolution” (Frost et al.

2005 ) , suggesting that they facilitate their host access to a vast genetic resource that

can then be improved upon and made available to other organisms. As already men-

tioned, many bene ﬁ cial traits for the receiving organisms are carried by plasmids,

including virulence factors, antibiotic resistance, detoxifying agents and enzymes

for secondary metabolism (Philppon et al. 2002 ; Yates et al. 2006 ; Martínez 2008,

2009 ; Rankin et al. 2011 ) . Additionally to having an effect on the bacterial host,

many horizontally transferred genes also code for traits that can affect the ﬁ tness of

a host’s neighbours (Rankin et al. 2011 ) . This can be either in a positive way, by

producing proteins that can have a bene ﬁ cial effect on the degrading enzymes of the

host’s neighbours (Livermore 1995 ) , or in a negative way, by producing compounds

that harm the host’s neighbours, such as bacteriocins (for instance, van der Ploeg

2005 ; Brown et al. 2006 ) . In spite of their potentially positive effects on host ﬁ tness,

it is important to mention that MGEs do not necessarily share the same interest as

that of the host genome and can thus be considered ﬁ rst and foremost as infectious

agents; they infect their hosts much in the same way as parasites infect their host

(through cell to cell contact for plasmids), and can thus persist in spite of potential

costs they may impose on the host (Rankin et al. 2011 ) . Whether they confer

bene ﬁ cial or detrimental effects on a host will depend on the selective forces exerting

an effect on both the MGE and the host chromosome.

220

E. Grohmann

Rankin et al. ( 2011 ) classi ﬁ ed in an excellent way the behaviour of MGEs by

their net in ﬂ uence on their host cell (from parasitic to mutualistic, see for example,

Ferdy and Godelle 2005 ) and additionally by their net in ﬂ uence on neighbouring

cells (whether they turn their host cell into “helpers” or “harmers” of neighbouring

cells). The classi ﬁ cation scheme commonly used in social evolution theory divides

social behaviours into two types, depending on their effects on the ﬁ tness of a target

individual and that of its neighbour. Social behaviours are divided into “mutual-

ism”, “sel ﬁ shness”, “altruism” and “spite” (West et al.

2007b ) . Thus, Rankin et al.

( 2011 ) distinguished traits that are kept within the bacterial cell (“private” traits,

governing the parasitism–mutualism axis) from those secreted outside the cell

(“public” traits, which govern the helping-harming axis). Some of the “private” and

“public” traits will be discussed in the following sections.

3.1 Private Traits: Genomic Parasites and Mutualists

3.1.1 MGEs as Parasites

As many prokaryotes have very large effective population sizes, any gene conferring

a deleterious effect on their host will be selected against and purged from the popula-

tion. However, many MGEs do exert costs on their hosts (Diaz Ricci and Hernandez

2000 ; Fox et al. 2008 ) raising the question as to how costly and poorly transmissible

MGEs can persist within a genome (see for instance, Bergstrom et al. 2000 ; Lili et al.

2007 ) . The persistence of any parasite is fundamentally determined by its rate of hori-

zontal transmission (Anderson and May 1992 ) , which can be easily measured for plas-

mids and has been found to vary over eight orders of magnitude among various E. coli

plasmids (Dionisio et al. 2002 ) . Although highly mobile plasmids can readily persist

as so called molecular “parasites” ( Bahl et al. 2007 ) , the persistence of elements with

extremely low rates of horizontal transfer cannot be readily explained in this way,

given any reduction in vertical transmission imposed by the plasmid (see Bergstrom

et al. 2000 ; Dionisio et al. 2002 ) . However, one of the unsolved issues in this context

is that HGT rates have until now been primarily determined under laboratory condi-

tions, and are still dif ﬁ cult to estimate for natural populations (Slater et al. 2008 ) .

Infectious elements such as plasmids are likely to face a trade off between hori-

zontal transfer and vertical transmission, mediated by the costs that they impose on

their hosts (Haft et al. 2009 ; Turner 2004 ) . Studies on conjugative plasmids demon-

strated that the cost of MGEs generally decreases under selection (Turner et al.

1998 ; Bouma and Lenski 1988 ) ; plasmids that exert lower costs on their hosts have

a higher representation in daughter cells. However, as an increase in vertical transfer

generally comes at a cost to HGT, there will be an optimum in which gene transfer

through some mix of both horizontal and vertical mechanisms is maximized

(Paulsson 2002 ; Rankin et al. 2011 ) .

There is a large variance in the transmissibility of bacterial plasmids (Dionisio

et al. 2002 ) , and selection is likely to exert an effect upon hosts to reduce the

221

9 Conjugative Plasmids in Anthropogenic Soils

frequency of conjugation in the case the transfer is costly. Thus, in many plasmids

the expression of the conjugation machinery depends on cell density (Kozlowicz

et al. 2006 ) , or is repressed after some lag upon acquisition of the plasmid

(Polzleitner et al.

1997 ) , presumably because by then most recipient cells already

contain the plasmid and the costs of conjugation offset the gains in further

transfer.

Considering MGEs as infectious agents highlights the selection pressures driv-

ing them to optimize their own parasite function, balancing gains through transfer

(vertical and horizontal) with losses through burden and eventually death of the

host. If the spatial density of hosts is high, favouring HGT, MGEs will be selected

to increase their horizontal transmission, even at a high cost to the host. However, if

HGT is reduced to very low levels, then MGEs can only increase their ﬁ tness by

coding for traits enhancing vertical transmission and for traits that are bene ﬁ cial to

the host (Ferdy and Godelle 2005 ) . Costs of MGEs are likely to be reduced by

coevolution with their bacterial hosts. If plasmid-chromosome co-evolution results

in the evolution of smaller plasmids, which impose little or no costs on their hosts,

there would be no additional ﬁ tness cost from a gene that is carried on the plasmid

compared with the chromosome. Very small plasmids may not exert a visible ﬁ tness

effect on their host if they do not have large copy numbers. If there are no or really

low costs to a MGE, it will be readily able to spread in a population through HGT

(Rankin et al. 2011 ) . Actually, reduced costs of plasmid carriage may have been the

driving force for the creation of secondary chromosomes in many bacteria. Such

chromosomes often have plasmid-like features and are ubiquitous in some bacterial

clades (Egan and Waldor 2003 ; Slater et al. 2009 ; Rankin et al. 2011 ) . Accordingly,

recent studies showed that the very large plasmids have lost mobility and acquired

essential genes (Smillie et al. 2010 ) .

3.1.2 MGEs as Mutualists

MGEs have been associated with the spread of a wide range of adaptive traits that

enhance the ﬁ tness of their hosts. For example, plasmids commonly carry resistance

genes that allow bacteria to grow in the presence of antibiotics or heavy metals,

which usually show spatially or temporarily variable distributions (Eberhard 1990 ) .

Plasmids also play important roles in the establishment of antagonisms or mutualisms

between prokaryotes and eukaryotes, such as virulence traits (Buchrieser et al.

2000 ) , nitrogen ﬁ xation by genes encoded on rhizobia symbiotic plasmids (Nuti

et al. 1979 ) or amino acid production, for instance in the insect endosymbiont

Buchnera (Gil et al. 2006 ) . Genes carried on plasmids may be readily transferred to

the bacterial chromosome. Theoretical models suggest that constant selection pres-

sure should favour transfer of bene ﬁ cial plasmid genes to the chromosome to avoid

the costs of plasmid carriage (Eberhard 1990 ; Bergstrom et al. 2000 ) . This raises the

question: Why do bene ﬁ cial genes remain on MGEs and do not integrate them-

selves into the chromosome? If selection pressures differ over time or space, genes

that are bene ﬁ cial in some environments, but not others, will be able to persist on

222

E. Grohmann

MGEs. In a spatially structured environment, MGEs help to facilitate the transmission

of bene ﬁ cial traits that have previously evolved in local populations to other sub-

populations (Bergstrom et al. 2000 ) . Parasites and symbionts usually lie on a con-

tinuum between harming (in the case of parasites) and helping (in the case of

mutualists) their partners. MGEs that encode bene ﬁ cial genes can be seen as mutu-

alists and should face the same evolutionary dilemma (Sachs and Simms

2007 ;

Rankin et al. 2011 ) . When should a MGE provide a bene ﬁ t and when should it harm

its host, and how will these evolutionary decisions in turn in ﬂ uence mobility?

The more a MGE transmits vertically, the more it will depend on the reproduction

of the host, and selection processes will therefore favour genes that are bene ﬁ cial to

the host, whereas higher HGT frequencies will have a negative impact on the host.

Over long timescales, elements that harm the host are likely to be lost, and those that

are bene ﬁ cial will probably be integrated into the host genome. Despite the poten-

tial bene ﬁ ts of some plasmids to the bacteria involved, sharing bene ﬁ cial DNA with

other members of the population can be seen as a social dilemma. The reason for

this is that a bacterium that theoretically does not suppress the transmission of a

plasmid will be bene ﬁ ting its potential competitors. If plasmid transfer is costly,

then this may be seen as an altruistic act (Rankin et al. 2011 ) .

3.1.3 MGEs as Drivers of Bacterial Sociality

Social behaviours can be categorized by their net lifetime direct effect on the ﬁ tness

of a focal bacterium (the actor) and on neighbouring bacteria (the recipients) as

described by Hamilton ( 1964 ) and West et al. ( 2007b, c ) . The resulting four behav-

iours are “sel ﬁ shness”, which confers a bene ﬁ t on the actor while exerting a cost on

the social partner, “altruism”, “spite” and “mutually bene ﬁ cial behaviours”. Over

the past 10 years many research efforts have been devoted to microbial sociality, and

all four of these social behaviours can be found in microbial populations ( West et al.

2006, 2007a, b, c ; Xavier and Foster 2007 ; Rankin et al. 2011 ) . Rankin et al. ( 2011 )

argued that all of these four behaviours can be observed to be encoded by horizon-

tally transferred genes. Due to their effect on the local genetic structure, MGEs lend

themselves to promoting cooperative social traits (Rankin et al. 2011 ) .

3.2 Public Traits

3.2.1 Cooperation: Altruism and Mutually Bene ﬁ cial Traits

Bacteria are remarkably cooperative organisms, producing a diversity of shared,

secreted products (public goods) that can enhance growth in a diversity of challenging

environments (West et al. 2006, 2007a ) . However, similar to any social organism,

cooperative bacteria are always vulnerable to exploitation by non-producing cheats.

In the absence of any “family” or spatial structure, any individual in a population

223

9 Conjugative Plasmids in Anthropogenic Soils

that does not produce a public good will have an advantage over individuals that do,

a situation referred to as the tragedy of the commons (Hardin 1968 ; Rankin et al.

2007 , 2011 ) . As non-producing individuals have a ﬁ tness advantage over those that

produce public goods, non-producing individuals will invade over time. Many traits

that have been shown to be involved in bacterial cooperation and virulence are

encoded on MGEs, such as traits that can degrade toxins in the local environment

(Philppon et al.

2002 ; Lee et al. 2006 ; and secreted toxins (Waldor and Mekalanos

1996 ; Ahmer et al. 1999 ) .

As plasmids can spread horizontally within a local population, they can change the

genetic structuring among individuals in local populations. Relatedness is an in ﬂ uential

measure of population genetic structure, used in particular to decipher the direction of

selection on social traits (Hamilton 1964 ; Grif ﬁ n et al. 2004 ; Rankin et al. 2011 ) , with

higher relatedness between individuals tending to favour the evolution of cooperative

traits (Hamilton 1964 ) . Relatedness at mobile loci can increase as a result of HGT.

Therefore, it is expected that many genes involved in the production of cooperative

traits, or public goods, will be carried by MGEs, in particular by conjugative plasmids

(Rankin et al. 2011 ) . Genes encoding proteins that are secreted outside of the cell can

be referred to as being part of the secretome. As proteins are costly to produce, secret-

ing them outside of a cell has a clear cost to the producing individuals. Nogueira et al.

( 2009 ) analyzed the genomes of 20 Escherichia and Shigella lineages, determined

where proteins were likely to be expressed within a cell, and identi ﬁ ed the genes that

coded for secreted proteins. The genomes were further analyzed for transfer hotspots

(areas in the genome more likely to be transmitted horizontally) and for determining

whether the genes coding for secreted proteins were more likely to be located on

transfer hotspots or plasmids. They found that 8% of chromosomal hotspot genes

coded for extracellular proteins. On the contrary, 15% of the plasmid genes code for

extracellular proteins. This suggests that HGT has a high impact on the evolution of

social behaviours in bacteria (Nogueira et al. 2009 ) .

A well-studied plasmid in ﬂ uencing the social environment is the tumour-inducing

plasmid in the plant pathogen, Agrobacterium tumefaciens . For the bacterium to

be virulent, it must carry a copy of the T

plasmid, parts of it are then inserted via

HGT into the plant cells. Once in the plant, the plasmid induces cell division, which

creates a crown gall (Zupan et al. 2000 ) . The gall releases opines that can then be

used as an important source of nitrogen and energy for the bacterium (Zupan et al.

2000 ; White and Winans 2007 ) . Interestingly, only bacteria that are infected with

the plasmid can use the opines meaning that cooperation by plasmids only favours

other individuals that harbour the plasmid, making the trait a so-called “greenbeard”

(Rankin et al.

2011 ) .

3.2.2 Spiteful Traits

The ﬂ ipside of altruism is spite, in which an individual pays a cost to impose another

cost on another individual (Hamilton 1970 ; Gardner and West 2004a, b, 2006 ; Rankin

et al. 2011 ) . This is especially common in bacteria, in which individual cells may

224

E. Grohmann

produce bacteriocins, or other toxins, to kill their conspeci ﬁ cs (Riley and Wertz 2002 ;

Gardner et al. 2004 ; Ackermann et al. 2008 ) . Spite has long been observed as a puz-

zling evolutionary phenomenon, as a given actor pays a net cost to impose a net cost

on another member of the population (Foster et al.

2001 ) . Spite occurs in various sys-

tems (for example, Foster et al. 2000 ; Gardner et al. 2004, 2007 ; Rankin et al. 2011 )

but has most often been invoked regarding anti-competitor behaviours in bacteria

(West et al.

2006, 2007a ; Dionisio 2007 ; Brown and Buckling 2008 ; Rankin et al.

2011 ) . Spiteful extracellular products, which are costly for the producer and cause

harm to other members of the population, are frequently found on MGEs, especially

on plasmids and phages (see, for example, Brown et al. 2006 ) . In the case of bacterio-

cins, plasmids can encode both toxins and the corresponding genes for resistance to

the toxin (Riley and Wertz 2002 ) . Spite can evolve if the individual exerting an effect

spitefully and the recipient of the spiteful behaviour are negatively related. Usually

this occurs under small population sizes (Gardner and West 2004b ) or if there is a way

of recognizing unrelated individuals (Keller and Ross 1998 ; Brown and Buckling

2008 ; Rankin et al. 2011 ) . If bacteriocins are encoded on plasmids, then it is easier; if

a cell encoding bacteriocins lyses, it kills all members of the neighbourhood that do

not carry the plasmid, and this favours individuals that carry the plasmid (as they also

carry resistance to the bacteriocin). Therefore, one may regard such genes as being

“greenbeard”, as bacteriocinogenic individuals (carriers of the toxin-immunity gene

complex) preferentially help other individuals carrying the exactly same complex to

survive (Rankin et al. 2011 ) . One should expect bacteriocins to be carried by plasmids

with intermediate levels of HGT; if transfer is too high, and all individual cells in a

local neighbourhood carry a plasmid, there are no non-carriers to kill. In contrast, if

plasmids are too rare, then there would be insuf ﬁ cient toxin and subsequent killing to

compensate for the ﬁ xed costs of toxin production (Chao and Levin 1981 ) .

4 Soil Types and Plasmids Encountered

It is increasingly being recognized that conjugative plasmid transfer across species

boundaries plays a vital role in the adaptability of bacterial populations to varying

soil conditions. There are speci ﬁ c driving forces for and constraints to plasmid trans-

fer within bacterial communities in soils (Heuer and Smalla 2012 ) . Plasmid-mediated

genetic variation enables bacteria to respond rapidly via adaptive responses to chal-

lenges such as variable antibiotic or metal concentrations, or the opportunity to uti-

lize xenobiotic compounds as the sole carbon source. Plasmids seem to be an ancient

and successful strategy to ensure survival of a bacterial soil population in spatial and

temporal heterogeneous conditions with differing environmental stresses or opportu-

nities that occur irregularly or as a novel challenge in soil (Heuer and Smalla 2012 ) .

In all types of soil, for instance, in polluted, mine, urban, farmed, and fertilized

soils self-transmissible and mobilizable plasmids have been found and some of

them have been studied in detail. However, most of the studies up to now have been

only performed in polluted and fertilized/manured soils.

225

9 Conjugative Plasmids in Anthropogenic Soils

4.1 Plasmids in Polluted and Mine Soils

Most work has been dedicated to studies of plasmids encoding traits that enable the

degradation of xenobiotics.

Lin et al. (

2012 ) isolated a Gordonia strain capable to utilize naphthalene as a

sole carbon source from a diesel-oil industrial park site located in Kaohsiung

County, Taiwan. The naphthalene catabolic genes in the Gordonia strain

CC-NAPH129-6 are organized in an operon-like gene cluster and were found to be

located on a 97-kb plasmid harboured by the strain. Furthermore, a partial transpos-

ase sequence containing an insertion sequence (IS) element structure was found in

the plasmid, which was ﬂ anked by direct repeats downstream of narC, one of the

structural genes of the naphthalene catabolic operon. Comparative analyses of the

naphthalene catabolic genes, the 16S rRNA and gyrB gene present in strain

CC-NAPH129-6 and naphthalene-degrading Rhodococcus species implied that the

naphthalene catabolic genes in strain CC-NAPH129-6 might be horizontally trans-

ferred from Rhodococcus spp. Thus, this is the ﬁ rst report on the presence of naph-

thalene catabolic genes with an operon-like structure in Gordonia , and it might

provide evidence of the importance of this actinobacterial lineage in the bioreme-

diation of oil-contaminated soils (Lin et al. 2012 ) .

Over the past 40 years, the s-triazine herbicide, atrazine (2-chloro-4-ethylamino-

6-isopropylamino-s-triazine), has been widely used in agriculture to control grassy

and broadleaf weeds (Udiković-Kolić et al. 2010 ) . To characterize the atrazine-

degrading potential of bacterial communities enriched from an agrochemical fac-

tory area, upper soil layer samples were collected within the Herbos factory area,

Zagreb, Croatia, from three different locations exposed to long-term contamination

with atrazine and other s-triazine compounds. The bacterial communities enriched

from these three different sites of varying atrazine contamination mineralized

65–80% of

C ring-labelled atrazine within 4 days. The presence of the atrazine

degradative genes, in different combinations, trzN-atzBC-trzD , trzN-atzABC-trzD

and trzN-atzABC-DEF-trzD , was con ﬁ rmed by PCR. In all enriched communities,

the trzN-atzBC genes were located on a putatively conjugative 165-kb plasmid,

while the atzBC or atzC genes were located on separate plasmids (Udiković-Kolić

et al. 2010 ) . Quantitative real-time PCR revealed that catabolic genes were present

in up to 4% of the bacterial community. Sequencing of selected clones identi ﬁ ed

members belonging to the Proteobacteria ( a -, b - and g -subclasses), Actinobacteria

and Bacteroidetes . The presence of catabolic genes in a small proportion of the

microbial community suggests that only a subset of the community has the ability

to degrade atrazine (Udiković-Kolić et al. 2010 ) .

Gene bioaugmentation is a bioremediation strategy that enhances the biodegra-

dative potential via dissemination of degradative genes from introduced microor-

ganisms to indigenous microorganisms. Inoue et al. ( 2011 ) performed bioremediation

studies with 2,4-dichlorophenoxy-acetic acid (2,4-D)-contaminated soil slurry and

Pseudomonas putida and E. coli strains harbouring the conjugative 2,4-D degrada-

tive plasmid pJP4 in microcosms to assess possible effects of gene bioaugmentation

226

E. Grohmann

on the overall microbial community structure and ecological functions (carbon

source utilization and nitrogen transformation potentials). Although exogenous bac-

teria decreased rapidly, 2,4-D degradation was stimulated in bioaugmented micro-

cosms, probably due to the conjugative transfer of pJP4 to the indigenous soil

community. Terminal restriction fragment length polymorphism analysis revealed

that, although the bacterial community structure was changed immediately after

introducing the exogenous bacteria to the inoculated microcosms, that community

gradually approached the one of the uninoculated microcosm (Inoue et al.

2011 ) . In

this study transconjugants appeared to be limited to Burkholderia spp., which have

been frequently found to be 2,4-D-degrading transconjugants of plasmid pJP4 in

soil (DiGiovanni et al. 1996 ; Goris et al. 2002 ) . Furthermore, persistence of transcon-

jugant population even without the selective pressure (for instance, 2,4-D) argues

that plasmid pJP4 will be relatively stable in the soil microbial community.

Inoue et al. ( 2011 ) concluded that the impact of pJP4 dissemination among the

indigenous microbial community would be less pronounced than the introduction of

exogenous bacteria, and the in ﬂ uence of gene bioaugmentation with P. putida and

E. coli strains harbouring pJP4 on the indigenous soil microbial populations and

their carbon and nitrogen transformation capabilities are not irretrievable and long-

lasting. The results of Inoue et al. ( 2011 ) suggest that gene bioaugmentation can be

effective for the remediation of 2,4-D contaminated soil without drastic impacts on

the indigenous microbial community. Ikuma et al. ( 2012 ) have recently shown in

soil slurry batch reactors that ef ﬁ cient TOL plasmid-mediated bioaugmentation

could be further improved by minimal altering of environmental conditions, such as

the addition of nutrient.

Heavy-metal contamination of the environment is now wide-spread. Soils may

become contaminated from a variety of anthropogenic sources, such as smelters,

mining, industry, and application of metal-containing pesticides and fertilizers. Soil

microorganisms are very sensitive to moderate heavy-metal concentrations. Pereira

Almeida et al. ( 2006 ) designed a study to screen for possible mechanisms involved

in cadmium resistance of Rhizobium isolates, originating from an area in close prox-

imity to heavy metal industries that have been in operation for nearly 30 years. The

cadmium tolerance levels of several isolates derived from sites with different heavy-

metal contamination were determined. Unexpectedly, extremely cadmium tolerant

isolates accumulated higher levels of metal, suggesting the presence of intracellular

agents that prevent metal interfering with important metabolic pathways. Plasmid

pro ﬁ les also showed differences; most tolerant isolates harboured two plasmids, with

sizes of 485 and 415 kb, indicating that extra chromosomal DNA may be involved in

cadmium resistance (Pereira Almeida et al. 2006 ) . One of the characteristics encoded

by these plasmids that can interfere with heavy metal tolerance is the synthesis of

lipopolysaccharides (LPSs) which can function as a barrier to the entry of metals into

the cell (Pereira Almeida et al. 2006 ) . Plasmid pro ﬁ les showed variations between

Rhizobium isolates from differently contaminated soils. Most of the moderately tol-

erant and tolerant isolates harboured three or four plasmids; however, plasmid pro ﬁ les

were more similar between tolerant isolates. Plasmids of 485 and 415 kb were

detected only in tolerant and extremely tolerant isolates surviving in conditions

227

9 Conjugative Plasmids in Anthropogenic Soils

containing between 250 and 500 m M of cadmium chloride. Pereira Almeida and

co-workers showed that there is a resistance mechanism common to all isolates,

which is characterized by the presence and/or induction of a LPS quantity that

sequestrates most of the metal extracellularly, acting as a ﬁ rst-defence barrier against

heavy-metal stress. However, LPSs failed to reach the highest levels of stress imposed.

Pereira Almeida et al. (

2006 ) concluded that rhizobia response to heavy-metal stress

is a complex phenomenon, where different mechanisms, some of them carried on

plasmids, act together to confer the levels of tolerance observed. Mohamed and Abo-

Amer have recently isolated a P. aeruginosa RA65 strain from car-traf ﬁ c impacted

Egyptian soil. RA65 harboured a single plasmid of about 9.5 kb which mediated

heavy metal resistance (for instance to lead, cadmium and zinc). Consequently, this

putatively mobilizable small plasmid could be ef ﬁ ciently used in bioremediation of

heavy metal-contaminated soils (Mohamed and Abo-Amer 2012 ) .

4.2 Plasmids in Manured/Wastewater-Fertilized Soils

Binh and co-workers investigated the prevalence and types of self-transmissible

antibiotic resistance plasmids in piggery manure, which is applied as crop fertilizer

on ﬁ elds in Germany. Samples from manure storage tanks of 15 farms were analy-

sed, representing diverse sizes of herds, meat or piglet production. Antibiotic resis-

tance plasmids from manure bacteria were captured in gfp -tagged rifampicin-resistant

E. coli recipients and characterized (Binh et al. 2008 ) . The presence of different

plasmid types was also investigated in total community DNA by PCR and Southern

blot. Two hundred and twenty-eight transconjugants were recovered from the 15

manures using selective media supplemented with the antibiotics, amoxicillin, sul-

fadiazine or tetracycline. The restriction patterns of 81 plasmids representing differ-

ent resistance pro ﬁ les or originating from different samples clustered into seven

groups. Replicon typing revealed that most of the plasmids belonged to the incom-

patibility group IncN, followed by members of the recently discovered pHHV216-

like plasmids and the IncP-1 type. The amoxicillin resistance gene bla -TEM was

found on 44 plasmids, and the sulphonamide resistance genes sul1 , sul2 and/or sul3

on 68 plasmids (Binh et al. 2008 ) . Hybridization of replicon-speci ﬁ c sequences

ampli ﬁ ed from community DNA revealed that IncP-1 and pHHV216-like plasmids

were present in all manures. The authors concluded that “ ﬁ eld-scale” piggery

manure is a reservoir of broad-host range plasmids conferring multiple antibiotic

resistance genes.

The transfer frequencies of MGEs from the manure bacteria to E. coli CV601 gfp

in this study were in the same range (10

−4

to 10

−8

) as the plasmid transfer frequencies

observed in a similar study (Smalla et al. 2000a ) . Most of the captured plasmids

conferred multiple antibiotic resistance, 4 of them even encoded resistance towards

7 of the 8 antibiotics investigated and 40 towards 6 of the 8 antibiotics tested. It is

documented that the selection by one antibiotic may co-select for other antibi-

otic resistances (Normark and Normark 2002 ) . Therefore, it is not surprising that,

228

E. Grohmann

although Binh et al. ( 2008 ) used only one antibiotic for the selection of putative

transconjugants, plasmids with multiple resistances were captured. Sulfadiazine

resistance was remarkably frequent among the transconjugants (204 out of 228),

although only one third of them had originally been isolated from sulfadiazine-

supplemented plates. The abundance of sulfadiazine resistance among the transcon-

jugants might re ﬂ ect the use of sulfadiazine in animal husbandries (Boxall et al.

2003 ) . The sul2 gene was the most frequently detected sul gene conferring resistance

to sulfadiazine (46 out of 81) captured from 12 manures. Interestingly, sul2 was

detected on all 19 pHHV216-like plasmids, a new plasmid type with low% G + C

content. These plasmids are self-transmissible, encode multiple antibiotic resistances

and have been recently identi ﬁ ed as a major vector of sul2 in manure and soil (Heuer

et al. 2009 ) . Thus, it may be argued that Low-G + C%-type plasmids like pHHV216

play an important role in the spread of sul2 genes in manure. Binh and co-workers

( 2008 ) demonstrated that the majority of the amoxicillin resistant transconjugants

carried the bla - TEM gene, con ﬁ rming the results by Binh et al. ( 2007 ) on the abun-

dance of bla-TEM genes on MGEs captured from manure and amoxicillin-treated

soils. Furthermore, Binh et al. ( 2008 ) con ﬁ rmed that IncN plasmids originating from

manure are important vehicles for the bla -TEM gene dissemination among manure

bacteria. Thus, the use of manure as a soil fertilizer will introduce not only bacteria

harbouring MGEs with antibiotic resistance genes but additionally nutrients and

antibiotics excreted un-metabolized by farm animals (Witte 2000 ) that may increase

the abundance of transmissible antibiotic resistance in soil- and plant-associated

bacterial communities (Heuer and Smalla 2007 ; Binh et al. 2008 ) .

The impact of wastewater irrigation on the abundance of antibiotics and their

corresponding putatively transmissible resistance genes was investigated in soils of

the Mezquital Valley (Mexico), the world’s largest sewage ﬁ eld, by Dalkmann et al.

( 2012 ). Irrigation with untreated wastewater releases among others pharmaceuti-

cals, pathogenic bacteria, and resistance genes into the environment, but little is

known about the growing accumulation of these contaminants when wastewater is

applied for decades. The researchers sampled a chronosequence of soils having

received from zero (“rain-fed soil”) to 100 years of wastewater irrigation in the

Mezquital Valley and investigated the accumulation of six different antibiotics, as

well as the occurrence of Enterococcus spp., and sul ( sul1 , sul2 ) and qnr ( qnrA ,

qnrB , qnrS ) genes, conferring resistance to ﬂ uorquinolones.

Total concentrations of the antibiotics cipro ﬂ oxacin, sulfamethoxazole, and car-

bamazepine increased with irrigation duration reaching 95% of their upper limit

after 19–28 years, in the Mezquital Valley soils. Accumulation was soil-type-

speci ﬁ c, with largest accumulation rates in Leptosols and no time-trend in Vertisols.

It is to note that qnrA genes were not detected, but qnrS and qnrB were found in two

of the wastewater-irrigated soils. Relative concentrations of sul1 genes in wastewa-

ter-irrigated soils were two orders of magnitude larger (3.15 × 10

−3

copies/16S

rDNA) than in rain-fed soils (4.35 × 10

−5

copies/16S rDNA), while those of sul2

exceeded those in rain-fed soils by a factor of 22. The concentration of sul genes

continued to increase with long-lasting irrigation together with Enterococcus spp.

23S rDNA and total 16S rDNA contents. However, increasing total concentrations

229

9 Conjugative Plasmids in Anthropogenic Soils

of antibiotics in soil were not accompanied by increasing relative abundances of

resistance genes. Dalkmann and co-workers assumed that increasing total concen-

trations of resistance genes with longer time of irrigation could be related to increas-

ing microbial biomass by wastewater irrigation and probably to longer survival of

wastewater-borne bacteria between irrigation events. Moreover, increasing absolute

concentrations of resistance genes suggest that the genetic information is preserved

for longer periods than the compounds themselves.

Heuer and Smalla (

2012 ) studied the role of the broad-host range IncP-1 e plas-

mids in the dissemination of antibiotic resistance in manure samples and arable

soils. IncP-1 e plasmids were detected in total DNA from all tested manure samples

and in arable soil via a novel 5 ¢ -nuclease assay for real-time PCR. The authors

reported a correlation between IncP-1 e plasmid abundance and antibiotic usage

(application of sulfadiazine) in a soil microcosm experiment. Fifty IncP-1 e plas-

mids that were captured in E. coli CV601 gfp from bacterial communities of manure

and arable soil were further characterized. All plasmids contained class 1 integrons

with highly variable sizes of the gene cassette region and the sul1 gene (Heuer and

Smalla 2012 ) . Three IncP-1 e plasmids captured from soil bacteria and one from

manure were completely sequenced. The backbones were nearly identical to that of

the previously described IncP-1 e plasmid pKJK5 (Binh et al. 2008 ) . Diverse Beta-

and Gamma-Proteobacteria were found as hosts of the IncP-1 e plasmids in the soil

microcosms. The remarkable diversity of antibiotic resistance gene cassettes

encoded on these plasmids, the ability to ef ﬁ ciently transfer under soil conditions

and the broad host range of IncP-1 e plasmids strongly suggest that these plasmids

are important vehicles for the transmission of antibiotic resistances in agricultural,

in particular manured soils (Heuer and Smalla 2012 ) .

4.3 Plasmids in Urban Soils

Malik et al. ( 2008 ) used PCR typing methods to assess the presence of plasmids of

the Inc groups IncP, IncN, IncW and IncQ in total DNA extracts from anthropogenic

soils from India and Germany. Soils from two different locations in Germany, (the

urban park Tiergarten in Berlin and the abandoned irrigation ﬁ eld Berlin-Buch), and

from four different polluted locations in India (for instance an urban road which has

been irrigated with wastewater, mainly from lock manufacturing and steel indus-

tries, for more than two decades and soil from the Jajmau area of Kanpur which

receives partially treated ef ﬂ uents from the tannery industries) were analyzed. PCR

ampli ﬁ cation of the total DNA extracts revealed the prevalence of IncP-speci ﬁ c

sequences in Berlin-Buch and Indian soil samples. The IncP plasmids contained at

least one conjugative transfer function, in contrast, IncQ, IncN and IncW-speci ﬁ c

sequences were never detected (Malik et al. 2008 ) . The prevalence of the antibiotic

resistance genes ampC , tet (O) , ermB , bla-SHV-5 , mecA , and vanA was also studied.

Three Indian soil samples irrigated with wastewater contained the ampC gene,

whereas the other resistance genes were not found in any of the samples.

230

E. Grohmann

Detection of IncP replicon-speci ﬁ c ( trfA ) and transfer-speci ﬁ c sequences ( oriT )

by PCR ampli ﬁ cation and Southern hybridization was a clear indication that IncP

plasmids with the potential to disseminate resistance genes and other virulence

factors are prevalent in these polluted urban habitats. Furthermore, through exog-

enous plasmid isolation conjugative plasmids belonging to the IncP b group encod-

ing resistance to ampicillin were isolated from all the urban sites investigated

(Malik et al.

2008 ) .

Contamination of soil and water with antibiotic-resistant bacteria may create

reservoirs of antibiotic resistance genes that have the potential to negatively impact

future public health through HGT. Cummings et al. ( 2011 ) studied the presence of

plasmid-mediated quinolone resistance genes – many of the plasmids are self-trans-

missible – in surface sediments of the Tijuana River Estuary, a sewage-impacted

coastal wetland along the U.S.-Mexico border and sediments of Famosa Slough, a

nearby urban wetland that is largely unaffected by sewage. qnrA , qnrB , qnrS , qepA ,

and aac(6 ¢ )-Ib-cr quinolone resistance genes were detected by PCR ampli ﬁ cation of

metagenomic DNA from the sewage-impacted wetland, while the almost unaffected

wetland contained only qnrB , qnrS , and qepA . The number of PCR-positive sites

increased in both wetlands after rainfall (Cummings et al. 2011 ) . qnrA amplicons

were cloned, and nucleotide sequences of most of the qnrA amplicons were af ﬁ liated

with qnrA genes found on plasmids of clinical isolates.

Urban stormwater in coastal cities is notorious for sewage contamination

(Gersberg et al. 2006 ; Coulliette and Noble 2008 ) that results in beach closing

and costs municipalities millions of dollars each year (Given et al. 2006 ;

Cummings et al. 2011 ) . The problems are more evident in developing countries

where wastewater infrastructure is lacking. Acute public health threats from

bacteria and viruses are usually alleviated within 72 h, probably as a result of

dilution, osmotic stress due to seawater salinity and photo-inactivation due to

exposure to direct sunlight (Boehm et al. 2009 ) . The chronic threats due to

repeated inoculation in the area with biological pollutants, however, are largely

unknown (Cummings et al. 2011 ) .

It is well documented that human and farm animal faeces contain elevated levels

of antibiotic resistant bacteria and resistance genes (“antibiotic resistance pollut-

ants”) (Chen et al. 2007 ; Sommer et al. 2009 ) as does wastewater within treatment

systems (Jindal et al. 2006 ; Schlüter et al. 2007 ) . It is reasonable to speculate that

antibiotic resistance pollutants may ﬁ nd their way back into the human community

via vectors, such as shore birds, insects, and marine animals or through direct con-

tact with the water by swimming or ﬁ shing (Bonnedahl et al. 2009 ; Cummings

et al. 2011 ) .

It is believed that antibiotic resistance genes evolved in the natural environment,

for instance in the microbial antibiotic producers, and subsequently moved into

clinically important bacteria through HGT (Martinez 2009 ) . Indeed, the origin of

many of the qnr resistance genes has been traced to marine organisms (for instance,

Poirel et al. 2005 ; Cattoir et al. 2007 ) . Thus, the contamination of natural environ-

ments with plasmid-encoded antibiotic resistance genes may have signi ﬁ cant future

public health consequences (Cummings et al. 2011 ) .

231

9 Conjugative Plasmids in Anthropogenic Soils

4.4 Plasmids in Farmed Soils

Umamasheswari and Murali ( 2010 ) studied three crop ﬁ elds in India, namely paddy,

sugarcane and tomato crops which have been exposed to the pesticides bavistin, mono-

crotophos and kinado plus, for the composition of the bacterial population and degra-

dation of pesticides. Pesticide resistant bacteria, af ﬁ liated to the human nosocomial

pathogens Staphylococcus aureus , E. faecalis and Pseudomonas aeruginosa were

found. All the resistant isolates studied harboured a plasmid of 240 kb. Plasmid curing

experiments demonstrated that all the isolates lost their bavistin resistance phenotype

after plasmid curing. Umamasheswari and Murali (

2010 ) concluded that the bavistin

resistance phenotype in these isolates was plasmid borne. However, whether the 240-

kb plasmid conferring bavistin resistance is conjugative, remains to be elucidated.

4.5 Plasmids in Pristine Soils

Gentry et al. ( 2004 ) performed a study to determine the diversity of 2-, 3-, and

4-chlorobenzoate (CB) degraders in two pristine soils with similar physical and

chemical characteristics. Surface soils were collected from forested sites of the

Coronado National Forest in Madera Canyon and Oversite Canyon, Arizona, USA,

and amended with 500 m g of 2-, 3-, or 4-CB g

−1

soil. CB degraders were isolated,

grouped by DNA ﬁ ngerprints, identi ﬁ ed via 16S rDNA sequences, and screened for

the presence of plasmids. Nearly all of the 2-CB degraders originating from the

Madera soil were identi ﬁ ed as a Burkholderia spp. encoding chromosomally located

degradative genes. In contrast, several different 3-CB degraders were isolated from

the Oversite soil, most of them were identi ﬁ ed as Burkholderia spp. that encoded

the degradative genes on large plasmids (Gentry et al. 2004 ) .

Knowledge of the microbial diversity of the CB degrader community along with

an understanding of the microbial ecology of the degrader community that develops

when a pristine soil is ﬁ rst exposed to high levels of CBs may help elucidate the

mechanisms of microbial adaptation and degrader development, such as HGT, that

occur as result of the contamination event (Gentry et al. 2004 ) . Southern hybridiza-

tion of selected CB degraders revealed details on the encoded genes: the genes from

the modi ﬁ ed ortho-3-CB cleavage pathway ( tfdC and tfdD ) that hybridized to plas-

mids from the Oversite 3-CB degraders are commonly encoded on conjugative plas-

mids (Perkins et al. 1990 ; Gentry et al. 2004 ) . Other 3-CB degradative genes are

also found on transmissible plasmids or transposons (Nakatsu et al. 1997 ) . Gentry

and co-workers ( 2004 ) concluded that even though the Madera and Oversite Canyon

soils were from similar locations and were chemically and physically comparable,

the bacterial communities that developed resulted in varying abilities to degrade 2-,

3-, and 4-CB. Furthermore, the origin of degradative genes in many of the isolated

3-CB degraders may have been due to gene transfer events, as several of the 3-CB

degraders harboured large plasmids, and at least two of them appeared to encode

homologous 3-CB degradative genes (Gentry et al. 2004 ) .

232

E. Grohmann

5 Techniques Applied to Detect and Characterize

Plasmids in Soil

There is a broad spectrum of culture-dependent and culture-independent techniques

in use to characterize plasmids in and from soils.

The methods can be divided in those that result in the isolation of the MGE and/

or are dependent on the availability of the isolated plasmid and in those independent

of plasmid extraction.

The classical methods (including isolation of the MGE) are:

(i) Bacteria isolation from soil and isolation of the plasmid(s) harboured by the

strain: provided their sizes permit isolation (large plasmids are prone to physical

breakage), plasmid isolation can be performed by diverse commercially available

kits for plasmid isolation or by the traditional caesium chloride/ethidium bromide

gradient (Sambrook and Russel 2001 ) . The clear separation of the plasmid DNA

from the genomic DNA has the great advantage that the plasmid features and

traits encoded by the plasmid can be studied separately from the core genome.

(ii) Plasmid Genome Sequencing: in the last 10 years several plasmid sequencing

projects have been carried out which revealed an overwhelming amount of inter-

esting data on plasmids from very diverse habitats, including from different soils.

Genome-sequencing data and comparative genomics support the assumption that the

horizontal acquisition of genetic modules is a major driver in bacterial evolution and

adaptability (de la Cruz and Davies 2000 ; Smillie et al. 2010 ; Heuer and Smalla 2012 ) .

The increasing number of sequenced plasmids from soil also con ﬁ rmed this assumption

for plasmids from soil bacteria and enabled new insights into the diversity of “plasmid

backbone genes” required for replication, maintenance and transfer of plasmids.

A major ﬁ nding of the plasmid genome sequencing projects is the modular char-

acter of most of the plasmids. The sequences of the genes coding for replication,

maintenance and transfer provided a far more reliable basis for plasmid grouping

than the classical incompatibility testing, enabling insights into the evolution of

plasmids (Sevastsyanovich et al. 2008 ; Smillie et al. 2010 ; Heuer and Smalla 2012 ) .

Sequencing of plasmids from soil bacterial isolates and exogenously isolated plas-

mids broadened our view of various plasmid groups and suggests that plasmids

consist of core (backbone) genes and ﬂ exible (accessory) genes as indicated before.

In soils various different types of plasmids have been detected such as broad-host

range plasmids, PromA-like plasmids, conjugative narrow host range plasmids,

IncP-9 plasmids, low GC plasmids, and plasmids of the B. cereus group.

5.1 Broad Host Range (BHR) Plasmids

Plasmids with a BHR are putatively important for many taxa in soil, as they can

transfer useful traits such as antibiotic, heavy metal- or UV-resistance genes,

233

9 Conjugative Plasmids in Anthropogenic Soils

ef ﬂ ux pumps, restriction modi ﬁ cation systems, and toxin–antitoxin systems

between different members of the bacterial communities in soil (Heuer and

Smalla 2012 ) . Several studies have demonstrated that the transfer range of plas-

mids is often much broader than their replication range (Musovic et al.

2006 ;

Baharoglu et al. 2010 ). The ability of plasmids to replicate in a wide range of

hosts requires that plasmid replication is to a large extent independent of the

host’s replication machinery. Furthermore, a tight regulation of plasmid-encoded

genes ensures a reduced metabolic burden for their host. Repression of transfer

genes might represent a compromise between the bene ﬁ ts for the plasmid to

transfer horizontally and the associated metabolic burden on the hosts (Haft et al.

2009 ; Heuer and Smalla 2012 ) . To predict the evolutionary range of hosts in

which plasmids evolved, Suzuki et al. ( 2010 ) recently explored the use of nucle-

otide composition for a range of plasmids. Based on the assumption that plas-

mids acquire the genomic signature of their hosts, the trinucleotide composition

of a variety of plasmids was compared with all sequenced bacterial genomes

(Heuer and Smalla 2012 ) . Indeed, the signatures of several typical BHR plasmids

such as IncP-1, PromA and IncU showed signatures that were dissimilar to any

chromosomal signature, suggesting that these plasmids did not ﬁ x in a particular

host (Suzuki et al. 2010 ) . BHR plasmids most often reported from soil bacteria

belonged either to the IncP-1 group or the recently proposed PromA group (Van

der Auwera et al. 2009 ) . Sequence-based insights into the diversity of backbone

genes of these main groups of BHR plasmids in soil revealed a strong modular

organization of the plasmid cores, comprising genes for replication, mainte-

nance and transfer and hot spots for acquisition of accessory genes.

Plasmids belonging to the IncP-1 group have attracted the attention of plas-

mid biologists for more than 40 years, as these plasmids transfer and stably

replicate in a wide range of bacterial hosts and are considered BHR plasmids

(Adamczyk and Jagura-Burdzy 2003 ) . In the 1990s, the complete sequence of

the two archetype plasmids of the IncP-1 a , RP4 (Pansegrau et al. 1994 ) and the

IncP-1 b group, R751 (Thorsted et al. 1998 ) provided the ﬁ rst insights from

comparative genomics. Nowadays, 28 published IncP-1 sequences are available.

The sequenced plasmids originated from different geographic regions and envi-

ronments, e.g. sewage, soils and river sediments. Genomic signature analysis

data from Norberg et al. ( 2011 ) indicated that the different IncP-1 plasmids

analyzed to date have adapted to hosts belonging to different species and that

their backbones seem to originate from various parental plasmids. Accessory

elements were inserted at various sites, the so-called hot spots of insertion

(Heuer et al.

2004 ) . Although IncP-1 plasmids were shown experimentally to

have a wide host range, stable replication in the absence of selective pressure is

strain-speci ﬁ c (De Gelder et al. 2007 ; Heuer et al. 2007 ; Sota et al. 2010 ) . The

complete sequences of nine IncP-1 plasmids isolated from soil bacteria of vari-

ous geographic origins revealed that IncP-1plasmids are also important shuttles

of bene ﬁ cial traits in soil bacteria (Trefault et al. 2004 ; Smalla et al. 2006 ; Bahl

et al. 2007 ; Heuer and Smalla 2012 ) .

234

E. Grohmann

5.2 PromA-Like Plasmids

The complete sequence of plasmids pSB102 and pIPO2, captured directly from

rhizosphere bacteria by exogenous plasmid isolation, revealed striking similarities

(Schneiker et al.

2001 ; Tauch et al. 2002 ) . Additionally, the overall organization of

the plasmids was very similar to plasmid pXF51 from the plant pathogen Xylella

fastidiosa . Given the similarities between these plasmids, a novel family of BHR

plasmids was proposed because both pIPO2 and pSB102 transferred to a wide range

of gram-negative bacteria but did not belong to any of the known BHR plasmid

groups revealed by PCR and Southern hybridization probing, and con ﬁ rmed by

sequencing. Comparative genomics based on their complete sequences enabled

Tauch et al. ( 2002 ) to discover that plasmids pSB102, pIPO2 and pXF51 had a strik-

ingly similar overall genetic organization and led to the proposal of a new family of

environmental BHR plasmids. Van der Auwera et al. ( 2009 ) proposed naming BHR-

plasmids belonging to the pIPO2 family PromA in accordance with the traditional

BHR plasmids PromN (IncN), PromP (IncP-1), PromU (IncU) and PromW (IncW).

5.3 Conjugative Narrow Host Range Plasmids

Conjugative plasmids that stably replicate only in a restricted number of taxonomi-

cally related species or those that are found only in a limited number of hosts are

termed narrow host range plasmids. Narrow host range plasmids might tend to

transfer modules that require more integration into cellular networks for their func-

tion. For example, plasmid-transferred genes amending upper degradative pathways

of aromatic compounds are only bene ﬁ cial for particular hosts with a corresponding

lower pathway (Heuer and Smalla 2012 ) .

5.4 IncP-9 Plasmids

Plasmids belonging to the IncP-9 group were most often detected in Pseudomonas

isolates from polluted soils and are supposed to play an important role in the adapta-

tion of Pseudomonas populations (Heuer and Smalla 2012 ) . In contrast to IncP-1

plasmids their biology is far less studied and the host range of IncP-9 plasmids

seems to be narrow, as no transfer to recipients other than Pseudomonas has been

shown (Krasowiak et al. 2002 ) . The complete sequences of four IncP-9 plasmids are

available, revealing an approximately 35-kb IncP-9 core, with genes involved in

replication, partitioning and transfer (Heuer and Smalla 2012 ) . On the basis of the

oriV and rep sequences of 28 IncP-9 plasmids, a novel primer system was recently

developed and applied to detect IncP-9 plasmids in total community DNA in soils

from various geographic regions (Heuer and Smalla 2012 ) . Cloning and sequencing

of PCR amplicons revealed a surprisingly high diversity of IncP-9 amplicons,

235

9 Conjugative Plasmids in Anthropogenic Soils

suggesting that, similar to IncP-1 plasmids, various subgroups of IncP-9 plasmids

might co-occur in the same environmental niche and contribute to a rapid adapt-

ability of Pseudomonas populations.

5.5 Low GC Plasmids

Studies on the effect of veterinary drugs introduced into soil via manure on the

abundance of transmissible antibiotic resistance recently led to the discovery of

another novel plasmid group. Plasmids belonging to this new group were the plas-

mids most frequently captured directly from manure-treated soil in E. coli in several

independent experiments (Heuer and Smalla 2012 ) . These plasmids did not hybrid-

ize with any of the previously described plasmid probes or primers and displayed a

huge diversity, based on their plasmid restriction patterns and the antibiotic resis-

tance genes encoded (Binh et al. 2008 ; Heuer et al. 2009 ) . The complete sequences

of three representatives of this group – pHHV35, pHHV216 and pHH1107 – were

recently determined and showed that all three of them shared virtually an identical

plasmid backbone of approximately 30 kb and had an unusually low GC content of

about 36%. The accessory regions of pHHV35, pHHV216 and pHH1107 showed a

mosaic structure with multiple antibiotic resistance genes and were similar in size

(27, 28.3, and 28 kb), respectively. Real-time PCR revealed a surprisingly high

abundance of these replicons in several soils (Heuer and Smalla 2012 ) . Considering

the huge diversity of their accessory gene load, Heuer et al. ( 2009 ) concluded that

this plasmid group might play an important role in disseminating antibiotic resis-

tance genes among soil bacterial populations.

5.6 Plasmids of the B. cereus Group

Recent whole genome sequencing projects of several isolates of the Bacillus cereus

group revealed that the isolates previously classi ﬁ ed as B. cereus , Bacillus thuringi-

ensis or Bacillus anthracis are only distinguished by the content of plasmids and

their accessory genes. The availability of the pXO1 and pXO2 plasmid sequences

provided the basis for the development of PCR primer systems targeting different

plasmid backbone genes and genes coding for toxins (Heuer and Smalla 2012 ) . The

application of these primer systems for screening environmental isolates belonging

to the B. cereus group provided evidence that pXO1- and pXO2-like replicons can

be detected in B. cereus isolates from soils (Hu et al. 2009a, b ) . Self-transfer and

plasmid mobilization was observed among pXO2 plasmids carrying transfer ( tra )

genes. Interestingly, components (VirB4, VirB11, VirD4) of the type IV secretion-

like transfer system of gram-negative bacteria were found encoded on several

pXO2-like plasmids, suggesting that the three key proteins also form a fundamental

core in Bacillus plasmids (Hu et al. 2009b ) . A model for a type IV secretion-like

236

E. Grohmann

transfer system was recently proposed for the enterococcal BHR plasmid pIP501

based on a protein–protein interaction mapping of all pIP501-encoded Tra proteins

(Abajy et al. 2007 ) . The 350-kb pXO16 plasmid from B. thuringiensis conferring an

aggregation phenotype DNA transfer was shown not only to conjugate ef ﬁ ciently,

but also mobilize and retro-mobilize (Timmery et al.

2009 ) .

The culture-independent methods can be divided into different categories. The

most important techniques are listed below:

(i) Polymerase Chain Reaction (PCR)-based methods. The PCR methods are usu-

ally applied on total genomic DNA that has been isolated from the microbial soil

community. They target the origin of conjugative transfer, oriT (Malik et al.

2008 ) ,

tra genes, such as the conjugative relaxase (Anjum et al. 2012 ; Schiwon et al.

unpublished) and the type IV secretion system signature genes, virB1 , virB4 , and

virD4 (Schiwon et al. unpublished) or antibiotic resistance genes or gene cassettes

encoded on the plasmids (Malik et al. 2008 ; Anjum et al. 2011, 2012 ; Kopmann

et al. 2013 ; Dalkmann et al. 2012 ). These PCRs are performed in the qualitative

way to look for the absence or presence of these genes and/or to compare

different samples with each other or as quantitative real-time PCR to determine

the concentration of the respective gene(s) in the soil (Walsh et al. 2011 ;

Dalkmann et al. 2012 ). The qualitative PCRs are frequently followed by dot

blot or Southern hybridization on the respective genes to con ﬁ rm the PCR results

obtained or to detect tra or antibiotic resistance genes which are present in low

copy-number and therefore cannot be unambiguously detected by qualitative

PCR (Ansari et al. 2008 ; Malik et al. 2008 ; Anjum et al. 2012 ) .

(ii) Conjugative transfer experiments and exogenous plasmid isolation. Through

conjugative transfer experiments between different soil bacteria or between a

labelled donor bacterium and the microbial soil community plasmid transfer

frequencies in soil can be estimated and transferred or mobilized plasmids can

be isolated from the transconjugants and further characterized. As label,

ﬂ uorescence based methods, such as gfp or rfp are frequently applied (for

instance, Arends et al. 2012 ) . These labels have the advantage that they can be

easily detected in situ through ﬂ uorescence microscopy, thus soil bacteria which

have acquired a gfp -marked plasmid can be visualized and enumerated by

epi ﬂ uorescence microscopy, ﬂ uorescence-activated cell sorting (FACS) or even

spatially localized in the sample by confocal microscopy. Exogenous plasmid

isolation usually applies the addition of a marked recipient strain (often encoding,

resistance to a speci ﬁ c antibiotic-in the classical exogenous plasmid isolation

protocol, a rifampin resistant E. coli strain is used) to samples of the microbial

soil community. Capture of conjugative plasmids by the introduced recipient

strain is visualized by growth on double selective plates, amended with both

the antibiotics selecting for the recipient and for potential self-transmissible

plasmids conferring another resistance phenotype to the transconjugant (Bale

et al.

1988 ; Hill et al. 1992 ) .

(iii) Soil column/soil microcosm experiments. Many researchers apply soil

microcosms as model systems for their studies on microbial soil communities,

237

9 Conjugative Plasmids in Anthropogenic Soils

as they enable simulating a soil ecosystem in the laboratory. Application of

soil columns for the understanding of processes taking place within and

among soil microbial populations includes among others studies on conju-

gative plasmid transfer from a labelled donor bacterium introduced into the

microcosm to the indigenous bacterial populations. Studies of this type

using gfp and rfp -labelled E. faecalis donor bacteria have been performed

by Broszat et al. (unpublished data) on wastewater-irrigated and rain-fed

soils from the Mezquital Valley (Mexico). Furthermore, soil columns are

well-suited to test degradative capabilities of bacteria, which are frequently

encoded on plasmids, e.g. on pJP4 plasmid coding for 2,4-D degradation

(Quan et al.

2011 ) . In this type of soil microcosms, the substrate to be

degraded is frequently applied in radiolabelled form and the incorporation

of radiolabelled carbon in bacterial 16S rRNA genes is monitored by stable

isotope probing (SIP). For instance, Uhlik et al. ( 2012 ) identi ﬁ ed bacteria

utilizing biphenyl, benzoate, and naphthalene in microcosms with contaminated

soil and amended with

C-labelled biphenyl, benzoate, or naphthalene by

SIP and sequence analysis of 16S rRNA gene pools via amplicon pyrose-

quencing (Pilloni et al. 2012 ) .

(iv) “Omic” technologies, such as transcriptomics and metagenomics. Transcriptomics

or microarray studies allow comparisons of gene expression in soil microbial

communities which have been exposed to varying physiological conditions, sub-

jected to environmental stresses, such as water stress or amendment with toxic

compounds. Metagenomics studies offer the possibility to obtain complete

genomic information on the microbial habitat of interest. If 16S rDNA ampli ﬁ ed

from a habitat or total DNA isolated from the habitat is applied to Illumina

sequencing platforms, the output is a complete data set of the core genome and

accessory genome (including the genomes of MGEs such as conjugative plas-

mids) of the soil of interest (for a review refer to Degnan and Ochman 2012 ) .

First metagenomics studies on wastewater-irrigated soils versus rain-fed soils

from the Mezquital Valley, Mexico have been carried out by Broszat et al.

(unpublished data).

Heuer and Smalla have recently published an excellent review on the role of

conjugative plasmids in soil bacteria, on the bacterial soil populations and the reper-

toire of tools to identify them (Heuer and Smalla 2012 ) . The knowledge on plasmids

in soil bacteria is still biased towards those carried by taxa that are accessible through

cultivation techniques. Furthermore, plasmids are also assumed to be present only

in a small proportion of a given bacterial population and thus their abundance might

often be below the detection limit. However, under conditions of selective pressure

they might become detectable (Heuer and Smalla

2012 ) . An overview of the experi-

mental tools available at present to study plasmids in soil bacteria is given in Fig. 9.1 .

Direct detection of plasmid backbone genes in total community DNA was already

suggested in the 1990s to obtain insights into the occurrence of conjugative plas-

mids in soil, and PCR detection systems were provided for the known BHR plas-

mids at the time (Götz et al. 1996 ) . The increasing number of newly sequenced

238

E. Grohmann

plasmids revealed that primer systems designed on the basis of only a few sequences

available at the time might fail to detect the huge diversity of different plasmid

groups; for instance, the originally proposed primer systems targeting the trfA gene

of IncP-1 plasmids will not ef ﬁ ciently amplify plasmid-speci ﬁ c sequences from the

newly discovered groups of IncP-1 g , e and d from community DNA (Heuer and

Smalla 2012 ) . This limitation has to be taken into consideration when interpreting

previously published studies (for instance, Heuer et al. 2002 ; van Overbeek et al.

2002 ; Binh et al. 2008 ) . If PCR amplicons are obtained from soil DNA, the diversity

of PCR-ampli ﬁ ed plasmid sequences can be analyzed by either cloning and sequenc-

ing (fosmid or BAC libraries, see Fig. 9.1 ) or direct pyrosequencing.

Although PCR-Southern blot detection is at best semi-quantitative, the rather

high speci ﬁ city of the hybridization probes enabled the assessment of the presence

of different plasmid groups or subgroups (Heuer and Smalla 2012 ) . Quantitative

real-time PCR targeting plasmid-speci ﬁ c genes provides the chance to quantify

plasmids in total community DNA and to determine their relative abundance (plas-

mid copy number related to 16S rRNA gene copy number). It enables the correla-

tion between plasmid abundance as well as plasmid-encoded functions and

environmental pollution. The main limitation of PCR-based screening is that the

genetic context of the plasmid-speci ﬁ c sequences ampli ﬁ ed, as well as of the host,

remain unknown (Heuer and Smalla 2012 ) . To explore the diversity and the types of

Fig. 9.1 Cultivation-dependent and -independent approaches to detect and analyze plasmids from

soil bacteria. RCA Rolling circle ampli ﬁ cation, BAC Bacterial arti ﬁ cial chromosome (With permis-

sion from Heuer and Smalla (

2012 ) )

239

9 Conjugative Plasmids in Anthropogenic Soils

accessory genes carried, the plasmids have to be either isolated from the culturable

fraction or captured directly from soil bacteria into suitable recipients (see above).

New insights into plasmids from soil bacteria will come from metagenomics

studies. Pyrosequencing of DNA from rivers highly polluted with antibiotics

revealed the occurrence of different plasmids and enabled the assembly of four

small plasmids encoding different antibiotic resistance genes (Kristiansson et al.

2011 ) . The main advantage of the pyrosequencing of total or plasmid DNA extracted

from soils is that novel plasmid sequences will be discovered. A major limitation is

that the sequencing depth affects the detection of plasmids in less abundant popula-

tions and thus will cover only a fraction of the entire soil metagenome (Kristiansson

et al. 2011 ) . Additionally, assembly, particularly of large plasmids, will be dif ﬁ cult

due to the low copy number or the use of random circle ampli ﬁ cation (Heuer and

Smalla 2012 ) .

6 Conclusions and Perspectives

At present it is known that plasmids are found in all types of soils and in virtually

all known bacterial taxa. They play an important role in shaping the physiologi-

cal capabilities of the soil microbial community, and have primordial importance

in adaptation processes of soil populations to environmental changes and stress

situations. In the last decade a great number of plasmid genomes have been fully

sequenced, plasmid sequencing projects continue and will further broaden our

knowledge on the plethora of genetic information carried on the genomes of

mobile genetic elements. Of particular interest are conjugative plasmids that

encode bene ﬁ cial traits for the microbial soil community, such as the catabolic

plasmids, which are frequently used in bioaugmentation experiments or plasmids

encoding for heavy metal resistance which are applied in ﬁ rst attempts in soil

sanitation. Another promising approach that involves plasmids is rhizostabiliza-

tion: it is based on the introduction of rhizosphere bacteria that tolerate increased

concentrations of heavy metals. The bene ﬁ cial plant-microbe interactions on the

plant root surfaces help improving phytoextraction and phytostabilization in

heavily contaminated soils.

Continuous methodological improvements such as the successful application

of ﬂ uorescence microscopy and FACS in soils will enable to estimate transfer

frequencies of introduced self-transmissible or mobilizable plasmids in soils,

independent of long term survival of the introduced donor strain. Such approaches

with labelled mobilizable broad-host-range plasmids are under progress in

polluted soils. Continuous efforts in plasmid genome sequencing projects as well

as in metagenomics approaches on various soil types will further extend our

knowledge on the wealth of bene ﬁ cial traits carried by plasmids that await our

exploitation. At the end of the decade we will hopefully reach a level of knowledge

on plasmid diversity and mosaic accessory genome structures comparable to that

on bacterial genomes.

240

E. Grohmann

Acknowledgements I sincerely thank Miquel Salgot and Jacques Mahillon for critical reading of

the manuscript. I regret that not all valuable contributions of colleagues in the ﬁ eld could have been

included in this chapter due to space limitation.

References

Abajy MY, Kopec J, Schiwon K, Burzynski M, Doring M, Bohn C, Grohmann E (2007) A type

IV-secretion-like system is required for conjugative DNA transport of broad-host-range plas-

mid pIP501 in gram-positive bacteria. J Bacteriol 189:2487–2496

Achtman M (1975) Mating aggregates in Escherichia coli conjugation. J Bacteriol 123:505–515

Ackermann M, Stecher B, Freed NE, Songhet P, Hardt W-D, Doebeli M (2008) Self-destructive

cooperation mediated by phenotypic noise. Nature 454:987–990

Adamczyk M, Jagura-Burdzy G (2003) Spread and survival of promiscuous IncP1 plasmids. Acta

Biochim Pol 50:425–453

Ahmer BMM, Tran M, Heron F (1999) The virulence plasmid of Salmonella typhimurium is self-

transmissible. J Bacteriol 181:1364–1368

Alvarez-Martinez CE, Christie PJ (2009) Biological diversity of prokaryotic type IV secretion

systems. Microbiol Mol Biol Rev 73:775–808

Anderson RM, May RM (1992) Infectious diseases of humans: dynamics and control. Oxford

University Press, Oxford

Anjum R, Grohmann E, Malik A (2011) Molecular characterization of conjugative plasmids in

pesticide tolerant and multi-resistant bacterial isolates from contaminated alluvial soil.

Chemosphere 84:175–181

Anjum R, Grohmann E, Malik A (2012) Exogenous isolation of conjugative plasmids from pesti-

cide contaminated soil. World J Microbiol Biotechnol 28:567–574

Ansari MI, Grohmann E, Malik A (2008) Conjugative plasmids in multi-resistant bacterial isolates

from Indian soil. J Appl Microbiol 104:1774–1781

Arends K, Schiwon K, Sakinc T, Huebner J, Grohmann E (2012) A GFP-labeled monitoring tool

to quantify conjugative plasmid transfer between gram-positive and gram-negative bacteria.

Appl Environ Microbiol 78:895–899

Baharoglu Z, Bikard D, Mazel D (2010) Conjugative DNA transfer induces the bacterial SOS

response and promotes antibiotic resistance development through integron activation. PLoS

Genet 6(10):e1001165

Bahl MI, Hansen LH, Goesmann A, Sorensen SJ (2007) The multiple antibiotic resistance IncP-1

plasmid pKJK5 isolated from a soil environment is phylogenetically divergent from members

of the previously established alpha, beta and delta sub-groups. Plasmid 58:31–43

Bale MJ, Day MJ, Fry JC (1988) Novel method for studying plasmid transfer in undisturbed river

epilithon. Appl Environ Microbiol 54:2756–2758

Banjard L, Richaume A (2001) Quantitative and qualitative microscale distribution of bacteria in

soil. Res Microbiol 152:707–716

Barlow M (2009) What antimicrobial resistance has taught us about horizontal gene transfer. In:

Gogarten MB, Gogarten JP, Olendzenski LC (eds) Horizontal gene transfer – genomes in ﬂ ux.

Humana Press/Springer, New York, pp 397–411

Bergstrom CT, Lipsitch M, Levin BR (2000) Natural selection, infectious transfer and the existence

conditions for bacterial plasmids. Genetics 155:1505–1519

Binh CT, Heuer H, Gomes NC, Kotzerke A, Fulle M, Wilke BM, Schloter M, Smalla K (2007)

Short-term effects of amoxicillin on bacterial communities in manured soil. FEMS Microbiol

Ecol 62:290–302

Binh TCT, Heuer H, Kaupenjohann M, Smalla K (2008) Piggery manure used for soil fertilization

is a reservoir for transferable resistance plasmids. FEMS Microbiol Ecol 66:25–37

241

9 Conjugative Plasmids in Anthropogenic Soils

Boehm AB, Yamahara KM, Love DC, Peterson BM, McNeill K, Nelson KL (2009) Covariation

and photoinactivation of traditional and novel indicator organisms and human viruses at a sew-

age-impacted marine beach. Environ Sci Technol 43:8046–8052

Bonnedahl J, Drobni M, Gauthier-Clerc M, Hernandez J, Granholm S, Kayser Y, Melhus A,

Kahlmeter G, Waldenström J, Johansson A, Olsen B (2009) Dissemination of Escherichia coli

with CTX-M-type ESBL between humans and yellow-legged gulls in the south of France.

PLoS One 4(6):e5958

Bouma JE, Lenski RE (1988) Evolution of a bacteria plasmid association. Nature 335:351–352

Boxall ABA, Fogg LA, Kay P, Blackwell PA, Pemberton EJ, Croxford A (2003) Prioritisation of

veterinary medicines in the UK environment. Toxicol Lett 142:207–218

Brown SP, Buckling A (2008) A social life for discerning microbes. Cell 135:600–604

Brown SP, Le Chat L, De Paepe M, Taddei F (2006) Ecology of microbial invasions: ampli ﬁ cation

allows virus carriers to invade more rapidly when rare. Curr Biol 16:2048–2052

Buchanan-Wollaston V, Passiatore JE, Cannon F (1987) The mob and oriT mobilization functions

of a bacterial plasmid promote its transfer to plants. Nature 328:170–175

Buchrieser C, Glaser P, Rusniok C, Nedjari H, D’Hauteville H, Kunst F et al (2000) The virulence

plasmid pWR100 and the repertoire of proteins secreted by the type III secretion apparatus of

Shigella ﬂ exneri . Mol Microbiol 38:760–771

Carattoli A (2009) Resistance plasmid families in Enterobacteriaceae. Antimicrob Agents

Chemother 53:2227–2238

Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ (2005) Identi ﬁ cation of plasmids

by PCR-based replicontyping. J Microbiol Methods 63:219–228

Cattoir V, Poirel L, Mazel D, Soussy CJ, Nordmann P (2007) Vibrio splendidus as the source of

plasmid-mediated qnrS -like quinolone resistance determinants. Antimicrob Agents Chemother

51:2650–2651

Chao L, Levin BR (1981) Structured habitats and the evolution of anticompetitor toxins in bacte-

ria. Proc Natl Acad Sci USA 78:6324–6328

Chen J, Yu Z, Michel FC Jr, Wittum T, Morrison M (2007) Development and application of real-

time PCR assays for quanti ﬁ cation of erm genes conferring resistance to macrolides lincos-

amides-streptogram in livestock manure and manure management systems. Appl Environ

Microbiol 73:4407–4416

Coulliette AD, Noble RT (2008) Impacts of rainfall on the water quality of the Newport River

Estuary (Eastern North Carolina, USA). J Water Health 6:473–482

Cummings DE, Archer KF, Arriola DJ, Baker PA, Faucett KG, Laroya JB, Pfeil KL, Ryan CR,

Ryan KR, Zuill DE (2011) Broad dissemination of plasmid-mediated quinolone resistance

genes in sediments of two urban coastal wetlands. Environ Sci Technol 45:447–454

Dalkmann P, Broszat M, Willaschek E, Sakinc T, Huebner J, Siebe C, Amelung W, Grohmann E,

Siemens J (2012) Accumulation of pharmaceuticals, Enterococcus, and resistance genes in

soils after up to 100 years of wastewater irrigation in the Mezquital Valley, Mexico. PLoS ONE

7(9):e45397

Daniel R (2004) The soil metagenome – a rich resource for the discovery of novel natural products.

Curr Opin Biotechnol 15:199–204

Davison J (1999) Genetic exchange between bacteria in the environment. Plasmid 42:73–91

De Gelder L, Ponciano J, Joyce P, Top EM (2007) Stability of a promiscuous plasmid in different

hosts: no guarantee for a long-term relationship. Microbiology 153:452–463

De Gelder L, Williams JJ, Ponciano JM, Sota M, Top EM (2008) Adaptive plasmid evolution

results in host-range expansion of a broad-host-range plasmid. Genetics 178:2179–2190

de la Cruz F, Davies J (2000) Horizontal gene transfer and the origin of species: lessons from

bacteria. Trends Microbiol 8:128–133

Degnan PH, Ochman H (2012) Illumina-based analysis of microbial community diversity. ISME J

6:183–194

Diaz Ricci JC, Hernandez ME (2000) Plasmid effects on Escherichia coli metabolism. Crit Rev

Biotechnol 20:79–108

242

E. Grohmann

DiGiovanni GD, Neilson JW, Pepper IL, Sinclair NA (1996) Gene transfer of Alcaligenes eutrophus

JMP134 plasmid pJP4 to indigenous soil recipients. Appl Environ Microbiol 62:3297–3304

Dionisio F (2007) Sel ﬁ sh and spiteful behaviour through parasites and pathogens. Evol Ecol Res

9:1199–1210

Dionisio F, Matic I, Radman M, Rodrigues OR, Taddei F (2002) Plasmids spread very fast in het-

erogeneous bacterial communities. Genetics 162:1525–1532

Doolittle W (1999) Phylogenetic classi ﬁ cation and the universal tree. Science 284:2124–2128

Eberhard WG (1990) Evolution in bacterial plasmids and levels of selection. Q Rev Biol 65:3–22

Egan ES, Waldor MK (2003) Distinct replication requirements for the two Vibrio cholerae chro-

mosomes. Cell 114:521–530

Ferdy JB, Godelle B (2005) Diversi ﬁ cation of transmission modes and the evolution of mututalism.

Am Nat 166:613–627

Fondi M, Bacci G, Brilli M, Papaleo MC, Mengoni M, Vaneechoutte M, Dijkshoorn L, Fani R

(2010) Exploring the evolutionary dynamics of plasmids: the Acinetobacter panplasmidome.

BMC Evol Biol 10:59

Foster RC (1988) Microenvironments of soil microorganisms. Biol Fertil Soils 6:189–203

Foster KR, Ratnieks FLW, Wenseleers T (2000) Spite in social insects. Trends Ecol Evol

15:469–470

Foster KR, Wenseleers T, Ratnieks FLW (2001) Spite: Hamilton’s unproven theory. Ann Zool

Fennici 38:229–238

Fox RE, Zhong X, Krone SM, Top EM (2008) Spatial structure and nutrients promote invasion of

IncP-1 plasmids in bacterial populations. ISME J 2:1024–1039

Frost LS, Leplae R, Summers AO, Toussaint A (2005) Mobile genetic elements: the agents of open

source evolution. Nat Rev Microbiol 3:722–732

Gardner A, West SA (2004a) Spite among siblings. Science 305:1413–1414

Gardner A, West SA (2004b) Spite and the scale of competition. J Evol Biol 17:1195–1203

Gardner A, West SA (2006) Spite. Curr Biol 16:R662–R664

Gardner A, West SA, Buckling A (2004) Bacteriocins, spite and virulence. Proc R Soc Lond B

271:1529–1535

Gardner A, Hardy ICW, Taylor PD, West SA (2007) Spiteful soldiers and sex ratio con ﬂ ict in

polyembryonic parasitoid wasps. Am Nat 169:519–533

Gentry TJ, Wang G, Rensing C, Pepper IL (2004) Chlorobenzoate-degrading bacteria in similar

pristine soils exhibit different community structures and population dynamics in response to

anthropogenic 2-, 3-, and 4-chlorobenzoate levels. Microb Ecol 48:90–102

Gersberg RM, Rose MA, Robles-Sikisaka R, Dhar AK (2006) Quantitative detection of hepatitis

A virus and enteroviruses near the United States-Mexico border and correlation with levels of

fecal indicator bacteria. Appl Environ Microbiol 72:7438–7444

Gil G, Sabater-Muñoz B, Perez-Brocal V, Silva FJ, Latorre A (2006) Plasmids in the aphid endo-

symbiont Buchnera aphidicola with the smallest genomes. A puzzling evolutionary story. Gene

370:17–25

Given S, Pendleton LH, Boehm AB (2006) Regional public health cost estimates of contaminated

coastal waters: a case study of gastroenteritis at southern California beaches. Environ Sci

Technol 40:4851–4858

Goris J, Dejonghe W, Falsen E, De Clerck E, Geeraerts B, Willems A, Top EM, Vandamme P, De Vos

P (2002) Diversity of transconjugants that acquired plasmid pJP4 or pEMT1 after inoculation of

a donor strain in the A- and B-horizon of an agricultural soil and description of Burkholderia

hospital sp. nov. and Burkholderia terricola sp. nov. Syst Appl Microbiol 25:340–352

Götz A, Pukall R, Smit E, Tietze E, Prager R, Tschäpe H, van Elsas JD, Smalla K (1996) Detection

and characterization of broad-host-range plasmids in environmental bacteria by PCR. Appl

Environ Microbiol 62:2621–2628

Grif ﬁ n AS, West SA, Buckling A (2004) Cooperation and competition in pathogenic bacteria.

Nature 430:1024–1027

Grohmann E, Muth G, Espinosa M (2003) Conjugative plasmid transfer in gram-positive bacteria.

Microbiol Mol Biol Rev 67:277–301

243

9 Conjugative Plasmids in Anthropogenic Soils

Hacker J, Carniel E (2001) Ecological ﬁ tness, genomic islands and bacterial pathogenicity. A

Darwinian view of the evolution of microbes. EMBO Rep 2:376–381

Haft RJF, Mittler JE, Traxler B (2009) Competition favours reduced cost of plasmids to host bac-

teria. ISME J 3:761–769

Hamilton WD (1964) The genetical evolution of social behaviour. I & II. J Theor Biol 7:1–52

Hamilton WD (1970) Sel ﬁ sh and spiteful behaviour in an evolutionary model. Nature

228:1218–1220

Hardin G (1968) The tragedy of the commons. Science 162:1243–1248

Heinemann JA, Sprague JF Jr (1989) Bacterial conjugative plasmids mobilize DNA transfer

between bacteria and yeast. Nature 340:205–209

Heuer H, Smalla K (2007) Manure and sulfadiazine synergistically increased bacterial antibiotic

resistance in soil over at least two months. Environ Microbiol 9:657–666

Heuer H, Smalla K (2012) Plasmids foster diversi ﬁ cation and adaptation of bacterial populations

in soil. FEMS Microbiol Rev 36:1083–1104

Heuer H, Kroegerrecklenfort E, Wellington EMH et al (2002) Gentamicin resistance genes in envi-

ronmental bacteria: prevalence and transfer. FEMS Microbiol Ecol 42:289–302

Heuer H, Szczepanowski R, Schneiker S, Pühler A, Top EM, Schlüter A (2004) The complete

sequences of plasmids pB2 and pB3 provide evidence for a recent ancestor of the IncP-1 b

group without any accessory genes. Microbiology 150:3591–3599

Heuer H, Fox RE, Top EM (2007) Frequent conjugative transfer accelerates adaptation of a broad-host-

range plasmid to an unfavorable Pseudomonas putida host. FEMS Microbiol Ecol 59:738–748

Heuer H, Kopmann C, Binh CTT, Top EM, Smalla K (2009) Spreading antibiotic resistance

through spread manure: characteristics of a novel plasmid type with low %G + C content.

Environ Microbiol 11:937–949

Hill KE, Weightman AJ, Fry JC (1992) Isolation and screening of plasmids from the epilithon

which mobilize recombinant plasmid pD10. Appl Environ Microbiol 58:1292–1300

Hu X, Swiecicka I, Timmery S, Mahillon J (2009a) Sympatric soil communities of Bacillus cereus

sensu lato: population structure and potential plasmid dynamics of pXO1- and pXO2-like ele-

ments. FEMS Microbiol Ecol 70:344–355

Hu X, Van der Auwera G, Timmery S, Zhu L, Mahillon J (2009b) Distribution, diversity, and

potential mobility of extrachromosomal elements related to the Bacillus anthracis pXO1 and

pXO2 virulence plasmids. Appl Environ Microbiol 75:3016–3028

ICOMANTH (International Committee for Anthropogenic Soils) Report No. 2 – Version 2.0,

August, 2007

Ikuma K, Holzem RM, Gunsch CK (2012) Impacts of organic carbon availability and recipient

bacteria characteristics on the potential for TOL plasmid genetic bioaugmentation in soil slur-

ries. Chemosphere 89:158–163

Inoue D, Yamazaki Y, Tsutsui H, Sei K, Soda S, Fujita M, Ike M (2011) Impacts of gene bioaug-

mentation with pJP4-harboring bacteria of 2,4-D-contaminated soil slurry on the indigenous

microbial community. Biodegradation 23:263–276

Jindal A, Kocherginskaya S, Mehboob A, Robert M, Mackie RI, Raskin L, Zilles JL (2006)

Antimicrobial use and resistance in swine waste treatment systems. Appl Environ Microbiol

72:7813–7820

Keller L, Ross KG (1998) Sel ﬁ sh genes: a green beard in the red ﬁ re ant. Nature 394:573–575

Kopmann C, Jechalke S, Rosendahl I, Groeneweg J, Krögerrecklenfort E, Zimmerling U, Weichelt

V, Siemens J, Amelung W, Heuer H, Smalla K (2013) Abundance and transferability of

antibiotic resistance as related to the fate of sulfadiazine in maize rhizosphere and bulk soil.

FEMS Microbiol Ecol 83:125–134

Kozlowicz BK, Shi K, Gu ZY, Ohlendorf DH, Earhart CA, Dunny GM (2006) Molecular basis for

control of conjugation by bacterial pheromone and inhibitor peptides. Mol Microbiol 62:958–969

Krasowiak R, Smalla K, Sokolov S, Kosheleva I, Sevastyanovich Y, Titok M, Thomas CM (2002)

PCR primers for detection and characterisation of IncP-9 plasmids. FEMS Microbiol Ecol

42:217–225

244

E. Grohmann

Kristiansson E, Fick J, Janzon A, Grabic R, Rutgersson C, Weijdegard B, Soederstroem H, Larsson

DG (2011) Pyrosequencing of antibiotic-contaminated river sediments reveals high levels of

resistance and gene transfer elements. PLoS One 6:e17038

Lee K, Lee M, Shin JH, Lee MH, Kang SH, Park AJ et al (2006) Prevalence of plasmid-mediated

AmpC b -Lactamases in Escherichia coli and Klebsiella pneumoniae in Korea. Microb Drug

Resist 12:44–49

Lili LN, Britton NF, Feil EJ (2007) The persistence of parasitic plasmids. Genetics 177:399–405

Lin CC, Shen FT, Tan CC, Huang CC, Chen BY, Arun AB, Young CC (2012) Characterization of

Gordonia sp. strain CC-NAPH129-6 capable of naphthalene degradation. Microbiol Res

167(7):395–404

Livermore DM (1995) Beta-Lactamases in laboratory and clinical resistance. Clin Microbiol Rev

8:557–584

Malik A, Celik EK, Bohn C, Böckelmann U, Knobel K, Grohmann E (2008) Detection of conjugative

plasmids and antibiotic resistance genes in anthropogenic soils from Germany and India. FEMS

Microbiol Lett 279:207–216

Martínez JL (2008) Antibiotics and antibiotic resistance genes in natural environments. Science

321:365–367

Martinez JL (2009) The role of natural environments in the evolution of resistance traits in patho-

genic bacteria. Proc R Soc Lond B 276:2521–2530

Mellata M, Touchman JW, Curtiss R III (2009) Full sequence and comparative analysis of the

plasmid pAPEC-1 of avian pathogenic E. coli w7122 (O78:K80:H9). PLoS One 4:e4232

Mohamed RM, Abo-Amer AE (2012) Isolation and characterization of heavy-metal resistant

microbes from roadside soil and phylloplane. J Basic Microbiol 52:53–65

Musovic S, Oregaard G, Kroer N, Sorensen SJ (2006) Cultivation-independent examination of

horizontal transfer and host range of an IncP-1 plasmid among gram-positive and gram-negative

bacteria indigenous to the barley rhizosphere. Appl Environ Microbiol 72:6687–6692

Nakatsu CH, Providenti M, Wyndham RC (1997) The cis-diol dehydrogenase cbaC gene of Tn 5271

is required for growth on 3-chlorobenzoate but not 3,4-dichlorobenozate. Gene 196:209–218

Nogueira T, Rankin DJ, Touchon M, Taddei F, Brown SP, Rocha EP (2009) Gene mobility drives

the evolution of bacterial cooperation and virulence. Curr Biol 19:1683–1691

Norberg P, Bergström M, Jethava V, Dubhashi D, Hermansson M (2011) The IncP-1 plasmid back-

bone adapts to different host bacterial species and evolves through homologous recombination.

Nat Commun 2:268

Norman A, Hansen LH, Sorensen SJ (2009) Conjugative plasmids: vessels of the communal gene

pool. Philos Trans R Soc Lond B 364:2275–2289

Normark BH, Normark S (2002) Evolution and spread of antibiotic resistance. J Intern Med

252:91–106

Novick RP (1987) Plasmid incompatibility. Microbiol Rev 51:381–395

Nuti MP, Lepidi AA, Prakash RK, Schilperoort RA, Cannon FC (1979) Evidence for nitrogen

ﬁ xation ( nif ) genes on indigenous Rhizobium plasmids. Nature 282:533–535

Ochman H, Lawrence JG, Groisman EA (2000) Lateral gene transfer and the nature of bacterial

innovation. Nature 405:299–304

Øvreås L (2000) Population and community level approaches for analysing microbial diversity in

natural environments. Ecol Lett 3:236–251

Pansegrau W, Lanka E, Barth PT, Figurski DH, Guiney DG, Haas D, Helinski DR, Schwab H,

Stanisich VA, Thomas CM (1994) Complete nucleotide sequence of Birmingham IncP-alpha

plasmids – compilation and comparative analysis. J Mol Biol 239:623–663

Paulsson J (2002) Multileveled selection on plasmid replication. Genetics 161:1373–1384

Pereira SI, Lima AI, Figueira EM (2006) Screening possible mechanisms mediating cadmium

resistance in Rhizobium leguminosarum bv. viciae isolated from contaminated Portuguese

soils. Microb Ecol 52:176–186

Perez-Mendoza D, de La Cruz F (2009) Escherichia coli genes affecting recipient ability in

plasmid conjugation: are there any? BMC Genomics 10:71

245

9 Conjugative Plasmids in Anthropogenic Soils

Perkins EJ, Gordon MP, Caceres O, Lurquin PF (1990) Organization and sequence analysis of the

2,4-dichlorophenol hydroxylase and dichlorocatechol oxidative operons of plasmid pJP4. J

Bacteriol 172:2351–2359

Philppon A, Arlet G, Jacoby GA (2002) Plasmid-determined ampC-type beta-lactamases.

Antimicrob Agents Chemother 46:1

Pilloni G, Granitsiotis MS, Engel M, Lueders T (2012) Testing the limits of 454 pyrotag sequenc-

ing: reproducibility, quantitative assessment and comparison to T-RFLP ﬁ ngerprinting of aqui-

fer microbes. PLoS One 7(7):e40467

Poirel L, Rodriguez-Martinez J-M, Mammeri H, Liard A, Nordmann P (2005) Origin of plasmid-

mediated resistance determinant QnrA. Antimicrob Agents Chemother 49:3523–3525

Polzleitner E, Zechner EL, Renner W, Fratte R, Jauk B, Högenauer G et al (1997) TraM of plasmid

R1 controls transfer gene expression as an integrated control element in a complex regulatory

network. Mol Microbiol 25:495–507

Quan X, Tang H, Ma J (2011) Effects of gene augmentation on the removal of 2,4-dichlorophenoxyacetic

acid in a bio ﬁ lm reactor under different scales and substrate conditions. J Hazard Mater

185:689–695

Rankin DJ, Bargum K, Kokko H (2007) The tragedy of the commons in evolutionary biology.

Trends Ecol Evol 22:643–651

Rankin DJ, Rocha EPC, Brown SP (2011) What traits are carried on mobile genetic elements, and

why? Heredity 106:1–10

Riley MA, Wertz JE (2002) Bacteriocins: evolution, ecology and application. Annu Rev Microbiol

56:117–137

Roselló-Mora R, Amann R (2001) The species concept for prokaryotes. FEMS Microbiol Rev

25:39–67

Sachs JL, Simms EL (2007) Pathways to mutualism breakdown. Trends Ecol Evol 21:585–592

Sambrook J, Russel DW (2001) Puri ﬁ cation of closed circular DNA by equilibrium centrifugation

in CsCl-Ethidium Bromide gradients: continuous gradients. In: Irwing N (ed) Molecular

cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, New York

Schlüter A, Szczepanowski R, Pühler A, Top EM (2007) Genomics of IncP-1 antibiotic resistance

plasmids isolated from wastewater treatment plants provides evidence for a widely accessible

drug resistance gene pool. FEMS Microbiol Rev 31:449–477

Schneiker S, Keller M, Dröge M, Lanka E, Pühler A, Selbitschka W (2001) The genetic organiza-

tion and evolution of the broad host range mercury resistance plasmid pSB102 isolated from a

microbial population residing in the rhizosphere of alfalfa. Nucleic Acids Res 29:5169–5181

Sevastsyanovich YR, Krasowiak R, Bingle LEH, Haines AS, Sokolov SL, Kosheleva IA, Leuchuk

AA, Titok MA, Smalla K, Thomas CM (2008) Diversity of IncP-9 plasmids of Pseudomonas .

Microbiology 154:2929–2941

Skippington E, Ragan MA (2011) Lateral genetic transfer and the construction of genetic exchange

communities. FEMS Microbiol Rev 35:707–735

Slater FR, Bailey MJ, Tett AJ, Turner SL (2008) Progress towards understanding the fate of plas-

mids in bacterial communities. FEMS Microbiol Ecol 66:3–13

Slater SC, Goldman BS, Goodner B, Setubal JC, Farrand SK, Nester EW et al (2009) Genome

sequences of three Agrobacterium biovars help elucidate the evolution of multichromosome

genomes in bacteria. J Bacteriol 191:2501–2511

Smalla K, Heuer H, Goetz A, Niemeyer D, Kroegerrecklenfort E, Tietze E (2000a) Exogenous

isolation of antibiotic resistance plasmids from piggery manure slurries reveals a high preva-

lence and diversity of IncQ-like plasmids. Appl Environ Microbiol 66:4854–4862

Smalla K, Haines AS, Jones K, Kroegerrecklenfort E, Heuer H, Schloter M, Thomas CM (2006)

Increased abundance of IncP-1 b plasmids and mercury resistance genes in mercury polluted

river sediments: ﬁ rst discovery of IncP-1 b plasmids with a complex mer transposon as the sole

accessory element. Appl Environ Microbiol 72:7253–7259

Smillie C, Garcillán-Barcia MP, Francia MV, Rocha EP, de la Cruz F (2010) Mobility of plasmids.

Microbiol Mol Biol Rev 74:434–452

246

E. Grohmann

Sommer MOA, Dantas G, Church GM (2009) Functional characterization of the antibiotic resis-

tance reservoir in the human micro ﬂ ora. Science 325:1128–1131

Sota M, Yano H, Hughes JM, Daughdrill GW, Abdo Z, Forney LJ, Top EM (2010) Shifts in the host

range of a promiscuous plasmid through parallel evolution of its replication initiation protein.

ISME J 4:1568–1580

Suzuki H, Yano H, Brown CJ, Top EM (2010) Predicting plasmid promiscuity based on genomic

signature. J Bacteriol 192:6045–6055

Tauch A, Schneiker S, Selbitschka W et al (2002) The complete nucleotide sequence and environ-

mental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 isolated from

bacteria of the wheat rhizosphere. Microbiology 148:1637–1653

Thomas CM, Nielsen KM (2005) Mechanisms of, and barriers to, horizontal gene transfer between

bacteria. Nat Rev Microbiol 3:711–721

Thorsted PA, Macartney DP, Akhtar P et al (1998) Complete sequence of the IncP beta plasmid

R751: implications for evolution and organisation of the IncP backbone. J Mol Biol

282:969–990

Timmery S, Modrie P, Minet O, Mahillon J (2009) Plasmid capture by the Bacillus thuringiensi s

conjugative plasmid pXO16. J Bacteriol 191:2197–2205

Torsvik V, Daa FL, Sandaa RA, Øvreås L (1998) Novel techniques for analysing microbial diver-

sity in natural and perturbed environments. J Biotechnol 64:53–62

Torsvik V, Daa FL, Sandaa RA, Øvreås L (2002) Microbial diversity and function in soil: from

genes to ecosystems. Curr Opin Microbiol 5:240–245

Touchon M, Hoede C, Tenaillon O, Barbe V, Baeriswyl S, Bidet P et al (2009) Organised genome

dynamics in the Escherichia coli species results in highly diverse adaptive paths. PLoS Genet

5:e1000344

Trefault N, De la Iglesia R, Molina AM, Manzano M, Ledger T, Perez-Pantoja D, Sanchez MA,

Stuardo M, Gonzalez B (2004) Genetic organization of the catabolic plasmid pJP4 from

Ralstonia eutropha JMP134 (pJP4) reveals mechanisms of adaptation to chloroaromatic pollut-

ants and evolution of specialized chloroaromatic degradation pathways. Environ Microbiol

6:655–668

Turner PE (2004) Phenotypic plasticity in bacterial plasmids. Genetics 167:9–20

Turner PE, Cooper VS, Lenski RE (1998) Tradeoff between horizontal and vertical modes of trans-

mission in bacterial plasmids. Evolution 52:315–329

Udikovi -Koli N, Hršak D, Devers M, Klepac-Ceraj V, Petri I, Martin-Laurent F (2010) Taxonomic

and functional diversity of atrazine-degrading bacterial communities enriched from agrochem-

ical factory soil. J Appl Microbiol 109:355–367

Uhlik O, Wald J, Strejcek M, Musilova L, Ridl J, Hroudova M, Vlcek C, Cardenas E, Mackova M,

Macek T (2012) Identi ﬁ cation of bacteria utilizing biphenyl, benzoate, and naphthalene in

long-term contaminated soil. PLoS One 7(7):e40653

Umamaheswari S, Murali M (2010) Prevalence of plasmid mediated pesticide resistant bacterial

assemblages in crop ﬁ elds. J Environ Biol 31:957–964

Van der Auwera GA, Krol JE, Suzuki H, Foster B, Van Houdt R, Brown CJ, Mergeay M, Top EM

(2009) Plasmids captured in C. metallidurans CH34: de ﬁ ning the PromA family of broad-host-

range plasmids. Antonie Van Leeuwenhoek 96:193–204

van der Ploeg JR (2005) Regulation of bacteriocin production in Streptococcus mutans by the

quorum-sensing system required for development of genetic competence. J Bacteriol

187:3980–3989

van Overbeek LS, Wellington EMH, Egan S, Smalla K, Heuer H, Collard JM, Guillaume G,

Karagouni AD, Nikolakopoulou TL, van Elsas JD (2002) Prevalence of streptomycin-resis-

tance genes in bacterial populations in European habitats. FEMS Microbiol Ecol 42:277–288

Waldor MK, Mekalanos J (1996) Lysogenic conversion by a ﬁ lamentous phage encoding cholera

toxin. Science 272:1910–1914

Walsh F, Ingenfeld A, Zampicolli M, Hilber-Bodmer M, Frey JE, Duffy B (2011) Real-time PCR

methods for quantitative monitoring of streptomycin and tetracycline resistance genes in agri-

cultural ecosystems. J Microbiol Methods 86:150–155

247

9 Conjugative Plasmids in Anthropogenic Soils

West SA, Grif ﬁ n AS, Gardner A, Diggle SP (2006) Social evolution theory for microorganisms.

Nat Rev Microbiol 4:597–607

West SA, Diggle SP, Buckling A, Gardner A, Grif ﬁ n AS (2007a) The social lives of microbes. Ann

Rev Ecol Evol Syst 38:53–77

West SA, Grif ﬁ n AS, Gardner A (2007b) Evolutionary explanations for cooperation. Curr Biol

17:R661–R672

West SA, Grif ﬁ n AS, Gardner A (2007c) Social semantics: altruism, cooperation, mutualism,

strong reciprocity and group selection. J Evol Biol 20:415–432

White CE, Winans SC (2007) Cell-cell communication in the plant pathogen Agrobacterium tume-

faciens . Philos Trans R Soc Lond B Biol Sci 362:1135–1148

Witte W (2000) Selective pressure by antibiotic use in livestock. Int J Antimicrob Agents

16(Suppl 1):S19–24

Wozniak RAF, Waldor MK (2010) Integrative and conjugative elements: mosaic mobile genetic

elements enabling dynamic lateral gene ﬂ ow. Nat Rev Microbiol 8:552–563

Wu LT, Tseng YH (2000) Characterization of the IncW cryptic plasmid pXV2 from Xathomonas

campetris pv. Vesicatoria. Plasmid 44:163–172

Xavier JB, Foster KR (2007) Cooperation and con ﬂ ict in microbial bio ﬁ lms. Proc Natl Acad Sci

USA 104:876–881

Yates CM, Shaw DJ, Roe AJ, Woolhouse MEJ, Amyes SGB (2006) Enhancement of bacterial

competitive ﬁ tness by apramycin resistance plasmids from non-pathogenic Escherichia coli .

Biol Lett 2:463–465

Zupan J, Muth TR, Draper O, Zambryski P (2000) The transfer of DNA from Agrobacterium

tumefaciens into plants: a feast of fundamental insights. Plant J 23:11–28

249

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_10, © Springer Science+Business Media Dordrecht 2013

Abstract Rapidly increasing human population, industrialization and urbanization

has led to agricultural land shrinkage resulting in food crisis. The widespread use of

agrochemicals to enhance the food production has worsened the situation and jeop-

ardized the environment, human and animal health. This mandates the need and

importance of sustainable agriculture. In this context, microorganisms play a vital

and vibrant role in sustainable agriculture. Microorganisms are ubiquitous and par-

ticipate in an inimitable role in maintaining the dynamism and integrity of the sus-

tainable biosphere. Microorganisms mediated transformation, degradation and

recycling of organic matter ensures the sustained existence of life in an eco-friendly

manner. They constitute the largest group of living creatures with varying potential

in biochemical, physiological and nutritional modes. They play an integral role in

many ﬁ elds, such as bioremediation, biomedicine, environmental and agricultural

sectors. Microorganisms leverage the agricultural sector through mutual symbiosis

in agricultural plants, biological control agents against several plant pathogens,

plant growth promotion and nutrient cycling.

S. Kaur

Department of Mycology & Plant Pathology, Institute of Agricultural Sciences ,

Banaras Hindu University (BHU) , Varanasi , Uttar Pradesh 221005 , India

INRS-ETE , Université du Québec , 490, Rue de la Couronne , QC, Québec G1K 9A9 , Canada

G. S. Dhillon • S. K. Brar (

INRS-ETE , Université du Québec , 490, Rue de la Couronne ,

QC, Québec G1K 9A9 , Canada

e-mail: satinder.brar@ete.inrs.ca

V. B. Chauhan • R. Chand

Department of Mycology & Plant Pathology, Institute of Agricultural Sciences ,

Banaras Hindu University (BHU) , Varanasi , Uttar Pradesh 221005 , India

M. Verma

Institut de Recherche et de Développement en Agroenvironnement Inc. (IRDA) ,

2700 rue Einstein , Québec , QC G1P 3W8 , Canada

Chapter 10

Potential Eco-friendly Soil Microorganisms:

Road Towards Green and Sustainable

Agriculture

Surinder Kaur , Gurpreet Singh Dhillon , Satinder Kaur Brar ,

Vijay Bahadur Chauhan , Ramesh Chand , and Mausam Verma

250

S. Kaur et al.

With the advancement in microbial technology, these microbes have been

successfully exploited with signi ﬁ cant achievements in recent years. An apprecia-

tion and utilization of such agriculturally important microorganisms (AIMs) have

the potential to improve living standards by enhancing the nation’s economy and

wealth creation. This chapter discusses various aspects of microorganisms and their

potential role in agriculture. The chapter highlights the contribution of ef ﬁ cient soil

microbes in sustainable agriculture and management of soil fertility for sustainable

agriculture. The chapter also addresses the potential plant growth promoting

rhizobacteria (PGPR) along with dynamics and signi ﬁ cance of other soil microbial

communities and their valuable and obliging roles in agricultural productivity and

sustainable agriculture development. Various microorganisms that contribute to the

production of agricultural antibiotics and compost production are also discussed.

The importance of soil microorganisms towards sustaining agro-ecosystem, it’s

functioning and the directions for future research are also discussed. Finally, the

chapter sheds light on the health and safety issues related to the utilization of these

microorganisms including their non-target effects and persistence in the environ-

ment and potential for horizontal gene transfer.

Keywords Agriculturally important microorganisms (AIMs) • Biocontrol agents

(BCAs) • Health and safety issues • Plant growth promoting rhizobacteria (PGPR) •

Sustainable agriculture

Abbreviations

ACC 1-aminocyclopropane-1-carboxylate

a.i. active ingredient

AIMs agriculturally important microorganisms

BCAs biocontrol agents

B t Bacillus thuringensis

GABA g –aminobutyric acid

IAA indole acetic acid

ISR induced systemic resistance

mRNA messenger ribonucleic acid

PGPR plant growth promoting rhizobacteria

PSB phosphate solubilising bacteria

1 Introduction

The rapid growth and development of human population has led to advancement in

agriculture and industrial revolution which in turn has invited several negative

effects, such as environmental pollution, excessive soil erosion, surface run-off of

251

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

chemical fertilizers and pesticides to surface and groundwater contamination

throughout the globe. The disproportionate erosion of topsoil from farmland caused

by agricultural practices such as intensive tillage and row-crop production has led to

extensive soil degradation and both surface waters and groundwater pollution. The

organic wastes from animal production, agriculture, marine processing industries

and municipal wastes, such as sewage and garbage have become a major concern of

environmental safety in both developed and developing countries. An area that appears

to hold the greatest promise for technological advancement in crop production, crop

protection, and natural resource conservation is that of bene ﬁ cial and ef ﬁ cient

microorganisms applied as soil, plant and environmental inoculants (Higa

1995 ) .

In this context, the concept of sustainable agriculture emerged that aims for the

development of productive, pro ﬁ table and eco-friendly farming systems. It should

also conserve the natural resources as well as guarantee the food safety and quality.

An enormous number of microbes have been explored and used in the past to func-

tion in various different areas , such as food processing, safety and quality, medical

technology, genetic engineering, biocontrol agents, agriculture, municipal waste

treatments, kitchen waste management, biofertilizers, waste water treatment, com-

posting, metal remediation, nitrogen ﬁ xation, phytohormone and vitamin produc-

tion, bioremediation and phytoremediation, overcoming abiotic stress and many

others (Figueiredo et al. 2008 ; Sandhya et al. 2009 ; Singh et al. 2011a ) . Considering

the potential of microorganisms against several pathogens and in improving the plant

health, they are now being used in nature farming as well as organic agriculture (Daly

and Stewart 1999 ; Maeder et al. 2002 ; Khaliq et al. 2006 ) . The concept of Effective

Microorganisms (EMs) was developed by Professor Teruo Higa, University of the

Ryukyus, Okinawa, Japan (Higa 1991 ; Higa and Wididana 1991 ) . Ef ﬁ cient microor-

ganisms play an important role in nitrogen ﬁ xation, decomposition of organic wastes,

detoxi ﬁ cation of many chemicals, disease suppression, disease control and plant growth

promotion (Birkhofer et al. 2008 ) . They also play a diverse role in agro-ecosystem

and maintain sustainable agriculture. Hence these microorganism are designated as

Agriculturally Important Microorganisms (AIMs) throughout the chapter.

2 Microbial Technology and Agriculture

The utilization of microorganisms in an ef ﬁ cient manner requires potential and

ef ﬁ cient technology. The development and advancement of microbiology, agricul-

tural microbiology, genetic engineering, molecular tools, bioinformatics and meta-

genomics has led to the ef ﬁ cient utilization of many AIMs for agricultural

intensi ﬁ cation. Microbial technology is being used with considerable success in

various sectors, such as, industrial fermentations, antibiotics production, biocontrol

agents and plant growth hormones, among others. However, they are often not

accepted by the scienti ﬁ c community owing to the inconsistency and non-reproducible

results. This could be explained on the basis that microorganisms require optimum

growth conditions in order to metabolize their substrates and yield effective results.

252

S. Kaur et al.

In the meantime, various types of microbial cultures and inoculants are available in

the market and functioning in various sectors.

In order to ful ﬁ l the increasing demands of food and agricultural commodities,

microbial technology and agriculture must interact in close proximity to yield effec-

tive and feasible results. This could be achieved by the development and execution

of conceptual designs and new technologies for the ef ﬁ cient utilization of AIMs for

sustainable agriculture and environment. Conceptual design relates to envisioning a

principle or model and then to formulate a strategy and technique to achieve the

authenticity. It also necessitates the careful coordination of the materials, environ-

ment and the technology comprising the method. Likewise, an idealistic approach

must be adopted while validating microbial technologies to agricultural production

and conservation systems.

3 Soil Microbes for Sustainable Agriculture

Several microorganisms, such as photosynthetic bacteria, actinomycetes, wood

degrading fungi, nematophagous fungi, fungal parasites, nitrogen ﬁ xers function

together in the same natural environment by producing several bioactive com-

pounds, such as vitamins, hormones and enzymes that stimulate plant growth and

suppress harmful pathogens. Therefore, these microbes can open new avenues

for shifting the soil microbiological equilibrium in ways that can improve soil

quality, enhance crop production and protection, conserve natural resources, and

ultimately create a more sustainable agriculture and environment, crop residue

recycling, and biocontrol of pests (Stockdale et al. 2002 ) . Crop growth and devel-

opment are affected by the microbes in close proximity of the plant roots i.e., the

rhizospheric micro ﬂ ora (Raaijmakers et al. 2009 ) . It thus suggests the impor-

tance of managing and exploring soil micro ﬂ ora. An array of biological activities

is in ﬂ uenced by AIMs.

4 Ecological Bene ﬁ ts of Managing Soil Micro ﬂ ora

Pro ﬁ table cropping systems must be designed to realize a nutrient balance through

continuous nutrient replenishment. Nutrients are replenished from rocks, processes

of decomposition and mineralization of organic materials and atmospheric ﬁ xation

by soil microorganisms. Under natural conditions, the release rate of nutrients from

minerals to soils and plants are not readily available. Increasing land pressure has

led to either reduced or even missing fallow periods, hence culminating nutrient

mining from soil (Shannon et al. 2002 ) . In most cases, the rate of replenishment is

slow and cannot surpass nutrient mining by crops and loss of nutrients by soil mis-

management. Soil replenishment of nutrients is therefore a necessity for sustainable

production systems. Only a small proportion of applied fertilizers are available to

253

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

crops, as nutrients may be lost through leaching, washing away, immobilization and

volarization (Wells et al. 2000 ; Ghorbani et al. 2009 ) . Mechanisms to combat loss

of nutrients and enhance nutrient use ef ﬁ ciency can be achieved ef ﬁ ciently by

microbiological processes (Richardson et al.

2009 ) .

Nutrient cycling processes are mediated by soil organisms, hence forming a

major component of the soil system and therefore greatly contributing to soil

health (Shannon et al.

2002 ) . Amongst the keystone microorganisms, soil micro-

organisms that contribute to soil health and subsequent plant growth are bacte-

ria (symbiotic and free living), such as Rhizobium , Bradyrhzobium , Azotobacter ,

Azospirillum sp. , Bacillus sp. and Pseudomonas sp. and fungi in symbiosis with

plants (Arbuscular Mycorrhizae), fungi in the rhizosphere ( Trichoderma sp. )

and other plant growth promoting organisms (Rodríguez and Fraga 1999 ; Singh

et al. 2011a ) .

5 Role of Soil Micro ﬂ ora in Sustainable Agriculture

Microbial population can be increased by the addition of organic amendments to the

soil. Generally, the soil microorganisms are heterotrophic in nature i.e. they require

carbon and nitrogen for metabolism and biosynthesis. Applications of organic mate-

rials, such as seaweed, ﬁ sh meal and chitin from crustacean shells not only helps to

balance the micronutrient content of a soil but also increases the population of

bene ﬁ cial antibiotic-producing actinomycetes. They help to improve the soil texture

and transform it into a disease-suppressive state (Sullivan 2001 ) . Nevertheless, eco-

system and environmental conditions will affect the probability that a particular

bene ﬁ cial microorganism will become predominant with organic farming or nature

farming methods (Peacock et al. 2001 ) .

6 Plant Growth Promoting Rhizobacteria (PGPR)

in Sustainable Agriculture

Plant growth-promoting rhizobacteria are free-living bacteria that exert bene ﬁ cial

effects in and around the plant rhizosphere that directly or indirectly affect the

plant system and agriculture. In 1904, Hiltner described the concept of rhizo-

sphere as, “the narrow zone of soil surrounding the roots where microbial popu-

lation is stimulated by root activities” (Saharan and Nehra 2011 ) . Several

microbes, such as bacteria, fungi, protozoa and algae exist and interact in the

rhizosphere. Among all microbial groups, bacteria are the most frequent in soils.

However, it has been estimated that bacteria account for less than half of the total

biomass in agricultural soils due to their small size (1–10 μ m) (Alexander 1977 ) .

Approximately, bacterial cells exist at 10

–10

colony forming units/g soil. The

254

S. Kaur et al.

abundance of bacterial cells in the rhizosphere probably suggests their major

role in in ﬂ uencing plant physiology, especially considering their competitiveness

in root colonization (Antoun and Kloepper 2001 ; Barriuso et al. 2008 ) . Some of

the most important PGPR belong to the genera Acetobacter , Acinetobacter ,

Alcaligenes , Arthrobacter , Azoarcus , Azospirillum , Azotobacter , Bacillus ,

Beijerinckia , Burkholderia, Derxia , Enterobacter , Gluconacetobacter , Klebsiella ,

Ochrobactrum , Pseudomonas , Rhodococcus , Serratia , Zoogloea etc. and have

been subject of extensive research for decades (Singh et al. 2011a ) .

PGPR function in diverse ways to enhance plant growth. In nutshell, different

mechanisms involved in plant growth are: production of root exudates, repression

of soil-borne pathogens (by the production of hydrogen cyanide, antibiotics, and/

or competition for nutrients), siderophore production, nitrate reduction, nitrogen

ﬁ xation, phosphate solubilization, production of organic acids, and phytohor-

mones (indole acetic acid or IAA), release of enzymes (dehydrogenase, phos-

phatase, nitrogenase, 1-aminocyclopropane-1-carboxylate (ACC) deaminase), and

the induction of systemic resistance (ISR) (Kohler et al. 2006 ; Figueiredo et al.

2010 ) as described in Fig. 10.1 . Regardless of the mechanism(s) of plant growth

promotion, the most important factor for PGPR functioning is the rhizosphere/

rhizoplane (root surface) colonization or the root itself (within root tissue) (Singh

et al. 2011 b ) .

Fig. 10.1 Different mechanisms of plant growth promoting rhizobacteria in plant rhizosphere

255

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

6.1 Plant Growth-Promoting Rhizobacteria as Biofertilizers

In the state of affairs after “Green revolution”, sustainable advances in agricultural

production, productivity and pro ﬁ tability can be attained only by a quantum jump in

productivity per unit of land, water and energy and even per capita, without compro-

mising environmental health. Resource ﬂ ow to the agriculture sector is declining and

indebtedness of small and marginal farmers is rising. Input costs are increasing, while

factor productivity is declining. The current scenario suggests the need of cheaper

available alternatives to chemical fertilizers, such as biofertilizers and organic amend-

ments . Biofertilizers and organic amendments are cost-effective substitutes to costly

and harmful chemical fertilizers to improve soil quality, fertility, biology and agricul-

tural productivity (Saleem et al.

2007 ; Ray et al. 2008 ; Babalola 2010 ) .

Biofertilizers are composed of microorganisms that ef ﬁ ciently convert micronu-

trients to a readily available form from an inaccessible form through biological

processes in soil. Microbial inoculants and biofertilizers are an important compo-

nent of organic farming accounting for about 65% of the nitrogen supply to

crops worldwide (Singh et al. 2011 b ) . In comparison with chemical pesticides and

fertilizers, microbial inoculants or biofertilizers have several advantages, such

as no health hazards, eco-friendly, targeted activity, effective at small quantity,

self-multiplication while being controlled by the plant as well as by the indigenous

microbial populations, no residual effect or bio-magni ﬁ cation and can be incorpo-

rated in conventional or integrated pest management systems (Berg 2009 ) .

Physical, chemical and biological changes in properties of rhizospheric soil

signi ﬁ cantly in ﬂ uence growth and health of plants. Both the structural and functional

characteristics of roots are vital factors for nutrient acquisition. They determine

the capacity of plants to utilize available essential nutrients from soil while

assuaging the toxic ones (Marschner 1995 ; Hinsinger 1998 ) . Ef ﬁ cient utilization

of nutrients from soil is an imperative issue for plants in nutrient limiting environ-

ments. Additionally, nutrient uptake depends on a wide range of physico-chemical

parameters, such as root architecture, environmental and seasonal factors, biological

interactions and competition (Lynch 2005 ) . According to Tinker and Nye ( 2000 )

the importance of different root traits and rhizosphere-mediated processes is

dependent on the nutrient in question and other factors, such as plant species and

soil type. For instance, nutrients present at low concentrations in soil solution and/

or with poor diffusivity (e.g. P as either HPO

2−

or H

−

, and micronutrients,

such as Fe and Zn), root growth and proliferation and the release of root exudates

are of meticulous signi ﬁ cance (Barber 1995 ) . In contrast, nutrients with greater

diffusion coef ﬁ cients (e.g. NO

3−

, SO

4−

and Ca

), or those present in higher concen-

trations (e.g. K

, NH

), move more freely towards the root probably via mechanism

of mass ﬂ ow. In such cases, characteristics, such as the root architecture and

its distribution that facilitates water uptake are of immense importance (Barber

1995 ; Tinker and Nye 2000 ; Lynch 2005 ) .

As biofertilizers, PGPR stimulate the plant growth directly through increase in

nutrition acquisition, such as phosphate solubilization and nitrogen ﬁ xation or by

256

S. Kaur et al.

Table 10.1 Different functions of plant growth promoting rhizobacteria in agro-ecosystem

Group Microorganisms Mechanism References

Biofertilizers Pseudomonas , Azospirillum , Azotobacter ,

Bacillus , Burkholdaria , Enterobacter ,

Rhizobium , Erwinia and

Flavobacterium

Enhanced nitrogen and zinc uptake,

plant growth promotion, increased

yield, phosphate solubilization,

phytohormone production, iron

chelation, antibiotics production

and induction of plant systemic

resistance

Zaidi and Mohammad (

2006 ) ; Turan

et al. (

2006 ) ; Kohler et al. ( 2006 )

Bio-control agents Pseudomonas ﬂ uorescens , Kluyvera

cryocrescens , Bacillus pumilus , B.

amyloliquefaciens , B. subtilis ,

Burkholderia , Azospirillum

Various antibiotic compounds, iron

chelators and exoenzymes such as

proteases, lipases, chitinases, and

glucanases, competitive root

colonization

Jiang et al. (

2006 ) ; Saravanakumar

and Samiyappan (

2007 ) ;

Hernandez-Rodriguez et al.

(

2008 ) ; Naureen et al. ( 2009 )

Abiotic stress

tolerance

P. ﬂ uorescens , P. mendocina , P. alcali-

genes , Bacillus polymyxa ,

Mycobacterium phlei , Azospirillum ,

Achromobacter piechaudii , Variovorax

paradoxus , Piriformaspora indica

Osmolytes production and over-

expression of salt-stress proteins

Egamberdiyeva (

2007 ) ; Kohler et al.

(

2009 ) ; Paul and Nair ( 2008 )

Nutrient recycling

Nitrogen cycle Rhizobium , Nitrosomonas , Nitrobacter ,

Pseudomonas , Bacillus , Micrococcus

Nitrogen ﬁ xation, ammoni ﬁ cation,

nitri ﬁ cation, denitri ﬁ cation

Egamberdiyeva (

2005 ) ; Tilak et al.

(

2005 )

Phosphorus cycle Pseudomonas , Bacillus , Streptomyces ,

Mycobacterium

Mineralization, immobilization,

solubilization

Rivas et al. (

2006 ) ; Ramachandran

et al. (

2007 )

257

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

Microbial transformation of micronutrients

Iron Thiobacillus thiooxidans , Pseudomonas ,

Streptomyces Bacillus , Klebsiella

Oxidation Meziane et al. (

2005 ) ; De

Vleesschauwer et al. (

2006 ) ;

Ongena et al. (

2005 )

Manganese Bacillus , Klebsiella , Pseudomonas ,

Athrobacter

Oxidation Sidhu (

1998 )

Biodegradation /

bioremediation

Pseudomonas , Actinobacter ,

Flavobacterium , Klebsiella , Moraxella

and Arthrobacter , Rhodococcus ,

Stenotrophomonas maltophilia ,

Alcaligenes denitri ﬁ cans , B. subtilis ,

Enterobacter gergoviae , Flavimonas

oryzihabitans

Hydrolysis and degradation by

bacterial enzyme-esterase and

amidase

Lee et al. (

2002 ) ; Turan et al. ( 2008 )

258

S. Kaur et al.

rendering the inaccessible nutrients available to the plants (Persello et al. 2003 ) .

Biofertilizers containing nitrogen (N

) ﬁ xers ( Rhizobium spp ., Bradyrhizobium spp .,

Azotobacter chroococcum ), P-solubilizer ( Bacillus megaterium ) and K-solubilizer

( B. mucilaginous ) have been developed for commercial applications. PGPR play

diverse roles in soil for plant growth promotion as described in Table

10.1 .

Although soils are generally rich in total phosphorus albeit only a small propor-

tion is available for uptake by the plants. However, in spite of lower concentration

( μ M) of phosphorus present in soil, plants ef ﬁ ciently acquire it from low concentra-

tion soil solution (Jungk

2001 ; Khan et al. 2006 ) . It might be due to the root exuda-

tions or microbial processes. N

- ﬁ xing and phosphate solubilizing bacteria (PSB)

are important for crops as they increase N and P uptake and play a fundamental role

as PGPR in the biofertilization (Zahir et al. 2004 ; Zaidi and Mohammad 2006 ) .

PGPR utilized in the treatment of arable soils have signi ﬁ cantly increased the agro-

nomic yields (Harish et al. 2009a, b ; Yazdani et al. 2009 ) .

Phosphate-solubilizing bacteria have already been applied in the agronomic

practices as potential bio-inoculants to increase the crop productivity (Kumar et al.

2011 ) . “Phosphobacterin” a biofertilizer product is formulated from Bacillus mega-

terium var. Phosphaticum . Studies have suggested that the co-inoculation of N

ﬁ xing bacteria and PSB has proved more ef ﬁ cient and effective than the single

microbe in providing a more balanced nutrition to agriculture crops, such as sor-

ghum, barley, black gram, soybean and wheat (Abdalla and Omer 2001 ; Tanwar

et al. 2002 ; Galal 2003 ) . Microbial consortia developed with PGPR and rhizobia

have ef ﬁ ciently increased plant nodulation and N

- ﬁ xation (Figueiredo et al. 2010 ) .

Consortia of PGPR strains, P. alcaligenes PsA15, B. polymyxa BcP26 and

Mycobacterium phlei MbP18, have found to exert pronounced stimulatory effects

on plant growth and uptake of N, P and K by maize in nutrient-de ﬁ cient calcisol

soils (Egamberdiyeva 2007 ) . PGPRs can also be utilized in combination with bio-

polymers, such as chitin and chitosan. P. ﬂ uorescens strain, CHA0 in combination

with chitin increased plant growth, leaf nutrient contents and banana yield under

perennial cropping systems (Kavino et al. 2010 ) . Therefore, it might be implicated

that PGPR might be symbolized as the potential soil micro ﬂ ora in the lieu of sus-

tainable and eco-friendly agriculture. The application of such microbes as biofertil-

izers also contributes to minimize the use of expensive phosphate fertilizers.

6.2 Plant Growth-Promoting Rhizobacteria

as Biocontrol Agents (BCA)

Soil microbial diversity is one of the most dynamic emerging areas that have been

explored in various ﬁ elds, such as improving soil structure, soil health, plant disease

management among others. Soil microbes have the potential to suppress plant

pathogens in their natural environment through different mechanisms. Various

microbes have been discovered and emerged with the potential to mitigate the unde-

sirable effects of phytopathogenic microbes on agriculture and forestry. The use of

259

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

biocontrol agents (BCAs) along with the current practices with some speci ﬁ cations

has been able to bring down their impact below threshold level. BCAs have been

harmonizing or even substituting the chemical counterparts.

Traditional methods used to protect crops from diseases have been largely based on

the use of chemical pesticides. Applications of fungicides, fumigants, herbicides and

insecticides can have drastic effects on the environment and consumers. Chemical

methods may not be economical in the long run because they pollute the atmosphere,

damage the environment, leave harmful residues and can lead to the development of

resistant strains among the target organisms with repeated use. Therefore, a reduction

or elimination of synthetic pesticide applications in agriculture is highly desirable. One

of the most promising means to achieve this goal is by the use of BCAs for disease

control alone, or by integrating them with lower concentration of chemicals in the con-

trol of plant pathogens resulting in alleviated impact of the chemicals on the environ-

ment. Biocontrol of pests in agriculture is a method of controlling pests including

insects, mites, weeds and soil-borne pathogens. A number of BCAs have been regis-

tered and are available commercially, including strains belonging to bacterial genera,

such as Agrobacterium , Pseudomonas , Streptomyces and Bacillus and fungal genera,

such as Gliocladium , Trichoderma , Ampelomyces , Candida and Coniothyrium .

PGPR play an important role against various phytopathogens through different

mechanisms, such as siderophore production (iron chelating), synthesis of anti-fungal

metabolites, antibiotic and hydrogen cyanide production, phenazines, pyrrolnitrin,

pyoluteorin, metabolites, phytohormones, competition for nutrition, production of

exoenzymes (e.g. proteases, lipases, chitinases and glucanases) as well as the competi-

tive root colonization and induction of systemic resistance (Bloemberg and Lugtenberg

2001 ; Lugtenberg et al. 2001 ; Persello et al. 2003 ) as depicted in Fig. 10.2 .

Among the various PGPRs identi ﬁ ed, P. ﬂ uorescens is one of the most exten-

sively studied rhizobacteria owing to its antagonistic actions against several plant

Fig. 10.2 Diagrammatic

representation of mechanism

of plant growth promoting

rhizobacteria as biocontrol

agents

260

S. Kaur et al.

pathogens (Kavino et al. 2007 ; Saravanakumar and Samiyappan 2007 ; Harish et al.

2009a ) . P. ﬂ uorescens MSP-393 has been proved as biocontrol agent for many of the

crops grown in saline agricultural soils (Paul and Nair 2008 ) . As discussed earlier,

the ef ﬁ cacy of microbes functioning in diverse areas can often be enhanced by

developing microbial consortia or amending certain adjuvants, such as different bio-

polymers (chitin and chitosan etc.). The biocontrol ef ﬁ cacy of PGP ﬂ uorescent

pseudomonads has been increased by mixing two or more strains of Pseudomonas

spp. and with amendment of chitin or other substances (Radjacommare et al.

2002 ;

Saravanakumar et al. 2009 ) . B. thuringiensis has also been used to control most of

the economically important insect pests, including American bollworm sp., Earias

spp., Spodoptera sp. and Plutella sp. strains of B. subtilis , and P. ﬂ uorescens are

used to control bacterial as well as fungal pathogens.

Pseudomonas ﬂ uorescens strain CHA0 in combination with chitin based bio-

formulations signi ﬁ cantly reduced the banana bunchy top virus (BBTV) incidence

in hill banana variety under greenhouse and ﬁ eld conditions in Western Ghats, India

(Kavino et al. 2008, 2010 ) . PGPR play an important role in PGPR-mediated insect

management. PGPR induce chitinases production which hydrolyze chitin, the main

structural component of the gut linings of insects (Harish et al. 2009b ) . Chitinases

also degrade fungal cell walls and cause cell lysis (Radjacommare et al. 2002 ) .

Exploration of such PGPR strains will aid in maintaining the concept of sustainable

agriculture. However at the same time, a better understanding of PGPR and their

ecology is needed before biological control can be implemented (Bull et al. 1992 ) .

6.3 Plant Growth-Promoting Rhizobacteria Mediated

Alleviation of Abiotic Stress

Agricultural crops face many stresses induced by both biotic as well as abiotic fac-

tors affecting crop yield. Such stresses impose serious challenges in introducing agri-

cultural crops into affected areas. Apart from affecting agricultural crops, different

stresses persuade the occurrence and activity of soil microorganisms. Abiotic stress

factors include heavy metals, high and low temperature, salinity, drought, ﬂ ood,

ultraviolet light and air pollution (ozone). Vegetable and other crops in many semi-

arid and arid regions of the world face serious loss in yield due to increasing salinity

of irrigation water as well as soil salinity (Parida and Das 2005 ; Saharan and Nehra

2011 ) . Salt stress of agricultural land is rising every year across the globe and has

become a matter of serious concern (Paul and Nair 2008 ) . Among various abiotic

stresses, soil salinity is one of the most severe limiting factors affecting nodulation,

yield and physiological response in plants. Salt stress affects leaf growth rate due to

decreased water uptake that results in reduced photosynthesis (Saharan and Nehra

2011 ) . High salt stress also inhibits the synthesis and activity of nitrogenases in plants

as reported in Azospirillum brasilense (Tripathi et al. 2002 ) . Similarly, Han and Lee

( 2005 ) also reported physiological disorder in lettuce plants affected by high salt

stress. Salt and water stress (drought) adversely affect a number of metabolic and plant

261

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

physiological processes, such as plant growth and nutritional uptake (Hu 2005 ) .

In this context, the role of PGPR in plant health and alleviating osmo-tolerance mech-

anisms is imperative. Catabolic versatility and ef ﬁ cient root colonizing habit has gained

paramount importance to PGPR mainly, soil-borne pseudomonads. Pseudomonads

are known to produce an array of enzymes and metabolites that facilitate the plant to

endure varied biotic as well as abiotic stress (Vessey

2003 ) . Egamberdiyeva ( 2007 )

has reported three PGPR isolates, P. alcaligenes PsA15, Bacillus polymyxa BcP26

and Mycobacterium phlei MbP18 to survive in arid and saline soils, such as calcisol.

These strains were tolerant to high temperature and salt concentrations.

Rhizobium , Bradyrhizobium , Azotobacter , Azospirillum , Pseudomonas and

Bacillus has been reported from abiotic stressed ecosystems (Venkateswarlu et al.

2008 ; Selvakumar et al. 2009 ; Upadhyay et al. 2009 ) . Most of the rhizobacteria

modulate their cytoplasmic osmolarity by producing osmo-protectants such as,

potassium ions, glutamate, trehalose, proline, glycine beatine, proline betaine and

ectoine etc. (Grover et al. 2011 ) . Azospirillum also reduces drought induced stress

in sorghum plants by improving water content, increasing water potential and low-

ering canopy temperature of foliage. Arbuscular Mycorrhizal Fungi (AMF) are also

known to improve plant growth under salt stress (Cho et al. 2006 ) . A PGPR, P. men-

docina , alone or in combination with an AMF, Glomus intraradices or G. mosseae

improved plant growth, enhanced plant growth, nutrient uptake and other physio-

logical activities of Lactuca sativa affected by salt stress (Kohler et al. 2009 ) . De

novo synthesis of osmolytes and over-expression of salt-stress proteins by P.

ﬂ uorescens MSP-393 have been reported to overcome the harsh effects of high

osmolarity (Paul and Nair 2008 ) . High salt, pH and temperature under alkaline soil

conditions affect the activity of PSB (Gaind and Gaur 1991 ) . Phosphate solubiliza-

tion occurs ef ﬁ ciently under acidic soil conditions as a result of organic acids

released from bacterial metabolism (Seshadri et al. 2007 ) . Phosphate solubilising

bacteria lower the soil pH by secreting organic acids thereby improving phosphate

solubilization (Chen et al. 2006 ) . Therefore, it might be implicated that PGPR-PSB

can be utilized to improve natural ecosystems, such as savannas that predominate in

tropics, and have low fertile acid soils poor in minerals, particularly phosphorus.

Therefore, all-embracing investigations are required for further exploitation of

PGPR and their interaction with other soil micro ﬂ ora might open new avenues to

facilitate sustainable agriculture in salt affect soils.

6.4 Plant Growth-Promoting Rhizobacteria Mediated

Phytoremediation

Phytoremediation is a cheap and energy pro ﬁ cient detoxi ﬁ cation method. It

in ﬂ uences plant metabolism by concentrating the heavy metals in their shoot bio-

mass thereby reducing their bioavailability (Saharan and Nehra 2011 ) . Soil microbes

alleviate toxic effects of heavy metals on the plants via different mechanisms, such

as acid secretion, over-expression of proteins, phyto-antibiotic production, and other

262

S. Kaur et al.

chemicals (Denton 2007 ) . The metal resistant PGPR can act ef ﬁ ciently in carbon

sequestering and enhancing plant growth under the conditions of metal stress

(Rajkumar and Freitas 2008 ) . Besides PGPR, mycorrhizal fungi also play an impor-

tant role in phytoremediation (Tam

1995 ; Belimov et al. 2005 ; Denton 2007 ) .

According to Khan ( 2005 ) , PGPR, PSB, mycorrhizal-helping bacteria and AMF in

the plant rhizosphere play an important role in phytoremediation. Cadmium induces

plant-stress-induced ethylene biosynthesis and the accumulation of ACC in the

roots (Pennasio and Roggero

1992 ) . PGPR help in overcoming the inhibitory effects

of metals, drought, ﬂ ooding and salt stress (Burd et al. 2000 ; Grichko and Glick

2001 ; Nie et al. 2002 ; Mayak et al. 2004a, b ; Amico et al. 2008 ) . Govindasamy et al.

( 2009 ) detected and characterized ACC in PGPR in wheat seedlings treated with

ACC deaminase under in vitro conditions by measuring ethylene production under

cadmium stress. Pseudomonas putida and P. ﬂ uorescens are also potent heavy metal

tolerant PGPR that have been evaluated successfully under the conditions of hyper-

osmolarity and contaminated soils (Schnider-Keel et al. 2001 ; Chacko et al. 2009 ) .

Streptomyces acidiscabies E13 strain exerts positive growth promoting effects in

cowpea in nickel contaminated soil probably by binding iron and nickel through the

production of hydroxamate siderophores (Dimkpa et al. 2008 ) .

6.5 Plant Growth-Promoting Rhizobacteria Mediated

Ethylene Stress Alleviation

Plant growth-promoting rhizobacteria producing ACC deaminase protect plants under

unfavourable environmental conditions, such as ﬂ ooding, heavy metals, phytopatho-

gens, drought and high salt. ACC deaminase-containing PGPR also protect the crops

from adverse effects of salt stress ethylene (Belimov et al. 2001 ) . PGPR containing

ACC deaminase help in alleviating the stress induced by ethylene and mitigate the

negative effect on plants. It has been comprehensively studied in numerous PGPR,

such as Agrobacterium genomovars , Azospirillum lipoferum , Alcaligenes , Bacillus ,

Burkholderia , Enterobacter , Methylobacterium fujisawaense , Pseudomonas sp . ,

Ralstonia solanacearum , Rhizobium , Rhodococcus , Sinorhizobium meliloti , Variovorax

paradoxus and Enterobacter cloacae (Hontzeas et al. 2004a ; Uchiumi et al. 2004 ;

Belimov et al. 2005 ; Pandey et al. 2005a, b ; Blaha et al. 2006 ; Stiens et al. 2006 ) .

Ethylene is an important phytohormone; however, its overproduction under

stressful conditions inhibits plant growth or might result in plant mortality, particu-

larly in seedlings. PGPR contain an enzyme, that lowers the ethylene concentration

in developing seedlings or stressed plants by producing an enzyme ACC deaminase.

ACC deaminasedegrades ACC and utilize it as a carbon source thereby lowering the

ACC uptake and hence ethylene (Van Loon

2007 ; Saleem et al. 2007 ) . Seed treat-

ment with ACC deaminase containing PGPR acts as a sink for ACC and maintains

plant ethylene levels that might prejudice root growth (Glick et al. 1999 ) . PGP

Enterobacter cloacae UW4 strain has been reported to induce root elongation and

proliferations in canola ( Brassica rapa ) by minimising ethylene levels (Hontzeas

263

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

et al. 2004b ) . PGPR containing ACC-deaminase impart resistance to plants against

several forms of stress probably by lowering ethylene levels resulting in enhanced

root systems (Safronova et al. 2006 ; Shaharoona et al. 2006 ) . Utilization of PGPR

containing ACC deaminase activity in plant growth promotion and gene expression

analysis under both normal and stresses conditions has gained sincere attention

(Sergeeva et al.

2006 ) . The advanced biotechnological tools such as metagenomics,

proteomics, cDNA microarrays, gene expression studies in conjuction with bioin-

formatics can further aid in better understanding and ef ﬁ cient utilization of PGPR

strains and hence attaining agricultural sustainability.

7 Nutrient Recycling

7.1 Nitrogen Cycle Processes Mediated by Microorganisms

Nitrogen cycles are strongly mediated by microorganisms and comprise four major

pathways: (1) Biological nitri ﬁ cation: Microbial-mediated mineralization of organic

forms of N to ammonium (NH

) and its subsequent nitri ﬁ cation to nitrite (NO

−

) and

nitrate (NO

−

) mediated by Nitrosococcus and Nitrobacter bacteria is of major

signi ﬁ cance to N availability; (2) symbiotic nitrogen (N

) ﬁ xation which is mediated

by Rhizobium and Bradyrhizobium associated with legumes and Frankia , Nostoc and

Azolla associated with non legume; (3) the free-living nitrogen ﬁ xers, such as the

rhizosphere nitrogen ﬁ xing Azotobacter , Azospirillum and Bacillus , free-living nitro-

gen ﬁ xing Cyanobacteria and Clostridium and; (4) denitri ﬁ cation, the conversion of

nitrate to gaseous nitrogen mediated by facultative heterotrophic bacteria. Arbuscular

Mycorrhizal Fungi (AMF) are also known to play an important role in nitrogen

cycling and nutrition in soil by increasing plant nitrate uptake and ef ﬁ cient utiliza-

tion. The major supply of nitrogen in leguminous plants occurs via symbiosis, a

process that is highly associated with the phosphorus cycle.

Microorganisms play an important role for the breakdown of organic material and

nutrient cycling with few compounds becoming recalcitrant (Dorn et al. 1974 ) .

Diversity of bacterial functions contributes a major role in nutrient recycling and plant

litter decomposition, thereby shaping the execution of a system (Lynch 1983 ; Collins

et al. 1992 ) . They represent a vibrant source and sink of nutrients in all ecosystems

and occupy a signi ﬁ cant place in the ecosystem and soil food web. Approximately,

90–95% of all nutrient cycling is passed through them towards higher trophic levels.

Bacterial cells break down several intricate compounds into simpler organic forms.

Therefore, they improve the soil organic content, soil structure and physical properties,

increase water retention capacity, nutrient availability as well as act as a cementing

agent by holding soil particles together. The symbiotic relationship between N- ﬁ xing

bacteria and legumes is one of the most dynamic plant–bacterial interactions (Sprent

1979 ) . However, environmental conditions and the host determine the distribution,

diversity and interaction of speci ﬁ c N- ﬁ xing bacteria (Turco and Bezdicek 1987 ; Hirsch

et al. 1993 ) . Another important role that bacteria play in the environment is the sulphur

264

S. Kaur et al.

cycle. However, a limited number of genera of facultative and obligate anaerobic

bacteria is accountable for the process within a narrow range of environmental

conditions. Sulfate reduction and oxidation is carried out by a variety of facultative and

obligate anaerobic and a limited number of aerobic autotrophic bacteria respectively

(Tiedje et al.

1984 ; Bock et al. 1989 ) . According to Jones ( 1991 ) , more than 50 species

of methanotrophs are responsible for the production or catabolism of methane. However,

the process of production and catabolism of methane in agricultural soils is generally

meagre due to the lack of anaerobic conditions. A limited number of genera of obligate

aerobic bacteria widely distributed in soils carry out methane oxidation in agricultural

soil and are involved in ammonium oxidation and oxygen depletion with subsequent

O production (Topp and Hansen 1991 ) .

7.2 Phosphorus Cycle Processes Mediated by Microorganisms

Phosphorus is one of the most important minerals abundantly present in the soil.

However, it is also the least accessible nutrient in the plant rhizosphere. Phosphorus

is known to play a crucial role in symbiotic nitrogen ﬁ xation in many nodulating

legumes, such as soy beans.

The capability of the extra radical mycelium of AMF to extend the phosphate

depletion zones has an added advantage to the plants by increasing the uptake of

comparatively immobile phosphate ions and sometimes increasing phosphorous use

ef ﬁ ciency (Koide et al. 2000 ) . The plants strategies for phosphorous uptake are

embraced by modi ﬁ cation of their rhizosphere conditions, hasty root growth and

elongation and root hair proliferation. Modi ﬁ cation of the rhizosphere is mediated

by the formation of symbiotic association with AMF; releasing bio-available phos-

phorous by chelating agents secreted by mycorrhizal roots in acid and calcareous

soils; mobilization of organic P by phosphate enzymes and acidi ﬁ cation via increased

proton ef ﬂ ux and pCO

enhancement in mycorhizosphere in high-P- ﬁ xing soils.

AMF besides increasing the uptake and ef ﬁ cient utilization of phosphorous also

enhance the uptake and utilization of other macronutrients, such as N, potassium,

magnesium (Clark and Zeto 2000 ; Hodge et al. 2001 ) and some micronutrients,

such as zinc, copper, iron, nitrogen, potassium, calcium and manganese (Clark and

Zeto 2000 ) . The availability of these nutrients may sometimes direct the pattern of

symbiotic association (Ryan and Angus 2003 ) . The availability of nutrients enhances

the plant growth and development, increases vigor and increased resistance to many

biotic as well as abiotic stresses and ﬁ nally the yield (Borowicz 1997 ; Feng et al.

2002 ; Karagiannidis et al. 2002 ). Signi ﬁ cant decrease in yield has been observed

due to the disruption in AMF probably due to lower phosphorous uptake (Thompson

1994 ) . On the other hand, there are also some examples that suggest the negative

effects of AM colonization. Under the conditions of higher phosphorous availabil-

ity, the colonization of roots by AMF may reduce the crop growth (Kahiluoto et al.

2001 ) while the plants may not counter native AMF even under low phosphorous

availability (Ryan et al. 2002 ) . In some cases, the inoculation of roots with AMF

265

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

may also not result in a positive response (Sainz et al. 1998 ) . Degree of selection

between the host and the AMF and their interaction with different hosts have been

accounted for such contradictory reports.

8 Microbes Mediated Agricultural Antibiotics/Metabolites:

Biopesticides

With the advancement in human civilization, development of technology, trade and

globalization has invited certain serious issues. The agro-ecosystem is also being

affected by this advancement owing to the extensive use of chemical pesticides in

agriculture. While the use of chemical pesticides is on the rise, the pest induced

losses are also increasing. Fortunately, realization of the negative effects of these

chemicals on nature and natural resources has forced us to search for alternatives to

chemical pesticides. In the current scenario, the focus is more on reliable, sustain-

able and environment friendly agents of pest control, i.e. biopesticides. Biopesticides

have been gaining increasing interest among those concerned with developing

environment friendly, safe and Integrated Crop Management (ICM)-compatible

approaches and tactics for pest management (Copping and Menn 2000 ) .

Pesticides of biological origin i.e. viruses, bacteria, pheromones, plant, animal

compounds and certain minerals are termed as biopesticides. Biopesticides are gen-

erally grouped into three major categories: (1) pesticide of microbial origin (e.g. a

bacterial, fungal, viral or protozoan pesticide) that contains microorganisms as the

active ingredient (a.i). Such pesticides are relatively speci ﬁ c for their target pest(s);

(2) microorganisms derived molecules that act as a.i against pests. The most widely

used biopesticides in this category are obtained from subspecies and strains of

B. thuringiensis (popularly called Bt); (3) Plant originated pesticidal substances

termed as Plant-Incorporated-Protectants (PIPs). Plant-Incorporated-Protectants are

produced by plants through genetic manipulations ( http://www.epa.gov/oecaagct/

tbio.html ). The key feature of biopesticides is their eco-friendly nature and biode-

gradability which reduces their residual effects and environmental pollution hence

they play a role in sustainable agriculture. Different types of biopesticides belong-

ing to these two categories are described in Fig. 10.3 (Table 10.2 ).

8.1 Bacteria Derived Molecules

8.1.1 Fungicide/Bactericide

(a) Blasticidin-S

Blasticidin-S was isolated from the soil actinomycete Streptomyces griseochro-

mogenes in 1955 by Fukunaga and later by Takeuchi in 1958 while its fungicidal

properties were ﬁ rst described by Misato in 1959 (Copping and Duke 2007 ) .

266

S. Kaur et al.

Blasticidin-S functions by inhibiting peptidyl transfer and protein chain elonga-

tion by binding to the 50S ribosome in prokaryotes and blocking protein bio-

synthesis (Huang et al. 1964 ) . Blasticidin-S inhibits spore germination and

mycelial growth of Pyricularia oryzae at a concentration <1 mg/ml under

in vitro conditions. Foliar application (100–300 g/ha) of the fungicide protects

the plants from the rice blast, however excessive application could result in yel-

low spots on rice leaves. Blasticidin-S could be phytotoxic to alfalfa, auber-

gines, clover, potatoes, soybean, tobacco and tomatoes. More recently, its use

has decreased following the introduction of new, less toxic, pathogen-speci ﬁ c,

synthetic rice blast products (Copping and Duke 2007 ) .

(b) Harpin protein

Harpin protein is produced by Erwinia amylovora (Burrill) Winslow, causal

organism of ﬁ re blight disease in apples and pears. Harpin is an acidic, heat-

stable, cell envelope-associated protein with a molecular mass of about 40 kDa,

comprising 403 amino acid residues, lacking cysteine. A weakened strain of

Escherichia coli (Migula) has been used to produce commercial harpin and

harpin a b by transfer of the DNA fragment encoding harpin protein from

E. amylovora to E. coli K-12 strain (Wei et al. 1992 ) . Harpin proteins are known

to enhance seed germination, plant vigour, ﬂ owering, fruit setting and increase

yields as well as suppress a wide range of phytopathogens. These proteins activate

innate defence mechanisms in plants, known as systemic acquired resistance

Fig. 10.3 Different types of biopesticides

267

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

Table 10.2 Microbes mediated agricultural antibiotics/metabolites

Isolation

Sold as/chemical

composition Used against Formulation Side effects

Blasticidin S Streptomyces

griseochromogenes

Benzylaminobenz-

enesulfonic

acid salt

Rice blast ( Pyricularia oryzae ) CF, DP, EC,

and WP

Toxic to mammal, Rodents

(>100 mgkg

−1

), Rats

(L.D >500 mgkg

−1

);

eye irritant

Harpin

protein

Erwinia amylovora

(Burrill) Winslow

403 amino acid

residues lacking

cysteine

Bacterial leaf spot, Bacterial speck,

Bacterial wilt, Fusarium wilt,

Phytophthora root rot, Rice stem

rot, Sheath blight, Apple scab,

Fire blight, Botrytis bunch rot,

Black rot, Black leaf spot,

Cucumber mosaic virus,

Root-knot nematode, Tobacco

cyst nematode and Tobacco

mosaic virus (TMV)

ST, SD, FA, WG Harpin is not considered

to be a toxic pesticide.

Harpin protein is

classi ﬁ ed as a toxicity

category IV product by

the US-EPA via the

oral, dermal and

inhalation route, and

a toxicity category IV

eye and skin irritant

Kasugamycin Streptomyces

kasugaensis

Kasugamycin hydro-

chloride hydrate

Rice blast ( P. oryzae ), Leaf spot

in sugar beet and Celery

( Cercospora spp.), Bacterial

disease in rice and vegetables

and Scab ( Venturia spp.) in

apples and pears

SF, protectants,

WP, DP, SC,

GF, FS, ST

Non-toxic to mammals,

ﬁ sh and non-target

organisms; biodegrad-

able; safe to non-target

organism; environmen-

tally safe

Mildiomycin Streptoverticillium

rimofaciens strain

B-98 891

Powdery mildews ( Erysiphe spp.,

Uncinula necator ), Podosphaera

spp. and Sphaerotheca spp.)

Eradicant, with

some systemic

activity, WP

Biodegradable and

Non-toxic to mammals,

ﬁ sh and non-target

organisms

Natamyci-N Streptomyces natalensis

and S.

chattanoogensis

Basal rots on ornamental bulbs

such as daffodils (caused by

Fusarium oxysporum ).

DT, WP Biodegradable and

Non-toxic to mammals,

ﬁ sh and non-target

organisms

(continued)

268

S. Kaur et al.

Isolation

Sold as/chemical

composition Used against Formulation Side effects

Oxytetracycline Streptomyces

rimosus

Hydrochloride Fireblight ( E. amylovora )

and diseases caused by

Pseudomonas and

Xanthomonas ; mycoplasma

like organisms; stone and

pome fruit and in turf.

WSP, FS Biodegradable and

Non-toxic to mammals,

ﬁ sh and non-target

organisms

Polyoxin Streptomyces

cacoai var asoensis

Isono

Polyoxins D Powdery mildews, Rice sheath blight,

Apple and Pear canker, Pear

black spot

and Apple cork spot, Grey

mould. It is ineffective against

bacteria and yeasts

FS, WP, EC, WSG, Biodegradable and

Non-toxic to mammals,

ﬁ sh and non-target

organisms

Streptomycinn Streptomyces

griseus

Sesquisu-lfate Bacterial shot-hole, bacterial rots,

wilts, ﬁ re blight and other

bacterial diseases. It is recom-

mended for use in pome fruit,

stone fruit, citrus fruit, olives,

vegetables, potatoes, tobacco,

cotton and ornamentals

Systemic, WP, FS Very low mammalian

toxicity; no adverse

effects on non-target

organisms or the

environment

Validamycin Streptomyces

hygroscopicus

Rhizoctonia solani and other

Rhizoctonia species in rice,

potatoes, vegetables, strawber-

ries, tobacco, ginger, cotton, rice

and sugar beet

NS, FS, SD, ST, DP Very low mammalian

toxicity (suf ﬁ cient to

be used as a pharma-

ceutical), and it has not

been shown to have

any adverse effects on

non-target organisms or

the environment

Table 10.2

(continued)

269

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

Isolation

Sold as/chemical

composition Used against Formulation Side effects

Bilanafos Streptomyces hygro-

scopicus;

Streptomyces

viridochromeo-

genes

Tripeptide

phosphinothricin

Post-emergence in vines, apples,

brassicas, cucurbits, mulberries,

azaleas, annual weeds and at

higher rates for control of

perennial weeds rubber and

annual weeds

LP Relatively non-toxic to

mammals and other

non-target organisms;

they have very little

activity in soil, mainly

owing to rapid

microbial degradation.

Low environmental

impact herbicides

The avermectin ABAMECTIN: Mixture of two

avermectins,

avermectin B1a

and avermectin B1b

Mites, leaf miners, suckers,

beetles and other insects,

and it is also used for control

of ﬁ re ants ( Solenopsis spp.).

EC, contact and

stomach action

Highly toxic to mammals,

insects and mites, bio

degradable

Streptomyces

avermitilis

EMAMEC-TIN Emamec-tin benzoate

(emamect-in B1a

and emamect-in

B1b)

Caterpillar pests (Lepidoptera),

with suppressive activity against

mites, leaf miners and thrips,

Pinewood nematodes

Contact and stomach

action, WG, EC

Lower mammalian

toxicity; toxic to

bene ﬁ cial insects such

as honey bees

Streptomyces

avermitilis

Milbemyctin Streptomyces hygro-

scopicus subsp.

aureolacrimosus

Milbemycin A3 and

milbemycin A4 in

the ratio 3:7

Citrus red mites, pink citrus rust

mites, Kanzawa spider mites

and other spider mites, leaf

miners in citrus fruit, tea,

aubergines and protected

ornamentals

Contact and stomach

action, EC, WP

Moderate oral mammalian

toxicity but is much

less toxic via the

dermal route;

non-persistent in the

environment; relatively

non-toxic to non-target

organisms, although

some bene ﬁ cial insects

are susceptible

(continued)

270

S. Kaur et al.

Isolation

Sold as/chemical

composition Used against Formulation Side effects

Polynactin Streptomyces aureus A mixture of tetranac-

tin, trinactin and

dinactin

Spider mites, such as carmine

spider mite, two-spotted mite

and European red mite in

orchard fruit trees, spider mites

EC Non toxic to mammals and

bene ﬁ cial insects, high

toxicity to aquatic

organisms

Spinosad Saccharopolyspora

spinosa

Mixture of spinosyn A

and spinosyn D

Caterpillars, Thrips, Flies, Beetles,

drywood termites, ﬁ re ants,

grasshoppers, chewing and

sucking lice. Spinosad may be

used on row crops (including

cotton), vegetables, fruit trees,

turf, vines and ornamentals

Water-based suspension

concentrate

formulation

Very low mammalian

toxicity; non-toxic to

birds but slightly to

moderately toxic to

ﬁ sh; highly toxic to

honey bees; dry

residues are non-toxic

Myrothecium

verrucaria

Isolated from a

nematode

Plant parasitic nematodes, including

root-knot ( Meloidogyne spp.),

cyst, sting and burrowing

nematodes. It is used in turf,

tobacco, grapes, citrus, brassicae

and bananas. Controls both adult

and juvenile nematodes on contact

and inhibits the hatching and

development of eggs

DP, LF There is no evidence of

allergic reactions on

non-target organisms

and environment.

Possible toxicity to

aquatic organisms

CF contact fungicide, DT dip treatment, DP dustable powder, EC emulsi ﬁ able concentrate, FA Foliar applications, FS Foliar spray, GF granule formulation,

LF liquid formulations, ST seed treatment, SD soil drench, SC soluble concentrate, SF systemic fungicide, WSG water soluble granule, WSP water-soluble

powder, WG wettable granule, WP wettable powder

Table 10.2

(continued)

271

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

(SAR) (Wei et al. 1992 ) . Since harpin does not show any direct inhibitory or

toxic effect on plant pathogens, it is claimed that it does not impose any selec-

tion pressure on pathogens (Copping and Duke 2007 ) . Harpin is likely to be an

important tool in sustainable agriculture by decreasing the use of conventional

pesticides and resistance management programmes. It degrades rapidly and

does not impose comprehensible adverse effects on birds, ﬁ sh, aquatic inverte-

brates, honey bees, non-target plants, algae or ground water contamination,

therefore, it is considered eco-friendly (Copping and Duke

2007 ) .

Kasugamycin and kasugamycin hydrochloride hydrate were isolated from the

soil actinomycete Streptomyces kasugaensis Hamad (Hamad and biological

activity of these compounds were ﬁ rst described by Hamada in 1965 (Copping

and Duke 2007 ) . Kasugamycin functions by inhibiting protein biosynthesis by

interfering with the binding of aminoacyl-tRNA to both the mRNA-30S and the

mRNA-70S ribosomal subunit complexes, thus preventing the incorporation of

amino acids into proteins (Tanaka et al. 1966 ) . Kasugamycin is used in combi-

nation with other fungicides with different modes of action. It is slightly phyto-

toxic to crops, such as peas, beans, soybeans, grapes, citrus and apples while it

is comparatively safe on rice, tomatoes, sugar beet, potatoes and many other

vegetables. The use of kasugamycin has declined due to resistance develop-

ment and the release of new, disease-speci ﬁ c chemical fungicides for rice blast

control.

(d) Mildiomycin

Mildiomycin was ﬁ rst reported by Harada and Kishi ( 1978 ) and its fungicidal

properties were reported by Kusaka et al . ( 1979 ) . Mildiomycin functions by

blocking peptidyl-transferase, hereby inhibits protein biosynthesis in fungi

(Om et al. 1984 ) . It is effective at concentrations of 50–100 mg/l. Mildiomycin

has not been widely used for disease control outside Japan. Mildiomycin has

very low mammalian toxicity and it has not been shown to have any adverse

effects on non-target organisms or the environment.

(e) Natamycin

Natamycin is also known as myprozine, pimaricin and tennectin. The structure

of natamycin was elucidated by Golding et al. ( 1966 ) and Meyer and Pimaricin

( 1968 ) . The mode of action is still unknown.

(f) Oxytetracycline

Oxytetracycline was ﬁ rst described by Finlay in 1950 (Copping and Duke

2007 ) . Oxytetracycline is a potent inhibitor of protein biosynthesis in bacteria

and binds to the 30S and 50S bacterial ribosomal subunits thereby inhibiting

the binding of aminoacyl-tRNA and the termination factors, RF1 and RF2 to

the A site of the bacterial ribosome (Caskey

1973 ) . It is rapidly taken up by

plant leaves, particularly through stomata, and is readily translocated to other

plant tissues. However, its use as a crop protection agent has been declining. It

is used to treat several mammalian diseases, such as acne, spirochaetal infections,

272

S. Kaur et al.

clostridial wound infection, anthrax, skin, ear, eye, respiratory and urinary tract

infections and gonorrhoea.

(g) The Polyoxins

The fungicidal polyoxins are polyoxin B and polyoxorim. Polyoxin was ﬁ rst

isolated by Isono et al. (

1965 ) , Polyoxorim (polyoxin D) was isolated by Suzuki

et al. ( 1965 ) and Isono et al. ( 1967 ) . Polyoxins functions through inhibition of

cell wall biosynthesis or chitin synthesis in fungal cell wall. It causes abnormal

swelling on the germ tubes of spores and hyphal tips of the pathogen (Eguchi

et al. 1968 ; Isono and Suzuki 1979 ) . It is effective against bacteria, yeasts and

phycomycetes.

(h) Streptomycin

Streptomycin was isolated by Schatz in 1944 (Dorothy et al. 1945 ). Streptomycin

binds to the 30S ribosomal subunit thereby inhibiting protein biosynthesis that

leads to misreading of the genetic code. Development of resistance to strepto-

mycin has reduced its use in crop protection markets. Recommended use rates

can cause chlorosis to rice, grapes, pears, peaches and some ornamentals, but

these symptoms can be relieved by the addition of iron chloride or iron citrate

to the spray tank (Copping and Duke 2007 ) .

(i) Validamycin

Validamycin is also known as validamycin A. It is not systemic but possesses

fungistatic properties. In Rhizoctonia solani , it does not exhibit fungicidal

action but causes abnormal branching of the tips of the pathogen followed by a

cessation of further development and inhibits trehalase (Matsuura 1983 ;

Shigemoto et al. 1989 ) . High concentrations (1 g/l) showed no phytotoxicity to

over 150 different target crops. Validamycin continues to ﬁ nd wide usage in a

wide variety of crops, particularly in Japan.

8.1.2 Herbicides

(a) Bilanafos

The tripeptide herbicide bilanafos is commonly known as bilanafos and biala-

phos. Bilanafos induces toxicity only after its metabolic conversion to a potential

irreversible inhibitor of glutamine synthetase (GS), phosphinothricin {4- [hydroxy

(methyl) phosphinoyl]-L-homoalanine} (Lydon and Duke 1999 ) . Glutamine syn-

thetase inhibition results in accumulation of ammonium ions and inhibition of

photorespiration. The rapid toxic effects of the herbicide can be reversed by

supplying the plant with glutamine. However, this does not reduce the levels

of ammonium ions. In case of C3 plants, toxicity results from rapid cessation of

photorespiration due to the inhibition of glutamine synthetase, resulting in

accumulation of glyoxylate in the chloroplast and rapid inhibition of ribulose

bisphosphate (RuBP) carboxylase (Lydon and Duke 1999 ) .

273

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

8.1.3 Insecticides and Acaricides

(a) The Avermectins: Abamectin and Emamectin

Abamectin is an insecticide and acaricide. It is a mixture of two avermectins,

avermectin B1a and avermectin B1b, and was introduced as an insecticide/

acaricide. It has the approved common names abamectin and abamectine,

but it is also known as avermectin B1. Abamectin acts on g –aminobutyric

acid (GABA) receptor in the peripheral nervous system (Fisher

1993 ) . The

compound stimulates the release of GABA from nerve endings and enhances

the binding of GABA to receptor sites on the post-synaptic membrane of

inhibitory motor neurons of nematodes and on the post-junction membrane

of muscle cells of insects and other arthropods. This enhanced GABA binding

results in an increased ﬂ ow of chloride ions into the cell, with consequent

hyperpolarization and elimination of signal transduction, resulting in an inhibi-

tion of neurotransmission (Jansson and Dybas 1996 ) . Emamectin, another

avermectin acts as insecticide/acaricide. It targets GABA receptors in the

peripheral nervous system in lepidopteran (Fisher 1993 ) .

(b) Milbemycin

Milbemycin (also known as milbemectin) acts as an insecticide and acaricide

by stimulating the release of GABA from nerve endings. It enhances the bind-

ing of the molecule to the receptor sites on the post-synaptic membrane of

inhibitory motor neurons of mites and other arthropods. This results in an

increased ﬂ ow of chloride ions into the cell, which subsequently causes hyper-

polarization and elimination of signal transduction and ﬁ nally inhibits neu-

rotransmission (Lankas and Gordon 1989 ) .

Polynactins are secondary metabolites of Streptomyces aureus Waksman &

Henrici isolate S-3466. Polynactins act on the lipid layer of the mitochondrial

membrane resulting in the leakage of basic cations such as, potassium ions

(Ando et al. 1974 ) .

(d) Spinosad

Spinosad is a secondary metabolite from the soil actinomycetes. It is target

speci ﬁ c and functions by activating nicotinic acetylcholine receptor, but at a

different site than nicotine or the neonicotinoids. It is also known to affect

GABA receptors, however their role is unclear. The activity of this herbicide

results in rapid death of target phytophagous insects. It has been recommended

to use this herbicide with sturdy, proactive resistance management strategy,

however its moderate residual activity reduces the possibility of the onset of

resistance (Thompson et al. 2000 ) . It has been an important component of

conventional and integrated farming systems. It has high biodegradability in

soil via photolysis and by soil microorganisms below the soil surface (Saunders

and Bret 1997 ) .

274

S. Kaur et al.

8.2 Fungi Derived Molecules

8.2.1 Fungicides and Bactericides

Yeast extract hydrolysate, a by-product of the fermentation of brewer’s yeast

( Saccharomyces cerevisiae Meyer exHansen) is the only fungi derived product that

is sold as a fungicide/bactericide (

www.epa.gov/pesticides/biopesticides/ingredi-

ents/index.htm ). It is sold under the trade name KeyPlex 350, however its composi-

tion is not known.

8.2.2 Herbicides

Till date, no herbicide of fungal origin is available on the market (Duke et al. 2002 ;

Copping and Duke 2007 ) .

8.2.3 Insecticides, Acaricides and Nematicides

(a) Myrothecium verrucaria

Myrothecium verrucaria (Alb. & Schwein.) Ditmar isolate AARC-0255 is a

potent nematicide belonging to order Hypocreales. The dried mycelium of the

fungus is used as a nematicide and the a.i is amixture of substances that are in

suspension and in solution. The mode of action of the fungus is still unidenti ﬁ ed.

Although the living fungus causes plant disease, its a.i (heat killed) acts as a

herbicide.

9 Microbes Mediated Composting

Some of the most common organic wastes and amendments used for soil application

such as, animal manure, kitchen waste, agriculture waste, pulp and paper industrial

sludge, municipal wastewater sludge can be converted into compost. The unknown

composition of the raw organic wastes and uncertainty in terms of pathogens, toxic

compounds, weed seeds, heavy metals and foul odours render them unsuitable

for ﬁ eld application (Singh et al. 2011 b ) . Untreated or unprocessed wastes often

pose a serious threat to the agro-ecosystem as well as human health and cause toxic-

ity to bene ﬁ cial soil micro ﬂ ora. Large quantities of organic waste, high cost of treat-

ment and unavailability of suf ﬁ cient dumping sites and associated environmental

hazards raises questions on incineration and land ﬁ lling practice. On the contrary,

organic waste treatment has emerged as an attractive and cost-effective strategy

being used for land application to supply plant nutrients and organic matter for

improved crop production. Most commonly used organic amendments are animal

275

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

and green manures, compost, nematicidal plants and proteinaceous wastes (Singh

et al. 2011 b ) . Organic soil amendments have been used as a traditional cultural

practice to improve soil fertility and texture. Organic amendments also help in plant

disease management by inhibiting soil-borne pathogens, such as Aphanomyces

euteiches , Gaeumannomyces graminis , Macrophomina phaseolina , Rhizoctonia

solani , Thielaviopsis basicola , Verticillium dahlia , etc. (Bonanomi et al.

2010 ) .

Organic amendments also help in suppression of various phytopathogenic nema-

todes (Oka 2010 ) .

Composting is one of the most appropriate methods for the management of solid

organic waste for agricultural use while minimizing the constraints associated with

it. Composting improves soil biophysical properties, organic matter and provides

plant nutrients and increases the crops yield. According to an estimate, nearly 827

million tons of compostable materials are generated every year, mainly by agricul-

ture, municipalities, and industry while only 140 million tons, or 17%, of those are

collected for composting (Ahmad et al. 2007 ; Singh et al. 2011 b ) . Composting is a

biological process of conversion of heterogeneous organic wastes (manure, sludge,

yard wastes, leaves, fruits, vegetables, and food wastes) into humus-like substances.

Technologies have been developed to fasten the process by utilizing consortia of

microorganisms, such as bacteria, actinomycetes and fungi under controlled condi-

tions of moisture, temperature and aeration. These microbes occur widely in nature

and are indigenous to soil, dust, fruit and vegetable matter and wastes. Apart from

bene ﬁ ting agro ecosystem, composts also mitigate the adverse effects of greenhouse

gases, such as carbon dioxide released from agricultural soil and methane gas from

livestock and their manures. This is done principally by carbon sequestration i.e.,

locking up carbon in organic matter and organisms within the soil due to the stable

nature of composts.

10 Non-target Effects of Microorganisms/Biological Control

Agents/Health and Safety Issues

Soil microbes or in particular AIMs, such as PGPR or BCAs that are extensively

used in agriculture might possess some under-estimated or neglected non-targeted

effects. Four safety issues were described by Burges ( 1981 ) and Cook et al. ( 1996 ) :

(1) competitive displacement; (2) allergenicity; (3) toxicity and; (4) pathogenicity.

The potential risk of BCAs could be Gene transfer from BCAs to other microorgan-

isms that could result in the development of new genotypes. Risk associated with

the probability of gene transfer depends on many factors such as biology of the

recipient organism, nature of the trait transferred as well as the environment.

However, according to Cook et al. ( 1996 ) , there are no safety issues associated with

the gene transfer, whether it occurs naturally or is done intentionally.

Competitive displacement embraces when BCAs eliminate or replace native

non-target species through temporal and spatial struggle for nutrients i.e., microbe-

microbe interaction. Targeted effect of Competitive displacement can be explained

276

S. Kaur et al.

by some of the following examples: (1) spore suspension of saprophytic fungus

Phlebia gigantea protects the pine stump from annosus root rot of pine caused by

Heterobasidion annosum (Rishbeth 1975 ) ; (2) yeasts and bacteria have been used in

post-harvest disease management in fruits during storage (Roberts

1990 ; Wisniewski

et al. 1991 ) . Candida oleophila Montrocher (Aspire) and two isolates of Pseudomonas

syringae van Hall with this ability (Bio-Save 10 and Bio-Save 11) were registered

with the U.S. Environmental Protection Agency in 1995 (Cook et al. 1996 ) ; (3) non-

pathogenic strain of P. syringae (Sno-Max) protects the frost-sensitive plants, such

as tomato and potato to prevent the subsequent natural establishment of ice-nucle-

ation-active bacteria (Lindow 1983 ) . The wide use of BCAs might reduce the diver-

sity and/or abundance of other microorganisms in an ecosystem that might

signi ﬁ cantly affect other natural processes occurring in the eco-system, such as

nutrient recycling by affecting their ability to release enzymes that permit the

metabolism of complex organic molecules that are unavailable to many organisms,

such as lignin or symbiotic relationships (mycorrhizae) with fungi (Orth et al. 1993 ) .

The interaction of AIMs in close proximity with other organisms, such as insects or

fungi or bacteria or among themselves might be affected.

Spores of AIMs might develop in patients with weak or suppressed immunity

resulting in allergic reactions are the non targeted effects (Latge and Paris 1991 ).

Allergenicity is a potential safety concern to the workers engaged in production

facilities exposed repeatedly to high concentrations of spores of fungi, such as

Beauveria or Metarhizium due to the development of hypersensitive reactions. An

intradermal skin testing con ﬁ rmed the allergenic potential of Beauveria bassiana

due to the presence of abundant IgE reactive proteins that are also cross-reactive

with allergens from other fungi. (Westwood et al. 2005 ) . Although no evidence

suggests that the toxicity of Metarhizium anisopliae to humans or other mammals,

there are some case studies that documents the infection by M. anisopliae in

immune-compromised and immune-competent individuals as well as a case of

invasive rhinitis in a cat (Ward et al. 2011 ) .

Antibiosis and the toxic alkaloids produced against aphids or other insect her-

bivores are an example of Toxigenicity (Cook and Baker 1983 ; Siegel et al. 1987 ) .

For example P. ﬂ uorescens , G. virens , B. thuringiensis , A. radiobacter , Acremonium

sp . (Siegel et al. 1987 ; Lumsden et al. 1992 ) . However, it has also been reported

that the alkaloids might cause toxicosis in livestock grazing on treated grass/

leaves and the several Bt toxins might affect arthropods (Rogoff 1982 ; Siegel

et al. 1987 ; Laird et al. 1990 ) . Some plant-associated microorganisms used for

seed treatments produce toxic metabolites during seed germination and exert

injury to the germinating seedlings resulting in stand failure or stunted plants.

Such types of non-targeted effects should be recognised early during the research

and development phase. Potential risk of these microorganisms to affect organ-

isms other than the target pests is of most important concern from a risk manage-

ment perspective. Simberloff and Stiling ( 1996 ) reviewed the probability of risk

associated with microorganisms, particularly BCAs. The prospective reproducing

and spreading habit of BCAs to non-target environments might produce unfore-

seen effects on native organisms. BCAs, being perceived as ‘natural’ and ‘low

277

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

risk’, are often exempted from the rigorous testing as in the case of chemical

pesticides (Lumsden and Walter 1995 ; Anonymous 2001 ) . Some of the microor-

ganisms used in plant disease management are hypo-virulent strains of plant

pathogens that increase the possibility of gene transfer between isolates that might

result in gain of virulence or loss of biological control abilities (Gullino et al.

1995 ) . The ecosystem exhibits an intricate environment and complex interactions

between biotic and abiotic factors. It renders dif ﬁ cult to investigate the interaction

of BCAs within their environment. However, the live behaviour of these microor-

ganisms implicates the importance of understanding their functioning and to

anticipate possible hitches and alleviate any adverse effects. According to

Wapshere ( 1974 ) and Briese ( 2003 ) , centrifugal phylogeny scheme used to verify

any unfavourable effects of BCAs in weed management on non-target plants can

also be used to determine the host range of plants for BCAs for plant diseases.

Nevertheless due to variable susceptibility within a single plant species, phylog-

eny testing might not be helpful in identifying vulnerable plant species. This

implicates the need of studying genetic relationships between hosts and patho-

gens for determining host range (Weidemann and Tebeest 1990 ) .

The movement of BCAs in an ecosystem needs to be monitored regularly.

Molecular techniques can be used to monitor the integrity as well as stability of

strains released in the ﬁ eld (Hermosa et al. 2000, 2001 ; Avis et al. 2001 ) . According

to Teng and Yang ( 1993 ) , the analysis of risks and impacts associated with release

of BCAs can be accessed through risk determination, data and information genera-

tion, prediction of impact, risk and bene ﬁ t evaluation. However, at the same time, it

is practically unfeasible to envisage all impacts or interactions of BCAs with non-

target organisms. In order to utilize the maximum potential of BCAs, some of the

safety issues pertinent to the safe use of microorganisms for biological control of

pests and diseases and to avoid the risk associated with the production and utiliza-

tion of BCAs are described in Fig. 10.4 .

Identi ﬁ cation, assessment and management of the risks or potential risks would

lead to the “safe use” of BCAs. Policies should be formulated to study the potential

risks of BCAs.

Fig. 10.4 Safety issues pertinent to biocontrol agents

278

S. Kaur et al.

11 Concluding Remarks

In the scenario of “ Green Revolution ” or sustainable advances in agricultural

production, productivity, pro ﬁ tability and enhanced job opportunities can be attained

only by a substantial progress in productivity per unit of land, water, and energy and

even per capita, without causing any harm to the environment. Agricultural ﬁ elds

vary with space and time and hence require site-speci ﬁ c crop management for maxi-

mising the ef ﬁ ciency of the input resources. Productivity and pro ﬁ tability enhance-

ment should be our key to success. In this endeavour, cutting-edge technologies will

play a pivotal role. Sustained growth in agricultural productivity will depend upon

continued improvements in genotypes, germplasms, improved nutritional value of

crops, resistance to abiotic stress and disease and pest management yield stability.

The increasing cost of chemical pesticides and fertilizers and the low purchasing

power of most of the farmers suggest the importance of cheaper, cost-effective and

easily accessible alternatives for practicing sustainable agriculture.

Decision making for agricultural sustainability requires an active participation of

not only at the ﬁ eld and farm levels but also on a large scale including the end users,

stakeholders, researchers together on one stage. Agricultural sustainability can be

attained by attaining ﬂ exible understanding and anticipation of social, economic and

biological factors. The wealth of soil microorganisms can be exploited for the cause

of mankind in a safe and effective manner. Intensive future research is required in

this area, predominantly on the ﬁ eld evaluation and application of potential microor-

ganisms. Unfavourable interactions between farming and conservation occur due to

the lack of understanding between plant-microbe and microbe-microbe interactions.

Therefore, well designed farming practices and successful bio-diversi ﬁ cation using

these microorganisms could lead in the right direction of sustainable agriculture.

Such understanding is also of utmost importance in biological control systems where

wildlife is to stay a major component of agricultural systems.

Considerable research in the ﬁ eld of microbial technology has proved to be an

effective and potential means for enriching soil fertility and crop health. However,

the technology needs further improvement for its better exploitation under sustain-

able agriculture development programs. In this direction, AIMs particularly PGPR

have emerged as an excellent model system with novel genetic constituents and

bioactive chemicals with multifaceted use in agriculture and environmental sustain-

ability. Our understanding of PGPR diversity, colonization ability and mechanisms

of interactions, formulation and application could assist there better utilization in

agricultural ecosystem. At the same time, the exploration of live microbial creatures

raises health and safety issues and their non-target effects on other organisms, such

as toxigenicity, allergenicity and pathogenicity, persistence in the environment and

potential for horizontal gene transfer.

Bio-augmentation and bio-stimulation approaches using microbial inoculants,

biofertilizers, bio(chemicals) and organic amendments help in improving and main-

taining soil biology, fertility, crop productivity, biocontrol methods for soil borne

diseases and plant–parasitic nematodes as well as soil remediation. However, the

279

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

knowledge of microbial diversity and function in soils is limited due to the lack

of taxonomic and ef ﬁ cient methodology. The recent rapid advances in the ﬁ eld of

genomics in particular, metagenomics, proteomics and functional genomics have

led to a better understanding of the microbial diversity.

The functional aspects of agro-ecosystems and soil biodiversity, important to

farmers are numerous and beyond the scope of the chapter. The full potential of

soil microorganisms in sustainable agriculture could be achieved by proper amal-

gamation with above-ground bio-diversity to sustain ecosystem functioning. The

acquaintance gained through in-depth experimentation and testing will reap

bene ﬁ ts only, if inspired and combined with farmer’s knowledge, problem percep-

tion and opportunities for application. At the same time, the role of society, in

understanding the importance of agro-biodiversity, at large cannot be neglected.

Acknowledgements The authors acknowledge ICAR, New Delhi, India for providing Senior

Research Fellowship for doctorate studies and Canadian Government for providing Canadian

Commonwealth Scholarship (CCSP, 2010–2011) to Surinder Kaur. The views or opinions

expressed in this article are those of the authors.

References

Abdalla MH, Omer SA (2001) Survival of Rhizobia/Bradirhizobia and a rock phosphate solubiliz-

ing fungus Aspergillus niger on various carriers from some agro-industrial wastes and their

effect on nodulation and growth of fababean and soybean. J Plant Nutr 24:261–272

Ahmad R, Jilani G, Arshad M, Zahir ZA, Khalid A (2007) Bio-conversion of organic wastes for

their recycling in agriculture: an overview of perspectives and prospects. Ann Microbiol

57:471–479

Alexander M (1977) Introduction to soil microbiology, 2nd edn. Academic, New York, p 467

Amico ED, Cavalca L, Andreoni V (2008) Improvement of Brassica napus growth under cadmium

stress by cadmium resistant Rhizobacteria. Soil Biol Biochem 40(1):74–84

Ando K, Sagawa T, Oishi H, Suzuki K, Nawata T (1974) Tetranactin, a pesticidal antibiotic.

Proceedings of the 1st intersect congr IAMS. Sci Counc Jpn 3:630

Anonymous (2001) Guidelines for the registration of microbial pest control agents and products.

Pest Management Regulatory Agency, Ottawa

Antoun H, Kloepper JW (2001) Plant growth promoting rhizobacteria (PGPR). In: Brenner S,

Miller JH (eds) Encyclopedia of genetics. Academic, New York, pp 1477–1480

Avis TJ, Hamelin RC, Bélanger RR (2001) Approaches to molecular characterization of fungal

biocontrol agents: some case studies. Can J Plant Pathol 23:8–12

Babalola OO (2010) Bene ﬁ cial bacteria of agricultural importance. Biotechnol Lett 32:1559–1570

Barber SA (1995) Soil nutrient bioavailability: a mechanistic approach, 2nd edn. Wiley, New York

Barriuso J, Solano BR, Lucas JA, Lobo AP, Villaraco AG, Mañero FJG (2008) Ecology, genetic

diversity and screening strategies of plant growth promoting rhizobacteria (PGPR). In: Ahmad I,

Pichtel J, Hayat S (eds) Plant-bacteria interactions. Wiley-VCH, Weinheim, pp 1–13

Belimov AA, Safronova VI, Sergeyeva TA, Egorova TN et al (2001) Characterization of plant

growth promoting rhizobacteria isolated from polluted soils and containing 1-aminocyclopro-

pane-1-carboxylate deaminase. Can J Microbiol 47(7):642–652

Belimov AA, Hontzeas N, Safronova VI, Demchinskaya SV, Piluzza G, Bullitta S, Glick BR

(2005) Cadmium-tolerant plant growth-promoting bacteria associated with the roots of Indian

mustard ( Brassica juncea L Czern.). Soil Biol Biochem 37(2):241–250

280

S. Kaur et al.

Berg G (2009) Plant–microbe interactions promoting plant growth and health: perspectives for

controlled use of microorganisms in agriculture. Appl Microbiol Biotechnol 84:11–18

Birkhofer KT, Bezemer M, Bloem J, Bonkowski M, Christensen S, Dubois D, Ekelund F, Fliebach

A, Gunst L, Hedlund K, Mader P, Mikola J, Robin C, Setala H, Tatin-Froux F, Wim H, der Putten

V, Scheu S (2008) Long-term organic farming fosters below and aboveground biota: implications

for soil quality, biological control and productivity. Soil Biol Biochem 40(9):2297–2308

Blaha D, Combaret CP, Mirza MS, Loccoz YM (2006) Phylogeny of the 1-aminocyclopropane-1-

carboxylic acid deaminase encoding gene acdS in phytobene ﬁ cial and pathogenic Proteobacteria

and relation with strain biogeography. FEMS Microbiol Ecol 56:455–470

Bloemberg GV, Lugtenberg BJJ (2001) Molecular basis of plant growth promotion and biocontrol

by rhizobacteria. Curr Opin Plant Biol 4:343–350

Bock E, Koops HP, Harms H (1989) Nitrifying bacteria. In: Schlegel H, Bowein B (eds) Autotrophic

bacteria. Science Tech Publishers, Madison, pp 81–96

Bonanomi G, Antignani V, Capodilupo M, Scala F (2010) Identifying the characteristics of organic

soil amendments that suppress soilborne plant diseases. Soil Biol Biochem 42:136–144

Borowicz VA (1997) A fungal root symbiont modi ﬁ es plant resistance to an insect herbivore.

Oecologia 112:534–542

Briese DT (2003) The centrifugal phylogenetic method used to select plants for host-speciWcity

testing of weed biological control agents: can and should it be modernized? In: SpaVord-Jacob

HS, Briese DT (eds) Improving the selection, testing and evaluation of weed biological control

agents, Tech. ser. 7. CRC for Australian Weed Management, Adelaide, pp 23–34

Bull AT, Goodfellow M, Slater JH (1992) Biodiversity as a source of innovation in biotechnology.

Annu Rev Microbiol 46:219–252

Burd GI, Dixon DG, Glick BR (2000) Plant growth-promoting bacteria that decrease heavy metal

toxicity in plants. Can J Microbiol 46:237–245

Burges HD (1981) Safety, safety testing and quality control of microbial pesticides. In: Burges HD (ed)

Microbial control of pests and plant diseases 1970–1980. Academic, London, pp 739–767, 949 pp

Caskey CT (1973) Inhibitors of protein biosynthesis. In: Hochster RM, Kates M, Quastel JH (eds)

Metabolic inhibitors, vol IV. Academic, New York, p 131

Chacko S, Ramteke PW, John SA (2009) Amidase from plant growth promoting rhizobacterium. J

Bacteriol Res 1(4):046–050

Chen YP, Rekha PD, Arun AB, Shen FT, Lai WA, Young CC (2006) Phosphate solubilizing bacte-

ria from subtropical soil and their tricalcium phosphate solubilizing abilities. Appl Soil Ecol

34(Suppl 1):33–41

Cho K, Toler H, Lee J, Owenley B, Stutz JC, Moore JL, Auge RM (2006) Mycorrhizal symbiosis

and response of sorghum plants to combined drought and salinity stresses. J Plant Physiol

163:517–528

Clark RB, Zeto SK (2000) Mineral acquisition by arbuscular mycorrhizal plants. J Plant Nutr

23:867–902

Collins HP, Rasmussen PE, Douglas CL Jr (1992) Crop rotation and residue management effects

on soil carbon and bacterial dynamics. Soil Sci Soc Am J 56:783–788

Cook RJ, Baker KF (1983) The nature and practice of biological control. APS Press, St. Paul

Cook RJ, Bruckart WL, Coulson JR, Goettel MS, Humber RA, Lumsden RD, Maddox JV,

McManus ML, Moore L, Meyer SF, Quimby PC, Stack JP, Vaughn JL (1996) Safety of micro-

organisms intended for pest and plant disease control: a framework for scienti ﬁ c evaluation.

Biol Control 7:333–351

Copping GL, Duke OS (2007) Natural products that have been used commercially as crop protec-

tion agents. Pest Manag Sci 63:524–554

Copping GL, Menn JJ (2000) Biopesticides: a review of their action, applications and ef ﬁ cacy.

Pest Manag Sci 56:651–676

Daly MJ, Stewart DPC (1999) In ﬂ uence of “effective microorganisms” (EM) on vegetable produc-

tion and carbon mineralization–a preliminary investigation. J Sustain Agric 14:2–3

281

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

De Vleesschauwer D, Cornelis P, Höfte M (2006) Redox-active pyocyanin secreted by Pseudomonas

aeruginosa 7NSK2 triggers systemic resistance to Magnaporthe grisea but enhances

Rhizoctonia solani susceptibility in rice. Mol Plant Microbe Interact 19:1406–1419

Denton B (2007) Advances in phytoremediation of heavy metals using plant growth promoting

bacteria and fungi. MMG 445 Basic Biotechnol 3:1–5

Dimkpa C, Svatoš A, Merten D, Büchel G, Kothe E (2008) Hydroxamate siderophores produced

by Streptomyces acidiscabies E13 bind nickel and promote growth in cowpea ( Vigna unguicu-

lata L) under nickel stress. Can J Microbiol 54(3):163–172

Dorn E, Hellwig M, Reineke W, Knackmuss HJ (1974) Isolation and characterization of a 3-chlo-

robenzoate degrading pseudomonad. Arch Microbiol 99:61–70

Dorothy GS, Harry JR, Dorothy MC (1945) The in ﬂ uence of streptomycin and streptothricin on

the intestinal ﬂ ora of mice. J Bacteriol 50(6):613–621

Duke SO, Dayan FE, Rimando AM, Schrader KK, Aliotta G, Oliva A et al (2002) Chemicals from

nature for weed management. Weed Sci 50:138–151

Egamberdiyeva D (2005) Plant-growth-promoting rhizobacteria isolated from a Calcisol in a semi-

arid region of Uzbekistan: biochemical characterization and effectiveness. J Plant Nutr Soil Sci

168(Suppl 1):94–99

Egamberdiyeva D (2007) The effect of plant growth promoting bacteria on growth and nutrient

uptake of maize in two different soils. Appl Soil Ecol 36:184–189

Eguchi J, Sasaki S, Ohta N, Akashiba T, Tsuchiyama T, Suzuki S (1968) Studies on polyoxins,

antifungal antibiotics. Mechanism of action on the diseases caused by Alternaria spp. Ann

Phytopathol Soc Jpn 34:280

Feng G, Zhang FS, Li XL, Tian CY, Tang C, Rengel Z (2002) Improved tolerance of maize plants

to salt stress by arbuscular mycorrhiza is related to higher accumulation of soluble sugars in

roots. Mycorrhiza 12:185–190

Figueiredo MVB, Burity HA, Martinez CR, Chanway CP (2008) Alleviation of drought stress in

common bean ( Phaseolus vulgaris L.) by co-inoculation with Paenibacillus polymyxa and

Rhizobium tropici . Appl Soil Ecol 40:182–188

Figueiredo MVB, Seldin L, Araujo FF, Mariano RLR (2010) Plant growth promoting rhizobacte-

ria: fundamentals and applications. In: Maheshwari DK (ed) Plant growth and health promot-

ing bacteria, microbiology monographs 18. Springer, Berlin

Fisher MH (1993) Recent progress in avermectin research. In: Duke SO, Menn JJ, Plimmer JR

(eds) Pest control with enhanced environmental safety, ACS symposium series no. 524.

American Chemical Society, Washington, DC, pp 169–182

Gaind S, Gaur AC (1991) Thermotolerant phosphate solubilizing microorganisms and their inter-

action with mungbean. Plant Soil 133(1):141–149

Galal YGM (2003) Assessment of nitrogen availability to wheat ( Triticum aestivum L.) from inor-

ganic and organic N sources as affected by Azospirillum brasilense and Rhizobium legumi-

nosarum inoculation. Egypt J Microbiol 38:57–73

Ghorbani R, Wilcockson S, Koocheki A, Leifert C (2009) Soil management for sustainable crop

disease control: a review. In: Lichtfouse E (ed) Organic farming, pest control and remediation

of soil pollutants, vol 1, Sustainable agriculture reviews. Springer, Dordrecht/New York

Glick BR, Patten CL, Holguin G, Penrose DM (1999) Biochemical and genetic mechanisms used

by plant growth promoting bacteria. Imperial College Press, London

Golding BT, Rickards RW, Meyer WE, Patrick JB, Barber M (1966) The structure of the macrolide

antibiotic pimaricin. Tetrahedron Lett 30:3551–3557

Govindasamy V, Senthilkumar M, Mageshwaran V, Annapurna K (2009) Detection and characterization

of ACC in plant growth promoting rhizobacteria. J Plant Biochem Biotechnol 18(1):71–76

Grichko VP, Glick BR (2001) Amelioration of ﬂ ooding stress by ACC deaminase containing plant

growth-promoting bacteria. Plant Physiol Biochem 39:11–17

Grover M, Ali Z, Sandhya V, Rasul A, Venkateswarlu B (2011) Role of microorganisms in adapta-

tion of agriculture crops to abiotic stresses. World J Microbiol Biotechnol 27:1231–1240

Gullino ML, Migheli Q, Mezzalama M (1995) Risk analysis in the release of biological control

agents. Plant Dis 79:1193–1201

282

S. Kaur et al.

Han HS, Lee KD (2005) Plant growth promoting rhizobacteria effect on antioxidant status, photosyn-

thesis, mineral uptake and growth of lettuce under soil salinity. Res J Agric Biol Sci 1(3):210–215

Harada S, Kishi T (1978) Isolation and characterisation of mildiomycin, a new nucleoside antibi-

otic. J Antibiot 31:519–524

Harish S, Kavino M, Kumar N, Balasubramanian P, Samiyappan R (2009a) Induction of defense-

related proteins by mixtures of plant growth promoting endophytic bacteria against Banana

bunchy top virus. Biol Control 51:16–25

Harish S, Kavino M, Kumar N, Samiyappan R (2009b) Differential expression of pathogenesis-

related proteins and defense enzymes in banana: interaction between endophytic bacteria

banana bunchy top virus and Pentalonia nigronervosa . Biocontrol Sci Technol 19:843–857

Hermosa MR, Grondona I, Iturriaga EA, Diaz-Minguez JM, Castro C, Monte E, Garcia-Acha I

(2000) Molecular characterization and identi ﬁ cation of biocontrol isolates of Trichoderma spp.

Appl Environ Microbiol 66:1890–1898

Hermosa MR, Grondona I, Diaz-Minguez JM, Iturriaga EA, Monte E (2001) Development of a

strain-speci ﬁ c SCAR marker for the detection of Trichoderma atroviride 11, a biological con-

trol agent against soilborne fungal plant pathogens. Curr Genet 38:343–350

Hernandez-Rodriguez A, Heydrich Perez M, Acebo Guerrero Y, Velazquez del Valle MG,

Hernandez Lauzardo AN (2008) Antagonistic activity of Cuban native rhizobacteria against

Fusarium verticillioides (Sacc.) Nirenb. In maize ( Zea mays L.). Appl Soil Ecol 39:180–186

Higa T (1991) Effective microorganisms: a biotechnology for mankind. In: Parr JF, Hornick SB,

Whitman CE (eds) Proceedings of the ﬁ rst international conference on Kyusei nature farming.

U.S. Department of Agriculture, Washington, D.C., pp 8–14

Higa T (1995) Effective microorganisms: their role in Kyusei nature farming and sustainable agri-

culture. In: Parr JF, Hornick SB, Simpson ME (eds) Proceedings of the third international

conference on Kyusei nature farming. U.S. Department of Agriculture, Washington. D.C

Higa T, Wididana GN (1991) The concept and theories of effective microorganisms. In: Parr JF,

Hornick SB, Whitman CE (eds) Proceedings of the ﬁ rst international conference on Kyusei

nature farming. U.S. Department of Agriculture, Washington, DC, pp 118–124

Hinsinger P (1998) How do plant roots acquire mineral nutrients? Chemical processes involved in

the rhizosphere. Adv Agron 64:225–265

Hirsch PR, Jones MJ, McGrath SP, Giller KE (1993) Heavy metals from past applications of

sewage sludge decrease the genetic diversity of Rhizobium leguminosarum biovar trifolii popu-

lations. Soil Biol Biochem 25:1485–1590

Hodge A, Campbell CD, Fitter AH (2001) An arbuscular mycorrhizal fungus accelerates decom-

position and acquires nitrogen directly from organic material. Nature 413:297–299

Hontzeas N, Saleh SS, Glick BR (2004a) Changes in gene expression in canola roots induced by ACC-

deaminase-containing plant-growth-promoting bacteria. Mol Plant Microbe Interact 17:865–871

Hontzeas N, Zoidakis J, Glick BR, Abu Omar MM (2004b) Expression and characterization of

1-aminocyclopropane-1-carboxylate deaminase from the rhizobacterium P. putida UW4: a key

enzyme in bacterial plant growth promotion. Biochim Biophys Acta Mol Cell Biol Lipids

1703:11–19

Hu C (2005) Induction of growth promotion and stress tolerance in Arabidopsis and tomato

by plant growth promoting rhizobacteria. Auburn University, Dissertation.

http://hdl.handle.

net/10415/769

Huang KT, Misato T, Suyama H (1964) Effect of blasticidin S on protein biosynthesis of Pyricularia

oryzae . J Antibiot Ser A 17:65

Isono K, Suzuki S (1979) The polyoxins: pyrimidine nucleoside peptide antibiotics inhibiting cell

wall biosynthesis. Heterocycles 13:333

Isono K, Nagatsu J, Kawashima Y, Suzuki S (1965) Studies on polyoxins, antifungal antibiotics.

Part 1. Isolation and characterisation of polyoxins A and B. J Antibiot Ser A 18:115

Isono K, Nagatsu J, Kobinata K, Sasaki K, Suzuki S (1967) Studies on polyoxins, antifungal

antibiotics. Part V. Isolation and characterisation of polyoxins C, D, E, F, G, H and I. Agric

Biol Chem 31:190

283

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

Jansson RK, Dybas RA (1996) Avermectins: biochemical mode of action, biological activity and

agricultural importance. In: Ishaaya I (ed) Insecticides with novel modes of action: mecha-

nisms and application. Springer, New York

Jiang ZQ, Guo Y-H, Li S-M, Qi H-Y, Guo J-H (2006) Evaluation of biocontrol ef ﬁ ciency of differ-

ent Bacillus preparations and ﬁ eld application methods against Phytophthora blight of bell

pepper. Biol Control 36:216–223

Jones JW (1991) Diversity and physiology of methanogens. In: Rogers JE, Whitman WB (eds)

Bacterial production and consumption of greenhouse gases: methane, nitrogen oxides, and

halomethanes. American Society for Microbiology, Washington DC, pp 3–55

Jungk A (2001) Root hair and acquisition of plant nutrients from soils. J Plant Nutr Soil Sci

164:121–129

Kahiluoto H, Ketoja E, Vestberg M, Saarela I (2001) Promotion of AM utilization through reduced

P fertilization. Plant Soil 231:65–79

Karagiannidis N, Bletsos F, Stavropoulos N (2002) Effect of Verticillium wilt ( Verticillium dahliae

Kleb.) and mycorrhiza ( Glomus mosseae ) on root colonization, growth and nutrient uptake in

tomato and eggplant seedlings. Sci Hortic 94:145–156

Kavino M, Harish S, Kumar N, Saravanakumar D, Damodaran T, Soorianathasundaram K,

Samiyappan R (2007) Rhizosphere and endophytic bacteria for induction of systemic resis-

tance of banana plantlets against bunchy top virus. Soil Biol Biochem 39:1087–1098

Kavino M, Harish S, Kumar N, Saravanakumar D, Samiyappan R (2008) Induction of systemic

resistance in banana ( Musa spp.) against banana bunchy top virus (BBTV) by combining chitin

with root-colonizing Pseudomonas ﬂ uorescens strain CHA0. Eur J Plant Pathol 120:353–362

Kavino M, Harish S, Kumar N, Saravanakumar D, Samiyappan R (2010) Effect of chitinolytic

PGPR on growth, yield and physiological attributes of banana ( Musa spp.) under ﬁ eld condi-

tions. Appl Soil Ecol 45:71–77

Khaliq A, Abbasi MK, Hussain T (2006) Effects of integrated use of organic and inorganic nutrient

sources with effective microorganisms (EM) on seed cotton yield in Pakistan. Bioresour

Technol 97(8):967–972

Khan AG (2005) Role of soil microbes in the rhizospheres of plants growing on trace metal con-

taminated soils in phytoremediation. J Trace Elem Med Biol 18(4):355–364

Khan MS, Zaidi A, Wani PA (2006) Role of phosphate solubilizing microorganisms in sustainable

agriculture-a review. In: Lichtfouse E, Navarrete M, Debaeke P, Veronique S, Alberola C (eds)

Sustainable agriculture, vol 5. Springer, Netherlands, pp 551–570

Kohler J, Caravaca F, Carrasco L, Roldan A (2006) Contribution of Pseudomonas mendocina and

Glomus intraradices to aggregates stabilization and promotion of biological properties in

rhizosphere soil of lettuce plants under ﬁ eld conditions. Soil Use Manag 22:298–304

Kohler J, Hernandez JA, Caravaca F, Roldan A (2009) Induction of antioxidant enzymes is involved

in the greater effectiveness of a PGPR versus AM fungi with respect to increasing the tolerance

of lettuce to severe salt stress. Environ Exp Bot 65:245–252

Koide RT, Goff MD, Dickie IA (2000) Component growth ef ﬁ ciencies of mycorrhizal and nonmy-

corrhizal plants. New Phytol 148:163–168

Kumar A, Prakash A, Johri BN (2011) Bacillus as PGPR in crop ecosystem. In: Maheshwari DK

(ed) Bacteria in agrobiology: crop ecosystems. Springer, Heidelberg. ISBN 3642183565,

9783642183560

Kusaka T, Suetomi K, Iwasa T, Harada S (1979) TF-138: a new fungicide. In: Proceedings of the

1979 British crop protection conference – pests and diseases, BCPC, Farnham, Surrey, 1979,

pp 589–595

Laird M, Lacey LA, Davidson EW (eds) (1990) Safety of microbial insecticides. CRC Press, Boca

Raton

Lankas G, Gordon LR (1989) Toxicology. In: Campbell WC (ed) Ivermectin and abamectin.

Springer, New York, pp 89–112

Latge JP, Paris S (1991) The fungal spore reservoir of allergens. In: Cole GT, Hoch, HC (eds) The

fungal spore and disease Initiation in plants and animals. Plenum Press, New York, pp 379–401

284

S. Kaur et al.

Lee EY, Jun YS, Cho KS, Ryu HW (2002) Degradation characteristics of toluene, benzene, ethyl-

benzene, and xylene by Stenotrophomonas maltophilia T3-c. J Air Waste Manage Assoc

52:400–406

Lindow S (1983) Methods of preventing frost injury caused by epiphytic ice nucleation active

bacteria. Plant Dis 67:327–333

Lugtenberg BJJ, Dekkers L, Bloemberg GV (2001) Molecular determinants of rhizosphere coloni-

zation by Pseudomonas . Ann Rev Phytopathol 39:461–490

Lumsden RD, Walter JF (1995) Development of the biocontrol fungus Gliocladium virens: risk

assessment and approval for horticultural use. In: Hokkanen MT, Lynch JM (eds) Biological

control: bene ﬁ ts and risks. Cambridge University Press, Cambridge, pp 263–269

Lumsden R, Locke JC, Adkins ST, Walter JF, Ridout CJ (1992) Isolation and localization of the

antibiotic gliotoxin produced by Gliocladium virens from alginate prill in soil and soilless

media. Phytopathology 82:230–235

Lydon J, Duke SO (1999) Inhibitors of glutamine synthesis. In: Singh BK (ed) Plant amino acids.

Marcel Dekker, New York, pp 445–464

Lynch JM (1983) Soil biotechnology, microbiological factors in crop productivity. Blackwell

Scienti ﬁ c Publications, Oxford, 191 pp

Lynch JP (2005) Root architecture and nutrient acquisition. In: BassiriRad H (ed) Nutrient acquisi-

tion by plants: an ecological perspective. Springer, Berlin, pp 147–183

Maeder P, Fliessbach A, Dubois D, Gunst L, Fried P, Niggli U (2002) Soil fertility and biodiversity

in organic farming. Science 296(5573):1694–1697

Marschner H (1995) Mineral nutrition of higher plants, 2nd edn. Academic, London

Matsuura K (1983) Characteristics of validamycin A in controlling rhizoctonia diseases. In: Miyamoto

J, Kearney PC (eds) IUPAC pesticide chemistry, vol 2. Pergamon Press, Oxford, p 301

Mayak S, Tirosh T, Glick BR (2004a) Plant growth-promoting bacteria that confer resistance to

water stress in tomato and pepper. Plant Sci 166:525–530

Mayak S, Tirosh T, Glick BR (2004b) Plant growth-promoting bacteria that confer resistance in

tomato and pepper to salt stress. Plant Physiol Biochem 42:565–572

Meyer WE (1968) Pimaricin: the glycosidic form of mycosamine. Chem Commun (Lond) 8:470

Meziane H, Van der Sluis I, Van Loon LC, Höfte M, Bakker PAHM (2005) Determinants of

Pseudomonas putida WCS358 involved in inducing systemic resistance in plants. Mol Plant

Pathol 6:177–185

Naureen ZP, Hafeez AH, Roberts FY, Michael R (2009) Identi ﬁ cation of rice blast disease-suppress-

ing bacterial strains from the rhizosphere of rice grown in Pakistan. Crop Prot 28:1052–1060

Nie L, Shah S, Rashid A, Burd GI, Dixon DG, Glick BR (2002) Phytoremediation of arsenate

contaminated soil by transgenic canola and the plant growth promoting bacterium Enterobacter

cloacae CAL2. Plant Physiol Biochem 40:355–361

Oka Y (2010) Mechanisms of nematode suppression by organic soil amendments: a review. Appl

Soil Ecol 44:101–115

Om Y, Yamaguchi I, Misado T (1984) Inhibition of protein biosynthesis by mildiomycin, an anti-

mildew substance. J Pestic Sci 9:317–323

Ongena M, Jourdan E, Schäfer M, Kech C, Budzikiewicz H, Luxen A, Thonart P (2005) Isolation

of an N-alkylated benzylamine derivative from Pseudomonas putida BTP1 as elicitor of

induced systemic resistance in bean. Mol Plant Microbe Interact 18:562–569

Orth AB, Royse DJ, Tien M (1993) Ubiquity of lignin degrading peroxidases among various wood-

degrading fungi. Appl Environ Microbiol 59:4017–4023

Pandey KD, Shukla PN, Giri DD, Kashyap AK (2005a) Cyanobacteria in alkaline soil and the

effect of cyanobacteria inoculation with pyrite amendments on their reclamation. Biol Fertil

Soils 41:451–457

Pandey P, Kang SC, Maheshwari DK (2005b) Isolation of endophytic plant growth promoting

Burkholderia sp. MSSP from root nodules of Mimosa pudica . Curr Sci 89:170–180

Parida AK, Das AB (2005) Salt tolerance and salinity effects on plants: a review. Ecotoxicol

Environ Saf 60:324–349

Paul D, Nair S (2008) Stress adaptations in a plant growth promoting rhizobacterium (PGPR) with

increasing salinity in the coastal agricultural soils. J Basic Microbiol 48:378–384

285

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

Peacock AD, Mullen MD, Ringelberg DB, Tyler DD, Hedrick DB, Gale PM, White DC (2001)

Soil microbial community responses to dairy manure or ammonium nitrate applications. Soil

Biol Biochem 33:1011–1019

Pennasio S, Roggero P (1992) Effect of cadmium and nickel on ethylene biosynthesis in soybean.

Plant Biol 34(3–4):345–349

Persello CF, Nussaume L, Robaglia C (2003) Tales from the underground: molecular plant–

rhizobacteria interactions. Plant Cell Environ 26:189–199

Raaijmakers JM, Paulitz TC, Steinberg C, Alabouvette C, Loccoz YM (2009) The rhizosphere: a

playground and battle ﬁ eld for soil borne pathogens and bene ﬁ cial microorganisms. Plant Soil

321:341–361

Radjacommare R, Nandakumar R, Kandan A, Suresh S, Bharathi M, Raguchander T, Samiyappan

R (2002) Pseudomonas ﬂ uorescens based bio-formulation for the management of sheath blight

disease and leaf folder insect in rice. Crop Prot 21:671–677

Rajkumar M, Freitas H (2008) In ﬂ uence of metal resistant-plant growth-promoting bacteria on the

growth of Ricinus communis in soil contaminated with heavy metals. Chemosphere 71(5):834–842

Ramachandran K, Srinivasan V, Hamza S, Anandaraj M (2007) Phosphate solubilizing bacteria

isolated from the rhizosphere soil and its growth promotion on black pepper ( Piper nigrum L)

cuttings. Dev Plant Soil Sci 102:324–331

Ray RC, Ward OP, Singh A, Isobe S (2008) Commercialization of microbial biotechnology in hor-

ticulture: summary, outlook of achievements, constraints and prospects. In: Ray RC, Ward OP

(eds) Microbial biotechnology in horticulture, vol 3. Science, New Hampshire, pp 341–365

Richardson AE, Barea JM, McNeill AM, Combaret CP (2009) Acquisition of phosphorus and nitro-

gen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil 321:305–339

Rishbeth J (1975) Stump inoculation: a biological control of Fomes annosus . In: Bruehl GW (ed)

Biology and control of soil-borne plant pathogens. Am. Phytopathol. Soc, St. Paul, pp 158–162

Rivas R, Peix A, Mateos PF, Trujillo ME, Martinez-Molina E, Velazqueze E (2006) Biodiversity of

populations of phosphate solubilizing rhizobia that nodulates chickpea in different spanish

soils. Plant Soil 287(Suppl 1–2):23–33

Roberts RG (1990) Biological control of mucor rot of pear by Cryptococcus laurentii , C. ﬂ avus ,

and C. albidius . Phytopathology 80:526–530

Rodríguez H, Fraga R (1999) Phosphate solubilizing bacteria and their role in plant growth promo-

tion. Biotechnol Adv 17:319–339

Rogoff MH (1982) Regulatory safety data requirements for registration of microbial pesticides. In:

Kurstak E (ed) Microbial and viral pesticides. Marcel-Dekker, New York, pp 645–679

Ryan MH, Angus JF (2003) Arbuscular mycorrhizae in wheat and ﬁ eld pea crops on a low P soil,

increased Zn-uptake but no increase in Puptake or yield. Plant Soil 250:225–239

Ryan MH, Norton RM, Kirkegaard JA, McCormick KM, Knights SE, Angus JF (2002) Increasing

mycorrhizal colonisation does not improve growth and nutrition of wheat on vertosols in south-

eastern Australia. Aust J Agric Res 53:1173–1181

Safronova VI, Stepanok VV, Engqvist GL, Alekseyev YV, Belimov AA (2006) Root-associated bac-

teria containing 1-minocyclopropane-1-carboxylate deaminase improve growth and nutrient

uptake by pea genotypes cultivated in cadmium supplemented soil. Biol Fertil Soils 42:267–272

Saharan BS, Nehra V (2011) Plant growth promoting rhizobacteria: a critical review. Life Sci Med

Res 2011:LSMR-21.

http://astonjournals.com/lsmr

Sainz MJ, Taboada-Castro MT, Vilarino A (1998) Growth, mineral nutrition and mycorrhizal colo-

nization of red clover and cucumber plants grown in a soil amended with composted urban

wastes. Plant Soil 205:85–92

Saleem M, Arshad M, Hussain S, Bhatti AS (2007) Perspective of plant growth promoting

rhizobacteria (PGPR) containing ACC deaminase in stress agriculture. J Ind Microbiol

Biotechnol 34:635–648

Sandhya V, Ali SZ, Grover M, Kishore N, Venkateswarlu B (2009) Pseudomonas sp . strain P45

protects sun ﬂ owers seedlings from drought stress through improved soil structure. J Oilseed

Res 26:600–601

Saravanakumar D, Samiyappan R (2007) ACC deaminase from Pseudomonas ﬂ uorescens mediated

saline resistance in groundnut ( Arachis hypogea ) plants. J Appl Microbiol 102:1283–1292

286

S. Kaur et al.

Saravanakumar D, Lavanya N, Muthumeena K, Raguchander T, Samiyappan R (2009) Fluorescent

pseudomonad mixtures mediate disease resistance in rice plants against sheath rot ( Sarocladium

oryzae ) disease. Biocontrol 54:273–286

Saunders DG, Bret BL (1997) Fate of spinosad in the environment. Down Earth 52:21–28

Schnider-Keel U, Lejbø lle KB, Bachler E, Haas D, Keel C (2001) The sigma factor Algu (Algt) con-

trols exopolysaccharides production and tolerance towards desiccation and osmotic stress in the

biocontrol agent, Pseudomonas ﬂ uorescens CHAO. Appl Environ Microbiol 67(2):5683–5693

Selvakumar G, Joshi P, Mishra PK, Bisht JP, Gupta HS (2009) Mountain aspects in ﬂ uence the

genetic clustering of psychrotolerant phosphate solubilizing Pseudomonads in the Uttarkhand

Himalayas. Curr Microbiol 59:432–438

Sergeeva E, Shah S, Glick BR (2006) Growth of transgenic canola ( Brassica napus cv, Westar)

expressing a bacterial 1-aminocyclopropane-1-carboxylate (ACC) deaminase gene on high

concentrations of salt. World J Microbiol Biotechnol 22:277–282

Seshadri S, Ignacimuthu S, Vadivelu M, Lakshminarasimhan C (2007) Inorganic phosphate solu-

bilization by two insect pathogenic Bacillus sp. Dev Plant Soil Sci 102:351–355

Shaharoona B, Arshad M, Zahir ZA (2006) Performance of Pseudomonas spp . containing ACC-

deaminase for improving growth and yield of maize ( Zea mays L.) in the presence of nitroge-

nous fertilizer. Soil Biol Biochem 38:2971–2975

Shannon D, Sen AM, Johnson DB (2002) A comparative study of the microbiology of soils man-

aged under organic and conventional regimes. Soil Use Manag 18:274–283

Shigemoto R, Okuno T, Matsuura K (1989) Effect of validamycin A on the activity of trehalase of

Rhizoctonia solani and several sclerotial fungi. Ann Phytopathol Soc Jpn 55:238

Sidhu GS (1998) Role of microorganisms in soil fertility. Utra Gro Plant Food Company. 1–10 pp 1–6

Siegel MR, Latch GCM, Johnson MC (1987) Fungal endophytes of grasses. Annu Rev Phytopathol

25:293–315

Simberloff D, Stiling P (1996) How risky is biocontrol. Ecology 77:1965–1974

Singh A, Parmar N, Kuhad RC (2011a) Bioaugmentation, biostimulation and biocontrol. In: Singh

A, Parmar N, Kuhad RC, Ward OP (eds) Soil biology, vol 28. Springer, Heidelberg. ISBN

364219768X, 9783642197680

Singh JS, Pandey VC, Singh DP (2011b) Ef ﬁ cient soil microorganisms: a new dimension for sus-

tainable agriculture and environmental development. Agric Ecosyst Environ 140:339–353

Spores of AIMs might develop in patients with weak or suppressed immunity resulting in allergic

reactions are the non targeted effects (Latge and Paris 1991)

Sprent JL (1979) The biology of nitrogen- ﬁ xing organisms. McGraw-Hill, London, 196 pp

Stiens M, Schneiker S, Keller M, Kuhn S, Puhler A, Schluter A (2006) Sequence analysis of the

144-kilobase accessory plasmid psmesm11a, isolated from a dominant Sinorhizobium meliloti strain

identi ﬁ ed during a long-term Weld release experiment. Appl Environ Microbiol 72:3662–3672

Stockdale EA, Shepherd MA, Fortune S, Cuttle SP (2002) Soil fertility in organic farming systems –

fundamentally different? Soil Use Manag 18:301–308

Sullivan P (2001) Sustainable management of soil-born plant diseases. ATTRA, USDA’s Rural

Business Cooperative Service.

www.attar.org . Accessed 12 June 2012

Suzuki S, Isono K, Nagatsu J, Mizutani T, Kawashima Y, Mizuno T (1965) A new antibiotic, polyoxin

A. J Antibiot Ser A 20:109

Tam PCF (1995) Heavy metal tolerance by ectomycorrhyzal fungi and metal amelioration by

Pisolithus tinctorium . Mycorrhiza 5:181–187

Tanaka N, Yamaguchi H, Umezawa H (1966) Mechanism of kasugamycin action on polypeptide

synthesis. J Biochem 60:429–434

Tanwar SPS, Sharma GL, Chahar MS (2002) Effect of phosphorus and biofertilizers on the growth

and productivity of black gram. Annl Agric Res 23:491–493

Teng PS, Yang XB (1993) Biological impact and risk assessment in plant pathology. Annu Rev

Phytopathol 31:495–521

Thompson JP (1994) Inoculation with vesicular-arbuscular mycorrhizal fungi from cropped soil

overcomes long-fallow disorder of linseed ( Linum usitatissimum L.) by improving P and Zn

uptake. Soil Biol Biochem 26:1133–1143

287

10 Potential Eco-friendly Soil Microorganisms: Road Towards Green…

Thompson GD, Dutton R, Sparks TC (2000) Spinosad – a case study: an example from a natural

products discovery programme. Pest Manag Sci 56:696–702

Tiedje JM, Sextone AJ, Parkin TB, Revsbech NP, Shelton DR (1984) Anaerobic processes in soil.

Plant Soil 76:197–212

Tilak KVBR, Ranganayaki N, Pal KK, De R, Saxena AK, Nautiyal CS, Mittal S, Tripathi AK,

Johri BN (2005) Diversity of plant growth and soil health supporting bacteria. Curr Sci

89(1):136–150

Tinker PB, Nye PH (2000) Solute movement in the rhizosphere. Oxford University Press, New York

Topp E, Hansen RS (1991) Metabolism of radiatively important trace gases by methane-oxidizing

bacteria. In: Rogers JE, Whitman WB (eds) Microbial production and consumption of green-

house gases: methane, nitrogen oxides, and halomethanes. American Society for Microbiology,

Washington, D.C., pp 71–90

Tripathi AK, Nagarajan T, Verma SC, Le Rudulier D (2002) Inhibition of biosynthesis and activity of

nitrogenase in Azospirillum brasilense Sp7 under salinity stress. Curr Microbiol 44(5):363–367

Turan M, Ataoglu N, Sahin F (2006) Evaluation of the capacity of phosphate solubilising bacteria

and fungi on different forms of phosphorus in liquid culture. Sustain Agric 28:99–108

Turan K, Levent K, Muhittin S, Songul K (2008) Bacterial biodegradation of aldicarb and determi-

nation of bacterium which has the most biodegradative effect. Turk J Biochem 33:209–214

Turco RF, Bezdicek DF (1987) Diversity within two serogroups of Rhizobium leguminosarum

native to soils in the Palouse of eastern Washington. Ann Appl Biol 111:103–114

Uchiumi T, Oowada T, Itakura M, Mitsui H, Nukui N, Dawadi P, Kaneko T et al (2004) Expression

islands clustered on symbiosis island of Mesorhizobium loti genome. J Bacteriol 186:2439–2448

Upadhyay SK, Singh DP, Saikia R (2009) Genetic diversity of plant growth promoting rhizobacteria

from rhizospheric soil of wheat under saline conditions. Curr Microbiol 59(5):489–496

Van Loon LC (2007) Plant responses to plant growth-promoting rhizobacteria. Eur J Plant Pathol

119:243–254

Venkateswarlu B, Desai S, Prasad YG (2008) Agriculturally important microorganisms for stressed

ecosystems: challenges in technology development and application. In: Khachatourians GG,

Arora DK, Rajendran TP, Srivastava AK (eds) Agriculturally important microorganisms, vol 1.

Academic World, Bhopal, pp 225–246

Vessey JK (2003) Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:571–586

Wapshere AJ (1974) A strategy for evaluating the safety of organisms for biological weed control.

Ann Appl Biol 77:210–211

Ward DWM, Chung YJ, Copeland LB, Doer ﬂ er LD (2011) Allergic responses induced by a fungal

biopesticide M etarhizium anisopliae and house dust mite are compared in a mouse model. J

Toxicol 2011:360805, 13 pages

Wei Z-M, Laby RJ, Zumoff CH, Bauer DW, He SY, Collmer A et al (1992) Harpin, elicitor of the hyper-

sensitive response produced by the plant pathogen Erwinia amylovora . Sci (Wash) 257:85–88

Weidemann GJ, Tebeest DO (1990) Biology of host range testing for biocontrol of weeds. Weed

Technol 4:465–470

Wells AT, Chan KY, Cornish PS (2000) Comparison of conventional and alternative vegetable farming

systems on the properties of a yellow earth in New South Wales. Agric Ecosyst Environ 80:47–60

Westwood GS, Huang SW, Keyhani NO (2005) Allergens of the entomopathogenic fungus

Beauveria bassiana . Clin Mol Allergy 3:1

Wisniewski M, Biles C, Droby S, McLaughlin R, Wilson C, Chalutz E (1991) Mode of action of

the postharvest biocontrol yeast. Pichia guilliermondii . I. Characterization of attachment to

Botrytis cinerea . Physiol Mol Plant Pathol 39:245–258

Yazdani M, Bahmanyar MA, Pirdashti H, Esmaili MA (2009) Effect of phosphate solubilization

microorganisms (PSM) and plant growth promoting rhizobacteria (PGPR) on yield and yield

components of corn ( Zea mays L.). World Acad Sci Eng Technol 49:90–92

Zahir A, Arshad ZM, Frankenberger WF (2004) Plant growth promoting rhizobacteria. Adv Agron

81:97–168

Zaidi A, Mohammad S (2006) Co-inoculation effects of phosphate solubilising microorganisms

and Glomus fasciculatum on green gram bradyrhizobium symbiosis. Agric Sci 30:223–230

289

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_11, © Springer Science+Business Media Dordrecht 2013

Abstract Global industrialization has resulted in a widespread contamination of the

environment with persistent addition of organic and inorganic wastes. The contami-

nants enter the environment either by natural processes or through human activity.

The natural contamination originates from excessive withering of minerals from

rocks or displacement from the groundwater or subsurface layers of the soil. Disposal

of industrial ef ﬂ uents, sewage sludge, deposition of air-borne industrial wastes, mili-

tary operations, mining, land- ﬁ ll operations, industrial solid-waste disposal and the

growing use of agricultural chemicals such as pesticides, herbicides and fertilizers

are sources of human-assisted contamination of the environment. Heavy metals exert

some important roles in some biochemical reactions, being essential to the growth

and development of microorganisms, plant and animals. However, in high concentra-

tions they can form unspeci ﬁ c compounds, creating cytotoxic effects. They exhibit a

range of toxicities towards microorganisms, depending on physico-chemical factors,

speciation etc., while toxic effects can arise from natural processes in the soil,

and on microbial communities are more commonly associated with anthropogenic

contamination or redistribution of toxic metals in terrestrial ecosystems. A variety of

mechanisms have been implicated in the adaptation, tolerance, and resistance

of microorganisms to a metal pollutant: precipitation of metals as phosphates,

carbonates, and/or sul ﬁ des, volatilization via methylation or ethylation, physical

exclusion of electronegative components in membranes and extracellular polymeric

substances (EPS), energy-dependent metal ef ﬂ ux systems, and intracellular seques-

tration with low molecular weight, cysteine-rich proteins. The ef ﬁ ciency of these

mechanisms depends on many parameters, among which the metal itself, the species

studied, time, temperature, pH, presence of plant communities near the microfauna,

interactions of the metal with other compounds. Most microorganisms are known

F. Masood (*) • A. Malik

Department of Agricultural Microbiology, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh 202002 , India

e-mail: farhanamasud4@gmail.com ; ab_malik30@yahoo.com

Chapter 11

Current Aspects of Metal Resistant Bacteria

in Bioremediation: From Genes to Ecosystem

Farhana Masood and Abdul Malik

290

F. Masood and A. Malik

to have speci ﬁ c genes for resistance to toxic ions of heavy metals. This chapter

summarizes the recent progress in the ﬁ eld of molecular microbial ecology of metal

resistant bacteria with emphasis that how the genetic capacity of the organisms can

be exploited for the remediation of heavy metal pollution. Genetic improvement may

help to develop the ﬁ eld of existing methodologies to decontamination processes are

also discussed in the chapter.

Keywords Bioremediation • Genetic engineering • Heavy metals • Metal resistance

• Ecosystem

1 Introduction

Heavy metal pollution is one of the most important environmental problems today.

Various industries produce and discharge wastes containing different heavy metals

into the environment. Mining, electroplating, metal processing, textile, battery man-

ufacturing, tanneries, petroleum re ﬁ ning, paint manufacture, pesticides, pigment

manufacture, printing and photographic industries are the main sources of heavy

metals (Williams et al. 1998 ; Kadirvelu et al. 2001 ; Lesmana et al. 2009 ) . Thus,

metal as a kind of resource is becoming shortage and also brings about serious envi-

ronmental pollution, threatening human health and ecosystem. Three kinds of heavy

metals are of concern, including toxic metals (such as Hg, Cr, Pb, Zn, Cu, Ni, Cd,

As, Co, Sn, etc.), precious metals (such as Pd, Pt, Ag, Au, Ru etc.) and radionuclides

(such as U, Th, Ra, Am, etc.) (Wang and Chen 2006 ) . Unlike organic wastes, heavy

metals are non-biodegradable and they can be accumulated in living tissues, causing

various diseases and disorders; therefore they must be removed before discharge

(Ansari et al. 2011 ) . Heavy metal toxicity can result in damage or reduced mental

and central nervous function, lower energy levels and damage to blood composition,

lungs, kidneys, liver and other vital organs (Lesmana et al. 2009 ) .

Rapid industrialization and accelerating global development over the past two cen-

turies have greatly increased the rate at which trace metals are released into the global

environment and as a result many of the fresh water bodies are becoming greatly

altered. Heavy metals in aquatic system can be naturally produced by the slow

leaching from soil/rock to water, which are usually at low levels, causing no serious

deleterious effects on human health (Kadirvelu et al. 2001 ) . The development of

industry and agriculture promotes the rapid increase of environmental metal pollution.

Aquatic heavy metal pollution usually represents high levels of Hg, Cr, Pb, Cd, Cu,

Zn, Ni etc. in water system

(Tunali et al. 2006 ) . The wastewater mainly originates

from mining, mill run, metallurgy, plating, chemical plant, curry and paper making

industry. Some of the metallic compounds may adsorbed on the suspended particles

and sediments however, under favourable conditions i.e. pH and Eh values they are

again released into the water. Some heavy metals including Hg, Cr, Cd, Ni, Cu, Pb

etc. introduced into environmental water system may pose high toxicities on the

aquatic organisms (Ahmaruzzaman 2011 ) .

291

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

Soil is a major sink for heavy metals released into the environment. Many soils

in industrialized countries are affected by acid deposition, mine waste and organic

refuses, such as sewage sludge that introduce pollutants to the soil (Moral et al.

2005 ; Akinola et al. 2011 ) . According to Moral et al. ( 2005 ) , the level of pollution

of soils by heavy metals depends on the retention capacity of soil, especially on

physico-chemical properties (mineralogy, grain size, organic matter) affecting soil

particle surfaces and also on the chemical properties of the metal. These metals may

be retained by soil components in the near surface soil horizons or may precipitate

or co-precipitate as sulphides, carbonates, oxides or hydroxides with Fe, Mn, Ca

etc. (van Hullebusch et al.

2005 ) . The mobility of trace metals re ﬂ ects their capacity

to pass from one soil compartment to another where the element is bound less ener-

getically, the ultimate compartment being soil solution, which determines the bio-

availability. The distribution of metals among various compartments or chemical

forms can be measured by sequential extraction procedures. Knowledge of how

contaminants are partitioned among various chemical forms allows a better insight

into degradation of soil and water quality following the input of metals around min-

ing and metallurgical plants. Therefore, soil pollution by heavy metals occurring

both on surface and in deeper layers of soil is of great concern for environmental

quality control. The pattern of pollutant content is the synergistic result of mixed

processes, including diffusion of deposited air-borne particulate matter, ﬂ uvial

deposition of contaminated sediments and irregular leaching of soil layers, assisted

by rainwater, even down to groundwater (Frentiu et al. 2009 ) . The impact of heavy

metals resulting from mining and ore roasting on soil is attenuated by several

processes such as adsorption, precipitation and complex formation with soil

compounds. Soil pollution with heavy metals is multidimensional. Upon entering

the soil in large amounts, heavy metals primarily affect biological characteristics:

the total content of microorganism changes, their species diversity reduced, and the

intensity of basic microbiological processes and the activity of soil enzymes

decreases. In addition, heavy metals also change humus content, structure, and pH

of soils. These processes ultimately lead to the partial or, in some cases complete

loss of soil fertility. Any increase in contamination emission adversely affect crop

productivity (Zhu et al. 2011 ) .

2 Impacts of Heavy Metals

Metals play an integral role in the life processes of organisms. Some metals, such

as, cobalt, chromium, copper, iron, potassium, magnesium, manganese, sodium,

nickel and zinc, are essential, serve as micronutrients used for- (i) redox-processes

(ii) to stabilize molecules through electrostatic interactions (iii) acting as components

of various enzymes and (iv) regulation of osmotic pressure (Bruins et al. 2000 ) .

Other metals, like, silver, cadmium, gold, lead and mercury, have no biological

function, and are nonessential and potentially toxic to organisms. Nonessential

292

F. Masood and A. Malik

metals may displace essential metals from their native binding sites or interact with

ligands leading to their toxicity (Nies 1999 ; Bruins et al. 2000 ) . For example, Hg

and Ag

can bind to SH groups of proteins, and thus inhibit the activity of

enzymes (Nies

1999 ) . Moreover, both essential and nonessential metals can damage

(i) cell membranes (ii) alter enzyme speci ﬁ city (iii) disrupt cellular functions and

(iv) damage the structure of DNA at high concentration (Bruins et al.

2000 ) . To be

toxic most metal ions have to enter into the cell. Many divalent metal cations

(e.g. Mn

, Fe

, Co

, Ni

, Cu

and Zn

) resemble structurally. Also, the structure

of oxy-anions such as chromate resembles that of sulfate, and the same is true for

arsenate and phosphate. Thus, to be able to differentiate between structurally very

similar metal ions, the organism’s uptake systems have to be tightly regulated.

3 Metal Resistance Mechanisms in Bacteria

The major problem of heavy metal concentration is ion imbalance. Microorganisms

have evolved mechanisms to solve this problem by using two types of uptake systems

for metal ions. One is fast, unspeci ﬁ c, and driven by the chemiosmotic gradient

across the cytoplasmic membrane of bacteria. Since this mechanism is used by a

variety of substrates, it is constitutively expressed (Nies 1999 ) . The second type of

uptake system has high substrate speci ﬁ city. It is slower, often uses ATP hydrolysis

as the energy source and is only produced by the cell in times of need, starvation or

a special metabolic situation (Nies and Silver 1995 ) . Even though microorganisms

have speci ﬁ c uptake systems, high concentrations of nonessential metals may be

transported across the cell by a constitutively expressed unspeci ﬁ c system.

Because metal ions cannot be degraded or modi ﬁ ed like toxic organic compounds,

there are six possible mechanisms for a metal resistance system- (i) metal exclusion

by permeability barriers (ii) active transport of the metal away from the cell organism

(iii) intracellular sequestration of the metal by protein binding (iv) extracellular

sequestration (v) enzymatic detoxi ﬁ cation of the metal to a less toxic form and (vi)

reduction in the sensitivity of cellular targets to metal ions (Nies and Silver 1995 ;

Bruins et al. 2000 ; Agrawal et al. 2011 ) . The detoxi ﬁ cation mechanisms may be

directed against one metal or a group of chemically related metals. Furthermore, the

detoxi ﬁ cation mechanisms may vary depending on the type of microorganism (Nies

and Silver 1995 ; Agrawal et al. 2011 ) . Most microorganisms are known to have

speci ﬁ c genes for resistance to toxic ions of heavy metals. Mostly, the resistance

genes are found on plasmids or on chromosomes (Nies

1999 ; Spain and Alm 2003 ) .

There are differences between chromosomal and plasmid-based metal resistance

systems. Essential metal resistance systems are usually chromosome-based and

more complex than plasmid systems. Plasmid-encoded systems, on the other hand,

are usually toxic-ion ef ﬂ ux mechanism. Plasmid-encoded metal resistance determinants

have been reported to be inducible (Silver et al. 1981 ; Rosen 2002 ; Poole 2005 ) .

Bacterial plasmids have resistance genes to many toxic metals and metalloids,

e.g. Ag

, AsO

−2

, AsO

−4

, Cd

, Co

, CrO

−4

, Cu

, Hg

, Ni

, Sb

, TeO

−3

, T

and

293

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

. Related systems are also frequently located on bacterial chromosomes, e.g.

resistance in Bacillus , Cd

ef ﬂ ux in Bacillus , arsenic ef ﬂ ux in E. coli (Silver

and Phung 1996 ) . Generalizations regarding bacterial metal resistance may include

that (1) plasmid-determined resistances are highly speci ﬁ c, (2) resistance systems

have been found on plasmids in all bacterial groups tested and (3) resistance mecha-

nisms generally involve ef ﬂ ux from the cells or enzymatic detoxi ﬁ cation (Silver and

Phung

1996 ; Nies 1999, 2003 ) . However, other less-speci ﬁ c interactions, e.g. sorp-

tion, may contribute to the overall response. Ef ﬂ ux pumps, determined by plasmid

and chromosomal systems, are either ATPases or chemiosmotic systems, with

mechanisms often showing similarity in different types of bacteria. Cd

resistance

may involve (1) an ef ﬂ ux ATPase in Gram-positive bacteria, (2) cation-H

antiport

in Gram-negative bacteria, and (3) intracellular metallothionein in cyanobacteria

(Silver and Phung 1996, 2005 ) . Arsenic-resistant Gram-negative bacteria have an

arsenite ef ﬂ ux ATPase and an arsenate reductase ( which reduces arsenate [As(V)] to

arsenite [As(III)] which comprise the underlying biochemical mechanism) (Oremland

et al. 2002 ; Macur et al. 2004 ) . Similar systems for Hg

resistance occur on plasmids

from Gram-positive and Gram- negative bacteria with component genes being

involved in transport of Hg

to the detoxifying enzyme, mercuric reductase, which

reduces Hg

to elemental Hg

(Silver and Phung 1996 ; Kannan and Krishnamoorthy

2006 ) . The enzyme organomercurial lyase can break the C-Hg bond in organomer-

curials ( Schottel et al. 1974 ). It appears that contaminating mercury selects for

higher frequencies of Hg

-resistant bacteria in polluted habitats (Silver and Phung

1996 ; Barkay et al. 2003 ) . Plasmid-determined chromate resistance appears uncon-

nected with chromate [Cr(Vl)] reduction to Cr(III) (Ohtake et al. 1987 ; Cervantes

et al. 2001 ; Cervantes and Campos-Garcia 2007 ) , resistance depending on reduced

CrO

−4

uptake (Cervantes and Campos-Garcia 2007 ) . A Cd

ef ﬂ ux ATPase is widely

found in Gram-positive bacteria including soil Bacillus spp. (Nies 2003 ) . The large

plasmids of Alcaligenes eutrophus have numerous toxic metal resistance determi-

nants, e.g. three for Hg

, one for Cr

, and two for divalent cations, czc (Cd

, Zn

and Co

resistance) and cnr (Co

and Ni

resistance; Silver and Phung 1996 ;

Rensing et al. 2002 ; Mergeay et al. 2003 ). Czc functions as a chemiosmotic divalent

cation/H

antiporter (Nies and Silver 1995 ) . In Enterococcus hirae (previously

Streptococcus faecalis ), copper resistance is determined by two genes, copA and

copB which respectively determine uptake and ef ﬂ ux P-type ATPases (Solioz and

Stoyanov 2003 ) . Plasmid-determined Cu

resistance has been described in

Pseudomonas (Cooksey 1994 ; Unaldi et al. 2003 ) , Xanthomonas (Lee et al. 1994 ;

Voloudakis et al. 2005 ) and Escherichia coli (Lee et al. 2002 ) . Chromosomal genes

also affect Cu

transport and resistance by determining functions such as uptake,

ef ﬂ ux and intracellular Cu

binding (Gadd 2005 ) .

It is clear that a more lucid understanding of the mechanisms of metal toxicity on

living cells may lead to the development of novel technologies to mitigate such toxicity.

To this end, microorganisms are useful models for the study of various aspects of oxida-

tive stress at the biochemical, molecular, and cellular levels. This is because the

natural stress factors, as well as the damage caused by oxidative stress to nucleic acids,

proteins, lipids, and other cell components, are very similar in all types of organisms.

294

F. Masood and A. Malik

This is also true because at all levels of cell organization, the principles of cellular

defense against oxidative stress are similar, for example, the nature and role of antioxi-

dants and antioxidative enzymes that act to decrease ROS concentrations, the repair

of damaged macromolecules, and the elimination of irreparable proteins (Poljsak

et al.

2010 ) . Many microorganisms have also evolved other complex mechanisms to

counteract the toxic effects of metals (Silver and Phung 1996 ) . Thus bacteria, yeasts,

algae, and fungi have been located in and isolated from sites contaminated with heavy

metals, and are now under study as possible bioremediators of environmental con-

tamination (Machado et al. 2008 ; Ray and Ray 2009 ; Ruta et al. 2010 ) . Despite

apparent toxicity, many microbes grow and even ﬂ ourish in apparently metal-polluted

locations, and a variety of mechanisms, both active and incidental, contribute to

resistance (Avery 2001 ; Holden and Adams 2003 ; Fomina et al. 2007 ; Ansari and

Malik 2007 ; Masood and Malik 2011 ) . Microbial resistance to toxic metals is wide-

spread, with frequencies ranging from a few per cent in pristine environments

to nearly 100% in heavily polluted environments (Silver and Phung 2009 ) .

4 Conventional Technologies for Treating

Environments Contaminated by Heavy Metals

The removal of metals from the environment is extremely important. Methods for

removing metal ions from aqueous solution mainly consist of physical, chemical and

biological technologies. Conventional methods for removing metal ions from aqueous

solution have been suggested, such as chemical precipitation, ﬁ ltration, ion exchange,

electrochemical treatment, membrane technologies, adsorption on activated carbon,

evaporation etc. However, chemical precipitation and electrochemical treatment are

ineffective, especially when metal ion concentration in aqueous solution is among

1–100 mg/L, and also produce large quantity of sludge required to treat with great

dif ﬁ culty. Ion exchange, membrane technologies and activated carbon adsorption

process are extremely expensive when treating large amount of water and wastewater

containing heavy metal in low concentration, they cannot be used at large scale. On the

other hand, bioremediation is increasingly gaining importance as an alternative technol-

ogy, due to the advantages it offers: simplicity, ef ﬁ ciency and low cost (Goyal et al.

2003 ; Tabak et al. 2005 ; Hameed 2006 ; Machado et al. 2008 ; Wang and Chen 2009 ) .

5 Bioremediation

Bioremediation is often considered a cost effective and environmental friendly

method and is gradually making inroads for environmental clean-up applications,

which rely on immobilization or mobilization of the toxic metals. A combination of

these approaches is often used by industry to treat metal-contaminated sites;

combining approaches can be more cost-effective than using just one. The ability of

295

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

a microorganism to survive and grow in a metal-contaminated habitat can depend

on genetic and/or physiological adaptation. Such physiological changes in the

microbial cells reduce the rate of metal uptake and intracellular metal toxicity, while

genetic changes result in the reduced intracellular and extracellular concentrations

of the toxic metal species. However, these natural transformations are limited by the

relative slow rates. Development of new genetic tools and a better understanding of

microorganism’s natural transformation ability at the genetic level are essential to

accelerate the progress of designer microbes for improved hazardous waste removal.

Several attempts have been made recently to enhance biotransformation and bioac-

cumulation of toxic wastes by microorganisms. In the last three decades extensive

research has been performed on basic and applied aspects of microbial interaction

with metals with a bioremediation perspective. These studies include mainly isola-

tion of superior metal resistant and/or accumulating or metal transforming microor-

ganisms, their identi ﬁ cation, biochemical and genetic characterization, elucidation

of microbe-metal interaction mechanisms and all related studies relevant for

bioremediation.

5.1 Microbial Transformations of Metals

5.1.1 Mobilization

Microorganisms can mobilize metals through autotrophic and heterotrophic leach-

ing, chelation by microbial metabolites and siderophores, and methylation, which

can result in volatilization. All these processes result in metal compounds and miner-

als (oxides, phosphates, sulphides and more complex mineral ores) dissolution, and

desorption of metal species from exchange sites on, e.g. clay minerals or organic

matter. Microorganisms can acidify their environment by proton ef ﬂ ux via plasma

membrane H

-ATPases, maintenance of charge balance or as a result of respiratory

carbon dioxide accumulation. Acidi ﬁ cation can lead to metal release via a number of

obvious routes, e.g. competition between protons and the metal in a metal–anion

complex or in a sorbed form, resulting in the release of free metal cations. Organic

acids can supply both protons and metal complexing anions (Gadd 1999 ; Gadd and

Sayer 2000 ; Huang et al. 2004 ; Lian et al. 2008a, b ) . For example, citrate and oxalate

can form stable complexes with a large number of metals. Many metal citrates are

highly mobile and not readily degraded (Francis et al. 1992 ). Oxalic acid can also act

as a leaching agent for those metals that form soluble oxalate complexes, including

Al and Fe (Strasser et al. 1994 ) . Organic acid production is also an important agent

of mineral deterioration, playing a role in both biogenic chemical weathering and

soil formation (Gadd 1999 ) . Such solubilisation phenomena can also have conse-

quences for mobilization of metals from toxic metal-containing minerals, e.g. pyro-

morphite (Pb

(PO

)

Cl) which can form in urban and industrially contaminated soils.

Pyromorphite can be solubilized by phosphate-solubilizing fungi, with concomitant

production of lead oxalate (Sayer et al. 1999 ; Fomina et al. 2004, 2005a, b ) . Most

296

F. Masood and A. Malik

chemolithotrophic (autotrophic) leaching is carried out by acidophilic bacteria

which ﬁ x CO

and obtain energy from the oxidation of Fe(II) or reduced sulphur

compounds which causes the solubilisation of metals because of the resulting

production of Fe(III) and H

(Rawlings 1997 ; Schippers and Sand 1999 ) . The

microorganisms involved include sulphur-oxidizing bacteria, e.g. Thiobacillus

thiooxidans , iron and sulphur-oxidizing bacteria, e.g. Thiobacillus ferrooxidans and

iron oxidizing bacteria, e.g. Leptospirillum ferrooxidans (Siddiqui et al.

2009 ) . As a

result of sulphur- and iron-oxidation, metal sulphides are solubilized concomitant

with the pH of their immediate environment being decreased, therefore resulting in

solubilization of other metal compounds including metals sorbed to soil and mineral

constituents (Rawlings 2002 ; Huang 2008 ) .

Functional groups such as hydroxamates and catecholates, siderophores can also

be observed in mobilizing metal complexation (Nair et al. 2007 ) . Although they

serve a speci ﬁ c purpose for the organism in obtaining iron, they are nonspeci ﬁ c for

the range of metals that they can bind. Siderophores have been shown to bind Al,

As, Cd, Co, Cr, Cu, Mn, Ni, Pb, Sn, and Zn, in addition to Fe (Nair et al. 2007 ) .

Siderophore pyridine-2, 6-bis (thiocarboxylic acid) produced by Pseudomonas

stutzeri KC precipitated As, Cd, Hg, and Pb, conferring resistance to the bacterium

(Zawadzka et al. 2007 ) . Similarly, microbially-produced biosurfactants including

rhamnolipid produced by Pseudomonas aeruginosa , surfactin by Bacillus subtilis ,

and sophorolipid from the yeast Torulopsis bombicola have been implicated in

metal resistance (Sandrin et al. 2000 ; Mulligan et al. 2001 ) .

Microorganisms can also mobilize metals, metalloids and organometallic com-

pounds by reduction and oxidation processes ( Lovley 2001 ; Lloyd 2003 . For example,

solubilities of Fe and Mn increase on reduction of Fe(III) to Fe(II) and Mn(IV) to

Mn(II) (Lovley 2001 ; McLean et al. 2002 ). Most iron reduction is carried out by

specialized anaerobic bacteria that use Fe(III) as a terminal electron acceptor.

Dissimilatory metal-reducing bacteria can use a variety of metal(loid)s with an

appropriate redox couple, including Fe(III), Mn(IV), Se(IV), Cr(VI) and U(VI)

(DiChristina et al. 2005 ; Geets et al. 2008 ). While Fe and Mn increase their solubility

upon reduction, the solubility of other metals such as U(VI) to U(IV) and Cr(VI) to

Cr(III) decreases, resulting in immobilization (Geets et al. 2008 ). Reduction of

Hg(II) to Hg(0) by bacteria and fungi results in diffusion of elemental Hg out of

cells (Hobman et al. 2000 ; Barkay and Wagner-Dobler 2005 ) . Bacillus and

Streptomyces spp. can oxidize Hg(0) to Hg(II) and, therefore participate in the oxi-

dative phase of the global Hg cycle (Barkay and Wagner-Dobler 2005 ; Ehrlich and

Newman 2009 ) . Fe(III) and Mn(IV) oxides absorb metals strongly and this may

hinder metal mobilization. Microbial reduction of Fe(III) and Mn(IV) may be one

way for releasing such metals and this process may be enhanced with the addition

of humic materials, or related compounds. Such compounds may also act as elec-

tron shuttles for, e.g. U(VI) and Cr(VI), converting them to less soluble forms,

especially if located in tight pore spaces where microorganisms cannot enter (Lovley

and Coates

1997 ; Lloyd 2003 ) . Ferric iron, Fe(III), can be enzymatically reduced to

ferrous iron, Fe(II), with a suitable electron donor. Many Fe(III) reducers are

heterotrophs and in some anaerobic environments such Fe(III) respiration may be a

297

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

more important mechanism of carbon source decomposition than sulfate reduction

(Ehrlich and Newman 2009 ) . Some Fe(III) reduction can be the result of metabolic

products such as H

S or formate, or other secondary metabolites. Naturally occur-

ring microbially produced metal chelators that may solubilize Fe(III) include

oxalate, citrate, humic acids and tannins.

5.1.2 Immobilization

A number of processes lead to immobilization of metals. Although immobilization

reduces the external free metal species, it may also promote solubilization in some

circumstances by shifting the equilibrium to release more metal into solution.

Biosorption can be de ﬁ ned as the microbial uptake of organic and inorganic metal

species, both soluble and insoluble, by physico-chemical mechanisms such as

adsorption. In living cells, metabolic activity may also in ﬂ uence this process because

of changes in pH, E h , organic and inorganic nutrients and metabolites. Biosorption

can also provide nucleation sites for the formation of stable minerals (McLean et al.

2002 ; Gadd 2005 ; Violante et al. 2010 as in continuation well as sorption to cellular

surfaces, cationic metal species can be accumulated within cells via membrane

transport systems of varying af ﬁ nity and speci ﬁ city (Ansari and Malik 2007 ; Ansari

et al. 2011 ; Masood and Malik 2011 ) . Once inside cells, metal species may be

bound (e.g. to metallothioneins, phytochelatins), precipitated (e.g. as reduced

forms), localized within intracellular structures or organelles (e.g. fungal vacuoles),

or translocated to speci ﬁ c structures (e.g. fungal fruiting bodies) depending on the

element concerned and the organism (Gadd 1996 ; White et al. 1997 ; Gadd and

Sayer 2000 ) . Peptidoglycan carboxyl groups are the main binding site for cations in

Gram-positive bacterial cell walls with phosphate groups contributing signi ﬁ cantly

in Gram-negative species (McLean et al. 2002 ; Wang and Chen 2009 ) . It seems

likely that microbial binding and biomineralization (mineral formation) reactions

have a more signi ﬁ cant role in metal speciation and mobility in the terrestrial envi-

ronment than has previously been supposed (McLean et al. 2002 ; Gadd 2009 ) .

A range of speci ﬁ c and non-speci ﬁ c metal-binding compounds are produced by

microorganisms. Non-speci ﬁ c metal-binding compounds range from simple organic

acids and alcohols to macromolecules such as polysaccharides, humic and fulvic

acids (Gadd 2005 ) . Exopolymers, e.g., exopolysaccharides (EPS), and cell walls

made up of lipopolysaccharides, proteins and carbohydrates with various functional

groups, create sorption sites for metal binding and metal immobilization. The EPS

produced by the bacterium Paenibacillus jamilae complexed up to 230 mg Pb per g

EPS (Morillo et al.

2006 ). Similarly, the EPS from the cyanobacterium Nostoc

spongiaeforme is a highly effective sorbent of zinc ( Singh et al. 2011 ) . Extracellular

polysaccharides can also adsorb or entrap particulate matter such as precipitated

metal sulphides and oxides (Gadd 2005, 2010 ) and these processes may be particu-

larly important in microbial bio ﬁ lms (White and Gadd 1998, 2000 ) . Where microbial

reduction of a metal to a lower redox state occurs, mobility and toxicity may be

reduced (Lovley 2001 ; Finneran et al. 2002 ; Holden and Adams 2003 ; Wall and

298

F. Masood and A. Malik

Krumholz 2006 ) . Such processes may also accompany other indirect reductive

metal precipitation mechanisms, e.g. in sulphate-reducing bacterial systems where

reduction of Cr(VI) can be a result of indirect reduction by Fe

and the produced

sulphide. Aerobic or anaerobic reduction of Cr(VI) to Cr(III) is widespread in

microorganisms (Smith and Gadd

2000 ; McLean and Beveridge 2001 ) . U(VI) can

be reduced to U(IV) by certain Fe(III)-dissimilatory microorganisms and this reduc-

tion in solubility can be the basis of U removal from contaminated waters and

leachates (Lovley

2001 ; Finneran et al. 2002 ; Landa 2005 ; Lloyd and Renshaw

2005 ) . Sulphur and sulphate-reducing bacteria are geochemically important in

reductive precipitation of toxic metals, e.g. U(VI), Cr(VI), Tc(VII), Pd(II) (Lloyd

2003 ; Lloyd and Renshaw 2005 ) . Some sulphate-reducing bacteria like

Desulfotomaculum reducens share physiological properties of both sulphate- and

metal-reducing groups of bacteria, and can use Cr(VI), Mn(IV), Fe(III) and U(IV)

as sole electron acceptors (Haveman and Pedersen 2002 ) . Sulphate-reducing bacte-

ria (SRB) oxidize organic compounds or hydrogen coupled with the reduction of

sulphate, producing sulphide (Muyzer and Stams 2008 ) . The solubility products of

most heavy metal sulphides are very low, so that even a moderate output of sulphide

can remove metals (Gadd 2005 ; Violante et al. 2010 ) . Sulphate-reducing bacteria

can also create extremely reducing conditions which can chemically reduce species

such as U(VI) (Hietala and Roane 2009 ; Du et al. 2011 ) .

Bacterial Fe oxidation is ubiquitous in environments with suf ﬁ cient Fe

and

conditions to support bacterial growth such as drainage waters and tailings piles in

mined areas, pyritic and hydric soils (bogs and sediments), drain pipes and irriga-

tion ditches, and plant rhizospheres. Iron-oxidizers found in acidic soil environ-

ments are acidophilic chemolithotrophs, such as Thiobacillus ferrooxidans ,

signi ﬁ cant for its role in generating acid mine drainage (Johnson 2003 ) . Fungi also

oxidize metals in their environment. Desert varnish is an oxidized metal layer

(patina) a few millimetres thick found on rocks and in soils of arid and semi-arid

regions, and is believed to be of fungal and bacterial origin.

5.2 Metalloid Transformations

Main microbial transformations carried out in the soil are reduction and methylation

which can lead to alterations in bioavailability and toxicity. For selenium, some

bacteria can use SeO

−4

as a terminal e − acceptor in dissimilatory reduction and also

reduce and incorporate Se into organic components, e.g. selenoproteins (assimila-

tory reduction). Methylation and subsequent volatilization of methylated selenium

derivatives is also a widely found property of soil bacteria and fungi and may be an

important process in Se transport from terrestrial to aquatic environments (Dungan

and Frankenberger

1999 ) . Selenate (SeO

−4

) and selenite (SeO

−3

) can be reduced to

, with SeO

−3

reduction appearing more ubiquitous than SeO

−4

reduction.

However, only SeO

−4

can support bacterial growth under anaerobic conditions:

SeO

−4

reduction to Se

is a major sink for Se oxyanions in anoxic sediments (Stolz

299

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

and Oremland 1999 ; Oremland and Stolz 2000 ) . Anaerobic sulphate-reducing bac-

teria like Desulfovibrio desulfuricans can reduce selenate/selenite to Se

, but neither

oxyanion could be used for respiratory growth (Tomei et al. 1995 ). Reduction to Se

can be considered a detoxi ﬁ cation mechanism (Dungan and Frankenberger

1999 ;

Yee and Kobayashi 2008 ) . The opposite process of Se

oxidation can occur in soils

and sediments (Dowdle and Oremland

1998 ; Losi and Frankenberger 1998 ) . It is

possible that Se

oxidation is a similar process to S oxidation, and may be mediated

by heterotrophs and autotrophs (Losi and Frankenberger 1998 ) . In aerobic soil slur-

ries, Se

was the main product with lower amounts of Se

being produced: het-

erotrophic and autotrophic thiobacilli were believed to be the active organisms

(Dowdle and Oremland 1998 ) .

Methylation of Se is a ubiquitous property of microorganisms and can occur in

soils, sediments and water (Gadd 2005 ) . Bacteria and fungi are the most important

Se-methylaters in soil (Karlson and Frankenberger 1988 ) with the most frequently

produced volatile being dimethyl selenide (DMSe; Karlson and Frankenberger

1988, 1989 ; Thompson-Eagle et al. 1989 ) . Other volatiles produced in smaller

amounts include dimethyl diselenide (DMDSe; Dungan and Frankenberger 1999 ) .

Like reduction, volatilization can be considered a detoxi ﬁ cation mechanism since

volatile Se derivatives are lost from the soil system. Those environmental factors

that affect microbial activity can markedly affect Se methylation, e.g. pH, tempera-

ture, organic amendments, Se speciation etc., addition of organic amendments can

stimulate methylation (Dungan and Frankenberger 1999 ) . The opposite process of

demethylation can also occur in soil and water systems. Anaerobic demethylation

may be mediated by methylotrophic bacteria (Oremland et al. 1989 ) . Tellurium may

also be transformed by analogous mechanisms as selenium, i. e. reduction and

methylation (Chasteen and Bentley 2003 ) . Reduction of tellurite to Te

results in a

grey to black colouration of microbial colonies with extracellular and intracellular

precipitation being observed (Gharieb et al. 1999 ) . Dimethyl telluride (DMTe) is the

main product of Te methylation (Chasteen and Bentley 2003 ) . Arsenic methylation

can be mediated by many organisms with compounds having the general structure

(CH

)

AsH

3−

n and mono-, di- and trimethylarsine (n = 1, 2, 3 respectively) being

major volatile compounds (Bentley and Chasteen 2002 ) . Reduction of arsenic oxya-

nions by reductase enzymes is also frequent and a determinant of As resistance.

However, there appears to be no involvement of such reductases in biomethylation

(Bentley and Chasteen 2002 ; Paez-Espino et al. 2009 ) .

5.3 Biomineralization

Microorganisms can form minerals by a process called biomineralization,

which offers an interesting bioremediation strategy for capturing pollutants

within relatively stable solid phases. Biomineralization occurs naturally in

very diverse environments but may be arti ﬁ cially stimulated for bioremediation

purposes as proposed in several past studies (e.g., Senko et al. 2002 ; Beazley

300

F. Masood and A. Malik

et al. 2007 ; Yabusaki et al. 2007 ) . Biomineralization refers to biologically induced

mineralization where an organism modi ﬁ es the local microenvironment creating

conditions that promote chemical precipitation of extracellular mineral phases

(Hamilton

2003 ; Dupraz et al. 2009 ) . Three different types of bacterially medi-

ated biomineralization processes have been distinguished in the literature (Dupraz

et al. 2009 ) : (1) biologically controlled biomineralization, referring to cases in

which a speci ﬁ c cellular activity directs the nucleation, growth, morphology, and

ﬁ nal location of a mineral; the emblematic example for that process in the case

of bacteria is the formation of intracellular chemically pure magnetite crystals in

magnetotactic bacteria (Blakemore 1975 ; Bazylinski and Frankel 2004 ; Komeili

2007 ) , but no signi ﬁ cant impact on immobilization of metal pollutants has been

reported so far; (2) biologically induced biomineralization resulting from indi-

rect modi ﬁ cation of chemical conditions, such as a pH shift or redox transforma-

tions, in the environment by biological activity; many examples are reported in

the literature for this process and can lead to ef ﬁ cient immobilization of almost

any known inorganic pollutant (e.g., Borch et al. 2010 ; Lowenstam 1981 ) ; and

(3) biologically in ﬂ uenced biomineralization, which is de ﬁ ned as passive min-

eral precipitation in the presence of organic matter, such as cell surfaces or extra-

cellular polymeric substances (EPS), whose properties in ﬂ uence crystal

morphology and composition. The term organomineralization encompasses bio-

logically in ﬂ uenced and biologically induced biomineralization (Dupraz et al.

2009 ) . Although by de ﬁ nition organomineralization involves processes that are

not supposed to involve speci ﬁ c genes, they may have a negative or positive

impact on cell viability. An increasing number of studies have shown that

microbial extracellular polymers can be involved in biomineralization, hence

inorganic pollutant trapping (Benzerara et al. 2008 ; Chan et al. 2009 ; Miot et al.

2009 ) . Calcium oxalate is the most common form of oxalate encountered in the

environment, mostly occurring as the dihydrate (weddellite) or the more stable

monohydrate (Gadd 1999 ) . Calcium oxalate crystals are commonly associated

with free-living, pathogenic and plant symbiotic fungi and are formed by the

precipitation of solubilized calcium as the oxalate ( Gharieb et al. 1999 ; Gadd

1999, 2010 ) . This has an important in ﬂ uence on biogeochemical processes in

soils, acting as a reservoir for calcium, and also in ﬂ uencing phosphate availabil-

ity. The importance of biomineralization in the sequestration of inorganic pollut-

ants is obvious, especially at ﬁ eld sites where the metabolic activity of

microorganisms has been arti ﬁ cially stimulated for bioremediation purposes

(Barkay and Schaefer 2001 ; Adriano et al. 2004 ) . A group of studies have, for

example, clearly shown that the secretion of phosphate groups due to phosphatase

activity can induce a signi ﬁ cant immobilization of uranium in the form of autunite

at acidic and alkaline pH (Macaskie et al. 2000 ; Merroun and Selenska-Pobell

2008 ; Nilgiriwala et al. 2008 ; Beazley et al. 2007 ) . Phosphatase activity

can be stimulated by injection of glycerol-3-phosphate as the sole carbon and

phosphorus source.

301

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

6 Gene Transfer and Genetic Engineering

of Metal-Resistance Genes

The genetic capacity of bacteria can be exploited for the remediation of heavy metal

pollution. Genes associated with metal resistance/detoxi ﬁ cation mechanisms have

long been studied in microorganisms (Silver and Phung 2005 ) . The cad operon

responsible for cadmium ef ﬂ ux is well-characterized in Staphylococcus aureus

( Nies and Silver 1995 ) . The mer operon in mercury resistance is well-understood in

a variety of microorganisms (Nies 1999 ) . The czc operon has been elucidated in

numerous bacteria (Abou-Shanab et al. 2007 ) . Such metal-resistance genes have

been introduced into other bacteria and plants to help establish metal-tolerant popu-

lations within contaminated systems. For example, numerous tree species have been

genetically altered to produce the MT-related glutathione for metal sequestration

(Merkle 2006 ) . Gene bioaugmentation is de ﬁ ned as the process of obtaining

enhanced biological activity after gene transfer from an introduced donor organism

into a member of the indigenous soil population (Maier 2000 ) . In a metal-contami-

nated environment, enhanced metal detoxi ﬁ cation activity could be achieved if

metal-resistant/detoxifying genes were transferred to bacterial populations within

the soil (Pepper et al. 2002 ) . Gene bioaugmentation has primarily been studied for

mitigation of organic pollutants (Urgun-Demirtas et al. 2006 ; Jussila et al. 2007 ) ,

and while not widely used gene bioaugmentation can potentially establish large,

diverse metal-resistant populations within a soil.

In situ bioremediation uses naturally occurring non engineered microorganisms

and is often enhanced (biostimulation) by the addition of nutrients, such as N and P,

surfactants and oxygen during the treatment (Watanabe 2001 ) . In such treatments,

nature of the microbial ecological niches is unpredictable. Another possible method to

improve the bioremediation ef ﬁ ciency is the bioaugmentation, where the indigenously

isolated bacteria are injected into the contaminated site, which may include geneti-

cally engineered (GE) bacterial strains, but it is rarely done. A major dif ﬁ culty with in

situ bioremediation by using transgenic bacteria is the unpredictable end result on

account of various environmental factors that may interfere. However, bioremediation

based on GE bacteria is an emerging technology and has been receiving more attention

as an ecofriendly and ef ﬁ cient way of cleaning up toxic-metal contaminations (Cases

and de Lorenzo 2005a, b ; Shukla et al. 2010 ; Liu et al. 2011 ) .

Recent developments in bioremediation technology, which includes the utilization

of protein engineering, metabolic engineering, whole-transcriptome pro ﬁ ling, and

proteomics are also considered signi ﬁ cant for removal of obstinate pollutants such

as heavy metals (Thomas 2008 ) . Cell surface appearance of precise proteins in the

GE bacteria is known to contribute in detoxi ﬁ cation of heavy metals as well as other

recalcitrant compounds (Muhammad et al. 2008 ) . Now, it is widely considered

that molecular biology has potential application in designing the bacteria for reme-

diative tasks. The GE bacteria have higher degradative capacity and have been

demonstrated successfully for the degradation of various pollutants under de ﬁ ned

conditions (Barac et al.

2004 ) . Various strains of Ralstonia eutropha, Pseudomonas

302

F. Masood and A. Malik

putida, Mycobacterium marinum, Escherichia coli, Sphingomonas desiccabilis,

Bacillus idriensis , etc., have genes inserted into their genomes, which empowers

them to speci ﬁ c bioremediation of toxic metal compounds in contaminated environ-

ment (Kube et al.

2005 ; Parnell et al. 2006 ; Schue et al. 2009 ; Liu et al. 2011 ) . Hu

et al. ( 2005 ) using whole-genome transcriptional analysis, have identi ﬁ ed the path-

ways responding to heavy metal toxicity in Caulobacter crescentus , a bacterium

known for its ability to live in environments with characteristics of those heavy

metal contaminated sites. The bacterium is able to tolerate uranium, cadmium and

chromium, possibly due to protection against oxidative stress and multiple ef ﬂ ux

pumps. In order to identify genes induced by exposure to heavy metals, Moore et al.

( 2005 ) used a transcriptional pro ﬁ ling assay of Bacillus subtilis , discovering that

many of the genes affected by metal stress were controlled by metalloregulatory

proteins known as Fur, MntR, PerR, ArsR and CueR. Recently Hasin et al. ( 2010 )

reported a well-characterized model methanotroph Methylococcus capsulatus able

to bioremediate chromium(VI) pollution over a wide range of concentrations (1.4–

1,000 mg/L of Cr

), thus extending the bioremediation potential via successful

genetic manipulation of this major group of microorganisms.

The genetic engineering offers the advantage of constructing the bacterial strains

which can withstand the adverse stressful conditions and can be deliberately employed

as bioremediators under complex environmental conditions. Thus, identi ﬁ cation and

genetic engineering of indigenous bacteria, which are fully adapted to such complex

environmental conditions, is largely expected to offer a most viable future remedia-

tion technology. Considering the huge selection pressure on the free living GE bac-

teria imposed by the environmental factors, both biotic (antagonism, competition and

predation) and abiotic (temperature, pH, moisture, adsorption, etc.), it is dif ﬁ cult and

a discouraging task to derive a competent modelling scheme for survival of engi-

neered bacteria. It is considered that the indigenous microbial ﬂ ora, if taken for con-

structing the recombinant bacteria, will have natural advantage over the “exotic

strain” of GE bacteria. Since the rate of bioremediation is not the only function of

degradative genes but is also dependent on total population and innate capabilities of

the bacteria to withstand the existing complex stressful environmental conditions.

Therefore, choosing and engineering the right bacterial strain with rapid growth

(largest potential population and greatest nutrient responses) and more ef ﬁ cient

bioremediation capabilities without environmental risk will be a crucial step for

achieving a safe and sustainable environment (Singh et al. 2011 ) .

Application of GE bacteria for bioremediation of heavy metals has come in the

forefront due to its selective nature of transforming the toxicants and thus, posing

less health hazards as compared to physico-chemical methods. Bacterial metal

detoxi ﬁ cation and removal can be an ef ﬁ cient strategy due to its low cost, high

ef ﬁ ciency and eco-friendly nature. Recent advances in the ﬁ eld of molecular

biology have enabled us to understand the metal-microbe interaction and their

application for bioremediation of metal in the environment (Rajendran et al. 2003 ) .

The detoxi ﬁ cation machineries in GE bacteria have been considered useful for

metal bioremediation, and a comparison of their ef ﬁ ciency of remediation with the

previously isolated metal-resistant bacteria may yield interesting results.

303

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

7 Nanotechnology in Bioremediation

The area of nanotechnology encompasses the synthesis of nanoscale materials, the

understanding and the utililization of their often exotic physicochemical and optoelec-

tronic properties, and the organization of nanoscale structures into prede ﬁ ned super-

structures. Thus, nanotechnology promises to play an increasingly important role in

many key technologies of the new millenium. Recently, the emerging ﬁ eld of nano-

technology has also contributed signi ﬁ cantly in remediating these common soil and

water pollutants in environment friendly manner. Biological synthesis of metal nano-

particles using microbes, such as bacteria, yeasts, algae, actinomycetes and fungi, is

gaining momentum due to the ecofriendly nature of the organisms which reduce toxic

chemicals (Muralisastry et al.

2003 ) . Metal-microbe interaction is very important in

several biotechnological applications, including in the ﬁ elds of biomineralization,

bioremediation, bioleaching, and microbial corrosion (Joerger et al. 2001 ) . Nano

materials, besides providing new research challenges, form the basis of a new class of

atomically engineered materials. Con ﬂ uence of environmental biotechnology and

nanotechnology will lead to the most exciting progress in the development of nano-

devices having bio-capabilities in novel metal remediation strategies.

Biological systems provide many examples of speci ﬁ cally tailored, nanostruc-

tured molecules with highly optimized properties and characteristics. Thus biologi-

cal materials are considered as a nanophase system in its own right and as the

starting point for producing other novel nanophase systems. Nanomaterial in vivo

biosynthesis is the best option for metal bioremediation, since a biologically con-

trolled mineralization process produces materials with well-de ﬁ ned characteristics.

The biominerals are composite materials and consist of an inorganic component and

a special organic matrix; the organic matrix has a vital in ﬂ uence on the morphology

of the inorganic compound. Li et al. ( 2003 ) have reported the sorption of Pb(II),

Cu(II) and Cd(II) onto multiwalled carbon nanotubes (MWCNTs). The maximum

sorption capacities of 97.08 mg/g for Pb(II), 24.49 mg/g for Cu(II) and 10.86 mg/g

for Cd(II) at room temperature, pH 5.0 and metal ion equilibrium concentration of

10 mg/L. It was also found that the metal-ion sorption capacities of the MWCNTs

were 3–4 times higher than that of powder activated carbon and granular activated

carbon which are two commonly used sorbents in water puri ﬁ cation.

8 Bioinformatics Use in Bioremediation

Advances in the molecular biology technologies are making a global gene expres-

sion pro ﬁ le possible; genome wide analysis of DNA (genomics), RNA expression

(transcriptomics) and protein expression (proteomics) as well as exploring com-

plexes of protein aggregation such as protein-protein interaction (interactomics)

create the opportunity to systematically study the physiological expressions of such

organisms. Attempts are made to interpret some of the areas of genomics and pro-

teomics which have been employed for bioremediation studies. The bioinformatic

304

F. Masood and A. Malik

data obtained viz. various sources are interpreted by combining these techniques

and applying them towards future studies of active bioremediation to develop envi-

ronmental cleanup technologies. Bioinformatic techniques have been developed to

identify and analyze various components of cells such as gene and protein function,

interactions, and metabolic and regulatory pathways. The next decade will belong

to the understanding of cellular mechanism and manipulation using the integration

of bioinformatics.

9 New Frontiers in Bioremediation

The biological treatment of metal-contaminated systems is a continuing ﬁ eld of

research. While much need for elucidation remains, the ﬁ eld of microbial metal

remediation is making great strides towards applicable technologies. There are

many new and exciting proposed uses of microorganisms and their products in soil

metal remediation. With our increased understanding of multiple microbial metal

resistance mechanisms, treatment of sites with ﬂ uctuating metal concentrations and

multiple metal and organic contaminants may be possible. The use of microbial

products, the microbial enhancement of phytoremediation technologies, in combi-

nation with the genetic engineering of plants and microorganisms for enhanced

metal uptake, represent continuing, exciting directions in the use of microorganisms

in soil metal remediation. Molecular approaches including ‘-omics’ tools were used

relatively recently in several studies to get better insight in to the bacterial interac-

tion with toxic metals. Such extensive studies have shown beyond doubt that micro-

bial interaction with metals and minerals have potential for treatment of environmental

pollution (Lloyd and Renshaw 2005 ; Gadd 2010 ) .

10 Conclusions

The pollution of soil and water with heavy metals is an environmental concern today.

Metals and other inorganic contaminants are among the most prevalent forms of

contamination found at waste sites, and their remediation in soils and sediments is

among the most technically dif ﬁ cult. The high cost of existing cleanup technologies

led to the search for new cleanup strategies that have the potential to be low cost, low

impact, visually benign, and environmentally sound. Some microorganisms act in

the biosphere as geochemical agents promoting precipitations, transformations, or

dissolutions of minerals. The use of these microorganisms for bioremediation offers

new tools to degrade or transform toxic contaminants. Various molecular, genetic,

and metabolic engineering tools have accelerated the progress toward bioremedia-

tion and have led to speci ﬁ cally designed microorganisms for various bio-based

clean-up processes. However, these genetic modi ﬁ cations should be understood in

full and any research must always determine the actual risks and bene ﬁ ts involved.

305

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

References

Abou-Shanab RAI, van Berkum P, Angle JS (2007) Heavy metal resistance and genotypic analysis

of metal resistance genes in gram-positive and gram-negative bacteria present in Ni-rich ser-

pentine soil and in the rhizosphere of Alyssum murale . Chemosphere 68:360–367

Adriano DC, Wenzel WW, Vangronsveld J, Bolan NS (2004) Role of assisted natural remediation

in environmental cleanup. Geoderma 122:121–142

Agrawal J, Sherameti I, Varma A (2011) Detoxi ﬁ cation of heavy metals: state of art. In: Sherameti

I, Varma A (eds) Detoxi ﬁ cation of heavy metals. Springer, Heidelberg

Ahmaruzzaman M (2011) Industrial wastes as low-cost potential adsorbents for the treatment of

wastewater laden with heavy metals. Adv Colloid Interface Sci 166:36–59

Akinola OM, Njoku LKL, I ﬁ tezue VN (2011) Assessment of heavy metals (lead and cadmium)

concentration in Paspalum orbiculare near municipal refuse dumpsites in Lagos State, Nigeria.

J Ecol Nat Environ 3:509–514

Ansari MI, Malik A (2007) Biosorption of nickel and cadmium by metal resistant bacterial isolates

from agricultural soil irrigated with wastewater. Bioresour Technol 98:3149–3153

Ansari MI, Masood F, Malik A (2011) Bacterial biosorption: a technique for remediation of heavy

metals. In: Ahmad I, Ahmad F, Pichtel J (eds) Microbes and microbial technology: agricultural

and environmental applications. Springer, New York

Avery SV (2001) Metal toxicity in yeast and the role of oxidative stress. Adv Appl Microbiol

49:111–142

Barac T, Taghavi S, Borremans B, Provoost A, Oeyen L, Colpaert JV, Vangronsveld J, van der Lelie

D (2004) Engineered endophytic bacteria improve phytoremediation of water-soluble, volatile,

organic pollutants. Nat Biotechnol 22:583–588

Barkay T, Schaefer JJ (2001) Metal and radionuclide bioremediation: issues, considerations and

potentials. Curr Opin Microbiol 4:318–323

Barkay T, Wagner-Dobler I (2005) Microbial transformations of mercury: potentials, challenges,

and achievements in controlling mercury toxicity in the environment. Adv Appl Microbiol

57:1–52

Barkay TS, Miller M, Summers AO (2003) Bacterial mercury resistance from atoms to ecosys-

tems. FEMS Microbiol Rev 27:355–384

Bazylinski DA, Frankel RB (2004) Magnetosome formation in prokaryotes. Nat Rev Microbiol

2:217–230

Beazley MJ, Martinez RJ, Sobecky PA, Webb SM, Taillefert M (2007) Uranium biomineralization

as a result of bacterial phosphatase activity: insights from bacterial isolates from a contami-

nated subsurface. Environ Sci Technol 41:5701–5707

Bentley R, Chasteen TG (2002) Microbial methylation of metalloids: arsenic, antimony and bismuth.

Microbiol Mol Biol Rev 66:250–271

Benzerara K, Morin G, Yoon TH, Miot J, Tyliszczak T, Casiot C, Bruneel O, Farges F, Brown GE

Jr (2008) Nanoscale study of as biomineralization in an acid mine drainage system. Geochim

Cosmochim Acta 72:3949–3963

Blakemore R (1975) Magnetotactic bacteria. Science 190:377–379

Borch T, Kretzschmar R, Kappler A, Van Cappellen P, Ginder-Vogel M, Voegelin A, Campbell K

(2010) Biogeochemical redox processes and their impact on contaminant dynamics. Environ

Sci Technol 44:15–23

Bruins MR, Kapil S, Oehme FW (2000) Microbial resistance to metals in the environment.

Ecotoxicol Environ Saf 45:198–207

Cases I, de Lorenzo V (2005a) Genetically modi ﬁ ed organisms for the environment: stories of

success and failure and what we have learned from them. Int Microbiol 8:213–222

Cases I, de Lorenzo V (2005b) Promoters in the environment: transcriptional regulation in its

natural context. Nat Rev Microbiol 3:105–118

Cervantes C, Campos-Garcia J (2007) Reduction and ef ﬂ ux of chromate by bacteria. In: Nies DH,

Silver S (eds) Molecular microbiology of heavy metals. Springer, Berlin

306

F. Masood and A. Malik

Cervantes C, Campos-Garcia J, Devars S, Gutierrez-Corona F, Loza-Tavera H, Torres-Guzman JC,

Moreno-Sanchez R (2001) Interactions of chromium with microorganisms and plants. FEMS

Microbiol Rev 25:335–347

Chan CS, Fakra SC, Edwards DC, Emerson D, Ban ﬁ eld JF (2009) Iron oxihydroxide mineraliza-

tion on microbial extracellular polysaccharides. Geochim Cosmochim Acta 73:3807–3818

Chasteen TG, Bentley R (2003) Biomethylation of selenium and tellurium: microorganisms and

plants. Chem Rev 103:1–26

Cooksey DA (1994) Molecular mechanisms of copper resistance and accumulation in bacteria.

FEMS Microbiol Rev 14:381–386

DiChristina TJ, Fredrickson JK, Zachara JM (2005) Enzymology of electron transport: energy

generation with geochemical consequences. Rev Miner Geochem 59:27–52

Dowdle PR, Oremland RS (1998) Microbial oxidation of elemental selenium in soil slurries and

bacterial cultures. Environ Sci Technol 32:749–3755

Du X, Boonchayaanant B, Wu W, Fendorf S, Bargar J, Criddle CS (2011) Reduction of uranium(VI)

by soluble iron(II) conforms with thermodynamic predictions. Environ Sci Technol

45:4718–4725

Dungan RS, Frankenberger WT (1999) Microbial transformations of selenium and the bioremedia-

tion of seleniferous environments. Bioremediation J 3:171–188

Dupraz C, Reid RP, Braissant O, Decho AW, Norman RS, Visscher PT (2009) Processes of carbonate

precipitation in modern microbial mats. Earth Sci Rev 96:141–162

Ehrlich HL, Newman DK (2009) Geomicrobiology, 5th edn. CRC Press/Taylor & Francis, Boca

Raton

Finneran KT, Anderson RT, Nevin KP, Lovley DR (2002) Bioremediation of uranium-contaminated

aquifers with microbial U(VI) reduction. Soil Sediment Contam 11:339–357

Fomina M, Alexander IJ, Hillier S, Gadd GM (2004) Zinc phosphate and pyromorphite solubiliza-

tion by soil plant-symbiotic fungi. Geomicrobiol J 21:351–366

Fomina M, Hillier S, Charnock JM, Melville K, Alexander IJ, Gadd GM (2005a) Role of oxalic

acid over-excretion in toxic metal mineral transformations by Beauveria caledonica . Appl

Environ Microbiol 71:371–381

Fomina M, Alexander IJ, Colpaert JV, Gadd GM (2005b) Solubilization of toxic metal minerals

and metal tolerance of mycorrhizal fungi. Soil Biol Biochem 37:851–866

Fomina M, Podgorsky VS, Olishevska SV, Kadoshnikov VM, Pisanska IR, Hillier S, Gadd GM

(2007) Fungal deterioration of barrier concrete used in nuclear waste disposal. Geomicrobiol J

24:643–653

Francis AJ, Dodge CJ, Gillow JB (1992) Biodegradation of metal citrate complexes and implica-

tions for toxic metal mobility. Nature 356:140–142

Frentiu T, Ponta M, Levei E, Cordos EA (2009) Study of partitioning and dynamics of metals in

contaminated soil using modi ﬁ ed four-step BCR sequential extraction procedure. Chem Pap

63:239–248

Gadd GM (2005) Microorganisms in toxic metal-polluted soils. In: Buscot F, Varma A (eds)

Microorganisms in soils: roles in genesis and functions. Springer, Heidelberg

Gadd GM (1996) In ﬂ uence of microorganisms on the environmental fate of radionuclides.

Endeavour 20:150–156

Gadd GM (1999) Fungal production of citric and oxalic acid: importance in metal speciation,

physiology and biogeochemical processes. Adv Microb Physiol 41:4792

Gadd GM (2009) Biosorption: critical review of scienti ﬁ c rationale, environmental importance and

signi ﬁ cance for pollution treatment. J Chem Technol Biotechnol 84:13–28

Gadd GM (2010) Minerals and microbes: geomicrobiology and bioremediation. Microbiology

156:609–643

Gadd GM, Sayer JA (2000) Fungal transformations of metals and metalloids. In: Lovley DR

(ed) Environmental microbe-metal interactions. American Society of Microbiology,

Washington, DC

Geets J, Vangronsveld J, Diels L, Taghavi S, van der Lelie D (2008) Microbial activities, monitor-

ing and application as part of a management strategy for heavy metal-contaminated soil and

307

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

ground water. In: Naidu R (ed) Developments in soil science. Elsevier B.V., London, pp

521–559

Gharieb MM, Kierans M, Gadd GM (1999) Transformation and tolerance of tellurite by ﬁ lamentous

fungi: accumulation, reduction and volatilization. Mycol Res 103:299–305

Goyal N, Jain SC, Banerjee UC (2003) Comparative studies on the microbial adsorption of heavy

metals. Adv Environ Res 7:311–319

Hameed MSA (2006) Continuous removal and recovery of lead by alginate beads free and

alginate-immobilized Chlorella vulgaris . Afr J Biotechnol 5:1819–1823

Hamilton WA (2003) Microbially in ﬂ uenced corrosion as a model system for the study of metal–

microbe interactions: a unifying electron transfer hypothesis. Biofouling 19:65–76

Hasin AA, Gurman SJ, Murphy LM, Perry A, Smith TJ, Gardiner PE (2010) Remediation of

chromium (VI) by a methane-oxidizing bacterium. Environ Sci Technol 44:400–405

Haveman SA, Pedersen K (2002) Microbially mediated redox processes in natural analogues for

radioactive waste. J Contam Hydrol 55:161–174

Hietala KA, Roane TM (2009) Microbial remediation of metals in soils. In: Singh A et al. (eds)

Advances in applied bioremediation, Soil biology, vol 17, Springer, Berlin/Heidelberg, pp

201–220

Holden JF, Adams MWW (2003) Microbe–metal interactions in marine hydrothermal vents. Curr

Opin Chem Biol 7:160–165

Hobman JL, Wilson JR, Brown NL (2000) Microbial mercury reduction. In: Lovley DR (ed)

Environmental microbe-metal interactions. Am Soc Microbiol Washington, pp 177–197

Hu P, Brodie EO, Suzuki Y, McAdams HH, Andersen GL (2005) Whole-genome transcriptional

analysis of heavymetal stresses in Caulobacter crescentus . J Bacteriol 187:8437–8449

Huang PM (2008) Impacts of physicochemical–biological interactions on metal and metalloid

transformations in soils: an overview. In: Violante A, Huang PM, Gadd GM (eds) Biophysico-

chemical processes of heavy metals and metalloids in soil environments. John Wiley and Sons,

Wiley, Chichester

Huang PM, Wang MC, Wang MK (2004) Mineral–organic–microbial interactions. In: Hillel D,

Rosenzweig C, Powlson DS, Scow KM, Singer MJ, Sparks DL, Hat ﬁ eld J (eds) Encyclopedia

of soils in the environment. Elsevier, Amsterdam

Joerger K, Joerger R, Olsson E, Granqvist CG (2001) Bacteria as workers in the living factory: metal

accumulating-bacteria and their potential for material science. Trends Biotechnol 19:15–20

Johnson DB (2003) Chemical and microbiological characteristics of mineral spoils and drainage

waters at abandoned coal and metal mines. Water Air Soil Pollut 3:47–66

Jussila MM, Zhao J, Suominen L, Lindström K (2007) TOL plasmid transfer during bacterial

conjugation in vitro and rhizoremediation of oil compounds in vivo. Environ Pollut

146:510–524

Kadirvelu K, Thamaraiselvi K, Namasivayam C (2001) Removal of heavy metals from industrial

wastewaters by adsorption onto activated carbon prepared from an agricultural solid waste.

Bioresour Technol 76:63–65

Kannan SK, Krishnamoorthy R (2006) Isolation of mercury resistant bacteria and in ﬂ uence of

abiotic factors on bioavailability of mercury – a case study in Pulicat Lake North of Chennai,

South East India. Sci Total Environ 367:341–353

Karlson U, Frankenberger WT (1988) Effects of carbon and trace element addition on alkylsele-

nide production by soil. Soil Sci Soc Am J 52:1640–1644

Karlson U, Frankenberger WT (1989) Accelerated rates of selenium volatilization from California

soils. Soil Sci Soc Am J 53:749–753

Komeili A (2007) Molecular mechanisms of magnetosome formation. Annu Rev Biochem

76:351–366

Kube M, Beck A, Zinder SH, Kuhl H, Reinhardt R, Adrian L (2005) Genome sequence of the

chlorinated compound respiring bacterium Dehalococcoides species strain CBDB1. Nat

Biotechnol 23:1269–1273

Landa ER (2005) Microbial biogeochemistry of uranium mill tailings. Adv Appl Microbiol

57:113–130

308

F. Masood and A. Malik

Lee Y-A, Hendson M, Panopoulus NJ, Schrott MN (1994) Molecular cloning, chromosomal

mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv .

juglandis : homology with blue copper proteins and multicopper oxidase. J Bacteriol 176:173–188

Lee SM, Grass G, Rensing C, Barrett SR, Yates CJD, Stoyanov JV, Brown NL (2002) The Pco

proteins are involved in periplasmic copper handling in Escherichia coli . Biochem Biophys

Res Commun 295:616–620

Lesmana SO, Febriana N, Soetaredjo FE, Sunarso J, Ismadji S (2009) Studies on potential applica-

tions of biomass for the separation of heavy metals from water and wastewater. Biochem Eng

J 44:19–41

Li YH, Ding J, Luan ZK, Di ZC, Zhu YF, Xu C, Wu DH, Wei BQ (2003) Competitive adsorption

of Pb

, Cu

and Cd

ions from aqueous solutions by multiwalled carbon nanotubes. Carbon

41:2787–2792

Lian B, Chen Y, Zhu L, Yang R (2008a) Effect of microbial weathering on carbonate rocks. Earth

Sci Front 15:90–99

Lian B, Wang B, Pan M, Liu C, Teng HH (2008b) Microbial release of potassium from K-bearing

minerals by thermophilic fungus Aspergillus fumigatus . Geochim Cosmochim Acta 72:87–98

Liu S, Zhang F, Chen J, Sun GX (2011) Arsenic removal from contaminated soil via biovolatilization

by genetically engineered bacteria under laboratory conditions. J Environ Sci 23:1544–1550

Lloyd JR (2003) Microbial reduction of metals and radionuclides. FEMS Microbiol Rev 27:411–425

Lloyd JR, Renshaw JC (2005) Bioremediation of radioactive waste: radionuclide-microbe interac-

tions in laboratory and ﬁ eld-scale studies. Curr Opin Biotechnol 16:254–260

Losi ME, Frankenberger WT (1998) Microbial oxidation and solubilization of precipitated

elemental selenium in soil. J Environ Qual 27:836–843

Lovley DR (2001) Anaerobes to the rescue. Science 293:1444–1446

Lovley DR, Coates JD (1997) Bioremediation of metal contamination. Curr Opin Biotechnol

8:285–289

Lowenstam HA (1981) Minerals formed by organisms. Science 211:1126–1131

Macaskie LE, Bonthrone KM, Yong P, Goddard DT (2000) Enzymically mediated bioprecipitation

of uranium by a Citrobacter sp.: a concerted role for exocellular lipopolysaccharide and associ-

ated phosphatase in biomineral formation. Microbiology 146:1855–1867

Machado MD, Santos MSF, Gouveia C, Soares HMVM, Soares EV (2008) Removal of heavy met-

als using a brewer’s yeast strain of Saccharomyces cerevisiae : the ﬂ occulation as a separation

process. Bioresour Technol 99:2107–2115

Macur RE, Jackson CR, Botero LM, Mcdermott TR, Inskeep WP (2004) Bacterial populations

associated with the oxidation and reduction of arsenic in an unsaturated soil. Environ Sci

Technol 38:104–111

Maier RM (2000) Microorganisms and organic pollutants. In: Maier RM, Pepper IL, Gerba CP

(eds) Environmental microbiology. Academic, San Diego

Masood F, Malik A (2011) Biosorption of metal ions from aqueous solution and tannery ef ﬂ uents

by Bacillus sp. FM1. J Environ Sci Health Part A 46:1667–1674

McLean J, Beveridge TJ (2001) Chromate reduction by a pseudomonad isolated from a site con-

taminated with chromate copper arsenate. Appl Environ Microbiol 67:1076–1084

McLean JS, Lee JU, Beveridge TJ (2002) Interactions of bacteria and environmental metals, ﬁ ne-

grained mineral development, and bioremediation strategies. In: Huang PM, Bollag J-M,

Senesi N (eds) Interactions between soil particles and microorganisms. Wiley, New York, pp

227–261

Merkle SA (2006) Engineering forest trees with heavy metal resistance genes. Silvae Genetica

55:263–268

Merroun ML, Selenska-Pobell S (2008) Bacterial interactions with uranium: an environmental

perspective. J Contam Hydrol 102:285–295

Mergeay M, Monchy S, Vallaeys T, Auquier V, Benotmane A, Bertin P, Taghavi S, Dunn J, van der

Lelie D, Wattinez R (2003) Ralstonia metallidurans, a bacterium speci ﬁ cally adapted to toxic

metals: towards a catalogue of metal-responsive genes. FEMS Microbiol Rev 27:385–410

309

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

Miot J, Benzerara K, Morin G, Kappler A, Bernard S, Obst M, Ferard C, Skouri-Panet F, Guigner

JM, Posth N, Galvez M, Brown GE Jr, Guyot F (2009) Iron biomineralization by neutrophilic

iron-oxidizing bacteria. Geochim Cosmochim Acta 73:696–711

Moore CM, Gaballa A, Hui M, Ye RW, Helmann JD (2005) Genetic and physiological responses

of Bacillus subtilis to metal ion stress. Mol Microbiol 57:27–40

Moral R, Gilkes RJ, Jordan MM (2005) Distribution of heavy metals in calcareous and non-calcareous

soils in Spain. Water Air Soil Pollut 162:127–142

Morillo JA, Aguilera M, Ramos-Cormenzana A, Monteoliva-Sánchez M (2006) Production of a

metal-binding exopolysaccharide by Paenibacillus jamilae using two-phase olive-mill waste as

fermentation substrate. Curr Microbiol 53:189–193

Muhammad A, Muhammad S, Sarfraz H (2008) Perspectives of bacterial ACC deaminase in

phytoremediation. Trends Biotechnol 25:356–362

Mulligan CN, Yong RN, Gibbs BF (2001) Heavy metal removal from sediments by biosurfactants.

J Hazard Mater 85:111–125

Muralisastry, Ahmad A, Khan MI, Rajivkumar (2003) Biosynthesis of metal nanoparticles using

fungi and actinnomycetes. Curr Sci 85:162–170

Muyzer G, Stams AJM (2008) The ecology and biotechnology of sulphate-reducing bacteria. Nat

Rev Microbiol 6:441–454

Nair A, Juwarkar AA, Singh SK (2007) Production and characterization of siderophores and its

application in arsenic removal from contaminated soil. Water Air Soil Pollut 180:199–212

Nies DH (1999) Microbial heavy-metal resistance. Appl Microbiol Biotechnol 51:730–750

Nies DH (2003) Ef ﬂ ux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol

27:313–339

Nies DH, Silver S (1995) Ion ef ﬂ ux systems involved in bacterial metal resistances. Ind J Microbiol

14:186–199

Nilgiriwala KS, Alahari A, Rao AS, Apte SK (2008) Cloning and overexpression of alkaline phos-

phatase PhoK from Sphingomonas sp. strain BSAR-1 for bioprecipitation of uranium from

alkaline solutions. Appl Environ Microbiol 74:5516–5523

Ohtake H, Cervantes C, Silver S (1987) Decreased chromate uptake in Pseudomonas ﬂ uorescens

carrying a chromate resistance plasmid. J Bacteriol 169:3853–3856

Oremland R, Stolz J (2000) Dissimilatory reduction of selenate and arsenate in nature. In: Lovley

DR (ed) Environmental microbe–metal interactions. American Society for Microbiology,

Washington, DC

Oremland RS, Hollibaugh JT, Maest AS, Presser TS, Miller LG, Culbertson CW (1989) Selenate

reduction to elemental selenium by anaerobic bacteria in sediments and culture: biogeo-

chemical signi ﬁ cance of a novel sulfate-independent respiration. Appl Environ Microbiol

55:2333–2343

Oremland RS, Hoeft SE, Santini JM, Bano N, Hollibaugh RA, Hollibaugh JT (2002) Anaerobic

oxidation of arsenite in Mono Lake water and by facultative, arsenite-oxidizing chemoauto-

troph, strain MLHE-1. Appl Environ Microbiol 68:4795–4802

Paez-Espino D, Tamames J, de Lorenzo V, Canovas D (2009) Microbial responses to environmen-

tal arsenic. Biometals 22:117–130

Parnell JJ, Park J, Denef V, Tsoi T, Hashsham S, Quensen JI, Tiedje JM (2006) Coping with poly-

chlorinated biphenyl (PCB) toxicity: physiological and genome wide responses of Burkholderia

xenovorans LB400 to PCB-mediated stress. Appl Environ Microbiol 72:6607–6614

Pepper IL, Gentry TJ, Newby DT, Roane TM, Josephson KL (2002) The role of cell bioaugmenta-

tion and gene bioaugmentation in the remediation of co-contaminated soils. Environ Health

Perspect 110:943–946

Poljsak B, Pócsi I, Raspor P, Pesti M (2010) Interference of chromium with biological systems in

yeast and fungi: a review. J Basic Microbiol 50:21–36

Poole K (2005) Ef ﬂ ux-mediated antimicrobial resistance. J Antimicrob Chemother 56:20–51

Rajendran P, Muthukrishnan J, Gunasekaran P (2003) Microbes in heavy metal remediation. Indian

J Exp Biol 41:935–944

310

F. Masood and A. Malik

Rawlings DE (1997) Mesophilic, autotrophic bioleaching bacteria: description, physiology and

role. In: Rawlings DE (ed) Biomining: theory, microbes and industrial processes. Springer,

Berlin, pp 229–245

Rawlings DE (2002) Heavy metal mining using microbes. Annu Rev Microbiol 56:65–91

Ray S, Ray MK (2009) Bioremediation of heavy metal toxicity-with special reference to chro-

mium. Al Ameen J Med Sci 2:57–63

Rensing C, Newby DT, Pepper IL (2002) The role of selective pressure and sel ﬁ sh DNA in hori-

zontal gene transfer and soil microbial community adaptation. Soil Biol Biochem 34:285–296

Rosen BP (2002) Biochemistry of arsenic detoxi ﬁ cation. FEBS Lett 529:86–92

Ruta L, Paraschivescu C, Matache M, Avramescu S, Farcasanu IC (2010) Removing heavy metals

from synthetic ef ﬂ uents using “kamikaze” Saccharomyces cerevisiae cells. Appl Microbiol

Biotechnol 85:763–771

Sandrin TR, Chech AM, Maier RM (2000) A rhamnolipid biosurfactant reduces cadmium toxicity

during naphthalene biodegradation. Appl Environ Microbiol 66:4585–4588

Sayer JA, Cotter-Howells JD, Watson C, Hillier S, Gadd GM (1999) Lead mineral transformation

by fungi. Curr Biol 9:691–694

Schippers A, Sand W (1999) Bacterial leaching of metal sulphides proceeds by two indirect mech-

anisms via thiosulfate or via polysul ﬁ des and sulphur. Appl Environ Microbiol 65:319–321

Schottel J, Mandal A, Clark D, Silver S, Hedges RW (1974) Volatilization of mercury and organo-

mercurials determined by inducible R-factor systems in enteric bacteria. Nature 251:335–337

Schue M, Dover LG, Besra GS, Parkhill J, Brown NL (2009) Sequence and analysis of a plasmid

encoded mercury resistance operon from Mycobacterium marinum identi ﬁ es MerH, a new

mercuric ion transporter. J Bacteriol 19:439–444

Senko JM, Istok JD, Su ﬂ ita JM, Krumholz LR (2002) In-situ evidence for uranium immobilization

and remobilization. Environ Sci Technol 36:1491–1496

Shukla KP, Singh NK, Sharma S (2010) Bioremediation: developments, current practices and

perspectives. Genet Eng Biotechnol J 3:1–20

Siddiqui MH, Kumar A, Kesari KK, Arif JM (2009) Biomining-a useful approach toward metal

extraction. Am Eurasian J Agron 2:84–88

Silver S, Phung LT (1996) Bacterial heavy metal resistance: new surprises. Annu Rev Microbiol

50:753–789

Silver S, Phung LT (2005) A bacterial view of the periodic table: genes and proteins for toxic

inorganic ions. J Ind Microbiol Biotechnol 32:587–605

Silver S, Phung LT (2009) Heavy metals, bacterial resistance. In: Schaechter M (ed) Encyclopedia

of microbiology. Elsevier, Oxford

Silver S, Budd K, Leahy KM, Shaw WV, Hammond D, Novick RP, Willsky GR, Malamy MH,

Rosenberg H (1981) Inducible 92 plasmid-determined resistance to arsenate, arsenite and

antimony(III) in Escherichia coli and Staphylococcus aureus . J Bacteriol 146:983–996

Singh JS, Abhilash PC, Singh HB, Singh RP, Singh DP (2011) Genetically engineered bacteria: an

emerging tool for environmental remediation and future research perspectives. Gene 480:1–9

Smith WL, Gadd GM (2000) Reduction and precipitation of chromate by mixed culture sulphate-

reducing bacterial bio ﬁ lms. J Appl Microbiol 88:983–991

Solioz M, Stoyanov JV (2003) Copper homeostasis in Enterococcus hirae . FEMS Microbiol Rev

27:183–195

Spain A, Alm E (2003) Implications of microbial heavy metal tolerance in the environment. Rev

Undergrad Res 2:1–6

Stolz JF, Oremland RS (1999) Bacterial respiration of arsenic and selenium. FEMS Microbiol Rev

23:615–627

Strasser H, Burgstaller W, Schinner F (1994) High yield production of oxalic acid for metal leaching

purposes by Aspergillus niger . FEMS Microbiol Lett 119:365–370

Tabak HH, Lens P, van Hullebusch ED, Dejonghe W (2005) Developments in bioremediation of

soils and sediments polluted with metals and radionuclides–1. Microbial processes and mecha-

nisms affecting bioremediation of metal contamination and in ﬂ uencing metal toxicity and

transport. Rev Environ Sci Bio Technol 4:115–156

311

11 Current Aspects of Metal Resistant Bacteria in Bioremediation…

Thomas KW (2008) Molecular approaches in bioremediation. Curr Opin Biotechnol 19:572–578

Thompson-Eagle ET, Frankenberger WT, Karlson U (1989) Volatilization of selenium by Alternaria

alternata . Appl Environ Microbiol 55:1406–1413

Tomei FA, Barton LL, Lemanski CL, Zocco TG, Fink NH, Sillerud LO (1995) Transformation of

selenate and selenite to elemental selenium by Desulfovibrio desulfuricans . J Ind Microbiol

14:329–336

Tunali S, Cabuk A, Akar T (2006) Removal of lead and copper ions from aqueous solutions by

bacterial strain isolated from soil. Chem Eng J 115:203–211

Unaldi MN, Korkmaz H, Ankan B, Coral G (2003) Plasmid-encoded heavy metal resistance in

Pseudomonas sp. Bull Environ Contam Toxicol 71:1145–1150

Urgun-Demirtas M, Stark B, Pagilla K (2006) Use of genetically engineered microorganisms

(GEMS) for the bioremediation of contaminants. Crit Rev Biotechnol 26:145–164

Van Hullebusch ED, Lens PNL, Tabak HH (2005) Developments in bioremediation of soils and

sediments polluted with metals and radionuclides. 3. In ﬂ uence of chemical speciation and

bioavailability on contaminants immobilization/mobilization bio-processes. Rev Environ Sci

Biotechnol 4:185–212

Violante A, Cozzolino V, Perelomov L, Caporale AG, Pigna M (2010) Mobility and bioavailability

of heavy metals and metalloids in soil environments. J Soil Sci Plant Nutr 10:268–292

Voloudakis AE, Reignier TM, Cooksey DA (2005) Regulation of resistance to copper in

Xanthomonas axonopodis pv. vesicatoria. Appl Environ Microbiol 71:782–789

Wall JD, Krumholz LR (2006) Uranium reduction. Annu Rev Microbiol 60:149–166

Wang JL, Chen C (2006) Biosorption of heavy metals by Saccharomyces cerevisiae : a review.

Biotechnol Adv 24:427–451

Wang J, Chen C (2009) Biosorbents for heavy metals removal and their future. Biotechnol Adv

27:195–226

Watanabe ME (2001) Can bioremediation bounce back? Nat Biotechnol 19:1111–1115

White C, Gadd GM (1998) Accumulation and effects of cadmium on sulphate-reducing bacterial

bio ﬁ lms. Microbiology 144:1407–1415

White C, Gadd GM (1997) An internal sedimentation bioreactor for laboratory-scale removal of

toxic metals from soil leachates using biogenic sulphide precipitation. J Ind Microbiol

18:414–421

White C, Gadd GM (2000) Copper accumulation by sulphate reducing bacterial bio ﬁ lms and

effects on growth. FEMS Microbiol Lett 183:313–318

Williams CJ, Aderhold D, Edyvean GJ (1998) Comparison between biosorbents for the removal of

metal ions from aqueous solution. Water Res 32:216–224

Yabusaki SB, Fang Y, Long PE, Resch CT, Peacock AD, Komlos J, Jaffe PR, Morrison SJ, Dayvault

RD, White DC, Anderson RT (2007) Uranium removal from groundwater via in situ biostimu-

lation: ﬁ eld-scale modeling of transport and biological processes. J Contam Hydrol

93:216–235

Yee N, Kobayashi DY (2008) Molecular genetics of selenate reduction by Enterobacter cloacae

SLD1a-1. Adv Appl Microbiol 64:107–123

Zawadzka AM, Crawford RL, Paszczynski AJ (2007) Pyridine-2, 6-bis (thiocarboxylic acid) pro-

duced by Pseudomonas stutzeri KC reduces chromium(VI) and precipitates mercury, cadmium,

lead and arsenic. Biometals 20:145–158

Zhu R, Wu M, Yang J (2011) Mobilities and leachabilities of heavy metals in sludge with humus

soil. J Environ Sci 23:247–254

313

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_12, © Springer Science+Business Media Dordrecht 2013

Abstract Municipal solid waste (MSW) is the waste generated from residential

sources, such as households, and from institutional and commercial sources such as

of ﬁ ces, schools, hotels and other sources. The main components of MSW are food,

garden waste, paper, board, plastic, textile, metal, and glass waste. The composition

of MSW varies depending on a range of factors; the household waste re ﬂ ects popu-

lation density and economic prosperity, seasonality, housing standards and the pres-

ence of waste minimization initiatives. The MSW consists of a high proportion of

organic fraction resulting from scraps, food residues, paper and garden waste. The

organic fraction of municipal solid waste (OFMSW) represents 70% of the waste

composition with moisture content around 85–90%.

The uncontrolled decomposition of OFMSW can contribute to global warming

and result in large-scale contamination of soil, water, and air. Macias-Corral et al.

(Bioresour Technol 99:8288–8293, 2008) indicated that the decomposition of one

metric ton of OFMSW can potentially release 50–110 m

of carbon dioxide (CO

)

and 90–140 m

of methane (CH

). In addition, the high levels of moisture content

make this type of waste ineffectual for incineration. Therefore, the anaerobic diges-

tion of OFMSW can be an environmentally sustainable technology to reduce the

harmful effects of MSW, reduce the volume and toxicity of this waste, in addition

to many advantages including potential for energy recovery, production of an end-

product suitable for soil conditioning, and decreased dependency on land ﬁ lls.

Anaerobic biodegradation of the organic material proceeds in the absence of

oxygen and presence of anaerobic microorganisms. Anaerobic Digestion (AD) is an

engineered biological process by which complex organic materials are ﬁ rst hydro-

lyzed and fermented by acid bacteria into volatile fatty acids that are consumed by

methanogenic bacteria and converted into biogas afterwards. The biogas generated

M. Albanna (*)

Water and Environmental Engineering Department, School of Natural Resources Engineering ,

German Jordanian University , P.O. Box: 35247 , Amman 11180 , Jordan

e-mail: muna.albanna@gju.edu.jo

Chapter 12

Anaerobic Digestion of the Organic Fraction

of Municipal Solid Waste

Muna Albanna

314

M. Albanna

can be used as a renewable source of energy, and the solid compost material can be

used as soil fertilizer. For all these advantages, the AD technology has been sup-

ported by legislation in many countries around the world and encouraged as sustain-

able solid waste management option.

This chapter presents in depth the AD technology to determine its economic and

environmental competitiveness, as one of the options for processing the biodegrad-

able organic materials in MSW. The chapter also discusses the stages of the diges-

tion of the waste such as; the pretreatment, the separation processes, waste digestion,

gas recovery and residue treatment. The AD operating parameters are illustrated,

such as – but not limited to –: waste composition, temperature, organic content, resi-

dence time, pH, carbon/nitrogen ratio, and compost quality.

Keywords Municipal solid waste (MSW) • Anaerobic digestion • Sustainable tech-

nology • Renewable energy

Abbreviations

AD Anaerobic Digestion

EIONET European Environmental Information and Observation Network

EU European Union

HRT Hydraulic Retention Time (days)

LCA Life Cycle Assessment

MSW Municipal Solid Waste

OFMSW Organic Fraction of Municipal Solid Waste

RCRA Resource Conversion and Recovery Act

SRT Solid Retention Time (days)

UASB Up ﬂ ow Anaerobic Sludge Bed

USEPA United States Environmental Protection Agency

UNESCAP United Nations Economic and Social Commission for Asia and the

Paci ﬁ c

VFA Volatile Fatty Acids

1 Introduction

The economic development of societies, which started after the industrial revolu-

tion, had major effects on the environment: the natural resources are used exten-

sively, and pollution and waste are produced as results of many activities related to

the human civilization. Solid waste treatment, disposal and management are huge

challenges for all municipalities, industries and businesses around the world.

Global societies produce enormous quantities of waste as a result of many activities

(municipal, agricultural, industrial and commercial). The crucial challenge is that

315

12 Anaerobic Digestion of the Organic Fraction…

the waste volumes produced are rapidly increasing due to the increase in population

and modernized lifestyles. The recent statistics declare that the annual amount of

the world’s waste production is approximately four billion tonnes; only one quarter

is recovered or recycled (Chalmin and Gaillochet

2009 ) . Future projections esti-

mate that the world’s waste production could reach up annually to 27 billion tonnes

by 2050; a third of which may be generated in Asia ( Shanghai Manual

2011 ).

In addition, the substances in the different types of waste are increasing in com-

plexity and diversity. Affordable and secure solid waste management is indeed one

of the key challenges of the twenty- ﬁ rst century as declared by many international

forums around the world.

Many societies recognized that some of the current waste management methods

are no longer acceptable due to the problems associated with the treatment paths,

such as the effects on the environment and human health. These speci ﬁ cs forced

different governments to look for improved practices that may lead to improved

quality of services and reduce the related negative impacts. Also, many countries

around the world started taking several measures to control the growing quantities

of waste. One of these measures is to use it as a resource since the entire waste

management system can be designed to maximize the bene ﬁ ts from the discarded

and disposed materials using different modern practices and techniques. The anaer-

obic digestion (AD) of the organic fraction of municipal solid waste (OFMSW) is

one of the simple technologies with a low energy requirement that may be used to

convert the OFMSW, agricultural waste and other organic biomass into biogas that

can be used as alternative and sustainable source of energy.

1.1 De ﬁ nition of Solid Waste

De ﬁ ning waste is not easy due to the fact that the waste contains numerous sub-

stances that are increasing in complexity and variety. One of the broad de ﬁ nitions

was recognized by the Resource Conservation and Recovery Act (RCRA) which is

the major federal statute that governs solid waste in the United States. This act

de ﬁ nes solid waste as “any garbage, refuse, sludge from a waste treatment plant,

water supply treatment plant or air pollution control facility and other discarded or

salvageable materials, including solid, liquid, semisolid, or contained gaseous

materials resulting from industrial, commercial, mining and agricultural operations,

and from community activities” (USEPA 2008 ) .

1.2 Composition of Solid Waste

There are different types of generated non-hazardous waste some of which are

municipal, commercial, agriculture, non-hazardous industrial, mining, construction,

and sewage wastes. The types of waste and the generation rates of each type of waste

vary over time and location, taking into consideration the industrial development and

316

M. Albanna

human activities. EIONET ( 2009 ) reported that over 1.8 billion tonnes of wastes are

generated annually in Europe, and this waste is mainly made up of municipal solid

waste (MSW), commercial, agriculture, non-hazardous industrial and construction

and demolition. The composition of solid waste reported by the latter author may

describe the waste stream for most of the countries around the world, yet with

different percentages.

The type of waste that takes much attention is the MSW, mainly due to the fact

that management of this waste stream is expensive for all the municipalities around

the world. The dilemma of MSW management is signi ﬁ cant as it is visible to the

communities and directly related to the national environmental concerns. Add to

this the fact that the quantities of MSW are still increasing, even with all the advanced

technologies for the waste recovery and treatment, and the more stringent laws and

regulations. The MSW generation rate in the USA increased from 242.5 million

tones in 2000 to around 250 million tonnes in 2010 (USEPA

2011 ) . Strange ( 2002 )

stated that the United Kingdom generates more than 400 million tonnes/year of

non-hazardous solid waste and 7% of this waste is MSW (calculated to be equiva-

lent to 28 million tonnes).

The MSW consists of a non-biodegradable portion and a biodegradable organic

fraction. The composition of MSW varies depending on a range of factors; the

household waste re ﬂ ects population density and economic prosperity, seasonality,

housing standards and the presence of waste minimization initiatives (Albanna

2011 ) . Figure 12.1 illustrates the composition of MSW in (a) the United States

MSW Composition

10%

20%

30%

40%

50%

60%

USA EU India Jordan

% composition

Food & Garden Paper and Board Metal

Glass Plastics Textile, Rubber, Leather

Others

Fig. 12.1 Composition of MSW ( a ) in the USA (Adapted from USEPA 2011 ) , ( b ) European

Community (Adapted from European Commission Report

2001 ) , ( c ) in India – Thiruvananthapuram

City (Adapted from Narayana

2009 ) , and ( d ) in Jordan (Adapted from Marayyan 2004 )

317

12 Anaerobic Digestion of the Organic Fraction…

(adapted from USEPA 2011 ) , (b) EU countries (adapted from the European

Commission report 2001 ) , (c) India (adapted from Narayana 2009 ) , and (d) Jordan

(adapted from Marayyan 2004 ) .

As demonstrated in Fig.

12.1 , food and garden wastes constitute the largest pro-

portion of MSW in most of the countries. Lardinois and van de Klundert ( 1993 )

illustrated that the vegetables and putrescible waste (organic fraction) forms 40–80%

of the MSW in low income countries, 20–65% of the MSW in middle income

countries and 20–50% of the MSW generated in the industrialized countries.

In addition to the MSW and agricultural waste; the animal manure and sewage

sludge are two signi ﬁ cant solid waste streams that usually contain high organic

content. Macias-Coral et al. (

2008 ) identi ﬁ ed the animal manure as a major environ-

mental problem in the United States as the quantities produced are 130 times greater

than the amount of human waste. Eskicioglu et al. ( 2008 ) indicated that approxi-

mately 670,000 t of dry sewage sludge or biosolids are produced annually in Canada.

According to the latter authors, these quantities of biosolids are subjected to increase

in future since many wastewater treatment plants are expanding to serve the demands

of growing communities.

As mentioned above; it is evident that huge quantities of waste which are rich in

organic content are produced annually around the world. The municipal, sewage,

and agricultural waste streams have potential for use as a substrate for anaerobic

bacteria that are able to degrade the organic matter and produce biogas as a viable

and recognized alternative source of energy.

2 Solid Waste Treatment Options of OFMSW

Throughout historical developments of human civilization; the acceptable treatment

and disposal options of waste created a huge challenge. The Greek civilization was

the ﬁ rst to recognize the problems associated with the waste disposal and conse-

quently forced a law that controlled the waste dumping (Williams 2005 ) . However,

since early ages and until recent decades; land ﬁ lling used to be the dominant waste

disposal method and incineration used to be the main method for waste treatment.

As mentioned earlier and according to estimates by the USEPA ( 2011 ) , the amount

of MSW generated in the USA in 2010 was 250 million tonnes. From this amount,

only 85 million tonnes were recycled or composted. Analysis of the illustrated sta-

tistics shows that the percentage of recovered MSW in 2010 in the USA was 34.1%

of the generated waste, while 11.7% of the wastes were combusted for energy recov-

ery, and the rest of the generated waste (54.2%) were land ﬁ lled. Nevertheless, due

to the environmental risks associated with different disposal and treatment options,

and mainly land ﬁ lling, many communities realized that integrated waste manage-

ment systems are one of the global top priorities. Figure

12.2 presents the disposal

methods for MSW in several countries (the data for USA adapted from USEPA

2011 , and data for countries in Asia adapted from UNESCAP 2000 ) .

318

M. Albanna

As illustrated in Fig. 12.2 , the solid waste disposal methods are different amongst

countries, though typically the main solid waste disposal method is either land ﬁ lling

or open dumping, which have negative implications on the environment and on

human health.

If the MSW is land ﬁ lled or dumped, unquestionably large amounts of land ﬁ ll gas

as well as leachate will be produced as a result of the anaerobic biodegradation

inside the land ﬁ lls or open dumps. The fugitive emissions of land ﬁ ll gas – that is

composed mainly of methane (CH

) and carbon dioxide (CO

) – generated from the

anaerobic biodegradation of the OFMSW will escape into the atmosphere, pollute

the environment and add to the anthropogenic greenhouse gases emissions.

Decomposition of one metric ton of organic solid waste can potentially release

50–110 m

of CO

and around 90–140 m

of CH

into the atmosphere (Macias-

Corral et al. 2008 ) . It is worth mentioning that land ﬁ lling of the combustible waste

has been outlawed in many countries in Europe since a decade ago. In these coun-

tries, the OFMSW has to be recycled, treated by anaerobic digestion or incinerated

(Eurostat 2012 ; Bond and Templeton 2011 ) .

Despite the fact that land ﬁ lling is still the dominant way of MSW disposal in

many countries around the world, there are still some other treatment options that

take advantage of the high organic fraction that the MSW contains. The primary

treatment and management options for the OFMSW may include: composting,

waste to energy technologies, incineration and land ﬁ lling. Yet, the high moisture

content levels of the OFMSW may hinder the incineration processes, also composting

of this type of waste may produce odors, ammonia and large amounts of residuals

that eventually have to be land ﬁ lled. The different treatment technologies of the

MSW Treatment Option

20%

40%

60%

80%

100%

USA Japan Australia India Pakistan Bangladesh

% waste disposal

Landfilling Incineration with energy recovery

Composting Open dumping

others (including Recycling)

Fig. 12.2 Disposal methods for MSW in USA (Adapted from USEPA 2011 ) , Japan, Australia,

India, Pakistan and Bangladesh (Adapted from UNESCAP

2000 )

319

12 Anaerobic Digestion of the Organic Fraction…

waste are based on the processes that change the physical, chemical, or biological

characteristics of the waste to reduce their negative impacts and threat on the envi-

ronment, and/or to provide opportunities of using the waste as alternative resources.

From this perspective, the AD will be a better treatment option for OFMSW. The

engineered biological processes in controlled anaerobic reactors can offer a sustain-

able approach to address the problems associated with OFMSW treatment and

provide useful products such as biogas and organic fertilizer. This chapter focuses

on the AD of the OFMSW, as one of the signi ﬁ cant treatment options and promising

waste to energy recovery techniques. Within the identi ﬁ ed treatment option; the

waste will be neutralized, energy can be recovered and used for electricity generation,

and other clean by products can be reclaimed as soil conditioner.

3 Anaerobic Digestion of the Organic Fraction of Solid Waste

The AD is the treatment of the organic fraction of solid waste in the absence of air for

a speci ﬁ c mean cell residence time at a speci ﬁ c temperature. Anaerobic fermentation

processes are among the oldest processes for the stabilization of solids and biosolids,

and have been identi ﬁ ed and used primarily for the treatment of waste sludge and high

strength organic wastes ( Metcalf et al. 2004 ) . The latter authors illustrated that the

stabilization of the organic fraction of the solid waste is accomplished biologically

using a variety of microorganisms which convert the colloidal and dissolved carbona-

ceous organic matter into various gases and into protoplasm. Also, many toxic and

recalcitrant organic compounds such as non-halogenated aromatic and aliphatic com-

pounds can serve as a growth substrate and are degraded under anaerobic conditions.

Davis ( 2011 ) classi ﬁ ed the diverse microorganisms involved in the environmen-

tal processes by the following: energy and carbon source, oxygen relationship, and

temperature. The relationship between the source of carbon and the source of energy

for the microorganisms is signi ﬁ cant, since the carbon is the basic building block for

cell synthesis. A source of energy must be obtained from outside the cell to enable

synthesis to proceed. The bacteria that use the organic matter as a supply of carbon

are called heterotrophic bacteria and the ones that use the CO

as a supply for the

carbon needs are autotrophs. Also, bacteria can be classi ﬁ ed by their ability or

inability to utilize oxygen in oxidation-reduction reactions. Obligate aerobes are

microorganisms that must have oxygen, while obligate anaerobes are microorgan-

isms that cannot survive in the presence of oxygen. Facultative anaerobes can use

oxygen in oxidation/reduction reactions, and under certain conditions, they can also

grow in the absence of oxygen. Under anoxic conditions, a group of facultative

anaerobes called denitri ﬁ ers utilize nitrites (NO

−

) and nitrates (NO

−

) instead of

oxygen. Nitrate nitrogen is converted to nitrogen gas in the absence of oxygen in

the anoxic de-nitri ﬁ cation process.

In addition, the bacteria can also be classi ﬁ ed according to temperature, since

each species of bacteria reproduces best within a limited range of temperatures.

There are four temperature ranges used to classify bacteria. The psychrophile species

320

M. Albanna

grow best at temperatures below 20°C, while the mesophiles grow best at temperatures

between 20 and 45°C. The third and fourth groups; the thermophiles grow at tem-

peratures between 45 and 60°C, and the hyperthermophiles grow best above 60°C to

near boiling. It is important to note that the facultative thermophiles growth usually

extends from the thermophilic ranges into the mesophilic range (Hahn and Hoffstede

2010 ) . Usually, the AD processes are designed to operate in either the mesophilic

(20–45°C) or thermophilic (45–60°C) temperature ranges. Most of the studies

reported in literature have been con ﬁ ned to biogas production at mesophilic and

thermophilic temperatures. The psychrophilic digestion has not been as extensively

explored due to the fact that low temperatures signi ﬁ cantly decrease the bacterial

kinetics and consequently the biogas yield. Balasubramaniyam et al. ( 2008 ) reported

that it is not expected to design competitive systems using the psychrophilic diges-

tion. In addition, De Mes et al. ( 2003 ) reported that the psychrophilic digestion

requires longer retention time, which will result in larger reactors volume. The same

authors reported that the mesophilic digestion is an advantageous option since it

requires less reactor volume, and the thermophilic digestion can be viable when the

waste is discharged at high temperature range or when the pathogen removal is

considered crucial.

4 Phases of Anaerobic Biodegradation

As any other biological degradation process; the AD of the organic waste includes

a wide variety of microbial communities. The conversion of the complex organic

compounds into biogas involves a series of metabolic reactions and requires differ-

ent groups of microorganisms that convert complex macromolecules into low

molecular weight compounds (Wilkinson 2011 ; Hahn and Hoffstede 2010 ; Metcalf

et al. 2004 ) . The AD metabolism is carried out in a sequence of four stages: hydro-

lysis, acidogenesis, acetogenesis and methanogenesis.

Hydrolysis is the ﬁ rst step of the fermentation process, and it is essential since

the methanogenic and acetogenic bacteria are not able to use polymers. In this

phase, hydrolytic bacteria release extracellular enzymes that break down the par-

ticulate materials or the biodegradable non-dissolved organic solids and convert

them into soluble compounds that can be hydrolyzed (or loosened with water) fur-

ther to simple monomers. In this context, carbohydrates are broken down to simple

sugars, fat into fatty acids and glycerol, and proteins into amino acids by the actions

of hydrolytic bacteria (Wilkinson

2011 ) . These monomers and particulates can be

used as substrates in subsequent reactions and are used by the bacteria that perform

the fermentation. In the AD of the OFMSW; hydrolysis is considered the rate limiting

step, since it is relatively slow and it depends on the temperature and the complexity

of the waste ( Park and Ahnn 2011 ; De Mes et al. 2003 ) .

The hydrolysis phase is followed by the acidogenesis phase, where two groups

of fermentative bacteria transform the monomers produced in the previous phase

into many intermediary products. The amino acids, sugars, and some fatty acids are

321

12 Anaerobic Digestion of the Organic Fraction…

degraded further in this phase. Metcalf et al. ( 2004 ) indicated that the organic

substrates serve as both the electron donors and acceptors. Acidogenic bacteria

convert the monomers resulting from the hydrolysis phase into alcohols, volatile

fatty acids – such as butyric, propionic, and lactic acids-, in addition to keytones – such

as methanol, ethanol, acetone and glycerol. In the acetogenesis phase, the carbohy-

drates fermentation continues and acetate is formed as the main end product. The

latter authors illustrated that the main products that result from the fermentation

phases are acetate, hydrogen (H

), carbon dioxide (CO

), propionate and butyrate.

The latter products are fermented further to produce more H

, CO

and acetate.

Therefore, the main ﬁ nal products of the fermentation up to this phase are H

, CO

and

acetate, and they are the predecessors of the next phase; the methanogenesis phase.

The methanogenesis phase is carried out by a diverse group of microorganisms

known as methanogens. In the beginning of this phase, the aceticlastic methanogens

split the acetate into CH

and CO

. While, the second group of methanogens – the

hydrogen-utilizing methanogens use the H

as electron donor and CO

as the elec-

tron acceptor to produce CH

. The acetogens in this phase use CO

to oxidize the H

and form the acetic acid, and this acetic acid is also converted to CH

. Figure 12.3

illustrates the anaerobic digestion phases as adapted from Hahn and Hoffstede

( 2010 ) .

Fig. 12.3 Phases of anaerobic biodegradation (Adapted from Hahn and Hoffstede 2010 )

322

M. Albanna

De Mes et al. ( 2003 ) explained that in order to maintain stable digestion and to

prevent the accumulation of intermediate compounds, it is important that the different

biological conversions remain suf ﬁ ciently coupled during the AD process.

The stoichiometry of the anaerobic fermentation phases can be summarized as

following, and as adapted from Metcalf et al. (

2004 ) :

22 22

42HCO CH HO+→ +

(12.1)

422

44 32HCOO H CH CO H O

−+

+→+ +

(12.2)

242

42 3CO H O CH CO+→+

(12.3)

3422

43 2CH OH CH CO H O→++

(12.4)

33 2 4 2 2 3

4( ) 9 3 6 4CH N H O CH CO H O NH+→ + + +

(12.5)

342

CH COOH CH CO→+

(12.6)

The kinetics of the microbial process of AD may be divided into kinetics of

growth and kinetics of substrate utilization. Methanogenesis is the rate controlling

process as methanogens have much slower growth rates than acidogenic and aceto-

genic bacteria. The rate of increase of the biomass or microorganism concentration

is modeled as a ﬁ rst-order process (Nwabanne et al. 2009 ) .

5 Factors Affecting Anaerobic Biodegradation of the Organic

Fraction of Solid Waste

As the complex digestion processes involve different degradation steps, it is worth

noting that the interdependent bacterial consortium must continue to exist in equilib-

rium, as discussed in the previous section. If one of the environmental parameters

needed for the bacterial consortium involved in the processes changes, then the

system will shift away from equilibrium and will result in disturbing the processes,

and consequently the operating system. Thus, the following environmental parame-

ters must be monitored and controlled to ensure stability and functionality of biologi-

cal processes.

5.1 Temperature

Temperature is one of the most signi ﬁ cant environmental parameters that affect

the digestion process, since it affects the bacterial growth kinetics and stability,

and subsequently the biogas production. The temperature does not affect the microbial

323

12 Anaerobic Digestion of the Organic Fraction…

kinetics only, but also has an extreme effect on gas transfer rates and settling

characteristics of biosolids (Metcalf et al. 2004 ) .

At temperatures below their optimum for growth, microorganisms are unable to

attack substrates from their environment because of lowered af ﬁ nity. High tempera-

tures may lower the biogas production rates due to the production of volatile gases

that may include ammonia which also affect the bacterial activities at the methano-

genesis phase (Khalid et al.

2011 ) .

The biogas production may be carried out at different temperatures through the

thermophilic, mesophilic and psychrophilic digestion processes. Balasubramaniyam

et al. ( 2008 ) reported- based on case studies- that the daily biogas production rates

per m

of OFMSW at different temperatures varied from 0.05 m

of biogas at

temperature range from 6–10°C, to 0.1–0.33 m

of biogas at temperature range from

16–22°C, and to 0.2–0.33 m

of biogas at temperature range higher than 22°C.

This information may show that the biodigester system can function under different

temperatures, but the biogas production is less at lower temperature range.

Many researchers illustrated that the AD is usually carried out at the mesophilic

temperatures due to the fact that the processes require smaller energy expenses

(Metcalf et al. 2004 ) . Khalid et al. ( 2011 ) demonstrated that a temperature range

between 35 and 37°C is considered right for the production of biogas in the meso-

philic digestion, and temperatures below 65°C are considered appropriate in the ther-

mophilic digestion. Several research groups (Saha et al. 2011 ; Eskicioglu et al. 2009 ;

Metcalf et al. 2004 ) stated that the thermophilic digestion is usually more ef ﬁ cient at

volatile solids reductions and CH

production than mesophilic digestion, in addition

to many other advantages that include: increased solid destruction, higher loading

rates, as well as increased bacterial destruction. However, thermophilic digestion has

some disadvantages such as: need of energy and more sensitivity to toxicity and

environmental changes. The mesophilic bacteria are more robust to environmental

changes, and demonstrated considerable stability in many different applications, and

therefore, are more reliable in most AD facilities (Wilkinson 2011 )

Studying the effect of temperature is important for the design and operation of

biologically active AD systems. It is necessary to maintain a stable temperature

range due to the fact that methanogenic bacteria are sensitive to temperature changes,

therefore, ﬂ uctuations in temperature will result in disturbing the bacterial activities

which will result in ﬂ uctuations in biogas production rates.

5.2 Moisture Content

The high moisture content will enhance the AD due to the fact that higher water

contents affect the rate of dissolving degradable organic matter, while lower mois-

ture content levels will result in decrease in the bacterial activities, presumably due

to physiological response to water stress. From their experiments; many researchers

reported that the highest CH

production rates occurred at moisture content between

60 and 80% (Khalid et al. 2011 ) .

324

M. Albanna

It is dif ﬁ cult to maintain the same availability of water throughout the digestion

cycle. Therefore, moisture levels are one of the important parameters to be moni-

tored and controlled during the AD operations in order to avoid ﬂ uctuations in the

biogas production rates.

5.3 pH Value and Alkalinity

The pH plays a signi ﬁ cant role in the phases of AD. The different stages of AD are

pH dependent, since each bacterial group involved in the AD has a speci ﬁ c pH range

for optimal growth. Hydrolytic and acidogenic bacteria’s optimal pH range is between

5.2 and 6.3, while the pH range for methanogenic bacteria is between 6.8 and 7.4.

Acidogenesis and acetogenic bacteria will result in producing large amounts of

volatile fatty acids, and consequently the pH will drop. Since the optimal pH for

methanogenesis is between 6.8 and 7.4; adding the bicarbonate alkalinity to the

operating system is important to buffer the system.

It can be concluded that the ﬁ rst phases of AD may occur at a wide range of pH

values, but the methanogenesis phase will only proceed at neutral pH, therefore, it is

expected to get lower CH

production rates when the pH values are outside the range

of 6.5–7.5 (De Mes et al. 2003 ) . Hahn and Hoffstede ( 2010 ) demonstrated that in the

one-step AD process, the pH is usually maintained at the optimal pH for methanogenic

bacteria to prevent the dominance of acidogenic bacteria, which can cause the accumu-

lation of organic acids and digester instability. Ward et al. ( 2008 ) reported that control-

ling the pH range between 6.8 and 7.2 is most suitable for the overall AD processes.

5.4 Substrate

The substrate that provides the carbon source for the bacterial activities may vary in

type and complexity. The OFMSW can be classi ﬁ ed as follows (Tchobanoglous

et al. 1993 )

Water-soluble constituents, such as sugars, starches, amino acids, in addition to –

other organic acids,

Hemicellulose, –

Cellulose, –

Fats, lipids, and oils, which are long chain fatty acids and esters of alcohols, –

Lignin which is a polymeric material containing aromatic rings with methoxyl –

groups (−OCH

) , present in some paper products,

Lignocellulose, a combination of lignin and cellulose, –

Proteins, which are composed of chains of amino acids. –

The most suitable substrate can be characterized for carbohydrate, lipid, pro-

tein and ﬁ ber contents (Khalid et al. 2011 ) . They stated that carbohydrates are the

most important organic source of the MSW for biogas production, and starch is an

325

12 Anaerobic Digestion of the Organic Fraction…

effective cheap substrate compared to sucrose and glucose. The degradation of

carbohydrates provides around 600–700 L of biogas per kg organic dry matter with

50% or more CH

content (Hahn and Hoffstede 2010 ) .

Fat is an excellent substrate and can produce the highest CH

yield; however, it is

hardly soluble in water and can be dif ﬁ cult to blend into the digestion process (Hahn

and Hoffstede 2010 ) . From this perspective, the pre-treatment of this substrate

(mainly heating) may allow the fat to mix with the other substrate and become more

readily accessible to the bacteria. Hahn and Hoffstede observed that the degradation

of fat provides around 1,000–1,250 L of biogas per kg organic dry matter with

68–73% CH

content. The same authors explained that problems can occur when

using proteins as a substrate due to the nitrogen and sulphur content. Nitrogen is

released in form of ammonia when a protein is degraded, which will cause the pH to

rise. Also sulphur is released in form of hydrogen sulphide. Hahn and Hoffstede

( 2010 ) demonstrated that in the integrated process and during the degradation of

proteins, part of CO

produced in the biogas dissolves in the liquid phase and forms

hydrogen carbonate which buffers the ammonia released. Hahn and Hoffstede stated

that the degradation of protein yields around 600–700 L of biogas per kg organic dry

matter with the highest CH

content of 70–75%.

5.5 Nutrients

In addition to a carbon source, bacteria need other elements as nutrients for their

cellular metabolism. The available level of nutrients affects signi ﬁ cantly the AD

and consequently the biogas production. To improve the nutrients levels and the avail-

able C/N ratios; co-digestion of different organic mixtures was applied by several

researchers. The recommended carbon/nitrogen ratio for the anaerobic bacteria is

40. Khalid et al. ( 2011 ) reported that nutrients levels of the elements carbon:nitrog

en:phosphorus:sulphur (C:N:P:S) at 600:15:5:3 are adequate for the methanogene-

sis. If the nitrogen concentration is high, ammonia will accumulate in the system

and will cause inhibition of the biological process and will raise the pH (above 8.5).

If the carbon concentration is high, this will cause rapid consumption of nitrogen by

methanogenic bacteria and consequently this will lower the biogas production.

Inhibition of AD of waste with a high organic content is usually also caused by high

ammonia concentrations produced by the degradation of proteins from nitrogen-

rich waste (Cuetos et al. 2008 ) .

Generally, the bacteria need balanced macro-nutrients (such as carbon, nitrogen,

phosphorus, potassium, and sulfur) and micro-nutrients such as (cobalt, iron, copper,

nickel, zinc and others) ( Wilkinson 2011 ) . The macro-nutrients are essential as cell

building material, for microbial synthesis, and as primary source of energy. Most of

the micro-nutrients are required in the enzymes that play important roles in the

microbial activities.

There are some types of waste, such as the olive mill waste, that have special toxic

characteristics such as: acid pH, low alkalinity, and low nitrogen content. Sampaio

et al. ( 2011 ) reported that several synthetic nutrients and additions of chemicals

326

M. Albanna

and pretreatment may be included in the AD process in order to overcome these

problems and enable the AD of such waste. However, these pre-treatments involve

inputs which will raise the cost-bene ﬁ t ratio and may lead to organic load reduction

and alternatively reduce the biogas production.

5.6 Hydraulic and Solid Retention Times

The retention time represents the time the feedstock remains in the digester and it is

important for the bacterial growth. There are two measures of retention time:

hydraulic retention time (HRT) and solid retention time (SRT). The HRT – also

known as the residence time- is the theoretical period of time that the material

spends in the digester, and is calculated based on the volumetric loading rate at

which a digester is operated. The HRT is important for bacterial growth because the

material has to remain in the digester for a suf ﬁ cient time so that the microorgan-

isms have enough time to grow and multiply. Wilkinson ( 2011 ) stated that the HRT

will differ for each substrate, with a range of 14–30 days for dry processes, and for

wet processes HRT can be around 3 days. The HRT is the most important factor in

determining the volume of the digester which in turn determines the cost of the plant

(Abu-Hamatteh et al. 2010 ) .

The HRT can be calculated as follows:

()

(/ )

Digester Volume m

HRT day

Feed Stock Mass Flow m day

(12.7)

The SRT is the amount of time solid material is retained in the digester. It is also

a measurement of the concentration of bacteria maintained within the system with

time. High STR indicates that larger populations of biomass are retained within the

system, while low levels of SRT indicate that bacterial growth cannot ef ﬁ ciently

replace the bacteria lost with the ef ﬂ uent. Hahn and Hoffstede ( 2010 ) indicated that

the process where bacterial dilution is faster than its growth is called “wash out”.

The organic loading rate is an important design parameter and describes the

amount of degradable substrate or volatile solids that enter the system over a period

of time. Higher loading rate means greater amount of degradable substrate per unit

of time, which if too high can cause stress in the digester due to increased bacterial

activities and consequently acid production, decrease in pH and harm effects to the

methanogenic bacteria.

6 Advantages of Anaerobic Digestion

In addition to the biogas production as energy source and the transformation of

organic waste into high quality fertilizer; the waste treatment option through the

anaerobic digestion of the OFMSW has many advantages that added to the popularity

327

12 Anaerobic Digestion of the Organic Fraction…

of this option, such as the low energy required, small reactor volume, fewer nutrients

required, as well as improvement of hygienic conditions through reduction of

pathogens.

However, and as for the disadvantages; the processes may have longer start-up

and retention time compared to other biological processes, and it may also be sensi-

tive to the adverse effect of lower temperatures on the bacterial kinetics. Moreover,

the chemical composition and structure of lignocellulose materials may hinder the

rate of biodegradation of the OFMSW (Khalid et al.

2011 ) . Consequently, the com-

post that results from the biological degradation of the organic matter may need

further aerobic treatment to be safely used as compost.

6.1 Biogas

Traditionally, the AD has been employed to stabilize wastewater sludge and agricul-

tural waste. However, due to the global pressure to shift towards renewable and

alternative energy sources, the AD has become not only a way to treat the waste, but

also to recover the useable energy. The feedstock and biomass have extended to

include MSW and many types of waste that contain high percentages of organic

content. Recent attention has been given to the AD of the OFMSW for the produc-

tion of biogas. The various types of waste streams that can be digested with special

intention to recover the energy may include: domestic wastes such as vegetables,

fruits, and yard wastes; agricultural wastes; manure; and non-hazardous industrial

and domestic wastewater.

The biogas generated from the anaerobic digestion processes is generally com-

posed of 48–75% CH

, 30–45% CO

, and traces of other gases (Hahn and Hoffstede

2010 ; Ward et al. 2008 ) . The energy content depends mainly on the CH

content and

is between 5.0 and 6.5 kWh/m

raw biogas, and ignition temperature is about 650–

750°C (Hahn and Hoffstede 2010 ) . De Mes et al. ( 2003 ) reported that the fuel value

of the biogas that contains 55–75% (v/v) CH

ranges between 22 and 30 MJ/Nm

its higher heating value, and 19–26 MJ/Nm

in its lower heating value.

Several reports indicate that the AD of OFMSW yields promising amounts of

biogas (Khalid et al. 2011 ) . The latter authors indicated that the biogas yield may

vary from 200 to 850 L of CH

/kg of volatile solids, by using several types of organic

waste such as MSW, fruit and vegetable waste, manure, and oil mill waste. It is

worth mentioning that the lowest yield values were obtained from the MSW and

lignin rich organic waste, and the higher yield values from oil mill waste. Figure

12.4

illustrates the different types of organic waste and the biogas yield as reported by

Abu-Hamatteh et al. ( 2010 ) .

Zhou et al. ( 2011 ) indicated that the energy production by means of AD of the

municipal and agricultural wastes globally could reach up to 200 billion kWh/year.

Crolla et al. ( 2007 ) demonstrated the results of the team’s research to evaluate the

production of biogas and electricity from anaerobic digestion of dairy manure in

328

M. Albanna

two digesters built in two farms (160 and 105 dairy cows respectively) in Ontario,

Canada and operating under mesophilic conditions. The authors reported that the

biogas produced (419 and 357 m

/day respectively) was used for electricity genera-

tion, heat production to heat the digesters and the farm’s utilities around, and for

electricity selling to the grid. They con ﬁ rmed that the odors were reduced

signi ﬁ cantly as they observed 95% reduction of volatile fatty acids (VFAs). The

results also showed 70–95% reduction in pathogens. The data con ﬁ rmed the effect

of the digestion processes to reduce greenhouse gases from the waste, since the

emissions from storage without digestion were reduced from 245 to 56 kg CH

head/year from storage with digestion. Energy recovery by means of anaerobic

digestion has some bene ﬁ ts in most of the categories; the anaerobic digestion

showed saved potential impacts in global warming category. Bene ﬁ ts in acidi ﬁ cation

and nutrient enrichment categories are mainly due to saved NOx emissions from

avoiding coal-based electricity production.

The biogas yield is not only affected by the type and composition of waste used

as the substrate, but is also affected by several factors, including the microbial com-

position, temperature, moisture and bioreactor design. Eskicioglu et al. ( 2011 ) stud-

ied the AD of dry stillage since this biomass is rich in nutrients such as ﬁ ber, protein,

lipids and starch. Their study showed that anaerobic digestion processes of the corn

stillage produced 88 ± 8 L of CH

/L of stillage from mesophilic digestion, and

96 ± 19 L of CH

/L of stillage from thermophilic digestion, and at the end of the

experiment the organic removal ef ﬁ ciencies were similar. This observation was

explained by the fact that this substrate has a highly biodegradable nature and the

percentage of organic matter is 93% of the solid waste. In addition the results of

these experiments showed that the thermophilic digestion showed slightly higher

biogas yield than the mesophilic digestion.

Biogas Yield of Organic Dry Waste

200

400

600

800

1000

1200

Cattle

manure

Vegetable

waste

Chicken

faeces

Pig

manure

Sugar

beet

leaves

Grass Waste

edible oil

Biogas Yield

(L CH

/Kg of organic dry substance)

Fig. 12.4 Biogas yield of different organic dry waste (Adapted from Abu-Hamatteh et al. 2010 )

329

12 Anaerobic Digestion of the Organic Fraction…

6.2 Water Recycle

The re-use of the liquid ef ﬂ uents generated from the AD digestion process or the

digestate has signi ﬁ cant economic bene ﬁ ts. If the MSW is subjected to source sepa-

ration, then the digestate from the digestion process of the organic fraction can

comply with the governing quality standards. De Mes et al. (

2003 ) indicated that the

digestate resulting from the thermophilic digestion may be easily used as fertilizer

without much treatment, and in this case the digestate is a bio-fertilizer that can be

distributed through the network of local farmers.

It should be mentioned that all the remaining liquid ef ﬂ uents resulting from the

AD process must be disposed off. Therefore, the discharge to the wastewater treat-

ment plants will involve considerable costs for transport and treatment charges

depending on the ef ﬂ uent quality. From this perspective, the on-site reuse systems

may be advantageous, such as the use of water from the digestion process for sub-

strate dilution to reduce fresh water consumption. In addition, Alkan-Ozkaynak and

Karthikeyan ( 2011 ) illustrated that the digestate from anaerobic treatment of thin

stillage would be of suitable quality for recycling as process water. The digestate

resulting from the AD of thin stillage may offset part of fresh water requirement for

corn-ethanol production.

6.3 Combined High Solids Anaerobic Digestion/Aerobic

Composting

The recovery of the nutrients-rich compost to be used as soil conditioner or fertilizer

depends on the compliance with the governing quality standards and mainly the

concentration of the heavy metals and pathogens (De Mes et al. 2003 ) . Therefore,

the combined (high solids anaerobic digestion/aerobic composting) process is one

of the promising AD technologies. Tchobanoglous et al. ( 1993 ) illustrated the high

solids AD/aerobic composting process as a two stage process according to Fig. 12.5

below.

The ﬁ rst stage (according to Tchobanoglous et al. 1993 ) of the two stage process

involves the AD of the high solids, which will degrade 25–30% of the OFMSW to

produce biogas. The AD operates under thermophilic conditions (54–59°C) and HRT

OFMSW

High Solids

Anaerobic

Digester

Aerobic

Composter

Humus

Fuel for power

plants

Fig. 12.5 Flow diagram for high-solids anaerobic digestion/aerobic composting process (Adapted

from Tchobanoglous et al.

1993 )

330

M. Albanna

of 30 days. The second stage involves the aerobic composting of the anaerobically

digested solids to increase the solids content from 25 to 65% and more. The output

is ﬁ ne humus like material that can be used as soil amendment, with speci ﬁ c weight

of about 35 lb/ft

(560.65 kg/m

), and thermal content of about 6,000–6,400 Btu/lb.

Anaerobic digestion preserves the nutrient content of the manure, so that it can

be land applied as a fertilizer. Anaerobic digestion also greatly reduces the pathogen

content of the manure, and greatly reduces the odor.

6.4 Weight and Volume Reductions of Waste

Macias-Corral et al. ( 2008 ) reported that the AD of OFMSW showed weight and

volume reductions. The AD of cow manure showed mean weight and volume reduc-

tions of 43 and 20% respectively. The same authors also stated the co-digestion had

improved not only the biogas yield, but also the weight and volume reductions of

the waste; the co-digestion of the OFMSW and cow manure showed weight and

volume reductions of 78 and 98% respectively, and the co-digestion of the cotton

gin waste and cow manure showed weight and volume reductions of 52 and 58%

respectively.

7 Optimization of Anaerobic Digestion Processes

Previously, the AD process has been extensively used for sewage sludge treat-

ment. Nowadays, there is a great interest worldwide to use this process for biogas

production from different organic substrates, due to the increasing concerns on

energy from renewable and alternative resources. The biological treatment pro-

cess aims to create optimal degradation conditions, accelerate the AD process and

reduce the process time, reduce the volume of digestate and to enhance the biogas

production. From this perspective; co-digestion and pre-treatment of waste were

introduced.

7.1 Co-digestion

Co-digestion is a waste treatment method where different types of waste are mixed

and treated together. It is used to improve the yield of the AD of the organic wastes.

The bene ﬁ ts of co-digestion are dilution of toxic compounds, improved balance of

nutrients needed for bacteria, enhancement of the biodegradation of the organic

fraction of the waste, stabilization of the feed and improved nitrogen to carbon ratio.

Also, it was con ﬁ rmed that the co-substrate addition effectively decreased the lag

phase of the organic biodegradation which explains the increase in CH

production

331

12 Anaerobic Digestion of the Organic Fraction…

(Li et al. 2011 ) . All of these processes help improve the biogas yields resulting from

the biodegradation processes.

Several researchers conducted laboratory scale experiments for co-digestion of

OFMSW and animal manure or sludge. Many reported that the co-digestion of two

wastes can reduce inhibition of methanogenesis and increase CH

yields (Macias-

Corral et al.

2008 ) . The latter authors con ﬁ rmed that the co-digestion of OFMSW

and other agricultural waste with cow manure utilized intrinsic cellulose degrading

bacteria, and the additional nutrients in the manure optimized the digestion of the

ﬁ ber in the agricultural waste as well as the paper fraction of the MSW.

Table 12.1 demonstrates the CH

yield from the co-digestion of different types of

solid waste.

As illustrated in Table 12.1 , the co-digestion of different types of solid waste

enhanced the biogas production by a range of 40–250% of the biogas generated

from the biodegradation processes of a single type of waste.

Zhu and Yao ( 2011 ) proposed a logistics model for the biomass-to-bioenergy

industry with multiple types of biomass feed stocks. The numerical study con ﬁ rmed

that the use of multiple types of biomass may have several advantages, including

increase of the supply of biomass, smoothing the biogas production, and conse-

quently increasing the unit pro ﬁ t of the generated biogas.

It is concluded that the co-digestion can affect positively the digestion process due

to the clear synergistic effect which overcomes the imbalance in nutrients, reduces

inhibition, and improves biodegradation of the organic fraction of the waste.

7.2 Pretreatment

Khalid et al. ( 2011 ) have indicated that the hydrolysis of the complex organic matter

to soluble compounds is the rate-limiting step of anaerobic processes for wastes

with a high solid content; therefore, various physical, chemical and enzymatic pre-

treatments may be required to increase substrate solubility and accelerate the

biodegradation rate of OFMSW. The pretreatment methods include mechanical

treatment, ultrasound, chemical treatment, thermal hydrolysis and thermo-chemical

pretreatment in addition to microwave pretreatment (Shahriari et al. 2011 ) . The latter

authors reported that all of the reported methods have increased biodegradability of

biomass and other organic solid wastes with varying degrees of success. Eskicioglu

et al. ( 2009 ) explained that these methods could disrupt the extracellular polymeric

substances (EPS) and divalent cation network and increase the extent of waste acti-

vated sludge biodegradability through an enhanced hydrolysis phase.

Previous studies reported that the pretreatment of waste activated sludge can

enhance the CH

production for both mesophilic AD by 43–145%, and thermophilic

AD by 4–58% (Saha et al. 2011 ) . It was noted by Saha and coworkers that the

thermophilic digestion is usually more ef ﬁ cient at volatile solids reductions and CH

production than the mesophilic, which explains the reduced bene ﬁ ts of pretreatment

in thermophilic systems.

332

M. Albanna

Table 12.1 Biogas yield from the co-digestion of different types of solid waste

Substrate Co-substrate

yield

(L of biogas/kg

of total VS)

Percentage

of improvement Reference

Waste activated sludge – 117 ± 2.02 Li et al. (

2011 )

Waste activated sludge Fat, oil and grease 418 ± 13.7 +257% Li et al. (

2011 )

Waste activated sludge Kitchen waste 324 ± 4.11 +177%. Li et al. (

2011 )

Cow manure – 62 Macias-Corral et al. (

2008 )

OFMSW – 37 Macias-Corral et al. (

2008 )

Cow manure OFMSW 173 +179% Macias-Corral et al. (

2008 )

Cow manure Cotton gin waste 87 +40% Macias-Corral et al. (

2008 )

83% Olive mill waste 17% Piggery ef ﬂ uent 340 Sampaio et al. (

2011 )

Cattle excreta Olive mill waste 179 +337 adapted from Khalid et al. (

2011 ) , and Goberna et al. ( 2010 )

Fruit and vegetable waste Abattoir wastewater 611 +51.5% adapted from Khalid et al. (

2011 ) , and Bouallagui et al. ( 2009 )

Potato waste Sugar beet waste 680 +62% adapted from Khalid et al. (

2011 ) , and Parawira et al. ( 2004 )

Slaughter house waste MSW 500 +100% Cuetos et al. (

2008 )

333

12 Anaerobic Digestion of the Organic Fraction…

The positive effects of different pre-treatment processes on the bacterial digestion

of the OFMSW may vary. Saha et al. ( 2011 ) studied the effects of different pretreat-

ment methods that were applied to pulp mill waste sludge to enhance CH

production

and reduce digester sludge retention time. Their experiments showed that micro-

wave pretreatment proved to be the most effective in terms of biodegradation rate,

since this pretreatment method increased the speci ﬁ c CH

yield by 90% compared

to samples without treatment in mesophilic digestion processes. They con ﬁ rmed

that although the chemo-mechanical pretreatment was the least method to enhance

the CH

yield, this method was the least energy intensive for both mesophilic and

thermophilic digestion of the waste activated sludge. As an example, they showed

that the input energy of the chemo-mechanical pretreatment in mesophilic digestion

was 1,111 kWh/t of total solids and the CH

output was 1,644 kWh/t of total solids.

For the ultrasound pretreatment in the same conditions (ultrasound for 90 min), the

input energy was 32,700 kWh/t of total solids and the CH

output was 1,780 kWh/t

of total solids. As for the microwave pretreatment (microwave temperature 175°C);

the input energy was 218,000 kWh/t of total solids and the CH

output was

2,206 kWh/t of total solids. These results lead to the conclusion that neither the

microwave nor the ultrasound treatment were energy economical due to much

smaller CH

yields compared to the high energy inputs.

Park and Ahnn ( 2011 ) investigated the effect of thermal and microwave pretreat-

ments on the AD of mixtures of primary municipal and secondary municipal sludge

in mesophilic digesters at different retention times. Their results showed that the

biogas production was 33% higher when the samples were thermally pretreated and

53% when the samples were microwaved. Also, the results showed that the micro-

wave pretreatment is more effective than thermal pretreatment in increasing the

solublization degree and mesophilic anaerobic biodegradation of the different sewage

sludge.

Several studies (Marin et al. 2011 ; Saha et al. 2011 ; Park and Ahnn 2011 ) have

reported that the microwave treatment is a promising pretreatment option to acceler-

ate the hydrolysis in anaerobic digestion processes. However, Solyom et al. ( 2011 )

concluded that in all microwave treatment experiments, the absorbed energy shall

be reported as an important operating variable, which may affect signi ﬁ cantly the

process operating conditions.

8 Bioreactors and Digesters Types

There are many ways in which the AD can occur. The modern advancements in the

design of bioreactors improved the use of AD techniques for the treatment of

OFMSW at a much higher rate than the conventional land ﬁ lling processes (Khalid

et al. 2011 ) . There are different types of bioreactor designs that have been developed

in the past decades targeting the optimization of the reaction rates of the biological

processes. The operational concerns associated with the anaerobic processes may

include long start-up time, sensitivity to possible toxic compounds present in the

334

M. Albanna

waste, operational stability, and corrosiveness of the generated gas (Metcalf et al.

2004 ) . The AD bio-processes are almost the same; however, they may vary depending

on: the composition of the substrate, the volume of the waste stream, the complexity

of design as well as the construction and operation. The main differences concerning

the design of the different digesters vary according to the operating parameters,

such as: the biogas potential of the substrate, the dry and wet processes, the meso-

philic and thermophilic processes, the mechanically mixed and no-mixed reactors,

the batch and continuous reactors and one-stage or multi-stage processes.

Khalid et al. (

2011 ) stated that there are three main groups of bioreactors, and as

follows:

Batch reactors: are considered the simplest in design. The digestion processes –

are quick, simple and cheap. The operations are based on ﬁ lling the reactors with

the feed stock that is kept inside the reactor for a designed retention time. Yet, the

limitations of this main type of reactors may include; high ﬂ uctuations in gas

quantity and quality, looses in quantities during emptying, as well as limitation

in the designed height.

One stage continuously fed system: in this type all the biochemical reactions take –

place in one bioreactor.

Two-stage or multi-stage continuously fed systems: the biochemical processes –

that include hydrolysis, acidi ﬁ cation, acetogenesis and methanogenesis, take

place separately. In this context, Shahriari ( 2011 ) explained that the multi-stage

or multi phase AD process is based on the principle of optimizing the conditions

for the individual biological reactions of AD, with the hydrolytic bacteria in one

reactor and the methanogens in another reactor in order to increase gas produc-

tion and waste stabilization rates. The system is based on separation of the bacte-

rial consortia based on hydraulic separation with a short residence time in the

acid phase digester followed by a longer residence time in the methanogenic

phase reactor. The two stage system is the most promising and optimized process

for the biological treatment of the OFMSW as well as the biogas production, due

to the fact that it allows the selection and enrichment of different bacteria involved

in each phase. Macias-Corral et al. ( 2008 ) reported that their experiments showed

that the biogas in two-phase AD had a higher CH

content (72% or more) than

the conventional single-phase systems, which usually produce a gas that contains

60% CH

The main three types of bioreactors mentioned above in addition to a variety of

methanizers such as continuously stirred tank rectors (CSTR), tubular bioreactor,

anaerobic sequencing batch reactor, up ﬂ ow anaerobic sludge blanket (UASB) and

anaerobic ﬁ lters have been used successfully for the biological treatment of the

OFMSW (Khalid et al.

2011 ) .

Hahn and Hoffstede ( 2010 ) and De Mes et al. ( 2003 ) illustrated digester types

used in a wide range of different substrates as follows:

High and low rates systems: the low rate systems are usually operated with –

long HRT and are usually used to treat slurry and solid wastes that necessitate

335

12 Anaerobic Digestion of the Organic Fraction…

a long time for appropriate anaerobic biodegradation, while high rate systems

are operated with short HRT and are used for wastewater. The high-rate systems

have a mechanism either to retrain bacterial sludge mass in the digester or to

separate bacterial sludge from the ef ﬂ uent and return it to the digester. The high

rate systems are recognized to be cost effective and ef ﬁ cient. High rate systems

can be batch, plug ﬂ ow and CSTR, while the low rate systems can be ﬂ uidized

bed and UASB.

Wet and dry fermentation systems: The wet fermentation systems are usually –

used to digest low solid content and the digester type is usually the CSTR. The

dry fermentation systems are usually used to digest solid feed stock with higher

solid content (30% and more) and usually require less process water and have

lower heating costs. In this context, Khalid et al. (

2011 ) demonstrated that the

wet bioreactors may contain 16% or less total solids, while the dry bioreactors

may contain 22–40% total solids.

De Mes et al. ( 2003 ) demonstrated that the wet digestion has been carried out in

a number of commercial and pilot scale plants, such as: AVECON in Finnland;

VAGRON in the Netherlands; and Bigadan process in Denmark and Sweden. The

dry fermentation systems have been developed and used in a number of commercial

and pilot scale plants around the world, namely: the Valorga process in France; the

Dranco or Dry Anaerobic Composting system in Belgium; the Komogas process in

Switzerland; and the Biocel system in the Netherlands.

Single and double stage systems: Single stage reactors use one reactor for both –

the acidogenic phase and the methanogenic reactions of AD. The single stage

AD processes are currently used at the majority of the existing facilities due to

simplicity and lower costs. It is based on the fact that the digestion process can

basically be divided into the main steps hydrolysis and methanogenesis, and

these processes occur in the same digester. In order to ensure successful diges-

tion the pH value has to be kept around neutral.

The two- and multi-stage AD process is based on the principle of optimizing the

conditions for the individual biological reactions of AD, with the hydrolytic bacteria in

one reactor and the methanogens in another reactor in order to increase gas production

and waste stabilization rates. De Mes et al. ( 2003 ) indicated that there are two types of

two-phase digestion systems; the different stages are separated based on a wet fermen-

tation in the ﬁ rst one, and separated based on a dry fermentation in the second one. The

two or multi-stage digestion systems have been developed and used in a number of

commercial and pilot scale plants around the world, namely: the BTA process in

Germany which is a three-phase liquid system for digestion of the OSMSW; and the

BRV process in Switzerland which is based on aerobic/anaerobic conversion systems.

Mesophilic and thermophilic systems: The mesophilic AD processes require

longer HRT; however they are not ef ﬁ cient in killing pathogens. Thermophilic AD

provides higher growth rates of the bacteria involved and higher loading rates of

organic materials as well. These processes are adapted usually for AD of industrial

organic wastes, manure and sewage sludge.

336

M. Albanna

9 Economy of Anaerobic Digestion

The AD of the OFMSW has a very important role as an alternative source of energy,

and may help to face the crucial energy challenges in the coming years. Fox and van

Kalles (

2010 ) estimated that the biodegradable waste in the United Kingdom is

around 100 million tonnes, all of which is suitable as a feedstock for the AD. They

added that if this waste is anaerobically digested, the potential renewable energy

generation could be 10–20 Tera Watt per hour (TWh) of heat and electricity, and this

renewable energy amount could form up to around 10% of the energy demand for

the country. Unlike the fossil fuel or coal; the biogas generated does not contribute

either to the greenhouse gas effect or to the ozone depletion.

Under the right conditions a biogas plant will yield several bene ﬁ ts for the end-

users, the main bene ﬁ ts are (Bond and Templeton 2011 ; Balasubramaniyam et al.

2008 ; De Mes et al. 2003 ) :

1. Production of energy through CH

recovery for lighting, heat, and electricity,

2. Improved sanitation through reduction of pathogens, worm eggs and ﬂ ies, in

addition to raw waste stabilization,

3. Environmental bene ﬁ ts through the reduction of greenhouse gas emissions from

the degradation of the OFMSW in land ﬁ lls and open dumps,

4. Retention of the fertilizer nutrients,

5. The AD processes usually have little energy needs or requirements. De Mes at al.

( 2003 ) reported that the energy requirements for the processes are in the range of

0.05–0.1 kWH/m

, depending on the need for pumping and recycling ef ﬂ uents,

6. Economic bene ﬁ ts (a substitute to spending on expensive fuels and fertilizers), in

addition to relatively low construction costs.

The AD of OFMSW has become a well-established technology mostly in Europe.

Boldrin et al. ( 2011 ) reported that as the biological treatment is becoming a com-

mon option for management of the OFMSW, there are around 2,000 composting

facilities in Europe, as well as 185 AD plants. Many technological developments

have taken place recently in the biogas sector; nevertheless there is still great poten-

tial for technical developments and improvements to solve the pending issues that

affect the optimization of the biological processes.

Fox and van Kalles ( 2010 ) and De Mes et al. ( 2003 ) stated that although the

potential bene ﬁ ts of the AD are evident, this technology has some disadvantages and

suffered a lack of wide spread implementation due to the following reasons: the vari-

ability of substrates which affects the process stability; the high sensitivity of metha-

nogenic bacteria that produce the biogas to a large number of chemical compounds

that may be toxic; the added time and costs associated with the source separation

and collection systems of the OFMSW; the lack of understanding of the technology

options and methods to optimize the biogas yield; the lack of con ﬁ dence in the

quality of digestate for market use; and ﬁ nally the inference of multiple governmental

associations where each have their own goals and ideas for end product use.

In order to balance the advantages and disadvantages of the AD process for any

industry or community, life cycle assessment (LCA) is a useful systematic approach and

337

12 Anaerobic Digestion of the Organic Fraction…

viable standardized methodology for reporting and assessing the effects associated

with the biological treatment ( Boldrin et al. 2011 ) . Boldrin stated that a complete

LCA study is iteratively carried out through four phases: goal and scope de ﬁ nition,

life cycle inventory and impact. In order to assess the life cycle impacts of AD tech-

nology, it is important to consider: the emissions needed to transport the waste and/

or to manage the system; the emissions resulting or mitigated from the treatment;

the use of the outputs; and the emissions mitigated as a result of displacement from

other sources (Fox and van Kalles

2010 ) .

De Mes et al. ( 2003 ) indicated that the costs for electricity produced from biogas

in the year 2000 were between 0.1 and 0.22 Euro/kWh, while the electricity from

land ﬁ ll gas was produced for 0.04–0.07 Euro/kWh. Despite this cost difference,

ﬁ nancial incentives are encouraged for enhancing the competitiveness of the AD

process and the biogas plants, and will have a positive impact on the expansion of

the AD processes.

10 Conclusions

The concept of anaerobic biodegradation of OFMSW as engineered systems for

solid waste treatment and management is viable and may extend the biogas pro-

duction to its maximum potential. It is concluded that the AD has become increas-

ingly popular in recent years as a sustainable technology producing clean energy

and green byproducts. In the developing countries, the AD of OFMSW shall be

encouraged as a promising option for the treatment of the MSW to face the ele-

vated challenges of solid waste management. The biogas yield varies with the types

of the substrates/feedstock available and the process conditions. It was reported by

several studies that the OFMSW’s biogas yield may vary between 80 and 200 m

of waste. Co-digestion is a signi ﬁ cant factor for improving the reactors ef ﬁ ciencies

which will result in economic feasibility of the AD systems. The AD process can

be engineered to optimize the biogas yield by controlling the operating conditions

such as temperature, moisture content, bacterial activities and waste properties. It is

worth noting that the different government’s policies and regulations are vital to

encourage the investment in the AD process which contributes to the alternative

energy production. The recent developments of the AD techniques have shown that

increasingly more feed stocks can be used in this process, and then, the AD tech-

nique can be used as an effective global treatment option for many types of gener-

ated wastes. The AD of the OFMSW can be described as relatively new in many

countries and its application is still in the initial phase. In this context, ﬁ nancial and

legislative incentives are key elements for economic feasibility of the biogas digesters

and plants.

The optimized engineering designs that will assure lower operating and mainte-

nance costs and efforts, improved ef ﬁ ciencies, and increased functionality will

de ﬁ nitely promote the AD as an attractive solid waste treatment option and viable

technique to generate a sustainable alternative source of energy.

338

M. Albanna

References

Abu-Hamatteh ZSH, Al-Jufout S, Abbassi B, Besieso MS (2010) Biogas energy: unexplored

source of a renewable energy in Jordan. European Association for the Development of

Renewable Energies, Environment and Power Quality (EA4EPQ). In: International conference

on renewable energies and power quality (ICREPQ’10) Granada (Spain), The European

Association for the Development of Renewable Energies, 23–25 Mar 2010

Albanna M (2011) Solid waste management options and their impacts on climate change and human

health. In: Malik A, Grohmann E (eds) Environmental protection strategies for sustainable

development. Springer Dordrecht Heidelberg London New York, pp 498–524

Alkan-Ozkaynak A, Karthikeyan KG (2011) Anaerobic digestion of thin stillage for energy recovery

and water reuse in corn-ethanol plants. Bioresour Technol 102:9891–9896

Balasubramaniyam U, Zisengwe L.S, Meriggi N, Buysman E, Zeeman G (2008) Biogas production

in climates with long cold winters. Wageningen University, Wageningen.

http://www.susana.org/

docs_ccbk/susana_download/2-1502-biogascoldclimatesweb-wecf0608.pdf

. Cited 31 May 2012

Boldrin A, Neidel TL, Damgaard A, Bhande G, Moller J, Christensen TH (2011) Modelling of

environmental impacts for biological treatment of organic municipal waste in EASEWASTE.

Waste Manag 31:619–630

Bond T, Templeton M (2011) History and future of domestic biogas plants in the developing world.

Energy Sustain Dev 15:347–354

Bouallagui H, Lahdheb H, Romdan E, Rachdi B, Hamdi M (2009) Improvement of fruit and veg-

etable waste anaerobic digestion performance and stability with co-substrates addition. J

Environ Manag 90:1844–1849

Chalmin P, Gaillochet C (2009) From waste to resource.

http://www.uncrd.or.jp/env/spc/docs/

plenary3/PS3-F-Veolia_Hierso-Print%20abstract.pdf

. Cited on 31 May 2012

Crolla A, Kinsley C, Desilets E, Pattey E, Desjardins R, Ball-Coelho B, Sahota T (2007) Assessment

of the production and land application of anaerobically digested manure from medium sized

livestocks farms. In: Growing the margins: energy conservation and generation for farms and

food processes, London Convention Center, London, Ontario, Canada, 11–14 April 2007

Cuetos MJ, G’omez X, Otero M, Mor’an A (2008) Anaerobic digestion of solid slaughterhouse waste

(SHW) at laboratory scale: in ﬂ uence of co-digestion with the organic fraction of municipal solid

waste (OFMSW). Biochem Eng J 40:99–106

Davis M (2011) Water and wastewater engineering- design principles and practices. McGraw-Hill

Inc. International Edition, New York. ISBN 978-007-128924-5

De Mes TZD, Stams AJM, Reith JH, Zeeman G (2003) Methane production by anaerobic diges-

tion of wastewater and solid wastes. In: Reith JH, Wijffels RH, Barten H (eds) Bio-methane

and bio-hydrogen- status and perspectives of biological methane and hydrogen production.

Dutch Biological Hydrogen Foundation, Netherlands. ISBN 90-9017165-7

Eskicioglu C, Prorot A, Marin J, Droste RL, Kennedy KJ (2008) Synergetic pretreatment of sewage

sludge by microwave irradiation in presence of H

for enhanced anaerobic digestion. Water

Res 42:4674–4682

Eskicioglu C, Kennedy KJ, Droste RL (2009) Enhanced disinfection and methane production from

sewage sludge by microwave irradiation. Desalination 248:279–285

Eskicioglu C, Kennedy K, Marin J, Strehler B (2011) Anaerobic digestion of whole stillage from

dry-grind corn ethanol plant under mesophilic and thermophilic conditions. Bioresour Technol

102:1079–1086

EU- European Commission (2001) Waste management options and climate change. Of ﬁ ce for

of ﬁ cial publications of the European Communities, Luxembourg, ISBM 92-894-1733-1.

http://

ec.europa.eu/environment/waste/studies/pdf/climate_change.pdf

. Cited 31 May 2012

Eurostat European Commission (2012) Municipal waste statistics.

http://epp.eurostat.ec.europa.

eu/statistics_explained/index.php/Municipal_waste_statistics

. Cited 10 June 2012

Fox N, van Kalles M (2010) Anaerobic digestion of municipal food waste on Merseyside: a practical

assessment. Masters thesis, Cran ﬁ eld University

339

12 Anaerobic Digestion of the Organic Fraction…

Goberna M, Schoen MA, Sperl D, Wett W, Insam H (2010) Mesophilic and thermophilic co-

fermentation of cattle excreta and olive mill wastes in pilot anaerobic digesters. Biomass

Bioenergy 34:340–346

Hahn H, Hoffstede U (2010) Assessment report on operational experience. Project supported

by the European commsion under RTD contract: 019795.

http://www.biogasmax.eu/media/

d2_11_biogasmax_iwes_v ﬁ nal_nov2010__095398400_1109_10022011.pdf

. Cited on 31

May 2012

Khalid A, Arshad M, Anjum M, Mahmood T, Dawson L (2011) The anaerobic digestion of solid

organic waste. Waste Manag 31:1737–1744

Lardinois I, van de Klundert A (1993) Organic waste options for small-scale resource recovery, Urban

solid waste series 1. TOOL, Amsterdam and Waste Consultants, Gouda. ISBN 90-70857-33-2

Li C, Champagne P, Anderson B (2011) Evaluating and modeling biogas production from municipal

fat, oil, and grease and synthetic kitchen waste in anaerobic co-digestions. Bioresour Technol

102:9471–9480

Macias-Corral M, Samani Z, Hanson A, Smith G, Funk P, Yu H, Longworth J (2008) Anaerobic

digestion of municipal solid waste and agricultural waste and the effect of co-digestion with

dairy cow manure. Bioresour Technol 99:8288–8293

Marayyan B (2004) Methane gas emissions from land ﬁ ll: opportunities and constraints – the case

of Al-Russifa city. J Environ Assess Policy Manag 6(3):367–384

Marin J, Kennedy KJ, Eskicioglu C (2011) Enhanced solubilization and anaerobic biodegradability

of source-separated kitchen waste by microwave pre-treatment. Waste Manag Res

29(2):208–218

Metcalf M, Eddy Metcalf & Eddy, Inc., Tchobanoglous G, Burton F, Stensel HD (2004) Water and

wastewater engineering-design principles and practices. McGraw-Hill International Edition,

New York, ISBN 978-007-128924-5

Narayana H (2009) Municipal solid waste management in India: from waste disposal to recovery

of resources? Waste Manag 29:1163–1166

Nwabanne JT, Onukwuli OD, Ifeakandu CM (2009) Bio-kinetics of anaerobic digestion of municipal

waste. Int J Environ Resour 3(4):511–516

EIONET – European Environmental Information and Observation Network (2009) What is waste?.

http://scp.eionet.europa.eu/themes/waste/#10 . Cited 31 May 2012

Parawira W, Murto M, Zvauya R, Mattiasson B (2004) Anaerobic batch digestion of solid potato

waste alone and in combination with sugar beet leaves. Renew Energy 29:1811–1823

Park WJ, Ahnn JH (2011) Effects of microwave pretreatment on mesophilic anaerobic digestion

for mixture of primary and secondary sludges compared with thermal pretreatment. Environ

Eng Res 16(2):103–109

Saha M, Eskicioglu C, Marin J (2011) Microwave, ultrasonic and chemo-mechanical pretreat-

ments for enhancing methane potential of pulp mill wastewater treatment sludge. Bioresour

Technol 102:7815–7826

Sampaio MA, Goncalves MR, Marques IP (2011) Anaerobic digestion challenges of raw olive mill

wastewater. Bioresour Technol 102:10810–10818

Shahriari H (2011) Enhancement of anaerobic digestion of organic fraction of municipal solid

waste by microwave pretreatment. Ph.D. of applied sciences in environmental engineering,

University of Ottawa, Canada

Shahriari H, Warith M, Kennedy K (2011) Effect of microwave temperature, intensity and mois-

ture content on solubilisation of organic fraction of municipal solid waste. Int J Environ Technol

Manag 14:67–83

Shanghai Manual (2011) A guide for sustainable urban development of 21sr century, United

Nations Bureau International des Expositions, Shanghai 2010 World Exposition Executive

Committee

Solyom K, Mato R, Perez-Elvira SI, Cocero MJ (2011) The in ﬂ uence of the energy absorbed from

microwave pretreatment on biogas production from secondary wastewater sludge. Bioresour

Technol 102:10849–10854

340

M. Albanna

Strange K (2002) Overview of waste management options; their ef ﬁ cacy and acceptability.

In: Hester RE, Harrison RM (eds) Environmental and health impact of solid waste management

activities, Issues in environmental science and technologies no. 18. Royal Society of Chemistry,

Cambridge, pp 1–52

Tchobanoglous G, Theisen H, Vigil S (1993) Integrated solid waste management – engineering

principles and management issues. McGraw-Hill Inc. International Edition, New York. ISBN

0-07-112865-4

UNESCAP- United Nations Economic and Social Commission for Asia and the Paci ﬁ c (2000)

Sustainable Asia – waste.

http://www.unescap.org/esd/environment/soe/2000/documents/

CH08.PDF

. Cited 31 May 2012

USEPA - United States Environmental Protection Agency (2011) Municipal solid waste generation,

recycling, and disposal in the United States: facts and ﬁ gures for 2010. Solid Waste and

Emergency Response (5306P), Washington, DC

USEPA – United States Environmental Protection Agency (2008) Waste management resources.

http://www.epa.gov/tribalcompliance/wmanagement/wmwastedrill.html. Cited 12 Dec 2012

Ward AJ, Hobbs PJ, Holliman PJ, Jones DL (2008) Optimization of the anaerobic digestion of

agricultural resources. Bioresour Technol 99:7928–7940

Wilkinson A (2011) Anaerobic digestion of corn ethanol thin stillage for biogas production in batch

and down- ﬂ ow ﬁ xed ﬁ lm reactor., Master of applied sciences in environmental engineering,

University of Ottawa, Canada

Williams P (2005) Waste treatment and disposal. John Wiley and Sons Ltd., West Sussex. ISBN

0-470-84912-6

Zhou H, Lof ﬂ er D, Kranert M (2011) Model-based predictions of anaerobic digestion of agricul-

tural substrates for biogas production. Bioresour Technol 102:10819–10828

Zhu XA, Yao Q (2011) Logistics system design for biomass-to-bioenergy industry with multiple

types of feed stocks. Bioresour Technol 102:10936–10945

341

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_13, © Springer Science+Business Media Dordrecht 2013

Abstract Sustainable agricultural systems must be adopted to increase the food and

ﬁ ber production keeping in view of human health and increase in population; the

number of undernourished has increased to almost 20% (The state of food insecurity

in the world economic crises – impacts and lessons learned. In Food and Agriculture

Organization of the United Nations, Rome). Insect pests have been causing serious

damage in the ﬁ elds and stored grains and their products. Interventions is required to

limit the losses, therefore, synthetic insecticides have played a signi ﬁ cant role in their

management for more than 60 years. Indiscriminate use of insecticides have left unde-

sirable residues in the environment, which are toxic to human beings and non target

organisms as well as insects have developed resistance against them and resurgence of

pests that lead to ﬁ nd a suitable, sustainable and ef ﬁ cient method of management.

Microorganisms: bacteria, viruses, fungi and protozoa form the most abundant and

diverse groups, which offer a vast resource for exploitation to use in the management

program. Bacillus thuringiensis is a gram positive, occurs in soil and ubiquitous in

distribution. It produces parasporal crystalline body which contains one or more c ry

proteins that can be toxic to a number of insects. c ry proteins are encoded by c ry genes

and 200 of them are identi ﬁ ed. Similarly, a number of insect pests are also vulnerable

to viral diseases. Nuclear Polyhedrosis and Granulosis Viruses are commonly used

against the Lepidoptera. They are highly species speci ﬁ c and safer to human beings.

Fungi, often act as important natural control agents that limit the insect population.

Promising results are obtained by Beauveria bassiana and Metarhizium anisopliae

against many insect pests. B. bassiana grows naturally in soil throughout the world

and causes white muscardine disease. Therefore, intensive work is required to improve

the ef ﬁ cacy of microbial insecticides through molecular biology and genetic engineer-

ing to enhance their role in the insect management for better food security.

M. S. Ansari (*) • S. Ahmad • N. Ahmad • T. Ahmad • F. Hasan

Department of Plant Protection, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh 202002 , India

e-mail: mohdsansari@yahoo.com ; salmanalig.alig@gmail.com ;

nadeem777in@yahoo.com ; fazilento10@gmail.com

Chapter 13

Microbial Insecticides: Food Security

and Human Health

M. Sha ﬁ q Ansari , Salman Ahmad , Nadeem Ahmad , Tufail Ahmad ,

and Fazil Hasan

342

M.S. Ansari et al.

Keywords Microbial insecticides • δ -endotoxin • Entomopathogenic fungi • Food

security • Biocontrol

1 Introduction

Agriculture is the backbone of economy of many countries and approximately, two

billion people in the world depend on agriculture for their livelihood. Majority of

them are farming families with small holdings, small-scale breeders and entrepre-

neurs, laborers and nomadic groups. Food security is a major concern because of

increase in human population and simultaneously increasing food demand. Ef ﬁ cient

and sustainable agricultural systems would be adopted to meet the demand of humans

who are living below poverty line. Food and ﬁ ber crops are damaged by over 10,000

species of insects, with an estimated annual loss of 13.6% globally (Benedict 2003 ) .

Despite the annual investment of US $35,000 for the application of 3 million tonnes

of pesticides and the use of various biological and other non-chemical methods of

control worldwide, global crop losses remain a matter of concern (Pimentel 2007,

2009 ) . The insect pests are polyphagous and migratory in nature, with high fecundity

and short life span and diapausing under adverse conditions . They are the most suc-

cessful group of animals that exist in a countless of environment and nearly 645

species of insects and mites have already developed resistance against insecticides

including B. thuringiensis (Narayanan 2004 ; Sayyed et al. 2004 ; Sarfraz and Keddie

2005 ) . In order to reduce the losses caused by the insects and to meet the demands of

increasing population, synthetic chemical insecticides have played an important role

in the management of insect pests for nearly 60 years (Smith 1970 ; Kumar et al.

2008 ) . Despite of these credentials, much use of insecticides has been ecologically

unsound. Therefore, alternate method of control strategy may be adopted.

Insect pathogens have great potential and can be used in pest management in at

least four ways by: (1) Utilizing naturally occurring diseases (2) Introduction of

insect pathogen in insect pest population (3) Application of insect pathogens (or their

products) as microbial insecticides (4) Novel manipulation of insect pathogen genes,

usually involving recombinant DNA technology. This article explores the role of

microbial genetic resources for food security without deterioration of environment

and human health.

2 Types of Insect Pathogens

(a) Bacteria

(b) Viruses

(d) Protozoa

343

13 Microbial Insecticides: Food Security and Human Health

2.1 Bacteria

Bacillus thuringiensis was recognized as living insecticides by Steinhaus ( 1954 )

that occurs naturally in the soil and is distributed worldwide. It is a gram-positive,

aerobic, rod-shaped and produces a proteinaceous parasporal crystal during

sporulation that consists of α , β -exotoxins and δ - endotoxin, which are highly

insecticidal even at very low concentrations (Xavier et al. 2007 ) . The molecular

weight of proteins of the bipyramidal crystal (5 × 15.5 nm) is of 120,000 Da.

The insecticidal activity is attributed to the parasporal crystal, δ -endotoxin

which is toxic to the larvae of Lepidoptera, Diptera, and Coleoptera but harm-

less to human being and non-target organisms ( de Maagd et al. 2000 ; Kumar

et al. 2008 ) .

The insecticidal crystal proteins are encoded by cry genes and nearly 200 genes

are classi ﬁ ed on the basis of amino acid homology and insecticidal activity

(Hernandez and Ferre 2005 ; XU Jian et al. 2006 ) . The proteins toxic for Lepidopteran

insects belong to cry 1, cry 2, and cry 9; for Coleopteran cry 3, cry 7 and cry 8

(Fig 13.1a–c ) and for Dipteran cry 2, cry 4, cry 10, cry 11, cry 16, cry 17, and cry 19

genes (Crickmore et al. 1998 ) .

B. popillae is used as a biocontrol agent that causes milky disease in the larvae

of Japanese beetle (Fig 13.1d ). The bacterium is applied to turf grass as a dust which

only controls the grubs effectively and virtually has no adverse effect on other soil

borne insects.

Fig. 13.1 Bacillus

thuringiensis ’s Spores ( a ),

cry proteins ( b ), Bt infected

silkworm larvae ( c ), B.

popillae infected larvae of

Japanese beetle ( d )

344

M.S. Ansari et al.

2.1.1 Mode of Entry

Bacterial pathogens must be ingested by a susceptible insect. The enzymes produced

by bacteria viz. lecithinase, proteinase and chitinase within the digestive tract that

act on the midgut cells and enable them to enter the hemocoel of insect. Toxins are

produced in the initial stages and play a signi ﬁ cant role in the invasion of bacteria

through the digestive tract. In some cases the bacteria multiply in the gut before

invading the hemocoel, when the larva is placed under stressed conditions, such

as abnormal nutrition, unfavorable temperature and humidity or other microbial

infections.

2.1.2 Mode of Action

The primary action of c ry toxins is to lyse midgut epithelial cells in the target insect

by forming pores in the cells of apical microvilli membrane (Aronson and Shai

2001 ; de Maagd et al. 2000 ; Bravo et al. 2004 ) . Each bacterial cell forms a spore at

one end and a crystal at the other. Insecticidal activity of Bt is due to the presence of

crystalline protein body called parasporal crystal or δ -endotoxin formed during

sporulation (Heimpel 1967 ) that contains protoxin (Herrero et al. 2004 ) . The crystal

is composed of large protein with molecular weight of 130–135 kDa. After ingestion,

it is hydrolyzed into active toxin of 60–65 kDa in the presence of alkaline conditions

of midgut (pH 10–12) and proteases (Gill et al. 1992 ; Knowles 1994 ) . Finally, acti-

vated toxins bind to speci ﬁ c receptors present in the larval midgut epithelial cells.

As a result of binding, ATPs are rapidly lost from the cell stimulating respiration

and glucose uptake and also create ion channels or pores eventually. The cells burst

spilling their cytoplasmic content into lumen. Goblet cells may be the site of original

lesion. The pore formation causes osmotic shock upsetting the gut’s ion balance. As a

result of this process, the cell membrane lyses, paralysis occurs and consequently,

the insect stops feeding and dies from starvation (Knowles 1994 ) .

2.1.3 Symptoms of Infection

Bacterial infections are broadly classi ﬁ ed as;

1 . Bacteremia: Bacteremia occurs when the bacteria multiply in insect’s hemo-

lymph without production of toxins. Bacteremia occurs in case of bacterial

symbionts occurring in the body of insects and rarely occurs with bacterial

pathogens.

2 . Septicemia: Septicemia occurs most frequently with pathogenic bacteria, which

invade the hemocoel, multiply, produce toxins and kills the insects.

3 . Toxemia: Toxemia occurs when the bacteria is usually con ﬁ ned to the gut of

lumen and produce toxins there. Insects are usually killed by these toxins as in

case of brachytosis of the tent caterpillar.

345

13 Microbial Insecticides: Food Security and Human Health

2.1.4 Application of Bt

Three major applications of Bt toxins have been achieved: (i) in the control of insect

defoliators in agricultural crops, (ii) control of vectors e.g. mosquitoes for transmission

of human diseases, and (iii) in the development of transgenic plants. B. thuringiensis

formulations have been used to control insect pests since1920s (Lemaux

2008 ) and its

commercial formulation was ﬁ rst marketed by USA in 1958. These formulations have

the characteristics of being eco-friendly, safe, easy to use and cheap (Carlton 1988 ) , as

compared to chemical pesticides. They are now used under trade names such as Dipel

and Thuricide as speci ﬁ c insecticides. In 1985, Plant Genetic Systems, Belgium was

the ﬁ rst company to develop genetically engineered (tobacco) plants with insect toler-

ance by expressing cry genes from B. thuringiensis (Hofte et al. 1986 ; Vaeck et al.

1987 ) . In 1995, Bt toxins expressing in the potato plants were approved safe by the

Environmental Protection Agency, USA as a ﬁ rst Bt crop. Transgenic cotton often

referred to as Bt cotton, is grown in a number of countries. Bt cotton with a single

cry 1A gene and stacked with cry 2A gene has offered better protection against cotton

bollworm, Helicoverpa armigera (Gujar et al. 2007 ) . Liquid formulation of Bt is

applied on the crops through overhead irrigation systems or in a granular form for con-

trol of European corn borer (Cranshaw 2008 ) . A synergistic effect was obtained when

Spodoptera litura ingested B. thuringiensis subsp. kurstaki ( Btk ) with plant extracts

(Rajguru et al. 2011 ) . B. thuringiensis subsp. israelensis is used as solid or granules

with slow release rings or brickettes on the standing water to control the mosquito lar-

vae. The persistence of Bt . in water is more than on sun-exposed plant surface.

2.1.5 Disadvantages of Bt

Bt . is effective only against immature stages of target insects which are defoliators

and not effective against sap suckers and borers. Repeated applications of Bt are

required to achieve successful results but used judiciously, not indiscriminately

because resistance has also been reported in a number of economically important

insects like; Plutella xylostella , Plodia interpunctella , Heliothis virescens , H. armig-

era , Spodoptera exigua , S. litura (Narayanan 2004 ) . High level of resistance to

a -endotoxin of Bt. subspecies kurstaki is also recorded against the Indian meal

moth , P. interpunctella (McGaughey 1985 ) .

2.2 Viruses

The entomopathogenic viruses offer a promising option of microbial control second

only to bacteria in terms of adoption, and success in the ﬁ eld conditions. Viral dis-

eases are commonly occurring among the insects and one of the most widely inves-

tigated infections. The advanced techniques in biotechnology, biochemistry,

recombinant DNA technology, serology, pathology and tissue culture have provided

346

M.S. Ansari et al.

the opportunity to study the viral diseases in insects. With these advancements, the

applied virology had extended beyond pest management to the ﬁ eld of genetic engi-

neering, where virus serves as a vector for expression of foreign gene to form bio-

chemically important products.

2.2.1 Classi ﬁ cation of Insect Viruses

Insect viruses are divided into, the occluded and the non-occluded viruses. After

virion formation in infected cell, it is occluded within a protein matrix, forming

paracrystalline body that is referred to as occlusion body that contributes to stability

and persistence in the environment. In non-occluded, the virion occurs freely or

occasionally forms paracrystalline arrays of virions, known as inclusion body and

has no occlusion body protein scattered in the virions.

Types of insect virus:

(a) Iridoviruses

(b) Cytoplasmic Polyhedrosis Viruses

(d) Ascoviruses

(e) Baculoviruses

Iridoviruses

Iridoviruses (Family- Iridoviridae) are non-occluded with a linear double-stranded

DNA genome and icosahedral in shape (125–200 nm) which replicate in cytoplasm

in the infected hosts. The virion is made up of three domains; a central core contain-

ing DNA-protein complexes, an intermediate lipid membrane and an outer proteina-

ceous capsid. The iridoviruses have been most commonly reported from larval stages

of Diptera, Lepidoptera and Coleoptera. Nearly 44 species of Diptera are known to

be infected by iridoviruses (Williams

2008 ) . Invertebrates are, generally infected by

iridoviruses and chloriridoviruses especially insects and terrestrial isopods, and also

living in aquatic and damp habitats, and are both called as invertebrate iridescent

viruses (IIVs) because of the opalescent hues observed in heavily infected hosts

(Fig 13.2a ). The infection is invariably lethal, but there is now growing evidence that

sublethal infections may be common in certain host species (Tonka and Weiser

2000 ) . The IIV infections have little potential to control the medically and agricultur-

ally important insect pests due to broad host range shown in laboratory tests and

often low prevalence of patent disease (Henderson et al. 2001 ; Jakob et al. 2002 ) .

Cytoplasmic Polyhedrosis Viruses

Cytoplasmic polyhedrosis viruses (Family- Reoviridae) consist of double-stranded

RNA with 10 segments. The CPV particle is icosahedral in shape and formed in the

cytoplasm of midgut epithelium of lepidopterous larvae. Inclusion body of CPV is also

347

13 Microbial Insecticides: Food Security and Human Health

called polyhedron, which is stable, protecting the virions from adverse environmental

factors and serving as vehicle for transmission of virus from one host to another. The

infection occurs when the insect ingests polyhedra contaminated food (foliage of a

plant). As the infection progresses, the synthesis of the polyhedron matrix proteins

intensi ﬁ es resulting in an increase in the inclusion body. The inclusion body may also

increase in size by the uniting of one or more bodies to form a large body. Proteolytic

enzymes may function in the dissolution of ingested polyhedra by the insect and the

liberated virions enter the midgut lumen and become attached to the migut columnar

cells by the spikes on the viral surface ( Asai et al. 1973 ) where RNA is released leaving

Fig 13.2 Woodlouse ( Porcelio scaber ) infected with Iridovirus – blue colour is due to Iridovirus

infection ( a ), a larvae infected with Cytoplasmic polyhedrosis viruses – the skin of larvae rupture

and polyhedral bodies are released ( b ), Soil Scarab ( Othnonius batses ) infected with Entomopox

virus ( c ), Larvae of Spodoptera spp. Infected with Ascovirus ( d ), larvae of Helocoverpa armigera

infected with Baculovirus NPV ( e ), larvae of Cydia pomonella infected with Baculovirus GV ( f )

348

M.S. Ansari et al.

an empty shell on the cell surface. During severe infection, polyhedra are released with

feces of lepidopterous caterpillar, thus contaminating more foliage responsible for the

transmission of CPV when a healthy insect consumes the leaves. The disease is often

chronic, while Lepidopterous with lethal infection may retard their development and

are smaller, lighter in weight and may have an increased number of larval moults as

compared with uninfected larvae. In later stages, the infected midgut is turned yellow

to white rather than translucent brown because of accumulation of larger number of

polyhedra (Fig

13.2b ). The CPV is relatively common among the Lepidoptera and

Diptera (suborder Nematocera) (mosquitoes, black ﬂ ies and midges).

Entomopoxviruses

Entomopoxviruses (EPVs) (Family – Poxviridae) consist of double stranded DNA

with virions (150 × 300 nm) that are brick-shaped or oval. EPVs replicate in the

cytoplasm in most of the insects, causing an acute and fatal disease. They are com-

monly reported from Lepidoptera, Coleoptera, Diptera, Hymenoptera and Orthoptera

(Fig 13.2c ). These are DNA viruses which have naturally infecting grasshoppers.

Occlusion bodies of EPVs are varied from spindle to oval shaped and occluding

nearly 100 or more virions.

Entomopoxviruses form two types of proteinaceous crystalline bodies: spindles

and spheroids. The spheroid occludes virions, whereas the spindle does not; thus,

spheroids are main agent of infection. The major constituent proteins of the spheroid

are spheroidin and that of spindle are fusolin and both of them are most abundant

proteins of EPVs (Mitsuhashi et al. 2007 ) . It is easily transmitted by feeding, with

relatively narrow host range generally being restricted to closely related species. EPV

of insect are related to vertebrate poxviruses, such as the variola virus (causative agent

of smallpox), and they may be the evolutionary source of the vertebrate poxviruses.

Ascoviruses

The ascoviruses (Family – Ascoviridae) consisting of an envelope, an internal lipid

membrane associated with the inner particle and a core. Enveloped virions are large,

approximately 130 × 400 nm. The virions are bacilliform, ovoid and allantoid, con-

taining a linear double-stranded DNA. They are reported to infest Noctuids ( Spodoptera

frugiperda, S. exigua, Trichoplusia ni, Helicoverpa virescens ) of Lepidoptera

(Fig

13.2d ). Ascovirus causes stunting of growth of larvae and large numbers of virion

containing vesicles are formed in the cytoplasmic membrane of the cell. As the infec-

tion progresses, the hemolymph of an infected larva becomes opaque white as large

numbers of retractile vesicles are released after breaking down of cell membrane into

hemolymph ( Tillman et al. 2004 ). Infected caterpillars are generally stopped feeding

and retarded growth rate, concomitantly increased the larval longevity as compared to

uninfected larvae. Ascovirus is transmitted mechanically from one lepidopteran host

to another by female endoparasitic wasps but rarely through feeding.

349

13 Microbial Insecticides: Food Security and Human Health

Baculoviruses

The genus Baculovirus (Baculoviridae) constitutes one of the largest groups of insect

pathogenic viruses. It has two prominent members, namely, Nuclear Polyhedrosis virus

(NPV) and Granulovirus (GV), which show the greatest potential due to their exclusive

pathogenicity to insects spanning over 400 species of Lepidoptera, Hymnoptera,

Coleoptera, Diptera, and Decapoda (Gupta et al.

2007 ) . Baculoviruses are large, envel-

oped; rod-shaped nucleocapsid in which an amorphous but a de ﬁ nite layer exists

between the nucleocapsid and the envelope. The baculovirus has a single molecule of

circular, supercoiled, double-stranded DNA. NPV contains many virions occluded

within occlusion body called polyhedra, while, GV contains only one or, rarely, two or

more virons in occlusion body called granules (Rohrmann 2008 ) . Both NPVs and GVs

are highly infectious, and in some insects periodically cause epizootics (outbreaks of

disease). Baculoviruses primarily infect the larval stage through feeding upon the plant

foliage, in soil or eggs contaminated with occlusion bodies (Blissard et al. 2000 ) .

The dissolution occurred both by the high pH and the presence of alkaline proteinases

in the midgut lumen of most Lepidoptera. The virions are released then passed through

the peritrophic membrane and fused with the midgut epithelial cell plasma membrane.

The nucleocapsids are then released into the cytoplasm and migrate to the nucleus,

where transcription of viral genes and replication of viral genome takes place. The BVs

produced in the midgut epithelial cells spread via hemolymph into all tissues of the

insect causing secondary infection, but the predominant target is the fat body cell.

At the end of infection, the cells and tissues of dead insects are disintegrated and occlu-

sion bodies are released into the environment, thus named as “wilting disease”.

Commercially, the Baculovirus products are mostly produced in the form of con-

centrated wettable powders apart from liquid or granular forms. The virus is inactivated

by ultra violet (UV) rays of wavelength 290–320 nm; UV protectants such as metallic

oxides are used besides the addition of anti-evaporants and spreaders/wetting agents to

the virus formulations. In ﬁ eld conditions, they are generally failed, if not applied at

proper time and right place; thus, information regarding the insect behaviour and dis-

tribution within the crop in each instar, and the area of foliage ingested per instar all

should be well known for the effective use of the virus (Simon et al. 2008 ) . Genetic

engineering could be performed using genes of various origins such as Bt gene, scor-

pion toxin (BelT/AaIT) gene, straw itch mite toxin (TxP1) gene, and insect hormone

genes such as diuretic hormone from Manduca sexta that alters the larval ﬂ uid metabo-

lism, eclosion hormone associated with ecdysis from M. sexta that causes initiation of

the eclosion in the inoculated larvae, and ecdysteroid UDP-glucosyltransferase (EGT),

juvenile hormone esterase (JHE) expression in Baculovirus (Lasa et al.

2009 ) that

inhibit the larval feeding and molting (Bonning and Hammock 1996 ).

Nuclear Polyhedrosis Virus (NPV)

The NPV is the ﬁ rst virus to be detected in the insects but most commonly reported

from Lepidoptera (Fig 13.2e ). Most NPVs have been isolated from Lepidoptera

(88%), Hymenoptera (6%) and Diptera (5%) (Sau ﬁ 2008 ) . The virions are large

350

M.S. Ansari et al.

(80–200 × 280 nm) consisting of one or more nucleocapsids with double-stranded

circular DNA enclosed in an envelope. Most of the enveloped nucleocapsids in the

nucleus are occuluded in polyhedra. The number of enveloped virions in polyhedra

may be as high as 200 virions. NPVs replicate in the nuclei of epidermal cells, blood

cells, fat body and trachea. When ingested by a susceptible insect, the polyhedra

dissolve and virions enter into midgut cells, replicate, and then pass to tissues more

commonly associated with NPV infections. The larva infected with NPV becomes

discolored (brown and yellow), hemolymph turns cloudy and milky, becomes less

active and stops feeding; the whole body decomposes and becomes lique ﬁ ed and,

moves to the top of the plant and hangs upward down by its abdominal and caudal

prolegs. After death the larva rapidly darkens and the older infected larvae which

die in the ﬁ fth or late instars gradually turn slightly pale with pinkish tinge several

days before death, but otherwise remain nearly as dark brown as the healthy larvae.

Currently, high virus production costs make the viral treatments uncompetitive

compared with the chemical treatments, but more economical than B. thuringiensis

treatments (Bhargava et al.

2008 ; Suryawanshi et al. 2008 ) .

Granulosis Virus (GV)

The occlusion body of granulosis virus is granule or capsule-like and it is ovoid or

ovocylindrical (0.3 × 0.5 μ m) but the shapes may vary greatly. Each capsule has one,

rarely two or more enveloped nucleocapsids. GV infections have been reported from

more than 100 species of insects, limited to Lepidoptera (Murphy et al. 1995 ) .

Granuloviruses are generally considered to have a narrow host range (Federici 1997 ) but

four of them: CpGV ( Cydia pomonella GV) (Fig 13.2f ), HaGV ( Helicoverpa armigera –

GV), SpfrGV ( Spodoptera frugiperda -GV) and XecnGV ( Xestia c-nigrum – GV) have

relatively wide host range (Winstanley and O’Reilly 1999 ) . The fat body is the primary

site of infection, but the epidermis and tracheal matrix may occasionally be affected

(Huger 1963 ) . GVs are transmitted orally and via the egg. Latent infections also occur.

The period between ingestion of the virus and the death of the host generally ranges

between 4 and 25 days. External symptoms are not usually apparent in early stages of

infection, but towards the later stages infected larvae frequently develop a lighter color.

Liquefaction of the infected larvae occurred, similar to NPV infection, but when the epi-

dermis is not involved; liquefaction does not take place (Martignoni and Iwai 1986 ) .

Within a few days after infection, the host larvae become unable to digest the food, and

so weaken and die (Thakore 2006 ) . The infected larvae hang upside down from the leaves

and twigs in a characteristic way and brownish ﬂ uid oozes from them which is a highly

infective and is readily disseminated amongst the healthy insect population.

2.2.2 Symptoms of Infection

The insects that are killed by viruses are shiny-oily appearance, and often seen

hanging limply from vegetation. The infected larvae are extremely fragile, with

ruptured cuticle and releasing ﬂ uid with infective virus particles. Infection to

351

13 Microbial Insecticides: Food Security and Human Health

other insects will occur only when they eat upon leaves contaminated by virus

killed larvae.

These viruses are highly species speci ﬁ c and bene ﬁ cial insects and not affect to

parasitoids and predators and are safe to humans and non target organisms. There

has been a growing demand amongst the farmers for these bioagents because of

their usefulness. NPV can be used on ﬁ eld crops, including chickpea, sorghum, cot-

ton and maize etc.

2.3 Fungi

Most of the insects are infected by naturally occurring entomopathogenic fungi. 750

species of fungi representing 100 genera are known to be associated with insects

(Benjamin et al. 2002 ; Zimmerman 2007 ) . The epizootic potential of fungi is con-

siderably high and may spread quickly through insect population. Fungi usually

attached to the cuticle of the insects in the form of asexual spores (conidia) or sexual

spores. Under favorable temperature and high moisture, they germinate as hyphae

and colonize on to the cuticle; eventually they penetrate through it and reach the

hemocoel. They are also called as mycoinsecticides and are being used on a limited

scale to control insect pests.

2.3.1 Process of Infection

The fungal pathogens are unique among the bioagents which do not require the

consumption by the insect through food to act up on and can invade their hosts

directly through the exoskeleton or cuticle. Therefore, they can infect non-feeding

stages such as eggs and pupae. The site of invasion is often at intersegmental folds,

between the mouthparts or through the spiracles, where high humidity promotes

germination and the hyphae penetrated easily (Hajek and Leger 1994 ; Clarkson and

Charnley 1996 ) . Metarhizium spp. and Beauveria spp. are opportunistic hemibiotro-

phs with a parasitic phase in the live host and saprotrophic phase during post-mor-

tem growth on the cadaver (Charnley and Collins 2007 ) . They may use toxins to

overcome host defences, while, Entomophthorales are biotrophs with little or no

saprotrophism; kill the insect by tissue colonisation without producing toxins

(Charnley 2003 ; Freimoser et al. 2003 ) .

2.3.2 Host Response to Fungal Attack

The host insects respond by different ways to the fungal attack. The cuticle is not

only the major but also the ﬁ rst barrier to the host invasion. Structural features such

as sclerotisation impede penetration, while enzyme inhibitors and tyrosinases,

which generate antimicrobial melanins, are frontline defences against weak pathogens

352

M.S. Ansari et al.

(Charnley and Collins 2007 ) . Virulent fungal pathogens are least affected by blood-borne

defences. Phagocytosis by individual blood cells and cooperative behaviour between

haemocyte subpopulations viz. encapsulation and granuloma formation are often

not recorded after the initial incursion. This has been attributed to a failure of the

insect’s non-self recognition system, in some cases brought about by toxic fungal

metabolites, in others due to the removal of immunogenic components from fungal

cell walls in the blood of infected insects (Charnley

2003 ) .

2.3.3 Mode of Action

The fungal spore adheres ﬁ rst on to the cuticle and, under favorable environmental

conditions it germinates in the form of germ tube which further penetrates the cuticle

of the host. The process of penetration through the cuticle involves chemical

(enzymes) and physical forces. The mechanical force is noticeable at the tip of invad-

ing hypha where the cuticular layers are distorted from pressure. The enzymes

detected on germ tube are proteases, aminopeptidases, lipase, esterase and N-acetyl-

glucosamidase (chitinase). These enzymes liberate monomers that can be metabo-

lized by the germ tube in order to continue to grow into the integument. Vegetative

structures, hyphae multiply by budding in the hemocoel and ﬁ lled with hyphae, the

insect usually dies, and the fungus develops saprophytically. The cells and tissues of

an infected insect may begin to disintegrate prior to insect’s death or they may break

down after death. The fungal hyphae continue to grow usually resulting mummi ﬁ cation,

and dead insects retain their shape and form. Finally, mycelia emerged from the

cadaver after death. In Lepidopteran larvae infected with certain Entomophthorales,

they become ﬂ accid with watery contents and fragile integument that may appear

dark in color.

2.3.4 Groups of Entomopathogenic Fungi

Many common entomopathogenic fungi belong to order, Hypocreales of the

Ascomycota: the asexual (anamorph) phases; Beauveria , Metarhizium , Nomuraea ,

Paecilomyces, Hirsutella (Fig 13.3 ) and sexual (teleomorph) state Cordyceps ; oth-

ers ( Entomophthora , Zoophthora , Pandora , Entomophaga ) are from the order

Entomophthorales of the Zygomycota.

Beauveria spp.

Beauveria grows naturally in the soil throughout the world and acts as parasite on

various arthropod species, causing white muscardine disease in insects. B. bassi-

ana is the most biologically active species, discovered by Agostino Bassi in 1835

as the cause of the muscardine disease in silkworm. B. bassiana (formerly as

Tritirachium shiotae ) is the anamorph (asexually reproducing form) of Cordyceps

353

13 Microbial Insecticides: Food Security and Human Health

Fig 13.3 Hairy caterpillar and Cicada infected with Beauveria bassiana ( a and b ), larvae of white

grub infected with Metarhizium anisopliae ( c ), stroma of Cordyceps sp. emerging from a locust

( d ), infection of Nomuraea sp. on a lepidopterous larvae ( e ), a lepidopterous pupa infected with

Paecilomyces tenuipus

bassiana . Teleomorph (the sexually reproducing form) was discovered in 2001.

B. bassiana is one of the most commonly occurring entomopathogenic fungi and

shows strong pathogenicity to Lepidoptera, Hymenoptera, and Coleoptera (Harris

et al . 2000 ; Fernandez et al . 2001 ; Mannion et al . 2001 ; Phoofolo et al . 2001 ) . It is

used to control a number of agricultural insect pests such as white ﬂ ies, thrips, ter-

mites, aphids and beetles on major agricultural crops and even mosquitoes. Conidia

of B. bassiana are also effective in controlling of mosquito larvae when applied as

354

M.S. Ansari et al.

conidia dust on to breeding sites (Prasad and Veerwal 2010 ) . The use of B. bassiana

is environmentally safe and generally non-toxic to bene ﬁ cial insects. It grows as a

white mold on culture media and produces many dry powdery conidia, white spore

balls. Each spore ball is composed of cluster of conidiogenous cells, which are

short, ovoid and terminate in rachis with is a narrow apical extension. The conidia

are single-celled and hydrophobic in nature.

Mode of Action

The conidia when come into contact with cuticle of an insect, they germinate and

penetrate into the hemocoel where they multiply until hemocoel is ﬁ lled with myce-

lia. At this stage the infected insect is usually dead and has a rather ﬁ rm consistency,

like a small loaf of bread. Under favorable conditions the fungus continues to grow

and produces structures that protrude through the cuticle and form conidia. Death is

caused by destruction of tissues and the toxins produced by Beauveria like- bassia-

nin, bassiacridin, beauvericin, bassianolide, beauverolides, tenellin and oosporein

(Strasser et al.

2000 ; Vey et al. 2001 ; Romeis et al. 2006 ) . B. bassiana can be used

to control the insects of economically important crops.

Metarhizium spp.

Metarhizium anisopliae ( Entomophthora anisopliae) is widely distributed and soil-

inhabiting fungus, known as green muscardine fungus and was ﬁ rst isolated by

Metchnikoff ( 1879 ) from the beetle, Anisoplia austriaca . The colony of M.

anisopliae appears white at initial stage but dark green at later (Zimmerman 2007 ) .

Spores of M. anisopliae bind to the cuticle where germination occurred and the

germ tubes penetrate in the hemocoel where lateral extension of hyphae are

produced and continue to prolifrate until the insect is ﬁ lled with mycelia. They spo-

rulate in the hemocoel and the cuticle breaks down and makes the insect “fuzzy”.

Death may occur because of the destruction of tissues, nutritional de ﬁ ciency and

toxins produced by M. anisopliae ; cyclodepsipeptides, destruxins A. B, C, D and E

and desmethyldestruxin B (Tamura et al. 1964 ; Suzuki et al. 1970 ) . Destruxins have

been considered as a new generation insecticides. They cause titanic paralysis when

inoculated into larvae of Gallerria mellonella (Romeis et al. 2006 ) . M. anisopliae

could be used to control locusts, grasshoppers, termites, curculionids, and scarabeids.

2.3.5 Application in the Insect Pest Management

Several strategies have been adopted for the use entomopathogenic fungi in the

integrated pest management programs. B. bassiana (Mycotrol®) applied to seed-

lings grown in a nursery was effective in controlling DBM before they were trans-

planted into the ﬁ eld. Classical biological control is also known as permanent

355

13 Microbial Insecticides: Food Security and Human Health

introduction of pathogens in nature. This involves the establishment of a disease in

a population where it does not occur normally, in order to obtain long-term or per-

manent suppression of the pest. It may be promoted through introduction of natural

fungal epizootics by adopting appropriate cultural and crop protection practices of

harnessing entomopathogenic fungi for pest management. There are also new

opportunities for developing biopesticides in IPM by combining ecological factors

with post-genomic technologies (Chandler et al.

2011 ) . Loc and Chi ( 2007 ) showed

that the isolates of B . bassiana were isolated from naturally infected DBM exhibited

the highest infectivity to P. xylostella .

2.4 Protozoa

Protozoans are diverse group of motile, unicellular eukaryotic organisms. Generally,

they are referred to as animal-like protists because of movement (motile). However,

both protozoa and protists are paraphyletic groups (not including all genetic rela-

tives of the group). It is a potential microbial genetic resource for the management

of insect pests as they have ability to cause diseases in the insects. They range from

well known microsporida such as Nosema locustae , a pathogen of grasshoppers,

N. apis , a pathogen of honey bee, and N. pyrausta , a pathogen of European corn

borer. They are generally host speci ﬁ c and slow acting, most often producing chronic

infections. Of some 14,000 described species of Protozoa, about 500 are pathogens

of insects. Most of them are chronic pathogens that may debilitate a host without

producing obvious disease symptoms but some species are extremely virulent, caus-

ing stunted growth, slow development, and early death (Tanada and Kaya 1993 ) .

Protozoan diseases of insects are ubiquitous and comprised of an important regu-

latory role in insect populations (Lacey et al. 2001 ) . They are generally host speci ﬁ c

and slow acting, most often producing chronic infections. They develop only in liv-

ing hosts and many species require an intermediate host. Microsporida are among

the most commonly observed. Their main advantages are persistence and recycling

in host populations and their devastating effect on reproduction and overall ﬁ tness

of target insects (Solter and Becnel 2000 ) . The grasshopper pathogen N. locustae

Canning is the only species that has been registered and commercially available

species of microsporidium, marketed under several labels for the control of grass-

hoppers and crickets. It is applied with insect-attractant bait. Because of its slow

mode of action, this product is better suited to long-term management of rangeland

pests than to the more intensive demands of commercial crop or even home garden

production. Other Nosema species have been shown to infect spider mites and web-

worms, but have yet to be developed suf ﬁ ciently for commercial use. Similarly, N.

pyraust a (= Perezia pyraustae ) infects several insect species, including European

corn borer, for which it can be an important natural control. However, its commer-

cial use is still in the developmental phase. Infection can spread from diseased to

healthy larvae via contaminated frass, and by migration of infected larvae between

plants. Vairimorpha necatrix is another microsporidium with commercial potential.

356

M.S. Ansari et al.

It has a wide host range among caterpillar pests, including corn earworm and

European corn borer, various armyworms, fall webworm, and cabbage looper. It can

be more virulent than other species and infected insects may die within 6 days of

infection. The main disadvantages of the Protozoa as inundatively applied microbial

control agents are the requirement for in vivo production and low levels of immedi-

ate mortality.

2.4.1 Mode of Action

To cause infection, most microsporidia must be ingested by an insect. However,

there may also be some natural transmission within a pest population, for example

by predators and parasitoids. The pathogen enters the insect body via the gut wall,

spreads to various tissues and organs, and multiplies, sometimes causing tissue

breakdown and septicemia.

2.4.2 Symptoms

Infected insects may become sluggish and smaller than normal, sometimes with

reduced feeding and reproduction, and dif ﬁ culty molting. Death may follow if the

level of infection is high. One advantage of this type of infection is that the weak-

ened insects are more likely to be susceptible to adverse weather and other mortality

factors.

3 Conclusion

The perusal of literature shows that there are several ecofriendly ways available to

reduce the pesticide usage in agriculture. Sustainable agriculture will rely increas-

ingly on alternative interventions for insect pest management that are environment

friendly and safer to non target organisms as well as to human beings. Effective

microbial control agents that can ﬁ ll the void of phased out chemicals exist, but their

further development and implementation will require the following advances:

improvements in the ef ﬁ cacy of pathogens, their production, and formulation; better

understanding of how they will ﬁ t into integrated systems and their interaction with

the environment and other biotic components; greater appreciation for their full

advantages (ef ﬁ cacy, safety, selectivity, etc.), not simply their comparison with

chemical pesticides; and acceptance by growers and the general public. Despite our

optimistic appraisal of the future of entomopathogens as biological control agents,

portions of the biopesticide industries which are currently facing ﬁ nancial setbacks.

Although the market for microbial insecticides is growing, it represents only

approximately 1–1.5% of the total crop protection market and most of this is due to

sales of B. thuringiensis (Lacey et al. 2001 ) . We believe that in the near future

357

13 Microbial Insecticides: Food Security and Human Health

microbials will face even stiffer competition from new pesticide chemistry and

transgenic plants. Improvement in microbial products, bene ﬁ t to growers that micro-

bial control offers, and the need to develop alternatives to conventional chemical

insecticides should overcome many of the obstacles that it is now facing. However,

if future development is only market driven, then there will be considerable delay in

the implementation of microbial control agents that have good potential for use in

insect management programs.

References

Aronson AI, Shai Y (2001) Why Bacillus thuringiensis insecticidal toxins are so effective? Unique

features of their mode of action. FEMS Microbiol Lett 195:1–8

Asai J, Kawamoto F, Kawase S (1973) On the structure of cytoplasmic polyhedrosis virus of silk-

worm, Bombyx mori . J Invert Pathol 29:69–73

Benedict JH (2003) Strategies for controlling insect, mite and nematodes pests. In: Chrispeels MJ,

Sadava DE (eds) Plants, genes, and crop biotechnology. Jones and Bartlett Publishers, Sudbury,

pp 414–442

Benjamin MA, Zhioua E, Ostfeld RS (2002) Laboratory and ﬁ eld evaluation of the entomopatho-

genic fungus, Metarhizium anisopliae (Deuteromycetes) for controlling questing adult, Ixodes

scapularis (Acari: Ixodidae). J Med Entomol 39:723–728

Bhargava MC, Choudhary RK, Jain PC (2008) Genetic engineering of plants for insect resistance.

In: Jain PC, Bhargava MC (eds) Entomology: novel approaches. New India Publishing, New

Delhi, pp 133–144

Blissard GW, Black B, Crook N, Keddie BA, Possee R, Rohrmann G, Theilmann D, Volkman L

(2000) Family Baculoviridae. In: van Regenmortel MHV, Fauquet CM, Bishop DHL, Carstens

EGB, Estate MK, Lemon SM, Mainloff J, Mayo MA, McGoech DJ, Pringle CR, Wickners RB

(eds) Virus Taxonom. Academic, San Diego, pp 195–202

Bonning BC, Hammock BD (1996) Development of recombinant baculoviruses for insect control.

Annu Rev Entomol 41:191–210

Bravo A, Gómez I, Conde J, Muñoz-Garay C, Sánchez J, Zhuang M, Gill SS, Soberón M

(2004) Oligomerization triggers differential binding of a pore-forming toxin to a different

receptor leading to ef ﬁ cient interaction with membrane microdomains. Biochem Biophys

Acta 1667:38–46

Carlton BC (1988) Development of genetically improved strain of Bacillus thuringiensis – a bio-

logical insecticide. Am Chem Soc 9:260–297

Chandler D, Bailey AS, Mark G, Davidson TG, Greaves J, Grant WP (2011) The development,

regulation and use of biopesticides for integrated pest management. Philos Trans R Soc Biol

Sci. doi:

10.1098/rstb.2010.0390

Charnley AK (2003) Fungal pathogens of insects: cuticle degrading enzymesandtoxins. Adv Bot

Res 40:241–321

Charnley AK, Collins SA (2007) Entomopathogenic fungi and their role in pest control. In:

Kubicek CP, Druzhinina IS (eds) Environmental and microbial relationships. The Mycota IV,

2nd edn. Springer, Berlin/Heidelberg

Clarkson JM, Charnley AK (1996) New insights into the mechanisms of fungal pathogenesis in

insects. Trends Microbiol 4:197–203

Cranshaw WS (2008) Bacillus thuringiensis : home and garden, Insect series no 5.556. Colorado

State University Cooperative Extension, Fort Collins

Crickmore N, Zeigler DR, Feitelson J, Schnepf E, Van Rie J, Lereclus D, Baum J, Dean DH (1998)

Revision of nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol

Mol Biol Rev 62:807–813

358

M.S. Ansari et al.

de Maagd RA, Weemen-Hendriks M, Stiekema W, Bosch D (2000) Domain III substitution in

Bacillus thuringiensis delta-endotoxin Cry1C domain III can function as a speci ﬁ c determinant

for Spodoptera exigua in different, but not all, Cry1-Cry1C hybrids. Appl Environ Microbiol

66:1559–1563

Federici BA (1997) Baculovirus pathogenesis. In: Miller LK (ed) The baculoviruses. Plenum

Press, New York, pp 33–59

Fernandez S, Groden E, Vandenberg JD, Furlong MJ (2001) The effect of mode of exposure to

Beauveria bassiana on conidia acquisition and host mortality of Colorado potato beetle,

Leptinotarsa decemlineata . J Invert Pathol 77:217–226

Freimoser FM, Screen S, Hu G, St Leger R (2003) EST analysis of genes expressed by the zygo-

mycete pathogen Conidiobolus coronatus during growth on insect cuticle. Microbiology

149:1893–1900

Gill SS, Cowles EA, Pietrantonio PV (1992) The mode of action of Bacillus thuringiensis endo-

toxins. Annu Rev Entomol 37:615–636

Gujar GT, Kalia V, Kumar A, Singh BP, Mittal A, Nair R, Mohan M (2007) Helicoverpa armigera

baseline susceptibility to Bacillus thuringiensis (Bt) Cry toxins and resistance management for

Bt cotton in India. J Invert Pathol 95:214–219

Gupta RP, Kalia A, Kapoor S (2007) Biopesticides. In: Bioinoculants: a step towards sustainable

agriculture. In: Singh A, Parmar N, Kuhad RC (eds) Bioaugmentation, biostimulation and

biocontrol soil biology. New India Publishing Agency, New Delhi, pp 223–256

Hajek AE, St Leger RJ (1994) Interactions between fungal pathogens and insect hosts. Annu Rev

Entomol 39:293–322

Harris RS, Harcourt SJ, Glare TR, Rose EA, Nelson TJ (2000) Susceptibility of Vespula vulgaris

(Hymenoptera: Vespidae) to generalist entomopathogenic fungi and their potential for wasp

control. J Invert Pathol 75:251–258

Heimpel AM (1967) A taxonomic key proposed for the species of “crystaloferous” bacteria. J Invertebr

Pathol 9:364–375

Henderson CW, Johnson CL, Lodhi SA, Bilimoria SL (2001) Replication of Chilo iridescent virus

in the cotton boll weevil, Anthonomus grandis , and development of an infectivity assay. Arch

Virol 146:767–775

Hernandez CS, Ferre J (2005) Common receptor for Bacillus thuringiensis toxins Cry 1Ac,

Cry1Fa, and Cry1Ja in Helicoverpa armigera , Helicoverpa zea , and Spodoptera exigua . Appl

Environ Microbiol 71:5627–5629

Herrero SJ, Cabrera G, Ferré J, Bakker PL, de Maagd RA (2004) Mutations in the Bacillus

thuringiensis Cry1Ca toxin demonstrate the role of domains II and III in speci ﬁ city towards

Spodoptera exigua larvae. Biochem J 384:507–513

Höfte H, de Greve H, Seurinck J (1986) Structural and functional analysis of a cloned delta

endotoxin of Bacillus thuringiensis Berliner. Eur J Biochem 161:273–280

Huger A (1963) Granulosis of insects. In: Steinhaus EA (ed) Insect pathology: an advanced treatise,

vol 689. Academic, New York/London, pp 531–575

Jakob NJ, Kleespies RG, Tidona CA, Müller K, Gelderblom HR, Darai G (2002) Comparative

analysis of the genome and host range characteristics of two insect iridoviruses: Chilo irides-

cent virus and a cricket iridovirus isolate. J Gen Virol 83:463–470

Jian X, Qin L, Xiang-dong Y, Shu-de Z (2006) A review of recent development of Bacillus

thuringiensis . ICP genetically engineered microbes. Entomol J East China 15:53–58

Knowles BH (1994) Mechanism of action of Bacillus thuringiensis insecticidal δ -endotoxins. Adv

Insect Physiol 24:275–308

Kumar S, Chandra A, Pandey KC (2008) Bacillus thuringiensis ( Bt ) transgenic crop: an environ-

ment friendly insect-pest management strategy. J Environ Biol 29:641–653

Lacey LA, Frutos R, Kaya HK, Vail P (2001) Insect pathogens as biological control agents: do they

have a future? Biol Control 21:230–248

Lasa R, Moreno I, Caballero P, Williams T (2009) Application of juvenile hormone analogue and

optical brightener technologies to the production of Spodoptera frugiperda multiple nucleopo-

lyhedrovirus. IOBC Wprs Bull 45:153–156

359

13 Microbial Insecticides: Food Security and Human Health

Lemaux P (2008) Genetically engineered plants and foods: a scientist’s analysis of the issues

(part I). Annu Rev Plant Biol 59:771–812. doi:

10.1146/annurev.arplant.58.032806.103840

Loc NT, Chi VTB (2007) Biocontrol potential of Metarhizium anisopliae and Beauveria bassiana

against diamondback moth, Plutella xylostella. Omonrice 15:86–93

Mannion CM, McLane W, Klein MG, Moyseenko J, Oliver JB, Cowan D (2001) Management of

early-instar Japanese beetle (Coleoptera: Searabaeidae) in ﬁ eld-grown nursery crops. J Econ

Entomol 94:1151–1161

Martignoni ME, Iwai PJ (1986) A catalogue of viral diseases of insects, mites and ticks, 4th edn.

USDA Forest Service PNW-195, Washington, DC

McGaughey WH (1985) Insect resistance to the biological insecticide Bacillus thuringiensis .

Science 229:193–195

Metchnikoff E (1879) Diseases of the larva of the grain weevil. Insects harmful to agricul-

ture (series). Issue III, The grain weevil. Published by the commission attached to the

Odessa Zemstvo of ﬁ ce for the investigation of the problem of insects harmful to agriculture,

Odessa, 32 p

Mitsuhashi W, Kawakita H, Murakami R, Takemoto Y, Saiki T, Miyamoto K, Wada S (2007)

Spindles of an entomopoxvirus facilitate its infection of the host insect by disrupting the peri-

trophic membrane. J Virol 18:4235–4243

Murphy FA, Fauquet CM, Bishop DHL, Ghabrial SA, Jarvis AW, Martelli GP, Mayo MA, Summers

MD (1995) Virus taxonomy; classi ﬁ cation and nomenclature of viruses. Sixth report of the

international committee on taxonomy of viruses. Springer, Wien/New York. 586 pp

Narayanan K (2004) Insect defence: its impact on microbial control of insect pests. Curr Sci 86:6–25

Phoofolo MW, Obrycki JJ, Lewis LC (2001) Quantitative assessment of biotic mortality factors of

the European corn borer (Lepidoptera: Crambidae) in ﬁ eld corn. J Econ Entomol 94:617–622

Pimentel D (2007) Area-wide pest management: environmental, economic and food issues. In:

Vreysen MJB, Robinson AS, Hendrichs J (eds) Area-wide control of insect pests: from research

to ﬁ eld implementation. Springer, Dordrecht, pp 35–47

Pimentel D (2009) Pesticides and pest control. In: Peshin R, Dhawan AK (eds) Integrated pest

management: innovation- development. Springer, Dordrecht, pp 83–88

Prasad A, Veerwal B (2010) Biotoxicity of entomopathogenic fungus Beauveria bassiana

( balsamo ) vuillemin , against early larval instars of anopheline mosquitoes. J Herb Med Toxicol

4(2):181–188

Rajguru M, Sharma AN, Banerjee S (2011) Feasibility assessment of plant extracts forti ﬁ ed with

Bacillus thuringiensis Berliner for management of Spodoptera litura Fab. Int J Trop Insect Sci

31(1–2):92–97

Rohrmann GF (2008) Baculovirus molecular biology. National Center for Biotechnol. Information

(US), NCBI, Bethesda

Romeis J, Meissle M, Bigler F (2006) Transgenic crops expressing Bacillus thuringiensis toxins

and biological control. Nat Biotechnol 24:63–71

Sarfraz M, Keddie BA (2005) Conserving the ef ﬁ cacy of insecticides against Plutella xylostella

(L.) (Lep., Plutellidae). J Appl Entomol 129:149–157

Sau ﬁ AEM (2008) Characterization of an Egyptian Spodoptera littoralis nuclear polyhedrosis

virus and a possible use of a highly conserved region from polyhedron gene nucleopolyhedro-

virus detection. Virol J 5:13

Sayyed AH, Omar D, Wright DJ (2004) Genetics of spinosad resistance in a multi-resistant ﬁ eld

selected population of Plutella xylostella . Pest Manag Sci 60:827–832

Simon O, Williams T, Lopez-Ferber M, Taulemesse JM, Caballero P (2008) Population genetic

structure determines the speed of kill and occlusion body production in Spodoptera frugiperda

multiple nucleopolyhedrovirus. Biol Control 44:321–330

Smith RF (1970) Pesticides: their use and limitations in the pest management. In: Labb RL, Guthrie

FE (eds) Concepts of pest management., pp 102–113

Solter LF, Becnel JJ (2000) Entomopathogenic microsporida. In: Lacey LA, Kaya HK (eds) Field

manual of techniques in invertebrate pathology: application and evaluation of pathogens for

control of insects and other invertebrate pests. Kluwer, Dordrecht, pp 231–254

360

M.S. Ansari et al.

Steinhaus EA (1954) Further observations on Bacillus thuringiensis Berliner and other spore form-

ing bacteria. Hilgardia 23:1

Strasser H, Vey A, Butt T (2000) Are there any risks in using entomopathogenic fungi for pest

control, with particular reference to the bioactive metabolites of Metarhizium , Tolypocladium

and Beauveria species? Biocontrol Sci Technol 10:717–735

Suryawanshi DS, Bhede BV, Bhosale SV, More DG (2008) Insecticide resistance in ﬁ eld popula-

tion of American bollworm, Helicoverpa armigera Hub. (Lepidoptera: Noctuidae). Indian J

Entomol 70:44–46

Suzuki A, Taguchi H, Tamura S (1970) Isolation and structure elucidation of three new insecticidal

cyclodepsipeptides, destruxins C and D and desmethyldestruxin B, produced by Metarrhizium

anisopliae . Agric Biol Chem 34:813–817

Tamura S, Kuyama S, Kodaira Y, Higashikawa S (1964) Studies on destruxin B, an insecticidal

depsipeptide produced by Oospora destructor . Inst Appl Microbiol Symp Microbiol

6:127–140

Tanada Y, Kaya HK (1993) Insect pathology. Academic, San Diego, p 666

Thakore Y (2006) The biopesticide market for global agricultural use. Ind Biotechnol 2:194–208

Tillman PG, Styer EL, Hamm JJ (2004) Transmission of an ascovirus from Heliothis virescens

(Lepidoptera, Noctuidae) and effects of the pathogen on survival of a parasitoid, Cardiochiles

nigriceps (Hymenoptera, Braconidae). Environ Entomol 33:633–643

Tonka T, Weiser J (2000) Iridovirus infection in may ﬂ y larvae. J Invertebr Pathol 76:229–231

Vaeck M, Reynaerts A, Hofte A (1987) Transgenic plants protected from insect attack. Nature

328:33–37. doi:

10.1038/328033a0

Vey A, Hoagland RE, Butt TM (2001) Toxic metabolites of fungal biocontrol agents. In: Butt TM,

Jackson C, Magan N (eds) Fungi as biocontrol agents. Progress, problems and potential. CABI

Publishing, Oxford, pp 311–346

Williams T (2008) Natural invertebrate hosts of iridoviruses (Iridoviridae). Neotrop Entomol

37:615–632

Winstanley D, O’Reilly DR (1999) Granuloviruses. In: Webster R, Granoff A (eds) The encyclo-

pedia of virology, 2nd edn. Academic, London, pp 140–146

Xavier R, Reena J, Sreeramanan S (2007) Environmental distribution and diversity of insecticidal

proteins of Bacillus thuringiensis Berliner. Malays J Microbiol 3(2):1–6

Zimmerman G (2007) Review on safety of entomopathogenic fungus Metarhizium anisopliae .

Biocontrol Sci Technol 17:879–920

361

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

DOI 10.1007/978-94-007-5931-2_14, © Springer Science+Business Media Dordrecht 2013

Abstract Plant growth promoting rhizobacteria (PGPR) contain diverse type of

plant growth promoting attributes that has many bene ﬁ cial effects on crop produc-

tivity. The PGPR appear to promote the plant growth via – suppression of plant

disease (bio-controls), enhanced nutrient achievement, or phytohormone produc-

tion (bio-fertilizers). The PGPR protect plants from several biotic and abiotic

stresses. Co-inoculation of PGPR can ease the adverse effects on crop plants due to

various environmental stresses such as soil salinity, droughts, temperature and nutri-

ent de ﬁ ciency. During the last couple of decades given the negative environmental

impact of arti ﬁ cial fertilizers and their increasing costs, the use of PGPR for sustain-

able environment and safe agriculture has increased globally. Thus, the PGPR offer

an environmentally sustainable approach to increase crop production for future

generation.

Keywords Agriculture • Biofertilizers • Bio-control • Environment • Rhizobacteria

1 Introduction

The bacteria colonizing the plant rhizosphere are known as plant growth promoting

rhizobacteria (PGPR) (Kloepper et al. 1980 ) . Most of the PGPR strains are found to be

associated with plant growth indirectly, via alterations in the structure of rhizosphere soil

J. S. Singh (*)

Department of Environmental Microbiology , Babasaheb Bhimrao Ambedkar (Central)

University , Raibarelly Road , Lucknow 226025 , Uttar Pradesh , India

e-mail: jayshankar_1@yahoo.co.in

D. P. Singh

Department of Environmental Science , Babasaheb Bhimrao Ambedkar (Central) University ,

Raibarelly Road , Lucknow 226025 , Uttar Pradesh , India

Chapter 14

Plant Growth Promoting Rhizobacteria

(PGPR): Microbes in Sustainable Agriculture

Jay Shankar Singh and D. P. Singh

362

J.S. Singh and D.P. Singh

(Noel et al. 1996 ) . Direct mechanisms include production of plant growth regulators,

solubilization of mineral materials (Son et al. 2006 ; Chen et al. 2008 ) or ﬁ xation of

atmospheric nitrogen. For example, Bacillus strains induce plant resistance against stress

and produce various plant hormones for growth improvement (Rajendran et al.

2008 ) .

In addition it has been demonstrated that inoculation with plant growth promoting

improves plant growth under a variety of salinity stress conditions (Han and Lee

2005 ) .

In the last few years, the number of PGPR like Pseudomonas, Azospirillum,

Azotobacter, Klebsiella, Enterobacter, Alcaligenes, Arthrobacter, Burkholderia,

Bacillus and Serratia have been identi ﬁ ed and have gained importance because their

dominant role in the microcosm of rhizosphere (Kloepper et al. 1989 ; Joseph et al.

2007 ) . Now many PGPR inoculants are commercialized which apparently promote

the plant growth through at least one mechanism; improved nutrient supply, biofer-

tilizers, bio-control agent and phytohormone production. (Rajendran et al. 2008 ;

Singh et al. 2011 ; Upadhyay et al. 2012 ) .

Environmental stresses are the major constraints, which hampers the crop produc-

tion, causing loss of signi ﬁ cant quantity of yield. Soil salinity is one of the major

environmental constrains that signi ﬁ cantly reduces plant nutrient uptake, particularly

phosphate (P) ions which tends to get precipitated with Ca ions in saline soil (Grattan

and Grieve 1999 ) . Phosphate solubilizing bacteria can increase P availability to

plants by solubilizing the insoluble P, and thereby improve the availability of nutri-

ents including the phosphate (Gyaneshwar et al. 2002 ) . Application of such bene ﬁ cial

soil microorganisms in agriculture has drawn the attention of scientists all over the

world (Berg 2009 ; Weyens et al. 2009 ) . Inoculation of PGPR strains, well adapted to

rhizospheric conditions and exhibiting P solubilizing attributes, are considered more

effective for balanced nutrition to plants and crop yields (Galal 2003 ) . The PGPR can

stimulate not only plant growth and yield, but can also alleviate the effects of biotic

or abiotic stresses on plants (Lugtenberg and Kamilova 2009 ) . An increase in various

agronomic yields involving production of growth stimulating phytohormones as well

as by improved phosphate nutrition of plants due to PGPR has been reported (Kohler

et al. 2006 ) . Therefore, PGPR inoculation to alleviate environmental stress may be

considered as an innovative and cost effective alternative to overcome the various

plants stresses (Bano and Fatima 2009 ) . Biofertilizer is the most commonly referred

term used for the bene ﬁ cial soil microorganisms such as PGPR which increase the

availability and uptake of nutrients for plants (Vessey 2003 ) . Application of such

bene ﬁ cial soil microorganisms in sustainable agriculture has drawn the attention of

scientists all over the world (Berg 2009 ; Weyens et al. 2009 ) . This review describes

the future perspectives of PGPR in sustainable agricultural productivity.

2 Perspective of PGPR in Stress Agriculture

The PGPR associated with plant roots play important role in enhancing the plant

productivity and disease resistance. Recently several workers have demonstrated

that PGPR provide protection to the plants against several biotic and abiotic stresses.

363

14 Plant Growth Promoting Rhizobacteria (PGPR)…

The PGPR dependent enhanced stress resistance in plants may be mediated by

speci ﬁ c enzymes, inducing alterations at physiological and molecular level. Among

these enzymes, bacterial 1-aminocyclopropane-1-carboxylate (ACC) deaminase is

reported to play a well de ﬁ ned role in the regulation of level of ethylene- a plant

growth hormone (Glick 2005 ) . Ethylene is a gaseous plant growth hormone pro-

duced endogenously by almost all plants and is known to alter the growth and devel-

opment of plants (Saleem et al. 2007 ) . Apart from the role of ethylene as a plant

growth regulator, it is an established stress hormone in plants. These PGPR boost

plant growth particularly under stressed conditions by the regulation of accelerated

ethylene production in response to a multitude of abiotic and biotic stresses like

salinity, drought, waterlogging, temperature, pathogenicity and contaminants.

Recently, Ahmad et al. ( 2011 ) showed that co-inoculation with PGPR containing

ACC deaminase and Rhizobium spp. could be a useful approach for inducing salt

tolerance and thus improving growth and nodulation in mung bean under salt-

affected conditions. Inoculation of PGPR containing ACC deaminase and subse-

quent physiological changes in plants are given in Table 14.1 .

2.1 Salinity Stress

Soil salinity constitutes a serious problem for vegetable as well as for other crops.

An alteration in physiology of plants induced by salt stress leads to reduced nutri-

tional uptake and also the plant growth (Singh et al. 2011 ) . Salinity stress boosts

Table 14.1 Inoculation with PGPR containing ACC deaminase and subsequent physiological

changes in plants

PGPR Plant Physiological changes References

Pseudomonas cepacia Glycine max Rhizobacterium caused an

early soybean growth

Cattelana et al.

(

1999 )

Alcaligenes sp. Brassica napus Inoculated plant demon-

strated more vigorous

growth than the control

Belimov et al.

(

2001 )

Bacillus pumilus

Pseudomonas sp.

Variovorax paradoxus

B. circulans DUC1, Brassica

campestris

Bacterial inoculation

enhanced

root and shoot elongation

Ghosh et al.

(

2003 )

B. wrmus DUC2,

B. globisporus DUC3

Enterobactersakazakii 8MR5 Zea mays L. Inoculation increased

agronomic parameters

of maize

Babalola et al.

(

2003 )

Pseudomonas sp. MKS8

Klebsiellaoxytoca 10MKR7

P. syringae ; Mk20, P.

ﬂ uorescens Mk25, and P.

ﬂ uorescens biotype G

Mung bean Improve seedling growth

and nodulation

Ahmad et al.

(

2011 )

Bacillus subtilis SU47 and

Arthrobacter sp. SU18

Wheat Increase in dry biomass,

total soluble sugars and

proline content

Upadhyay

et al. (

2012 )

364

J.S. Singh and D.P. Singh

endogenous ethylene production in plants, which in most cases serves as a stress

hormone (O’Donnell et al. 1996 ; Blumwald 2000 ) . It is very likely that reducing

salinity-induced ethylene production by any mechanism could reverse the negative

impact of salinity onto the plant growth. Since the PGPR is known to colonize the

plant roots (Upadhyay et al.

2011 ) , it can be an effective tool in developing the

strategies to enhance the wheat production in salinity affected areas ( Ashraf et al.

2004 ). We very recently during an experiment demonstrated that co-inoculation of

B. subtilis and Arthrobacter sp. might ease the unfavorable in ﬂ uence of the soil

salinity on wheat plants (Upadhyay et al. 2012 ) . Studies have revealed that plants

inoculated with PGPR containing ACC deaminase were better able to thrive through

the salinity stress while demonstrating a normal growth pattern. In this direction,

Mayak et al. ( 2004b ) during an investigation showed that Achromobacter piechau-

dii having ACC deaminase activity considerably enhanced the tomato seedlings

fresh and dry weights when treated with NaCl salt (up to 172 mM). The bacterium

Achromobacter piechaudii has been found to reduce the generation of ethylene by

salt stressed tomato seedlings. However, the sodium content of the plant was not

decreased whereas the uptake of phosphorous and potassium were slightly increased,

which might have contributed in part, to the activation of processes involved in the

alleviation of the adverse effect of salt on plant growth. The bacterium also increased

the water use ef ﬁ ciency (WUE) in saline environment and helped in alleviating the

salt suppression of photosynthesis. Saravanakumar and Samiyappan ( 2007 ) reported

that Pseudomonas ﬂ uorescens strain TDK1 containg ACC deaminase activity

enhanced the saline resistance in groundnut plants and increased yield as compared

with that inoculated with Pseudomonas strains lacking ACC deaminase activity.

Cheng et al. ( 2007 ) have also con ﬁ rmed that ACC deaminase bacteria conferred salt

tolerance onto plants by lowering the synthesis of salt-induced stress ethylene and

promoted the growth of canola in saline environment. Nadeem et al. ( 2006 ) have

observed almost similar results in the case of maize growth under salt stress in

response to inoculation with ACC deaminase PGPR.

2.2 Drought Stress

Drought is one of the major constraints to the yield of crop globally. Since the

global population continues to increase and water resources for crop production

decline, the development of drought-tolerant cultivars and water-use-ef ﬁ cient crops

is a global concern. Drought affects virtually all climatic regions of the world

(Wilhite 2000 ) and more than one half of the earth is susceptible to drought every

year (Kogan 1997 ) Drought is one of the major environmental stresses that limit the

growth of plants and the production of crops. Plants respond to drought stress at

cellular and molecular levels (Bray 1997 ; Ingram and Bartels 1996 ; Shinozaki and

Yamaguchi-Shinozaki 1999 ) . Like many other environmental factors, drought also

induces accelerated ethylene production in plant tissues which leads to abnormal

growth of a plant (Mattoo and Suttle 1991 ) . Mayak et al. ( 2004a ) reported that ACC

365

14 Plant Growth Promoting Rhizobacteria (PGPR)…

deaminase in Achromobacter piechaudii ARV8 signi ﬁ cantly increased the fresh and

dry weights of both tomato and pepper seedlings exposed to transient water stress.

In addition, the bacterium also reduced the production of ethylene by tomato seed-

lings exposed to water stress. During water scarcity, the bacterium did not in ﬂ uence

the water content of plants; however, it signi ﬁ cantly improved the recovery of plants

when watering was resumed. Interestingly, inoculation of tomato plants with the

bacterium resulted in continued plant growth both during water stress as well as

when watering was resumed. The bacterial effects were more pronounced and more

consistent under controlled soil drying (moisture stress conditions). In short term

experiments, the ACC deaminase producing bacteria showed positive effects on the

root and shoot biomass, leaf area and plant transpiration. In case of long-term exper-

iments, plants inoculated with ACC deaminase producing bacteria gave higher yield

(25–41%); greater seed number and seed nitrogen accumulation than that in the

uninoculated plants. Moreover, PGPR inoculation of drought affected pea plants

restored the level of root nodulation when compared with well-watered uninocu-

lated plants. It has been shown that the inoculation with ACC deaminase producing

bacteria partially eliminated the effects of water scarcity on growth and yield of

Pisum sativum L. both in pot and ﬁ eld conditions (Arshad et al.

2008 ) .

Several investigations have been carried out under greenhouse and ﬁ eld situations

by using mixtures of PGPR strains with symbiotic nitrogen- ﬁ xing rhizobia (Figueiredo

et al. 2008 ) or with mycorrhizal fungi (Kohler et al. 2008 ) . The co-inoculation of

PGPR with Rhizobium tropici under low soil water content conditions has been found

to show improved plant growth and enhanced number of root nodules in Phaseolus

vulgaris L. (Figueiredo et al. 2008 ) . Interestingly, the effect of co-inoculation of two

strains of P. polymyxa strains on nodule number exhibited synergistic effects.

A survey on the effect of drought stress in relation to plant hormone revealed that

how an increase in the abscisic acid (ABA) content in the plant leaves with simultane-

ous decrease in the endogenous level of cytokinin elicited a differential response of

stomata closure (Cowan et al. 1999 ; Figueiredo et al. 2008 ) . Earlier the cytokinin –

ABA antagonism has been observed as they share a common biosynthetic origin

(Cowan et al. 1999 ) . It will be interesting to determine whether cytokinin produced by

P. polymyxa affects ABA signaling in plants or rhizobia-elicited nodulation (Timmusk

and Wagner 1999 ; Figueiredo et al. 2008 ) Co-inoculation of lettuce ( Lactuca sativa L.)

with PGPR Pseudomonas mendocina and arbuscular mycorrhizal fungi ( Glomus intra-

radices or G. mosseae ) is known to increase the level of antioxidant enzyme catalase

under severe drought conditions, suggesting that these can be used as co-inoculants to

alleviate the oxidative damage elicited by the drought stress (Kohler et al. 2008 ) .

2.3 Temperature Stress

Changes in the global climate, notably spatial and temporal variations in temperature,

are predicted to have important consequences for crop production. Transient or con-

stantly high temperatures may cause an array of morpho-anatomical, physiological

366

J.S. Singh and D.P. Singh

and biochemical changes in plants, which induce changes in the growth and

development of plants, and ultimately account for severe decrease in the economic

yield. Plants with ACC deaminase expression can successfully cope with the stress-

ful situations by lowering the production of ethylene. Bensalim et al. (

1998 ) reported

that a plant growth promoting rhizobacterium Burkholderia phyto ﬁ rmans strain

PsJN was able to maintain normal growth of potato plant under heat stress. Barka

et al. ( 2006 ) reported that ACC deaminase activity of the same bacterium

( Burkholderia phyto ﬁ rmans strain PsJN) enhanced plant growth and physiological

activity of grapevine ( Vitis vinifera L.) cv. Chardonnay explants at both ambient

(26°C) and low (4°C) temperature conditions. Inoculation of PGPR was able to

increase the root growth (11.8- and 10.7-fold at 26 and 4°C, respectively) and plant-

let biomass (6- and 2.2-fold at 26 and 4°C, respectively). It was inferred that this

bacterium can successfully improve the cold tolerance property of the plantlet when

compared with that of the non-bacterized control. Cheng et al. ( 2007 ) demonstrated

that ACC deaminase producing bacterium P. putida UW4 have also promoted the

growth of psychrotolerant Canola plant at extremely low temperature under the salt

stress. These studies have clearly demonstrated the potential of ACC deaminase

enzyme in normalizing the plant growth exposed to temperature extremes by lower-

ing the accelerated production of ethylene.

The various kinds of stresses in fact accentuate the biosynthesis of ethylene,

which in the most cases retards the plant growth through several mechanisms at

molecular level. In the present scenario, the application of PGPR containing ACC

deaminase activity is considered vital in regulation of ethylene production in plants.

Thus, application of PGPR containing ACC deaminase in agriculture might prove

bene ﬁ cial and could be a sound step towards sustainable crop production.

2.4 Nutrient Stress

Another crucial abiotic stress faced by the crop plants is supply of inadequate soil

nutrients. Although soil fertilization is typically required for better agricultural pro-

duction. However, external application of nitrate and phosphate fertilizers eventually

contaminate the surface and ground waters. Phosphate and nitrate run-off is associ-

ated with eutrophication of surface water bodies, resulting in ecological nuisance in

aquatic ecosystem. Application of fertilization of soil is attributable to low nutrient

level, which is created due to mutual interaction of nutrients such as phosphorous

interaction with highly reactive iron, aluminium and calcium minerals in soil, result-

ing into locking of up to 90% of the soil available phosphorous (Gyaneshwar et al.

2002 ) and rendering it unavailable to the plants. The PGPR have potential to main-

tain adequate plant nutrition and also reduce the negative environmental impact of

fertilizers. Plant growth promotion by some PGPR has been associated with improved

availability of soil nutrients as well as improved uptake of nutrients (Gyaneshwar

et al. 2002 ) . PGPR have been known to improve the nitrate uptake by plants (Mantelin

and Touraine 2004 ; Adesemoye et al. 2008 ) . It has been reported that a general

367

14 Plant Growth Promoting Rhizobacteria (PGPR)…

increase in the plant growth and nutrient uptake by PGPR is due to profuse root

development (Mantelin and Touraine 2004 ) and altered root structure due to produc-

tion of phytohormones like indole acetic acid (IAA) (Adesemoye et al. 2008 ) . An

increase in root surface area and numbers of root tips can contribute to improved

system tolerance and plant defense against pathogens. An increase in the nutrient

uptake ef ﬁ ciency of plants due to PGPR is also suggested to be mediated by stimu-

lated activity of proton pump ATPase (Mantelin and Touraine

2004 ) .

Owing to the ever increasing price of chemical fertilizers and its adverse environ-

mental impact, there is a growing need worldwide to reduce the application of

chemical fertilizers. Hence, several studies are now testing the hypothesis that

PGPR might enable us to maintain agricultural productivity with reduced applica-

tion of fertilizers. The preliminary results are found to be promising. The use of

PGPR isolates as inoculants is reportedly highly bene ﬁ cial for rice cultivation as

they can enhance the growth of rice by inducing other plant growth promoting traits

(Ashrafuzzaman et al. 2009 ) . During a ﬁ eld study with wheat plant ( Triticum aesti-

vum L.), the total yield of crop plants, given only 75% of the recommended doses of

N-P-K fertilizer plus a PGPR strain was comparable to the yield for plants given full

dose of fertilizer, but without PGPR (Shaharoona et al. 2008 ) . In another study on

tomato (Hernanndez and Chailloux 2004 ) , the dry weight of tomato transplants

grown with two PGPR strains and 75% fertilizer dose in the greenhouse was

signi ﬁ cantly higher than that with the full dose of fertilizer and without PGPR. After

transplanting the plants in the ﬁ eld, yields with some combinations of PGPR and

mycorrhizal fungi at 50% recommended ﬁ eld fertilization were greater than the

yield in plants treated with full dose of fertilizer, but without microbes.

Another current hypothesis is that PGPR, used as components of integrated

nutrient management systems, can help reduce the build-up of nutrients in fertilized

soils. Support for this hypothesis was presented in a report (Adesemoye et al. 2008 )

of a 3-year ﬁ eld study on maize that evaluated PGPR with and without mycorrhizal

fungi, manure and inorganic fertilizer, as well as with and without tillage. Signi ﬁ cant

increases in grain yield from microbial treatments were accompanied by increased

nitrogen content per gram of grain tissue and removal of signi ﬁ cantly higher

amounts of nitrogen, phosphorous and potassium. Therefore, within the tested nutri-

ent management system, PGPR contributed signi ﬁ cantly to reducing nutrient build

up in the soil. Many current studies are underway that will further de ﬁ ne the utility

of PGPR in nutrient management strategies aimed at reducing fertilizer application

rates and nutrient runoff from agricultural sources.

3 Perspective of PGPR as Biofertilizers

The word biofertilizer may be de ﬁ ned as living microorganisms, which can promote

growth of plants by increasing the availability of primary nutrients to the host plant.

More recent research ﬁ ndings indicated that the treatment of agricultural soils with

PGPR inoculation signi ﬁ cantly increases agronomic yields when compared with

368

J.S. Singh and D.P. Singh

that of uninoculated soil. There are many mechanisms by which the PGPR can

promote the growth of plants. Some of the important mechanisms by which PGPR

can enhance the growth and yield of crop plants are listed below:

(1) PGPR mediated N

ﬁ xation

(2) Availability of nutrients in the rhizosphere

(3) Root surface area enhancement

(4) Phytohormone synthesis.

3.1 N

Fixation

The PGPR as microbial inoculants have been accepted as an alternative source of

N-fertilizers and they can promote plant growth and productivity. They are consid-

ered environment friendly and can be used to ensure a sustainable crop production.

In the biofertilizer technology, efforts are being made to increase biological nitrogen

ﬁ xation for cereals and other non-legumes, by introducing the N

- ﬁ xing bacteria in

plant roots (Cocking 2000 ) . The plant growth promotion by means of nitrogen

ﬁ xation is an important criterian used for selection of rhizobacteria as an effective

biofertilizer. Application of both symbiotic and free-living N

- ﬁ xing bacteria (PGPR)

has shown a considerable bene ﬁ cial effect on plant growth (Kloepper et al. 1980 ;

Bashan and Holguin 1998 ) . The bacterial species belonging to genera Azospirillum ,

Alcaligenes , Arthrobacter , Acinetobacter , Bacillus , Burkholderia , Enterobacter ,

Erwinia , Flavobacterium , Pseudomonas , Rhizobium and Serratia are known to be

associated with the plant rhizosphere and are found to show bene ﬁ cial effect on plant

growth (Tilak et al. 2005 ; Egamberdiyeva 2005 ) . There is an important role played

by plant root exudates in selecting and enriching the compatible bacterial strains.

Therefore, the type of bacteria colonizing the rhizosphere of plants depends upon

the nature and concentrations of organic constituents of root exudates, but also on the

ability and ef ﬁ ciency of the microorganism to utilize the organic source present in the

root exudates (Curl and Truelove 1986 ) . The rhizospheric bacteria, that have ef ﬁ cient

systems for uptake and catabolism of organic constituents of root exudates (Barraquio

et al. 2000 ) , can get attached with the root surfaces and derive maximum bene ﬁ t from

root exudates. The associative interactions of plants with microorganisms must have

evolved as a result of co evolution. The use of latter group as bio-inoculants, for a

long-term successful and sustainable interaction, envisages that microbes must be

pre-adapted (Chaiharn et al. 2008 ) . The PGPR application as inoculants offers an

attractive and environment friendly technology to replace the chemical fertilizers and

pesticides (Ashrafuzzaman et al.

2009 ) . The use of bio-fertilizer and bio-enhancer

such as N

ﬁ xing bacteria would not only reduce the dependence of farmers on the

use of chemical fertilizers applications, but also reduce the cost of agricultural pro-

duction. Utilization of PGPR is a viable alternative to organic fertilizers, which will

help in preserving the environment and reducing the pollution (Stefan et al. 2008 ) .

Thus, the PGPR or combinations of PGPR and AMF can be exploited for improving

the nutrient use ef ﬁ ciency of plants (Adesemoye et al. 2009 ) . Applying the combined

369

14 Plant Growth Promoting Rhizobacteria (PGPR)…

inoculation of PGPR as biofertilizer affects bene ﬁ cially the yield and growth of

chickpea in ﬁ eld conditions (Rokhzadi et al. 2008 ) . Application of PGPR strains,

especially Azospirillum spp. was reported to ﬁ x N

in oil palm ( Elaeis guineensis )

and sweet potato ( Ipomoea batatas ). Bacillus sphaericus UPMB10 was observed to

produce bene ﬁ cial effects on oil palm (Amir et al.

2001 ) . In sweet potato, PGPR

inoculation along with 33% the total N-fertilizer requirement produced a plant bio-

mass comparable to yield obtained with fully fertilized plants, which represents

about 67% saving of N-fertilizer (Saad et al.

1999 ) . Halimi et al. ( 2000 ) observed that

the PGPR can supplement the nutrient requirement of tomato on soilless culture

media under protected environment. Azospirillum inoculation process has reportedly

increased the N

ﬁ xation, mineral nutrient content (P, K, Ca and Mg) and growth of

maize (Rai and Hunt 1993 ) .

3.2 Enhanced Rhizospheric Nutrient Status

There is ample evidence that the primary mode of PGPR action is related with

enhanced availability of nutrients to plant rhizosphere (Glick 1995 ; Rodriguez and

Fraga 1999 ) . The method by which availability of nutrients increases involves

solubilization of unavailable form of nutrients The solubilisation of phosphate and

production of siderophores help in the availability and transport of certain nutrients

(notably ferric iron).

3.2.1 Phosphate Solubilization

Phosphorus (P) is second to nitrogen in mineral nutrients which commonly limits

the growth of terrestrial plants. Ironically, there is large reserve of total P in the soil,

but the amount of phosphorous available to plants is usually a tiny fraction of the

total amount (Stevenson and Cole 1999 ) . The reduced availability of P to plants in

the vast majority of soil is due to insoluble form of P and plants can only absorb P

in two soluble forms i.e., the monobasic (H

−

) and the dibasic (HPO

2−

) ions

(Glass 1989 ) . P-solubilizing bacteria are commonly present in the rhizosphere

secrete organic acids which converts the non-available form of P to soluble form.

The phosphatases enzyme present in the P solubilising bacteria facilitates the con-

version of insoluble forms of P to soluble form (Kim et al. 1998 ) . The solubilization

of P in the rhizosphere is considered as the most common action of PGPR in the

direction of improving the P availability to the host plants (Richardson 2001 ) . Few

examples of such actions include associations between Azotobacter chroococcum

with wheat, Bacillus sp. and ﬁ ve crop species, Enterobacter agglomerans with

tomato, Pseudomonas chlororaphis and P. putida with soybean, Rhizobium sp. and

Bradyrhizobium japonicum with radish, Rhizobium leguminosarum with Phaseolus

(Antoun et al. 1998 ; Kim et al. 1998 ; Pal 1998 ; Chabot et al. 1998 ; Kumar and

Narula 1999 ; Singh and Kapoor 1999 ; Cattelana et al. 1999 ) .

370

J.S. Singh and D.P. Singh

Phosphate-solubilizing bacteria are common in rhizospheres (Nautiyal et al.

2000 ; Vazquez et al. 2000 ) . However, their ability to solubilize P with no extra input

suggested that a rhizospheric P solubilizing bacterium can be considered as PGPR.

Cattelana et al. (

1999 ) found only two out of ﬁ ve rhizospheric isolates positive for

P solubilisation, which registered a positive impact on soybean seedling growth.

Thus, not all P solubilizing PGPR are able to increase the plant growth by increas-

ing the P availability to the hosts. de Freitas et al. (

1997 ) isolated number of

P-solubilizing Bacillus sp. and a Xanthomonas maltophilia isolate from canola

( Brassica napus L.) rhizosphere, which had positive effects on plant growth, but no

effects on P content of the host plants.

3.2.2 Iron Absorption by Siderophore Production

The PGPR are reported to secrete some extracellular metabolites called sidero-

phores. For the ﬁ rst time, Kloepper et al. ( 1980 ) reported the signi ﬁ cance of sidero-

phores in plant growth promotion produced by certain genera of PGPR. Siderophores

are commonly referred to as microbial chelating agent of Fe. The presence of sidero-

phore producing PGPR in rhizosphere can enhance the Fe supply to plants and

thereby, improve the plant growth and yield. Further, this compound after chelating

make the soil Fe

de ﬁ cient for other soil microbes and consequently inhibits

the activity of other competing microbes.

Iron (Fe) is an essential nutrient of plants, but it is relatively insoluble in soil

solutions. Plant roots prefer absorption of iron in its reduced form i.e., ferrous (Fe

)

ion. The ferric (Fe

) ion is more common in well aerated soil and tends to get pre-

cipitated in the form of iron-oxide (Salisbury and Ross 1992 ) . Plants normally

excrete various soluble organic compounds (chelators and phytosiderophores)

which tend to bind with Fe

form and prevent it precipitation. Chelators help in the

transport the Fe

to the root surface where it is reduced to Fe

and is ready for

absorption. Phytosiderophores, excreted by grasses, are absorbed with the Fe

across the plasmalemma (von Wiren et al. 2000 ) .

There is evidence that a number of plant species can absorb bacterial Fe

sidero-

phore complexes (Bar-Ness et al. 1992 ; Wang et al. 1993 ) . However, the signi ﬁ cance

of bacterial Fe

siderophore being taken up by plants important mode of iron nutri-

tion in plants (Duijff et al. 1994 ) , it is more vital process especially in calcareous

soils (Masalha et al. 2000 ) . There is another school of thought which subscribes to

the theory that contribution of bacterial siderophores to the overall iron require-

ments of plants is small (Glick 1995 ) . Bar-Ness et al. ( 1992 ) had earlier supported

the concept of bacterial siderophore uptake by plants (Bar-Ness et al. 1992 ), con-

cluded that two bacterial siderophores (pseudobactin and ferrioxamine B) were

inef ﬁ cient as iron sources for plants and that rhizospheric siderophore-producing

bacteria can be in competition with the plant for iron. A vast majority of the research-

ers believe that the microbial siderophores in the rhizosphere are closely associated

with the bio-control activities in the region due to their ability to create an iron

de ﬁ cient condition for competing plant pathogens (Hiifte et al. 1994 ) .

371

14 Plant Growth Promoting Rhizobacteria (PGPR)…

3.3 Root Surface Area Improvement

Despite wide ranging impact of PGPR on the solubility and availability of soil

nutrients, they are known to affect the root density, surface area and morphoanatomy

of the plant. More speci ﬁ cally, enhanced root surface area can have a huge in ﬂ uence

on the nutrient uptake ef ﬁ ciency (Vessey

2003 ) . The plant growth promoting attribute

of the PGPR is mainly associated with morphological and physiological changes in

the inoculated plant roots and which suf ﬁ ciently improve the water and mineral

intake (Sarig et al. 1988 ) .

So far the accumulated evidences on the positive effects of biofertilizing-PGPR

points to bacteria-mediated changes in root growth and morphology. Bacterial medi-

ated increases in root weight are commonly reported in response to PGPR inocula-

tions (Vessey and Buss 2002 ) , particularly an increase in the root length and surface

area (Galleguillos et al. 2000 ; German et al. 2000 ; Holguin and Glick 2001 ) . Fallik

et al. ( 1994 ) reported that maize plants inoculated with Azospirillum brasilense

resulted in a proliferation of root hairs and exhibited profound impact on the root

surface area. The root length and root surface area are considered important param-

eters more effective evaluation of PGPR potential, just mention of increase in the

root weight i. e. not suf ﬁ cient. For instance, the clipped soybean roots in the pres-

ence of A. brasilense Sp7 showed about 63% increase in the root dry weight, but

there was about sixfold increase in speci ﬁ c root length (root length per unit root dry

weight), and more than tenfold increase in total root length (Molla et al. 2001 ) .

3.4 Production of Phytohormone by PGPR

Accumulating evidences indicated that PGPR in ﬂ uence the plant growth and devel-

opment by bringing about changes in the level of phytohormones such as auxins,

gibberellins, and cytokinins. The effects of auxins on plant growth are found to be

concentration dependent, where lower concentrations stimulate the growth and

higher concentrations reduce the overall growth (Arshad and Frankenberger 1991 ) .

However, different plant seedlings respond differently to variable level of auxin

concentrations (Sarwar and Frankenberger 1994 ) . The microorganisms (Ahmad

et al. 2005 ) which produce the highest amount of auxins i.e. indole acetic acid

(IAA) and indole acetamide (IAM) in non-sterilized soil, cause maximum increase

in growth and yield of the wheat crop (Khalid et al. 2004 ) . Even few strains showing

low rate IAA production, if secreted continuously, also exhibit improved plant

growth (Tsavkelova et al. 2007 ) . It has been observed that addition of IAA to soil

not only improves the root and shoot weight, but also ensures better survival of

rhizosphere bacteria (Narula et al. 2006 ) . The Dendrobium moschatum -originally

isolated from the roots of the epiphytic orchid and the strains of Rhizobium ,

Microbacterium , Sphingomonas , and Mycobacterium genera are among the most

active IAA producers (Tsavkelova et al.

2007 ) . The species of Pseudomonas and

Bacillus are also considered to promote the growth of plants, but the production of

372

J.S. Singh and D.P. Singh

phytohormones or growth regulators is not characterized. But they are known to

induce the greater amounts of ﬁ ne roots which have the effect on the absorptive

surface of plant roots and uptake of water and nutrients. Rhizobia were the ﬁ rst

group of bacteria characterized for production of IAA which helps and promotes the

growth and pathogen resistance in plants (Mandal et al.

2007 ; Basu and Ghosh

2001 ; Ghosh and Basu 2002 ; Roy and Basu 2004 ) . Sridevi and Mallaiah ( 2007 ) also

showed that all the strains of Rhizobium isolated from root nodules of Sesbania

sesban (L) Merr. were able to produce IAA. The Rhizobium sp. isolated from the

root nodules of plant Vigna mungo (L) Hepper showed high levels of IAA and was

made available to young and healthy root nodules (Mandal et al. 2007 ) . All the

Rhizobium spp. isolated from Crotalaria sp. showed IAA production, but the iso-

lates differ signi ﬁ cantly in the level of auxin production, perhaps depends upon the

cultural conditions. The studies conducted so far indicated that Rhizobia can be

effectively used as both bioenhancer and biofertilizer for increasing the crop pro-

duction as it can easily improve the nutrient uptake (N, P and K) by producing IAA

and subsequently increases the plant root system (Etesami et al. 2009 ) . Among all

the isolates maximum amount of IAA is produced by isolate from C . retusa (Sridevi

et al. 2008 ) . Independent of the origin (rhizosphere vs. phyllosphere), the isolated

bacterial strains produced IAA, which had positive impact on the growth of pea and

wheat plants. Among them, the highest concentration of IAA was particularly pro-

duced by the bacterial strain P. ﬂ uorescens and Kocuria varians (Ahmad et al. 2005 ;

Egamberdieva 2008 ) . While working on chickpea, Joseph et al. ( 2007 ) observed

that all the isolates of genus Bacillus, Pseudomonas and Azotobacter were able to

produce IAA. On the other hand, about 85.7% isolates of genus Rhizobium exhib-

ited IAA production. Choi et al. ( 2008 ) have reported that Pseudomonas ﬂ uorescens

B16 is a plant growth-promoting rhizobacterium and it produces Pyrroloquinoline

Quinone which is a plant growth promotion factor. Even the plant growth promoting

attribute of nitrogen ﬁ xing Azotobacter strain is associated with production of phy-

tohormone rather than to its diazotrophic activity. Pseudomonas bacteria, especially

P. ﬂ uorescens and P. putida are the most important PGPR strains known to produce

auxin and promote the plant yield.

In fact, a variety of auxin like substances such as indole-3-acetic acid (IAA),

indole-3-pyruvic acid, indole-3-butyric acid and indole lactic acid (Costacurta

et al. 1994 ; Martinez-Morales et al. 2003 ) ; cytokinins (Horemans et al. 1986 ;

Cacciari et al. 1989 ) and gibberellins (Bottini et al. 1989 ) are known as growth

promoters. But the production of auxin is comparatively and quantitatively most

important for plants (Barassi et al. 2007 ) . Khakipour et al. ( 2008 ) tried to evaluate

the auxin production potential of Pseudomonas strains through chromatography,

using HPLC devise; compared the methods of IAA synthesis in Azospirillum brasi-

lense strain SM which has potential to trigger the IAA accumulation in Sorghum

plants under nutrient stresses. Further, it also exhibited ability to promote the

growth of number of other plants like Mung bean, Wheat and Maize (Malhotra and

Srivastava 2008 ) . Some of the P-solubilizing bacteria (PSB) and fungi (PSF) are

also known as plant growth promoters due to their ability to produce IAA but there

is a differential rate of IAA production among different PSB and PSF isolates

373

14 Plant Growth Promoting Rhizobacteria (PGPR)…

(Souchie et al. 2007 ) . Bacillus megaterium isolated from tea plant rhizosphere was

found to contribute positively to the plant growth due to its ability to produce IAA

(Chakraborty et al. 2006 ) . It has been suggested that the cytokinin receptors in

B. megaterium also play a complimentary role in plant growth promotion (Ortiz-

Castro et al.

2008 ) .

4 PGPR as Bio-control Agents

The plant growth promoting bacteria colonizing the rhizosphere of plants produce

substances, which not only increase the growth of plants, but also protect them

against various diseases. They are known to suppress a broad spectrum of bacte-

rial, viral, fungal and nematode diseases. The PGPR provide protection to the

plants against pathogens by direct antagonistic interactions with pathogens and

work as bio-control agents. As the PGPR are indigenous to soil and the plant

rhizosphere, it is easier for them to play the role of bio-control agents against

plant pathogens. On the other side, they can also induce the host resistance against

plant disease. Most of the studies demonstrating the plant protection by PGPR

have been carried out in laboratory and greenhouse. The results obtained so far

under the ﬁ eld condition have been inconsistent. Recent progress in our under-

standing of their diversity, colonizing ability, and mechanism of action, formula-

tion and application should be fully utilized to facilitate and devise the cost

effective plant protection technology against plant pathogens. Some of these

rhizobacteria may also be tried as a part of integrated pest management pro-

grammes. Greater the application of PGPR be encouraged in plant protection and

biofertilization (Siddiqui 2006 ) . The isolation of bacterial strains from the rhizo-

sphere of Lolium perenne rhizosphere are found to be effective as plant growth

promoters and as bio-control agents and subsequently resulting into enhanced

yield (Shoebitz et al. 2007 ) . The Pseudomonades – a major group of rhizobacteria

with potential for biological control (Kremer and Kennedy 1996 ) , are ubiquitous

and are present in agricultural soils. A great deal of information is available

regarding the process of root colonization by pseudomonads and also the biotic/

abiotic factors regulating the colonization, bacterial traits and genes, which confer

the special attributes to this soil bacteria for rhizosphere competence and suppres-

sion of pathogen (Weller 2007 ) . Pseudomonads possess many more traits that

make them well suited as bio-control and growth-promoting agents (Weller 1988 ) .

These include the ability to (i) grow rapidly in vitro and produce larger biomass;

(ii) ef ﬁ cient utilization of seed and root exudates; (iii) ability to colonize and mul-

tiply in the rhizosphere environments and within the plant tissue; (iv) ability to

produce a wide spectrum of bioactive metabolites (i.e., antibiotics, siderophores,

volatiles, and growth-promoting substances); (v) compete aggressively with

other microorganisms; and (vi) adapt to environmental stresses. In addition,

pseudomonads are responsible for the natural suppression of growth of some soil

borne pathogens (Weller et al. 2002 ) . The major weakness of pseudomonads as

374

J.S. Singh and D.P. Singh

bio-control agents is their inability to produce resting spores like many other

Bacillus spp. which restricts the wide application of the bacteria for commercial

use. Fluorescent pseudomonas spp. has been studied for decades for their plant

growth-promoting effects through effective suppression of soil borne plant dis-

eases. Among various bio-control agents, Fluorescent pseudomonads , are well

equipped with multiple mechanisms of bio-control as well as plant growth promo-

tion (Banasco et al.

1998 ; Dileep et al. 1998 ) . They produce a wide spectrum of

compounds like antibiotics, chitinolytic enzymes, P solubilising enzymes, growth

promoting hormones, siderophores, HCN and catalase enzyme (Kraus and Loper

1995 ) . Pseudomonas ﬂ uorescens MSP-393 has been tried as plant growth-pro-

moting rhizobacterium as well as bio-control agent for rice crop grown in saline

soils of coastal areas (Paul et al. 2006 ) . Cold-tolerant ﬂ uorescent Pseudomonas

isolated from Garhwal district of Uttarakhand has shown its potential both as

plant growth promoter and bio-control agents for pea (Negi et al. 2005 ) .

Bacillus subtilis, an endospore forming bacterium predominantly an inhabitant

of soil, has been widely recognized as a powerful bio-control agent as it produces

different biologically active compounds with a broad spectrum of activity (Nagorska

et al. 2007 ) . Bacillus megaterium – an isolate from tea plant rhizosphere can solubi-

lize phosphate, produce IAA, siderophore and antifungal metabolites and thereby, it

helps in the plant growth promotion and protection of plant diseases (Chakraborty

et al. 2006 ) . Two strains Bacillus thuringiensis ( kurstaki ) and B. sphaericus have

also been reported to have the ability to solubilise phosphates and help in the control

of the lepidopteron pests (Seshadri et al. 2007 ) .

In recent years, role of siderophore producing PGPR have been implicated in

bio-control of soil-borne plant pathogens. Now the Microbiologists have developed

the techniques for introduction of siderophore producing PGPR in soil system

through seed, soil or root system. The suppression of plant pathogens by PGPR, can

indirectly contribute to enhancement in the plant growth/ yield via a variety of

mechanisms. These include:

The ability to produce siderophores (as discussed above) that chelate iron, mak-•

ing it unavailable to pathogens.

The capacity to synthesize anti-fungal metabolites such as antibiotics, fungal cell •

wall-lysing enzymes, or hydrogen cyanide, which suppress the growth of fungal

pathogens.

The ability to successfully compete with pathogens for nutrients or speci ﬁ c •

niches on the root; and the ability to induce systemic resistance.

Among the various PGPRs identi ﬁ ed, Pseudomonas ﬂ uorescens is considered as

one of the most extensively used rhizobacterium because of its antagonistic action

against several plant pathogens. Banana bunchy top virus (BBTV) is one of the

deadly viruses which severely affects the yield of banana ( Musa spp.) crop in

Western Ghats, Tamil Nadu, India. It has been demonstrated that application of P.

ﬂ uorescens strain signi ﬁ cantly reduces the incidence of BBTV disease incidence in

the banana under both greenhouse and ﬁ eld conditions. Different PGPR spp. as bio-

control agents against various plant diseases has been given in Table

14.2 .

375

14 Plant Growth Promoting Rhizobacteria (PGPR)…

4.1 PGPR as Biological Fungicides

The PGPR and bacterial endophytes are known to play a vital role in the management

of various fungal diseases. But one of the major hurdles experienced with bio-

control agents is the lack of appropriate delivery system. Some PGPR can syn-

thesize antifungal compounds, viz. synthesis of 2, 4-diacetyl phloroglucinol by

P. ﬂ uorescens which inhibits the growth of pathogenic fungi (Nowak-Thompson

et al.

1994 ) . Certain PGPR can degrade fusaric acid produced by the fungi

Fusarium sp. – a causative agent of wilt (Toyoda and Utsumi 1991 ) . There are

few PGPR strains which can produce enzymes that hydrolyses the fungal cell

wall, for instance secretion of chitinase and laminarinase enzymes by the

Pseudomonas stutzeri which can lyse the mycelia of Fusarium solani (Mauch

et al. 1988 ) . Pseudomonas ﬂ uorescent has been suggested not only as a plant

growth promoter, but also as potential bio-control agent due to its ability to

Table 14.2 Bio-control behaviour of PGPR against various plant diseases

PGPR Pathogens Plant diseases References

Fluorescent

pseudomonas

Under gnotobiotic

conditions

Black root-rot of

tobacco

Voisard et al. (

1989 )

P. ﬂ uorescens

CHA0

Thielaviopsis

basicola

Black root rot of

tobacco

Voisard et al. (

1989 )

F. pseudomonas

EM85

Rhizoctonia solani Damping-off of cotton Pal et al. (

2000 )

P. oryzihabitans and

Xanthomonas

nematophila

strains

Pythium and

Rhizoctonia sp.

Damping-off of cotton Kapsalis et al.

(

2008 )

F. pseudomonads Rhizoctonia

bataticola and

Fusarium

oxysporum

Rice and sugarcane

rhizosphere

Kumar et al. (

2002 )

Pseudomonas

strains

Xanthomonas oryzae

pv. Oryzae and

Rhizoctonia

solani

Bacterial leaf blight

and sheathblight

pathogens of rice

( Oryzasativa )

Rangarajan et al.

(

2001 )

F. pseudomonads Helminthosporium

sativum

Endo-rhizosphere of

wheat

Gaur et al. (

2004 )

P. ﬂ uorescens

CHA0

Meloidogyne

javanica

Root-knot nematode Siddiqui et al. (

2005 )

P. putida Macrophomina

phaseolina

Root-rot disease

complex of

chickpea

Saraf et al. (

2008 )

P. aeruginosa Sha8 F.oxysporium and

Helmithosporium

sp.

Antagonistic activities Hassanein et al.

(

2009 )

P. ﬂ uorescens

CHA0

Tetrahymena

pyriformis

Pathogenic against the

ciliated protozoa

Jousset et al. (

2009 )

376

J.S. Singh and D.P. Singh

protect the plants against the incidence of a wide range of important fungal diseases

such as black root-rot of tobacco (Voisard et al. 1989 ) , root-rot of pea (Papavizas

and Ayers 1974 ) , root-rot of wheat (Garagulia et al. 1974 ) , damping-off of sugar

beet (Kumar et al.

2002 ) . There is ample scope for genetic manipulation of these

organisms to improve their ef ﬁ cacy s bio-control agents (Dowling and O’Gara

1994 ) . A number of ﬂ uorescent Pseudomonads exhibit strong antifungal activity

(Reddy and Rao 2009 ) . Pseudomonas ﬂ uorescent spp. EM85 and P. oryzihabi-

tans exhibit strong antagonistic interaction with Rhizoctonia solani – a causal

agent of damping-off of cotton (Pal et al. 2000 ) . The X. nematophila strain also

produce secondary metabolites which can suppress the growth of Pythium and

Rhizoctonia species causing damping-off in cotton (Kapsalis et al. 2008 ) . The

ﬂ uorescent Pseudomonads also exhibit strong antagonistic effect against

Rhizoctonia bataticola and Fusarium oxysporum associated with the rhizo-

sphere of rice and sugarcane plants (Kumar et al. 2002 ) . Xanthomonas oryzae

pv. oryzae and Rhizoctonia solani – the bacterial leaf blight (BB) and sheath

blight (ShB) pathogens of rice ( Oryza sativa ) are suppressed by indigenously

present Pseudomonas strains isolated from rice cultivated coastal agricultural

ﬁ elds, having saline soils (Rangarajan et al. 2001 ) . Pseudomonas ﬂ uorescens

isolated from rice plant rhizosphere are found to have strong antifungal activity

against P. oryzae and R. solani mainly due to excess production of antifungal

metabolites (Reddy et al. 2008 ) . About 50–60% of several ﬂ uorescent

pseudomonads isolated from the rhizosphere and endorhizosphere of wheat

plant growing Indo-Gangetic plains exhibit antagonistic interactions with

Helminthosporium sativum (Gaur et al. 2004 ) . Zadeh et al. ( 2008 ) reported

antagonistic potential of non-pathogenic rhizosphere isolates of ﬂ uorescent

Pseudomonas in the bio-control of Pseudomonas savastanoi – a causative agent

of Olive knot disease. The P. corrugata , which grows at 4°C under laboratory

conditions (Pandey and Palni 1998 ) , also produces antifungal compounds like

diacetylphloroglucinol and/or phenazine. Pseudomonas ﬂ uorescens CHA0 is

reported to suppresses the black root rot of tobacco plant caused by the fungus

Thielaviopsis basicola (Voisard et al. 1989 ) and it also contributes to biological

control of root-knot nematode disease caused by Meloidogyne javanica (Siddiqui

et al. 2005 ) . In addition, certain soils from Morens, Switzerland, were found to

be natural suppressive agent for Thielaviopsis basicola -mediated black root rot

of tobacco due to presence of ﬂ uorescent Pseudomonads populations (Pal et al.

2000 ) . P. putida has potential for the bio-control of root-rot disease complex of

chickpea due to its antagonistic interaction against Macrophomina phaseolina

(Saraf et al.

2008 ) . It has also been shown that anaerobic regulator ANR-

mediated cyanogenesis has important role in the suppression of black root rot

(Laville et al. 1998 ) . The suppression of Phytophthora capsici by fuorescent

Pseudomonads in all seasons of plant growth helps in control of foot rot disease

(Paul and Sarma 2006 ) . Some metabolites produced by Pseudomons aeruginosa

Sha8 include toxic volatile compound which reduces the growth of both F.

oxysporium and Helmithosporium sp. but not the growth of A. niger (Hassanein

et al. 2009 ) . B. luciferensis strain KJ2C12 controls the Phytophthora blight of

377

14 Plant Growth Promoting Rhizobacteria (PGPR)…

pepper by effective root colonization and enhanced production of protease

enzyme and, also by increasing the soil microbial activity (Kim et al. 2009 ) .

5 Conclusions

It has been demonstrated and proven that PGPR can be the very effective and

potential microorganisms for enriching the soil fertility and enhancing the pro-

ductivity in various agriculture yields. In the present scenario, application of

PGPR is vital to overcome the problems of various environmental stresses such

as soil salinity, drought, water logging, temperature and nutritional stresses to

crop plants. Inoculation of plants under salinity stress with PGPR having ACC-

deaminase activity is expected to mitigate the inhibitory effects of salinity on

root growth by lowering the ethylene concentration in the plant. The PGPR is the

most commonly used as biofertilizer which increase the availability and uptake

of nutrients in plants. Current and future progress in our understanding of PGPR

diversity, colonization ability, mechanisms of action, formulation, and applica-

tion could facilitate their development as reliable components in the manage-

ment of sustainable agricultural systems. On a commercial scale, application of

PGPR in agriculture might prove bene ﬁ cial and could be a sound step towards

sustainable crop production and conservation. A schematic diagram showing

role of PGPR in sustainable agriculture productivity is presented in Fig. 14.1 .

Acknowledgements The authors wish to thank the Head of the Department of Environmental

Microbiology and Department of Environmental Science, Babasaheb Bhimrao Ambedkar (Central)

University, Lucknow for providing infrastructure facilities. Financial support from UGC, New

Delhi is gratefully acknowledged.

Biocontrols

Phytohormones

Stress agriculture

Biofertilizers

Nutrient

availability

PGPR

Sustainable Agriculture

Antifungal

Fig. 14.1 A schematic diagram showing perspectives of PGPR in sustainable agriculture

development

378

J.S. Singh and D.P. Singh

References

Adesemoye AO, Torbert HA, Kloepper JW (2008) Enhanced plant nutrient use ef ﬁ ciency with

PGPR and AMF in an integrated nutrient management system. Can J Microbiol 54:876–886

Adesemoye A, Torbert H, Kloepper J (2009) Plant growth-promoting rhizobacteria allow reduced

application rates of chemical fertilizers. Microb Ecol 58:921–929

Ahmad F, Ahmad I, Khan MS (2005) Indole acetic acid production by the indigenous isolates of

Azotobacter and Fluorescent Pseudomonas in the presence and absence of tryptophan. Turk J

Biol 29:29–34

Ahmad M, Zahir ZA, Asghar HN, Asghar M (2011) Inducing salt tolerance in mung bean through

coinoculation with rhizobia and plant-growth-promoting rhizobacteria containing 1-aminocy-

clopropane-1-carboxylate deaminase. Can J Microbiol 57(7):578–589

Amir HG, Shamsuddin ZH, Halimi MS, Ramlan MF, Marziah M (2001) Effects of Azospirillum inocu-

lation on N2 ﬁ xation and growth of oil palm plantlets at nursery stage. J Oil Palm Res 13:42–49

Antoun H, Beauchamp CJ, Goussard N, Chabot R, Lalande R (1998) Potential of Rhizobium and

Bradyrhizobium species as plant growth promoting rhizobacteria on non-legumes: effect on

radishes ( Raphanus sativus L.). Plant Soil 204:57–67

Arshad M, Frankenberger WT (1991) Microbial production of plant hormones. Plant Soil 133:1–8

Arshad M, Shaharoona B, Mahmood T (2008) Inoculation with plant growth promoting rhizobac-

teria containing ACC-deaminase partially eliminates the effects of water stress on growth, yield

and ripening of Pisum sativum L. Pedosphere 18:611–620

Ashraf M, Hasnain S, Berge O (2004) Bacterial exo-polysaccharides and productivity of the salt

affected soils. II. Effect of exo-polysaccharides (EPS) producing bacterial inoculation on

growth of roots of wheat ( Triticum aestivum L.) plants grown in a salt-affected soil. Int J

Environ Sci Tech 3:45–53

Ashrafuzzaman M, Hossen FA, Ismail MR, Hoque MA, Islam MZ, Shahidullah SM, Meon S

(2009) Ef ﬁ ciency of plant growth promoting rhizobacteria (PGPR) for the enhancement of rice

growth. Afr J Biotechnol 8:1247–1252

Babalola OO, Osir EO, Sanni AI, Odhaimbo GD, Bulimo WD (2003) Ampli ﬁ cation of 1-amino-

cyclopropane-1-carboxylic (ACC) deaminase from plant growth promoting rhizobacteria in

Striga-infested soils. Afr J Biotechnol 2:157–160

Banasco P, Fuente L De La, Gaultieri G, Noya F, Arias A (1998) Fluorescent Pseudomonas spp.

as bio-control agents against forage legume root pathogenic fungi. Soil Biol Biochem

10:1317–1323

Bano A, Fatima M (2009) Salt tolerance in Zea mays (L). following inoculation with Rhizobium

and Pseudomonas . Biol Fertil Soils 45:405–413

Barassi CA, Sueldo RJ, Creus CM, Carrozzi LE, Casanovas EM, Pereyra MA (2007) Azospirillum spp.,

a dynamic soil bacterium favourable to vegetable crop production. Dyn Soil Dyn Plant 1:68–82

Barka EA, Nowak J, Clement C (2006) Enhancement of chilling resistance of inoculated grapevine

plantlets with a plant growth-promoting rhizobacterium, Burkholderia phytoWrmans strain

PsJN. Appl Environ Microbiol 72:7246–7252

Bar-Ness E, Hadar Y, Chen Y, Romheld V, Marschner H (1992) Short-term effects of rhizosphere

microorganisms on Fe uptake from microbial siderophores by maize and oat. Plant Physiol

100:451–456

Barraquio WL, Segubre EM, Gonzalez MS, Verma SC, James EK, Ladha JK, Tripathi AK (2000)

Diazotrophic enterobacteria: what is their role in the rhizosphere? In: Ladha JK, Reddy PM

(eds) The quest for nitrogen ﬁ xation in rice. IRRI, Manila, pp 93–118

Bashan Y, Holguin G (1998) Proposal for the division of plant growth-promoting rhizobacteria

into two classi ﬁ cations: biocontrol-PGPB (plant growth promoting bacteria) and PGPB. Soil

Biol Biochem 30:1225–1228

Basu PS, Ghosh AC (2001) Production of indole acetic acid in cultures by a Rhizobium species from

the root nodules of a mono cotyledonous tree, Roystonea regia . Acta Biotechnol 1:65–72

379

14 Plant Growth Promoting Rhizobacteria (PGPR)…

Belimov AA, Safronova VI, Sergeyeva TA, Egorova TN, Matveyeva VA, Tsyganov VE, Borisov

AY, Tikhonovich IA, Kluge C, Preisfeld A, Dietz KJ, Stepanok VV (2001) Characterization of

plant growth promoting rhizobacteria isolated from polluted soils and containing 1-aminocy-

clopropane-1-carboxylate deaminase. Can J Microbiol 47:242–252

Bensalim S, Nowak J, Asiedu SK (1998) A plant growth promoting rhizobacterium and temperature

effects on performance of 18 clones of potato. Am J Potato Res 75:145–152

Berg G (2009) Plant microbe interactions promoting plant growth and health: perspectives for

controlled use of microorganisms in agriculture. Appl Microbiol Biotechnol 84:11–18

Blumwald E (2000) Sodium transport and salt tolerance in plants. Curr Opin Cell Biol 12:431–434

Bottini R, Fulchieri M, Pearce D, Pharis RP (1989) Identi ﬁ cation of gibberellins A1, A3 and iso-

A3 in culture of Azospirillum lipoferum . Plant Physiol 90:45–47

Bray EA (1997) Plant responses to water de ﬁ cit. Trends Plant Sci 2:48–54

Cacciari I, Lippi D, Ippoliti S, Pietrosanti W, Pietrosanti W (1989) Response to oxygen of diaz-

otrophic Azospirillum brasiliense-Arthobacter giacomelloi mixed batch culture. Arch Microbiol

152:111–114

Cattelana AJ, Hartela PG, Fuhrmann JJ (1999) Screening for plant growth–promoting rhizobacte-

ria to promote early soybean growth. Soil Sci Soc Am J 63:1670–1680

Chabot R, Beauchamp CJ, Kloepper JW, Antoun H (1998) Effect of phosphorus on root coloniza-

tion and growth promotion of maize by bioluminescent mutants of phosphate-solubilizing

Rhizobium leguminosarum biovar phaseoli . Soil Biol Biochem 30:1615–1618

Chaiharn M, Chunhaleuchanon S, Kozo A, Lumyong S (2008) Screening of rhizobacteria for their

plant growth promoting activities. KMITL Sci Technol J 8:18–23

Chakraborty U, Chakraborty B, Basnet M (2006) Plant growth promotion and induction of resis-

tance in Camellia sinensis by Bacillus megaterium . J Basic Microbiol 46:186–195

Chen CZ, Ma S, Liu L (2008) Studies on phosphorus solubilizing activity of a strain of phospho-

bacteria isolated from chestnut type soil in. Bioresour Technol 99:6702–6707

Cheng Z, Park E, Glick BR (2007) 1-Aminocyclopropane-1-carboxylate (ACC) deaminase from

Pseudomonas putida UW4 facilitates the growth of canola in the presence of salt. Can J

Microbiol 53:912–918

Choi O, Kim J, Kim J, Jeong Y, Moon JS, Park CS, Hwang I (2008) Pyrroloquinoline Quinone is

a plant growth promotion factor produced by Pseudomonas ﬂ uorescens B16. Plant Physiol

146:657–668

Cocking EC (2000) Helping plants get more nitrogen from air. Eur Rev 8:193–200

Costacurta A, Keijers V, Vanderleyden J (1994) Molecular cloning and sequence analysis of an

Azospirillum brasilense indole-3-acetic pyruvate decarboxylase gene. Mol Gen Genet

243:463–472

Cowan AK, Cairns ALP, Bartels-Rahm B (1999) Regulation of abscisic acid metabolism: towards

a metabolic basis for abscisic acid-cytokinin antagonism. J Exp Bot 50:595–603

Curl EA, Truelove B (1986) The rhizosphere. Springer, Berlin/Heidelberg, 288

de Freitas JR, Banerjee MR, Germida JJ (1997) Phosphate solubilizing rhizobacteria enhance the

growth and yield but not phosphorus uptake of canola ( Brassica napus L.). Biol Fertil Soils

24:358–364

Dileep C, Kumar BSD, Dube HC (1998) Promotion of plant growth and yield by two rhizoplane

ﬂ uorescent Pseudomonas . Ind J Exp Biol 36:399–402

Dowling DN, O’Gara F (1994) Metabolites of Pseudomonas involved in the bio-control of plant

disease. Trends Biotechnol 12:133–141

Duijff BJ, de Kogel WJ, Bakker PAHM, Schippers B (1994) In ﬂ uence of pseudobactin 358 on the

iron nutrition of barley. Soil Biol Biochem 26:1681–1688

Egamberdieva D (2008) Plant growth promoting properties of rhizobacteria isolated from wheat

and pea grown in loamy sand soil. Turk J Biol 32:9–15

Egamberdiyeva D (2005) Plant-growth-promoting rhizobacteria isolated from a calcisol in a semi-

arid region of Uzbekistan: biochemical characterization and effectiveness. J Plant Nutr Soil Sci

168:94–99

380

J.S. Singh and D.P. Singh

Etesami H, Alikhani HA, Jadidi M, Aliakbari A (2009) Effect of superior IAA producing rhizobia

on N, P, K uptake by wheat grown under greenhouse condition. World J Appl Sci 6:1629–1633

Fallik E, Sarig S, Okon Y (1994) Morphology and physiology of plant roots associated with

Azospirillum . In: Okon Y (ed) Azospirillum/plant associations. CRC Press, Boca Raton,

pp 77–86

Figueiredo VB, Burity HA, Martinez CR, Chanway CP (2008) Alleviation of drought stress in the

common bean ( Phaseolus vulgaris L.) by co-inoculation with Paenibacillus polymyxa and

Rhizobium tropici . Appl Soil Ecol 40:182–188

Galal YGM (2003) Assessment of nitrogen availability to wheat ( Triticum aestivum L.) from inor-

ganic and organic N sources as affected by Azospirillum brasilense and Rhizobium legumi-

nosarum inoculation. Egypt J Microbiol 38:57–73

Galleguillos C, Aguirre C, Barea JM, Azcon R (2000) Growth promoting effect of two

Sinorhizobium meliloti strains (a wild type and its genetically modi ﬁ ed derivative) on a non-

legume plant species in speci ﬁ c interaction with two arbuscular mycorrhizal fungi. Plant Sci

159:57–63

Garagulia AD, Kiprianova EA, Boiko OI (1974) Antibiotic effect of bacteria from the genus

Pseudomonas on phytopathogenic fungi. Mikrobiol Zh (Kiev) 36:197–202

Gaur R, Shani N, Kawaljeet Johri BN, Rossi P, Aragno M (2004) Diacetyl phloroglucinol-produc-

ing Pseudomonas does not in ﬂ uence AM fungi in wheat rhizosphere. Curr Sci 86:453–457

German MA, Burdman S, Okon Y, Kigel J (2000) Effects of Azospirillum brasilense on root mor-

phology of common bean ( Phaseolus vulgaris L.) under different water regimes. Biol Fertil

Soils 32:259–264

Ghosh AC, Basu PS (2002) Growth behaviour and bioproduction of indole acetic acid by a

Rhizobium species isolated from root nodules of a leguminous tree Dalbergia lanceolarea . Ind

Exp Biol 40:796–801

Ghosh S, Penterman JN, Little RD, Chavez R, Glick BR (2003) Three newly isolated plant growth-

promoting bacilli facilitate the seedling growth of canola, Brassica campestris . Plant Physiol

Biochem 41:277–281

Glass ADM (1989) Plant nutrition: an introduction to current concepts. Jones and Bartlett

Publishers, Boston, 234

Glick BR (1995) The enhancement of plant growth by free-living bacteria. Can J Microbiol

41:109–117

Glick BR (2005) Modulation of plant ethylene levels by the bacterial enzyme ACC deaminase.

FEMS Microbiol Lett 251:1–7

Grattan SR, Grieve CM (1999) Salinity mineral nutrient relations in horticultural crops. Sci Hortic

78:127–157

Gyaneshwar P, Kumar GN, Parekh LJ, Poole PS (2002) Role of soil microorganisms in improving

P nutrition of plants. Plant Soil 245:83–93

Halimi MS, Raf ﬁ dah Z, Ismail MR (2000) Growth responses of tomatoes ( Lycopersicon esculen-

tum Mill) under protected environment to rhizobacterial inoculation. Trans Malays Soc Plant

Physiol 9:235–239

Han HS, Lee KD (2005) Plant growth promoting rhizobacteria effect on antioxidant status, photosyn-

thesis, mineral uptake and growth of lettuce under soil salinity. Res J Agric Biol Sci 1:210–215

Hassanein WA, Awny NM, El-Mougith AA, Salah El-Dien SH (2009) The antagonistic activities

of some metabolites produced by Pseudomonas aeruginosa Sha8. J Appl Sci Res 5:404–414

Hernandez M, Chailloux M (2004) Las microrizas arbusculares y las bacterias rizosfe’ricas como

alternativa a la nutricion mineral del tomate. Cultivos Tropicales 25:5–16

Hiifte M, Vande Woestyne M, Verstraete W (1994) Role of siderophores in plant growth promo-

tion and plant protection by ﬂ uorescent pseudomonads. In: Manthey JA, Crowley DE, Luster

DG (eds) Biochemistry of metal micro-nutrients in the rhizosphere. Lewis Publishers, Boca

Raton, pp 81–92

Holguin G, Glick BR (2001) Expression of the ACC deaminase gene from Enterobacter cloacae

UW4 in Azospirillum brasilense . Microb Ecol 41:281–288

381

14 Plant Growth Promoting Rhizobacteria (PGPR)…

Horemans S, de Koninck K, Neuray J, Hermans R, Valassak K (1986) Production of plant growth

substances by Azospirillum sp. and other rhizosphere bacteria. Symbiosis 2:341–346

Ingram J, Bartels D (1996) The molecular basis of dehydration tolerance in plants. Annu Rev Plant

Physiol Plant Mol Biol 47:377–403

Joseph B, Patra RR, Lawrence R (2007) Characterization of plant growth promoting rhizobacteria

associated with chickpea ( Cicer arietinum L.). Int J Plant Prod 1:141–152

Jousset A, Rall B, Kalinkat G, Scheu S, Brose U (2009) Extracellular toxin production by soil

bacteria cause a shift from a type III to type IV functional response by microfaunal predators

[Oral presentation]. The 39th annual meeting of the ecological, Society of Germany, Austria/

Switzerland

Kapsalis A, Gravanis F, Gowen S (2008) Involvement of phenazine-1-carboxylic acid, sidero-

phores and hydrogen cyanide in suppression of Rhizoctonia solani and Pythium spp. damping-

off by Pseudomonas oryzihabitans and Xenorhabdus nematophila . J Food Agric Environ

6:168–171

Khakipour N, Khavazi K, Mojallali H, Pazira E, Asadirahmani H (2008) Production of Auxin

hormone by Fluorescent Pseudomonads . Am Eurasian J Agric Environ Sci 4:687–692

Khalid A, Arshad M, Zahir ZA (2004) Screening plant growth-promoting rhizobacteria for improv-

ing growth and yield of wheat. J Appl Microbiol 96(8):473–480

Kim KY, Jordan D, McDonald GA (1998) Effect of phosphate solubilizing bacteria and vesicular–

arbuscular mycorrhizae on tomato growth and soil microbial activity. Biol Fertil Soils 26:79–87

Kim H, Sang MK, Myung I, Chun S, Kim KD (2009) Characterization of Bacillus luciferensis

strain KJ2C12 from pepper root, a bio-control agent of Phytophthora blight of pepper. J Plant

Pathol 25:62–69

Kloepper JW, Leong J, Teintze M, Schroth MN (1980) Enhanced plant growth by siderophores

produced by plant growth promoting rhizobacteria. Nature 286:885–886

Kloepper JW, Lifshitz R, Zablotowicz RM (1989) Free-living bacterial inocula for enhancing crop

productivity. Trends Biotechnol 7:39–43

Kogan FN (1997) Global drought watch from space. Bull Bridge University Press, New York

Kohler J, Caravaca F, Carrasco L, Roldan A (2006) Contribution of Pseudomonas mendocina and

Glomus intraradices to aggregates stabilization and promotion of biological properties in

rhizosphere soil of lettuce plants under ﬁ eld conditions. Soil Use Manage 22:298–304

Kohler J et al (2008) Plant-growth-promoting rhizobacteria and arbuscular mycorrhizal fungi

modify alleviation biochemical mechanisms in water-stressed plants. Funct Plant Biol

35:141–151

Kraus J, Loper J (1995) Characterization of genomic region required for production of antibiotic

pyoluteorin by the biological control agent Pseudomonas ﬂ uorescens Pf-5. Appl Environ

Microbiol 61:849–854

Kremer RJ, Kennedy AC (1996) Rhizobacteria as bio-control agents of weeds. Weed Technol

10:601–609

Kumar V, Narula N (1999) Solubilization of inorganic phosphates and growth emergence of wheat

as affected by Azotobacter chroococcum mutants. Biol Fertil Soils 28:301–305

Kumar NR, Arasu VT, Gunasekaran P (2002) Genotyping of antifungal compounds producing

plant growth-promoting rhizobacteria, Pseudomonas ﬂ uorescens . Curr Sci 82:1465–1466

Laville J, Blumer C, Schroetter CV, Gaia V, Defago G, Keel C, Haas D (1998) Characterization of

the hcnABC gene cluster encoding hydrogen cyanide synthase and anaerobic regulation by

ANR in the strictly aerobic bio-control agent Pseudomonas ﬂ uorescens CHA0. J Bacteriol

180:3187–3196

Lugtenberg B, Kamilova F (2009) Plant-growth-promoting rhizobacteria. Annu Rev Microbiol

63:541–556

Malhotra M, Srivastava S (2008) Stress-responsive indole-3-acetic acid biosynthesis by

Azospirillum brasilense SM and its ability to modulate plant growth. Eur J Soil Biol 45:73–80

Mandal SM, Mondal KC, Dey S, Pati BR (2007) Optimization of cultural and nutritional condi-

tions for indol-3-acetic acid (IAA) production by a Rhizobium sp. isolated from rot nodules of

Vigna mungo (L) hepper. Res J Microbiol 2:239–246

382

J.S. Singh and D.P. Singh

Mantelin S, Touraine B (2004) Plant growth-promoting bacteria and nitrate availability impacts on

root development and nitrate uptake. J Exp Bot 55:27–34

Martinez-Morales LJ, Soto-Urzua L, Baca BE, Sanchez-Ahedo JA (2003) Indole-3-butyric acid

(IBA) production in culture medium by wild strain Azospirillum brasilense . FEMS Microbiol

Lett 228:167–173

Masalha J, Kosegarten H, Elmaci O, Mengel K (2000) The central role of microbial activity for

iron acquisition in maize and sun ﬂ ower. Biol Fertil Soils 30:433–439

Mattoo AK, Suttle JC (1991) The plant hormone ethylene. CRC Press, Boca Raton

Mauch F, Mauch-Mani B, Boller T (1988) Antifungal hydrolases in pea tissue. II. Inhibition of

fungal growth by combinations of chitinase and/3-1,3-glucanase. Plant Physiol 88:936–942

Mayak S, Tirosh T, Glick BR (2004a) Plant growth-promoting bacteria that confer resistance to

water stress in tomato and pepper. Plant Sci 166:525–530

Mayak S, Tirosh T, Glick BR (2004b) Plant growth-promoting bacteria confer resistance in tomato

plants to salt stress. Plant Physiol Biochem 42:565–572

Molla AH, Shamsuddin ZH, Halimi MS, Morziah M, Puteh AB (2001) Potential for enhancement

of root growth and nodulation of soybean co-inoculated with Azospirillum and Bradyrhizobium

in laboratory systems. Soil Biol Biochem 33:457–463

Nadeem SM, Zahir ZA, Naveed M, Arshad M, Shahzad SM (2006) Variation in growth and ion

uptake of maize due to inoculation with plant growth promoting rhizobacteria under salt stress.

Soil Environ 25:78–84

Nagorska K, Bikowski M, Obuchowski M (2007) Multicellular behaviour and production of a

wide variety of toxic substances support usage of Bacillus subtilis as a powerful bio-control

agent. Acta Biochim Pol 54:495–508

Narula N, Deubel A, Gans W, Behl RK, Merbach W (2006) Paranodules and colonization of wheat

roots by phytohormone producing bacteria in soil. Plant Soil Environ 52:119–129

Nautiyal CS, Bhadauria S, Kumar P, Lal H, Mondal R, Verma D (2000) Stress induced phosphate

solubilization in bacteria isolated from alkaline soils. FEMS Microbiol Lett 182:291–296

Negi YK, Garg SK, Kumar J (2005) Cold-tolerant ﬂ uorescent Pseudomonas isolates from Garhwal

Himalayas as potential plant growth promoting and bio-control agents in pea. Curr Sci 89:25

Noel TC, Cheng C, Yost CK, Pharis RP, Hynes FM (1996) Rhizobium leguminosarum as a plant-growth

rhizobacterium: direct growth promotion of canola and lettuce. Can J Microbiol 42:279–283

Nowak-Thompson B, Gould SJ, Kraus J, Loper JE (1994) Production of 2, 4-diacetylphlorogluci-

nol by the bio-control agent Pseudomonas ﬂ uorescens Pf-5. Can J Microbiol 40:1064–1066

O’Donnell PJ, Calvert CM, Atzorn R, Wasternack C, Leyser HMO, Bowles DJ (1996) Ethylene as

a signal mediating the wound response of tomato plants. Science 274:1914–1917

Ortiz-Castro R, Valencia-Cantero E, Lopez-Bucio J (2008) Plant growth promotion by Bacillus

megaterium involves cytokinin signalling. Plant Signal Behav 3:263–265

Pal SS (1998) Interactions of an acid tolerant strain of phosphate solubilizing bacteria with a few

acid tolerant crops. Plant Soil 198:169–177

Pal KK, Tilak KVBR, Saxena AK, Dey R, Singh CS (2000) Antifungal characteristics of a

ﬂ uorescent Pseudomonas strain involved in the biological control of Rhizoctonia solani . Res

Microbiol 155:233–242

Pandey A, Palni LMS (1998) Isolation of Pseudomonas corrugate from Sikkim, Himalaya. World

J Microbiol Biotechnol 14:411–413

Papavizas GC, Ayers WA (1974) Aphanomyces species and their root diseases in pea and sugar-

beet. A review. US Department of Agriculture, Washington, DC

Paul D, Sarma YR (2006) Antagonistic effects of metabolites of Pseudomonas ﬂ uorescens strains

on the different growth phases of Phytophthora capsici , foot rot pathogen of black pepper

( Piper nigrum L). Arch Phytopathol Plant Prot 39:113–118

Paul D, Dineshkumar N, Nair S (2006) Proteomics of a plant growth-promoting rhizobacterium,

Pseudomonas ﬂ uorescens MSP-393, subjected to salt shock. World J Microbiol Biotechnol

22:369–374

Rai R, Hunt PG (1993) Inoculation of maize varieties with salt tolerant mutants of Azospirillum

brasilense and VAM fungi in saline calcareous soil. Microbiol Release 1:243–251

383

14 Plant Growth Promoting Rhizobacteria (PGPR)…

Rajendran G, Sing F, Desai AJ, Archana G (2008) Enhanced growth and nodulation of pigeon pea

by co-inoculation of Bacillus strains with Rhizobium spp. Bioresour Technol 99:4544–4550

Rangarajan S, Loganathan P, Saleena LM, Nair S (2001) Diversity of pseudomonads isolated from

three different plant rhizospheres. J Appl Microbiol 91:742–749

Reddy BP, Rao KS (2009) Biochemical and PCR- RAPD characterization of Pseudomonas

ﬂ uorescent produced antifungal compounds inhibit the rice fungal pathogens in vitro . Electron

J Environ Agric Food Chem 8:1062–1067

Reddy BP, Reddy KRN, Rao SM, Rao KS (2008) Ef ﬁ cacy of antimicrobial metabolites of

Pseudomonas ﬂ uorescens against rice fungal pathogens. Curr Trends Biotechnol Pharm

2:178–182

Richardson AE (2001) Prospects for using soil microorganisms to improve the acquisition of phos-

phorus by plants. Aust J Plant Physiol 28:897–906

Rodriguez H, Fraga R (1999) Phosphate solubilizing bacteria and their role in plant growth promo-

tion. Biotechnol Adv 17:319–339

Rokhzadi A, Asgharzadeh A, Darvish F, Nour-Mohammadi G, Majidi E (2008) In ﬂ uence of plant

growth promoting rhizobacteria on dry matter accumulation of chickpea ( Cicer arietinum L )

under ﬁ eld conditions. J Agric Environ Sci 3:253–257

Roy M, Basu PS (2004) Studies on root nodules of leguminous plants bioproduction of indole acetic

acid by a Rhizobium sp. from a twiner Clitorea ternatea L. Acta Biotechnol 12:453–460

Saad MS, Shabuddin ASA, Yunus AG, Shamsuddin ZH (1999) Effects of Azospirillum inoculation

on sweet potato grown on sandy tin-tailing soil. Commun Soil Sci Plant Anal 30:583–1592

Saleem M, Arshad M, Hussain S, Bhatti AS (2007) Perspective of plant growth promoting

rhizobacteria (PGPR) containing ACC deaminase in stress agriculture. J Ind Microbiol

Biotechnol 34:635–648

Salisbury FB, Ross CW (1992) Plant physiology. Wadsworth Pub. Co., Belmont, p 682

Saraf M, Thakker A, Patel BV (2008) Bio-control activity of different species of Pseudomonas

against phytopathogenic fungi In vivo and In vitro conditions. Int J Biotechnol Biochem

4:223–232

Saravanakumar D, Samiyappan R (2007) ACC deaminase from Pseudomonas Xuorescens mediated

saline resistance in groundnut ( Arachis hypogea ) plants. J Appl Microbiol 102:1283–1292

Sarig S, Blum A, Okon Y (1988) Improvement of the water status and yield of ﬁ eld-grown grain

sorghum ( Sorghum bicolor ) by inoculation with Azospirillum brasilense . J Agric Sci

110:271–277

Sarwar M, Frankenberger WT (1994) In ﬂ uence of L-tryptophan and auxins applied to the rhizo-

sphere on the vegetative growth of Zea mays L. Plant Soil 160:97–104

Seshadri S, Ignacimuthu S, Vadivelu M, Lakshminarasimhan C (2007) Inorganic phosphate solu-

bilization by two insect pathogenic Bacillus sp. Dev Plant Soil Sci 102:351–355

Shaharoona B, Naveed M, Arshad A, Zahir ZA (2008) Fertilizer-dependent ef ﬁ ciency of

pseudomonads for improving growth, yield, and nutrient use ef ﬁ ciency of wheat ( Triticum

aestivum L). Appl Microbiol Biotechnol 79:147–155

Shinozaki K, Yamaguchi-Shinozaki K (1999) Molecular responses to drought stress. In: Shinozaki

K, Shinozaki YK (eds) Molecular responses to cold, drought, heat and salt stress in higher

plants. RG Landes, Austin, pp 11–28

Shoebitz M, Ribaudo CM, Pardo MA, Cantore ML, Ciampi L, Cura JA (2007) Plant growth pro-

moting properties of a strain of Enterobacter ludwigii isolated from Lolium perenne rhizo-

sphere. Biochem J 41:1768–1774

Siddiqui ZA (2006) PGPR: prospective bio-control agents of plant pathogens. In: PGPR: bio-

control and biofertilization. Springer, Dordrecht, pp 111–142

Siddiqui IA, Haas D, Heeb S (2005) Extracellular protease of Pseudomonas ﬂ uorescens CHA0, a

bio-control factor with activity against the root-knot nematode Meloidogyne incognita . Appl

Environ Microbiol 71:5646–5649

Singh S, Kapoor KK (1999) Inoculation with phosphate solubilizing microorganisms and a vesicular

arbuscular mycorrhizal fungus improves dry matter yield and nutrient uptake by wheat grown in

a sandy soil. Biol Fertil Soils 28:139–144

384

J.S. Singh and D.P. Singh

Singh JS, Pandey VC, Singh DP (2011) Ef ﬁ cient soil microorganisms: a new dimension for sus-

tainable agriculture and environmental development. Agric Ecosyst Environ 140:339–353

Son HJ, Park GT, Cha MS, Heo MS (2006) Solubilization of insoluble inorganic phosphates by a

novel salt- and pH-tolerant Pantoea agglomerans R-42 isolated from soybean rhizosphere.

Bioresour Technol 97:204–210

Souchie EL, Azcon R, Barea JM, Saggin-Junior OJ, da Silva EMR (2007) Indolacetic acid produc-

tion by P-solubilizing microorganisms and interaction with arbuscular mycorrhizal fungi. Acta

Sci Biol Sci 29:315–320

Sridevi M, Mallaiah KV (2007) Bioproduction of indole acetic acid by Rhizobium strains isolated

from root nodules of green manure crop, Sesbania sesban (L) Merr . Iran J Biotechnol

5:178–182

Sridevi M, Yadav NCS, Mallaiah KV (2008) Production of indol-acetic acid by Rhizobium isolates

from Crotalaria species. Res J Microbiol 3:276–281

Stefan M, Mihasan M, Dunca S (2008) Plant growth promoting rhizobacteria can inhibit the

in vitro germination of Glycine Max L seeds. Scienti ﬁ c Annals of University “Alexandru Ioan

Cuza” Iasi, Section Genetics and Molecular Biology, T. IX, 3:105–110

Stevenson FJ, Cole MA (1999) Cycles of soil: carbon, nitrogen, phosphorus, sulfur, micronutri-

ents, 2nd edn. Wiley, New York, 427

Tilak KVBR, Ranganayaki N, Pal KK, De R, Saxena AK, Nautiyal CS, Mittal S, Tripathi AK,

Johri BN (2005) Diversity of plant growth and soil health supporting bacteria. Curr Sci

89:136–150

Timmusk S, Wagner GH (1999) The plant-growth-promoting rhizobacterium Paenibacillus poly-

myxa induces changes in Arabidopsis thaliana gene expression: a possible connection between

biotic and abiotic stress responses. Mol Plant Microbe Interact 12:951–959

Toyoda H, Utsumi R (1991) Method for the prevention of Fusarium diseases and microorganisms

used for the same. US patent no. 4, 988, p 586

Tsavkelova EA, Cherdyntseva TA, Klimova SY, Shestakov AI, Botina SG, Netrusov AI

(2007) Orchid-associated bacteria produce indole-3-acetic acid, promote seed germina-

tion, and increase their microbial yield in response to exogenous auxin. Arch Microbiol

188:655–664

Upadhyay SK, Singh JS, Singh DP (2011) Exopolysaccharide-producing plant growth promoting

rhizobacteria salinity condition. Pedosphere 21:214–222

Upadhyay SK, Singh JS, Saxena AK, Singh DP (2012) Impact of PGPR inoculation on growth and

antioxidants status of wheat plant under saline condition. Plant Biol 14:605–611

Vazquez P, Holguin G, Puente ME, Lopez-Cortez A, Bashan Y (2000) Phosphate-solubilizing

microorganisms associated with the rhizosphere of mangroves in a semiarid coastal lagoon.

Biol Fertil Soils 30:460–468

Vessey JK (2003) Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:571–586

Vessey JK, Buss TJ (2002) Bacillus cereus UW85 inoculation effects on growth, nodulation, and

N accumulation in grain legumes. Controlled-environment studies. Can J Plant Sci

82:282–290

Voisard C, Keel C, Haas D, Defago G (1989) Cyanide production by Pseudomonas ﬂ uorescens

helps suppress black root rot of tobacco under gnotobiotic conditions. EMBO J 8:351–358

von Wiren N, Khodr H, Hider RC (2000) Hydroxylated phytosiderophore species possess an

enhanced chelate stability and af ﬁ nity for iron (III). Plant Physiol 124:1149–1157

Wang Y, Brown HN, Crowley DE, Szaniszlo PJ (1993) Evidence for direct utilization of a sidero-

phore, ferrioxamine B, in axenically grown cucumber. Plant Cell Environ 16:579–585

Weller DM (1988) Biological control of soil borne plant pathogens in the rhizosphere with bacte-

ria. Annu Rev Phytopathol 26:379–407

Weller DM (2007) Pseudomonas bio-control agents of soil borne pathogens: looking back over

30 years. Annu Rev Phytopathol 40:309–348

Weller DM, Raaijmakers JM, McSpadden Gardener BB, Thomashow LS (2002) Microbial

populations responsible for speci ﬁ c soil suppressiveness to plant pathogens. Annu Rev

Phytopathol 40:309–348

385

14 Plant Growth Promoting Rhizobacteria (PGPR)…

Weyens N, van der Lelie D, Taghavi S, Vangronsveld J (2009) Phytoremediation: plant endophyte

partnerships take the challenge. Curr Opin Biotechnol 20:248–254

Wilhite DA (2000) Drought as a natural hazard. In: Wilhite DA (ed) Drought: a global assessment.

Routledge, London, pp 3–18

Zadeh HR, Khavazi K, Asgharzadeh A, Hosseinimazinani M, Mot RD (2008) Bio-control of

Pseudomonas Savastanoi , causative agent of olive knot disease: antagonistic potential of non-

pathogenic rhizosphere isolates of Fluorescent Pseudomonas . Commun Agric Appl Biol Sci

73:199–203

387

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

Abstract Extreme environments are habitats that experience steady or ﬂ uctuating

exposure to one or more environmental factors, such as salinity, osmolarity, desic-

cation, UV radiation, barometric pressure, pH, temperature, heavy metals, xeno-

biotics and antibiotics. The evolutionary biologist studies the steps by which the

adaptations have evolved. But the general nature of such adaptive steps is still

unclear. Evolution is often thought to be random and dependent on unpredictable

events. This chapter focuses on antibiotic and xenobiotic stress in the environment

and the microbial adaptations along with the genetic regulation of these stresses.

Bacteria have come up with sophisticated modes of cooperative behaviour to cope

with adverse and varying environmental conditions. They developed intricate

communication capabilities, including a broad repertoire of chemical signaling

mechanisms, collective activation and deactivation of genes and even exchange of

genetic materials. With these tools, they can communicate and self-organize their

colonies into multicellular hierarchical aggregates, out of which new abilities

emerge. Many examples of bacterial mechanisms are thought to be adaptations for

survival in changing environments, some of which are the mutator phenotypes,

sporulation, adaptive mutation, and phase variation. The most frequently proposed

hypothesis is that genes involved in antibiotic resistance originated in antibiotic-

producing organisms, as part of the cluster involved in antibiotic biogenesis, to

prevent self-inhibition. Eventually, these genes may have moved to the neighboring

bacterial organisms, which then became resistant. Alternatively, these neighboring

organisms may have introduced changes in the DNA sequence of possibly duplicate

M. I. Ansari • A. Malik (*)

Department of Agricultural Microbiology, Faculty of Agricultural Sciences ,

Aligarh Muslim University , Aligarh 202002 , India

e-mail: ikram_ansari21@yahoo.com ; ab_malik30@yahoo.com

Chapter 15

Antibiotic Resistance Gene Pool and Bacterial

Adaptation to Xenobiotics in the Environment

Mohd Ikram Ansari and Abdul Malik

388

M.I. Ansari and A. Malik

genes involved in functions that were thus reoriented to antibiotic elimination or

detoxi ﬁ cation. Recent studies have revealed the existence of new types of xenobiotic

catabolic mobile genetic elements, such as catabolic genomic islands, which integrate

into the chromosome after transfer. Molecular analysis of the catabolic pathways

of xenobiotic-degrading bacteria indicated that they might have adapted to the

appearance of such compounds by expressing new functions to resist the potential

toxic effects of the molecules or to use their bene ﬁ ciary characteristics, for example,

as an alternative source of essential nutrients, such as carbon, nitrogen or energy.

Keywords Adaptation • Antibiotics • Environmental stress • Mutation

• Xenobiotics

1 Introduction

The spread and evolution of resistance to antibiotic depends on the pressure

exerted by the antibiotic in the microbial environment. Different effects occur in

different compartments, where concentrations of particular antibiotic result in a

differential growth rate of resistant bacteria. This happens even at very low anti-

biotic concentrations which are able to select low level resistant bacteria. When

multiple antibiotics are present in the environment, then multiple and variable

pressure select the bacteria which use multiple or versatile mechanisms or optimize

a single mechanism of resistance to survive under the changeable environmental

conditions. Host factors such as immunity add to the selective process.

Antibiotics itself might support bacterial diversity, whichever mediated by the

random drift effect or triggering the increase in events of mutation under bacte-

rial stress. Analysis of selective environment related antibiotic host bacteria

interactions is necessary in understanding the biology of antibiotic resistance

(Baquero et al. 1998 ) .

Xenobiotics are chemically synthesized organic compounds most of which do not

occur in nature ( Schlegel 1986 ) . Xenobiotics are de ﬁ ned as compounds that are foreign

to a living organism. Where these compounds are not easily recognized by existing

degradative enzymes and they gather in soil and water (Esteve-Nenez et al. 2001 ) .

Xenobiotics include fungicides, pesticides, herbicides, insecticides, nematicides, and

so on. The majority of which are substituted hydrocarbons, phenyl carbonates, and

related compounds (Ojo 2007 ) .

Among the chlorinated, polyaromatic, xenobiotics, and nitro-aromatic compounds

are considered to be mutagenic, carcinogenic and toxic for living organisms.

However, microbial diversity and versatility for adaptation to xenobiotics makes

them the best candidates among all living organisms to convey xenobiotic com-

pounds into natural biogeochemical cycles. Even though, more microorganisms are

389

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

able to degrade these anthropogenic molecules, some xenobiotics have been shown

to be uncommonly refractory (Esteve-Nenez et al. 2001 ; Ojo 2007 ) .

In nature, microorganisms must survive with aggressive environmental conditions.

For this purpose, they have developed complicated mutual behavior and intricate

communication capabilities, such as direct cell–cell physical interactions mediated

by cell surface structures, collective production of extracellular “wetting” ﬂ uid for

movement on hard surfaces, long range chemical signals such as quorum sensing

and chemotactic (bias of movement according to gradient of chemical agent)

signaling, collective genes activation and deactivation and even exchange of genetic

material. In some cases, these capabilities are exploited by bacterial colonies to

develop complex spatio-temporal patterns in response to unfavorable growth conditions

(Ben-Jacoba et al.

2000 ) .

Recent studies pointed out two major breakthroughs regarding the molecular

basis of bacterial adaptation to pollutants: (i) the de ﬁ nition of new types of xenobi-

otic catabolic mobile genetic elements (MGEs) and (ii) ﬁ ndings from microbial

ecology studies that suggest that such adaptation events actually occur in a polluted

environment in the ﬁ eld (Springael and Top 2004 ) . Adaptation to environmental

change is essential for microbial survival and proliferation. Environmental changes

will shift the balance of complex microbial communities by favoring some popula-

tions, while restricting others, through mechanisms such as microbial competition

(for nutrients), antibiosis and by the selection of those microorganisms best adapted

to environmental stress. Thus, much research in microbial ecology focuses on the

evolution of microbial populations (both taxonomic and functional groups) submitted

to ﬂ uctuations in environmental conditions (Castro et al. 1997 ; Amoroso et al. 1998 ;

Baath et al. 1998 ; Carrasco et al. 2005 ; Raniard et al. 2008 ; Baek and Kim 2009 ;

Baek et al. 2009 ; Belanger et al. 2011 ) .

Recently, several studies have suggested for a new evolutionary synthesis (Dean and

Thornton 2007 ; Pigliucci 2007 ; Carroll 2008 ; Koonin 2009 ) that contain mecha-

nisms other than mutation, natural selection and drift to elucidate evolutionary

changes, like developmental constraints and epigenetic modi ﬁ cations among others

(Boto 2010 ) . The direct visualization of horizontal (or lateral) gene transfer, which

has been achieved recently (Babic et al. 2008 ) , is a signi ﬁ cant method of measuring

the evolution of Bacteria and Archaea, as well as that of unicellular eukaryotes, and

should therefore also be considered as part of the structure of any evolutionary

synthesis. This chapter highlights the mechanism of adaptations of bacterial popula-

tions to antibiotics and xenobiotics present in the environment. The chapter also

insights the role of horizontal gene transfer in bacterial evolution.

2 Antimicrobial Resistance

The prokaryotic cell is pro ﬁ cient of adapting to the antibiotics introduced into the

environment. The natural genetic variation ensures a reasonable sum of heterogeneity

that ensures survivors in antibiotic charged environments. Thus surveys of bacterial

390

M.I. Ansari and A. Malik

isolates show the presence of resistant organisms from the pre-antibiotic days,

although in small numbers (Madeinos 1997 ) . Population dynamics would keep this

proportion low enough not to in ﬂ uence therapeutic outcome. However, in an anti-

biotic charged environment a selection pressure builds up favouring the resistant

organisms. This ‘survival of the ﬁ ttest’ principle enunciated by Charles Darwin

(

1859 ) consequences in a regular rise in MICs.

The concept of the soil as a location of antibiotic resistance determinants,

particularly those harboured in antibiotic producers as self-protection mechanisms

has been acknowledged for decades. However, mechanistic commonalities between

clinical pathogens and soil inhabiting organisms were not shown until the 1970s.

In 1973, two molecular mechanisms of aminoglycoside resistance in soil-dwelling

actinomycetes from the genus Streptomyces were determined to be the same to

those in clinical pathogens (Benveniste and Davies 1973 ) . These strains, producers

of the aminoglycosides kanamycin and neomycin, were capable of drug modi ﬁ cation

by acetylation and phosphorylation, respectively as a means of self-protection

(Benveniste and Davies 1973 ) .

In recent years, approaches have been implemented to characterize the diversity

and prevalence of resistance in soil bacteria, the soil antibiotic resistome as an

essential reservoir of resistance (Wright 2007 ) . Riesenfeld et al. ( 2004 ) investigated

resistance in the soil, concentrating on unculturable organisms, bacteria that have

yet to be characterized and thus underappreciated because of challenging culture

conditions (Riesenfeld et al. 2004 ) . By creating a functional metagenomic library

(Handelsman 2004 ) in which cloned genomic fragments were expressed from DNA

isolated directly from soil and selecting for resistance, traditional challenges associ-

ated with studying genes of unknown sequence were circumvented. Speci ﬁ cally,

these functional analyses revealed novel antibiotic resistance proteins that were pre-

viously of unknown function and unrecognizable by sequence alone. Thus, this

work not only allowed for the identi ﬁ cation of aminoglycoside N-acetyltransferases,

the O-phosphotransferases, and a putative tetracycline ef ﬂ ux pump but also a

construct with a novel resistance determinant to the aminoglycoside butirosin

(Riesenfeld et al. 2004 ) . This work shows the power of the functional metagenomic

approach when applied to a search of activity with a highly selectable phenotype

such as antibiotic resistance (D’Costa et al. 2007 ) .

Focusing on agriculturally associated resistance, Schmitt et al. characterized the

diversity of tetracycline resistance determinants in soil (Schmitt et al. 2006 ) . Using

PCR-based approaches, three resistance genes were ubiquitously identi ﬁ ed in the

soil, and additional ﬁ ve were found in manure-supplemented soils. This work speaks

to the diversity of tetracycline resistance in agricultural soils. With respect to environ-

mental resistance to antibiotics, this ability is not simply restricted to soil-dwelling

microorganisms. Both phenotypically and genetically, resistance to antibacterials

has been extensively documented in genera spanning the entire bacterial domain

from diverse ecosystems (Acar and Moulin

2006 ; Martins da Costa et al. 2006 ;

Stepanauskas et al. 2006 ; De Souza et al. 2006 ; Schmitt et al. 2006 ; D’Costa et al.

2006 ; Ferreira da Silva et al. 2007 ; Jacobs and Chenia 2007 ; Levesque et al. 2007 ;

Neela et al. 2007 ; Oliynyk et al. 2007 ) .

391

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

3 Antibiotic Pressure and Adaptive Mutation

All previous considerations regarding the selection of antibiotic resistance were

based on the classic belief that mutations occur at random during nonselective

bacterial growth and that selection is essentially the “amplifying mechanism”

(or amplifying ﬁ eld) for the organisms with mutations, resulting in an increase in

ﬁ tness. Adaptive mutation can also be termed post selection mutation (Foster

1995 ) ,

implying that non growing bacteria inhibited by a given antibiotic (under selection)

may be able to produce increased genetic variation that eventually gives rise to

mutations, thereby helping the inhibited strain survive the antibiotic challenge.

It appears as if the antibiotic may “direct” resistance to itself, but in fact only the

frequency of genetic variation is increased under stress (inhibition) circumstances.

The study of genetic variation under stationary-phase conditions will most likely

contribute to the understanding of the machinery involved in adaptive mutation

(Baquero et al. 1998 ) .

Antibiotic pressure on cells under stationary-phase conditions may contribute to

the emergence of antibiotic resistance; indeed, this factor was presumed by the

observation of the frequent development of resistance among bio ﬁ lm-forming

bacterial populations. Finally, the recent recognition of the mutator genes in promoting

genetic diversity and bacterial adaptive evolution (Taddei et al. 1997 ) may provide

key data for understanding the evolution of antibiotic resistance under antibiotic

pressure (Baquero et al. 1998 ) . The main proposed hypothesis is that genes implicated

in antibiotic resistance originated in antibiotic producing organisms, as part of the

cluster involved in antibiotic biogenesis, to prevent self-inhibition (Davies 1992 ;

Baquero et al. 1998 ) .

The advent of genome sequencing has greatly accelerated our understanding

of evolution. With respect to resistance determinants, these efforts have uncovered

genes responsible for resistance, cryptic genes that encode resistance but are

perhaps insuf ﬁ ciently expressed and thus do not confer the phenotype, as well

as those that serve as precursors for resistance determinants. Recent efforts have

uncovered a wealth of putative resistance determinants. For example, the

recently sequenced genome of the erythromycin producer Saccharopolyspora

erythraea NRRL23338, a non-pathogenic Gram-positive bacterium resistant to

a wide spectrum of antibiotics, is predicted to encode a remarkable number of

putative resistance determinants representing approximately 1% of its genome

(Oliynyk et al. 2007 ) .

Horizontal gene transfer of genetic material takes the phenomenon to a different

plane. Once the resistance genes are transported to plasmids, transposons or inte-

grons then dissemination of resistance genes is rapid. In the present context trans-

missible resistance to ﬂ uroquinolones has already been observed in Klebsiella

pneumoniae (Martinez-Martinez et al. 1998 ) . If these genetic elements progress into

the enteric fever causing Salmonellae, the pro ﬁ le of the disease would change.

However, there is no details of such results having occurred. Another effective mode

of production of genetic elements capable of continuous horizontal transfer is the

392

M.I. Ansari and A. Malik

mobilization of naturally present protective resistance determinants in antibiotic

producers (Piepersberg 2001 ; Raghunath 2008 ) .

4 Mechanisms of Generation of Antibiotic Resistance

Genes currently involved in antibiotic resistance have probably evolved for other

purposes than antibiotic resistance. In this view, resistance can be considered as a

chance product, determined by the interaction of an antibiotic and a particular geno-

type. This is not incompatible with the idea of a gradual modi ﬁ cation of some genes

of pre-existing cellular machinery to become resistance genes. Possession of some

‘core’ genes may be neutral or nearly neutral in the prevailing nonantibiotic environ-

ment but may be a latent potential for selection that can only be expressed under the

appropriate conditions of antibiotic selection. The possible origin of enzymes hydro-

lyzing β -lactam antibiotics ( β -lactamases) as an alteration of the three-dimensional

structure of the target cell wall biosynthetic enzymes (transpeptidases that now

increase the rates of β -lactam deacylation) may be a splendid example of evolution

as tinkerer. In other cases, the mere high-level expression of genes with small activity

for the purposes of resistance under normal circumstances may also result in a resis-

tant phenotype. Antibiotic producing microorganisms under external antibiotic pres-

sure, in the absence of effective resistance mechanisms, experience biological stress,

resulting from membrane or cell wall damage, compromised protein synthesis, or

altered DNA supercoiling (Baquero and Blazquez 1997 ) .

The molecular mechanisms of resistance to antibiotics have been studied exten-

sively and have involved investigations of the genetics and biochemistry of many

different facets of bacterial cell function (Gale et al. 1981 ; Walsh 2003 ; Alekshun

and Levy 2007 ) . The study of antibiotic action and resistance has considerably con-

tributed to our understanding of cell structure and function. Resistance processes

are broadly dispersed in the microbial kingdom which have been well described for

a variety of commensals (Marshall et al. 2009 ) and pathogens; and most of them can

be spread by one or more different gene transfer mechanisms.

The principal role of human activities in the production of environmental reser-

voirs of antibiotic resistance cannot be neglected. Since the 1940s, ever rising

amounts of antibiotics chosen for human applications have been produced, used

clinically, and are released into the environment, and widely disseminated, thus

provide constant selection and maintenance pressure for resistant populations in all

the environments. Obtaining precise information on the quantities of antimicrobials

produced by the pharmaceutical industry is not easy (it is not in the best interest of

pharmaceutical companies to provide this information), but it can be predictable

that many millions of metric tons of antibiotic compounds have been released into

the biosphere over the last half century. Since the only existing proof indicates that

little in the way of antibiotics is contributed by naturally occurring antibiotic pro-

ducing strains in their native environments (Gottlieb

1976 ) , we must assume that the

commercial production gives the vast bulk of the antibiotics found in the biosphere

(Davies and Davies 2010 ) .

393

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

5 Role of Plasmids in Adaptation

Plasmid DNA may play a particularly important role in genetic adaptation in that it

represents a highly mobile form of DNA that can be transferred via conjugation or

transformation and can pass on novel phenotypes, including hydrocarbon-oxidizing

ability, to recipient organisms. The pathways for the metabolism of salicylate, naph-

thalene, octane, camphor, xylene, and toluene have been found to be on plasmids in

Pseudomonas spp. Exposure of natural microbial populations to oil or other hydro-

carbons may impose a selective advantage to strains possessing plasmids encoding

enzymes for hydrocarbon catabolism, resulting in an overall increase in the plasmid

frequency in the community (Leahy and Colwell

1990 ) .

Heuer and Smalla ( 2012 ) reported that the transport of conjugative plasmids

across species boundaries plays a very important role in the adaptation of bacterial

populations in soil. There are de ﬁ nite driving forces and restrictions of plasmid

transfer within bacterial populations in soils. Plasmid mediated genetic variation

allows bacteria to respond rapidly with adaptive responses to challenges such as

irregular antibiotic or metal concentrations, or opportunities such as the utilization

of xenobiotic compounds. Cultivation independent detection and capture of plas-

mids from soil bacteria, and whole plasmid sequences have provided new insights

into the function and biology of plasmids. Broad host range plasmids such as those

belonging to IncP-1 transfer accessory functions which are carried by similar plas-

mid backbones. Plasmids with a narrow host range can be more speci ﬁ cally adapted

to particular species and often transfer genes which complement chromosomally

encoded functions. Plasmids are ancient and successful approach to ensure survival

of a soil population in spatial and temporal heterogeneous conditions with various

environmental stresses or opportunities that occur unevenly or as a novel challenge

in soil (Heuer and Smalla 2012 ) .

Retrospective studies clearly indicate that mobile genetic elements (MGEs) play a

major role in the in situ spread and even de novo construction of catabolic pathways

in bacteria, allowing bacterial communities to rapidly adapt to new xenobiotics. The

production of novel pathways seems to occur by an gathering process that involves

horizontal gene transfer: different appropriate genes or gene modules that encode dif-

ferent parts of the novel pathway are recruited from phylogenetically related or distant

hosts into one single host. Direct proof for the signi ﬁ cance of catabolic MGEs in bac-

terial adaptation to xenobiotics stems from observed correlations between catabolic

gene transfer and accelerated biodegradation in numerous habitats and from studies

that examine catabolic MGEs in contaminated sites (Top and Springael 2003 ) .

6 Adaptation to Xenobiotics

The spontaneous occurrence of DNA rearrangements in xenobiotic-degraders that

resulted in evolution of different pathways for mineralization of synthetic com-

pounds in natural environment is one of the principal mechanisms of adaptation to

394

M.I. Ansari and A. Malik

xenobiotic substrates. The evolution of catabolic pathways (that is, modi ﬁ ed ortho

cleavage pathway, meta cleavage pathway and others) in micro-organisms for xeno-

biotic substrates often involves different gene clusters encoding for the aromatic

pathway enzymes (Ojo

2007 ) .

The characterization of bacteria that degrade organic xenobiotics has revealed

that they can adapt to these compounds by expressing ‘novel’ catabolic pathways.

Some of them have evolved by patchwork assembly of horizontally transferred

genes and following mutations and gene rearrangements. Recent studies have

showed the presence of new types of xenobiotic catabolic MGEs, such as catabolic

genomic islands, which incorporate into the chromosome after transfer. The signi ﬁ cance

of horizontal gene transfer and patchwork assembly for bacterial adaptation to

pollutants under real environmental conditions remains uncertain, but recent publi-

cations suggest that these processes do occur in a polluted environment (Springael

and Top 2004 ) .

6.1 Recombination and Transposition

Recombination is the combining of genes (DNA) from two or more different cells.

This is principally based on molecular methods involving cutting of DNA fragments

from different cells harbouring desired catabolic traits. These DNA fragments are

hybridized and inserted in host cells that are known as recombinants, which are

seeded onto polluted environment where the expression of the catabolic trait is

desired (Black 1999 ) . This strategy is often practiced in vitro than in vivo (El-Fantroussi

2000 ) in the soil enrichment method for the degradation of an herbicide (Linuron) a

modi ﬁ ed strategy which can be extended for bioremediation process in soil polluted

by this herbicide. Van der Meer et al. ( 1991 ) perform biodegradation experiment

involving Acinetobacter and Pseudomonas spp., and a DNA rearrangement strategy

was used to achieve mineralization. The sequential arrangement of the genes encoding

the ortho cleavage pathways of Acinetobacter calcoaceticus and P. putida differs

from one another and from those of other organisms, suggesting that various DNA

rearrangements have occurred (Van der Meer et al. 1991 ) . Gene rearrangements are

also evident between the different operons for the modi ﬁ ed ortho pathways enzymes.

Rearrangement of DNA fragments is believed to be due to insertion elements which

subsequently enhance gene transfer as well as activation or inactivation of silent

genes (Tsuda et al. 1989 ; Ramezani and Hawley 2010 ) .

Insertion elements have been shown to play an important role in rearrangement

of DNA fragments, in gene transfer, and in activation or inactivation of silent genes.

For catabolic pathways several examples of insertion elements are known. The TOL

catabolic operons are part of a large transposable element, Tn 4651 that belongs to

the family of Tn 3 -type transposons (Tsuda and Iino 1987, 1988 ; Tsuda et al. 1989 ) .

This transposon was later found to be part of an even larger mobile element, element,

Tn 4653 (Tsuda and Iino 1988 ) . A similar Tn 3 -type element, Tn 4655 , contains the

catabolic genes on plasmid NAH7, although it is defective in its transposase function

395

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

(Tsuda and Iino 1990 ) . P. cepacia 249 was shown to carry at least nine different

insertion elements, which were present in 1–13 copies in its genome. These IS elements

are thought to be responsible for the extraordinary adaptability and catabolic

potential of this strain (Lessie et al.

1990 ) .

6.2 Gene Duplication

This is an important mechanism for the evolution of different strains of microorganisms

of the same species. Once a gene becomes duplicated, the extra gene copy thus becomes

independent of selective pressures and subsequently imbibes mutations with speed.

These mutations could eventually lead to full inactivation, rendering this copy silent.

Reactivation of the silent gene copy could then occur through the action of insertion

elements. This occurred in Flavobacterium sp. strain K172 that produces two

isozymes of 6-aminohexanoate dimer hydrolase, one of the enzymes is involved in

the degradation of nylon oligomers (Okada et al. 1983 ) .

Studies with various TOL-type plasmids have shown that upper- and lower-pathway

operons (upper-pathway” enzymes oxidize methylbenzenes to methylbenzoates while

the “lower-pathway” encode enzymes for the conversion of methylbenzoates to

pyruvate, acetaldehyde, and acetate via (methyl) catechols), as well as the xylS and

xylR regulatory genes, sometimes switched positions, or are inverted, or increased their

copy number (Chat ﬁ eld and Williams 1986 ; Assinder and Williams 1990 ; Williams

et al. 1990 ) . A pair of 1.4 kb sequences present on the TOL plasmid is consider to direct

several recombinational processes and the insertion of the TOL catabolic operons in the

chromosome (Meulien et al. 1981 ; Yano et al. 2010 ) . In other bacterial strains, genes

for catechol 2, 3-dioxygenase or catechol 1, 2-dioxygenase are duplicated (Nakai et al.

1990 ; Schreiner et al. 1991 ) . Plasmid pJP4, which contains the genes for the degrada-

tion of 2,4-dichlorophenoxyacetic acid, seem to undergo several gene duplications

(Don et al. 1985 ; Perkins et al. 1990 ; Vedler et al. 2004 ; Sen et al. 2010 ) .

6.3 Mutational Drift

Mutational drift in terms of point mutation is of much relevance in xenobiotic

degradation. It is possible that a number of stress factors such as chemical pollutants

induce error-prone DNA replication that subsequently accelerates DNA evolution.

Point mutation involves base substitution, or nucleotide replacement, in which one

base is substituted for another at a speci ﬁ c location in a gene (Black 1999 ) . This kind

of mutation changes a single codon in mRNA, and it may or may not change the

amino acid sequence in a protein. Several examples have illustrated that single-site-

mutations can alter substrate speci ﬁ cities of enzymes or effector speci ﬁ cities. Clarke

( 1984 ) isolated mutants with altered substrate speci ﬁ cities of the AmiE amidase of

Pseudomonas aeruginosa , which were provoked by single-base-pair changes.

396

M.I. Ansari and A. Malik

Sequential mutations in the cryptic ebg genes of Escherichia coli were shown to result

in active enzymes capable of metabolizing lactose and other sugars (Ojo 2007 ) .

Single-site-mutations are believed to arise continuously and at random as a

result of errors in DNA replication or repair. Although, the important effects of

single-base-pair mutation on the adaptive process have been demonstrated experimen-

tally, the accumulation of single-base pair changes may not be the main reason for

the differences in the properties of the catabolic enzymes elicited by xenobiotic-

degraders. There are other factors that would precipitate changes in DNA sequences,

this include gene conversion or slipped-strand mispairing (Niedle et al.

1988 ) .

The degradation mainly depends upon the adapting responses of the microbial

communities which include both selective enrichment (resulting in ampli ﬁ cation of

genes) and genetic changes (mainly includes gene transfer or mutation). With the

mobilization of silent sequences into the functional catabolic routes and advance-

ment of substrate range by gradual or spontaneous mutations, the recalcitrance of

several toxic synthetic pollutants would certainly decrease (Sinha et al. 2009 ) .

6.4 Gene Transfer

Gene transfer is a process of movement of genetic information between organisms

(Black 1999 ) . The signi ﬁ cance of gene transfer for adaptation of host cells to new

compounds has been explicitly demonstrated in many studies on experimental evolu-

tion of novel metabolic activities. Such studies identi ﬁ ed biochemical blockades in

natural pathways that prevented the degradation of novel substrates and these barriers

scaled by transferring appropriate genes (Reineke et al. 1982 ; Ojo 2007 ; Liu and

Paroo 2010 ) . Genetic interactions in microbial communities are effected by several

mechanisms such as conjugative transfer via plasmid replicons, transduction and

transformation (Saye et al. 1990 ) . The occurrence of plasmids in bacteria in the

natural environment is certainly a general phenomenon and an important pool of

genetic information residing on plasmid vehicles may ﬂ ow among indigenous

organisms. The self transmissible plasmids that carry genes for degradation of

aromatic or of other organic compounds are known and their roles in spreading

these genes to other organisms is predictable (Assinder and Williams 1988 ; Ojo

2007 ) . Although, the transfer of catabolic plasmids can lead to regulatory and/or

metabolic problems for the cells and therefore additional mutations in the primary

transconjugants are often needed to construct strains with the desired metabolic

activities (Reineke et al. 1982 ; Davey and O’toole 2000 ) .

Recently, approaches have been made to assemble data with reference to adapta-

tion in bacterial populations to speci ﬁ c xenobiotic compounds by gene transfer and

to characterize and compare the genes involved in degradation of identical or similar

xenobiotic compounds in different isolated bacterial genera from different environ-

ment. The following observations have been made:

(i) Evolutionarily related catabolic genes and their clusters have been derived

from very distant locations in bacterial genera;

397

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

(ii) The phylogeny of the catabolic genes is not compatible with that of the 16S

rRNA genes of the related hosts;

(iii) Genes for the degradation of synthetic pollutants are often associated with

plasmids and transposons and

(iv) Evolutionary related catabolic genes and entire gene modules are involved in

the degradation of structurally similar but different xenobiotic compounds

(Top and Springael

2003 ) .

It, therefore, appears that such genes are mostly clustered and located either on

chromosomes acting as insertion elements or on plasmids as mobile genetic elements,

and they also facilitate horizontal gene transfer (Sinha et al. 2009 ) .

7 MGEs Involved in Adaptation to Organic

Xenobiotics in the Environment

From comparative studies of sequenced bacterial genomes it has become obvious

that gene acquisition by HGT is one of the driving forces behind the evolution of

bacterial genomes (Lawrence and Ochman 2002 ) . During the past 15 years, numerous

groups have provided strong indications that MGEs and HGT have played and still

play a signi ﬁ cant role in the distribution and construction of xenobiotic catabolic

pathways (Copley 2000 ; Top and Springael 2003 ) . One line of evidence for the

importance of HGT is the ﬁ nding that catabolic genes in organic xenobiotic-degrading

bacteria are often carried by MGEs. Plasmids are the best studied catabolic MGEs,

probably because they can be easily detected in a bacterial strain (Tsuda et al. 1999 ;

Top and Springael 2003 ) .

The role of MGEs in the distribution of catabolic pathways and in the adaptation

of a microbial community to a pollutant stress has recently been shown using different

microcosm studies, where donor bacteria carrying a catabolic MGE were introduced

into an environment that was subsequently challenged with the xenobiotic speci ﬁ c

for that MGE. In many cases, transfer of the MGE into members of the indigenous

community was shown; in some cases, this was accompanied by community changes

and enhanced degradation of the xenobiotic by the ‘adapted’ microbial community

(Top et al. 2002 ; Sorensen et al. 2005 ) .

Mobile genetic elements support horizontal gene transfer more accurately via

conjugation or transformation that can impart novel phenotypes or may modify

existing genes through mutational processes. Typical catabolic plasmids are TOL,

OCT, CAM, NAH etc. (Mishra et al.

2001 ) . Studies have con ﬁ rmed that horizontal

transfer of catabolic genes, mostly by means of plasmid-mediated conjugation,

happens in soil microcosms, bioreactors and so on after inoculation of a donor strain

containing natural catabolic genes (Fulthorpe and Wyndham 1992 ) . The catabolism

of benzoate and phthalate suggests a high degree of redundancy, as Rhodocccus

RHA1 has three linear plasmids. The smallest one has 300 putative genes and

performs one fourth of the catabolic reactions, encoding 2,3-dihydroxybiphenyl

398

M.I. Ansari and A. Malik

1,2-dioxygenase. This suggests that it has potential to degrade various PCB congeners

(Larkin and Kulakov La Allen 2005 ) . Toluene degrading plasmid (TOL) is also one

of the best studied catabolic plasmids, as it bears degradative genes for xylene, tolu-

ene, benzoate, salicylate, catechol, phenol and several other complex compounds

(Lloyd-Jones et al.

1999 ) .

Generally, the mechanism of action for degradation by genes varies from organism

to organism, depending on the entire organization of genes as given below.

(i) In the ﬁ rst category, genes are organized in a single operon system e.g. phenol

(Khan et al. 2001 ) . Here the genes may be located on the plasmid genome or

may be present separately on the chromosome.

(ii) In the second group, genes are organized in two operon systems e.g. polychlori-

nated biphenyls etc. Here the genes are located on the plasmid genome (Shimizu

et al. 2001 ) .

(iii) In the third group, genes are organized in more than two operon systems

e.g. 2,4-dichlorophenoxyaceticacid degradation, etc. Here, the genes are

located on the plasmid genome and the capability or incapability of bacteria to

carry out the entire degradation depends on the existence of the complementary

enzymes encoded by genes on the chromosome (Don and Pemberton 1981 ;

Lykidis et al. 2010 ; Sinha et al. 2009 ).

(iv) In another group, the genes are organized on transposons, e.g. 2,4,5-trichloro-

phenoxyacetate (2,4,5-T is a herbicide) degradation. Pseudomonas AC1100

contains two insertion elements, IS 931 and IS 932 ; they play a signi ﬁ cant role

in degradation of 2,4,5-T (Chaudhry and Chapalamadugu 1991 ) .

The expression of catabolic genes is when enzymes, substrate, metabolites and

structure of respective genes all are in a synchronized manner (Whyte et al. 2002 ;

Sinha et al. 2009 ) .

8 Genetic Composition of the Microbial Community

and Adaptation

Of the three mechanisms for adaptation of microbial communities to chemical

contaminants, induction and derepression of enzymes, genetic changes, and selective

enrichment, only the third has been examined in detail. This has been primarily a

result of limitations imposed by available methods, which have, until recently,

restricted the study of adaptation of microbial communities to the phenomenon of

selective enrichment, in which the numbers or proportion of microorganisms that

can utilize the compound of interest increase within the community and can be

enumerated by their ability to grow on a medium containing the compound as the

sole carbon source.

The primary genetic mechanism for the adaptation of the microbial community

is the ampli ﬁ cation, by means of selective enrichment and gene transfer and mutation,

of genes which are involved in the metabolism of the chemical contaminant

399

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

(Spain and van Veld 1983 ; Barkay and Pritchard 1988 ; Becker et al. 2006 ) . Direct

monitoring of this process with respect to adaptation to hydrocarbons has been

made possible by the development of DNA probes speci ﬁ c for the genes encoding

hydrocarbon-catabolic pathways (Trevors

1985 ) . Sayler et al. ( 1985 ) , for example,

using the colony hybridization technique, showed a correlation between the

enhanced rates of PAH mineralization in oil-contaminated sediments and an increase

in the number of colonies containing DNA sequences which hybridized to TOL

(toluate oxidation) and NAH (naphthalene oxidation) plasmid probes. The colony

hybridization procedure, however, has the disadvantage of requiring the growth of

organisms on laboratory media, which limits sensitivity and does not allow detec-

tion of DNA sequences in viable but nonculturable microorganisms (Roszak and

Colwell 1987 ) . Dot blot hybridization, in which DNA is extracted from environ-

mental samples and then probed (Ogram et al. 1987 ; Holben et al. 1988 ) , can be

used to detect speci ﬁ c DNA sequences in the environment without the need for

isolation and culture of microorganisms (Ansari et al. 2008 ; Malik et al. 2008 ) .

The use of these methods in conjunction with nucleic acid probes for genes involved

in hydrocarbon metabolism will allow measurement of the frequency of those genes

within the microbial community (Trevors 1985 ) . This will permit assessment of the

relative degree of adaptation of the community as well as a more detailed analysis

of the dynamics of gene ampli ﬁ cation associated with adaptation.

9 Different Strategies for Niche Adaptation

Bacteria change their physiological behavior according to signals detected in the

environment. Typically, these changes are re ﬂ ected in the modi ﬁ cation of gene

expression patterns. These changes can be the effect of action by a number of differ-

ent types of signaling proteins, including histidine protein kinases (HPKs) and their

cognate response regulators (RRs), methyl-accepting chemotaxis proteins, diguany-

late and adenylate cyclases, and serine/threonine/ tyrosine protein kinases, as well

as individual transcription factors or “one-component” signal transduction proteins

(Ulrich et al. 2005 ; Galperin 2005 ) . Out of the different protein families, HPKs are

the most abundant, and historically have been considered as the main mechanism

for signal transduction in bacteria (Wolanin et al. 2002 ) . HPKs, or signal transduc-

tion proteins, are considered to play a major role in the adaptation of bacteria to new

or varying environments. In agreement with this hypothesis, those bacteria that have

the largest complements of signaling proteins usually tend to be bacteria with com-

plex lifestyles such as Myxococcus xanthus , those that are found ubiquitously in

diverse environments such as Pseudomonas , or bacteria with several alternative

metabolic strategies such as different δ - and ε -proteobacteria (Rodrigue et al. 2000 ;

Galperin 2005 ) . Few HPKs have been identi ﬁ ed in the reduced genomes of parasitic

bacteria, which likely have a relatively constant external environment. While these

signal transduction systems are considered to be a key part of the adaptive evolution

of bacteria, few details are known about this process. Alm et al. ( 2006 ) looked specially

400

M.I. Ansari and A. Malik

at genes that entered into each lineage recently, making the logical supposition that

current additions are more likely to provide insight into the evolutionary basis of

niche adaptation. Identifying recent achievement in a environment of multiple para-

logs is a complicated task. Alm et al. (

2006 ) explained a BLAST-based procedure

for classifying and establishing the age of HPK domains (Ragan and Charlebois

2002 ; Daubin and Ochman 2004 ; Price et al. 2005 ) .

Phylogenetic analysis was based on the histidine kinase domain of each HPK

only, allowing follow changes in the structure of the signaling domains (domain

shuf ﬂ ing) that generally upstream (N-terminal) from the kinase domain. The phylo-

genetic procedure for inference described requires a precise species phylogeny,

which they deduce from a concatenated gene pro ﬁ le including 15 ubiquitous bacte-

rial genes without obvious paralogs (Alm et al. 2006 ) .

The relative contribution of horizontal gene transfer (HGT) and gene duplication

events to the evolution of new HPKs in each genome was inferred by gene histories.

The result shows that some genomes acquired new HPKs primarily via HGT, while

others relied mainly on lineage-speci ﬁ c expansion (LSE) of existing gene families

(Alm et al. 2006 ) . A careful examination of genes obtained by these two mecha-

nisms revealed differences in the amount to which upstream signaling domains and

cognate Response regulators were conserved as a result of each process, with HGT

being more likely to preserve pre-existing relationships than gene duplication.

Alm et al. ( 2006 ) reported that two-component systems including histidine protein

kinases represent the primary signal transduction paradigm in prokaryotic organ-

isms. To recognize how these systems acclimatize to allow organisms to detect

niche-speci ﬁ c signals, they analyzed the phylogenetic distribution of nearly 5,000

histidine protein kinases from 207 sequenced prokaryotic genomes. They found that

many genomes carry a large repertoire of recently evolved signaling genes, which

may re ﬂ ect selective pressure to adapt to new environmental conditions. Both

lineage-speci ﬁ c gene family expansion and horizontal gene transfer play important

role in introducing new histidine kinases into genomes; though, there are contradic-

tion in how these two evolutionary forces act. Genes transferredvia horizontal transfer

are more expected to keep their original functionality as inferred from a comparable

complement of signaling domains, while gene family extension accompanied by

domain shuf ﬂ ing appears to be a key source of novel genetic diversity. Family

extension is the main source of new histidine kinase genes in the genomes mainly

enriched in signaling proteins, and detailed analysis revealed that divergence in

domain organization and changes in expression patterns are hallmarks of recent

expansions. Finally, while these two modes of gene transfer are widespread among

bacterial taxa, there are clear species-speci ﬁ c preferences for which mode is used.

10 Horizontal Gene Transfer and Microbial Evolution

The effect of horizontal gene transfer in microbial evolution (Bacteria and Archaea)

is dependent on a number of genes which have been transferred to and effectively

maintained in microbial genomes, however is also dependent on the degree of the

401

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

phenomena, in both evolutionary time framework (considering both recent and

ancient events) and phylogenetic distance between organisms (Boto 2010 ) .

Since the appearance of horizontal gene transfer as a way of explaining phylogenetic

incongruence using different gene trees, a signi ﬁ cant number of studies have been

published about genes that have been acquired by horizontal gene transfer (Gogarten

et al.

2002 ; Lerat et al. 2005 ) , both in Bacteria (Saunders et al. 1999 ; Ochman et al.

2000 ) and Archaea (Doolittle and Logsdon 1998 ; Faguy and Doolittle 1999 ; Boto

2010 ) , as well as in eukaryotes (Andersson 2005 ) . These studies explain that the

transfer can take place not only among but also between domains in all possible

directions: from Bacteria to Archaea (Rest and Mindell 2003 ) , from Archaea to

Bacteria (Gophna et al. 2004 ) , from Archaea to Eukarya (Andersson et al. 2003 ) ,

from Bacteria to Eukarya (Watkins and Gray 2006 ) , from Eukarya to Bacteria

(Guljamow et al. 2007 ) and even within Eukarya (Nedelcu et al. 2008 ) . Though,

it is in bacterial and archaeal evolution that horizontal gene transfer has been more

extensively documented and accepted.

10.1 Gene Transfer and the Fate of Transferred Genes

Horizontal gene transfer results both from the successful transfer of genetic material

(mediated by processes such as conjugation, transduction or transfection and recom-

bination) and from the existence of the transferred genetic material all through the

generations. The presence of certain physical barriers to transfer, as well as different

selective forces over the transferred genes, may explain observed differences in

the type of genes involved in horizontal gene transfer. Jain et al. ( 1999 ) proposed the

complexity hypothesis to elucidate the observed differences in horizontal gene

transfer susceptibility between genes. This hypothesis proposes that the so-called

informational genes (involved in DNA replication, transcription and translation, and

whose products participate in multiple molecular interactions) are less prone to

horizontal gene transfer than operational genes (involved in cell maintenance and

whose products have few interactions with other molecules). This hypothesis acquired

support from the characterization by Bayesian inference of recently acquired genes

in prokaryotic genomes (Nakamura et al. 2004 ) , which has shown that the portion of

transferred genes is biased towards genes involved in DNA binding, pathogenicity

and cell surface functions, all of them included among the functions of operational

genes. This work also shows, however, that not all operational genes are participating

equally in horizontal gene transfer events (Nakamura et al.

2004 ) .

A corresponding approach to realize whether there are differences between

genes, in consideration to their involvement in transfer processes, is to determine

what events are involved in post-transfer gene maintenance. It is accepted that the

preservation of a transferred gene is related with positive selection (Gogarten et al.

2002 ; Pal et al. 2005 ) . So, genes having a useful function are conserved while use-

less genes are removed. Numerous recent studies shed interesting results with

regard to the maintenance of transferred genes (Kuo and Ochman 2009 ) . For

example, it has been shown that the incorporation of a single transferred gene into

402

M.I. Ansari and A. Malik

regulatory interaction networks is very slow (Lercher and Pal 2008 ) in the case of

genes which provides the receptor with new functions, and it is dependent on the

number of partners for the gene product in the regulatory network, according to the

complexity hypothesis. Furthermore, products of these genes are incorporated in

the margin of the corresponding regulatory network. On the other hand, transferred

genes codifying for products with few partners are more easily deleted from

genomes (Rocha

2008 ) .

Recent work also shows that the transfer of whole operons enables the incorporation

and maintenance processes, allowing a quick gain of function and facilitating the

coordinate regulation of the new genes in the receptor (Price et al. 2008 ) . Considering

all, these results support that the involvement of their products in multiple molecular

interactions (complexity) is a more important constraint to transfer and maintenance

of genes in the prokaryotic world than the functional class to which the transferred

genes belong.

10.2 Incidence of Horizontal Gene Transfer

The evolutionary distance among organisms can be another signi ﬁ cant constraint

with regard to transfer because genes transferred between organisms separated a

long time ago were found to contribute in very different regulatory networks. On the

other hand, the ancient transfer events are dif ﬁ cult to detect because of the ameliora-

tion process that affects the evolution of foreign genes in the receptor genome

(Almeida et al. 2008 ; Marri and Golding 2008 ; Kuo and Ochman 2009 ) . numerous

studies suggest that gene transfer could effectively be more frequent for short and

intermediate evolutionary distances but infrequent between organisms that are sepa-

rated by large evolutionary time frames (Ochman et al. 2000 ; Brugger et al. 2002 ;

Nakamura et al. 2004 ; Ge et al. 2005 ; Choi and Kim 2007 ; Dagan et al. 2008 ) .

A recent study (Wagner and De la Chaux 2008 ) has analyzed the evolution of 2,091

insertion sequences in 438 wholly sequenced prokaryotic genomes and found only

30 cases of supposed transfer events among distantly related clades. Twenty-three

of these events seemed to be ancient while only seven were recent. However,

instances of gene transfer between Archaea and Bacteria have been described

(Rest and Mindell 2003 ; Gophna et al. 2004 ) , which shows that horizontal gene

transfer could affect evolution in the prokaryotic world along the different evolu-

tionary times.

A recent study (Kanhere and Vingron

2009 ) compares the distance between

orthologues and the intergenomic distances to try to identify ancient transfer

processes in prokaryotic genomes. The authors found that 118 of the 171 gene

transfer events were between Archaea and Bacteria, and they correspond primarily

to metabolic genes. Seventy four per cent of these events were transfers from

Bacteria to Archaea and the remaining 26% were transfers from Archaea to Bacteria.

Only 53 genes were gene transfer events between bacteria phyla and corresponded

mainly to genes involved in translation. Despite the fact that this approach is

403

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

restricted to protein families that evolve at a steady rate, the study shows interesting

trends within the inter domain gene transfer. It seems that the majority of transfers

between Bacteria and Archaea have taken place in the Bacteria to Archaea direction.

On the other hand, studies by Zhaxybayeva et al. (

2006, 2009 ) show that the intra-

phylum versus inter phylum gene exchange is different between different bacteria

lineages: in Cyanobacteria, intra-phylum gene change seems to be more important

than inter phylum exchange (Zhaxybayeva et al.

2006 ) . In Thermotogales, however,

and in particular in Firmicutes (Zhaxybayeva et al. 2009 ) , the inter phylum exchange

is dominant over intra phylum gene transfer. In addition, the proposed multiple gene

exchange between ε -proteobacteria and Aqui ﬁ cales seems another example of inter-

phylum exchange dominance (Boussau et al. 2008 ) .

Considering all, these studies suggest that regardless of the fact that gene transfer

can be more frequent between closely associated organisms, it may also take place

between distantly related organisms, contributing to evolution of Archaea and

Bacteria. On the other hand, the reality that recent transfer events can be more easily

detected adds a bias to the study of gene transfer in prokaryotic evolution, confound-

ing the real impact of ancient gene transfer events (Boto 2010 ) .

10.3 Phylogenetic Relationships, Bacterial Species

Concept and Horizontal Gene Transfer

Reconstructing the phylogenetic relationships between Bacteria and Archaea,

morphological characters are of limited use (Bohannon 2008 ) compared with metabolic

and molecular markers. However, horizontal gene transfer challenges in many cases

the correct reconstruction of these relationships, confounding the phylogenetic

signal present in these markers. Some authors (Doolittle 1999 ; Martin 1999 ;

Doolittle and Bapteste 2007 ) question whether it is achievable to restructure a correct

phylogenetic tree for the microbial world at all, considering the existence of horizon-

tal gene transfer events. Others support the idea that some core genes are in no way

transferred (Wolf et al. 2002 ; Brown 2003 ) , thus maintaining a true phylogenetic

signal that enables the reconstruction of a microbial phylogenetic tree. Finally,

others (Kurland et al. 2003 ; Kurland 2005 ) consider that the existence of many barriers

to gene transfer between organisms lowers the impact of horizontal gene transfer in

phylogenetic reconstruction.

A recent study (Sorek et al. 2007 ) dealing with this topic searched in all the

completed bacterial and archaeal genomes for genes that cannot be cloned in E. coli

as a proxy to the study of barriers against horizontal gene transfer. Their results

propose that there are no complete barriers to gene transfer because genes in all the

families considered can be cloned in E. coli from at least one of the genomes. In

addition, the results of a network analysis of shared genes (Dagan et al.

2008 ) agree

with the idea that horizontal gene transfer leaves no gene family untouched.

Supporting the idea that horizontal gene transfer challenges the reconstruction of

phylogenetic relationships among prokaryotes, another study claims that less than 0.7%

404

M.I. Ansari and A. Malik

of the prokaryotic genes may be considered core genes (Bapteste et al. 2008 ) ,

making the construction of a phylogenetic tree unsustainable. Recently, the pange-

nome concept, originally developed to establish how many genomes should be

sequenced from any given bacterial species in order to get a correct representation

of the whole gene repertoire (Tettelin et al.

2005, 2008 ; Hogg et al. 2007 ) and to

de ﬁ ne the complete set of genes present in a prokaryotic group has been applied to

the study of the whole set of genes present in sequenced bacterial genomes (Lapierre

and Gogarten

2009 ) . In this interesting study, the authors search for the presence of

homologue genes in 573 completed genomes using BLAST and conclude that only

8% of the genes in a typical bacterial genome (approx. 250 gene families in all

genomes) are present in 99% of the sampled genomes and therefore can be considered

to be core genes that are part of the extended core genome or set of shared genes.

Lapierre and Gogarten ( 2009 ) identi ﬁ ed two other gene categories: the so-called

character genes (shared by a group of organisms) present in a subset of genomes

(64% of the genes in a typical bacterial genome and 7,900 gene families in all

genomes) and the so-called accessory genes present in only one or in only a few of

the genomes (28% of the genes in a bacterial genome and an in ﬁ nite number of gene

families in all genomes). The authors also propose that character gene evolution is

mostly based on mutation, gene duplication and horizontal gene transfer, while

horizontal gene transfer and gene losses are involved in the evolutionary history of

accessory genes. The ﬁ nal conclusion of this study is that the bacterial ‘pan-genome’

(the set of all genes present in bacteria) is of in ﬁ nite size, demonstrating the plasticity

of the genome evolution in prokaryotes. Disregarding the fact that the methodology

used can lead to under estimations or over estimations of particular gene categories,

this study strongly underlines the impact that horizontal gene transfer has had on the

evolutionary history of prokaryotes and provides us with important clues towards

understanding the evolution of prokaryotic genomes (Boto 2010 ) .

11 Conclusion

Horizontal gene transfer is an important force modulating evolution in the prokary-

otic world and the evolution of particular eukaryotes. Even though gene exchange is

easier in closely linked organisms, horizontal gene transfer occurred between both

domains in the evolution of Archaea and Bacteria. The overwhelming evidence

using both functional and in silico genomic screening is that environmental organ-

isms harbour a previously underappreciated density of antibiotic resistance genes.

This unexpected conclusion should have a paradigm shifting impact on our under-

standing of the judicious use of antibiotics and the drug discovery process.

Further, the catabolic operons known today have evolved from MGEs, which

brought diverse catabolic genes together in one host and thus allowed a wide range

of organic compounds to be degraded through a few central metabolic pathways

(Top and Springael

2003 ) . The studies that have been discussed show that the genetic

patrimony of catabolic MGEs reaches further than plasmids and ‘conventional’

405

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

transposons and strongly indicate that HGT and patchwork assembly contribute to

the adaptation of bacteria to organic xenobiotics in the real environment. In conclu-

sion, it can be expected that further study of the molecular biology of different cata-

bolic MGEs, microbial MGEs, and the ecology of prokaryotes and their MGEs in

polluted sites at the macro- and micro-scale, will provide new insights into the evo-

lutionary processes at work during community adaptation to pollution and adaptation

of microorganisms in general.

References

Acar JF, Moulin G (2006) Antimicrobial resistance at farm level. Rev Sci Technol 25:775–792

Alekshun MN, Levy SB (2007) Molecular mechanisms of antibacterial multidrug resistance.

Cell 128:1037–1050

Alm E, Huang K, Arkin A (2006) The evolution of two-component systems in bacteria reveals dif-

ferent strategies for niche adaptation. PLoS Comput Biol 2(11):e143

Almeida FC, Leszczyniecka M, Fisher PB, DeSalle R (2008) Examining ancient inter-domain

horizontal gene transfer. Evol Bioinform 4:109–119

Amoroso MJ, Castro GR, Carlino FJ, Romero NC, Hill RT, Oliver G (1998) Screening of heavy

metal-tolerant actinomycetes isolated from the Sali River. J Gen Appl Microbiol 44:129–132

Andersson JO (2005) Lateral gene transfer in eukaryotes. Cell Mol Life Sci 62:1182–1197

Andersson JO, Sjogren AM, Davis LAM, Embley TM, Roger AJ (2003) Phylogenetic analysis of

diplomonad genes reveals frequent lateral gene transfer affecting eukaryotes. Curr Biol

13:94–104

Ansari MI, Grohmann E, Malik A (2008) Conjugative plasmids in multi-resistant bacterial isolates

from Indian soil. J Appl Microbiol 104:1774–1781

Assinder SJ, Williams PA (1988) Comparison of the meta pathway operons on NAH plasmids

pWW60-22 and TOL plasmid pWW53-4 and its evolutionary signi ﬁ cance. J Gen Microbiol

134:2769–2778

Assinder SJ, Williams PA (1990) The TOL plasmids: determinants of the catabolism of toluene

and the xylenes. Adv Microb Physiol 31:1–69

Baath E, Diaz-Ravina M, Frostegard A, Campbell CD (1998) Effect of metal-rich sludge amend-

ments on the soil microbial community. Appl Environ Microbiol 64:238–245

Babic A, Lindner AB, Vulic M, Stewart EJ, Radman M (2008) Direct visualization of horizontal

gene transfer. Science 319:1533–1536

Baek KH, Kim HS (2009) Microbial community structure in hexadecane- and naphthalene-enriched

gas station soil. J Microbiol Biotechnol 19:651–657

Baek KH, Yoon BD, Cho DH, Kim BH, Oh HM, Kim HS (2009) Monitoring bacterial population

dynamics using real-time PCR during the bioremediation of crude-oil-contaminated soil.

J Microbiol Biotechnol 19:339–345

Bapteste E, Susko E, Leigh J, Ruiz-Trillo I, Bucknam J, Doolittle WF (2008) Alternative methods

for concatenation of core genes indicate a lack of resolution in deep nodes of the prokaryotic

phylogeny. Mol Biol Evol 25:83–91

Baquero F, Blazquez J (1997) Evolution of antibiotic resistance. Tree 12(12):482–487

Baquero F, Negri MC, Morosini MI, Blazquez J (1998) Antibiotic-selective environments.

Clin Infect Dis 27(1):S5–S11

Barkay T, Pritchard H (1988) Adaptation of aquatic microbial communities to pollutant stress.

Microbiol Sci 5:165–169

Becker JG, Berardesco G, Rittmann BE, Stahl DA (2006) Effects of endogenous substrates on

adaptation of anaerobic microbial communities to 3-chlorobenzoate. Appl Environ Microbiol

72(1):449–456

406

M.I. Ansari and A. Malik

Belanger PA, Beaudin J, Roy S (2011) High-throughput screening of microbial adaptation to

environmental stress. J Microbiol Methods 85:92–97

Ben-Jacoba E, Cohen I, Golding I, Gutnick DL, Tcherpakov M, Helbing D, Ron IG (2000)

Bacterial cooperative organization under antibiotic stress. Phys A 282:247–282

Benveniste R, Davies J (1973) Aminoglycoside antibiotic-inactivating enzymes in actinomycetes

similar to those present in clinical isolates of antibiotic-resistant bacteria. Proc Natl Acad Sci

70:2276–2280

Black JG (1999) Bioremediation. In: Microbiology: principles and explorations. Prentice Hall

Publishers, Upper Saddle River, pp 751–752

Bohannon J (2008) Confusing kinships. Science 320:1031–1033

Boto L (2010) Horizontal gene transfer in evolution: facts and challenges. Proc R Soc B 277:819–827

Boussau B, Gueguen L, Gouy M (2008) Accounting for horizontal gene transfers explains

con ﬂ icting hypotheses regarding the position of aqui ﬁ cales in the phylogeny of Bacteria. BMC

Evol Biol 8:272

Brown J (2003) Ancient horizontal gene transfer. Nat Rev Genet 4:121–132

Brugger K, Redder P, She QX, Confalonieri F, Zivanovic Y, Garrett RA (2002) Mobile elements in

archaeal genomes. FEMS Microbiol Lett 206:131–141

Carrasco JA, Armario P, Pajuelo E, Burgos A, Caviedes MA, Lopez R, Chamber MA, Palomares AJ

(2005) Isolation and characterization of symbiotically effective Rhizobium resistant to arsenic

and heavy metals after the toxic spill at the Aznalcollar pyrite mine. Soil Biol Biochem

37:1131–1140

Carroll SB (2008) Evo-devo and expanding evolutionary synthesis A genetic theory of morpho-

logical evolution. Cell 134:25–36

Castro IV, Ferreira EM, McGrath SP (1997) Effectiveness and genetic diversity of Rhizobium

leguminosarum bv trifolii isolates in Portuguese soils polluted by industrial ef ﬂ uents. Soil Biol

Biochem 29:1209–1213

Chat ﬁ eld LK, Williams PA (1986) Naturally occurring TOL plasmids in Pseudomonas strains

carry either two homologous or two nonhomologous catechol 23-oxygenase genes. J Bacteriol

168:878–885

Chaudhry GR, Chapalamadugu S (1991) Biodegradation of halogenated organic compounds.

Microbiol Rev 55:59–79

Choi IG, Kim SH (2007) Global extent of horizontal gene transfer. Proc Natl Acad Sci

104:4489–4494

Clarke PH (1984) The evolution of degradative pathways. In: Gibson DT (ed) Microbial degrada-

tion of organic compounds. Marcel Dekker Inc, New York, pp 11–27

Copley SD (2000) Evolution of ametabolic pathway for degradation of a toxic xenobiotic: the

patchwork approach. Trends Biochem Sci 25:261–265

D’Costa VM, McGrann KM, Hughes DW, Wright GD (2006) Sampling the antibiotic resistome.

Science 311:374–377

D’Costa VM, Grif ﬁ ths E, Wright GD (2007) Expanding the soil antibiotic resistome: exploring

environmental diversity. Curr Opin Microbiol 10:481–489

Dagan T, Artzy-Randrup Y, Martin W (2008) Modular networks and cumulative impact of lateral

transfer in prokaryote genome evolution. Proc Natl Acad Sci 105:10039–10044

Darwin C (1859) On the origin of species by means of natural selection (London Murray).

http://wwwliteratureorg/authors/ drawin-charles/the-origin-of-species/

Daubin V, Ochman H (2004) Bacterial genomes as new gene homes: the genealogy of ORFans in

E. coli . Genome Res 14:1036–1042

Davey ME, O’toole GA (2000) Microbial bio ﬁ lms: from ecology to molecular genetics. Microbiol

Mol Biol Rev 64(4):847–867

Davies J (1992) Another look at antibiotic resistance. J Gen Microbiol 138:1553–1559

Davies J, Davies D (2010) Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev

74(3):417–433

De Souza MJ, Nair S, Loka Bharathi PA, Chandramohan D (2006) Metal and antibiotic-resistance

in psychrotrophic bacteria from Antarctic Marine waters. Ecotoxicology 15:379–384

407

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

Dean AM, Thornton JW (2007) Mechanistic approaches to the study of evolution: the functional

synthesis. Nat Rev Genet 8:1604–1607

Don RH, Pemberton JM (1981) Properties of six pesticide degradation plasmids isolated from

Alcaligenes paradoxus and Alcaligenes eutrophus . J Bacteriol 145:681–686

Don RH, Weightman AJ, Knackmuss HJ, Timmis KN (1985) Transposon mutagenesis and cloning

analysis of the pathways for degradation of 24-dichlorophenoxyacetic acid and 3-chlorobenzoate

in Alcaligenes eutrophus JMP134(pJP4). J Bacteriol 161:85–90

Doolittle WF (1999) Phylogenetic classi ﬁ cation and the universal tree. Science 284:2124–2128

Doolittle WF, Bapteste E (2007) Pattern pluralism and the tree of life hypothesis. Proc Natl Acad

Sci 104:2043–2049

Doolittle WF, Logsdon JM Jr (1998) Do archaea have a mixed heritage? Curr Biol 8:R209–R211

El-Fantroussi S (2000) Enrichment and molecular characterization of a bacterial culture that

degrades methoxy-methyl urea herbicides and their aniline derivatives. Appl Environ Microbiol

66(12):5110–5115

Esteve-Nenez A, Caballero A, Ramos JL (2001) Biological degradation of 2 4 6-trinitrotoluene.

Microbiol Mol Biol Rev 65:335–352

Faguy DM, Doolittle WF (1999) Lessons from the Aeropyrum pernix genome. Curr Biol

9:R883–R886

Ferreira da Silva M, Vaz-Moreira I, Gonzalez-Pajuelo M, Nunes OC, Manaia CM (2007)

Antimicrobial resistance patterns in Enterobacteriaceae isolated from an urban wastewater

treatment plant. FEMS Microbiol Ecol 60:166–176

Foster P (1995) Adaptive mutation. In: Baumberg S, Young JPW, Wellington EMH, Saunders JR

(eds) Population genetics of bacteria. Cambridge University Press, Cambridge, pp 13–30

Fulthorpe RR, Wyndham RC (1992) Involvement of a chlorobenzoate catabolic transposon Tn5271

in community adaptation to chlorobiphenyl chloroaniline and 2, 4 dichlorophenoxyacetic acid

in a freshwater ecosystem. Appl Environ Microbiol 58:314–325

Gale EF, Cundliffe E, Reynolds PE, Richmond M, Waring MJ (eds) (1981) The molecular basis of

antibiotic action, 2nd edn. Wiley, Chichester

Galperin MY (2005) A census of membrane-bound and intracellular signal transduction proteins

in bacteria: bacterial IQ extroverts and introverts. BMC Microbiol 5:35

Ge F, Wang LS, Kim J (2005) The cobweb of life revealed by genome scale estimates of horizontal

gene transfer. PLoS Biol 3:e316

Gogarten JP, Doolittle WF, Lawrence JG (2002) Prokaryotic evolution in light of gene transfer.

Mol Biol Evol 19:2226–2238

Gophna U, Charlebois RL, Doolittle WF (2004) Have archaeal genes contributed to bacterial viru-

lence? Trends Microbiol 12:213–219

Gottlieb D (1976) The production and role of antibiotics in soil. J Antibiot (Tokyo) 29:987–1000

Guljamow A, Jenke-Kodama H, Saumweber H, Quillardet P, Frangeul L, Castets AM, Bouchier A,

Tandeau M, de Marsac N, Dittmann E (2007) Horizontal gene transfer of two cytoskeletal

elements from a eukaryote to a cyanobacterium. Curr Biol 17:R757–R759

Handelsman J (2004) Metagenomics: application of genomics to uncultured microorganisms.

Microbiol Mol Biol Rev 68:669–685

Heuer H, Smalla K (2012) Plasmids foster diversi ﬁ cation and adaptation of bacterial populations

in soil. FEMS Microbiol Rev. doi:

10.1111/j.1574-6976.2012.00337.x

Hogg JS, Hu FZ, Janto B, Boissy R, Hayes J, Keefe R, Post JC, Ehrlich GD (2007) Characterization

and modeling of the Haemophilus in ﬂ uenzae core and supragenomes based on the complete

genomic sequences of Rd and 12 clinical nontypeable strains. Genome Biol 8:R103

Holben WE, Jansson JK, Chelm BK, Tiedje JM (1988) DNA probe method for the detection of

speci ﬁ c microorganisms in the soil bacterial community. Appl Environ Microbiol 54:703–711

Jacobs L, Chenia HY (2007) Characterization of integrons and tetracycline resistance determi-

nants in Aeromonas spp. isolated from South African aquaculture systems. Int J Food Microbiol

114:295–306

Jain R, Rivera MC, Lake JA (1999) Horizontal gene transfer among genomes: the complexity

hypothesis. Proc Natl Acad Sci 96:3801–3806

408

M.I. Ansari and A. Malik

Kanhere A, Vingron M (2009) Horizontal gene transfer in prokaryotes shows differential preferences

for metabolic and translational genes. BMC Evol Biol 9:9

Khan AA, Wang RF, Cao WW, Doerge DR, Wennerstrom D, Cerniglia CE (2001) Molecular

cloning nucleotide sequence and expression of genes encoding a polycyclic ring dioxygenase

from Mycobacterium sp. strain PYR-1. Appl Environ Microbiol 67:3577–3585

Koonin EV (2009) Darwinian evolution in the light of genomics. Nucleic Acids Res 37:1011–1034

Kuo CH, Ochman H (2009) The fate of new bacterial genes. FEMS Microbiol Rev 33:38–43

Kurland CG (2005) What tangled web: barriers to rampant horizontal gene transfer. Bioessays

27:741–747

Kurland CG, Canback B, Berg OB (2003) Horizontal gene transfer: a critical view. Proc Natl Acad

Sci 100:9658–9662

Lapierre P, Gogarten JP (2009) Estimating the size of the bacterial pan-genome. Trends Genet

25:107–110

Larkin MJ, Kulakov La Allen CCR (2005) Biodegradation and Rhodococcus masters of catabolic

versatility. Curr Opin Biotechnol 16:282–290

Lawrence JG, Ochman H (2002) Reconciling the many faces of lateral gene transfer. Trends

Microbiol 10:1–4

Leahy JG, Colwell RR (1990) Microbial degradation of hydrocarbons in the environment.

Microbiol Rev 54(3):305–315

Lerat E, Daubin V, Ochman H, Moran NA (2005) Evolutionary origins of genomic repertoires in

bacteria. PLoS Biol 3:e130

Lercher MJ, Pal C (2008) Integration of horizontally transferred genes into regulatory interaction

networks takes many million years. Mol Biol Evol 25:559–567

Lessie TG, Wood MS, Byrne A, Ferrante A (1990) Transposable gene-activating elements in

Pseudomonas cepacia . In: Silver S, Chakrabarty AM, Iglewski B, Kaplan S (eds) Pseudomonas :

biotransformations pathogenesis and evolving biotechnology. American Society for Microbiology,

Washington, DC, pp 279–292

Levesque S, Frost E, Michaud S (2007) Comparison of antimicrobial resistance of Campylobacter

jejuni isolated from humans chickens raw milk and environmental water in Quebec. J Food

Prot 70:729–735

Liu Q, Paroo Z (2010) Biochemical principles of small RNA pathways. Annu Rev Biochem

79:295–319

Lloyd-Jones G, Laurie AD, Hunter DWF, Fraser R (1999) Analysis of catabolic genes for naphtha-

lene and phenanthrene degradation in contaminated New Zealand soils. FEMS Microbiol Ecol

29:69–79

Lykidis A, Pérez-Pantoja D, Ledger T, Mavromatis K, Anderson IJ et al (2010) The complete mul-

tipartite genome sequence of cupriavidus necator jmp134, a versatile pollutant degrader. PLoS

One 5(3):e9729

Madeinos AA (1997) Evolution and dissemination of betalactamases accelerated by generation of

beta lactum antibiotics. Clin Infect Dis 29:1419–1422

Malik A, Celik E-K Bohn C, Boeckelmann U, Knobel K, Grohmann E (2008) Molecular detection

of conjugative plasmids and antibiotic resistance genes in anthropogenic soils from Germany

and India. FEMS Microbiol Lett 279:207–216

Marri PR, Golding GB (2008) Gene amelioration demonstrated: the journey of nascent genes in

bacteria. Genome 5:164–168

Marshall BM, Ochieng DJ, Levy SB (2009) Commensals: unappreciated reservoir of antibiotic

resistance. Microbe 4:231–238

Martin W (1999) Mosaic bacterial chromosomes: a challenge en route to a tree of genomes.

Bioessays 21:99–104

Martinez-Martinez L, Pascnal A, Jacoby GA (1998) Quinolone resistance from a transferable plasmid.

Lancet 351:797–799

Martins da Costa PM, Vaz-Pires PM, Bernardo FM (2006) Antibiotic resistance of Enterococcus

spp. isolated from wastewater and sludge of poultry slaughterhouses. J Environ Sci Health B

41:1393–1403

409

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

Meulien P, Downing RG, Broda P (1981) Excision of the 40 kb segment of the TOL plasmid from

Pseudomonas putida mt-2 involves direct repeats. Mol Gen Genet 184:97–101

Mishra V, Lal R, Srinivasan (2001) Enzymes and operons mediating xenobiotic degradation in

bacteria. Crit Rev Microbiol 27:133–166

Nakai C, Horiike K, Kuramitsu S, Kagamilyama H, Nozaki M (1990) Three isozymes of catechol

12-dioxygenase (pyrocatechase) aa a1 and B3 from Pseudononas arvilla C-1. J Biol Chem

265:660–665

Nakamura Y, Itoh T, Matsuda H, Gojobori T (2004) Biased biological functions of horizontally

transferred genes in prokaryotic genomes. Nat Genet 36:760–766

Nedelcu AM, Miles IH, Fagir AM, Karol K (2008) Adaptative eukaryote-to-eukaryote lateral

gene transfer: stress-related genes of algal origin in the closest unicellular relatives of animals.

J Evol Biol 21:1852–1860

Neela FA, Nonaka L, Suzuki S (2007) The diversity of multi-drug resistance pro ﬁ les in tetracy-

cline-resistant Vibrio species isolated from coastal sediments and seawater. J Microbiol

45:64–68

Niedle EL, Harnett C, Bonitz S, Ornston LN (1988) DNA sequence of Acinetobacter calcoaceticus

catechol 12-dioxygenase-I structural gene cat A: evidence for evolutionary divergence of intra-

diol dioxygenases by acquisition of DNA sequence repetitions. J Bacteriol 170:4874–4880

Ochman H, Lawrence JG, Grolsman EA (2000) Lateral gene transfer and the nature of bacterial

innovation. Nature 405:299–304

Ogram A, Sayler GS, Barkay T (1987) The extraction and puri ﬁ cation of microbial DNA from

sediments. J Microbiol Methods 7:57–66

Ojo OA (2007) Molecular strategies of microbial adaptation to xenobiotics in natural environment.

Biotechnol Mol Biol Rev 2(1):001–013

Okada H, Negoro S, Kimura H, Nakamura S (1983) Evolutionary adaptation of plasmid-encoded

enzymes for degrading nylon oligomers. Nature (London) 306:203–206

Oliynyk M, Samborskyy M, Lester JB, Mironenko T, Scott N, Dickens S, Haydock SF, Leadlay PF

(2007) Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora

erythraea NRRL23338. Nat Biotechnol 25:447–453

Pal C, Papp B, Lercher MJ (2005) Horizontal gene transfer depends on gene content of the host.

Bioinformatics 21(S2):222–223

Perkins EJ, Gordon MP, Caceres O, Lurquin PF (1990) Organization and sequence analysis of the

24-dichlorophenol hydroxylase and dichlorocatechol oxidative operons of plasmid pJP4.

J Bacteriol 172:2351–2359

Piepersberg W (2001) Endogenous antimicrobial molecules: an ecological perspective. In: Sussman

M (ed) Molecular medical microbiology, vol 1. Academic, New York, pp 561–585

Pigliucci M (2007) Do we need an extended evolutionary synthesis? Evolution 61:2743–2749

Price MN et al (2005) Operon formation is driven by co-regulation and not by horizontal gene

transfer. Genome Res 15:809–819

Price MN, Dehal PS, Arkin AP (2008) Horizontal gene transfer and the evolution of transcriptional

regulation in Escherichia coli . Genome Biol 9:R4

Ragan MA, Charlebois RL (2002) Distributional pro ﬁ les of homologous open reading frames

among bacterial phyla: implications for vertical and lateral transmission. Int J Syst Evol

Microbiol 52:777–787

Raghunath D (2008) Emerging antibiotic resistance in bacteria with special reference to India.

J Biosci 33:593–603

Ramezani A, Hawley RG (2010) Strategies to insulate lentiviral vector-expressed transgenes.

Methods Mol Biol 614:77–100

Raniard L, Nowak V, Echairi A, Faloya V, Chaussod R (2008) The dynamics of soil bacterial

community structure in response to yearly repeated agricultural copper treatments. Res

Microbiol 159:251–254

Reineke W, Jeenes DJ, Williams PA, Knackmuss HA (1982) TOL plasmid in constructed halo

benzoate-degrading Pseudomonas strains: prevention of meta pathway. J Bacteriol

150:195–201

410

M.I. Ansari and A. Malik

Rest JS, Mindell DP (2003) Retroids in archaea: phylogeny and lateral origin. Mol Biol Evol

20:1134–1142

Riesenfeld CS, Goodman RM, Handelsman J (2004) Uncultured soil bacteria are a reservoir of

new antibiotic resistance genes. Environ Microbiol 6:981–989

Rocha EPC (2008) Evolutionary patterns in prokaryotic genomes. Curr Opin Microbiol

11:454–460

Rodrigue A, Quentin Y, Lazdunski A, Mejean V, Foglino M (2000) Two component systems in

Pseudomonas aeruginosa : why so many? Trends Microbiol 8:498–504

Roszak DB, Colwell RR (1987) Survival strategies of bacteria in the natural environment. Microbiol

Rev 51:365–379

Saunders NJ, Hood DW, Moxon ER (1999) Bacterial evolution: bacteria play pass the gene. Curr

Biol 9:R180–R183

Saye DJ, Ogunseitan OA, Sayler GS, Miller RV (1990) Transduction of linked chromosomal genes

between Pseudomonas aeruginosa strains during incubation in situ in a fresh water habitat.

Appl Environ Microbiol 56:140–145

Sayler GS, Shields MS, Tedford ET, Breen A, Hooper SW, Sirotkin KM, Davis JW (1985)

Application of DNA-DNA colony hybridization to the detection of catabolic genotypes in envi-

ronmental samples. Appl Environ Microbiol 49:1295–1303

Schlegel HG (1986) Xenobiotics. In: General microbiology, 6th edn. Cambridge University Press,

New York, p 433

Schmitt H, Stoob K, Hamscher G, Smit E, Seinen W (2006) Tetracyclines and tetracycline resis-

tance in agricultural soils: microcosm and ﬁ eld studies. Microb Ecol 51:267–276

Schreiner A, Fuchs K, Lottspeich F, Poth H, Lingens F (1991) Degradation of 2-methylaniline in

Rhodococcus rhodochrous : cloning and expression of two clustered catechol 2,3-dioxygenase

genes from strain CTM. J Gen Microbiol 137:2041–2048

Sen D, Yano H, Suzuki H, Król JE, Rogers L, Brown CJ, Top EM (2010) Comparative genomics

of pAKD4, the prototype IncP-1 δ plasmid with a complete backbone. Plasmid 63(2):98

Shimizu S, Kobayashi H, Masai E, Fuduka M (2001) Characterization of the 450-kb linear plasmid

in a polychlorinated biphenyl degrader Rhodococcus sp. strain RHA1. Appl Environ Microbiol

67:2021–2022

Sinha S, Chattopadhyay P, Pan I, Chatterjee S, Chanda P, Bandyopadhyay D, Das K, Sen SK (2009)

Microbial transformation of xenobiotics for environmental bioremediation. Afr J Biotechnol

8(22):6016–6027

Sorek R, Zhu Y, Creevey CJ, Francino MP, Bork P, Rubin EM (2007) Genome-wide experimental

determination of barriers to horizontal gene transfer. Science 318:1449–1452

Sorensen SJ, Bailey M, Hansen LH, Kroer N, Wuertz S (2005) Studying plasmid horizontal

transfer in situ: a critical review. Nat Rev Microbiol 3:700–710

Spain JC, van Veld PA (1983) Adaptation of natural microbial communities to degradation of xeno-

biotic compounds: effects of concentration exposure time inoculum and chemical structure.

Appl Environ Microbiol 45:428–435

Springael D, Top EM (2004) Horizontal gene transfer and microbial adaptation to xenobiotics:

new types of mobile genetic elements and lessons from ecological studies. Trends Microbiol

12(2):53–58

Stepanauskas R, Glenn TC, Jagoe CH, Tuck ﬁ eld RC, Lindell AH, King CJ, McArthur JV (2006)

Coselection for microbial resistance to metals and antibiotics in freshwater microcosms.

Environ Microbiol 8:1510–1514

Taddei F, Radman M, Maynard-Smith J, Toupance B, Gouyon PH, Godelle B (1997) Role of muta-

tor alleles in adaptive evolution. Nature 387:700–702

Tettelin H et al (2005) Genome analysis of multiple pathogenic isolates of Streptococus agalac-

tiae : implications for the microbial ‘pan-genome’. Proc Natl Acad Sci 102:13950–13955

Tettelin H, Riley D, Cattuto C, Medini D (2008) Comparative genomics: the bacterial pan-genome.

Curr Opin Microbiol 12:472–477

Top EM, Springael D (2003) The role of mobile genetic elements in bacterial adaptation to

xenobiotic organic compounds. Curr Opin Biotechnol 14(3):262–269

411

15 Antibiotic Resistance Gene Pool and Bacterial Adaptation to Xenobiotics…

Top EM et al (2002) Catabolic mobile genetic elements and their possible use in bioaugmentation

of polluted soils and waters. FEMS Microbiol Ecol 42:199–208

Trevors JT (1985) DNA probes for the detection of speci ﬁ c genes in bacteria isolated from the

environment. Trends Biotechnol 3:291–293

Tsuda M, Iino T (1987) Genetic analysis of a transposon carrying toluene degrading genes on a

TOL plasmid pWWO. Mol Gen Genet 210:270–276

Tsuda M, Iino T (1988) Identi ﬁ cation and characterization of Tn4653 a transposon covering the

toluene transposon Tn4651 on TOL plasmid pWWO. Mol Gen Genet 213:72–77

Tsuda M, Iino T (1990) Naphthalene degrading genes on plasmid NAH7 are on a defective trans-

poson. Mol Gen Genet 223:33–39

Tsuda M, Minegishi KI, Iino T (1989) Toluene transposons Tn4651 and Tn4653 are class II trans-

posons. J Bacteriol 171:1386–1393

Tsuda M et al (1999) Mobile catabolic genes in bacteria. J Biosci Bioeng 87:401–410

Ulrich LE, Koonin EV, Zhulin IB (2005) One-component systems dominate signal transduction in

prokaryotes. Trends Microbiol 13:52–56

Van der Meer JR, Eggen RIL, Zehnder AJB, De Vos WM (1991) Sequence analysis of Pseudomonas

sp. Strain P51 tcb gene cluster which encodes metabolism of chlorinated catecols: evidence for

specialization of catecol 1 2-dioxygenases for chlorinated substrates. J Bacteriol 173:2425–2434

Vedler E, Vahter M, Heinaru A (2004) The completely sequenced plasmid pest4011 contains a

novel incp1 backbone and a catabolic transposon harboring tfd genes for 2, 4-dichlorophe-

noxyacetic acid degradation. J Bacteriol 186(21):7161–7174

Wagner A, De la Chaux N (2008) Distant horizontal gene transfer is rare for multiple families of

prokaryotic insertion sequences. Mol Genet Genomics 280:397–408

Walsh C (2003) Antibiotics: actions, origins, resistance. ASM Press, Washington, DC

Watkins RF, Gray MW (2006) The frequency of eubacterium-to-eukaryote lateral gene transfer

shows signi ﬁ cant cross-taxa variation within amoebozoa. J Mol Evol 63:801–814

Whyte LG, Smits THM, Labbe D, Witholt B, Greer CW, Van Beilen JB (2002) Gene cloning and

characterization of multiple alkanehydroxylase systems in Rhodococcus strains Q15 and

NRRLB-16531. Appl Environ Microbiol 68:5933–5942

Williams PA, Assinder SJ, Shaw LE (1990) Construction of hybrid xylE genes between the two

duplicate homologous genes from TOL plasmid pWW53: comparison of the kinetic properties

of the gene products. J Gen Microbiol 136:1583–1589

Wolanin PM, Thomason PA, Stock JB (2002) Histidine protein kinases: key signal transducers

outside the animal kingdom. Genome Biol 3:R3013

Wolf YI, Rogozin IB, Grishin NV, Koonin EV (2002) Genome trees and the tree of life. Trends

Genet 18:472–479

Wright GD (2007) The antibiotic resistome: the nexus of chemical and genetic diversity. Nat Rev

Microbiol 5:175–186

Yano H, Miyakoshi M, Ohshima K, Tabata M, Nagata Y, Hattori M, Tsuda M (2010) Complete

nucleotide sequence of TOL plasmid pDK1 provides evidence for evolutionary history of

IncP-7 catabolic plasmids. J Bacteriol 192(17):4337–4347

Zhaxybayeva O, Gogarten JP, Charlebois RL, Doolittle WF, Papke RT (2006) Phylogenetic analyses

of cyanobacterial genomes: quanti ﬁ cation of horizontal gene transfer events. Genome Res

16:1099–1108

Zhaxybayeva O et al (2009) On the chimeric nature thermophilic origin and phylogenetic

placement of the Thermotogales. Proc Natl Acad Sci 106:5865–5870

413

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

Abstract Synthetic lethality is de ﬁ ned as a type of genetic interaction where two

simultaneous genetic defects result in cellular death. These defects could be in the

form of two independent non lethal mutations, over-expression of genes or the

action of a chemical compound under a certain genetic background. The synthetic

lethal genetic interaction network provides information about the functional rela-

tionship between the genes in a simple and experimentally tractable model system,

such as yeast and improves our understanding for the treatment of complex human

diseases. The synthetic lethal interaction data can be used to identify the gene func-

tion and to elucidate the mechanism of action of drugs. A large number of yeast

genes have human orthologs and the synthetic lethal interaction data obtained from

the yeast can provide excellent opportunities for therapeutics in cancer cell lines

that can be extended up to drug developmental stage. This chapter provides the

overview of genetic diversity of yeast using a synthetic lethal interaction network in

order to identify function of genes of interest, mechanism of drug action and can-

cer therapy in higher eukaryotes. Furthermore, yeast as a model system for viral

pathogenesis studies has also been discussed.

Keywords Yeast • Synthetic lethal interaction • Genetic interaction • Cancer

• Virus

A genetic interaction is de ﬁ ned by the emergence of a surprising phenotype

when two genes are disrupted together. The genetic interaction studies have

been used to understand signaling or metabolic pathways and to examine the

crosstalk between different pathways in ﬁ ssion and budding yeast (Forsburg 2001 ;

S. Khan • A. K. Sonkar • S. Ahmed (*)

Molecular and Structural Biology Division , CSIR – Central Drug

Research Institute , Chattar Manzil Palace, MG Road , Lucknow 226001, India

e-mail: shakil_ahmed@cdri.res.in

Chapter 16

Synthetic Lethal Genetic Interaction

Networks and Their Utility

for Anticancer Therapy

Saman Khan , Amit Kumar Sonkar , and Shakil Ahmed

414

S. Khan et al.

Avery and Wasserman 1992 ) . Topological analysis of the yeast genetic interaction

network has revealed the importance of gene interactions in phenotype modelling

(Hartwell 2004 ). About 30 genetic interactions have been identi ﬁ ed for non-essential

genes and ﬁ vefold more for essential genes (Tong et al.

2004 ; Davierwala et al.

2005 ) . Recent genetic interactions studies in the yeast model system have been

able to de ﬁ ne the general principles of genetic networks, and also pave the way

for similar studies in higher eukaryotic systems. A comparative understanding of

these genetic-interaction networks promises to identify the nature of quantitative

traits and the basis of complex inherited diseases.

1 Genome-Wide Loss-of-Function Screening in Yeast

The availability of elegant and straightforward genetic tools makes the yeast

(budding and ﬁ ssion yeast) the preferred organism for the development of genomic

methods for systematic discovery of gene function. The availability of remarkable

genetic resources, including a systematic gene deletion set has made the system

more attractive. Knock out deletion strains of about 6,000 known genes in budding

yeast have been constructed, resulting in 5,000 viable haploid gene deletion mutants

and identifying another 1,000 essential yeast genes (Giaever et al. 2002 ) . A genome-

wide gene deletion set for the ﬁ ssion yeast Schizosaccharomyces pombe has also

been constructed (Kim et al. 2010 ) . The comparisons of orthologous gene pairs

between budding and ﬁ ssion yeast showed that 83% of single-copy orthologs in the

two yeasts had conserved dispensability. The gene dispensability between the bud-

ding and ﬁ ssion yeast differed for certain pathways, including mitochondrial trans-

lation and cell cycle checkpoint control. In ﬁ ssion yeast a relationship between gene

essentiality and the presence of introns has also been identi ﬁ ed (Kim et al. 2010 )

suggesting that the essential genes are less likely to be rapidly regulated (Jeffares

et al. 2008 ) . The number of essential genes in ﬁ ssion yeast is higher as compared to

the budding yeast. About 3,492 orthologs of ﬁ ssion yeast genes have been identi ﬁ ed

in other eukaryotes, including humans. About 87% of these orthologs are conserved

in both yeast and other eukaryotes including human. Such a high degree of conser-

vation suggests that conclusions drawn from analyses in the two yeasts concerning

molecular and cell biology will be relevant to, and improve our understanding of,

metazoan cells.

The availability of deletion collections enables us to screen for complete or par-

tial loss-of-function phenotype. To date, the collection has been surveyed for ﬁ tness

defects in response to a variety of growth conditions including different drug treat-

ments and environmental insults (Suter et al. 2006 ; Scherens and Goffeau 2004 ;

Brown et al. 2006 ) . Plating assays and parallel analysis with the deletion collection

has identi ﬁ ed the genes responsible for complex phenotypes such as chromosome

cohesion (Marston et al. 2004 ) , sporulation (Deutschbauer et al. 2002 ; Enyenihi and

Saunders 2003 ) and aging defects (Powers et al. 2006 ) .

415

16 Synthetic Lethal Genetic Interaction Networks and Their Utility…

2 Genetic Interactions in Yeast: Synthetic Lethality

Synthetic lethality is a type of genetic interaction in which a combination of mutations

in two or more genes leads to cell death, whereas a mutation in one of these genes does

not (Fig. 16.1 ). The classic interpretation of this interaction between two genes is that

the genes (or the pathways in which they act) are at least partially functionally redun-

dant (Hartman et al. 2001 ) . In other words synthetic lethal relationships often occur

when the products of two genes act on the same pathway and combine to control a

speci ﬁ c essential function or when two genes function in different pathways such that

one pathway functionally compensates for defects in the other.

There is another model for synthetic lethal interactions termed as ‘induced essen-

tiality’. In this model the loss of one gene results in a rearrangement of the genetic

network into an alternative viable state that makes a second gene an essential gene

(Fig. 16.2 ). In such scenario the functions of two genes or the pathways in which

they act, are not necessarily redundant or related. In this scenario one gene is simply

required under a condition caused by the loss of another gene. In this model, a syn-

thetic lethal interaction is a special form of conditional lethality and may be a con-

sequence of the evolution of adaptive responses to different environmental conditions

(Yadav et al. 2011 ) . This model is consistent with the ﬁ nding that in an analysis of

276 viable deletion mutants about 95% had a perturbed expression pro ﬁ le relative

to wild-type cells, suggesting that loss of a non-essential gene results in a network

rearrangement (Hughes et al. 2000 ) .

Despite the existence of hundreds of alleles within the human population, in

most cases only rare combinations lead to a disease state. To understand the genetic

interactions that compromise the function of conserved pathways, model organisms

will be essential in mapping genetic interactions that are relevant to disease states.

Large-scale identi ﬁ cation of synthetic lethal interactions can provide global maps of

functional relationships between genes and pathways. To facilitate such large-scale

genetics projects, an automated method for the construction of double mutants

called synthetic genetic array (SGA) analysis has been developed (Tong et al. 2001,

Gene A

B Viable

Viable

Lethal

Gene B

Fig. 16.1 Model depicting

synthetic lethal interactions

between two genes (shown

here as gene A and gene B )

that can compensate for each

other because of functional

redundancy

416

S. Khan et al.

2004 ) . These arrays consist of a series of sequential transfers to selective media,

which enable rapid generation of haploid double mutants between a query gene and

the ordered array of deletion mutants (Tong et al. 2004 ; Davierwala et al. 2005 ) .

3 Synthetic Dosage Lethality (SDL) and Over-Expression

The term synthetic dosage lethality is used when a particular gene becomes essen-

tial for survival due to the over-expression of another gene. A SDL interaction

occurs when overexpression of a gene is lethal in a target mutant strain but is viable

in a wild type strain. At least four basic screening procedures can be applied to

identify the interacting proteins using the SDL method.

1. Synthetic dosage lethality can be used as a direct test to assay for an interaction

between a reference gene and a target mutation. For example, over-expression of

the Cdk inhibitor protein Farlp is lethal to a strain defective in cdc34 but not in a

cdcl6 mutant in S. cerevisae (Henchoz et al. 1997 ) .

2. Synthetic dosage lethality can also be used as a secondary screen to uncover

mutants of interest from a primary mutant collection by overexpression of a pro-

tein with a particular biological role. This screen has successfully identi ﬁ ed a

kinetochore mutant from a collection of chromosome transmission ﬁ delity

mutants by over-expression of known kinetochore proteins (Kroll et al. 1996 ) .

3. Synthetic dosage lethality can also be adapted to a primary genetic screen to isolate

mutants which interact with the reference protein. In this experiment, a wild-type

strain is ﬁ rst mutagenized, an inducible reference gene introduced, and colonies

isolated which are lethal only when the reference gene is over-expressed.

4. A variation of an SDL screen can also be performed in which a mutant strain is

transformed with an over-expression library and screened for genes that when

overexpressed cause cell lethality (Imiger et al. 1995 ) .

Induced

essentiality

Loss of gene A

Viable

Loss of gene B

Lethal

Condition X

Wild type

aab

Wild type

Conditional

essentiality

Fig. 16.2 Alternative model for synthetic lethality: the loss of one gene ( gene A ) results in a rear-

rangement of the genetic network in such a way that the other gene ( gene B ) becomes essential

under new conditions

417

16 Synthetic Lethal Genetic Interaction Networks and Their Utility…

Synthetic genetic arrays have recently been used to manipulate a genome-wide

over-expression array where each strain expresses a unique yeast gene from an

inducible promoter permitting systematic exploration of gain-of-function phenotypes

(Sopko et al.

2006 ) . In this manner, dosage suppressors of a conditional phenotype

such as a temperature-sensitive allele of an essential gene should be readily identi ﬁ ed

(Huang et al.

2003 ) . The combination of synthetic lethal and synthetic dosage lethal-

ity screens can also prove fruitful in the systematic dissection of speci ﬁ c biological

processes (Measday and Hieter 2002 ; Measday et al. 2005 ) .

4 Genetic Interactions and Small-Molecule Perturbation

The synthetic genetic interaction can also be used to identify the compounds that

target speci ﬁ c pathways of interest. In this method the combination of mutations

with environmental stresses and inhibition by chemical compounds mimics double

deletions and hence abrogate the target pathway. Indeed, for a global understanding

of complex biological processes, small molecules can serve as speci ﬁ c and revers-

ible modulators of gene activity. Recently the synthetic genetics interaction network

has been utilized for pathway-to-drug discovery using the DNA damage checkpoint

as the target pathway (Tamble et al. 2011 ) . Due to the availability of simple assays

that can give robust ﬁ tness readouts in the yeast system, such chemical-genetic

approaches on a genome-wide scale via ‘chemical genomics’ can be very useful for

therapeutic purposes. Furthermore, many essential therapeutic targets and pathways

are conserved between yeast and man.

5 The RNAi and Genome-Wide Loss-of-Function Screening

RNAi describes a process for mRNA degradation by sequence speci ﬁ c double-

stranded RNA (dsRNA) (Moffat and Sabatini 2006 ) . The RNA interference (RNAi)

technology provides a smooth transition from sequence to function in more complex

cells and metazoans. The RNAi libraries have been designed to target every predicted

gene in the worm, ﬂ y, mouse and human genomes (Kamath et al. 2003 ; Boutros et al.

2004 ; Berns et al. 2004 ; Silva et al. 2005 ; Moffat et al. 2006 ) and offer the potential

to systematically examine effects of gene perturbation on a genome-wide scale.

Thus, targeted loss-of-function screens can now be used to uncover direct links

between gene sequence and disease manifestation. A library of dsRNA-expressing

bacterial strains targeting about 86% of the C. elegans genes has been used for RNAi-

mediated loss-of-function screens to identify genes involved in embryonic lethality,

sterility, genome instability, longevity, apoptosis, molting, transposon silencing and

fat metabolism (Vastenhouw et al.

2003 ; Lee et al. 2003 ; Pothof et al. 2003 ; Frand

et al. 2005 ; Ashra ﬁ et al. 2003 ) . Recently, adult worms were injected with a dsRNA

418

S. Khan et al.

library targeting 19,075 genes and over 650 perturbed genes were found to be required

for early embryogenesis (Sonnichsen et al. 2005 ) . The availability of different cell

lines as well as dsRNA libraries and the relative ease with which cells take up exog-

enous dsRNA make Drosophila ideal for cell-based HT RNAi screens (Boutros et al.

2004 ; Wheeler et al. 2004 ; Echeverri and Perrimon 2006 ) . High throughput

Drosophila cell-based loss-of-function screens have identi ﬁ ed genes involved in cell-

cycle progression (Bjorklund et al. 2006 ) , morphology (Kiger et al. 2003 ) , cardiac

and nervous system development (Kim et al. 2004 ; Ivanov et al. 2004 ) and signaling

pathways (DasGupta et al. 2005 ; Muller et al. 2005 ) .

6 Synthetic Lethal Interactions and Cancer Progression

Cancer arises from the consecutive acquisition of genetic alterations that produce the

loss of function or transcriptional down-regulation of tumor suppressor genes and the

activation or transcriptional up-regulation of oncogenes (Hernandez et al. 2007 ;

Hanahan and Weinberg 2000 ) . Downstream of the genetic alterations in tumor cells

the expression pattern changes in many genes, which leads to abnormal regulation of

biological processes such as the cell cycle and apoptosis (Green and Evan 2002 ) . The

importance of studying genetic interactions between tumor suppressor genes and

oncogenes was established, that help to understand the mechanisms of tumorigenesis

and metastasis (Ma et al. 2005 ; Xu et al. 2001 ; Takahashi and Ewen 2006 ) . The

genetic alterations that contribute to the tumorigenesis could be used to target cancer

cells according to the concept of synthetic lethality. Under this hypothesis the genetic

alteration can be identi ﬁ ed by examining the pro ﬁ les of somatic mutations, genomic

alterations or gene expression changes in large series of tumors that can be utilized

for the genetic interactions mapping. This genetic interaction mapping may illumi-

nate the mechanisms of tumorigenesis with insights into prognosis.

In cases where a substantial knowledge of a particular process exists, as in DNA

damage repair, checkpoint pathways, some of these synthetic lethal interactions can

be predicted without the need for extensive screening ( Bryant et al. 2005 ; Farmer

et al. 2005 ) . High-throughput screening can also be very useful in identifying more

complex and unpredictable interactions. Synthetic lethal targeting of cancer cells

could be therapeutically advantageous for targeting the cancer cells because only

the cancer cells with a speci ﬁ c genetic mutation are killed. Cells without the cancer-

inducing genotype are unaffected by such targeting. Exploiting synthetic lethality

therefore increases selectivity towards killing only tumor cells. The tumor growth in

many cases is driven by loss-of-function mutations in tumor suppressor genes.

However restoring the function of tumor suppressor genes by gene therapy is not

suf ﬁ cient for their normal function (Harris and Hollstein 1993 ; Olivier et al. 2009 ;

Liu et al. 2008 ) . In such cases the identi ﬁ cation of synthetic lethal drugs and path-

ways could enable the exploitation of these gene mutations for selective targeting.

The synthetic lethality approach can also be used in combination with cytotoxic

419

16 Synthetic Lethal Genetic Interaction Networks and Their Utility…

chemotherapy and/or radiotherapy, or in patients with relapsed disease (Tutt et al.

2010 ; Audeh et al. 2010 ) . Moreover, the synthetic lethality could target a range of

temporal mutations that occur from tumorigenesis to metastatic dissemination.

7 Screening for Mammalian Synthetic Lethality

The concept of using the synthetic lethal screen to identify new anti cancer drugs was

ﬂ oated by Hartwell et al. 1997 . One of the limiting steps for drug discovery was the

identi ﬁ cation of tumor-selective characteristics; they suggested that loss-of-function

mutations – such as those found in DNA repair genes or tumor suppressor genes- could

be exploited. The idea was based on that, the ﬁ rst mutation could be a cancer-driving

defect and highly conserved evolutionarily from model organisms to humans. The sec-

ond mutation can be identi ﬁ ed by a genome wide synthetic lethal interaction screening

in yeast that can make the double mutant unable to grow. Hartwell et al. performed a

small-scale screen of a panel of 70 different isogenic strains from budding yeast with

deletions in DNA damage response genes against US Food and Drug Administration

(FDA)-approved chemotherapies. The rationale was that the genetic instability which

is a common feature of many tumors can make tumor cells more sensitive to the effects

of some drugs than normal cells. This led to the identi ﬁ cation of two putative anticancer

agents: cisplatin and mitoxantrone. Cisplatin demonstrated increased speci ﬁ city for

yeast strains that were defective in post-replication repair, whereas mitoxantrone, a

topoisomerase II poison resulted in increased sensitivity of yeast strains that were

defective in double stranded DNA break repair. The applicability of synthetic lethal

interaction studies in the context of mammalian cells is now more fully recognized and

technological advances have been made to identify the synthetic lethal interaction

genes in mammalian setting. The libraries of siRNAs and small molecules enable us to

identify speci ﬁ c mutations on a genome-wide scale in mammalian cells. The screening

of RNA interference (RNAi)-based libraries can identify genes that are important in a

pathway context and thus provide a better understanding of the fundamental biology

behind the interactions. In contrast the screening of small-molecule libraries can

through up candidate compounds for the treatment of a given cancer genotype.

8 Conditional Synthetic Lethality Screens for Cancer Therapy

The conditional synthetic lethal screen has demonstrated great potential by using

interactions based on temporary situations to further increase the therapeutic index

and the selectivity for cancer cells. This kind of screening can be developed in

different contexts such as, in response to ionizing radiation, cytotoxic chemo-

therapeutic agents, or changes in the cellular microenvironment. Recently it has

been demonstrated that tumor hypoxia decreases the expression of homologous

420

S. Khan et al.

recombination proteins such as RAD51 (Bindra et al. 2004 ; Chan et al. 2008 ) . Thus

by suppressing the expression of DNA repair proteins, hypoxia conditionally trans-

forms cells into a recombination-de ﬁ cient state and consequently makes them sensi-

tive to poly (ADP-ribose) polymerase (PARP) inhibitors (Chan et al.

2010 ) . This

approach represents one example of how conditional synthetic lethal interactions

can potentially be manipulated and exploited for cancer therapy.

Thus the synthetic lethal interactions represent a very promising means of selec-

tively killing tumor cells. Future synthetic lethality screens could also be used to

investigate mechanisms to exploit epigenetic phenomena, the tumor microenviron-

ment and stromal–tumour interactions. Other screens could focus on identifying

genetic interactions to enhance radiotherapy or current cytotoxic chemotherapies.

9 Yeast as a Model System for Viral Pathogenic Studies

The complexity of higher eukaryotic systems makes them dif ﬁ cult systems for

genetics and cell biology studies. Over the years scientists have utilized yeast as a

simpler system for the study of various pathologies including virus proliferation and

testing new drugs against these pathogenic agents. Moreover, the heterologous pro-

tein expression in yeast species has become an important tool in the production of

therapeutic and commercially relevant proteins. The advantage of a yeast-based

expression system is due to the fact that as a eukaryotic microorganism, it can per-

form complex posttranslational protein modi ﬁ cations combined with ease of genetic

manipulation and cell growth (Buckholz and Gleeson 1991 ; Romanos et al. 1992 ;

Smith et al. 1985 ) . The simple yeast system has been utilized to elucidate the func-

tion of individual proteins from important pathogenic viruses such as Hepatitis C

virus, and Epstein-Barr virus (DeMarini et al. 2003 ; Kapoor et al. 2005 ) . Furthermore,

studies of viruses that infect yeast have provided important information to elucidate

the mechanistic aspect of the life cycle of many RNA viruses targeting eukaryotes

and the host factors involved (Wickner 2008 ) . Till now a number of viruses have

been reported to undergo replication in yeast. These include RNA and DNA viruses

that infect plants, insects, mammals, and humans (Angeletti et al. 2002 ; Panavas

and Nagy 2003 ; Pantaleo et al. 2003 ; Raghavan et al. 2004 ; Zhao and Frazer 2002 ;

Price et al. 2005 ) . There are numerous ways one can utilize yeast as a model system

for viral pathogenic studies.

10 AIDS Viral Protein Expression and its Effect

in Yeast Cells

The yeast two-hybrid system has been extensively used to identify and characterize

the potential interacting partner(s) of a given protein (Fields and Song 1989 ; Luban

and Goff 1995 ; Hamdi and Colas 2012 ) . In this method the interaction between a

421

16 Synthetic Lethal Genetic Interaction Networks and Their Utility…

protein and a protein encoded by the library plasmids leads to transcriptional activation

of a reporter gene. HIV-1 Integrase, which catalyzes the insertion of proviral DNA

into the host cell genome, has been shown to interact with human SFN5, a transcrip-

tion factor and its yeast ortholog. This interaction plays an important role during the

integration step and facilitates the interaction with the host cell chromatin (Kalpana

et al.

1994 ; Rain et al. 2009 ) . It has been observed that the retroviral integrase is unable

to perform its lethal activity in cells having disrupted the SNF5 gene, suggesting

that it might be involved in the lethal effect induced by integrase in yeast cells

(Parissi et al. 2000 ) . The interaction of HIV-1 integrase with microtubules proteins

has also been studied by two hybrid analysis (De Soultrait et al. 2002 ) .

The yeast model has been extremely useful to study many aspects of the integra-

tion step in retroviral replication. The retroviral integrase gene expression in

Saccharomyces cerevisiae yeast cells strongly increased the deleterious effects of

the retroviral enzyme only in absence of the rad52 gene, which is involved in the

repair of double-strand DNA breaks. Genetic experiments suggested that the muta-

genic effect and the level of recombination events were affected in cells expressing

the retroviral enzyme, while expression of the mutated enzyme had no signi ﬁ cant

effect (Parissi et al. 2003 ) . Vpr, another HIV-1 encoded protein plays several roles

in the replication cycle of this retrovirus. A study on ﬁ ssion yeast has suggested that

Vpr plays an important role during the G2 to M transition of the cell cycle (Chang

et al. 2004 ) . It has been reported that the induction of Vpr expression in the ﬁ ssion

yeast Schizosaccharomyces pombe leads to several defects in the assembly and

function of the mitotic spindle. It delocalizes the spindle pole body protein and

affects the actin ring formation that leads to the disruption of cytokinesis (Chang

et al. 2004 ) . Similar defects in mitosis and cytokinesis have also been observed in

human cells suggesting that these defects could be responsible for some of the path-

ological effects associated with HIV-1 infection. Vpr also triggers production of

reactive oxygen species (ROS), indicating that an apoptotic-like mechanism might

be mediated by these reactive species. Recently Vpr suppressor genes have been

identi ﬁ ed that are able to overcome Vpr-induced cell death in ﬁ ssion yeast as well

as arrest Vpr-induced apoptosis in mammalian cells (Huard et al. 2008 ) . The simi-

larity of Vpr-induced cell death in ﬁ ssion yeast with the mammalian apoptotic pro-

cess reinforces the idea that ﬁ ssion yeast may be used as a simple model system to

study the apoptotic-like process induced by Vpr.

11 Interaction Studies of Plant Viruses Using Yeast

as a Model Host

Using yeast as model host for some plant viruses such as bromoviruses and tombus-

viruses has led to the identi ﬁ cation of replication associated factors that affect host

virus interactions and viral pathology (Janda and Ahlquist 1993 ) . The knowledge

gained from such studies will lead to the development of new antiviral methods and

applications in biotechnology. A number of yeast genes have been shown to affect

422

S. Khan et al.

RNA-RNA recombination in tombusviruses. Studies with plant viruses, such as

Brome mosaic virus (BMV), tombusviruses, and geminiviruses, as well as with animal

viruses and in ﬂ uenza virus have shown that certain viruses can complete most of the

steps required for intracellular replication in yeast cells (Naito et al.

2007 ; Panavas

et al. 2005 ; Panavas and Nagy 2003 ; Nagy 2008 ) .

The Y2H assay has also been used to screen cDNA libraries prepared from dif-

ferent plants to identify possible host factors regulating cell-to-cell movement

(Desvoyes et al.

2002 ; Dunoyer et al. 2004 ; Fridborg et al. 2003 ) , RNA encapsida-

tion (Ho ﬁ us et al. 2007 ; Okinaka et al. 2003 ) , and host responses (Schaad et al.

2000 ; Ueda et al. 2006 ) . The development of yeast as a model host facilitated by

systems biology and proteomics approaches has led to the identi ﬁ cation and charac-

terization of host factors involved in RNA virus replication on a genome-wide scale.

Future work based on the combined use of yeast genetics, biochemistry, and cell

biology should help in further dissecting the detailed functions of the host proteins

during virus replication.

12 Expression of E2 Protein in Fission Yeast

Cervical cancer is one of the leading causes of death from cancer among women.

Infection with human papillomavirus (HPV) is associated with cervical cancer.

Different types of HPV are associated with cervical tumor; out of these HPV16 is

the most prevalent in infections (zur Hausen 1991 ) .

Analysis of viral infected tumor cells shows disruption of the E2 gene during

integration suggesting that the loss of E2p is an important step in malignant trans-

formation. E2p regulates viral transcription via binding to palindromic DNA

sequences present in the upstream regulatory region of the viral DNA (Ushikai

et al. 1994 ; Tan et al. 1994 ; Steger and Corbach 1997 ) . It is also required for the

initiation of viral DNA replication (Chiang et al. 1992 ) . The E2 gene product is

also able to inhibit cell cycle progression in HPV negative cells (Frattini et al.

1997 ) . To understand the mechanistic aspect of cell cycle progression, E2p has

been expressed in ﬁ ssion yeast S. pombe and has been shown to inhibit the G2-M

transition by delaying the activation of Cdc2p kinase (Fournier et al. 1999 ) . Thus,

the yeast system provides a simple method for the identi ﬁ cation of novel E2

mutants that may give insights as to how E2p regulates cell division in higher

eukaryotic cells.

13 Conclusions and Perspectives

The synthetic lethal interactions represent a very promising means of selectively

killing tumor cells. The integration of the yeast synthetic-genetic interactions, phys-

ical interactions, mRNA expression pro ﬁ ling and functional genomics data will

423

16 Synthetic Lethal Genetic Interaction Networks and Their Utility…

enable us to generate important framework for understanding human biology and

disease. Future synthetic lethality screens could also be used to investigate mecha-

nisms to exploit epigenetic phenomena, the tumor microenvironment and stromal–

tumour interactions. Other screens could focus on identifying genetic interactions to

enhance radiotherapy or current cytotoxic chemotherapies. Moreover, future work

should lead to the discovery of new cellular factors involved in virus proliferation.

Yeast can also be used to obtain recombinant viral protein to determine 3D structure

as well as for high-resolution imaging. Proteomics approaches should also help us

to identify various posttranslational modi ﬁ cations of viral and host proteins that

could affect their functions during the pathogenesis. The detailed results generated

using yeast model system can also be applied to dissect the interactions between

plant viruses and their native plant hosts that will lead to better understanding of

viral pathogenesis.

References

Angeletti P, Kim K, Fernandes F, Lambert P (2002) Stable replication of papillomavirus genomes

in Saccharomyces cerevisiae . J Virol 76(7):3350–3358

Ashra ﬁ K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003) Genome-

wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421:268–272

Audeh MW, Carmichael J, Penson RT, Friedlander M, Powell B, Bell-McGuinn KM, Scott C,

Weitzel JN, Oaknin A, Loman N, Lu K, Schmutzler RK, Matulonis U, Wickens M, Tutt A

(2010) Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2

mutations and recurrent ovarian cancer: a proof-of-concept trial. Lancet 376:245–251

Avery L, Wasserman S (1992) Ordering gene function: the interpretation of epistasis in regulatory

hierarchies. Trends Genet 8(9):312–316

Berns K, Hijmans EM, Mullenders J, Brummelkamp TR, Velds A, Heimerikx M, Kerkhoven RM,

Madiredjo M, Nijkamp W, Weigelt B, Agami R, Ge W, Cavet G, Linsley PS, Beijersbergen RL,

Bernards R (2004) A large-scale RNAi screen in human cells identi ﬁ es new components of the

p53 pathway. Nature 428:431–437

Bindra RS, Schaffer PJ, Meng A, Woo J, Måseide K, Roth ME, Lizardi P, Hedley DW, Bristow RG,

Glazer PM (2004) Down-regulation of Rad51 and decreased homologous recombination in

hypoxic cancer cells. Mol Cell Biol 24:8504–8518

Bjorklund M, Taipale M, Varjosalo M, Saharinen J, Lahdenpera J, Taipale J (2006) Identi ﬁ cation

of pathways regulating cell size and cell-cycle progression by RNAi. Nature 439:1009–1013

Boutros M, Kiger AA, Armknecht S, Kerr K, Hild M, Koch B, Haas SA, Consortium HF, Paro R,

Perrimon N (2004) Genome-wide RNAi analysis of growth and viability in Drosophila cells.

Science 303:832–835

Brown JA, Sherlock G, Myers CL, Burrows NM, Deng C, Wu HI, McCann KE, Troyanskaya OG,

Brown JM (2006) Global analysis of gene function in yeast by quantitative phenotypic pro ﬁ ling.

Mol Syst Biol 2:2006.0001

Bryant HE, Schultz N, Thomas HD, Parker KM, Flower D, Lopez E, Kyle S, Meuth M, Curtin NJ,

Helleday T (2005) Speci ﬁ c killing of BRCA2-de ﬁ cient tumors with inhibitors of poly(ADP-

ribose) polymerase. Nature 434:913–917

Buckholz R, Gleeson M (1991) Yeast systems for the commercial production of heterologous

proteins. Biotechnology 9:1067–1072

Chan N, Koritzinsky M, Zhao H, Bindra R, Glazer PM, Powell S, Belmaaza A, Wouters B, Bristow

RG (2008) Chronic hypoxia decreases synthesis of homologous recombination proteins to off-

set chemoresistance and radioresistance. Cancer Res 68:605–614

424

S. Khan et al.

Chan N, Pires IM, Bencokova Z, Coackley C, Luoto KR, Bhogal N, Lakshman M, Gottipati P,

Oliver FJ, Helleday T, Hammond EM, Bristow RG (2010) Contextual synthetic lethality of

cancer cell kill based on the tumor microenvironment. Cancer Res 70:8045–8054

Chang F, Sebastian F, Sazer S, Luban J (2004) HIV-1 Vpr induces defects in mitosis, cytokinesis,

nuclear structure, and centrosomes. Mol Biol Cell 15(4):1793–1801

Chiang CM, Ustav M, Stenlund A, Ho T, Broker TR, Chow LT (1992) Viral E1 and E2 proteins

support replication of homologous and heterologous papillomaviral origins. Proc Natl Acad

Sci USA 89:5799–5803

DasGupta R, Kaykas A, Moon RT, Perrimon N (2005) Functional genomic analysis of the Wnt-

wingless signaling pathway. Science 308:826–833

Davierwala AP, Haynes J, Li Z, Brost RL, Robinson MD, Yu L, Mnaimneh S, Ding H, Zhu H, Chen

Y, Cheng X, Brown GW, Boone C, Andrews BJ, Hughes TR (2005) The synthetic genetic

interaction spectrum of essential genes. Nat Genet 37(10):1147–1152

De Soultrait V, Caumont A, Parissi V, Morellet N, Ventura M, Lenoir C, Litvak S, Fournier M,

Roques B (2002) A novel short peptide is a speci ﬁ c inhibitor of the human immunode ﬁ ciency

virus type 1 integrase. J Mol Biol 318:45–58

DeMarini D, Johnston V, Konduri M, Gutshall L, Sarisky R (2003) Intracellular hepatitis C virus

RNA-dependent RNA polymerase activity. J Virol Methods 113:65–68

Desvoyes B, Faure-Rabasse S, Chen MH, Park JW, Scholthof HB (2002) A novel plant homeodo-

main protein interacts in a functionally relevant manner with a virus movement protein. Plant

Physiol 129:1521–1532

Deutschbauer A, Williams RM, Chu AM, Davis RW (2002) Parallel phenotypic analysis of sporu-

lation and postgermination growth in Saccharomyces cerevisiae . Proc Natl Acad Sci USA

99:15530–15535

Dunoyer P, Thomas C, Harrison S, Revers F, Maule A (2004) A cysteine-rich plant protein potenti-

ates potyvirus movement through an interaction with the virus genome-linked protein VPg.

J Virol 78:2301–2309

Echeverri CJ, Perrimon N (2006) High-throughput RNAi screening in cultured cells: a user’s

guide. Nat Rev Genet 7:373–384

Enyenihi AH, Saunders WS (2003) Large-scale functional genomic analysis of sporulation and

meiosis in Saccharomyces cerevisiae . Genetics 163:47–54

Farmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, Santarosa M, Dillon KJ,

Hickson I, Knights C, Martin NM, Jackson SP, Smith GC, Ashworth A (2005) Targeting the

DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434:917–921

Fields S, Song O (1989) A novel genetic system to detect protein-protein interactions. Nature

340:245–246

Forsburg SL (2001) The art and design of genetic screens: yeast. Nat Rev Genet 2:659–666

Fournier N, Raj K, Saudan R, Utzig S, Sahli R, Simanis V, Beard P (1999) Expression of human

papillomavirus 16 E2 protein in Schizosaccharomyces pombe delays the initiation of mitosis.

Oncogene 18(27):4015–4021

Frand AR, Russel S, Ruvkun G (2005) Functional genomic analysis of C. Elegans molting. PLoS

Biol 3:e312

Frattini MG, Hurst SD, Lim HB, Swaminathan S, Laimins LA (1997) Abrogation of a mitotic

checkpoint by E2 proteins from oncogenic human papillomaviruses correlates with increased

turnover of the p53 tumor suppressor protein. EMBO J 16:318–331

Fridborg I, Grainger J, Page A, Coleman M, Findlay K, Angell S (2003) TIP, a novel host factor

linking callose degradation with the cell-to-cell movement of Potato virus X. Mol Plant Microbe

Interact 16:132–140

Giaever G, Chu AM, Ni L, Connelly C, Riles L, Veronneau S, Dow S, Lucau-Danila A, Anderson

K, Andre B et al (2002) Functional pro ﬁ ling of the Saccharomyces cerevisiae genome. Nature

418:387–391

Green DR, Evan GI (2002) A matter of life and death. Cancer Cell 1(1):19–30

Hamdi A, Colas P (2012) Yeast two hybrid methods and their applications in drug discovery.

Trends Pharmacol Sci 33(2):109–118

425

16 Synthetic Lethal Genetic Interaction Networks and Their Utility…

Hanahan D, Weinberg RA (2000) The hallmarks of cancer. Cell 100(1):57–70

Harris CC, Hollstein M (1993) Clinical implications of the p53 tumor-suppressor gene. N Engl J

Med 329:1318–1327

Hartman J, Gravik B, Hartwell L (2001) Principles for the buffering of genetic variation. Science

291:1001–1004

Hartwell L (2004) Genetics. Robust interactions. Science 303:774–775

Hartwell LH, Szankasi P, Roberts CJ, Murray AW, Friend SH (1997) Integrating genetic approaches

into the discovery of anticancer drugs. Science 278:1064–1068

Henchoz S, Chi Y, Catarin B, Herskowitz I, Deshaies RJ, Peter M (1997) Phosphorylation and

ubiquitin-dependent degradation of the cyclin-dependent kinase inhibitor Far1p in budding

yeast. Genes Dev 11:3046–3060

Hernandez P, Huerta-Cepas J, Montaner D, Al-Shahrour F, Valls J, Gomez L, Capella G, Dopazo

J, Pujana MA (2007) Evidence for systems level molecular mechanisms of tumorigenesis.

BMC Genomics 8:185

Ho ﬁ us D, Maier AT, Dietrich C, Jungkunz I, Bornke F, Maiss E, Sonnewald U (2007) Capsid

protein-mediated recruitment of host DnaJ-like proteins is required for Potato virus Y infection

in tobacco plants. J Virol 81:11870–11880

Huang ME, Rio AG, Nicolas A, Kolodner RD (2003) A genome wide screen in Saccharomyces

cerevisiae for genes that suppress the accumulation of mutations. Proc Natl Acad Sci USA

100:11529–11534

Huard S, Chen M, Burdette K, Fenyvuesvolgyi C, Yu M, Elder RT, Zhao RY (2008) HIV-1 Vpr-

induced cell death in Schizosaccharomyces pombe is reminiscent of apoptosis. Cell Res

18(9):961–973

Hughes TR, Marton MJ, Jones AR, Robert CJ, Stoughton R, Armour CD, Bennett HA, Coffey E,

Dai H, He YD, Kidd MJ, King AM, Meyer MR, Slade D, Lum PY, Stepaniants SB, Shoemaker

DD, Gachotte D, Chakraburtty K, Simon J, Bard M, Friend SH (2000) Functional discovery via

a compendium of expression pro ﬁ les. Cell 102:109–126

Imiger S, Piatti S, Michaelis C, Nasmyth K (1995) Genes involved in sister chromatid separation

are needed for B-type cyclin proteolysis in budding yeast. Cell 81(2):269–278

Ivanov AI, Rovescalli AC, Pozzi P, Yoo S, Mozer B, Li HP, Yu SH, Higashida H, Guo V, Spencer

M, Nirenberg M (2004) Genes required for Drosophila nervous system development identi ﬁ ed

by RNA interference. Proc Natl Acad Sci USA 101:16216–16221

Janda M, Ahlquist P (1993) RNA-dependent replication, transcription, and persistence of brome

mosaic virus RNA replicons in S. Cerevisiae . Cell 72:961–970

Jeffares DC, Penkett CJ, Bahler J (2008) Rapidly regulated genes are intron poor. Trends Genet

24:375–378

Kalpana G, Marmon S, Wang W, Crabtree G, Goff S (1994) Binding and stimulation of HIV-1

integrase by a human homolog of yeast transcription factor SNF5. Science

266(5193):2002–2006

Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, Kanapin A, Le Bot N, Moreno S,

Sohrmann M, Welchman DP, Zipperlen P, Ahringer J (2003) Systematic functional analysis of

the Caenorhabditis elegans genome using RNAi. Nature 421:231–237

Kapoor P, Lavoie B, Frappier L (2005) EBP2 plays a key role in Epstein-Barr virus mitotic segre-

gation and is regulated by aurora family kinases. Mol Cell Biol 25(12):4934–4945

Kiger AA, Baum B, Jones S, Jones MR, Coulson A, Echeverri C, Perrimon N (2003) A functional

genomic analysis of cell morphology using RNA interference. J Biol 2:27

Kim YO, Park SJ, Balaban RS, Nirenberg M, Kim Y (2004) A functional genomic screen for car-

diogenic genes using RNA interference in developing Drosophila embryos. Proc Natl Acad Sci

USA 101:159–164

Kim D, Hayles J, Kim D, Wood V, Park H, Won M, Yoo HS, Duhig T, Nam M et al (2010) Analysis

of a genome-wide set of gene deletions in the ﬁ ssion yeast Schizosaccharomyces pombe . Nat

Biotechnol 28(6):617–623

Kroll ES, Hyland KM, Hieter P, Li JJ (1996) Establishing genetic interactions by a synthetic dosage

lethality phenotype. Genetics 143:95–102

426

S. Khan et al.

Lee SS, Lee RY, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003) A systematic RNAi screen

identi ﬁ es a critical role for mitochondria in C. Elegans longevity. Nat Genet 33:40–48

Liu TC, Hwang TH, Bell JC, Kirn DH (2008) Translation of targeted oncolytic virotherapeutics

from the lab into the clinic, and back again: a high-value iterative loop. Mol Ther

16:1006–1008

Luban J, Goff S (1995) The yeast two-hybrid system for studying protein-protein interactions.

Curr Opin Biotechnol 6(1):59–64

Ma L, Teruya-Feldstein J, Behrendt N, Chen Z, Noda T, Hino O, Cordon-Cardo C, Pandol ﬁ PP

(2005) Genetic analysis of Pten and Tsc2 functional interactions in the mouse reveals asym-

metrical haploinsuf ﬁ ciency in tumor suppression. Genes Dev 19(15):1779–1786

Marston AL, Tham WH, Shah H, Amon A (2004) A genome-wide screen identi ﬁ es genes required

for centromeric cohesion. Science 303:1367–1370

Measday V, Hieter P (2002) Synthetic dosage lethality. Methods Enzymol 350:316–326

Measday V, Baetz K, Guzzo J, Yuen K, Kwok T, Sheikh B, Ding H, Ueta R, Hoac T, Cheng B, Pot

I, Tong A, Yamaguchi-Iwai Y, Boone C, Hieter P, Andrews B (2005) Systematic yeast synthetic

lethal and synthetic dosage lethal screens identify genes required for chromosome segregation.

Proc Natl Acad Sci USA 102:13956–13961

Moffat J, Sabatini DM (2006) Building mammalian signalling pathways with RNAi screens. Nat

Rev Mol Cell Biol 7:177–187

Moffat J, Grueneberg DA, Yang X, Kim SY, Kloepfer AM, Hinkle G, Piqani B, Eisenhaure TM,

Luo B, Grenier JK, Carpenter AE, Foo SY, Stewart SA, Stockwell BR, Hacohen N, Hahn WC,

Lander ES, Sabatini DM, Root DE (2006) A lentiviral RNAi library for human and mouse

genes applied to an arrayed viral high-content screen. Cell 124:1283–1298

Muller P, Kuttenkeuler D, Gesellchen V, Zeidler MP, Boutros M (2005) Identi ﬁ cation of JAK/

STAT signalling components by genome-wide RNA interference. Nature 436:871–875

Nagy PD (2008) Yeast as a model host to explore plant virus-host interactions. Annu Rev

Phytopathol 46:217–242

Naito T, Kiyasu Y, Sugiyama K, Kimura A, Nakano R, Matsukage A, Nagata K (2007) An in ﬂ uenza

virus replicon system in yeast identi ﬁ ed Tat-SF1 as a stimulatory host factor for viral RNA

synthesis. Proc Natl Acad Sci USA 104:18235–18240

Okinaka Y, Mise K, Okuno T, Furusawa I (2003) Characterization of a novel barley protein, HCP1,

that interacts with the Brome mosaic virus coat protein. Mol Plant Microbe Interact

16:352–359

Olivier M, Petitjean M, Marcel V, Petre A, Mounawar M, Plymoth A, deFromentel CC, Hainaut P

(2009) Recent advances in p53 research: an interdisciplinary perspective. Cancer Gene Ther

16:1–12

Panavas T, Nagy PD (2003) Yeast as a model host to study replication and recombination of defec-

tive interfering RNA of Tomato bushy stunt virus. Virology 314:315–325

Panavas T, Hawkins CM, Panaviene Z, Nagy PD (2005) The role of the p33:p33/p92 interaction

domain in RNA replication and intracellular localization of p33 and p92 proteins of Cucumber

necrosis tombusvirus. Virology 338:81–95

Pantaleo V, Rubino L, Russo M (2003) Replication of Carnation Italian ringspot virus defective

interfering RNA in Saccharomyces cerevisiae . J Virol 77(3):2116–2123

Parissi V, Caumont A, De Soultrait V, Dupont C, Pichuantes S, Litvak S (2000) Inactivation of the

SNF5 transcription factor gene abolishes the lethal phenotype induced by the expression of

HIV-1 integrase in yeast. Gene 247:129–136

Parissi V, Caumont A, De Soultrait VR, Desjobert C, Calmels C, Fournier M, Gourgue G, Bonneu

M, Tarrago-Litvak L, Litvak S (2003) The lethal phenotype observed after HIV-1 integrase

expression in yeast cells is related to DNA repair and recombination events. Gene

322:157–168

Pothof J, van Haaften G, Thijssen K, Kamath R, Fraser A, Ahringer J, Plasterk R, Tijsterman M

(2003) Identi ﬁ cation of genes that protect the C. Elegans genome against mutations by genome-

wide RNAi. Genes Dev 17:443–448

Powers R, Kaeberlein M, Caldwell S, Kennedy B, Fields S (2006) Extension of chronological life

span in yeast by decreased TOR signaling. Genes Dev 20:174–184

427

16 Synthetic Lethal Genetic Interaction Networks and Their Utility…

Price B, Eckerle L, Ball L, Johnson K (2005) Nodamura virus RNA replication in Saccharomyces

cerevisiae : heterologous gene expression allows replication-dependent colony formation. J Virol

79(1):495–502

Raghavan V, Malik P, Choudhury N, Mukherjee S (2004) The DNA-A component of a plant gemi-

nivirus (Indian Mungbean yellow mosaic virus) replicates in budding yeast cells. J Virol

78(5):2405–2413

Rain J, Cribier A, G´erard A, Emiliani S, Benarous R (2009) Yeast two-hybrid detection of inte-

grase-host factor interactions. Methods 47(4):291–297

Romanos M, Scorer C, Clare J (1992) Foreign protein expression in yeast: a review. Yeast

8:423–488

Schaad MC, Anderberg RJ, Carrington JC (2000) Strain-speci ﬁ c interaction of the tobacco etch

virus NIa protein with the translation initiation factor eIF4E in the yeast two-hybrid system.

Virology 273:300–306

Scherens B, Goffeau A (2004) The uses of genome-wide yeast mutant collections. Genome Biol

5:229

Silva J, Li M, Chang K, Ge W, Golding M, Rickles RJ, Siolas D, Hu G, Paddison PJ, Schlabach

MR et al (2005) Second-generation shRNA libraries covering the mouse and human genomes.

Nat Genet 37:1281–1288

Smith R, Duncan M, Moir D (1985) Heterologous protein secretion from yeast. Science

229:1219–1224

Sonnichsen B, Koski LB, Walsh A, Marschall P, Neumann B, Brehm M, Alleaume AM, Artelt J,

Bettencourt P, Cassin E et al (2005) Full-genome RNAi pro ﬁ ling of early embryogenesis in

Caenorhabditis elegans . Nature 434:462–469

Sopko R, Huang D, Preston N, Chua G, Papp B, Kafadar K, Snyder M, Oliver SG, Cyert M,

Hughes TR, Boone C, Andrews B (2006) Mapping pathways and phenotypes by systematic

gene overexpression. Mol Cell 21:319–330

Steger G, Corbach S (1997) Dose-dependent regulation of the early promoter of human papilloma-

virus type 18 by the viral E2 protein. J Virol 71:50–58

Suter B, Auerbach D, Stagljar I (2006) Yeast-based functional genomics and proteomics technolo-

gies: the ﬁ rst 15 years and beyond. Biotechniques 40:625–644

Takahashi C, Ewen ME (2006) Genetic interaction between Rb and Nras: differentiation control

and metastasis. Cancer Res 66:9345–9348

Tamble C, St Onge R, Giaever G, Nislow C, Williams A, Stuart J, Lokey R (2011) The synthetic

genetic interaction network reveals small molecules that target speci ﬁ c pathways in

Sacchromyces cerevisiae . Mol Biosyst 7:2019–2030

Tan S-H, Leong LE-C, Walker PA, Bernard H-U (1994) The human papillomavirus type 16 E2

transcription factor binds with low cooperativity to two ﬂ anking sites and represses the E6

promoter through displacement of Sp1 and TFIID. J Virol 68:6411–6420

Tong AH, Evangelista M, Parsons AB, Xu H, Bader GD, Page N, Robinson M, Raghibizadeh S,

Hogue CW, Bussey H, Andrews B, Tyers M, Boone C (2001) Systematic genetic analysis with

ordered arrays of yeast deletion mutants. Science 294:2364–2368

Tong AH, Lesage G, Bader GD, Ding H, Xu H, Xin X, Young J, Berriz GF, Brost RL, Chang M,

Chen Y, Cheng X, Chua G, Friesen H et al (2004) Global mapping of the yeast genetic interac-

tion network. Science 303:808–813

Tutt A, Robson M, Garber JE, Domchek SM, Audeh MW, Weitzel JN, Friedlander M, Arun B,

Loman N, Schmutzler RK, Wardley A, Mitchell G, Earl H, Wickens M, Carmichael J (2010)

Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2

mutations and advanced breast cancer: a proof-of-concept trial. Lancet 376:235–244

Ueda H, Yamaguchi Y, Sano H (2006) Direct interaction between the Tobacco mosaic virus heli-

case domain and the ATP-bound resistance protein, N factor during the hypersensitive response

in tobacco plants. Plant Mol Biol 61:31–45

Ushikai M, Lace MJ, Wa YY, Kono M, Anson J, Ishiji T, Parkkinen S, Wicker N, Valentine M-E,

Davidson I, Turek LP, Haugen TH (1994) Transactivation by the full length E2 proteins of

human papillomavirus type 16 and bovine papillomavirus type 1 in vitro and in vivo: cooperation

with activation domains of cellular transcription factors. J Virol 68:6655–6666

428

S. Khan et al.

Vastenhouw NL, Fischer SE, Robert VJ, Thijssen KL, Fraser AG, Kamath RS, Ahringer J, Plasterk

RH (2003) A genome-wide screen identi ﬁ es 27 genes involved in transposon silencing in C.

Elegans . Curr Biol 13:1311–1316

Wheeler DB, Bailey SN, Guertin DA, Carpenter AE, Higgins CO, Sabatini DM (2004) RNAi

living-cell microarrays for loss-of-function screens in Drosophila melanogaster cells. Nat

Methods 1:127–132

Wickner R (2008) The yeast dsRNA virus L-A resembles mammalian dsRNA virus cores.

In: Patton JT (ed) Segmented double-stranded RNA viruses: structure and molecular biology.

Caister Academic Press Norfolk, UK

Xu X, Qiao W, Linke SP, Cao L, Li W, Furth P, Harris CC, Deng C (2001) Genetic interactions

between tumor suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigenesis. Nat

Genet 28(3):266–271

Yadav S, Verma SK, Ahmed S (2011) DNA topoisomerase II mutant activates DNA damage check-

point protein kinase Chk1 in ﬁ ssion yeast S. Pombe . Genet Res 93(4):275–283

Zhao K, Frazer I (2002) Saccharomyces cerevisiae is permissive for replication of bovine papil-

lomavirus type 1. J Virol 76(23):12265–12273

zur Hausen H (1991) Human papillomaviruses in the pathogenesis of anogenital cancer. Virology

184:9–13

429

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

Abstract One of the most important attributes of microorganisms is their ability to

biologically adapt to every environment on earth. Microorganisms possess sophisti-

cated signaling systems that enable them to sense and respond to environmental

changes and challenges. Typically, this response results in morphological, physio-

logical and even genetic differentiations. The genetic information associated with a

microbe is capable of alterations which are sometimes reversible, and disappearing

when the particular pressure is lifted. Other alterations are maintained and can even

be passed on to succeeding generations of bacteria. This fact may well indicate that

the structure can be modi ﬁ ed to maintain function under environmental stress.

Candida albicans , commonly found as a component of the normal ﬂ ora of humans,

residing in the gastrointestinal tract, in the genitourinary tract and on the skin, is the

most common opportunistic human pathogen. The yeast is a harmless commensal

in most healthy people, but it causes super ﬁ cial as well as life-threatening systemic

infections in immunocompromised patients. The ability of C. albicans to be virulent

depends completely on its yeast-to-hyphae switch where the organism changes from

a unicellular yeast form to a multicellular hyphal form. This switch may likely be

induced by environmental conditions like temperature, pH and nutrients. This chapter

presents the regulatory adaptation mechanisms that make C. albicans the most

successful fungal pathogen of humans.

Keywords Candida albicans • Adaptation mechanisms • Environmental stress

Z. Zakaria (*) • B. R. M. A. Arra • S. Ganeshan

Biology Programme, School of Distance Education ,

Universiti Sains Malaysia , 11800 Minden , Penang , Malaysia

e-mail: zuraini@usm.my

Chapter 17

Adaptation of Candida albicans

for Growth Within the Host

Zuraini Zakaria , Basma Rajeh Mohammad Abu Arra ,

and Sumathi Ganeshan

430

Z. Zakaria et al.

1 Introduction

The ability of microorganisms to sense and adapt to changes in the external environment

is essential for their survival. This adaptation to environmental conditions is particularly

important for the survival of fungal species growing with a close association with

host organisms, such as pathogens, symbionts or commensals (Vylkova et al.

2011 ) .

Accordingly, the yeast Candida albicans is both a harmless commensal and an

aggressive pathogen (Wächtler et al. 2011 ) . Since C. albicans lacks any typical

environmental habitat, their cells generally adapt to diverse environmental condi-

tions, each with its own speci ﬁ c set of environmental pressures, with ease within

very short time periods. Candida albicans has even adapted to grow in association

with the human host whereby the human immune system has allowed it.

The fungus is found as a commensal in most healthy individuals. As commen-

sals, Candida species are harmless and the population is colonized with C. albicans

without any signs of diseases. However, if the balance of the normal ﬂ ora is dis-

rupted or the immune defenses are compromised, C. albicans frequently outgrows

the microbial ﬂ ora and causes symptoms of diseases (Mavor et al. 2005 ) . Therefore,

C. albicans is able to switch between being a commensal and a pathogen (Rupp

2007 ; Schulze and Sonnenborn 2009 ) . However, the cause of transition from a

harmless commensal to an aggressive pathogen (Wächtler et al. 2011 ) , and the sta-

ble maintenance between commensalism and pathogenicity is still not known (Sohn

et al. 2006 ; Rupp 2007 ) . Nevertheless, by using the host as an environment, C. albi-

cans has got to not only develop mechanisms to colonize and invade into the host,

but also need to possess particular attributes to persist in the host in large numbers

without causing any damages. Undoubtedly, both host and microbial factors are

required to maintain the balance from commensalisms to host damage and vice

versa (Rupp 2007 ) .

Thus, this chapter focuses on the recently identi ﬁ ed systems for adaptation of

C. albicans during colonization and infection of their human host and the role of

these systems in the fungal survival and virulence.

2 Epidemiology

Humans harbor C. albicans during or shortly after birth wherein it almost immediately

colonizes the newborn and becomes a commensal (Khan and Gyanchandani 1998 ;

Calderone and Fonzi 2001 ; Khan et al. 2010 ) . The growth of the yeast is kept under

control by the infant’s immune system and thus produces no signs of diseases.

Accordingly, it is presumed that by 6 months of age, 90% of all babies are colonized

by C. albicans . By adulthood, almost all humans become involved in a life-long

relationship and play host to C. albicans . Since C. albicans is part of the normal

ﬂ ora, it is normal for all humans to have controlled quantities of the organism.

Candida albicans being the most common commensal fungi in healthy individuals

(Pinto et al. 2008 ) , rarely causes diseases in immunocompetent hosts (Khan et al. 2010 ) .

431

17 Adaptation of Candida albicans for Growth Within the Host

The fungi are normally found as commensals in the human oral cavity, gastrointestinal

tract, genitourinary tract, diseased skin and mucosal membranes (Baron et al. 1994 ;

Forche et al. 2011 ) . As commensals, C. albicans competes with other microbes for

nutrition in different body sites and adapts to different host conditions like tem-

perature, pH and nutrients within the host (Calderone

2002 ) . Moreover, the physi-

cal barriers such as epithelial layers and a functional immune system maintain the

commensal phase of C. albicans in the host (Wächtler et al.

2011 ) . Therefore, com-

mensally growing C. albicans are controlled by the normal microbial ﬂ ora and the

immune response of the host (Mavor et al. 2005 ) .

In order to survive in a niche, a fungus has to adapt to constantly changing param-

eters wherein C. albicans has been found to respond to these environmental changes

by inducing transcriptional and translational changes for adaptation in the new

environmental conditions (Khan et al. 2010 ) . Success of survival also depends on

rapid adaptations to changing micro-environments and likewise, as C. albicans

enters the human host, their lifestyle changes from harmless commensals to oppor-

tunistic pathogens. Opportunistic pathogens, when given the opportunity, will

attempt to colonize all bodily tissues. Thereby, under conditions of weakened immunity

(people with Acquired Immunode ﬁ ciency Syndrome (AIDS), leukemia or cancer) or

imbalance in the commensal ﬂ ora, C. albicans becomes an opportunistic pathogen

and causes diseases ranging from mild super ﬁ cial infections (such as oral thrush and

vaginitis) to severe, life-threatening bloodstream infections (such as disseminated

candidiasis) (Forche et al. 2011 ) . Candida albicans takes the advantage of certain

predisposing events to cause diseases (Baron et al. 1994 ) . These different candidal

infections therefore involve adaptation of C. albicans to different host environmental

niches and growth conditions (Forche et al. 2011 ).

3 Mycology

Candida albicans is an asexual oval-shaped diploid fungus of the Ascomycetes.

A number of such fungi are causal agents of opportunistic infections in humans

(Baron et al. 1994 ) . Some species show phenotypic switching, a variant colony mor-

phology (Khan et al. 2010 ) . They grow both as yeast and ﬁ lamentous cells on various

mucosal surfaces of the body, including the oral cavity, gastrointestinal tract and

vaginal mucosa. The predominant asexual reproductive unit of the yeast is a blasto-

conidium (Baron et al. 1994 ) .

3.1 Candida albicans Strain Variation

Candida albicans infection in the majority of cases is a patient’s own commensal

ﬂ ora. Evidence suggests many individuals harbor a mixture of strain types of minor

variants, typically differing in levels of genetic heterozygosity (Odds 2010 ) . As such,

432

Z. Zakaria et al.

more than one distinctly different C. albicans strain type may be found in a small

proportion of individuals in a single sample from a single anatomical site (Jacobsen

et al. 2008 ) , and in longitudinal samples from the same site or different anatomical

sites (Odds et al.

2006a ; Bougnoux et al. 2006 ) . These interstrain differences may

indicate strain replacement (Bartie et al. 2001 ) . However, strain replacements are

much less common than a single type with minor variations (Odds 2010 ) . This sin-

gle C. albicans strain type with minor variations may suggest microadaptations of

C. albicans on the host.

3.2 Organism Characteristics

3.2.1 General Characteristics

An unusual feature of C. albicans is its ability to grow either as an unicellular bud-

ding yeast or in ﬁ lamentous pseudohyphal and hyphal forms (Odds 1988 ; Sudbery

et al. 2004 ) . Pseudohyphae are morphologically distinguishable from the hyphae

form whereby the former have constrictions at the sites of septation and are wider

than the latter. By contrast, hyphae form long tube-like ﬁ laments with completely

parallel sides and no constrictions at the sites of septation (Sudbery 2011 ) .

3.2.2 Cell Wall Structure

The cell wall is crucial for colonization and infection since it de ﬁ nes the interface

between host and pathogen. It is one of the major structures, comprising 15–25%

of the dry weight of the cell of which approximately 80–90% of the cell wall of

C. albicans consists of carbohydrates. Three basic constituents representing the

major components of the cell wall are complex polymers of glucose ( β -1,3- and β -1,6-

glucan), chitin (N-acetylglucosamine) and polymers of mannan (mannoproteins).

The glucans make up 50–60% of the total mass of the cell wall, whereas chitin

constitutes 0.6–2%, and mannan moiety of mannoproteins represents 30–40% of the

cell wall polysaccharides in C. albicans . The rigid structure of complex polymers of

glucose and chitin surrounds the cell like a shield, protects it from environmental

stresses like osmotic pressure and de ﬁ nes the shape and physical strength of the

fungal cell (Sohn et al . 2006 ) . In addition, cell walls contain 6–25% proteins and

minor amounts of 1–7% lipid. However, the protein composition of the cell wall varies

greatly according to the different cell morphologies like the yeast, pseudohyphal and

hyphal form. Also, the expression pattern of cell wall proteins in hyphae varies with

the different stimuli induced. Accordingly, it has been shown that cell surface

proteins determine the adhesion (Rupp 2007 ) , colonization and infection of host

cells and any alterations in the protein composition of the cell wall may result in reduced

virulence of C. albicans (Sohn et al . 2006 ) . This shows that host and pathogen interact

and this interaction is controlled by several signaling systems of C. albicans .

433

17 Adaptation of Candida albicans for Growth Within the Host

4 Candida albicans Infections

Fungal infections also commonly occur in the healthy population. Healthy persons

generally encounter super ﬁ cial infections but immunocompromised patients face inva-

sive infections (Khan et al.

2010 ) . As such, C. albicans has been reported to be the

fourth most common cause of nosocomial infections in the USA and elsewhere in the

world (Wenzel 1995 ) . The ability of C. albicans to adapt and survive at different ana-

tomic sites of the human host has also made them more harmful than other commen-

sals of the human body (Khan et al. 2010 ) . As commensals of the normal ﬂ ora,

C. albicans causes super ﬁ cial infections and epithelial damage when it overgrows the

microbial ﬂ ora (Mavor et al. 2005 ) . However, in severe cases, the fungus penetrates

through epithelial layers into deeper tissues and may cause life-threatening systemic

infections (Wächtler et al. 2011 ) . Infections caused by this pathogen normally include

cutaneous lesions, mucous membranes and systemic disseminated diseases.

4.1 Cutaneous Lesions

Super ﬁ cial Candida infections include intertrigo (warm and moist environment like

skin folds), diaper rash and nail infections. Commensal Candida infections rapidly

colonize damaged skin or skin areas with closely opposing surfaces, such as the

diaper area in infants and toddlers and abdominal fat folds and groin in older indi-

viduals. Candida albicans also causes candidal onchomychosis in the nails or the

area around the nail and such infections produces lesions that resemble those pro-

duced by dermatophytes. Nail infection almost always includes involvement of the

area around the nail leading to club-shaped ﬁ ngers (Baron et al. 1994 ) .

4.2 Mucous Membranes

The ability of C. albicans to live as a commensal on mucosal surfaces of healthy individu-

als often cause super ﬁ cial infections of mucous membranes and may lead to a condition

known as thrush (Baron et al. 1994 ; Mavor et al. 2005 ) . The mucosal surface of the vagina

is a frequent site of Candida infection (vulvovaginitis). Approximately 70% of women

experience vaginal candidiasis once in a life and 20% suffer from recurrence (Baron et al.

1994 ; Fidel et al. 1999 ) , however, the reasons for repeated attacks are not known.

4.3 Systemic Disseminated Disease

The Candida cells which manage to penetrate into deeper tissues cause severe systemic

infections in immunocompromised patients, in children with AIDS and other immune

de ﬁ ciencies, as well as in very low birth weight premature infants. When a person is

434

Z. Zakaria et al.

severely immunocompromised, C. albicans enters the bloodstream and causes infection

of the bloodstream which leads to serious problems, especially in the kidneys, heart,

lungs, eyes, brain and many other organs. Furthermore, in the severely immunocom-

promised host, C. albicans may also cause life-threatening systemic infections.

5 Candida albicans Pathogenesis and Virulence Factors

Although C. albicans is a commensal, the organism is also an important opportunis-

tic pathogen (Rosenbach et al. 2010 ) . Like other fungal pathogens, C. albicans

regulates the expression of certain genes as virulence factors to produce disease.

Some of virulence factors include the ability to recognize and adhere to host tissues,

to respond rapidly to changes in the external environment and to secrete hydrolases

(Khan et al. 2010 ) . Some of the commonly studied virulence factors in C. albicans

are brie ﬂ y described here.

5.1 Genetics

Candida albicans is a diploid organism but is unable to undergo meiotic division to a

haploid phase. However, it has developed unusual mechanisms for maintenance of

genetic diversity in the absence of a complete sexual cycle. These include chromo-

somal polymorphisms, with partial ploidy changes for some chromosomes, mitotic

recombination events, and gains and losses of heterozygosity (Odds 2010 ) . Amongst

these, loss of heterozygosity (LOH) has been widely observed among closely related

C. albicans isolates undergoing microadaptation (Shepherd et al. 1985 ; Tavanti et al.

2004 ; Odds et al. 2006b ) . Forche et al. ( 2011 ) measured the rates of LOH and the types

of LOH events that appeared in the presence and absence of physiologically relevant

stresses and found that stress causes a signi ﬁ cant increase in the rates of LOH. This

increase in the rates of LOH is proportional to the degree of stress and is expected to

facilitate the adaptation of C. albicans to changing environments within the host.

5.2 Adherence

The ﬁ rst step in infection is interaction with the host cells by adhesion. Candida

albicans expresses various adhesins, which bind to extracellular matrix proteins of

mucosal or endothelial cells. The well-known adhesins include members of the

agglutin-like (Als) family of adhesins, hyphal wall protein 1 (Hwp1), which forms

covalent bonds with the host cell through the action of host cell transglutaminases

(Staab et al. 1999 ) and elF4E-associated protein 1 (Eap1), which is a hypha-speci ﬁ c

protein that confers adhesive properties to Saccharomyces cerevisiae cells when

435

17 Adaptation of Candida albicans for Growth Within the Host

heterologously expressed (Li and Palecek 2008 ) . Most Candida albicans adhesins

are glycoproteins (Mavor et al. 2005 ) . Adhesins promote the binding of the organ-

ism to host cells via hydrophobic interactions and the variability of adhesins gives

diversity to host cells invasion. The adhesin genes are also differentially expressed

according to the environmental conditions.

5.3 Filament Formation

Morphogenesis in C. albicans is de ﬁ ned as a switch from unicellular yeast form to

ﬁ lamentous form (pseudohyphae or hyphae) (Khan et al. 2010 ) . As such, many

human fungal pathogens are morphogenetic. Accordingly, Calderone and Fonzi

( 2001 ) found ﬁ lamentation to increase the ability of C. albicans to cause infection

and associated the yeast form with asymptomatic carriage and the hyphae form with

active infection. Similarly, Mavor et al. ( 2005 ) suggested that yeast cells are better

suited for dissemination while hyphae are important for tissue and organ invasion.

Furthermore, strains of C. albicans that are unable to switch between yeast and

hyphal growth forms were avirulent (Sohn et al . 2006 ) . All these suggested that the

yeast and hyphal growth forms play different roles in causing infections (Mavor

et al. 2005 ) and therefore, each morphological form has a varying virulence factor

which differs with particular environments.

5.4 Proteases

Secreted aspartly proteinases (Saps) from Candida have been reported to hydrolyze

many proteins. To date, ten proteins have been recognized as Sap family (Saps

1–10) and found to be responsible for tissue invasion (Khan et al. 2010 ) .

Phospholipases are enzymes that hydrolyze ester linkages of glycophospholipids

and in C. albicans , four types of phospholipases have been found. Phospholipase

activity was observed in 99.4% of the strains of C. albicans tested (Pinto et al. 2008 )

and that results were similar to those obtained by Kantarcioğlu and Yücel ( 2002 )

who described 94% of the strains of C. albicans as phospholipase producers.

Accordingly, phospholipases and Saps secretion in Candida albicans has been

considered as relevant virulence factors (Pinto et al. 2008 ) .

5.5 Phenotypic Switching

Phenotypic switching also plays a role in altering the yeast’s adherence properties,

antigen expression and tissue af ﬁ nity (Mavor et al. 2005 ) .This phenotypic switching

provides cells with the ﬂ exibility for adaptation of the organism to the hostile conditions

436

Z. Zakaria et al.

imposed by the host and aids survival in different microenvironments. This switching

is reversible, occurs spontaneously in stress, and results in changes in cell surface

behaviour, colony appearance, and metabolic, biochemical and molecular attributes

to become more virulent and effective during infection (Odds et al.

2006b ) .

Strains isolated from vaginitis or systemically infected patients showed higher

frequencies of switching, indicating a strong role for the switching phenomenon in

establishing diseases (Kvaal et al.

1999 ) .

6 Adaptation of Candida albicans to the Host

For being a successful human commensal and pathogen, C. albicans has developed

host adaptation mechanisms on various levels. The regulated expression of viru-

lence and other genes in response to environmental signals allows effective adaptation

to new host niches during the course of an infection. When fungi invade a mamma-

lian host their lifestyle converts from saprophytic to parasitic. As saprophytes, fungi

survive in an environment with a moderate ambient temperature and pH, de ﬁ ned

sources for crucial nutrients such as carbon and metal ions, and atmospheric

concentrations of gases like carbon dioxide and oxygen. By invading a human host,

these environmental factors undergo a sudden and drastic change where ambient

temperature is suddenly replaced with the restrictively high temperature of the

human body. Ambient pH is replaced with acidic mucosal surfaces or neutral blood

and tissues. Known sources of carbon and metal ions are missing in an environment

where essential nutrients are sequestered from microbes to support host survival.

Carbon dioxide and oxygen concentrations are reversed in host tissues, leaving

C. albicans to adapt to hypoxia and high levels of carbon dioxide. Herein, we con-

centrate on recently studied adaptation mechanisms to the abiotic stresses that

C. albicans encounter during colonization and infection of their human hosts and

review the functions of these mechanisms in C. albicans survival and virulence.

6.1 Thermal Adaptation

Fungal survival at the high temperature of a human host is essential for virulence.

Fungi often develop morphogenetic virulence mechanisms, e.g., formation of yeasts,

hyphae, and spherules that facilitate their multiplication within the host at higher

temperature. Yeast cells of many Candida species produce ﬁ lamentous pseudohy-

phae and hyphae in tissues (Khan et al .

2010 ) . C. albicans alters from commensal

yeast to invasive hyphae at this elevated temperature.

The exact mechanisms by which thermal adaptation is regulated in eukaryotic

cells have been widely studied, but are still not yet completely understood.

However, it was found that when yeast cells are exposed to an acute thermal

stress, proteins unfold, the heat shock transcription factor becomes activated by

437

17 Adaptation of Candida albicans for Growth Within the Host

phosphorylation and this promotes the expression of heat shock genes (Leach

et al . 2012 ) . Recently, researchers identi ﬁ ed Ryp1, a homolog of the C. albicans

transcriptional regulator Wor1, as essential regulator for thermal dimorphism in

response to elevated temperature. Ryp1 binds its own promoter and might act as

an autoregulatory transcriptional regulator in C. albicans . Ryp1 mutants grow as

hyphae and are unable to induce expression of most yeast phase-speci ﬁ c genes at

37°C (Cooney and Klein

2008 ) .

The heat shock response in C. albicans has been of interest for few reasons. First,

temperature up-shifts induce morphological changes from the yeast to hyphae and

this cellular morphogenesis is a major virulence factor in C. albicans . Second,

mutations that block heat shock transcription factor (Hsf1) activation in C. albicans

prevent thermal adaptation and signi ﬁ cantly decrease the virulence of C. albicans .

Third, antifungal drug resistance is abrogated by Hsp90 inhibitors and by elevated

temperatures equivalent to those in febrile patients. Fourth, C. albicans heat shock

proteins are immunogenic, so, directly affecting host-pathogen interactions during

infection. Last, autoantibodies against Hsp90 are immunoprotective against C. albi-

cans infections (Leach et al. 2012 ) .

To summarize, the thermal adaptation of fungal pathogens is of high importance

because it is crucial for virulence, and because heat shock proteins represent targets

for novel therapeutic strategies.

6.2 pH Adaptation

The capability of fungal pathogens to cause disease depends on their ability to sur-

vive within the human host environment. Generally, ambient pH is replaced with

acidic conditions of mucosal surfaces or neutral to slightly alkaline pH of blood and

tissues, and the ability of fungi to grow at this pH is crucial for pathogenesis. The

Rim101 signal transduction pathway is the primary pH sensing pathway described

in the pathogenic fungi, and in C. albicans , it is essential for a variety of diseases

(Davis 2009 ) . Rim101 is essential for C. albicans virulence in models of mucosal

invasion and systemic candidiasis (Davis et al. 2000 ) . Rim101 is activated down-

stream of a signaling cascade involving a plasma membrane complex, an endosomal

membrane complex, and the proteasomes

The proteins of the plasma membrane signaling complex undergo pH-dependent

activation. PalI/Rim9 is responsible for localization of the pH-sensor PalH/Rim21 to

the plasma membrane (Calcagno-Pizarelli et al.

2007 ) . This facilitates PalH-dependent

phosphorylation and ubiquitylation of PalF/Rim8. PalF is an arrestin-like protein

thought to trigger endocytosis of the plasma membrane complex upon PalH-dependent

modi ﬁ cation, mediating transduction of the pH signal from the plasma membrane to

the endosomal membrane ( Herranz et al. 2005 ) . PalH is also required for localization

of the endosomal complex protein PalC to the endosomal membrane (Galindo et al.

2007 ) . This occurs through interaction of PalC with the endosomal sorting complex

protein Vps32, which is essential for both the pH response and the virulence of

438

Z. Zakaria et al.

C. albicans (Cornet et al. 2005 ) . Similarly, expression of ferric reductase genes occurs

downstream of Rim101 activation in C. albicans (Baek et al. 2008 ) . This connects the

pH response to known virulence factors and is probably one reason why PacC/Rim101

mutants show decreased virulence. Mucosal invasion by C. albicans requires degrada-

tion of epithelial cell junctions by the protease Sap5p, which is upregulated down-

stream of Rim101. Expression of Sap5p in a Rim101 mutant strain restored the ability

of C. albicans to invade an epithelial barrier in an in vitro model (Villar et al.

2007 ) .

Changes in cell wall composition also occur downstream of Rim101 activation in

C. albicans , with over-expression of several cell wall-modulating proteins partially

restoring virulence to a Rim101 mutant strain (Nobile et al. 2008 ) . These results indi-

cate the importance of pH sensing in fungal adaptation to mammalian hosts and high-

light components of the pH signaling cascade as potential drug targets.

On the other hand, calcineurin, Crz1, and Crz2 are required for the growth of

C. albicans at acidic pH. In fact, Crz1 and Crz2 act together to enhance the growth

at acidic pH (Davis 2009 ) .

6.3 Gas Tension

6.3.1 Carbon Dioxide

During human infection, fungi are exposed to carbon dioxide (CO

) concentrations

from low atmospheric CO

on epithelial surfaces to higher physiological CO

within

host tissues. Work in C. albicans identi ﬁ ed both carbonic anhydrase (CA) and ade-

nylyl cyclase (AC) as CO

sensors. Conversion of atmospheric CO

to bicarbonate

by CA is crucial for fatty acid biosynthesis and growth. Physiological CO

levels

spontaneously generate enough bicarbonate for both growth and stimulation of AC.

This activates the cAMP pathway and begins ﬁ lamentation and expression of

virulence traits ( Bahn and Muhlschlegel 2006 ) . Simultaneously, CA is required for

virulence in models with ambient CO

levels, such as C. albicans epithelial invasion

(Klengel et al. 2005 ) . In contrast, CA is dispensible and AC is important in models

with increased CO

, like systemic infections by C. albicans (Bahn et al. 2005 ;

Klengel et al. 2005 ; Mogensen et al. 2006 ) .

6.3.2 Oxygen

In order to maintain metabolic and biosynthetic functions in the host, fungal patho-

gens must also be able to adapt to hypoxia within host tissues. Oxygen levels in

mammalian tissues are below atmospheric levels. Furthermore, in ﬂ ammation,

thrombosis, and necrosis accompanied with infection are thought to rise degrees of

hypoxia. In C. albicans , the response to hypoxia depends on the coordination of

speci ﬁ c transcriptional regulators. In hypoxic conditions, the transcription factor

Ace2 represses oxidative metabolic processes and promotes ﬁ lamentation (Mulhern

439

17 Adaptation of Candida albicans for Growth Within the Host

et al. 2006 ) . The transcriptional regulator Egf1p, however, antagonizes Ace2 by

repressing ﬁ lamentation during hypoxia (Setiadi et al. 2006 ) . The hypoxic environ-

ment of the vaginal mucosa has been shown to induce iron uptake protein expres-

sion, probably linking the hypoxic response to both iron acquisition and virulence

in C. albicans (Sosinska et al.

2008 ) .

6.4 Nutrients

6.4.1 Carbon Metabolism

Like most fungi, C. albicans uses sugars, especially glucose, as the preferred carbon

source. While, a wide variety of nonfermentable carbon sources may also satisfy cellular

requirements, including but not restricted to ethanol, acetate, glycerol, amino acids, and

fatty acids. Collectively, these compounds are sometimes known as nonpreferred or

alternative carbon sources since fungi only use them in the absence of sugars. These

alternative sources are metabolized by three main pathways: β -oxidation of fatty acids,

the glyoxylate cycle, and gluconeogenesis (Ramirez and Lorenz 2007 ) . The main goals

of these three interconnected pathways are to provide energy, replenish tricarboxylic

acid (TCA) cycle intermediates and acetyl-coenzyme A (CoA), and ultimately convert

lipids to acetate to glucose (Lorenz and Fink 2001 ; Lorenz et al . 2004 ) .

Due to the fact that alternative carbon metabolism in C. albicans are impor-

tant during systemic infections, deletions of genes encoding key enzymes in each

pathway, the -oxidation multifunctional protein (FOX2), isocitrate lyase (ICL1),

and fructose-1, 6-bisphosphatase (FBP1) in the pathways of β -oxidation of fatty

acids (FOX2), the glyoxylate cycle (ICL1), and gluconeogenesis (FBP1) allow

virulence defects from moderate to severe (Ramirez and Lorenz 2007 ) . Therefore,

alternative carbon metabolism in C. albicans plays an important role in survival

within the host. On the other hand, some aspects of alternative carbon metabo-

lism are unique to microorganisms, the identi ﬁ cation of relevant carbon sources

in vivo may highlight enzymes or pathways as attractive candidates for antifun-

gal drug discovery.

6.4.2 Iron Acquisition

Generally, Iron is required for the survival of most organisms, primarily due to its

role as a cofactor in essential metabolic functions (Lan et al. 2004 ) . However, within

the mammalian host environment, iron is sequestered away from microbes by iron

carrier proteins, being stored in intracellular ferritin complexes; the trace amounts

of extracellular iron bound by transferrin in the tissues and lactoferrin on mucosal

surfaces and body secretions (Davis 2009 ) , creating an iron-limited environment in

which fungal pathogens must encode mechanisms for iron acquisition in order to

survive (Haas et al . 2008 ) .

440

Z. Zakaria et al.

Many fungi possess high af ﬁ nity iron chelators, called siderophores, which

ef ﬁ ciently bind host iron in the extracellular space and store it within the fungal

cytoplasm. Fungal pathogens must also possess mechanisms for controlling and

coordinating the utilization of acquired iron. For instance, C. albicans has multiple

mechanisms for utilizing iron sources from the environment, including a reductive

pathway and transport of heterologous siderophores. Moreover, Als3, an adhesin,

binds to ferritin, enabling its use as a source of iron (Ding et al .

2011 ) . The recent

identi ﬁ cation of the transcriptional regulator Hap43 in C. albicans has provided

view for a mechanism by which C. albicans can adapt to iron limitation by reducing

iron utilization. Hap43 was found to act as a transcriptional activator for the ferric

reductases, which are crucial for the removal and utilization of iron from chelators

including both siderophores and host carrier proteins (Baek et al . 2008 ) . A novel

mechanism by which C. albicans scavenges iron from host hemoglobin was also

recently described. Receptor mediated endocytosis of hemoglobin facilitates extrac-

tion of iron, probably by a heme oxygenase in the vacuole (Weissman et al . 2008 ) .

Some Bcr1 targets in C. albicans play a role in acquiring iron from host proteins.

These include two CFEM proteins, Rbt5 and Pga10, which act as receptors for

hemoglobin, allowing endocytosis of the host iron complex (Ding et al . 2011 ) . This

hemoglobin utilization system considered an additional iron acquisition system that

will probably be linked to survival of C. albicans within the host.

In addition to the speci ﬁ c sensory and regulatory adaptation mechanisms briefed

above, C. albicans pathogens must also adapt to changes in nitrogen, calcium, mag-

nesium, and copper sources, pressure, and ﬂ uid ﬂ ow rates.

7 Prevention of Candidiasis

In general, like other fungal infections, most Candida infections can be prevented by

keeping the skin clean, dry, and free from abrasions or cuts. Moreover, by using anti-

biotics according to doctor’s directions since our bodies contain Acidophilus bacteria

as a normal ﬂ ora in the gut and this friendly bacteria helps keep our body in balance

and able to ﬁ ght pathogenic bacteria and fungus, like Candida . Uncontrolled intake

of antibiotics may kill Acidophilus bacteria and enhance Candida growth. On the

other hand, resistance of Candida to the used antifungal drugs can be decreased by

following the doctor’s directions and taking the described antibiotic completely.

Furthermore, following a healthy lifestyle, including proper nutrition ensures good

immunity. People with diabetes should try to keep their blood sugar under tight con-

trol since sugars are food for Candida and promote its growth.

8 Treatment of Candidiasis

Now a day, several antifungal agents are available, these include: Polyene derivatives

such as Amphotericin B, Lipid based amphotericin, Nystatin, Azoles, and Griseofulvin.

Amphotericin B is a polyene antimycotic, has been the drug of choice for most systemic

441

17 Adaptation of Candida albicans for Growth Within the Host

fungal infections. It has a greater af ﬁ nity for ergosterol in the cell membranes of fungi

than for the cholesterol in the host’s cells; once bound to ergosterol it causes disrup-

tion of the cell membrane and death of the fungal cell. Amphotericin B is usually

administered intravenously, often for 2–3 months. The drug has side effects of being

toxic; thrombo-phlebitis, nephrotoxicity, fever, chills and anemia frequently occur

during administration. Although newer drugs have been shown to be as ef ﬁ cacious

and less toxic, amphotericin B is still the gold standard for comparison as well as the

therapy of last resort for severe infections. However, Lipid based amphotericin is

effective, less toxic, and more expensive (Khan and Jain

2000 ; Di salvo 2007 ) . Next,

nystatin is considered the drug of choice for vaginitis and cutaneous infections (Hector

1993 ) . On the other hand, the azoles (imidazoles and triazoles), including ketocon-

azole, ﬂ uconazole, itraconozole, voriconazole and posaconazole are being used for

muco-cutaneous candidiasis, dermatophytosis, and for some systemic fungal infec-

tions. The general mechanism of action of the azoles is the inhibition of ergosterol

synthesis which affects cell wall synthesis. Oral administration and reduced toxicity

are distinct advantages. Griseofulvin is a very slow-acting drug which is used for

severe skin and nail infections. Its effect depends on its accumulation in the stratum

corneum where it is incorporated into the tissue and forms a barrier, which stops fur-

ther fungal penetration and growth. It is administered orally (Khan and Jain 2000 ; Di

salvo 2007 ) . New agents with different mechanisms of action are under development

(Hector 1993 ) . Echinocandins (caspofungin), a new antifungal agent recently approved

by the FDA (Di salvo 2007 ) . Importantly, it is active against Candida isolates that

are refractory to azole treatment. It kills fungi by inhibiting the synthesis of ß-1,

3-glucan, a major component of the fungal cell wall. Thus, it has potent in vitro

activity against C. albicans bio ﬁ lms ( Bachmann 2002 ).

Recently, thousands of products have been screened in vitro for antimicrobial

activity and promising molecules have been evaluated in various animal models for

new drug development. Much research focuses on plant sources.

9 Conclusions and Future Recommendations

During growth within the intestinal tract, C. albicans senses pH, oxygen, carbon

sources, and the presence of surfaces allowing it to optimize gene expression for a

particular environment. With these mechanisms for sensing, C. albicans is able to

ef ﬁ ciently survive in humans starting from infancy, establishing itself in its most

important natural niche.

References

Bachmann SP, Walle KV, Ramage G, Patterson TF, Wickes BL, Graybill JR, López-Ribot JL

(2002) In vitro activity of caspofungin against Candida albicans bio ﬁ lms. Antimicrobial Agents

Chemother 46(11):3591–3596

442

Z. Zakaria et al.

Baek YU, Li M, Davis D (2008) Candida albicans ferric reductases are differentially regulated in

response to distinct forms of iron limitation by the Rim101 and CBF transcription factors.

Eukaryot Cell 7:1168–1179

Bahn YS, Muhlschlegel F (2006) CO

sensing in fungi and beyond. Curr Opin Microbiol 9:572–578

Bahn YS, Cox GM, Perfect JR, Heitman J (2005) Carbonic anhydrase and CO

sensing during

Cryptococcus neoformans growth, differentiation, and virulence. Curr Biol 15:2013–2020

Baron EJ, Chang RS, Howard DH, Miller JN, Turner JA (1994) Medical microbiology: a short

course. Wiley, New York, pp 537–543

Bartie KL, Williams DW, Wilson MJ, Potts AJC, Lewis MAO (2001) PCR ﬁ ngerprinting of

Candida albicans associated with chronic hyperplastic candidosis and other oral conditions.

J Clin Microbiol 39(11):4066–4075

Bougnoux M-E, Diogo D, Francois N, Sendid B, Veirmere S, Colombel JF, Van Kruiningen H,

d’Enfert C, Poulain D (2006) Multilocus sequence typing reveals intrafamilial transmission

and microevolutions of Candida albicans isolates from the human digestive tract. J Clin

Microbiol 44(5):1810–1820

Calcagno-Pizarelli AM, Negrete-Urtasun S, Denison SH, Rudnicka JD, Bussink HJ, Munera-

Huertas T, Stanton L, Hervas-Aguilar A, Espeso EA, Tilburn J, Arst HN, Penalv MA (2007)

Establishment of the ambient pH signaling complex in Aspergillus nidulans : PalI assists plasma

membrane localization of PalH. Eukaryot Cell 6:2365–2375

Calderone R (2002) Candida and candidiasis. American Society for Microbiology, Washington, DC

Calderone RA, Fonzi WA (2001) Virulence factors of Candida albicans . Trends Microbiol

9(7):327–335

Cooney NM, Klein BS (2008) Fungal adaptation to the mammalian host: it is a new world, after

all. Curr Opin Microbiol 11:511–516

Cornet M, Bidard F, Schwarz P, Da Costa G, Blanchin-Roland S, Dromer F, Gaillardin C (2005)

Deletions of endocytic components VPS28 and VPS32 affect growth at alkaline pH and viru-

lence through both RIM101-dependent and RIM101-independent pathways in Candida albi-

cans . Infect Immun 73:7977–7987

Davis DA (2009) How human pathogenic fungi sense and adapt to pH: the link to virulence.

[Review]. Curr Opin Microbiol 12:365–370

Davis D, Edwards JE Jr, Mitchell AP, Ibrahim A (2000) Candida albicans RIM101 pH response

pathway is required for hostpathogen interactions. Infect Immun 68:5953–5959

Di Salvo A (2007) Medical microbiology (MBIM 650/720) Course. Medical mycology. L:82–86

Ding C, Vidanes GM, Maguire SL, Guida A, Synnott JM, Andes DR et al (2011) Conserved and

divergent roles of Bcr1 and CFEM proteins in Candida parapsilosis and Candida albicans .

PLoS One 6(12):e28151

Fidel PL Jr, Vanquez JA, Sobel JD (1999) Candida glabrata : a review of epidemiology, pathogen-

esis and clinical disease with comparison to Candida albicans . Clin Microbiol Rev 12:80–96

Forche A, Abbey D, Pisithkul T, Weinzierl MA, Ringstrom T, Bruck D, Petersen K, Berman J (2011)

Stress alters rates and types of loss of heterozygosity in Candida albicans . mbio 2(4):1–8, asm.org

Galindo A, Hervas-Aguilar A, Rodriguez-Galan O, Vincent O, Arst HN Jr, Tilburn J, Penalva MA

(2007) PalC, one of two Bro1 domain proteins in the fungal pH signalling pathway, localizes

to cortical structures and binds Vps32. Traf ﬁ c 8:1346–1364

Haas H, Eisendle M, Turgeon B (2008) Siderophores in fungal physiology and virulence. Annu

Rev Phytopathol 46:149–187

Hector RF (1993) Compounds active against cell walls of medically important fungi. Clin

Microbiol Rev 6:1–21

Herranz S, Rodriguez JM, Bussink HJ, Sanchez-Ferrero JC, Arst HN Jr, Penalva MA, Vincent O

(2005) Arrestin-related proteins mediate pH signaling in fungi. Proc Natl Acad Sci USA

102:12141–12146

Jacobsen MD, Duncan AD, Bain J, Johnson EM, Naglik JR, Shaw DJ, Gow NAR, Odss FC (2008)

Mixed Candida albicans strain populations in colonized and infected mucosal tissues. FEMS

Yeast Res 8(8):1334–1338

443

17 Adaptation of Candida albicans for Growth Within the Host

Kantarcioğlu AS, Yücel A (2002) Phospholipase and protease activities in clinical Candida iso-

lates with reference to the sources of strains. Mycoses 45:160–165

Khan ZK, Gyanchandani A (1998) Candidiasis: a review. PINSA 64:1–34

Khan ZK, Jain P (2000) Antifungal agents and immunomodulators in systemic mycoses. Indian J

Chest Dis Allied Sci 42:345–3551

Khan MSA, Ahmad I, Aqil F, Owais M, Shahid M, Musarrat J (2010) Virulence and pathogenicity

of fungal pathogens with special reference to Candida albicans . In: Ahmad I, Owais M, Shahid

M, Aqil F (eds) Combating fungal infections, problems and remedy. Springer, Berlin/

Heidelberg, pp 21–45

Klengel T, Liang WJ, Chaloupka J, Ruoff C, Schroppel K, Naglik JR, Eckert SE, Moqensen EG,

Haynes K, Tuite MF, Levin LR, Buck J, Muhlschlegel FA (2005) Fungal adenylyl cyclase

integrates CO

sensing with cAMP signaling and virulence. Curr Biol 15:2021–2026

Kvaal C, Lachke SA, Srikantha T, Daniels K, McCoy J, Soll DR (1999) Misexpression of the

opaque phase speci ﬁ c gene PEP1 (SAP1) in the white phase of Candida albicans confers

increased virulence in a mouse model of cutaneous infection. Infect Immun 67:6652–6662

Lan C-Y, Rodarte G, Murillo LA, Jones T, Davis RW, Dungan J, Newport G, Agabian N (2004)

Regulatory networks affected by iron availability in Candida albicans . Mol Microbiol

5:1451–1469

Leach MD, Tyc KM, Brown AJP, Klipp E (2012) Modelling the regulation of thermal adaptation

in Candida albicans , a major fungal pathogen of humans. PLoS One 7(3):e32467

Li F, Palecek SP (2008) Distinct domains of the Candida albicans adhesin Eap 1 p mediate cell-

cell and cell-substrate interactions. Microbiology 154:1193–1203

Lorenz MC, Fink G (2001) The glyoxylate cycle is required for fungal virulence. Nature 412:83–86

Lorenz M, Bender JA, Fink GR (2004) Transcriptional response of Candida albicans upon inter-

nalization by macrophages. Eukaryot Cell 3:1076–1087

Mavor AL, Thewes S, Hube B (2005) Systemic fungal infections caused by Candida species:

epidemiology, infection process and virulence attributes. Curr Drug Targets 6:863–874

Mogensen EG, Janbon G, Chaloupka J, Steegborn C, Fu MS, Moyrand F, Klengel T, Pearson DS,

Geeves MA, Buck J, Levin LR, Muhlschlegel FA (2006) Cryptococcus neoformans senses CO

through the carbonic anhydrase Can2 and the adenylyl cyclase Cac1. Eukaryot Cell

5:103–111

Mulhern SM, Logue ME, Butler G (2006) Candida albicans transcription factor Ace2 regulates

metabolism and is required for ﬁ lamentation in hypoxic conditions. Eukaryot Cell 5:2001–2013

Nobile CJ, Solis N, Myers CL, Fay AJ, Deneault JS, Nantel A, Mitchell AP, Filler SG (2008)

Candida albicans transcription factor Rim101 mediates pathogenic interactions through cell

wall functions. Cell Microbiol 10:2180–2196

Odds FC (1988) Candida and candidosis, 2nd edn. Baillière Tivdall, London, pp 42–59

Odds FC (2010) Molecular phylogenetics and epidemiology of Candida albicans . Future Microbiol

5(1):67–79

Odds FC, Davidson AD, Jacobsen MD, Tavanti A, Whyte JA, Kibbler CC, Ellis DH, Maiden MCJ,

Shaw DJ, Gow NAR (2006a) Candida albicans strain maintenance, replacement, and micro-

variation demonstrated by multilocus sequence typing. J Clin Microbiol 44(10):3647–3658

Odds FC, Gow NAR, Brown AJP (2006b) Toward a molecular understanding of Candida albicans

virulence. In: Heitman J, Filler SG, Edwards JE Jr, Mitchell AP (eds) Molecular principles of

fungal pathogenesis. ASM, Washington, DC, pp 305–319

Pinto E, Ribeiro IC, Ferreira NJ, Fortes CE, Fonseca PA, Figueiral MH (2008) Correlation between

enzyme production, germ tube formation and susceptibility to ﬂ uconazole in Candida species

isolated from patients with denture-related stomatitis and control individuals. J Oral Pathol

Med 37:587–592

Ramirez MA, Lorenz M (2007) Mutations in alternative carbon utilization pathways in Candida

albicans attenuate virulence and confer pleiotropic phenotypes. Eukaryot Cell 6:280–290

Rosenbach A, Dignard D, Pierce JV, Whiteway M, Kumamoto CA (2010) Adaptations of Candida

albicans for growth in the mammalian intestinal tract. Eukaryot Cell 9(7):1075–1086

444

Z. Zakaria et al.

Rupp S (2007) Review: interactions of the fungal pathogen Candida albicans with the host. Future

Microbiol 2(2):141–151

Schulze J, Sonnenborn U (2009) Yeast in the gut: from commensals to infectious agents. Dtsch

Arztebl Int 106(51–52):837–842

Setiadi ER, Doedt T, Cottier F, Noffz C, Ernst J (2006) Transcriptional response of Candida albi-

cans to hypoxia: linkage of oxygen sensing and Efg1p-regulatory networks. J Mol Biol

361:399–411

Shepherd MG, Poulter RTM, Sullivan PA (1985) Candida albicans : biology, genetics and patho-

genicity. Annu Rev Microbiol 39:579–614

Sohn K, Schwenk J, Urban C, Lechner J, Schweikert M, Rupp S (2006) Getting in touch with

Candida albicans : the cell wall of a fungal pathogen. Curr Drug Targets 7(4):505–512

Sosinska GJ, de Groot PW, Teixeira de Mattos MJ, Dekker HL, de Koster CG, Hellingwerf KJ,

Klis FM (2008) Hypoxic conditions and iron restriction affect the cell-wall proteome of

Candida albicans grown under vagina-simulative conditions. Microbiology 154:510–520

Staab JF, Bradway SD, Fidel PL, Sundstrom P (1999) Adhesive and mammalian transglutaminase

substrate properties of Candida albicans Hwp1. Science 283:1535–1538

Sudbery PE (2011) Growth of Candida albicans hyphae. Nat Rev Microbiol 9:737–748.

www.

nature.com/reviews/micro

Sudbery PE, Gow NAR, Berman J (2004) The distinct morphogenic states of Candida albicans .

Trends Microbiol 12:317–324

Tavanti A, Gow NAR, Maiden MCJ, Odds FC, Shaw DJ (2004) Genetic evidence for recombina-

tion in Candida albicans based on haplotype analysis. Fungal Genet Biol 41:553–562

Villar CC, Kashleva H, Nobile CJ, Mitchell AP, Dongari-Bagtzoglou A (2007) Mucosal tissue

invasion by Candida albicans is associated with E-cadherin degradation, mediated by tran-

scription factor Rim101p and protease Sap5p. Infect Immun 75:2126–2135

Vylkova S, Carman AJ, Danhof HA, Collette JR, Zhou H, Lorenz MC (2011) The fungal pathogen

Candida albicans autoinduces hyphal morphogenesis by raising extracellular pH. mBio.asm.

org 2(3):1–12.

http://mbio.asm.org/content/2/3/e00055-11.full.html

Wächtler B, Wilson D, Haedicke K, Dalle F, Hube B (2011) From attachment to damage: de ﬁ ned

genes of Candida albicans mediate adhesion, invasion and damage during interaction with oral

epithelial cells. PLoS One 6(2):1–14.

www.plosone.org

Weissman Z, Shemer R, Conibear E, Kornitzer D (2008) An endocytic mechanism for haemoglo-

bin-iron acquisition in Candida albicans . Mol Microbiol 69:201–217

Wenzel RP (1995) Nosocomial candidiasis: risk factors and attributable mortality. Clin Infect Dis

20:1531–1534

445

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

Abstract The development of products from marine bioresources is gaining importance

in the biotechnology sector. The global market for Marine Biotechnology products and

processes was, in 2010, estimated at € 2.8 billion with a cumulative annual growth rate

of 5–10% (Børresen et al., Marine biotechnology: a new vision and strategy for Europe.

Marine Board Position Paper 15. Beernem: Marine Board-ESF, 2010). Marine

Biotechnology has the potential to make signi ﬁ cant contributions towards the sus-

tainable supply of food and energy, the solution of climate change and environmen-

tal degradation issues, and the human health. Besides the creation of jobs and

wealth, it will contribute to the development of a greener economy. Thus, huge

expectations anticipate the global development of marine biotechnology. The marine

environment represents more than 70% of the Earth’s surface and includes the larg-

est ranges of temperature, light and pressure encountered by life. These diverse

marine environments still remain largely unexplored, in comparison with terrestrial

habitats. Notwithstanding, efforts are being done by the scienti ﬁ c community to

widespread the knowledge on ocean’s microbial life. For example, the J. Craig

Venter Institute, in collaboration with the University of California, San Diego

(UCSD), and Scripps Institution of Oceanography have built a state-of-the-art com-

putational resource along with software tools to catalogue and interpret microbial

life in the world’s oceans. The potential application of the marine biotechnology in

the bioenergy sector is wide and, certainly, will evolve far beyond the current inter-

est in marine algae. This chapter revises the current knowledge on marine anaerobic

bacteria and archaea with a role in bio-hydrogen production, syngas fermentation

and bio-electrochemical processes, three examples of bioenergy production routes.

Chapter 18

The Role of Marine Anaerobic Bacteria

and Archaea in Bioenergy Production

A. J. Cavaleiro , A. A. Abreu , D. Z. Sousa , M. A. Pereira ,

and M. M. Alves

A. J. Cavaleiro • A. A. Abreu • D. Z. Sousa • M. A. Pereira • M. M. Alves (*)

IBB – Institute for Biotechnology and Bioengineering,

Centre of Biological Engineering , University of Minho ,

Campus de Gualtar , 4710-057 Braga , Portugal

e-mail: acavaleiro@deb.uminho.pt ; angela_abreu@deb.uminho.pt ;

dianasousa@deb.uminho.pt ; alcina@deb.uminho.pt ; madalena.alves@deb.uminho.pt

A.J. Cavaleiro and A.A. Abreu contributed equally to this chapter.

446

A.J. Cavaleiro et al.

1 Introduction

Energy is essential for life and has been a critical and decisive factor for the devel-

opment of human civilizations. The ever-increasing use of energy, and particularly

the overexploitation of fossil fuels and the depletion of easily accessible oil

resources, have prompted several environmental problems and pressed the search

for alternative renewable energy sources.

Renewable and sustainable bioenergy can be produced from any organic material

that stored sunlight in the form of chemical energy. This includes lignocellulosic

biomass, crops, agricultural and animal wastes, organic fraction of municipal solid

wastes and some industrial organic wastes. Heat and electricity can be generated

from these materials, as well as several liquid and gaseous biofuels, namely bioetha-

nol, biobutanol, biodiesel, biogas and biohydrogen.

Chemical, thermo-chemical and biological technologies are currently used for

biofuel production. Among these, processes performed by microorganisms are the

most cost effective (Barnard et al.

2010 ) . Nevertheless, a more comprehensive

understanding of the microbial processes involved and the identi ﬁ cation of novel

microorganisms capable of producing biofuels is needed for process development

and optimization.

Marine habitats are particularly attractive for bioprospection, due to the vast

microbial abundance and diversity. Microorganisms that grow in deep oceanic

environments have unique characteristics, necessary for thriving under extreme

conditions of light, temperature and pressure. Therefore, the oceans contain

an immense pool of genetic information with high biotechnology potential

(Børresen et al. 2010 ).

Studies in deep oceans are technically challenging and expensive, but recent

advances in genome sequencing techniques, metagenomics, remote sensing of

microorganisms and bioinformatics have contributed to the intensi ﬁ cation of marine

biotechnology. This has resulted in different applications with societal importance,

such as new therapeutics, chemical products and enzymes (Glöckner et al. 2012 ) .

Several genes of marine organisms have been patented and are mainly applied in

pharmacology and human health (55%), agriculture or aquaculture (26%) and food

industry (17%) (Arrieta et al. 2010 ) . Applications in ecotoxicology, bioremediation

and biofuel production are now emerging.

Marine non-phototrophic anaerobic microorganisms present an extensive and

almost unexplored potential for biofuels production. The microbial communities

present in hydrothermal ﬁ elds use the energy of organic compounds ( e.g. decaying

biomass) but also reduced inorganic compounds ( e.g. carbon monoxide) for growth,

producing hydrogen, methane and alcohols (Sokolova et al. 2001 ) . In the last decades,

several hydrogen-producing bacteria have been screened from different marine

environments, although few could be cultivated in the laboratory (Jayasinghearachchi

et al. 2010 ) . The use of extremophiles as catalysts may improve hydrogen yields in

dark fermentation processes or the energy yield in microbial electro-chemical

447

18 The Role of Marine Anaerobic Bacteria…

processes, since these microorganisms possess unique metabolic and physiological

characteristics (Mathis et al. 2008 ) .

In this chapter, the current knowledge on anaerobic microorganisms, or micro-

bial cultures, retrieved from marine habitats with potential application in biotech-

nology systems for bioenergy production are reviewed, specially focusing on

(1) dark fermentation for hydrogen production, (2) syngas (CO, CO

, H

) fermenta-

tion, and (3) electro-chemical processes (Fig. 18.1 ).

1.1 The Marine Environment

The marine environment covers more than 70% of the Earth’s surface and com-

prises 97% of all the water on the planet, much of which (75% of the ocean’s vol-

ume) at depths higher than 1,000 m. The ocean’s average depth is 4,000 m, but it

may reach 11,000 m deep. The pelagic zone (from the Greek “open sea”) can be

divided into several ecological sections based on depth (Fig. 18.2 ). The photic zone

of the ocean, i.e. the volume actually penetrated by sunlight, is located in the upper

layer, 200–300 m deep, and accounts only for approximately 2% of the total water

volume. Therefore, the majority of the ocean (approx. 1.3 × 10

) is deprived of

light (Orcutt et al. 2011 ) .

Fig. 18.1 Bioenergy production through dark fermentation, syngas fermentations and electro-

chemical processes catalyzed by anaerobic marine microorganisms

448

A.J. Cavaleiro et al.

Besides the ocean water column, the marine environment includes other microbial

habitats, namely marine sediments, the oceanic crust and hydrothermal vents. These

environments are characterized by extreme pressure and temperature conditions

(Fig. 18.2 ).

Pressure increases approximately 0.1 atm m

−1

of water column, and more than

62% of the ocean is exposed to pressure values higher than 100 atm (Orcutt et al.

2011 ) . Barophilic or piezophilic microorganisms exhibit an optimal growth at pres-

sure higher than 400 atm, while barotolerant microorganisms have their optimal

growth at pressures below 400 atm. Inhibitory effects of increased pressure on bio-

chemical processes have been reported, and deep-sea microorganisms present

speci ﬁ c features that allow them to live and grow under these high-pressure condi-

tions (Horikoshi 1998 ; Kato and Bartlett 1997 ) .

Temperature in the water column decreases from the surface until 100 m deep,

from which it remains more or less constant around 2–4°C (Fig. 18.2 ). In hydrother-

mal vents, however, thermophilic and hyperthermophilic conditions are present and

temperatures up to 400°C may occur (Orcutt et al. 2011 ) . In these geological places,

chemically reduced compounds are released at high temperatures from the earth

subsurface. Mineral deposition occurs in these zones and may cause the formation

of chimney structures surrounding the advecting ﬂ uids. Higher biological activity is

present in these areas, relatively to the majority of the deep sea, with chemosyn-

thetic archaea forming the base of a diverse food chain. Hydrogenotrophic metha-

nogenesis and sulfate reduction are the dominant anaerobic processes in high

temperature vent ﬂ uids (Orcutt et al. 2011 ) .

Fig. 18.2 The marine environment and its principal characteristics

449

18 The Role of Marine Anaerobic Bacteria…

The movement of chemical compounds ( e.g. oxygen, nutrients, waste products)

through the water column is another important factor that in ﬂ uences marine micro-

bial communities. Caused by differences in temperature and salinity, vertical gradi-

ents occur in the water masses, creating zones with diverse physical and chemical

characteristics. The metabolic activity of marine microorganisms is also greatly

dependent on the availability and speciation of electron donors and acceptors.

Organic matter and reduced inorganic compounds, such as hydrogen, methane,

reduced sulfur compounds, reduced iron and manganese, and ammonium, are the

main sources of electrons for the microbial metabolic reactions. Molecular hydro-

gen oxidation is energetically favorable, and thus marine microorganisms intensely

compete for this compound (Orcutt et al. 2011 ) .

Inorganic compounds such as oxygen, nitrate, nitrite, manganese and iron oxides,

oxidized sulfur compounds and carbon dioxide may serve as electron sinks in

marine microbial metabolisms (Table 18.1 ). The availability of terminal electron

acceptors in ﬂ uences signi ﬁ cantly the dominant microbial metabolic pathways.

Microorganisms preferable use the electron acceptors that provide higher thermo-

dynamic energy yields, generally following a redox cascade.

Microorganisms living in deep-sea habitats have different requirements in terms

of salt concentration for growth. Halotolerant microbes prefer low salt concentra-

tion, but are able to survive and grow in the presence of relatively high Na

concen-

trations, while halophilic microorganisms require salt concentrations from 0.5 to

2.5 M or even higher (saturated solutions) (Kivistö and Karp 2011 ) .

1.2 Microbial Abundance and Diversity

in the Marine Environment

The discovery of high microbial activity in deep ocean and sediments, previously

considered devoid of life, signi ﬁ cantly changed the understanding of marine eco-

systems. In the last decades, genomic and metagenomic approaches and the use of

high throughput sequencing techniques have revealed the remarkable diversity of

Table 18.1 Standard reduction potentials at 25°C and pH 7 for some possible electron acceptors

in marine microbial metabolism

Electron acceptor (ox/red) Half-reaction E

¢ (V)

O O

( g ) + 4H

+ 4 e

−

→ 2H

O +0.815

−

2NO

−

+ 12H

+ 10 e

−

→ N

( g ) + 6H

O +0.747

−

2NO

−

+ 8H

+ 6 e

−

→ N

+ 4H

O +0.958

−

/NO

−

+ 2H

+ 2 e

−

→ NO

−

+ H

O +0.432

2−

/HS

−

+ 9H

+ 8 e

−

→ HS

−

+ 4H

O −0.217

HCO

−

/CH

HCO

−

+ 9H

+ 8 e

−

→ CH

( g ) + 3H

O −0.238

Reduction potentials calculated from Thauer et al. (

1977 ) at standard conditions (1 M concentra-

tion for each solute, partial pressure of 1 atm for each gas, 25 ºC and pH 7)

450

A.J. Cavaleiro et al.

marine microbes, and contributed to the identi ﬁ cation of novel ecological processes

and functions in the marine environments. Dedicated research programs were

launched, speci ﬁ cally focusing on the assessment of genetic diversity and function

in marine microbial communities. For example, the Global Ocean Sampling expe-

dition (GOS) by Craig Venter started in 2004 with the aim of improving the

number of whole genome sequences of ecologically relevant marine microorgan-

isms (Sun et al.

2011 ) .

Total number of bacteria and archaea in the ocean is estimated to be around

cells. Prokaryotic biomass concentration in the pelagic zone is approximately

–10

cells mL

−1

and tends to decrease with depth, contrasting with diversity

that typically is higher at higher profundities. In deep sediments microbial abun-

dance exceeds 10

cells mL

−1

. In these habitats, higher abundance and diversity

occur at the surface and then decrease sharply, re ﬂ ecting changes in the geochem-

ical characteristics of the sediments (Nagata et al. 2010 ; Orcutt et al. 2011 ; Zhang

et al. 2012 ) .

A relatively high abundance of Archaea (10–50% of total prokaryote cell

abundance), has been reported in the bathypelagic communities (Nagata et al.

2010 ; Orcutt et al. 2011 ) . The structure of these communities appears to be more

closely related with depth than with the local of origin, since microbial commu-

nities collected in different places at the same depth present higher similarity

than the microbial assemblages inhabiting a speci ﬁ c ocean at different depths.

This fact suggests the existence of vertical strati ﬁ cation patterns at global scale

(Orcutt et al. 2011 ) .

Similar marine habitats appear to be dominated by similar microbial groups

(at the phylum level) (Inagaki et al. 2006 ; Orcutt et al. 2011 ) . Alpha -, Delta - and

Gamma-Proteobacteria prevail in typical deep-ocean bacterial communities,

whereas the Crenarchaeota marine group I dominates the archaeal communities

(Eloe et al. 2011 ; Fuhrman and Davis 1997 ; Orcutt et al. 2011 ) . In deep sediments,

predominant phylotypes of the Archaea domain include the Crenarchaeota clades

Marine Benthic Group B and Miscellaneous Crenarchaeota Group, for which there

are no cultivated members. These habitats also include as dominant bacteria, mem-

bers of the candidate OP9/JS1 phylum or of the Chloro ﬂ exi phylum (Inagaki et al.

2006 ; Orcutt et al. 2011 ; Schippers et al. 2012 ; Zhang et al. 2012 ) . Gamma- and

Epsilonproteobacteria dominate the hydrothermal habitats, as well as members of

the Euryarchaeota phylum, from genera Archaeoglobus , Thermococcales and

Methanococcales (Orcutt et al. 2011 ; Sokolova et al. 2001 ) .

Despite the recent advances achieved with metagenomic approaches, an enor-

mous pool of previously unknown, uncultured microorganisms and genes has been

revealed. As an example, Venter et al. ( 2004 ) identi ﬁ ed over 1.2 million previously

unknown genes through genome shotgun sequencing of samples from the Sargasso

Sea. The function of many of these genes was not identi ﬁ ed thus far (Glöckner et al.

2012 ; Pedrós-Alió 2006 ) . In order to fully exploit the genomic potential of marine

microbes, with possible applications in biotechnology, the development of novel

research tools for the characterization of these previously unknown marine micro-

organisms is absolutely necessary (Glöckner et al. 2012 ) .

451

18 The Role of Marine Anaerobic Bacteria…

In line with this need, the J. Craig Venter Institute (JCVI) launched the project

CAMERA, the Community Cyber Infrastructure for Advanced Marine Microbial

Ecology Research and Analysis Database, which is a continually evolving open

access tool for general access to raw environmental sequence data, associated meta-

data, pre-computed search results, and high-performance computational resources

(

http://camera.calit2.net/ ). The aim of this project is to serve the needs of the micro-

bial ecology research community by creating a rich, distinctive data repository and

a bioinformatics tools resource that will address many of the unique challenges of

metagenomics analysis. Initially, CAMERA is making available all the metage-

nomic data being collected by the J. Craig Venter Institute’s Sorcerer II Global

Ocean Sampling (GOS) expeditions, which have sampled microbial communities

around the globe, plus 150 new full genome maps of ocean microbes. It also includes

other data sets: a large-scale metagenomic survey of marine viral organisms col-

lected from sites around the North American continent by Forest Rohwer and his

research team at San Diego State University, and a vertical pro ﬁ le of marine micro-

bial communities collected at the Hawaii Ocean Time-Series (HOTS) station

ALOHA by Ed DeLong and his research team at Massachusetts Institute of

Technology (MIT) ( http://www.jcvi.org/cms/research/projects/camera/overview/ ).

2 Dark Fermentation Process

Hydrogen, a high-energy, non-polluting and environmental friendly compound can

be biologically produced through biophotolysis, indirect biophotolysis, photofer-

mentation and dark fermentation of organic matter. In dark fermentation, carbohy-

drate-rich substrates are converted by anaerobic microorganisms into organic acids

and alcohols, releasing hydrogen and CO

in the process. A variety of microorgan-

isms can be involved in this process, either as pure or in mixed cultures.

This process has several advantages relatively to other biological hydrogen pro-

duction methods, namely the use of a wide range of organic substrates, including

organic wastes, and higher hydrogen production rates (Hallenbeck et al. 2012 ) .

However, the economical feasibility of dark fermentation still needs to be improved,

for example through technological developments and increased knowledge on

microorganisms capable of ef ﬁ cient hydrogen production.

In dark fermentation, strictly anaerobic or facultative microorganisms break

down complex organic matter under anaerobic conditions, producing organic acids

and alcohols, and releasing H

and CO

. Carbohydrates are hydrolyzed to mono-

meric simple sugars, that are further converted to acetyl-coenzyme A (acetyl-CoA)

mainly through pentose phosphate and glycolysis pathways (Fig. 18.3 ).

The maximum theoretical yield of fermentative hydrogen production is 4 mol H

mol

−1

hexose, estimated from the reaction of glucose conversion to acetate. The

production of pyruvate from glucose yields 2 moles of reduced nicotinamide ade-

nine dinucleotide (NADH), which can be regenerated with the formation of 2 mol

of hydrogen (Fig. 18.3 ). Further breakdown of pyruvate generates acetyl-CoA and

452

A.J. Cavaleiro et al.

reduced ferredoxin (Fd

red

). Re-oxidation of ferredoxin yields hydrogen (1 mol H

mol

−1

Fd), making a total hydrogen yield of 4 moles per mol of glucose consumed.

Alternative pathways for hydrogen production have also been reported in micro-

organisms isolated from marine habitats, such as Vibrio aerogenes and Pantoea

agglomerans (Shieh et al. 2000 ; Zhu et al. 2008 ) , although yielding lower amounts

of hydrogen (around 2 mol H

mol

−1

hexose).

Fermentative hydrogen production can be carried out by a wide range of marine

microorganisms, with diverse requirements in terms of substrate preference, pH and

temperature (Wang and Wan 2009 ) . Those parameters do not only determine the

growth of the microorganisms, but also have a crucial role on the metabolic pathway

that will prevail, severely affecting the ﬁ nal hydrogen yield (Table 18.2 ). Another

important parameter, with signi ﬁ cant in ﬂ uence on hydrogen production, is hydro-

gen partial pressure ( P H

). High P H

tend to divert the metabolic pathway towards

more reduced end products (e.g. lactate and ethanol), with consequently lower H

yields. However, at higher temperatures this effect is not so severe. For example, at

25°C, P H

needs to be lower than 0.022 kPa to allow for the conversion of glucose

to acetate (reaction 2 in Table 18.2 ), while at 100°C this reaction becomes exergonic

at P H

lower than 2.2 kPa (Verhaart et al. 2010 ) .

Several archaea and bacteria capable of ef ﬁ cient hydrogen production were

isolated from marine environments, mostly from hydrothermal vents and deep-sea

Xylulose-5-P

2 H

Fd Red

Fd Ox

Frutose-6-P

Erythrose-4-P

Glyceraldehyde-3-P

Frutose-6-P

Arabinose / Xylose / ...

Ribulose

Ribulose-5-P

Xylulose-5-P

Ribose-5-P

Glyceraldehyde-3-P

Sedoheptulose-7-P

(2) Acetyl-CoA

(2) Pyruvate

(2) Glyceraldehyde-3-P

Frutose-6-P

Glucose

Glucose-6-P

Frutose-1,6-diP

2 NADH

2 NAD

Glycolysis

Pentose phosphate pathway

2 CO

2 CoA

2 NAD

2 NADH

2 NADPH

2 NADP

Fig. 18.3 Major catabolic pathways involved in the fermentation of hexoses and pentoses

453

18 The Role of Marine Anaerobic Bacteria…

geothermal heated sediments (Table 18.3 ). These microorganisms grow at very high

temperatures (extreme thermophilic and hyperthermophilic), with enhanced hydro-

lysis and thermodynamically more favorable metabolic reactions (Verhaart et al.

2010 ) . This high potential for biotechnology applications has been explored at lab-

scale, mainly in batch or fed-batch conditions, as shown in Table 18.3 .

Clostridium amygdalinum grows at mesophilic temperatures between 20 and

60°C, with an optimum around 45°C. These spore-forming anaerobic aerotolerant

bacteria are able to tolerate and grow in the presence of up to 50% air in the gas phase

(Parshina et al. 2003 ) . Thermotoga species are marine microorganisms that are able

to produce hydrogen and grow at temperatures up to 80°C (Frock et al. 2010 ) .

The anaerobic archaea reported in Table 18.3 belong to the order Thermococcales

that include two major genera, Thermococcus and Pyrococcus . Thermococcus

kodakaraensis and Thermococcus onnurineus grow between 60 and 100°C.

Pyrococcus furiosus grows at 70–103°C with an optimum around 100°C. A fast

doubling time of 37 min was reported for this microorganism. This fermentative

anaerobe is capable of utilizing maltose, starch, glycogen or cellobiose (Fiala and

Stetter 1986 ) .

As shown in Table 18.3 , hydrogen yields around 3–4 mol H

mol

−1

hexose were

obtained for the different microorganisms and substrates tested. Maximum hydro-

gen yields were achieved in pure cultures of Thermotoga species (Table 18.3 ), prob-

ably related to a bifurcating hydrogenase. This hydrogenase, recently characterized

in T. maritima (Schut and Adams 2009 ) , uses the reducing equivalents from both

NADH and reduced ferredoxin in a 1:1 ratio to produce hydrogen. Ferredoxin oxi-

dation is thermodynamically unfavorable at standard temperature and pressure con-

ditions (Δ G

¢ = +3 kJ reaction

−1

), but becomes exergonic for low P H

(e.g. Δ G ¢ =

−25 kJ reaction

−1

for P H

= 1 Pa) (Abreu et al. 2012 ) . Apparently, the exergonic

oxidation of ferredoxin is used to drive the unfavorable oxidation of NADH. To

maintain the 1:1 ratio of reducing equivalents from Fd and NADH, T. maritima

seems to use a Fd:NADH oxireductase to supply the bifurcating hydrogenase.

Table 18.2 Hydrogen-producing reactions in anaerobic processes, highlighting the theoretical

hydrogen yields

Substrate Reaction D G

(kJ reaction

−1

) Reference

(1) Glucose 1 glucose + 12 H

O → 6 HCO

−

+ 6 H

+ 12 H

+3 Thauer et al. (

1977 )

(2) Glucose 1 glucose + 2 H

O → 2 acetate

−

+ 2 CO

+ 2 H

+ 4 H

−206 Thauer et al. (

1977 )

(3) Glucose 1 glucose → 1 butyrate

−

+ 2

+ 2 H

−254 Thauer et al. (

1977 )

(4) Arabinose 1 arabinose + 1.67 H

O → 1.67

acetate

−

+ 1.67 CO

+ 1.67 H

+ 3.33 H

−192 Abreu et al. (

2012 )

(5) Arabinose 1 arabinose → 0.83 butyrate

−

+ 1.66 CO

+ 0.83 H

+ 1.66 H

−228 Abreu et al. (

2012 )

Gibbs free energies (at 25 ºC) calculated at standard conditions (solute concentrations of 1 M and

gas partial pressure of 10

Pa).

454

A.J. Cavaleiro et al.

Table 18.3 Hydrogen-producing microorganisms isolated from marine habitats

Organism Domain Isolation source

Growth

temp. (°C) Culturing type Substrate

Yield (mol H

mol

−1

hexose)

Genome

size (Mb) Ref.

Clostridium

amygdalinum

strain C9

Bacteria Sea buried crude

oil pipelines

37 Batch Xylose 3.0 (

) [1]

Thermotoga maritima

DSM 3109

Bacteria Geothermal heated

sea sediments

80 Batch Glucose 4.0 1.86 [2,3]

Thermotoga

neapolitana

DSM 4359

Bacteria Shallow submarine

hot springs

80–85 Batch Glucose 3.8 ~1.8 [4]

Batch Glucose and

Xylose

3.3 [5]

80 Batch Potato steam

peels

3.8 [6]

77 Batch Glucose 4.1 [3]

Pyrococcus furiosus

DSM 3638

Archaea Shallow marine

geothermal beach

90 Batch Cellobiose 2.8 1.9 [7,8]

Batch Maltose 3.5 [7]

Chemostat Cellobiose 3.8 [9]

Chemostat Maltose 2.9 [10]

100 Batch Glucose 3.5 [11]

Thermococcus

kodakaraensis

KOD1

Archaea Geothermal spring

in a coastal area

of Japan

85 Chemostat Starch 3.3 ~2.1 [12,13]

Thermococcus

onnurineus

NA1

Archaea Deep-sea hydrothermal

vent around Papua

New Guinea

80 Batch Starch 3.1 1.85 [14,15]

Genome being sequenced by DOE Joint Genome Institute

[1] (Jayasinghearachchi et al.

2010 ) . [2] (Nelson et al. 1999 ) . [3] (Schroder et al. 1994 ) . [4] (Munro et al. 2009 ) . [5] (de Vrije et al. 2009 ) . [6] (Mars et al. 2010 ) .

[7] (Kengen and Stams

1994a ) . [8] (Robb et al. 2001 ) . [9] (Chou et al. 2007 ) . [10] (Schicho et al. 1993 ) . [11] (Kengen and Stams 1994b ) . [12] (Fukui et al.

2005 ) . [13] (Kanai et al. 2005 ) . [14] (Bae et al. 2012 ) . [15] (Lee et al. 2008 )

455

18 The Role of Marine Anaerobic Bacteria…

Recently, the genome of several of these microorganisms has been sequenced

(Fukui et al. 2005 ) , providing new information and allowing the discovery of novel

functions. For example, the genome sequencing of Thermococcus onnurineus

allowed the identi ﬁ cation of genes coding for multiple hydrogenases (Lee et al.

2008 ) . The genome sequencing data of T. maritima DSM 3109 showed the presence

of numerous metabolic pathways involved in the degradation of many simple and

complex carbohydrates, namely glucose, xylose, mannose, starch, carboxymethyl-

cellulose (CMC), xylan, and pectin (Huber et al. 1986 ) . Moreover, 8–11% of

T. maritima genes were found to be most similar to Archaea, whereas 42–48% of

genes were most similar to Firmicutes , suggesting the occurrence of lateral gene

transference between these microbial groups (Nelson et al. 1999 ) . This mechanism

may contribute to the development of new capacities by marine bacteria, improving

the ability to live in extreme habitats and cope with environmental changes.

With genomic information, chromosomal gene disruption or replacement tech-

nology can be applied to expand the range of substrates utilized, as well as to knock-

out competitive metabolic pathways or increase species resilience. For instance,

T. kodakaraensis KOD1 cannot utilize maltose as a carbon source because of the

lack of maltose transporter (Fukui et al. 2005 ) . Introduction of the genes encoding

the respective transporter of other hyperthermophiles (such as P. furiosus and

T. litoralis ( DiRuggiero et al. 1999 ) ) could develop a new strain with the ability to

produce H

from maltose.

3 Syngas Fermentation

In the last decades, the biological process of synthesis gas fermentation has gained

interest as a sustainable technology for the production of valuable compounds and

biofuels, namely methane, ethanol and butanol. Low biodegradable materials, such as

lignocellulosic components of biomass, and other recalcitrant wastes ( e.g. naphta,

residual oil and petroleum coke) are used as substrate for syngas production through

gasi ﬁ cation (Ragauskas et al. 2006 ; Lawson et al. 2011 ) . This process is performed at

temperatures higher than 700°C with controlled supply of oxygen and/or steam.

Formed syngas is mainly composed of CO, CO

and H

(McKendry 2002 ) . Syngas can

be further converted to fuels, either through catalytic processes ( e.g. Fischer-Tropsch

for ole ﬁ ns and gasoline synthesis) (Spath and Dayton

2003 ) or microbial processes.

Biological processes, although generally slower than chemical reactions, have sev-

eral advantages over chemically catalyzed processes, such as higher speci ﬁ city, higher

yields, and generally greater resistance to poisoning (Klasson et al. 1992 ) . These

microbiological reactions occur at moderately high temperature and pressure condi-

tions, resulting in minimum energy requirements and comparative lower cost.

Acetogenic anaerobes oxidize CO to CO

and H

via CO dehydrogenase (CODH)

through a water-gas shift reaction (reaction 6 in Table 18.4 ). CODH is linked to the

Wood-Ljungdahl pathway (or reductive acetyl-CoA pathway), which plays a central

role in acetogenic CO metabolism (Fig. 18.4 ). In this pathway, H

(or CO) is used as

456

A.J. Cavaleiro et al.

an electron donor and CO

as an electron acceptor, with the formation of acetyl-Coenzyme

A (acetyl-CoA) (Fischer et al. 2008 ) . Alternatively, hydrogen and CO

can also react

to form CO, which is further converted to acetyl-CoA via acetyl-CoA synthase sys-

tem, by the activity of a CO dehydrogenase (Kopke et al. 2010 ) . Acetyl-CoA is the

precursor of volatile fatty acids ( e.g. acetate, butyrate) and alcohols, namely ethanol

and butanol. Therefore, Wood-Ljungdahl pathway represents a possible alternative to

glycolysis in the formation of this precursor, and gasi ﬁ cation of biomass constitutes a

more direct pathway towards the production of acetyl-CoA (Fig. 18.4 ).

Table 18.4 Stoichiometry and Gibbs free energy changes of some possible reactions for the

conversion of syngas components to biofuels (Henstra

2006 ; Sipma 2006 )

Reaction D G

(kJ reaction

−1

)

(6) CO + H

O → H

+ CO

−20

(7) 6CO + 3H

O → ethanol + 4CO

−222

(8) 2CO + 4H

→ ethanol + H

O −288

(9) 4CO + 8H

→ n-butanol + 3H

O −324

(10) 12CO + 5H

O → n-butanol + 8CO

−480

(11) 4CO + 2H

O → CH

+ 3CO

−211

(12) CO + 3H

→ CH

+ H

O −151

(13) HCO

−

+ 4H

+ H

→ CH

+ 3H

O −135

Gibbs free energies (at 25°C) calculated at standard conditions (solute concentrations of 1 M and

gas partial pressure of 10

Pa)

Starchy or

lignocellulosic wastes

Pre-treatment

and hydrolysis

Xylulose-5-P

Frutose-6-P

Erythrose-4-P

Glyceraldehyde-3-P

Frutose-6-P

Arabinose / Xylose/ ...

Ribulose

Ribulose-5-P

Xylulose-5-P

Ribose-5-P

Glyceraldehyde-3-P

Sedoheptulose-7-P

(2) Pyruvate

(2) Glyceraldehyde-3-P

Frutose-6-P

Glucose

Glucose-6-P

Frutose-1,6-diP

ATP

ADP

2 NADH

2 NAD

Glycolysis

Pentose phosphate pathway

ATP

ADP

4 ADP

4 ATP

Recalcitrant

materials

GASIFICATION

Wood-Ljungdahl pathway

2[H]

Formate

2[H]

Acetyl-CoA

Fig. 18.4 Pathways for the metabolic conversion of biomass and recalcitrant materials into acetyl

coenzyme A and further to biofuels

457

18 The Role of Marine Anaerobic Bacteria…

Additionally, the different syngas components (CO, H

and CO

) can be biologically

converted to methane (CH

), as show in reactions 11, 12 and 13 in Table 18.4 .

Methanogenesis is a biological process performed by prokaryotic microorganisms

from the Archaea domain, observed in a wide range of environments, such as

oceans, lakes, sediments, hydrothermal vents, anaerobic bioreactors and human and

animal gut (Sowers and Ferry

2003 ) .

CO utilization seems to be a quite widespread feature distributed among differ-

ent phyla of bacteria and archaea (Henstra et al. 2007a ) . The presence of

CO-consuming anaerobic microorganisms was detected in sediments and hydro-

thermal vents, where CO is one of the main components ( e.g. Svetlichny et al. 1991 ) .

The number of carboxydotrophic isolates retrieved from marine environments is

relatively low (Table 18.5 ), but considering the microbial diversity in CO-containing

environments this number is probably underestimated.

One of the reported CO-consuming microorganisms isolated from submarine hot

vent is the Caldanaerobacter subterraneus (Table 18.5 ). This Gram-positive, non-

motile bacterium grows chemolitotrophically on CO with the production of equimo-

lar quantities of CO

and H

. C. subterraneus is an extreme-thermophile with

optimum growth temperature at 70°C, belonging to Clostridia class. Another bacte-

rium, Acetobacterium woodii , is capable of utilizing CO or H

+ CO

at 30°C with

the formation of acetate. A. woodii is a Gram-positive bacterium with oval-shaped

cells, and was isolated from marine sediments (Balch et al. 1977 ) .

The ﬁ rst carboxydotrophic archaea described was isolated from hydrothermal

vents and belongs to the Thermococcus genera (Sokolova et al. 2004 ) . Thermococcus

strain AM4 presents coccoid cells and grows at hyperthermophilic conditions

(80°C), producing H

and CO

from CO (Table 18.5 ). Thermococcus onnurineus is

also able to grow in media supplemented with carbon monoxide, producing H

(Lee

et al. 2008 ) . A maximum hydrogen production rate of 1.55 mmol H

−1

and a

yield of 0.98 mol H

mol

−1

substrate were obtained from the degradation of CO in

batch bioreactors inoculated with pure culture of T. onnurineus (Bae et al. 2012 ) .

Complete genome sequencing of this microorganism allowed the identi ﬁ cation of

genes coding for a CO dehydrogenase (Codh) (TON_1018), besides multiple hydro-

genases (Lee et al. 2008 ) .

Carbon monoxide is also utilized by Archaeoglobus fulgidus, a hypherthermo-

philic archaea (optimal growth at 83°C) with irregular coccoid cells, isolated from

submarine hot spring. A. fulgidus can grow chemolitoautotrophically with CO form-

ing acetate (Henstra et al. 2007b ) .

The mesophilic Methanosarcina acetivorans , isolated from marine sediments,

and the hyper-thermophilic Methanocaldococcus jannaschii , isolated from hydro-

thermal vent, can utilize CO for the formation of methane. Additionally, these

archaea can also convert H

+ CO

to methane.

Other marine archaea are able to produce methane from the gaseous mixture

of CO

and H

(Sowers and Ferry 2003 ) . Mesophilic and extreme-thermophilic

microorganisms were isolated from sediments and hydrothermal vents, respec-

tively. These microorganisms mainly belong to the genera Methanococcus,

Methanocaldococcus, Methanoculleus, Methanolacinia, Methanogenium and

Methanopyrus (Sowers and Ferry 2003 ) .

458

A.J. Cavaleiro et al.

Table 18.5 Marine anaerobic microorganisms able to utilize carbon monoxide for growth

Microorganism Domain Isolation source Growth temp. (°C) Main Product

Genome Size

(Mb) References

Acetobacterium woodii Bacteria black sediment, Oyster

Pond (marine estuary),

Woods Hole, Mass

30 acetate 4,04 [1,2,3]

Caldanaerobacter

subterraneus subsp.

paci ﬁ cus

Bacteria submarine hot vent,

Okinawa Trough

70 hydrogen – [4,5]

Archaeoglobus fulgidus Archaea submarine hot spring,

Vulcano Island, Italy

83 acetate 2,18 [6,7,8]

Methanosarcina

acetivorans

Archaea Marine sediment, Scripps

Canyon, La Jolla, Calif

37 methane 5,75 [9,10,11]

Thermococcus strain AM4 Archaea East Paci ﬁ c Rise 82 hydrogen – [12]

Thermococcus onnurineus

NA1

Archaea Deep-sea hydrothermal

vent around Papua

New Guinea

80 hydrogen 1.85 [13]

[1] (Balch et al.

1977 ) . [2] (Genthner and Bryant 1987 ) . [3] (Poehlein et al. 2012 ) . [4] (Sokolova et al. 2001 ) . [5] (Fardeau et al. 2004 ) . [6] (Stetter 1988 ) . [7]

(Klenk et al.

1997 ) . [8] (Henstra 2006 ) . [9] (Sowers et al. 1984 ) . [10] (Galagan et al. 2002 ) . [11] (Rother and Metcalf 2004 ) . [12] (Sokolova et al. 2004 ) . [13]

(Lee et al.

2008 )

459

18 The Role of Marine Anaerobic Bacteria…

Despite the high potential of marine microorganisms for bioenergy production

from syngas through biological fermentation, this process is still not suf ﬁ ciently

studied. Practical applications in biotechnological process have just emerged,

requiring further research for full exploitation of its potential.

4 Electro-Chemical Processes

Harvesting electrons from bacterial metabolism as a potential sustainable energy

source has been for long subject of research interest, but only in the last few years

the prospects for practical applications improved considerably due to the develop-

ment of microbial fuel cells (MFC) with enhanced power output (Liu et al. 2004 ;

Liu and Logan 2004 ; Rabaey et al. 2003, 2004 ) .

In a MFC, biological and electrochemical processes are combined to convert dis-

solved organic matter directly into electrical current. This is achieved by diverting

the electrons produced by electrochemically active bacteria, during oxidation of the

organic matter, towards an insoluble acceptor, i.e. the anode electrode. The produced

protons diffuse through a membrane into a cathode compartment, where they react

with oxygen generating water and an electrical current from the anode towards the

cathode. In general, a MFC is a two-chamber structure, one containing the anode and

electrochemically active bacteria growing under anaerobic conditions, and another

containing the cathode (Fig. 18.5 ). The cathode chamber is kept aerobic by sparging

air in the water. Simpli ﬁ ed designs were developed with single-chamber con ﬁ gurations

where the cathode is fused to the proton exchange membrane and directly exposed to

air (Liu et al. 2004 ; Liu and Logan 2004 ; Park and Zeikus 2003 ) . Simple systems

without proton exchange membranes have been developed as well (Liu et al. 2005 ;

Liu and Logan 2004 ) . The performance of the MFC depends on several parameters,

Fig. 18.5 Schematic representation of a microbial fuel cell ( a ) and a marine microbial fuel cell ( b )

460

A.J. Cavaleiro et al.

such as substrate conversion rate, performance of the proton exchange membrane

and internal resistance of the MCF (Rabaey and Verstraete 2005 ) .

A diverse range of microorganisms has been found capable of interacting with

electrodes, usually referred as anodophiles (Park and Zeikus

2003 ) , exoelectrogens

(Logan and Regan 2006 ) , electrogenic (Debabov 2008 ) , anode-respiring (Torres

et al.

2007 ) or electrochemically active microorganisms (Chang et al. 2006 ) . The

term electricigens was also proposed speci ﬁ cally for microorganisms that completely

oxidize organic compounds to carbon dioxide with an electrode serving as the sole

electron acceptor (Lovley 2006 ) . Several mechanisms by which microorganisms

may transfer electrons to the anode of microbial fuel cells have been proposed,

including direct electron transfer through outer-surface c-type cytochromes

(Busalmen et al. 2008 ) , conductive bio ﬁ lm matrix containing cytochromes (Marcus

et al. 2007 ) or microbial nanowires (Reguera et al. 2005 ) , and indirect electron

transfer through soluble electron shuttles (Marsili et al. 2008 ) .

Microbial fuel cells were ﬁ rst developed to produce power from the electrical

current generated by bacteria, but there has been an evolution of the system for other

applications. Additional voltage added to the potential generated by the bacteria allow

for various products to be generated at the cathode, such as hydrogen (Rozendal

et al. 2006 ) , methane (Cheng et al. 2009 ) and hydrogen peroxide (Rozendal et al.

2009 ) . The terms bio-electrochemical systems (BES), microbial electrolysis cell

(MEC) and microbial electrochemical systems (MxC) have been used to describe

those technologies. Other applications include sensoring, remediation and wastewa-

ter treatment (Clauwaert et al. 2007 ; Li et al. 2008 ; Liu et al. 2004 ; Liu and Logan

2004 ; Tront et al. 2008 ; Zhang et al. 2010 ) .

The ﬁ rst practical application of marine microbial fuels cells was to power low-

energy consuming marine instrumentation, e.g. meteorological buoys capable of

measuring air temperature, pressure, relative humidity and water temperature

(Tender et al. 2008 ) . Anaerobic marine MFC are generally composed of graphite

electrodes that are placed in situ : the anode is introduced in anaerobic marine sedi-

ments and the cathode is positioned in the oxygen-rich seawater (Fig. 18.5 ). The

naturally occurring microorganisms colonize the anode and oxidize the organic

substrates present in the sediments, while in the cathode seawater constituents are

reduced. These systems are based on the natural redox gradient that occurs at the

water-sediment interface due to the microbial metabolic activity, and do not

require proton exchange membrane (Dumas et al. 2007 ; Tender et al. 2002 ) . Addition

to the sediments of insoluble slowly degrading organic substrates, such as chitin

or cellulose, or the use of anodes modi ﬁ ed with charge transfer mediators, has

resulted in power output increase (Rezaei et al.

2007, 2008, 2009 ) . For example,

Lowy and Tender ( 2008 ) reported a maximum power density of approximately

98 mW m

−2

(of anode area) at a cell voltage of 0.24 V in a marine MFC operating

with an anthraquinone-1,6-disulfonic acid (AQDS)-modi ﬁ ed graphite anode,

while a maximum value around 20 mW m

−2

at 0.30 V was attained in a similar

system assembled with a plain graphite anode.

Anoxic marine sediments have been frequently used as source of electrogenic

microorganisms (Table 18.6 ). Sequences from a denaturing gradient gel electrophoresis

461

18 The Role of Marine Anaerobic Bacteria…

Table 18.6 Electricigenic anaerobic microorganisms isolated from marine sediments or MFC

Organism Class Isolated from Growth temp. (°C) Main substrate Reference

Desulfuromonas

acetoxidans

Deltaproteobacteria Sediments from

Antarctic ocean

30 Acetate, ethanol, propanol Pfennig and Biebl

(

1976 )

Geopsychrobacter

electrodiphilus

Deltaproteobacteria Anode surface of marine

sediment MFC

22 Acetate, several OA, AA,

LCFA and Arom

Holmes et al. (

2004b )

Prolixibacter

bellariivorans

Bacteroidia Marine sediment MFC 22 Several sugars Holmes et al. (

2007 )

Rhodoferax

ferrireducens

Betaproteobacteria Isolated from coastal

aquifer sediment

25 Glucose Finneran et al. (

2003 )

OA organic acids, AA amino acids, LCFA long-chain fatty acids, Arom aromatic compounds

462

A.J. Cavaleiro et al.

(DGGE)-screened 16S rDNA clone library showed that a marine sediment used to

inoculate an MFC fed with cysteine resulted in a bacterial community in which 97%

of the sequences detected belong to the Gammaproteobacteria and were similar to

Shewanella af ﬁ nis KMM 3686 (40% of clones), with Vibrio spp. and Pseudoalteromonas

spp. being the next most frequently detected (Logan et al.

2005 ) .

The Shewanella genus has a wide environmental distribution and several species

have been retrieved from marine and freshwater habitats. These mesophilic facultative

anaerobic bacteria are capable of dissimilatory metal reduction (DMR). Member of the

genus Shewanella grow forming a bio ﬁ lm on insoluble metal oxides, which facilitates

the contact between bacteria and the metal allowing direct electron transfer. Alternative

mechanisms of electron transfer by Shewanella (nanowires or soluble electron shuttles)

have also been proposed (Flynn et al. 2012 ; Venkateswaran et al. 1999 ) . Pure cultures of

Shewanella oneidensis DSP10 and Shewanella oneidensis MR-1 were used as inocula

for power generation from lactate in marine sediment MFC (Kim et al. 2002 ; Ringeisen

et al. 2006 ) . High output power per device cross-section and volume (3 W m

−2

500 W m

−3

, respectively) was achieved in a miniature microbial fuel cell (mini-MFC)

inoculated with Shewanella oneidensis DSP10. Current and power was enhanced

30–100% by the addition of electron mediators (Ringeisen et al. 2006 ) . The genome of

this bacterium was completely sequenced in 2002, contributing for the understanding of

the mechanisms involved in Shewanella metabolism (Heidelberg et al. 2002 ) .

Other studies report a clear dominance of Deltaproteobacteria in sediment MFC.

Bond et al. ( 2002 ) veri ﬁ ed that 71% of the sequences obtained in a 16S rDNA clone

library from an anode electrode were Deltaproteobacteria , and 70% of these belonged

to the family Geobacteraceae . In a similar system, Deltaproteobacteria accounted for

76% of the sequences retrieved, from which 59% were from the family Geobacteraceae

and presented more than 95% similarity to Desulfuromonas acetoxidans (Tender et al.

2002 ) . Another group of Deltaproteobacteria sequences, most closely related to sul-

fate-reducing bacteria from the family Desulfobulbaceae , was also consistently

enriched on the anodes of marine sediment fuel cells (Holmes et al. 2004a ) . In fact, in

one ﬁ eld experiment, organisms in this cluster accounted for all of the deltaproteobac-

terial sequences and for approximately 62% of the bacterial 16S rRNA gene sequences

recovered from the current-harvesting anode (Holmes et al. 2004a ) .

Desulfuromonas acetoxidans , from the Desulfuromonadacea family of

Deltaproteobacteria , was isolated from Antarctic Ocean marine sediments and is a

strictly anaerobic, rod-shaped, Gram-negative bacterium (Pfennig and Biebl 1976 ) .

In this bacterium, the complete oxidation of organic compounds, such as acetate,

ethanol or propanol, is coupled with the reduction of a wide range of soluble and

insoluble electron acceptors (e.g. sulfur, fumarate, ferric iron or manganese)

(Table

18.6 ). Electron transfer to the anode appears to be related with a complex

network of multiheme cytochromes, from which only few have been characterized

(Alves et al. 2011 ) . Despite the reported abundance of D. acetoxidans in microbial

communities colonizing the anode of sediment MFC ( e.g. Tender et al. 2002 ) , inoc-

ulation of MFC with pure cultures of these microorganisms has not been tested.

Several mesophilic psychrotolerant bacteria, capable of DMR metabolism, have

been isolated from marine sediment MFC, namely Geopsychrobacter electrodiphilus ,

463

18 The Role of Marine Anaerobic Bacteria…

Prolixibacter bellariivorans , Rhodoferax ferrireducens (Finneran et al. 2003 ;

Holmes et al. 2004b, 2007 ) . These mesophilic microorganisms can grow and reduce

metals, e.g. iron(III), manganese (IV), at low temperatures ( ca. 4°C), although

exhibiting optimum growth around 22–25°C. Lab-scale experiments were per-

formed with MFC inoculated with a pure culture of Rhodoferax ferrireducens ,

achieving electric current intensity of 31 mA m

−2

(Chaudhuri and Lovley 2003 ) .

Higher values of electric current (209–254 mA m

−2

) were obtained at 60°C with a

MFC prepared with a thermophilic electrogenic microbial community recovered

from marine sediments (South Carolina, USA) (Mathis et al. 2008 ) . The main ribo-

type retrieved (approximately 68% of the clones) was found to be closely related

to Thermincola carboxydophila (99% similarity), with uncultured microorganisms

belonging to the Firmicutes and Deferribacteres phyla as the remaining 16S rRNA

genes.

In the last years MFC systems have developed considerably toward a simple and

robust technology. The main research efforts have been focused on the materials and

con ﬁ guration of electrodes and proton exchange membranes, as well as the design of

the MFC system. More inputs on the selection of electricigenic microbial communi-

ties are required for optimal electricity production in MFC. Marine environments

constitute a powerful source of potential electrochemically active microorganisms.

5 Conclusions and Future Prospects

Marine habitats can offer unique microbial and metabolic features with huge poten-

tial for application in bioenergy production processes. Dark fermentation, syngas

fermentation and bioelectrochemical processes were selected as demonstration

examples of the potential application of marine anaerobic bacteria and archaea in

the bioenergy ﬁ eld.

The advances in “omics” in line with newly designed and optimized biotechnol-

ogy processes, for example operating at extreme conditions of temperature and

pressure or electrically assisted, will turn marine biotechnology a ﬁ eld of growing

interest and increasing application in the sector of bioenergy.

References

Abreu A, Karakashev D, Angelidaki I, Sousa D, Alves M (2012) Biohydrogen production from

arabinose and glucose using extreme thermophilic anaerobic mixed cultures. Biotechnol

Biofuels 5:6. doi:

10.1186/1754-6834-5-6

Alves AS, Paquete CM, Fonseca BM, Louro RO (2011) Exploration of the ‘cytochromome’ of

Desulfuromonas acetoxidans , a marine bacterium capable of powering microbial fuel cells.

Metallomics 3:349–353. doi:

10.1039/C0MT00084A

Arrieta JM, Arnaud-Haond S, Duarte CM (2010) What lies underneath: conserving the oceans’

genetic resources. Proc Natl Acad Sci USA 107:18318–18324. doi:

10.1073/pnas.0911897107

464

A.J. Cavaleiro et al.

Bae SS, Kim TW, Lee HS, Kwon KK, Kim YJ, Kim M-K, Lee J-H, Kang SG (2012) H

production

from CO, formate or starch using the hyperthermophilic archaeon, Thermococcus onnurineus .

Biotechnol Lett 34:75–79. doi:

10.1007/s10529-011-0732-3

Balch WE, Schoberth S, Tanner RS, Wolfe RS (1977) Acetobacterium , a new genus of hydrogen-

oxidizing, carbon dioxide-reducing, anaerobic bacteria. Int J Syst Bacteriol 27:355–361.

doi:

10.1099/00207713-27-4-355

Barnard D, Casanueva A, Tuf ﬁ n M, Cowan D (2010) Extremophiles in biofuel synthesis. Environ

Technol 31:871–888. doi:

10.1080/09593331003710236

Bond DR, Holmes DE, Tender LM, Lovley DR (2002) Electrode-reducing microorganisms that

harvest energy from marine sediments. Science 295:483–485. doi:

10.1126/science.1066771

Børresen T, Boyen C, Dobson A, Hö ﬂ e M, Ianora A, Jaspars M, Kijjoa A, Olafsen J, Querellou J,

Rigos G, Wijffels R (2010) In: McDonough N (ed) Marine biotechnology: a new vision and

strategy for Europe. Marine Board Position Paper 15. Marine Board-ESF, Beernem

Busalmen JP, Esteve-Núñez A, Berná A, Feliu JM (2008) C-type cytochromes wire electricity-pro-

ducing bacteria to electrodes. Angew Chem Int Ed 47:4874–4877. doi:

10.1002/anie.200801310

Chang IS, Moon H, Bretschger O, Jang JK, Park HI, Nealson KH, Kim BH (2006) Electrochemically

Active Bacteria (EAB) and mediator-less microbial fuel cells. J Microbiol Biotechnol 16:163–177

Chaudhuri SK, Lovley DR (2003) Electricity generation by direct oxidation of glucose in media-

torless microbial fuel cells. Nat Biotechnol 21:1229–1232. doi:

10.1038/nbt867

Cheng S, Xing D, Call DF, Logan BE (2009) Direct biological conversion of electrical current into

methane by electromethanogenesis. Environ Sci Technol 43:3953–3958. doi:

10.1021/es803531g

Chou CJ, Shockley KR, Conners SB, Lewis DL, Comfort DA, Adams MWW, Kelly RM (2007)

Impact of substrate glycoside linkage and elemental sulfur on bioenergetics of and hydrogen

production by the hyperthermophilic archaeon Pyrococcus furiosus . Appl Environ Microbiol

73:6842–6853. doi:

10.1128/AEM.00597-07

Clauwaert P, Rabaey K, Aelterman P, De Schamphelaire L, Pham TH, Boeckx P, Boon N, Verstraete

W (2007) Biological denitri ﬁ cation in microbial fuel cells. Environ Sci Technol 41:3354–3360.

doi:

10.1021/es062580r

de Vrije T, Bakker RR, Budde MAW, Lai MH, Mars AE, Claassen PAM (2009) Ef ﬁ cient hydrogen

production from the lignocellulosic energy crop Miscanthus by the extreme thermophilic bac-

teria Caldicellulosiruptor saccharolyticus and Thermotoga neapolitana . Biotechnol Biofuels

2:12. doi:

10.1186/1754-6834-2-12

Debabov V (2008) Electricity from microorganisms. Microbiology 77:123–131. doi:

10.1134/

S002626170802001X

DiRuggiero J, Brown JR, Bogert AP, Robb FT (1999) DNA repair systems in archaea: mementos

from the last universal common ancestor? J Mol Evol 49:474–484. doi:

10.1007/PL00006570

Dumas C, Mollica A, Féron D, Basséguy R, Etcheverry L, Bergel A (2007) Marine microbial fuel

cell: use of stainless steel electrodes as anode and cathode materials. Electrochim Acta 53:468–

473. doi:

10.1016/j.electacta.2007.06.069

Eloe EA, Fadrosh DW, Novotny M, Zeigler Allen L, Kim M, Lombardo MJ, Yee-Greenbaum J,

Yooseph S, Allen EE, Lasken R, Williamson SJ, Bartlett DH (2011) Going deeper: metagenome

of a hadopelagic microbial community. PLoS ONE 6:e20388. doi:

10.1371/journal.pone.0020388

Fardeau ML, Salinas MB, L’Haridon S, Jeanthon C, Verhe F, Cayol JL, Patel BKC, Garcia JL,

Ollivier B (2004) Isolation from oil reservoirs of novel thermophilic anaerobes phylogeneti-

cally related to Thermoanaerobacter subterraneus : reassignment of T. subterraneus ,

Thermoanaerobacter yonseiensis , Thermoanaerobacter tengcongensis and Carboxydibrachium

paci ﬁ cum to Caldanaerobacter subterraneus gen. nov., sp nov., comb. nov as four novel sub-

species. Int J Syst Evol Microbiol 54:467–474. doi:

10.1099/ijs.0.02711-0

Fiala G, Stetter KO (1986) Pyrococcus furiosus sp. nov. represents a novel genus of marine het-

erotrophic archaebacteria growing optimally at 100°C. Arch Microbiol 145:56–61. doi:

10.1007/

BF00413027

Finneran KT, Johnsen CV, Lovley DR (2003) Rhodoferax ferrireducens sp. nov., a psychrotoler-

ant, facultatively anaerobic bacterium that oxidizes acetate with the reduction of Fe(III). Int J

Syst Evol Microbiol 53:669–673. doi:

10.1099/ijs.0.02298-0

465

18 The Role of Marine Anaerobic Bacteria…

Fischer CR, Klein-Marcuschamer D, Stephanopoulos G (2008) Selection and optimization of microbial

hosts for biofuels production. Metab Eng 10:295–304. doi:

10.1016/j.ymben.2008.06.009

Flynn CM, Hunt KA, Gralnick JA, Srienc F (2012) Construction and elementary mode analysis of

a metabolic model for Shewanella oneidensis MR-1. Biosystems 107:120–128. doi:

10.1016/j.

biosystems.2011.10.003

Frock AD, Notey JS, Kelly RM (2010) The genus Thermotoga : recent developments. Environ

Technol 31:1169–1181. doi:

10.1080/09593330.2010.484076

Fuhrman JA, Davis AA (1997) Widespread archaea and novel bacteria from the deep sea as shown

by 16S rRNA gene sequences. Mar Ecol Prog Ser 150:275–285. doi:

10.3354/meps150275

Fukui T, Atomi H, Kanai T, Matsumi R, Fujiwara S, Imanaka T (2005) Complete genome sequence

of the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1 and comparison with

Pyrococcus genomes. Genome Res 15:352–363. doi:

10.1101/gr.3003105

Galagan JE, Nusbaum C, Roy A, Endrizzi MG, Macdonald P, FitzHugh W, Calvo S, Engels R,

Smirnov S, Atnoor D, Brown A, Allen N, Naylor J, Stange-Thomann N, DeArellano K,

Johnson R, Linton L, McEwan P, McKernan K, Talamas J, Tirrell A, Ye WJ, Zimmer A, Barber

RD, Cann I, Graham DE, Grahame DA, Guss AM, Hedderich R, Ingram-Smith C, Kuettner

HC, Krzycki JA, Leigh JA, Li WX, Liu JF, Mukhopadhyay B, Reeve JN, Smith K, Springer

TA, Umayam LA, White O, White RH, de Macario EC, Ferry JG, Jarrell KF, Jing H, Macario

AJL, Paulsen I, Pritchett M, Sowers KR, Swanson RV, Zinder SH, Lander E, Metcalf WW,

Birren B (2002) The genome of M. acetivorans reveals extensive metabolic and physiological

diversity. Genome Res 12:532–542. doi:

10.1101/gr.223902

Genthner BRS, Bryant MP (1987) Additional characteristics of one-carbon-compound utilization

by Eubacterium limosum and Acetobacterium woodii . Appl Environ Microbiol 53:471–476

Glöckner FO, Stal LJ, Sandraa R-A, Gasol JM, O’Gara F, Hernandez F, Labrenz M, Stoica E,

Varela MM, Bordalo A, Pitta P (2012) In: Calewaert JB, McDonough N (eds) Marine microbial

diversity and its role in ecosystem functioning and environmental change. Marine Board

Position Paper 17. Marine Board-ESF, Ostend

Hallenbeck PC, Abo-Hashesh M, Ghosh D (2012) Strategies for improving biological hydrogen

production. Bioresour Technol 110:1–9. doi:

10.1016/j.biortech.2012.01.103

Heidelberg JF, Paulsen IT, Nelson KE, Gaidos EJ, Nelson WC, Read TD, Eisen JA, Seshadri R,

Ward N, Methe B, Clayton RA, Meyer T, Tsapin A, Scott J, Beanan M, Brinkac L, Daugherty

S, DeBoy RT, Dodson RJ, Durkin AS, Haft DH, Kolonay JF, Madupu R, Peterson JD, Umayam

LA, White O, Wolf AM, Vamathevan J, Weidman J, Impraim M, Lee K, Berry K, Lee C,

Mueller J, Khouri H, Gill J, Utterback TR, McDonald LA, Feldblyum TV, Smith HO, Venter

JC, Nealson KH, Fraser CM (2002) Genome sequence of the dissimilatory metal ion-reducing

bacterium Shewanella oneidensis . Nat Biotechnol 20:1118–1123. doi:

10.1038/nbt749

Henstra AM (2006) CO metabolisms of Carboxydothermus hydrogenoformans and Archaeoglobus

fulgidus . PhD thesis, Wageningen University

Henstra AM, Sipma J, Rinzema A, Stams AJM (2007a) Microbiology of synthesis gas fermentation

for biofuel production. Curr Opin Biotechnol 18:200–206. doi:

10.1016/j.copbio.2007.03.008

Henstra AM, Dijkema C, Stams AJ (2007b) Archaeoglobus fulgidus couples CO oxidation to sul-

fate reduction and acetogenesis with transient formate accumulation. Environ Microbiol

9:1836–1841. doi:

10.1111/j.1462-2920.2007.01306.x

Holmes DE, Bond DR, O’Neil RA, Reimers CE, Tender LR, Lovley DR (2004a) Microbial com-

munities associated with electrodes harvesting electricity from a variety of aquatic sediments.

Microb Ecol 48:178–190. doi:

10.1007/s00248-003-0004-4

Holmes DE, Nicoll JS, Bond DR, Lovley DR (2004b) Potential role of a novel psychrotolerant

member of the family Geobacteraceae , Geopsychrobacter electrodiphilus gen. nov., sp. nov.,

in electricity production by a marine sediment fuel cell. Appl Environ Microbiol 70:6023–

6030. doi:

10.1128/AEM.70.10.6023-6030.2004

Holmes DE, Nevin KP, Woodard TL, Peacock AD, Lovley DR (2007) Prolixibacter bellariivorans

gen. nov., sp. nov., a sugar-fermenting, psychrotolerant anaerobe of the phylum Bacteroidetes ,

isolated from a marine-sediment fuel cell. Int J Syst Evol Microbiol 57:701–707. doi:

10.1099/

ijs.0.64296-0

466

A.J. Cavaleiro et al.

Horikoshi K (1998) Barophiles: deep-sea microorganisms adapted to an extreme environment.

Curr Opin Microbiol 1:291–295. doi:

10.1016/S1369-5274(98)80032-5

Huber R, Langworthy TA, Kunig H, Thomm M, Woese CR, Sleytr UB, Stetter KO (1986)

Thermotoga maritima sp. nov. represents a new genus of unique extremely thermophilic eubac-

teria growing up to 90 ºC. Arch Microbiol 144:324–333. doi:

10.1007/BF00409880

Inagaki F, Nunoura T, Nakagawa S, Teske A, Lever M, Lauer A, Suzuki M, Takai K, Delwiche M,

Colwell FS, Nealson KH, Horikoshi K, D’Hondt S, JØrgensen BB (2006) Biogeographical dis-

tribution and diversity of microbes in methane hydrate-bearing deep marine sediments on the

Paci ﬁ c Ocean Margin. Proc Natl Acad Sci USA 103:2815–2820. doi:

10.1073/pnas.0511033103

Jayasinghearachchi HS, Singh S, Sarma PM, Aginihotri A, Lal B (2010) Fermentative hydrogen

production by new marine Clostridium amygdalinum strain C9 isolated from offshore crude oil

pipeline. Int J Hydrogen Energy 35:6665–6673. doi:

10.1016/j.ijhydene.2010.04.034

Kanai T, Imanaka H, Nakajima A, Uwamori K, Omori Y, Fukui T, Atomi H, Imanaka T (2005)

Continuous hydrogen production by the hyperthermophilic archaeon, Thermococcus koda-

karaensis KOD1. J Biotechnol 116:271–282. doi:

10.1016/j.jbiotec.2004.11.002

Kato C, Bartlett DH (1997) The molecular biology of barophilic bacteria. Extremophiles 1:111–

116. doi:

10.1007/s007920050023

Kengen SWM, Stams AJM (1994a) Growth and energy conservation in batch cultures of Pyrococcus

furiosus . FEMS Microbiol Lett 117:305–309. doi:

10.1111/j.1574-6968.1994.tb06784.x

Kengen SWM, Stams AJM (1994b) Formation of l-alanine as a reduced end-product in carbohy-

drate fermentation by the hyperthermophilic archaeon Pyrococcus furiosus . Arch Microbiol

161:168–175. doi:

10.1007/BF00276479

Kim HJ, Park HS, Hyun MS, Chang IS, Kim M, Kim BH (2002) A mediator-less microbial fuel

cell using a metal reducing bacterium, Shewanella putrefaciens . Enzyme Microb Technol

30:145–152. doi:

10.1016/S0141-0229(01)00478-1

Kivistö AT, Karp MT (2011) Halophilic anaerobic fermentative bacteria. J Biotechnol 152:114–

124. doi:

10.1016/j.jbiotec.2010.08.014

Klasson KT, Ackerson MD, Clausen EC, Gaddy JL (1992) Bioconversion of synthesis gas into liquid

or gaseous fuels. Enzyme Microb Technol 14:602–608. doi:

10.1016/0141-0229(92)90033-K

Klenk HP, Clayton RA, Tomb JF, White O, Nelson KE, Ketchum KA, Dodson RJ, Gwinn M,

Hickey EK, Peterson JD, Richardson DL, Kerlavage AR, Graham DE, Kyrpides NC,

Fleischmann RD, Quackenbush J, Lee NH, Sutton GG, Gill S, Kirkness EF, Dougherty BA,

McKenney K, Adams MD, Loftus B, Peterson S, Reich CI, Mcneil LK, Badger JH, Glodek A,

Zhou LX, Overbeek R, Gocayne JD, Weidman JF, McDonald L, Utterback T, Cotton MD,

Spriggs T, Artiach P, Kaine BP, Sykes SM, Sadow PW, DAndrea KP, Bowman C, Fujii C,

Garland SA, Mason TM, Olsen GJ, Fraser CM, Smith HO, Woese CR, Venter JC (1997) The

complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon

Archaeoglobus fulgidus . Nature 390(10.1038/37052):364–370. doi:

10.1038/37052

Kopke M, Held C, Hujer S, Liesegang H, Wiezer A, Wollherr A, Ehrenreich A, Liebl W, Gottschalk

G, Durre P (2010) Clostridium ljungdahlii represents a microbial production platform based on

syngas. Proc Natl Acad Sci USA 107:13087–13092. doi:

10.1073/pnas.1004716107

Lawson PA, Allen TD, Caldwell ME, Tanner RS (2011) Anaerobes: a piece in the puzzle for alter-

native biofuels. Anaerobe 17:206–210. doi:

10.1016/j.anaerobe.2011.05.011

Lee HS, Kang SG, Bae SS, Lim JK, Cho Y et al (2008) The complete genome sequence of

Thermococcus onnurineus NA1 reveals a mixed heterotrophic and carboxydotrophic metabo-

lism. J Bacteriol 190:7491–7499. doi:

10.1128/JB.00746-08

Li Z, Zhang X, Lei L (2008) Electricity production during the treatment of real electroplating

wastewater containing Cr

using microbial fuel cell. Process Biochem 43:1352–1358.

doi:

10.1016/j.procbio.2008.08.005

Liu H, Logan BE (2004) Electricity generation using an air-cathode single chamber microbial fuel

cell in the presence and absence of a proton exchange membrane. Environ Sci Technol

38:4040–4046. doi:

10.1021/es0499344

Liu H, Ramnarayanan R, Logan BE (2004) Production of electricity during wastewater treatment

using a single chamber microbial fuel cell. Environ Sci Technol 38:2281–2285. doi:

10.1021/

es034923g

467

18 The Role of Marine Anaerobic Bacteria…

Liu H, Cheng S, Logan BE (2005) Production of electricity from acetate or butyrate using a

single-chamber microbial fuel cell. Environ Sci Technol 39:658–662. doi:

10.1021/es048927c

Logan BE, Regan JM (2006) Electricity-producing bacterial communities in microbial fuel cells.

Trends Microbiol 14:512–518

Logan BE, Murano C, Scott K, Gray ND, Head IM (2005) Electricity generation from cysteine in

a microbial fuel cell. Water Res 39:942–952. doi:

10.1016/j.watres.2004.11.019

Lovley DR (2006) Bug juice: harvesting electricity with microorganisms. Nat Rev Microbiol

4:497–508. doi:

10.1038/nrmicro1442

Lowy DA, Tender LM (2008) Harvesting energy from the marine sediment-water interface: III.

Kinetic activity of quinone- and antimony-based anode materials. J Power Sources 185:70–75.

doi:

10.1016/j.jpowsour.2008.06.079

Marcus AK, Torres CI, Rittmann BE (2007) Conduction-based modeling of the bio ﬁ lm anode of a

microbial fuel cell. Biotechnol Bioeng 98:1171–1182. doi:

10.1002/bit.21533

Mars AE, Veuskens T, Budde MAW, van Doeveren PFNM, Lips SJ et al (2010) Biohydrogen pro-

duction from untreated and hydrolyzed potato steam peels by the extreme thermophiles

Caldicellulosiruptor saccharolyticus and Thermotoga neapolitana . Int J Hydrogen Energy

35:7730–7737. doi:

10.1016/j.ijhydene.2010.05.063

Marsili E, Baron DB, Shikhare ID, Coursolle D, Gralnick JA, Bond DR (2008) Shewanella secretes

ﬂ avins that mediate extracellular electron transfer. Proc Natl Acad Sci USA 105:3968–3973.

doi:

10.1073/pnas.0710525105

Mathis B, Marshall C, Milliken C, Makkar R, Creager S, May H (2008) Electricity generation by

thermophilic microorganisms from marine sediment. Appl Microbiol Biotechnol 78:147–155.

doi:

/10.1007/s00253-007-1266-4

McKendry P (2002) Energy production from biomass (part 3): gasi ﬁ cation technologies. Bioresour

Technol 83:55–63. doi:

10.1016/S0960-8524(01)00120-1

Munro SA, Zinder SH, Walker LP (2009) The fermentation stoichiometry of Thermotoga neapoli-

tana and in ﬂ uence of temperature, oxygen, and pH on hydrogen production. Biotechnol Prog

25:1035–1042. doi:

10.1002/btpr.201

Nagata T, Tamburini C, Arístegui J, Baltar F, Bochdansky AB, Fonda-Umani S, Fukuda H, Gogou

A, Hansell DA, Hansman RL, Herndl GJ, Panagiotopoulos C, Reinthaler T, Sohrin R, Verdugo

P, Yamada N, Yamashita Y, Yokokawa T, Bartlett DH (2010) Emerging concepts on microbial

processes in the bathypelagic ocean − ecology, biogeochemistry, and genomics. Deep Sea Res

Pt II 57:1519–1536. doi:

10.1016/j.dsr2.2010.02.019

Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ et al (1999) Evidence for lateral gene

transfer between archaea and bacteria from genome sequence of Thermotoga maritima . Nature

399:323–329. doi:

10.1038/20601

Orcutt BN, Sylvan JB, Knab NJ, Edwards KJ (2011) Microbial ecology of the dark ocean above, at,

and below the sea ﬂ oor. Microbiol Mol Biol Rev 75:361–422. doi:

10.1128/MMBR.00039-10

Park DH, Zeikus JG (2003) Improved fuel cell and electrode designs for producing electricity from

microbial degradation. Biotechnol Bioeng 81:348–355. doi:

10.1002/bit.10501

Parshina SN, Kleerebezem R, Sanz JLS, Lettinga G, Nozhevnikova AN et al (2003) Soehngenia sac-

charolytica gen. nov., sp. nov. and Clostridium amygdalinum sp. nov., two novel anaerobic, benz-

aldehyde-converting bacteria. Int J Syst Evol Microbiol 53:1791–1799. doi:

10.1099/ijs.0.02668-0

Pedrós-Alió C (2006) Genomics and marine microbial ecology. Int Microbiol 9:191–197

Pfennig N, Biebl H (1976) Desulfuromonas acetoxidans gen. nov. and sp. nov., a new anaerobic, sul-

fur-reducing, acetate-oxidizing bacterium. Arch Microbiol 110:3–12. doi:

10.1007/BF00416962

Poehlein A, Schmidt S, Kaster AK, Goenrich M, Vollmers J, Thurmer A, Bertsch J, Schuchmann

K, Voigt B, Hecker M, Daniel R, Thauer RK, Gottschalk G, Muller V (2012) An ancient path-

way combining carbon dioxide ﬁ xation with the generation and utilization of a sodium ion

gradient for ATP synthesis. PLoS One 7. doi:

10.1371/journal.pone.0033439

Rabaey K, Verstraete W (2005) Microbial fuel cells: novel biotechnology for energy generation.

Trends Biotechnol 23:291–298

Rabaey K, Lissens G, Siciliano SD, Verstraete W (2003) A microbial fuel cell capable of convert-

ing glucose to electricity at high rate and ef ﬁ ciency. Biotechnol Lett 25:1531–1535.

doi:

10.1023/A:1025484009367

468

A.J. Cavaleiro et al.

Rabaey K, Boon N, Siciliano SD, Verhaege M, Verstraete W (2004) Biofuel cells select for microbial

consortia that self-mediate electron transfer. Appl Environ Microbiol 70:5373–5382.

doi:

10.1128/AEM.70.9.5373-5382.2004

Ragauskas AJ, Williams CK, Davison BH, Britovsek G, Cairney J, Eckert CA, Frederick WJ, Hallett

JP, Leak DJ, Liotta CL, Mielenz JR, Murphy R, Templer R, Tschaplinski T (2006) The path for-

ward for biofuels and biomaterials. Science 311:484–489. doi:

10.1126/science.1114736

Reguera G, McCarthy KD, Mehta T, Nicoll JS, Tuominen MT, Lovley DR (2005) Extracellular

electron transfer via microbial nanowires. Nature 435:1098–1101. doi:

10.1038/nature03661

Rezaei F, Richard TL, Brennan RA, Logan BE (2007) Substrate-enhanced microbial fuel cells for

improved remote power generation from sediment-based systems. Environ Sci Technol

41:4053–4058. doi:

10.1021/es070426e

Rezaei F, Richard TL, Logan BE (2008) Enzymatic hydrolysis of cellulose coupled with electric-

ity generation in a microbial fuel cell. Biotechnol Bioeng 101:1163–1169. doi:

10.1002/bit.

22015

Rezaei F, Richard TL, Logan BE (2009) Analysis of chitin particle size on maximum power gen-

eration, power longevity, and Coulombic ef ﬁ ciency in solid−substrate microbial fuel cells.

J Power Sources 192:304–309. doi:

10.1016/j.jpowsour.2009.03.023

Ringeisen BR, Henderson E, Wu PK, Pietron J, Ray R, Little B, Bif ﬁ nger JC, Jones-Meehan JM

(2006) High power density from a miniature microbial fuel cell using Shewanella oneidensis

DSP10. Environ Sci Technol 40:2629–2634. doi:

10.1021/es052254w

Robb FT, Maeder DL, Brown JR, DiRuggiero J, Stump MD et al (2001) Genomic sequence of

hyperthermophile, Pyrococcus furiosus : implications for physiology and enzymology.

Hyperthermophilic Enzymes Pt A 330:134–157. doi:

10.1016/S0076-6879(01)30372-5

Rother M, Metcalf WW (2004) Anaerobic growth of Methanosarcina acetivorans C2A on carbon

monoxide: an unusual way of life for a methanogenic archaeon. Proc Natl Acad Sci USA

101:16929–16934. doi:

10.1073/pnas.0407486101

Rozendal RA, Hamelers HVM, Euverink GJW, Metz SJ, Buisman CJN (2006) Principle and per-

spectives of hydrogen production through biocatalyzed electrolysis. Int J Hydrogen Energy

31:1632–1640. doi:

10.1016/j.ijhydene.2005.12.006

Rozendal RA, Leone E, Keller J, Rabaey K (2009) Ef ﬁ cient hydrogen peroxide generation from

organic matter in a bioelectrochemical system. Electrochem Commun 11:1752–1755. doi:

10.1016/j.

elecom.2009.07.008

Schicho RN, Ma K, Adams MWW, Kelly RM (1993) Bioenergetics of sulfur reduction in the

hyperthermophilic archaeon Pyrococcus furiosus . J Bacteriol 175:1823–1830

Schippers A, Kock D, Höft C, Köweker G, Siegert M (2012) Quanti ﬁ cation of microbial commu-

nities in subsurface marine sediments of the Black Sea and off Namibia. Front Microbiol 3:1–

11. doi:

10.3389/fmicb.2012.00016

Schroder C, Selig M, Schonheit P (1994) Glucose fermentation to acetate, CO

and H

in the

anaerobic hyperthermophilic eubacterium Thermotoga maritima : involvement of the Embden-

Meyerhof pathway. Arch Microbiol 161:460–470. doi:

10.1007/BF00307766

Schut GJ, Adams MWW (2009) The iron-hydrogenase of Thermotoga maritima utilizes ferre-

doxin and NADH synergistically: a new perspective on anaerobic hydrogen production.

J Bacteriol 191:4451–4457. doi:

10.1128/JB.01582-08

Shieh WY, Chen A-L, Chiu H-H (2000) Vibrio aerogenes sp. nov., a facultatively anaerobic marine

bacterium that ferments glucose with gas production. Int J Syst Evol Microbiol 50:321–329.

doi:

10.1099/00207713-50-1-321

Sipma J (2006) Microbial hydrogenogenic CO conversions: applications in synthesis gas

puri ﬁ cation and biodesulfurization. PhD thesis, Wageningen University.

Sokolova TG, González JM, Kostrikina NA, Chernyh NA, Tourova TP, Kato C, Bonch-

Osmolovskaya EA, Robb FT (2001) Carboxydobrachium paci ﬁ cum gen. nov., sp. nov., a new

anaerobic, thermophilic, CO-utilizing marine bacterium from Okinawa Trough. Int J Syst Evol

Microbiol 51:141–149. doi:

10.1099/00207713-51-1-141

Sokolova TG, Jeanthon C, Kostrikina NA, Chernyh NA, Lebedinsky AV, Stackebrandt E, Bonch-

Osmolovskaya EA (2004) The ﬁ rst evidence of anaerobic CO oxidation coupled with H

469

18 The Role of Marine Anaerobic Bacteria…

production by a hyperthermophilic archaeon isolated from a deep-sea hydrothermal vent.

Extremophiles 8:317–323. doi:

10.1007/s00792-004-0389-0

Sowers KR, Ferry JG (2003) Methanogenesis in the marine environment. Encyclopedia of envi-

ronmental microbiology. Wiley, New York

Sowers KR, Baron SF, Ferry JG (1984) Methanosarcina acetivorans sp. nov., an acetotrophic meth-

ane-producing bacterium isolated from marine sediments. Appl Environ Microbiol 47:971–978

Spath PL, Dayton DC (2003) Preliminary screening – technical and economic assessment of syn-

thesis gas to fuels and chemicals with emphasis on the potential for biomass-derived syngas.

National Renewable Energy Laboratory, U.S. Department of Energy

Stetter KO (1988) Archaeoglobus fulgidus gen. nov., sp. nov. a new taxon of extremely thermo-

philic archaebacteria. Syst Appl Microbiol 10:172–173

Sun S, Chen J, Li W, Altintas I, Lin A, Peltier S, Stocks K, Allen EE, Ellisman M, Grethe J, Wooley

J (2011) Community cyberinfrastructure for advanced microbial ecology research and analysis:

the CAMERA resource. Nucleic Acids Res 39:D546–D551. doi:

10.1093/nar/gkq1102

Svetlichny VA, Sokolova TG, Gerhardt M, Kostrikina NA, Zavarzin GA (1991) Anaerobic

extremely thermophilic carboxydotrophic bacteria in hydrotherms of Kuril Islands. Microbiol

Ecol 21:1–10

Tender LM, Reimers CE, Stecher HA, Holmes DE, Bond DR, Lowy DA, Pilobello K, Fertig SJ,

Lovley DR (2002) Harnessing microbially generated power on the sea ﬂ oor. Nat Biotechnol

20:821–825. doi:

10.1038/nbt716

Tender LM, Gray SA, Groveman E, Lowy DA, Kauffman P, Melhado J, Tyce RC, Flynn D,

Petrecca R, Dobarro J (2008) The ﬁ rst demonstration of a microbial fuel cell as a viable power

supply: powering a meteorological buoy. J Power Sources 179:571–575. doi:

10.1016/j.

jpowsour.2007.12.123

Thauer RK, Jungermann K, Decker K (1977) Energy conservation in chemotrophic anaerobic

bacteria. Bacteriol Rev 41:100–180

Torres CI, Marcus AK, Rittmann BE (2007) Kinetics of consumption of fermentation products by

anode-respiring bacteria. Appl Microbiol Biotechnol 77:689–697. doi:

10.1007/s00253-007-

1198-z

Tront JM, Fortner JD, Plötze M, Hughes JB, Puzrin AM (2008) Microbial fuel cell biosensor for

in situ assessment of microbial activity. Biosens Bioelectron 24:586–590. doi:

10.1016/j.

bios.2008.06.006

Venkateswaran K, Moser DP, Dollhopf ME, Lies DP, Saffarini DA, MacGregor BJ, Ringelberg

DB, White DC, Nishijima M, Sano H, Burghardt J, Stackebrandt E, Nealson KH (1999)

Polyphasic taxonomy of the genus Shewanella and description of Shewanella oneidensis sp.

nov. Int J Syst Bacteriol 49:705–724. doi:

10.1099/00207713-49-2-705

Venter JC, Remington K, Heidelberg JF, Halpern AL, Rusch D, Eisen JA, Wu D, Paulsen I, Nelson KE,

Nelson W, Fouts DE, Levy S, Knap AH, Lomas MW, Nealson K, White O, Peterson J, Hoffman J,

Parsons R, Baden-Tillson H, Pfannkoch C, Rogers YH, Smith HO (2004) Environmental genome

shotgun sequencing of the Sargasso Sea. Science 304:66–74. doi:

10.1126/science.1093857

Verhaart MRA, Bielen AAM, van der Oost J, Stams AJM, Kengen SWM (2010) Hydrogen pro-

duction by hyperthermophilic and extremely thermophilic bacteria and archaea: mechanisms

for reductant disposal. Environ Technol 31:993–1003. doi:

10.1080/09593331003710244

Wang JL, Wan W (2009) Factors in ﬂ uencing fermentative hydrogen production: a review. Int J

Hydrogen Energy 34:799–811. doi:

10.1016/j.ijhydene.2008.11.015

Zhang T, Gannon SM, Nevin KP, Franks AE, Lovley DR (2010) Stimulating the anaerobic degra-

dation of aromatic hydrocarbons in contaminated sediments by providing an electrode as the

electron acceptor. Environ Microbiol 12:1011–1020. doi:

10.1111/j.1462-2920.2009.02145.x

Zhang Y, Su X, Chen F, Wang Y, Jiao L, Dong H, Huang Y, Jiang H (2012) Microbial diversity in

cold seep sediments from the northern South China Sea. Geosci Front 3:301–316. doi:

10.1016/j.

gsf.2011.11.014

Zhu D, Wang G, Qiao H, Cai J (2008) Fermentative hydrogen production by the new marine

Pantoea agglomerans isolated from the mangrove sludge. Int J Hydrogen Energy 33:6116–

6123. doi:

10.1016/j.ijhydene.2008.07.008

471

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

Abstract Research on antimicrobial peptides is continuously growing because of

the possibilities of applications they offer in different domains including food safety,

human medicine, and plant biocontrol (phytosanitary).

The present chapter is aiming to shed lights on diversity, function and structure

of ribosomally synthesized antimicrobial peptides from Gram positive bacteria usually

referred to as bacteriocins. In bacterial systems, competition is often driven by the

production of bacteriocins; narrow spectrum proteinaceous toxins that serve to kill

closely related species providing the producer better access to limited resources.

Despite high levels of bacteriocin diversity, these proteins share many general char-

acteristics. They are generally high molecular weight protein antibiotics that kill

N. B. Omar • H. Abriouel • A. Galvez

Área de Microbiología, Departamento de Ciencias de la Salud, Facultad de Ciencias

Experimentales, Edif. B3 , Universidad de Jaén ,

Campus Las Lagunillas s/n. 23071 , Jaén , Spain

I. Fliss

STELA Dairy Research Center, Nutraceuticals and Functional Foods Institute ,

Université Laval , Québec , QC , Canada

M. Á. Ferandez-Fuentes

Área de Microbiología, Departamento de Ciencias de la Salud, Facultad de Ciencias

Experimentales, Edif. B3 , Universidad de Jaén ,

Campus Las Lagunillas s/n. 23071 , Jaén , Spain

Laboratoire des Procédés Biologiques, Génie Enzymatique et Microbien (ProBioGEM),

UPRES-EA 1026, Polytech’Lille/IUTA , Université Lille Nord de France ,

Avenue Paul Langevin , 59655 , Villeneuve d’Ascq Cedex , France

D. Drider (

Laboratoire des Procédés Biologiques, Génie Enzymatique et Microbien (ProBioGEM),

UPRES-EA 1026, Polytech’Lille/IUTA , Université Lille Nord de France ,

Avenue Paul Langevin , 59655 Villeneuve d’Ascq Cedex , France

e-mail: djamel.drider@univ-lille1.fr

Chapter 19

Bacteriocins: Natural Weapons for Control

of Food Pathogens

Nabil Ben Omar , Hikmate Abriouel , Ismail Fliss , Miguel Ángel

Ferandez-Fuentes , Antonio Galvez , and Djamel Drider

472

N.B. Omar et al.

closely related strains or species. The bacteriocin gains entry into the target cell by

recognizing speci ﬁ c cell surface receptors and then kills the cell by forming

ion-permeable channels in the cytoplasmic membrane, by nonspeci ﬁ c degradation

of cellular DNA, by inhibition of protein synthesis through the speci ﬁ c cleavage of

16s rRNA, or by cell lysis. In this chapter, the limits and performances of production

will be presented. Further clear evidences on their aptitudes to master growth of

microbes will be discussed as well as the main achievements and perspectives of

their applications in food, environment and medical domains.

1 Lactic Acid Bacteria Bacteriocins: Brief Overview

This chapter is focused on the role of lactic acid bacteria (LAB) bacteriocins in the

control of food pathogens, which constitute a serious public concern worldwide.

LAB-bacteriocins are produced by strains belonging to the genera of Lactococcus,

Lactobacillus, Leuconostoc, Enterococcus, Pediococcus, Carnobacterium and

Streptococcus . In 1976, Tagg and coworkers have de ﬁ ned bacteriocins as proteina-

ceous compounds with inhibition activity against related bacteria. The continuing

research on LAB-bacteriocins has shed light on their capacities of antagonism.

Remarkably, LAB-bacteriocins were reported to be active against Gram negative

bacteria such as Campylobacter jejuni (Cole et al. 2006 ; Stern et al. 2006 ; Nazef

et al. 2008 ; Messaoudi et al. 2011 ) . LAB bacteriocins should be de ﬁ ned as naturally

and ribosomally-synthesized antimicrobial peptides displaying a large antagonism

spectrum. The LAB bacteriocins are documented in an online database, named

BACTIBASE (Hammami et al. 2010 ) that is available at http://bactibase.pfba-lab-

tun.org . Overall, BACTIBASE provides physicochemical, structural, microbiological,

and taxonomic informations about bacteriocins produced by both Gram-positive

and Gram-negative bacteria.

LAB bacteriocins have been subjected to different classi ﬁ cation schemes due

to their biochemical and genetic diversities and their bioactivities. The ﬁ rst

classi ﬁ cation scheme was provided by Klaenhammer ( 1993 ) . As new bacteriocin

members were identi ﬁ ed and being characterized, this classi ﬁ cation was amended

at different instances (Tagg et al. 1976 ; Cotter et al. 2005 ) . In 2001, Cintas and col-

laborators have proposed a classi ﬁ cation scheme including four main classes,

among which: Class I lantibiotics are post-translationally modi ﬁ ed, heat-stable,

low molecular mass peptides (<5 kDa) characterized by the presence of unusual

amino acids, such as lanthionine or β -methyllanthionine. Class II bacteriocins are

small heat-stable, unmodi ﬁ ed peptides (<10 kDa) and are subdivided into three

subclasses, namely, class IIa (pediocin-like), class IIb (two-peptide), and IIc (other

[i.e., non-pediocin-like], one-peptide bacteriocins). Class III bacteriocins are

large (>30 kDa) and heat-labile proteins. Lastly, class IV bacteriocins include

cyclic peptides with covalently linked N- and C-termini. Recently, an updated

classi ﬁ cation was reported by Rea et al. (

2011 ) . This novel classi ﬁ cation is brie ﬂ y

described below.

473

19 Bacteriocins: Natural Weapons for Control…

1.1 Class Ia ( Lantibiotics )

Bacteriocins of this class are <5 kDa and 28 amino acids in length. Lantibiotics

undergo post-translational modi ﬁ cations leading to unusual aminoacids such as

lanthionine (Lan), and/or B-methyllanthioonine (meLan) and dehydroalanine (Dha).

The linear or type A lantibiotics comprise bacteriocins such as nisin, subtilin or

epidermin. The type A lantibiotics are known to be elongated, cationic and

amphiphilic and could contain until 34 amino acids in length. They act by pore

forming leading to the death of the target cell upon a cascade of damages like the

dissipation of membrane potential and ef ﬂ ux of small molecules. The globular

lantibiotics or type B lantibiotics such as merscaidin, mutacin and lacticin 481 are

structurally more compact, they are small peptides less than 19 aminoacids. Their

mode of action is based on the inhibition of lipid II, which is the key precursor of

peptidoglycan in the cell wall. Remarkably, nisin, which is a linear lantibiotic (type

A lantibiotic) could act by pore forming or lipid II inhibition (Breukink et al.

1999 ) .

As this classi ﬁ cation has become misleading, the novel classi ﬁ cation of lantibiotics

contains four subclasses (subclass I, subclass II, subclass III and subclass IV).

1.2 Class Ib ( Labyrinthopeptins )

Recently identi ﬁ ed (Meindl et al. 2010 ) , these peptide are characterized by their

“labyrinthine” structure and the presence of “labionin”, which is a carbocyclic,

post-translationally modi ﬁ ed amino acid.

1.3 Class Ic ( Sactibiotics )

Bacteriocins of this class are subtilosin A and Thuricin CD produced by Bacillus

subtilis and Bacillus thuringiensis 6431, respectively. Subtilosin A is a circular pep-

tide, post-translationally modi ﬁ ed with cross-linkages between the sulphur and

cystein residues. Thuracidin CD is a dipeptide (Trn α , Trn β ) with intramolecular

crosslinkages between three cysteine residues in each peptide and the α -carbons.

1.4 Class II: Unmodi ﬁ ed Bacteriocins

We ﬁ nd in this class peptides less than 10 kDa with linear or cyclic structures.

This class has been committed to intensive investigation and despite its heteroge-

neous traits, different classi ﬁ cations were suggested. Currently, four subclasses

(Class IIa, Class IIb, Class IIc and Class IVd) are proposed and they are brie ﬂ y

described below.

474

N.B. Omar et al.

1.4.1 Class IIa (Pediocin-Like Bacteriocins)

Bacteriocins of this subclass are certainly of major interest because of their poten-

tial as food preservatives but also as alternatives to current antibiotics. Class IIa

bacteriocins display activity against Listeria strains and even against other patho-

gens such as Clostridium spp. There are more than 30 bacteriocins in this repertoire

with speci ﬁ cities. Class IIa bacteriocins are ranking from 37 to 57 amino acids in

length and all of them share a YGNGV box at the N-terminal moitiey. Class IIa

bacteriocins are also named cystibiotics because they contain at least two cysteines

in the C-terminal part leading to disulphide bond formation. It happens that models

of class IIa bacteriocins such as divercin V41 could harbor four cystein residues, in

which two residues are located in the C-terminal part and the other two in the

N-terminal parts, respectively.

1.4.2 Class IIb (Two Peptide Bacteriocins)

Class IIb bacteriocins consist of two distinct peptides, which are necessary to obtain

high antimicrobial activity. The antimicrobial activity requires the presence of both

peptides at equal amounts. There are at least 16 bacteriocins nowadays known as

class IIb bacteriocins. Studies of the mode of action of class IIb bacteriocins have

revealed a leakage in the membrane of the sensitive target bacteria. However,

speci ﬁ cities in the mode of action, mainly in the movement of the ions across the

membrane, have been reported for plantaricin E/F and plantaricin J/K. All class IIb

bacteriocins comprise between 30 and 50 aminoacids, they are cationic, amphi-

phatic, membrane active and synthesized as pre-peptide cut of and vehiculed outcell

by the dedicated ABC transporter. It was also demonstrated that the synthesis of

class IIb bacteriocins is regulated in some bacteria by three component regulatory

systems.

1.4.3 Class IIc (Circular Bacteriocins)

Structurally, the circular bacteriocins are characterized by the head –to-tail

cyclization of their backbone. They are produced by LAB as well as by non-LAB

strains. The best characterized are Enterocin AS-48, grassericin, carnocyclin A

and lactocyclicin A. They are known to have potent antimicrobial activity, which

is thought to be attributed to their circular structure. In this sense, it has been

established that the enzymatic hydrolysis of Enterocin AS-48 by thermolysin

releases a linear component lacking bioactivity despite its helical structure.

Overall, circular bacteriocins (class IIc bacteriocins) display broad spectra includ-

ing activity against food spoilage pathogens. Enterocin AS-48 and lactocyclicin Q

are also active against Gram negative bacteria.

475

19 Bacteriocins: Natural Weapons for Control…

1.4.4 Class IId (Linear and Non-pediocin Like Bacteriocins)

Class IId bacteriocins have no signi ﬁ cant similarities to the other class II bacteriocins.

Class IId bacteriocins are synthesized by the sec -independent double glycine motif

and then are transported by ABC transporters. Some of the class IId bacteriocins are

synthesized without an N-terminal leader sequence or signal peptide. For this reason,

they are named “leaderless bacteriocins”.

Enterocin L50, produced by Enterococcus faecium L50, consists of two peptides

named Enterocin L50A (EntL50A) and Enterocin L50B (EntL50B), which are

highly similar (70%).

1.5 Bacteriolysins

They were formerly denominated class III bacteriocins. Overall, they are large, heat

labile proteins. In this class, we can ﬁ nd helveticin J from Lactobacillus helveticus

J and enterolysin from Enterococcus faecalis . It should be noted that other class IId

bacteriocins from non LAB exist, such as zoocin A, linocin and millericin.

2 Bacteriocins and Control of Food Pathogens

In the last years, bacteriocins have been considered very promising agents for

ﬁ ghting foodborne pathogens (García et al. 2010 ; Mills et al. 2011 ) . Even though

bacteriocins are produced by either Gram-positive or Gram-negative bacteria,

the most accepted peptides for food preservation or even clinical applications

are those produced by Gram-positive bacteria, especially lactic acid bacteria

(LAB). Those bacteriocins are produced by a bacterial group which is generally

present in different foodstuffs and even intensively used in foods, moreover,

LAB are generally recognized as safe (GRAS status) (Carr et al. 2002 ; Pedersen

et al. 2005 ) and their Quali ﬁ ed Presumption of Safety (QPS) has been proposed

by the EFSA ( 2007 ). These peptides were described in detail and many appli-

cations have been proposed (Acuña et al. 2010 ; De Vuyst and Leroy 2007 ) .

Although a number of peptides were described in the literature so far, nisin

and pediocin PA-1 are better positioned than the other peptides as food

preservatives.

This book chapter focuses on the role ascribed to the LAB bacteriocins in the

control of foodborne pathogens able to grow in different food matrices. The main

bacterial pathogens of concern in food industry are those able to survive and

multiply in the raw materials, such as Listeria monocytogenes , Staphylococcus

aureus , Escherichia coli, Salmonella spp., Bacilli and Clostridia .

476

N.B. Omar et al.

2.1 Listeria monocytogenes

Through the last two decades, many studies have been carried out to search for

bacteriocin producing strains able to inhibit Listeria monocytogenes. The applica-

tion of bacteriocins or bacteriocin producing starter cultures in food can provide an

additional hurdle to L. monocytogenes and can possibly ensure the safety of food

products in the future. Among all bacteriocins tested, nisin (in the commercial form

Nisaplin) has been tested extensively in foods. In the dairy industry, nisin has found

many applications, especially in processed cheeses and cheese products (e.g., hard

cheese, soft white cheeses, slices, spreads, sauces, dips) to prevent proliferation of

L. monocytogenes (Davies and Delves-Broughton

1999 ; Thomas and Delves-

Broughton 2001 ) . In skim milk, whey, or simulated milk ultra ﬁ ltrate media, the use

of a combination of nisin and pulsed electric ﬁ elds (PEFs) resulted in a signi ﬁ cant

inhibition of L. monocytogenes (Calderón-Miranda et al . 1999 ) .

Addition of nisin to pasteurized liquid whole egg reduced the viable counts

of L. monocytogenes and increased the shelf-life of the refrigerated product

(Delves-Broughton et al . 1992 ; Knight et al . 1999 ; Schuman and Sheldon 2003 ) .

Both nisin and pediocin PA-1/Ach acted synergistically with heat treatments

against L. monocytogenes (Knight et al . 1999 ; Muriana 1996 ) in liquid whole

egg and in egg white during pasteurization (Boziaris et al . 1998 ) .

Although the application of nisin in meats is limited due to several factors such

as its poor solubility, interaction with phospholipids, and inactivation by glutathione

(Montville et al . 1995 ; Rayman et al . 1983 ; Rose et al . 1999 ; Stergiou et al . 2006 ) ,

addition of nisin has shown to extend the lag phase of L. monocytogenes inoculated

into minced buffalo meat (Pawar et al . 2000 ) . In meat marketing, prime cuts are

often vacuum-packaged in order to extend their shelf-life during distribution before

preparation of retail cuts. As a result of these practices, meat can become contami-

nated with L. monocytogenes and spoilage bacteria that may shorten the shelf-life of

retail meats. Under modi ﬁ ed atmosphere packaging, nisin was able to completely

inhibit the growth of L . monocytogenes in pork (Fang and Lin 1994a, b ) . In sausages

and other fermented meat products, addition of nisin induced a signi ﬁ cant inhibition

of L. monocytogenes . The lower pH of sausages compared to fresh meats may

increase the solubility of nisin, and probably the antimicrobial activity as well. Addition

of nisin alone was effective in inhibiting L. monocytogenes in sucuk, a Turkish

fermented sausage (Hampikyan and Ugur 2007 ) .

The effectiveness of nisin in sausages increases in combination with other

antimicrobials. The combination of nisin and a grape seed extract showed an

enhanced antibacterial activity in refrigerated turkey frankfurters with reduction

of L. monocytogenes populations to undetectable levels (Sivarooban et al .

2007 ) .

In ham and/or bologna sausages, a mixture of nisin-lysozyme-EDTA inhibited

the growth of Leuconostoc mesenteroides and L. monocytogenes (Gill and Holley

2000a , b ) . Activity of nisin against L. monocytogenes in minced beef was potenti-

ated with thyme essential oil, decreasing the impact of the oil on the meat organo-

leptic properties (Solomakos et al . 2008 ) .

477

19 Bacteriocins: Natural Weapons for Control…

Although effective, the addition of bacteriocin as food ingredients may be limited

by the degradation of the active compound by different bacterial proteases especially

in fermented foods or by the interaction of the bacteriocin with several food

compounds such as fat. The use of bacteriocin-producing starter or adjunct cultures

in foods represents therefore an ef ﬁ cient alternative to overcome these problems.

It may also signi ﬁ cantly reduce costs associated with nisin production, puri ﬁ cation and

processing. Nisin-producing strains have been reported to inhibit L. monocytogenes

in several types of cheeses, such as cheddar cheese (Benech et al.

2003 ) , cottage

cheese (Benkerroum and Sandine 1988 ) or Camembert (Maisnier-Patin et al . 1992 ;

Sulzer and Busse 1991 ) . In Manchego cheese made from raw ewe’s milk, Lactococcus

lactis subsp. lactis ESI 515 reduced viable counts of L. innocua by 4.08 log units

after 60 days of ripening, and the produced nisin was detected in cheese through the

ripening period.

In vegetables, L. monocytogenes can proliferate rapidly and several listeriosis

outbreaks have been associated with fresh produce, such as raw celery, tomatoes,

and lettuce (Beuchat 1996 ) . Leverentz et al . ( 2003 ) showed that nisin reduced

L. monocytogenes populations on honeydew melon slices and apple slices. The list-

ericidal effect was enhanced by application of nisin in combination with a phage

mixture (Leverentz et al . 2003 ) . Exposure of L. monocytogenes Scott A to nisin in

tofu resulted in an initial reduction of viable counts followed by regrowth of survivors

to nisin during further incubation (Schillinger et al . 2001 ) . Nisin was tested alone or

in combination with sodium lactate, potassium sorbate, phytic acid, and citric acid

as possible sanitizer treatments for reducing the population of L. monocytogenes on

cabbage, broccoli, and mung bean sprouts (Bari et al . 2005 ) . After a 1-min wash, a

signi ﬁ cant reduction of L. monocytogenes was observed on cabbage and broccoli,

with nisin-phytic acid combination (Bari et al . 2005 ) .

Lacticin 3147 produced by L. lactis subsp. lactis DPC3147 is another bacteriocin

with a high potential for application in the preservation of foods (Ross et al . 1999 ) .

Lacticin 3147 powder was shown to rapidly inactivate L. monocytogenes Scott

A in an infant milk formulation (Morgan et al . 1999 ) . In natural yogurt and in

cottage cheese supplemented with lacticin 3147 powder, viable cell numbers of

L. monocytogenes were reduced by 99 and by 85%, respectively, within 2 h (Morgan

et al . 2001 ) . An increased bactericidal effect was reported for the combined treat-

ment of lacticin 3147 concentrates and HHP against L. monocytogenes in milk and

whey (Morgan et al . 2000 ) . The lactocin 705 is another bacteriocin produced by

Lactobacillus casei CRL 705 (Vignolo et al. 1996 ) which was highly effective

against L. monocytogenes in beef slurry (Vignolo et al . 1998 ) and also in a meat

system when used in combination with enterocin CRL35 produced by E. faecium

CRL35 (Farías et al. 1994 ) and nisin (Vignolo et al . 2000 ) .

Application of enterococcal bacteriocins on foods to inhibit the growth of

L. monocytogenes has been the focus of many investigations (reviewed by Foulquié

Moreno et al . 2006 ; Giraffa 1995 ) . An early report indicated that bacteriocin from

E. faecium DPC1146 had a rapid bactericidal effect on L. monocytogenes in milk

(Parente and Hill 1992 ) . A decrease of viable L. monocytogenes was also reported

in enterocin-added yogurt and in Saint-Paulin cheese (Lauková et al . 2001 ) .

478

N.B. Omar et al.

However, after 6 weeks and at the end of the experiment, the difference in surviving

listeria was only 1 or 0.7 log units compared to the control cheese (Lauková et al .

2001 ) . In “bryndza” (a traditional Slovak dairy product from sheep milk), the addi-

tion of enterocin CCM 4231 has reduced the levels of L. monocytogenes Li1 during

a 7-day ripening period (Lauková and Czikková

2001 ) . In contrast, when concen-

trated enterocin CRL35 was added to goat cheese, the population of L. monocyto-

genes diminished by 9 log units by the end of the ripening period without affecting

the cheese quality (Farías et al .

1999 ) . Similarly, cultured broths obtained from raw

ewe’s milk containing enterocin 4 (enterocin AS-48) signi ﬁ cantly reduced viable

counts of L. monocytogenes (Rodríguez et al . 1997 ) , whilst in soy milk the enterocin

CCM 4231 has completely eliminated L. monocytogenes . The enterococcal faecal

CCM4231 was able to grow and produce enterocin in soy milk (Lauková and

Czikková 1999 ) . In fermented meat, enterocins can inhibit Listeria , as shown for

enterocin CCM 4231 when incorporated in dry fermented Hornád salami (Lauková

et al . 1999c ) , and enterocins A and B in espetect (traditional Spanish sausages;

Aymerich et al . 2000 ) . In a meat sausage model system, added enterocin AS-48

inhibited the growth of L. monocytogenes (Ananou et al . 2005a, b ) .

Bacteriocinogenic enterococci could be used as cocultures for preservation of

meat products (e.g., fermented sausages and sliced vacuum-packed cooked meat

products) and for the control of emergent pathogenic and spoilage bacteria (Foulquié

Moreno et al . 2006 ; Hugas et al . 2003 ) . When used as starter cultures in sausage

fermentation, the bacteriocinogenic strains E. faecium CCM 4231 and E . faecium

RZS C13 were partially competitive and strongly inhibited the growth of Listeria

spp. (Callewaert et al . 2000 ) . E. faecium CTC492 (producer of enterocins A and B)

partially prevented ropiness due to Lactobacillus sakei CTC746 in sliced vacuum-

packaged cooked ham (Aymerich et al . 2002 ) . The strain E. casseli ﬂ avus IM 416K1

(producer of enterocin 416 K1) was able to eliminate L. monocytogenes in arti ﬁ cially

inoculated “cacciatore” Italian sausages (Sabia et al . 2003 ) . The cyclic bacteriocin

enterocin AS-48 produced in situ by an E. faecalis strain or a food-grade E. faecium

transconjugant controlled the growth of L. monocytogenes in a meat model system

(Ananou et al . 2005a, b ) .

On the other hand, a limited number of studies have focused on the application

of pediocin-producing strains in dairy foods, given the poor adaptation of pediococci

to dairy substrates. Early experiments indicated that inhibition of L. monocytogenes

in milk required a high cell concentration of pediococci (Raccach and Geshell

1993 ) . For this reason, genetically engineered pediocin-producing LAB were devel-

oped, such as L. lactis subsp. lactis or the yogurt starter culture Streptococcus

thermophilus (Coderre and Somkuti

1999 ; Somkuti and Steinberg 2003 ) . In ched-

dar cheese, the pediocin PA-1 producer L. lactis subsp. lactis MM217 reduced the

counts of inoculated L. monocytogenes from 10

to 10

CFU/g within 1 week of

ripening, and then to about 10 CFU/g within 3 months (Buyong et al. 1998 ) . It was

concluded that pediocin-producing starter cultures have signi ﬁ cant potential for

protecting cheese against L. monocytogenes (Buyong et al . 1998 ) . In a more recent

study, the pediocin PA-1-producing derivatives L. lactis CL1 and L. lactis CL2 also

reduced the counts of L. monocytogenes during cheese ripening (Rodríguez et al . 2005 ) .

479

19 Bacteriocins: Natural Weapons for Control…

Similarly, heterologous production of pediocin PA-1/AcH in nisin-producing and

non nisin-producing L. lactis strains previously selected as starters because of their

technological properties for cheese making reduced viable counts of L. monocyto-

genes in cheese below 50 or 25 CFU/g at the end of the ripening period (Reviriego

et al .

2007 ) .

Pediocin production has also been reported in non-pediococcal LAB from dairy

environments. Spraying with a cell suspension of the pediocin AcH producer strain

Lactobacillus plantarum WHE92 on the surface of Muenster cheese was reported to

prevent the growth of L. monocytogenes (Ennahar et al .

1998 ) . Because L. plantarum

WHE 92 exists naturally in Muenster cheese, it did not adversely affect the ripening

process (Ennahar et al . 1998 ) . On red smear cheese, an almost complete inhibition of

L. monocytogenes by pediocin-producing L. plantarum was also reported (Loessner

et al . 2003 ) . However, pediocin-resistant listeria were readily detected, they were

able to proliferate in the cheese, regardless of the produced bacteriocin. It was con-

cluded that the continuous use of pediocin AcH does not appear to be suitable as a

primary means of food preservation (Loessner et al . 2003 ) .

Besides the previously mentioned bacteriocins, there are other bacteriocins which

have been shown to be very effective against listeriae. Among those bacteriocins, we

can mention propionicin PLG-1 ( produced by Propionibacterium thoenii P127) (Lyon

and Glatz 1993 ) which was shown to kill or inhibit several psychrotrophic spoilage or

pathogenic bacteria including L. monocytogenes, Pseudomonas ﬂ uorescens, Vibrio

parahaemolyticus, Yersinia enterocolitica , and Corynebacterium sp., suggesting its

potential use as an antibacterial food preservative (Lyon et al . 1993 ) . The bacteriocin-

producer strain Streptococcus salivarius subsp. thermophilus B was tested as a ther-

mophilic starter in yogurt to control L. monocytogenes. Use of the Bac+ starter was

reported to extend the product shelf-life by 5 days (Benkerroum et al . 2002 ) .

2.2 Escherichia coli and Salmonella spp.

Escherichia coli and Salmonella enterica are of major concern in a wide variety of

foods that have not undergone a germ reducing process. Enteric bacteria are espe-

cially tolerant towards adverse environmental conditions such as low pH, high salt

concentrations (Small et al. 1994 ; Cheville et al. 1996 ; Brown et al. 1997 ) and have

been shown to survive during storage in acidic (or low pH) foods or products with

high concentrations of salt or organic acids (Presser et al. 1998 ; Glass et al. 1992 ;

Leyer et al. 1995 ; Reitsma and Henning 1996 ) .

Several reports suggest that bacteriocins of LAB may contribute to the inactiva-

tion of Gram-negative microorganisms in foods if these are applied in combination

with chelating agents (Shefet et al. 1995 ; Scannell et al. 1997 ) . The architecture of

the outer membrane (OM) of Gram-negative organisms prevents penetration of the

bacteriocins to their target cells, the cytoplasmic membrane, and therefore confers a

high degree of resistance (Stevens et al. 1991 ; Schved et al. 1994 ) . Chelating agents

such as EDTA as well as the application of sublethal stress such as heating or freezing

480

N.B. Omar et al.

were shown to disrupt the permeability barrier of the LPS leading to an increased

sensitivity of Gram-negative bacteria towards LAB bacteriocins (Stevens et al.

1991 ; Kalchayanand et al. 1992 ; Cutter and Siragusa 1995 ; Murdock et al. 2007 ) .

Nisin was proposed as a hurdle in association with chelating agents for controlling

Salmonella and E. coli . The ﬁ rst report using this approach conclusively showed

that at least 20 Salmonella serovars were inhibited with simultaneous treatment of

50 μ g/ml nisin and 20 mM EDTA. In fact, the population was reduced by up to

5.3 log CFU units after an hour of treatment. Neither EDTA nor nisin alone were

able to inhibit the growth of Salmonella (Stevens et al.

1991 ) . Later, Cutter and

Siragusa ( 1995 ) showed a signi ﬁ cant inhibition effect by combining 50 μ g/ml nisin

with different chelators such as 500 mM lactate, 100 mM citrate, 50 mM EDTA or

1% (w/v) sodium hexametaphosphate in buffer. Salmonella typhimurium popula-

tion was reduced up to 5.5 log CFU units. On the other hand, the combination of 1

μ M nisin (~3.35 μ g/ml) with 0.5–5 mM trisodium phosphate was successfully used

in controlling S. enteritidis . Cell counts were reduced by 6 log CFU units after only

30 min of treatment (Carneiro de Melo et al. 1998 ) . The main ﬂ aw of these reports

though, is that experiments were performed under cell starvation conditions, which

seem to constitute a different model from food products and hence the conclusions

may not be accurate. Cutter and Siragusa ( 1995 ) only got 0.4-log units reduction of

Salmonella upon nisin-lactate treatment when experiments were carried out in beef

instead of buffer. In the same trend, Carneiro de Melo et al. ( 1998 ) only found over

1 log unit reduction when nisin–trisodium phosphate was applied in chicken skins

instead of buffer. Furthermore, although Branen and Davidson ( 2004 ) working with

trypticase soy broth instead of buffer they still observed a synergistic effect with

nisin–EDTA combination on two pathogenic E. coli strains, the effect on S. enteritidis

was not synergistic at all. However, they did observe some bactericidal activity with

a minimal bactericidal concentration of 46.9 μ g/ml nisin and 1.25 mg/ml EDTA

(~3.4 mM). It is important to note that Branen and Davidson ( 2004 ) used a low

concentration of the chelator, which does not allow direct comparisons between

them. Besides, it was shown that S. typhimurium OM was stabilized by nisin

pre-treatment when cells were suspended in 0.1 mM EDTA. Therefore, nisin should

not be used in combination with chelating agents at low concentrations. On the

other hand, high concentrations of these agents would be able to completely disrupt

the OM and therefore, nisin would reach the inner membrane (IM) and exert its

bactericidal effect (Helander and Mattila-Sandholm 2000 ) .

Nisin also showed a positive effect in association with other chemicals. For

example in ham and/or bologna sausages, a mixture of nisin-lysozyme-EDTA inhibited

the growth of E. coli O157:H7 (Gill and Holley

2000a ) . In fresh pork sausages, a

combination of nisin and organic acids reduced the viable counts of Salmonella

Kentucky and S. aureus (Scannell et al . 1997 ) . In apple juice, a combination of nisin

and cinnamon accelerated death of Salmonella Typhimurium and E. coli O157:H7,

enhancing the safety of the product (Yuste and Fung 2004 ) . When nisin and lysozyme

were tested for inactivation of Salmonella typhimurium in orange juice in combina-

tion with PEFs, the combination of the two antimicrobials had a more pronounced

bactericidal effect than either nisin or lysozyme alone (Liang et al . 2002 ) .

481

19 Bacteriocins: Natural Weapons for Control…

The combined effect of bacteriocins and other hurdles had been shown to be

highly effective against Gram-negative bacteria, such as nisin and curvacin A in

combination with low pH, 5% NaCl, or propylparabene. This combination also

leads to an increased sensitivity of E . coli and S . enterica towards nisin and curvacin

A (Gänzle et al.

1999 ) . These results suggested that bacteriocins may be active

against E . coli at environmental conditions near the growth limiting factor levels

even if a functional outer membrane is present. In another study, an inhibitory syn-

ergetic effect was obtained against Salmonella enteritidis PT4 in liquid whole egg

and in egg white when both nisin or pediocin Pa1/Ach were applied in combination

with pasteurization (Boziaris et al .

1998 ) . Sakacin P produced by L. sakei strains

Lb674 and LHT673 (Holck et al. 1994 ; Tichaczek et al. 1994 ) also acted synergisti-

cally against E. coli when tested in combination with the ﬁ sh antimicrobial peptide

pleurocidin (Lüders et al . 2003 ) .

Recently in vitro experiments (in growth media) performed by Smaoui et al . ( 2010 )

showed that BacTN635, a peptide produced by Lactobacillus plantarum TN635

was able to kill Salmonella. The plantaricin-producing strain L. plantarum 2.9

(isolated from ben saalga, a traditional pearl millet fermented food from Burkina

Faso) produced a strong inhibitory activity in malted millet ﬂ our, decreasing the

survival of E. coli O157:H7, and S. enterica (Valenzuela et al . 2008 ) . This strain

could be used as a starter culture to improve the safety of ben saalga (Ben Omar

et al . 2006 ) . Paracin 1.7, a bacteriocin produced by Lactobacillus paracasei HD1.7,

was also reported to be effective in inhibiting Salmonella (Ge et al. 2009 ) .

Regarding enterocins, enterocin AS-48 has been shown to be active against some

Gram-negative bacteria especially when combined with outer-membrane permeabi-

lizing agents (Abriouel et al. 1998 ) . This bacteriocin was evaluated on S. choleraesuis

LT2 in combination with EDTA and Tris. The cell survival was reduced proportion-

ally to the enterocin concentration. This positive effect could be enhanced either by

using acidic (pH 4) or alkaline conditions (pH 9) or mild heat treatment (Abriouel

et al. 1998 ) . Both nisin and enterocin AS-48 were successfully used for surface

decontamination of fruits and vegetables. In this regard, a positive effect of nisin-

chelating agent treatments in foods was reported by Ukuku and Fett ( 2004 ) . They

combined 50 μ g/ml nisin with 20 mM EDTA, 3% sodium lactate or 2% potassium

sorbate as sanitizer treatments on whole and fresh-cut cantaloupe. All the combina-

tions reduced Salmonella by 3 log units/cm

at day 0 of treatment and by 2 log units/

after 3–7 days of treatment. Combined treatment of enterocin AS-48 with each

of the following preservatives (lactic, polyphosphoric and peracetic acids, sodium

hypochlorite, hexadecylpyridinium chloride and hydrocinnamic acid) signi ﬁ cantly

reduced (P 0.05) the S. enterica counts during storage at 15°C for at least 48 h.

This synergistic effect was further explored for other Gram-negative bacteria

( E. coli O157:H7, S. sonnei, Shigella ﬂ exneri, E. aerogenes , Y. enterocolitica,

A. hydrophila and P. ﬂ uorescens ), using a combination treatment of enterocin AS-48

and polyphosphoric acid. The enterocin AS-48 (25 μ g/ml) alone did not signi ﬁ cantly

(P 0.05) reduce the growth of these bacteria during storage. However, the combi-

nation of enterocin AS-48 (25 μ g/ml) and polyphosphoric acid (0.1–0.2% range)

signi ﬁ cantly reduced the viable counts of all of the above mentioned Gram-negative

482

N.B. Omar et al.

bacteria during storage at 6 and 15°C, as compared to treatment with either AS-48

or polyphosphoric acid alone. These results indicate the potential of combination

treatments of AS-48 along with other preservatives to effectively control Gram-

negative bacteria in vegetable foods (Molinos et al.

2008 ) .

Another enterocin which has shown best results against Gram-negative bacteria

was enterocin E 50–52, a pediocin-like bacteriocin produced by E. faecium (NRRL

B-30746) that has been shown to be very effective in controlling S. enteritidis as

well as E. coli O157:H7 among others. It should be noted that the anti- Salmonella

activity was not only demonstrated in vitro but also in therapeutic tests in chickens

(Svetoch et al. 2008 ) . Kang and Lee ( 2005 ) reported that an enterocin P-like bacte-

riocin produced by E. faecium GM-1 had a broad antimicrobial spectrum including

S. typhimurium . This ﬁ nding is in sharp contrast to enterocin P itself, which is

unable to kill Gram-negative bacteria (Cintas et al. 1997 ) . Another recently reported

bacteriocin with broad inhibitory spectrum is the enterocin produced by an E. faecium

strain isolated from mangrove environment. In particular, it was shown that this

enterocin was active against S. paratyphi (Annamalai et al. 2009 ) . Ferreira et al.

( 2007 ) screened 70 strains of Enterococcus mundtii and found that only four of

them produced bacteriocins active against Salmonella Enteritidis . These bacterio-

cins were only partially puri ﬁ ed and characterized so far (Ferreira et al. 2007 ) . One

of the newest bacteriocins from LAB reported to be active against Salmonella spp.

is lactococcin BZ, which was produced by L. lactis subsp. lactis BZ. This peptide is

relatively heat labile because its activity was abolished after 15 min at 110°C. It is

also sensitive to beta mercaptoethanol. The anti- Salmonella activity did not seem to

be that high, at least as compared to other food pathogens tested (Şahingil et al.

2011 ) . Enterocin 012 and acidophilin 801 are among the few long known bacterio-

cins able to kill Salmonella . On one hand, acidophilin 801, a bacteriocin produced

by L. acidophilus IBB 801 with a very narrow inhibitory spectrum, surprisingly

inhibits Salmonella Panama 1467 and E. coli Row (Zam ﬁ r et al. 1999 ; Jennes et al.

2000 ) . On the other hand, enterocin 012 is a bacteriocin produced by Enterococcus

gallinarum 012, a strain isolated from the duodenum of an ostrich. Remarkably,

enterocin O12 has a lytic activity to the bactericidal or bacteriostatical activities

usually reported for the LAB-bacteriocins (Jennes et al. 2000 ) .

2.3 Endospore-Forming Bacteria

Endospore-forming bacteria represent an important threat to the safety and shelf-life

of many foods and foodstuffs, because endospores may survive heat treatments

applied to foods. After germination under suitable storage conditions, the resulting

vegetative cells may propagate and produce food-poisoning toxins or cause food

spoilage. Frequently, the cooking process does not inactivate heat-resistant bacterial

spores and, consequently, endospore-forming Bacillus spp. and Clostridum spp. can

be found in the ﬁ nal products, even during storage at low temperature ( 5°C) (Gould

1995 ). Clostridium botulinum and Bacillus cereus belong to these genera that are

483

19 Bacteriocins: Natural Weapons for Control…

reported as the cause of several food-borne outbreaks (Angulo et al. 1998 ; Doan and

Davidson 2000 ) , thus, their inhibition by bacteriocins has a high signi ﬁ cance.

In dairy food, nisin has been tested extensively. One of the earliest applications

was to prevent gas blowing in cheese caused by C. tyrobutyricum (De Vuyst and

Vandamme

1994 ; Hirsch et al. 1951 ) . More recently, a strain of L. lactis ssp. lactis

IPLA 729 isolated from raw milk cheese producing the natural variant nisin Z was

reported to reduce the levels of the spoilage strain C. tyrobutyricum CECT 4011 in

Vidiago cheese (a semihard farmhouse variety manufactured in Asturias, Northern

Spain) during ripening. The produced nisin Z activity was stable in the cheese at

least until 15 days of ripening. The nisin-producing strain was used in combination

with a suitable starter to achieve desired acidi ﬁ cation (Rilla et al. 2003 ).

Nisin has been tested for its useful contribution to control Bacillus and Clostridium

growth in potato-based products by Thomas et al. ( 2002 ) . Addition of 6.25 μ g of

nisin per gram of cooked mashed potatoes retarded the growth of B. cereus and

B. subtilis , previously inoculated in the product not vacuum packaged, for at least

27 days at 8°C and the growth of C. sporogenes and Clostridium tyrobutiricum ,

added as spores in the product and then vacuum packaged, for at least 58 days at

25°C. Nisin remained at active levels after pasteurization, but the authors high-

lighted that, in order to be effective against temperature abuse and in extending

shelf-life of ﬁ nal products, nisin must be well mixed to the various ingredients.

Incorporation of nisin in canned vegetables can prevent spoilage caused by

nonaciduric ( Bacillus stearothermophilus and Clostridium thermosaccharolyticum )

and aciduric ( Clostridium pasteurianum, Bacillus macerans and Bacillus coagulans )

spore formers (Thomas et al. 2000 ) . Nisin was also an effective preservative in fresh

pasteurized “home-made”–type soups (Thomas et al. 2000 ) and in the control of

Bacillus and Clostridium in cooked potato products (Thomas et al. 2002 ) . In one

example, in nisin-added, pasteurized, vacuum-packaged mashed potatoes inocu-

lated with a cocktail of Clostridium sporogenes and C. tyrobutyricum spores, no

bacterial growth was observed and the shelf-life of the mashed potatoes was

extended by at least 30 days (Thomas et al. 2002 ) . Similar results were reported in

trials involving a cocktail of B. cereus and B. subtilis strains (Thomas et al. 2002 ) .

In heat-treated cream, growth of Bacillus cereus during storage was completely

inhibited by low concentrations of nisin (Nissen et al. 2001 ; Pol et al. 2001 ) .

Concerning the effect of nisin on Gram-positive spores like Bacillus and

Clostridium spp., several reports showed that spores were particularly susceptible to

nisin, being more sensitive than vegetative cells (Delves-Broughton et al. 1996 ) .

Nisin action against spores was caused by binding to sulfhydryl groups of protein

residues (Morris et al. 1984 ) . It was observed that spores became more sensitive to

nisin the more heat damaged they are, and it is an important factor in the use of nisin

as a food preservative in heat processed foods. For example, spores of Clostridium

anaerobe PA3679 which have survived heat treatment of 3 min at 121.1°C were

10 times more sensitive to nisin than those which had not been heat damaged (Delves-

Broughton et al. 1996 ) . Sensitivity of spores to nisin varied, those of species like

Bacillus stearothermophilus and Clostridium thermosaccharolyticum being particu-

larly susceptible, as were all spores which open their coats by mechanical rupture.

484

N.B. Omar et al.

Enterocin AS-48 added to a rice-based infant formula dissolved in whole milk

completely inactivated B. cereus and prevented its growth for at least 15 days at

37°C (Grande et al. 2006 ) . Enterocin AS-48 was also able to suppress B. coagulans

vegetative cells in tomato paste, syrup from canned peaches, and juice from canned

pineapple for at least 15 days of storage at 37°C (Lucas et al.

2006 ) . In a nonfat hard

cheese, the strain E. faecalis A-48-32 produced enough enterocin AS-48 to inhibit

B. cereus and reduce the cell counts of bacilli by 5.6 log units after 30 days of ripening

(Muñoz et al.

2004 ) . Growth of starter cultures used in cheese making was not

affected by the bacteriocin-producing strain. Similarly, the same strain A-48-32

successfully inhibited B. cereus in skim milk (Muñoz et al. 2004, 2007 ) .

The enterocin EJ97 produced by E. faecalis EJ97 (Gálvez et al. 1998 ) had a

bactericidal effect on Bacillus macroides / Bacillus maroccanus after several incubation

conditions (4 h at 37°C, 24 h at 15°C and 48 h at 4°C); its activity was reduced at pH

5.0 and 9.0 and enhanced by sodium nitrite, sodium benzoate, sodium lactate and

sodium tripolyphosphate. The in situ ef ﬁ cacy of pure enterocin EJ97 was obtained with

a 10-fold higher concentration, whereas no inhibition was detected with the application

of E. faecalis EJ97 as a developing bacterium in purée, although it was able to produce

the bacteriocin in situ . Thus, the enterocin EJ97 has a potential to preserve food spoiled

by B. macroides / B. maroccanus if used in concentrated pure form.

Thermophilin from Streptococcus thermophilus ST580 is active against

C. tyrobutyricum (Mathot et al. 2003 ) . Strain ST580 could be used as thermophilic

starter for hard cheese making because the bacteriocin is not active against thermo-

philic lactobacilli. Furthermore, curds made with strain ST580 and inoculated with

C. tyrobutyricum endospores showed no gas production for up to 20 days

(Mathot et al. 2003 ) . The strain S. macedonicus ACA-DC 198 isolated from Greek

Kasseri cheese produced the food-grade lantibiotic macedocin in skim milk

supplemented with nitrogen sources (Georgalaki et al. 2002 ; Tsakalidou et al.

1998 ) as well as in cheese (Anastasiou et al. 2007 ; Van den Berghe et al. 2006 ) .

Since macedocin showed inhibitory activity toward C. tyrobutyricum , it could be

used as a nisin substitute to inhibit gas formation in cheese (Georgalaki et al. 2002 ) .

O’Mahony et al. ( 2001 ) showed that added variacin, a bacteriocin produced by

Kocuria varians (in the form of a milk-based ingredient) inhibited the proliferation

of B. cereus in chilled dairy products, vanilla, and chocolate desserts in a concen-

tration-dependent way.

Alicyclobacillus acidoterrestris is a spore-forming bacterium known to cause

problems in fruit juices and fruit juice-based drinks either not heat-treated or

pasteurized (Pettipher et al. 1997 ) . Komitopoulou et al. ( 1999 ) studied the growth

of A. acidoterrestris in fruit juice and its sensitivity to heat treatment and nisin.

The spores were con ﬁ rmed to be heat-resistant after 10 min at 80°C, 2 min at 90°C

and 1 min at 95°C in orange, grapefruit and apple juice. The resistance was reduced

with decrement of pH of juices, although the effect waless marked at higher tempera-

tures. Nisin addition (100 AU/ml) completely prevented A. acidoterrestris under all

temperature and time of storage conditions. In particular, the presence of nisin during

heating decreased the decimal reduction time up to 40% and its minimal inhibition

concentration against A. acidoterrestris spores was only 5 AU/ml at 25°C.

485

19 Bacteriocins: Natural Weapons for Control…

Control of A. acidoterrestris in fruit juice was also approached with enterocin

AS-48 (Grande et al. 2005 ) . Vegetative cells of A. acidoterrestris DSMZ 2498 were

inactivated by 2.5 μ g/ml of this bacteriocin in natural orange and apple juices incubated

at 37°C. No growth was detected in both juices until the 15th day of observation.

Commercial orange, apple, pineapple, peach and grapefruit juices were then added

with the same concentration of enterocin AS-48 and inoculated with vegetative cells

or endospores of strain DSMZ 2498 and maintained at different incubation tem-

peratures (4, 15 and 37°C) for 3 months. In those cases, no viable cells were observed

during the whole incubation, except for apple, peach and grapefruit juices at 37°C

containing vegetative cells which, however, were stable for up to 60 days. Treatment

with enterocin AS-48, as revealed by electron microscopy, determined cell damage

and bacterial lysis and disorganization of endospore structure in all fruit juices

object of the study. These ﬁ ndings showed that enterocin AS-48 can be a valid

substitute of the intense heat treatments necessary for inactivation of A. acidoter-

restris endospores without altering the chemical composition of fruit juices.

2.4 Staphylococcus aureus

Staphylococcal food poisoning is among the most common causes of reported

food borne diseases (Tirado and Schimdt 2001 ; WHO 2002 ; Le Loir et al. 2003 ;

EFSA 2010 ) , requiring hospital attention by up to 19.5% of the affected individuals

(EFSA 2010 ) . In many countries, S. aureus is the second or third most common

pathogen responsible for outbreaks of food poisoning (Veras et al. 2008 ) . S. aureus

is found in the nostrils as well as on the skin and hair of warm-blooded animals,

and up to 30 e 50% of human population are carriers (Le Loir et al. 2003 ) .

S. aureus has been isolated from several foods including meat and meat products,

chicken, milk and dairy products, fermented food items, salads, vegetables, ﬁ sh

products, etc. (Tamarapu et al. 2001 ; Jørgensen et al. 2005 ; Seo and Bohach 2007 ) .

Most strains were capable of producing one or more heat stable enterotoxins

(Balaban and Rasooly 2000 ; Ortega et al. 2010 ) which were the cause of the

gastrointestinal symptoms observed during intoxications (Tamarapu et al. 2001 ) .

One of the approaches proposed for the control of S. aureus in foods was the

application of bacteriocins either singly or in combination with other antimicrobials

(Gálvez et al. 2008 ) .

To control the development of S. aureus in foods, in addition to traditional chemical

and physical preservatives, several bacteriocins of LAB, either alone or combined

with other hurdles, have been used with varying degrees of success. In this sense,

many recent studies have shown the effect of nisin against S. aureus . In sliced

cheese, immobilized nisin in a polyethylene/polyamide packaging was shown to

reduce the population of S. aureus (Scannell et al. 2000b ) . In fresh pork sausages, a

combination of nisin and organic acids reduced the viable counts of S. aureus

(Scannell et al. 1997 ) . The combination of sodium citrate or sodium lactate with

lacticin 3147 was also reported to be an effective biopreservative (Scannell et al. 2000a ) .

486

N.B. Omar et al.

In skim milk, whey or simulated milk ultra ﬁ ltrate media, increased nisin activity in

combination with pulsed electric ﬁ elds (PEFs) has been reported against S. aureus

(Sobrino-López and Martín Belloso 2006 ) .

Compared to nisin, pediocin has been shown to be more effective against

S. aureus (Cintas et al.

1998 ; Eijsink et al. 1998 ) . Moreover, the evaluation of anti-

bacterial ef ﬁ cacy of the bacteriocins, nisin and pediocin AcH revealed that they had

better antibacterial property in combination due to synergistic effect than when used

singly (Hanlin et al.

1993 ; Mulet-Powell et al. 1998 ) .

Lacticin 3147 powder was shown to rapidly reduce S. aureus viable cell counts in

an infant milk formulation (Morgan et al. 1999 ) . Similarly, as was reported with nisin

an increased bactericidal effect was shown for the combined treatment of lacticin 3147

concentrates and HHP against S. aureus in milk and whey (Morgan et al. 2000 ) .

Regarding enterocins, enterocin CCM 4231 reduced the viable counts of

S. aureus SA1 in skim milk, Sunar (milk nourishment for suckling babies), and

yogurt (Lauková et al. 1999a, b ) . Enterocin AS-48 may also be an interesting bacte-

riocin to inhibit the growth of S. aureus . Several reports demonstrated the suscepti-

bility of S. aureus to AS-48 in BHI broth, a sausage model system, milk and cheese

and in vegetable sauces (Ananou et al. 2004 ; Grande et al. 2007 ; Muñoz et al. 2007 ) .

Muñoz et al. ( 2007 ) indicated that bacteriocin AS-48 was effective at controlling

S. aureus in milk whether added exogenously or produced by a bacteriocinogenic

strain. The ef ﬁ cacy of AS-48 was greatly enhanced by combination with a moderate

heat treatment, which is of great technological relevance. In unripened cheese,

AS-48 was also effective in controlling staphylococci when added as an adjunct

culture during the manufacture of cheese.

In vegetable sauces anti-staphylococcal activity of AS-48 was signi ﬁ cantly

improved when the enterocin was used in combination with different phenolic com-

pounds and even some of the combinations of enterocin AS-48 and phenolic

compounds served to completely inactivate S. aureus in sauces. Nevertheless the

effect depended largely on the type of food, which in turn had a great in ﬂ uence on

the activity of AS-48 as well as the phenolic compounds tested individually (Grande

et al. 2007 ) . The storage temperature was also an important factor in the inhibition

of S. aureus by AS-48 in sauces being more effective at high (22 ºC) than at low

(10°C) storage temperatures.

References

Abriouel H, Valdivia E, Gálvez A, Maqueda M (1998) Response of Salmonella choleraesuis LT2

spheroplasts and permeabilized cells to the bacteriocin AS-48. Appl Environ Microbiol

64:4623–4626

Acuña L, Morero RD, Bellomio A (2010) Development of wide spectrum hybrid bacteriocins for

food biopreservation. Food Bioprocess Technol 4:1029–1049

Ananou S, Valdivia E, Martínez-Bueno M, Gálvez A, Maqueda M (2004) Effect of combined

physico-chemical preservatives on enterocin AS-48 activity against the enterotoxigenic

Staphylococcus aureus CECT 976 strain. J Appl Microbiol 97:48–56

487

19 Bacteriocins: Natural Weapons for Control…

Ananou S, Garriga M, Hugas M, Maqueda M, Martínez-Bueno M, Gálvez A, Valdivia E (2005a)

Control of Listeria monocytogenes in model sausages by enterocin AS-48. Int J Food Microbiol

103:179–190

Ananou S, Maqueda M, Martínez-Bueno M, Gálvez A, Valdivia E (2005b) Control of Staphylococcus

aureus in sausages by enterocin AS-48. Meat Sci 71:549–576

Anastasiou R, Georgalaki M, Manolopoulou E, Kandarakis I, De Vuyst L, Tsakalidou E (2007)

The performance of Streptococcus macedonicus ACA-DC 198 as starter culture in Kasseri

cheese production. Int Dairy J 17:208–217

Angulo FJ, Getz J, Taylor JP, Hendricks KA, Hatheway CL, Barth SS, Solomon HM, Larson AE,

Johnson EA, Nickey LN, Reis AA (1998) A large outbreak of botulism: the hazardous baked

potato. J Infect Dis 178:172–177

Annamalai N, Manivasagan P, Balasubramanian T, Vijayalakshmi S (2009) Enterocin from

Enterococcus faecium isolated from mangrove environment. Afr J Biotechnol 8:6311–6316

Aymerich MT, Garriga M, Ylla J, Vallier J, Monfort JM, Hugas M (2000) Application of enterocins

as biopreservatives against Listeria innocua in meat products. J Food Prot 63:721–726

Aymerich MT, Garriga M, Costa S, Monfort JM, Hugas M (2002) Prevention of ropiness in cooked

pork by bacteriocinogenic cultures. Int Dairy J 12:239–246

Balaban N, Rasooly A (2000) Staphylococcal enterotoxins. Int J Food Microbiol 61:1–10

Bari ML, Ukuku DO, Kawasaki T, Inatsu Y, Isshiki K, Kawamoto S (2005) Combined ef ﬁ cacy of

nisin and pediocin with sodium lactate, citric acid, phytic acid, and potassium sorbate and

EDTA in reducing the Listeria monocytogenes population of inoculated fresh-cut produce.

J Food Prot 68:1381–1387

Ben Omar N, Abriouel H, Lucas R, Martínez-Cañamero M, Guyot JP, Gálvez A (2006) Isolation

of bacteriocinogenic Lactobacillus plantarum strains from ben saalga, a traditional fermented

gruel from Burkina Faso. Int J Food Microbiol 112:44–50

Benech RO, Kheadr EE, Lacroix C, Fliss I (2003) Impact of nisin producing culture and liposome-

encapsulated nisin on ripening of Lactobacillus added-Cheddar cheese. J Dairy Sci

86:1895–1909

Benkerroum N, Sandine WE (1988) Inhibitory action of nisin against Listeria monocytogenes .

J Dairy Sci 71:3237–3245

Benkerroum N, Oubel H, Mimoun LB (2002) Behavior of Listeria monocytogenes and

Staphylococcus aureus in yogurt fermented with a bacteriocin-producing thermophilic starter.

J Food Prot 65:799–805

Beuchat LR (1996) Pathogenic microorganisms associated with fresh produce. J Food Prot

59:204–216

Boziaris IS, Humpheson L, Adams MR (1998) Effect of nisin on heat injury and inactivation of

Salmonella enteritidis PT4. Int J Food Microbiol 43:7–13

Branen JK, Davidson PM (2004) Enhancement of nisin, lysozyme, and monolaurin antimicrobial

activities by ethylenediaminetetraacetic acid and lactoferrin. Int J Food Microbiol 90:63–74

Breukink E, Wiedemann I, van Kraaij C, Kuipers OP, Sahl H, de Kruijff B (1999) Use of the cell

wall precursor lipid II by a pore-forming peptide antibiotic. Science 5448:2361–2364

Brown JL, Ross T, McMeekin TA, Nichols PD (1997) Acid habituation of Escherichia coli and the

potential role of cyclopropane fatty acids in low pH tolerance. Int J Food Microbiol 37:163–173

Buyong N, Kok J, Luchansky JB (1998) Use of a genetically enhanced, pediocin-producing starter

culture, Lactococcus lactis subsp. lactis MM217, to control Listeria monocytogenes in cheddar

cheese. Appl Environ Microbiol 64:4842–4845

Calderón-Miranda ML, Barbosa-Cánovas GV, Swanson BG (1999) Inactivation of Listeria innocua

in skim milk by pulsed electric ﬁ elds and nisin. Int J Food Microbiol 51:19–30

Callewaert R, Hugas M, De Vuyst L (2000) Competitiveness and bacteriocin production of entero-

cocci in the production of Spanish-style dry fermented sausages. Int J Food Microbiol 57:33–42

Carneiro de Melo AM, Cassar CA, Miles RJ (1998) Trisodium phosphate increases sensitivity of

gram-negative bacteria to lysozyme and nisin. J Food Prot 61:839–843

Carr FJ, Chill D, Maida N (2002) The lactic acid bacteria: a literature survey. Crit Rev Microbiol

28:281–370

488

N.B. Omar et al.

Cheville AM, Arnold KW, Buchrieser C, Cheng CM, Kaspar CW (1996) rpoS regulation of acid,

heat, and salt tolerance in Escherichia coli O157:H7. Appl Environ Microbiol 62:1822–1824

Cintas LM, Casaus P, Håvarstein LS, Hernández PE, Nes IF (1997) Biochemical and genetic

characterization of enterocin P, a novel sec-dependent bacteriocin from Enterococcus faecium

P13 with a broad antimicrobial spectrum. Appl Environ Microbiol 63:4321–4330

Cintas LM, Casaus P, Fernandez MF, Hernandez PE (1998) Comparative antimicrobial activity of

enterocin L50, pediocin PA-1, nisin A and lactocin S against spoilage and food borne patho-

genic bacteria. Food Microbiol 15:289–298

Coderre PE, Somkuti GA (1999) Cloning and expression of the pediocin operon in Streptococcus

thermophilus and other lactic fermentation bacteria. Curr Microbiol 39:295–301

Cole K, Farnell MB, Donoghue AM, Stern NJ, Svetoch EA, Eruslanov BN, Volodina LI, Kovalev

YN, Perelygin VV, Mitsevich EV, Mitsevich IP, Levchuk VP, Pokhilenko VD, Borzenkov VN,

Svetoch OE, Kudryavtseva TY, Reyes-Herrera I, Blore PJ, Solis de los Santos F, Donoghue DJ

(2006) Bacteriocins reduce Campylobacter colonization and alter gut morphology in turkey

poults. Poult Sci 85:1570–1575

Cotter PD, Hill C, Ross RP (2005) Bacteriocins: developing innate immunity for food. Nat Rev

Microbiol 3:777–788

Cutter CN, Siragusa GR (1995) Treatments with nisin and chelators to reduce Salmonella and

Escherichia coli on beef. J Food Prot 58:1028–1030

Davies EA, Delves-Broughton J (1999) Nisin. In: Robinson R, Batt C, Patel P (eds) Encyclopedia

of food microbiology. Academic, London, pp 191–198

De Vuyst L, Leroy F (2007) Bacteriocins from lactic acid bacteria: production, puri ﬁ cation, and

food applications. J Mol Microbiol Biotechnol 13:194–199

De Vuyst L, Vandamme EJ (1994) Bacteriocins of lactic acid bacteria: microbiology, genetics and

applications. Blackie Academic & Professional, London

Delves-Broughton J, Williams GC, Wilkinson S (1992) The use of bacteriocin, nisin, as a preserva-

tive in pasteurized liquid whole egg. Lett Appl Microbiol 15:133–136

Delves-Broughton J, Blackburn P, Evans RJ, Hugenholtz J (1996) Applications of the bacteriocin,

nisin. Antonie Van Leeuwenhoek 69:193–202

Doan CH, Davidson PM (2000) Microbiology of potatoes and potato products: a review. J Food

Prot 63:668–683

EFSA (2007) Introduction of a Quali ﬁ ed Presumption of Safety (QPS) approach for assessment of

selected microorganisms referred to EFSA1. The EFSA J 587:1–16

EFSA (2010) The community summary report on trends and sources of zoonoses and zoonotic

agents and food-borne outbreaks in the European Union in 2008. J EFSA 8(1):1496 [pp. 410].

doi:

10. 2903/j.efsa.2010.1496

Eijsink VG, Skeie M, Middelhoven PH, Brurberg MB, Nes IF (1998) Comparative studies of Class

IIa bacteriocins of lactic acid bacteria. Appl Environ Microbiol 64:3275–3281

Ennahar S, Assobhel O, Hasselmann C (1998) Inhibition of Listeria monocytogenes in a smear-

surface soft cheese by Lactobacillus plantarum WHE 92, a pediocin AcH producer. J Food Prot

61:186–191

Fang TJ, Lin LW (1994a) Growth of Listeria monocytogenes and Pseudomonas fragi on cooked

pork in a modi ﬁ ed atmosphere packaging/nisin combination system. J Food Prot

57:479–485

Fang TJ, Lin LW (1994b) Inactivation of Listeria monocytogenes on raw pork treated with modi ﬁ ed

atmosphere packaging and nisin. J Food Drug Anal 2:189–200

Farías ME, de Ruiz Holgado AP, Sesma F (1994) Bacteriocin production by lactic acid bacteria

isolated from regional cheeses: inhibition of foodborne pathogens. J Food Prot 57:1013–1015

Farías ME, Nuñez de Kairuz M, Sesma F, Palacios J, de Ruiz Holgado AP, Oliver G (1999)

Inhibition of Listeria monocytogenes by the bacteriocin enterocin CRL35 during goat cheese

making. Milchwissenschaft 54:30–32

Ferreira A, Canal N, Morales D, Fuentefria D, Corção G (2007) Characterization of enterocins

produced by Enterococcus mundtii isolated from humans feces. Braz Arch Biol Technol

50:249–258

489

19 Bacteriocins: Natural Weapons for Control…

Foulquié Moreno MR, Sarantinopoulos P, Tsakalidou E, De Vuyst L (2006) The role and application

of enterococci in food and health. Int J Food Microbiol 106:1–24

Gálvez A, Lucas-López R, Abriouel H, Valdivia E, Ben Omar N (2008) Application of bacterio-

cins in the control of foodborne pathogenic and spoilage bacteria. Crit Rev Biotechnol

28:125–152

Gálvez A, Valdivia E, Abriouel H, Camafeita E, Mendez E, Martinez-Bueno M, Maqueda M

(1998) Isolation and characterization of enterocin EJ97, a bacteriocin produced by Enterococcus

faecalis EJ97. Arch Microbiol 171(1):59–65

Gänzle MG, Weber S, Hammes WP (1999) Effect of ecological factors on the inhibitory spectrum

and activity of bacteriocins. Int J Food Microbiol 46:207–217

García P, Rodríguez L, Rodríguez A, Martínez B (2010) Food biopreservation: promising strategies

using bacteriocins, bacteriophages and endolysins. Trends Food Sci Technol 21:373–382

Ge J, Ping W, Song G, Du C, Ling H, Sun X (2009) Paracin 1.7, a bacteriocin produced by

Lactobacillus paracasei HD1.7 isolated from Chinese cabbage sauerkraut, a traditional Chinese

fermented vegetable food. Wei sheng wu xue bao. Acta Microbiol Sin 49:609–616

Georgalaki MD, Van den Berghe E, Kritikos D, Devreese B, Van Beeumen J, Kalantzopoulos G,

De Vuyst L, Tsakalidou E (2002) Macedocin, a food-grade lantibiotic produced by Streptococcus

macedonicus ACA-DC 198. Appl Environ Microbiol 68:5891–5903

Gill AO, Holley RA (2000a) Inhibition of bacterial growth on ham and bologna by lysozyme, nisin

and EDTA. Food Res Int 33:83–90

Gill AO, Holley RA (2000b) Surface application of lysozyme, nisin, and EDTA to inhibit spoilage

and pathogenic bacteria on ham and bologna. J Food Prot 63:1338–1346

Giraffa G (1995) Enterococcal bacteriocins: their potential as anti- Listeria factors in dairy tech-

nology. Food Microbiol 12:291–299

Glass KA, Loeffelholz JM, Ford JP, Doyle MP (1992) Fate of Escherichia coli O157:H7 as affected

by pH or sodium chloride and in fermented, dry sausage. Appl Environ Microbiol 58:2513–2516

Gould GW (1995) Homeostatic mechanisms during food preservation by combined methods. In:

Welti-Chanes J, Barbosa-Canovas G (eds) Food preservation by moisture control – fundamentals

and applications. Technomic Publishing Co., Lancaster, pp 397–410

Grande MJ, Lucas R, Valdivia E, Abriouel H, Maqueda M, Martínez-Cañamero M, Ben Omar N,

Gálvez A (2005) Stability of enterocin AS-48 in fruit and vegetable juices. J Food Prot

68:2085–2094

Grande MJ, Lucas R, Abriouel H, Valdivia E, Ben Omar N, Maqueda M, Martínez-Bueno M,

Martínez-Cañamero M, Gálvez A (2006) Inhibition of toxicogenic Bacillus cereus in rice-

based foods by enterocin AS-48. Int J Food Microbiol 106:185–194

Grande MJ, Lucas R, Abriouel H, Valdivia E, Ben Omar N, Maqueda M (2007) Treatment of veg-

etable sauces with enterocin AS-48 alone or in combination with phenolic compounds to inhibit

proliferation of Staphylococcus aureus . J Food Prot 70:405–411

Hammami R, Zouhir A, Le Lay C, Ben Hamida J, Fliss I (2010) BACTIBASE second release:

a database and tool platform for bacteriocin characterization. BMC Microbiol 10:22

Hampikyan H, Ugur M (2007) The effect of nisin on L. monocytogenes in Turkish fermented

sausages (sucuks). Meat Sci 76:327–332

Hanlin MB, Kalchayanand N, Ray P, Ray B (1993) Bacteriocins of lactic acid bacteria in combina-

tion have a greater antibacterial activity. J Food Prot 56:252–255

Helander IM, Mattila-Sandholm T (2000) Permeability barrier of the gram-negative bacterial outer

membrane with special reference to nisin. Int J Food Microbiol 60:153–161

Hirsch A, Grinsted E, Chapman HR, Mattick ATR (1951) A note on the inhibition of an anaerobic

spore former in Swiss-type cheese by a nisin-producing Streptococcus . J Dairy Res 18:205–206

Holck AL, Axelsson L, Huhme K, Krockel L (1994) Puri ﬁ cation and cloning of sakacin 674,

a bacteriocin from Lactobacillus sake Lb674. FEMS Microbiol Lett 115:143–150

Hugas M, Garriga M, Aymerich T (2003) Functionality of enterococci in meat products. Int J Food

Microbiol 88:223–233

Jennes W, Dicks LM, Verwoerd DJ (2000) Enterocin 012, a bacteriocin produced by Enterococcus

gallinarum isolated from the intestinal tract of ostrich. J Appl Microbiol 88:349–357

490

N.B. Omar et al.

Jørgensen HJ, Maticen T, Løvseth A, Oboe K, Qvale KS, Loncarevic S (2005) An outbreak of

staphylococcal food poisoning caused by enterotoxin H in mashed potato made with raw milk.

FEMS Microbiol Lett 252:267–272

Kalchayanand N, Hanlin MB, Ray B (1992) Sublethal injury makes Gram-negative and resistant

Gram-positive bacteria sensitive to the bacteriocins, pediocin AcH and nisin. Lett Appl

Microbiol 15:239–243

Kang JH, Lee MS (2005) Characterization of a bacteriocin produced by Enterococcus faecium

GM-1 isolated from an infant. J Appl Microbiol 98:1169–1176

Klaenhammer TR (1993) Genetics of bacteriocins produced by lactic acid bacteria. FEMS

Microbiol Rev 12:39–85

Knight KP, Bartlett FM, McKellar RC, Harris LJ (1999) Nisin reduces the thermal resistance of

Listeria monocytogenes Scott A in liquid whole egg. J Food Prot 62:999–1003

Komitopoulou E, Boziaris IS, Davies EA, Delves-Broughton J, Adams MR (1999) Alicyclobacillus

acidoterrestris in fruit juices and its control by nisin. Int J Food Sci Technol 34:81–85

Lauková A, Czikková S (1999) The use of enterocin CCM 4231 in soy milk to control the growth

of Listeria monocytogenes and Staphylococcus aureus . J Appl Microbiol 87:182–186

Lauková A, Czikková S (2001) Antagonistic effect of enterocin CCM 4231 from Enterococcus

faecium on “bryndza”, a traditional Slovak dairy product from sheep milk. Microbiol Res

156:31–34

Lauková A, Czikková S, Burdova O (1999a) Anti-staphylococcal effect of enterocin in Sunar and

yogurt. Folia Microbiol (Praha) 44:707–711

Lauková A, Czikková S, Dóbransky T, Burdova O (1999b) Inhibition of Listeria monocytogenes

and Staphylococcus aureus by enterocin CCM4231 in milk products. Food Microbiol

16:93–99

Lauková A, Czikková S, Laczková S, Turek P (1999c) Use of enterocin CCM 4231 to control

Listeria monocytogenes in experimentally contaminated dry fermented Horn’ad salami. Int

J Food Microbiol 52:115–119

Lauková A, Vlaemynick G, Czikková S (2001) Effect of enterocin CCM 4231 on Listeria mono-

cytogenes in Saint-Paulin cheese. Folia Microbiol 46:157–160

Le Loir Y, Baron F, Gautier M (2003) Staphylococcus aureus and food poisoning. Genet Mol Res

2:63–76

Leverentz B, Conway WS, Camp MJ, Janisiewicz WJ, Abuladze T, Yang M, Saftner R, Sulakvelidze

A (2003) Biocontrol of Listeria monocytogenes on fresh-cut produce by treatment with lytic

bacteriophages and a bacteriocin. Appl Environ Microbiol 69:4519–4526

Leyer GJ, Wang LL, Johnson EA (1995) Acid adaptation of Escherichia coli O157:H7 increases

survival in acidic foods. Appl Environ Microbiol 61:3752–3755

Liang Z, Mittal GS, Grif ﬁ ths MW (2002) Inactivation of Salmonella Typhimurium in orange juice

containing antimicrobial agents by pulsed electric ﬁ eld. J Food Prot 65:1081–1087

Loessner M, Guenther S, Steffan S, Scherer S (2003) A pediocin-producing Lactobacillus

plantarum strain inhibits Listeria monocytogenes in a multispecies cheese surface microbial

ripening consortium. Appl Environ Microbiol 69:1854–1857

Lucas R, Grande MJ, Abriouel H, Maqueda M, Ben Omar N, Valdivia E, Martínez-Cañamero M,

Gálvez A (2006) Application of the broad-spectrum bacteriocin enterocin AS-48 to inhibit

Bacillus coagulans in low-pH canned fruit and vegetable foods. Food Chem Toxicol

44:1774–1781

Lüders T, Birkemo GA, Fimland G, Nissen-Meyer J, Nes IF (2003) Strong synergy between a

eukaryotic antimicrobial peptide and bacteriocins from lactic acid bacteria. Appl Environ

Microbiol 69:1797–1799

Lyon WJ, Glatz BA (1993) Isolation and puri ﬁ cation of propionicin PLG-1, a bacteriocin produced

by a strain of Propionibacterium thoenii . Appl Environ Microbiol 59:83–88

Lyon WJ, Sethi JK, Glatz BA (1993) Inhibition of psychrotrophic organisms by propionicin PLG-1,

a bacteriocin produced by Propionibacterium thoenii . J Dairy Sci 76:1506–1513

Maisnier-Patin S, Deschamps N, Tatini SR, Richard J (1992) Inhibition of Listeria monocytogenes

in Camembert cheese made with a nisin-producing starter. Lait 72:249–263

491

19 Bacteriocins: Natural Weapons for Control…

Mathot AG, Beliard E, Thuault D (2003) Streptococcus thermophilus 580 produces a bacteriocin

potentially suitable for inhibition of Clostridium tyrobutyricum in hard cheese. J Dairy Sci

86:3068–3074

Meindl K, Schmiederer T, Schneider K, Reicke A, Butz D, Keller S, Gühring H, Vértesy L, Wink

J, Hoffmann H, Brönstrup M, Sheldrick GM, Süssmuth RD (2010) Labyrinthopeptins: a new

class of carbacyclic lantibiotics. Angew Chem Int Ed Engl 49:1151–1154

Messaoudi S, Kergourlay G, Rossero A, Ferchichi M, Prévost H, Drider D, Manai M, Dousset X

(2011) Identi ﬁ cation of lactobacilli residing in chicken ceca with antagonism against

Campylobacter . Int Microbiol 14:103–110

Mills S, Stanton C, Hill C, Ross RP (2011) New developments and applications of bacteriocins and

peptides in foods. Annu Rev Food Sci Technol 2:299–329

Molinos AC, Abriouel H, López RL, Valdivia E, Ben Omar N, Gálvez A (2008) Combined

physico-chemical treatments based on enterocin AS-48 for inactivation of Gram-negative

bacteria in soybean sprouts. Food Chem Toxicol 46:2912–2921

Montville TJ, Winkowski K, Ludescherer RD (1995) Models and mechanisms for bacteriocin

action and application. Int Dairy J 5:797–814

Morgan SM, Garvin M, Kelly J, Ross RP, Hill C (1999) Development of a lacticin 3147-enriched

whey powder with inhibitory activity against foodborne pathogens. J Food Prot 62:1011–1016

Morgan SM, Ross RP, Beresford T, Hill C (2000) Combination of hydrostatic pressure and lacticin

3147 causes increased killing of Staphylococcus and Listeria . J Appl Microbiol 88:414–420

Morgan SM, Garvin M, Ross RP, Hill C (2001) Evaluation of a spray-dried lacticin 3147 powder

for the control of Listeria monocytogenes and Bacillus cereus in a range of food systems. Lett

Appl Microbiol 33:387–391

Morris SL, Walsh RC, Hansen JN (1984) Identi ﬁ cation and characterization of some bacterial

membrane sulfhydryl groups which are targets of bacteriostatic and antibiotic action. J Biol

Chem 259:13590–13594

Mulet-Powell N, Lactoste-Armynot AM, Vinas M, Simeon De Buochberg M (1998) Interactions

between pairs of bacteriocins from lactic acid bacteria. J Food Prot 61:1210–1212

Muñoz A, Maqueda M, Gálvez A, Martínez-Bueno M, Rodríguez A, Valdivia E (2004) Biocontrol

of psychrotrophic enterotoxigenic Bacillus cereus in a non fat hard type cheese by an entero-

coccal strain-producing enterocin AS-48. J Food Prot 67:1517–1521

Muñoz A, Ananou S, Gálvez A, Martínez-Bueno M, Rodríguez A, Maqueda M, Valdivia E (2007)

Inhibition of Staphylococcus aureus in dairy products by enterocin AS-48 produced in situ and

ex situ: bactericidal synergism through heat and AS-48. Int Dairy J 17:760–769

Murdock CA, Cleveland J, Matthews KR, Chikindas ML (2007) The synergistic effect of nisin and

lactoferrin on the inhibition of Listeria monocytogenes and Escherichia coli O157:H7. Lett

Appl Microbiol 44:255–261

Muriana PM (1996) Bacteriocins for control of Listeria spp. in food. J Food Prot 59:S54–S63

Nazef L, Belguesmia Y, Tani A, Prévost H, Drider D (2008) Identi ﬁ cation of lactic acid bacteria

from poultry feces: evidence on anti- campylobacter and anti- listeria activities. Poult Sci

87:329–334

Nissen H, Holo H, Axelsson L, Blom H (2001) Characterization and growth of Bacillus spp. in

heat-treated cream with and without nisin. J Appl Microbiol 90:530–534

O’Mahony T, Rekhif N, Cavadini C, Fitzgerald GF (2001) The application of a fermented food

ingredient containing ‘variacin’, a novel antimicrobial produced by Kocuria varians , to control

the growth of Bacillus cereus in chilled dairy products. J Appl Microbiol 90:106–114

Ortega E, Abriouel H, Lucas R, Gálvez A (2010) Multiple roles of Staphylococcus aureus entero-

toxins: pathogenicity, superantigenic activity, and correlation to antibiotic resistance. Toxins

2:2117–2131

Parente E, Hill C (1992) Inhibition of Listeria in buffer, broth, and milk by enterocin 1146, a

bacteriocin produced by Enterococcus faecium . J Food Prot 55:503–508

Pawar DD, Malik SVS, Bhilegaonkar KN, Barbuddhe SB (2000) Effect of nisin and its combina-

tion with sodium chloride on the survival of Listeria monocytogenes added to raw buffalo meat

mince. Meat Sci 56:215–219

492

N.B. Omar et al.

Pedersen MB, Iversen SL, Sørensen KI, Johansen E (2005) The long and winding road from the

research laboratory to industrial applications of lactic acid bacteria. FEMS Microbiol Rev

29:611–624

Pettipher GL, Osmundson ME, Murphy JM (1997) Methods for the detection and enumeration of

Alicyclobacillus acidoterrestris and investigations of growth and taint in fruit juice and

fruit-containing drinks. Lett Appl Microbiol 24:185–189

Pol IE, Mastwijk HC, Slump RA, Popa ME, Smith EJ (2001) In ﬂ uence of food matrix on inactiva-

tion of Bacillus cereus by combinations of nisin, pulsed electric ﬁ eld treatment, and carvacrol.

J Food Prot 64:1012–1018

Presser KA, Ross T, Ratkowsky DA (1998) Modelling the Angrowth limits (growth/no growth

interface) of Escherichia coli as a function of temperature, pH, lactic acid concentration, and

water activity. Appl Environ Microbiol 64:1773–1779

Raccach M, Geshell DJ (1993) The inhibition of Listeria monocytogenes in milk by pediococci.

Food Microbiol 10:181–186

Rayman K, Malik N, Hurst A (1983) Failure of nisin to inhibit outgrowth of Clostridium botulinum

in a model cured meat system. Appl Environ Microbiol 46:1450–1452

Rea MC, Ross P, Cotter PD, Hill C (2011) Classi ﬁ cations of bacteriocins from Gram positive

bacteria. In: Drider D, Rebuffat S (eds) Prokaryotic antimicrobial peptides: from Geenes to

applications. Springer, New York, 29–53. doi:

10. 1007/978-1-4419-7692-5_3

Reitsma CJ, Henning DR (1996) Survival of enterohemor- rhagic Escherichia coli O157:H7

during the manufacture and curing of cheddar cheese. J Food Prot 59:460–464

Reviriego C, Fernández L, Rodríguez JM (2007) A food-grade system for production of pediocin

PA-1 in nisin-producing and nonnisin- producing Lactococcus lactis strains: application to

inhibit Listeria growth in a cheese model system. J Food Prot 70:2512–2517

Rilla N, Martinez B, Delgado T, Rodriguez A (2003) Inhibition of Clostridium tyrobutyricum in

Vidiago cheese by Lactococcus lactis ssp. Lactis IPLA 729, a nisin Z producer. Int J Food

Microbiol 85(1–2):23–33

Rodríguez JL, Gaya P, Medina M, Núñez M (1997) Bactericidal effect of enterocin 4 on Listeria

monocytogenes in a model dairy system. J Food Prot 60:28–32

Rodríguez E, Calzada J, Arqués JL, Rodríguez JM, Núñez M, Medina M (2005) Antimicrobial

activity of pediocin-producing, Lactococcus lactis on Listeria monocytogenes , Staphylococcus

aureus and Escherichia coli O157:H7 in cheese. Int Dairy J 15:51–57

Rose NL, Sporns P, Stiles ME, McMullen LM (1999) Inactivation of nisin by glutathione in fresh

meat. J Food Sci 64:759–762

Ross RP, Galvin M, McAuliffe O, Morgan S, Ryan M, Twomey DP, Meaney WJ, Hill C (1999)

Developing applications for lactococcal bacteriocins. Antonie Leeuwenhoek 76:337–346

Sabia C, de Niederhäusern S, Messi P, Manicardi G, Bondi M (2003) Bacteriocin-producing

Enterococcus casseli ﬂ avus IM 416K1, a natural antagonist for control of Listeria monocyto-

genes in Italian sausages (“cacciatore”). Int J Food Microbiol 87:173–179

Şahingil D, Işlero lu H, Yildirim Z, Akçelik M, Yildirim M (2011) Characterization of lactococcin

BZ produced by Lactococcus lactis subsp. lactis BZ isolated from boza. Turk J Biol

35:21–33

Scannell AGM, Hill C, Buckley DJ, Arendt EK (1997) Determination of the in ﬂ uence of organic

acids and nisin on shel ﬂ ife and microbiological safety aspects of fresh pork sausage. J Appl

Microbiol 83:407–412

Scannell AG, Ross RP, Hill C, Arendt EK (2000a) An effective lacticin biopreservative in fresh

pork sausage. J Food Prot 63:370–375

Scannell AGM, Hill C, Ross RP, Marx S, Hartmeier W, Arendt EK (2000b) Development of bio-

active food packaging materials using immobilised bacteriocins lacticin 3147 and Nisaplin. Int

J Food Microbiol 60:241–249

Schillinger U, Becker B, Vignolo G, Holzapfel WH (2001) Ef ﬁ cacy of nisin in combination with

protective cultures against Listeria monocytogenes Scott A in tofu. Int J Food Microbiol

71:159–168

493

19 Bacteriocins: Natural Weapons for Control…

Schuman JD, Sheldon BW (2003) Inhibition of Listeria monocytogenes in pH-adjusted pasteurized

liquid whole egg. J Food Prot 66:999–1006

Schved F, Henis Y, Juven BJ (1994) Response of spheroplasts and chelator-permeabilized cells of

Gram-negative bacteria to the action of the bacteriocins pediocin SJ-1 and nisin. Int J Food

Microbiol 21:305–314

Seo KS, Bohach GA (2007) Staphylococcus aureus. In: Doyle MP, Beuchat LR (eds) Food

microbiology: fundamentals and frontiers, 3rd edn. ASM Press, Washington, DC, pp 493–518

Shefet SM, Sheldon BW, Klaenhammer TR (1995) Ef ﬁ cacy of optimized nisin-based treatments

to inhibit Salmonella typhimurium and extend shelf life of broiler carcasses. J Food Prot

58:1077–1082

Sivarooban T, Hettiarachchy NS, Johnson MG (2007) Inhibition of Listeria monocytogenes using

nisin with grape seed extract on turkey frankfurters stored at 4 and 10°C. J Food Prot

70:1017–1020

Small P, Blankenhorn D, Welty D, Zinser E, Slonczewski JL (1994) Acid and base resistance in

Escherichia coli and Shigella ﬂ exneri : role of rpoS and growth pH. J Bacteriol 176:1729–1737

Smaoui S, Elleuch L, Bejar W, Karray-Rebai I, Ayadi I, Jaouadi B (2010) Inhibition of fungi and

gram-negative bacteria by bacteriocin BacTN635 produced by Lactobacillus plantarum sp.

TN635. Appl Biochem Biotechnol 162:1132–1146

Sobrino-López A, Martín Belloso O (2006) Enhancing inactivation of Staphylococcus aureus in

skim milk by combining highintensity pulsed electric ﬁ elds and nisin. J Food Prot 69:345–353

Solomakos N, Govaris A, Koidis P, Botsoglou N (2008) The antimicrobial effect of thyme essential

oil, nisin, and their combination against Listeria monocytogenes in minced beef during refrig-

erated storage. Food Microbiol 25:120–127

Somkuti GA, Steinberg DH (2003) Pediocin production by recombinant lactic acid bacteria.

Biotechnol Lett 25:473–477

Stergiou VA, Thomas LV, Adams MR (2006) Interactions of nisin with glutathione in a model

protein system and meat. J Food Prot 69:951–956

Stern NJ, Svetoch EA, Eruslanov BV, Perelygin VV, Mitsevich EV, Mitsevich IP, Pokhilenko VD,

Levchuk VP, Svetoch OE, Seal BS (2006) Isolation of a Lactobacillus salivarius strain and

puri ﬁ cation of its bacteriocin, which is inhibitory to Campylobacter jejuni in the chicken

gastrointestinal system. Antimicrob Agents Chemother 50:3111–3116

Stevens KA, Sheldon BW, Klapes NA, Klaenhammer TR (1991) Nisin treatment for inactivation

of Salmonella species and other Gram-negative bacteria. Appl Environ Microbiol

57:3612–3615

Sulzer G, Busse M (1991) Growth inhibition of Listeria spp. On Camembert cheese by bacteria

producing inhibitory substances. Int J Food Microbiol 14:287–296

Svetoch EA, Eruslanov BV, Perelygin VV, Mitsevich EV, Mitsevich IP, Borzenkov VN (2008)

Diverse antimicrobial killing by Enterococcus faecium E 50–52 bacteriocin. J Agric Food

Chem 56:1942–1948

Tagg JR, Dajani AS, Wannamaker LW (1976) Bacteriocins of gram-positive bacteria. Bacteriol

Rev 40:722–7256

Tamarapu S, McKillip JL, Drake M (2001) Development of a multiplex polymerase chain reaction

assay for detection and differentiation of Staphylococcus aureus in dairy products. J Food Prot

64:664–668

Thomas LV, Delves-Broughton J (2001) New advances in the application of the food preservative

nisin. Adv Food Sci 2:11–22

Thomas LV, Clarkson MR, Delves-Broughton J (2000) Nisin. In: Naidu AS (ed) Natural food

antimicrobial systems. CRC Press, Boca Raton, pp 463–524

Thomas LV, Ingram RE, Bevis HE, Davies EA, Milne CF, Delves-Broughton J (2002) Effective

use of nisin to control Bacillus and Clostridium spoilage of a pasteurized mashed potato

product. J Food Prot 65:1580–1585

Tichaczek PS, Vogel RF, Hammes WP (1994) Cloning and sequencing of sakP encoding sakacin

P, the bacteriocin produced by Lactobacillus sake LHT673. Microbiol 140:361–367

494

N.B. Omar et al.

Tirado C, Schimdt K (2001) WHO surveillance programme for control of foodborne infections and

intoxications: preliminary results and trends across greater Europe. J Infect 43:80–84

Tsakalidou E, Zoidou E, Pot B, Wassill L, Ludwig W, Devriese LA, Kalantzopoulos G, Schleifer

KH, Kersters K (1998) Identi ﬁ cation of streptococci from Greek Kasseri cheese and descrip-

tion of Streptococcus macedonicus sp. nov. Int J Syst Bacteriol 48:519–527

Ukuku DO, Fett WF (2004) Effect of nisin in combination with EDTA, sodium lactate, and

potassium sorbate for reducing Salmonella on whole and fresh-cut cantaloupet. J Food Prot

67:2143–2150

Valenzuela AS, Ben Omar N, Abriouel H, Lucas Lopez R, Ortega E, Martinez Canamero M,

Gálvez A (2008) Risk factors in enterococci isolated from foods in Morocco: determination of

antimicrobial resistance and incidence of virulence traits. Food Chem Toxicol 46:2648–2652

Van den Berghe E, Skourtas G, Tsakalidou E, DeVuyst L (2006) Streptococcus macedonicus

ACA-DC 198 produces the lantibiotic, macedocin, at temperature and pH conditions that

prevail during cheese manufacture. Int J Food Microbiol 107:138–147

Veras JF, Carmo LS, Tong LC, Shupp JW, Cummings C, Santos DA (2008) A study of the

enterotoxigenicity of coagulase negative and coagulase positive staphylococcal isolates from

food poisoning outbreaks in Minas Gerais, Brazil. Int J Infect Dis 12:410–415

Vignolo G, Fadda S, de Kairuz MN, de Ruiz Holgado AA, Oliver G (1996) Control of Listeria

monocytogenes in ground beef by ‘Lactocin 705’, a bacteriocin produced by Lactobacillus

casei CRL 705. Int J Food Microbiol 29:397–402

Vignolo G, Fadda S, de Kairuz MN, Holgado APR, Oliver O (1998) Effects of curing additives on

the control of Listeria monocytogenes by lactocin 705 in meat slurry. Food Microbiol

15:259–264

Vignolo G, Palacios J, Farias ME, Sesma F, Schillinger U, Holzapfel W, Oliver G (2000) Combined

effect of bacteriocins on the survival of various Listeria species in broth and meat system.

Curr Microbiol 41:410–416

WHO (2002) Statistical information on food-borne disease in Europe. Microbiological and

chemical hazards. In: FAO/WHO Pan-European conference on food quality and safety,

Budapest. Springer, pp 29–53. ISBN 978-1-4419-7691-8

Yuste J, Fung DY (2004) Inactivation of Salmonella Typhimurium and Escherichia coli O157:H7

in apple juice by a combination of nisin and cinnamon. J Food Prot 67:371–377

Zam ﬁ r M, Callewaert R, Cornea PC, Savu L, Vatafu I, De Vuyst L (1999) Puri ﬁ cation and

characterization of a bacteriocin produced by Lactobacillus acidophilus IBB 801. J Appl

Microbiol 87:923–931

495

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

Abstract Lindane ( γ -HCH) is a pesticide that has mainly been used in agriculture.

Lindane and the other HCH isomers are highly chlorinated hydrocarbons. The presence

of a large number of electron withdrawing chlorine groups makes some of the HCH

isomers rather recalcitrant in oxic environments. Especially β -HCH is poorly

degraded by aerobic bacteria. The chlorine groups make HCH isomers more acces-

sible for an initial reductive attack, a common mechanism in anoxic environments.

Among the HCH isomers, γ -HCH is degraded most easily while β -HCH is most

persistent. Little is known about the diversity of the microorganisms involved in

anaerobic HCH degradation. Thus far, species within the genera Clostridium and

Bacillus , two Desulfovibrio species, and one species each of Desulfococcu s,

Desulfobacter, Citrobacter and Dehalobacter have been found to metabolize lindane

F. Mehboob (*)

Laboratory of Microbiology , Wageningen University ,

Dreijenplein 10 , 6703 HB Wageningen , The Netherlands

Ecotoxicology Research Programme , National Institute of Bio-remediation,

National Agriculture Research Centre , Islamabad , Pakistan

e-mail: farrakhmehboob@gmail.com

A. A. M. Langenhoff

Sub-department of Environmental Technology, Wageningen University ,

Bornse Weilanden 9, 6708 WG Wageningen , The Netherlands

G. Schraa

Laboratory of Microbiology , Wageningen University ,

Dreijenplein 10 , 6703 HB Wageningen , The Netherlands

A. J. M. Stams

Laboratory of Microbiology , Wageningen University ,

Dreijenplein 10 , 6703 HB Wageningen , The Netherlands

Centre of Biological Engineering , University of Minho ,

Campus de Gualtar , 4710-057 Braga , Portugal

Chapter 20

Anaerobic Degradation of Lindane

and Other HCH Isomers

Farrakh Mehboob , Alette A. M. Langenhoff , Gosse Schraa ,

and Alfons J. M. Stams

496

F. Mehboob et al.

and other HCH isomers. Benzene and monochlorobenzene are the end products of

anaerobic degradation, while in some studies pentachlorocyclohexane, tetrachloro-

cyclohexene, chlorobenzenes and chlorophenols have been detected as intermediates.

Enzymes and coding genes involved in the reductive dechlorination of HCH isomers

are largely unknown. Recently, a metagenomic analysis has indicated the presence

of numerous putative reductive dehalogenase genes in the genome of β -HCH

degrading Dehalobacter sp. High-throughput omics techniques can help to explore

the key players and enzymes involved in the reductive dehalogenation of lindane

and other HCH isomers.

Keywords Anaerobic • Reductive dechlorination • Halorespiration • Hexchloro-

cyclohexane (HCH) • Lindane • Dehalobacter

1 Introduction

Lindane is the gamma isomer of the 1,2,3,4,5,6-hexachlorocyclohexane. Hexachloro-

cyclohexane (HCH) or benzene hexachloride (BHC) has eight stereoisomers i.e. α ,

β , γ , δ , ε , ζ , η and θ . α -HCH is the only chiral isomer of HCH and has two enantiomeric

forms (Buser and Müller 1995 ) . Only γ -HCH has strong insecticidal properties

(Deo et al. 1994 ) . It is a broad spectrum pesticide used against mosquitoes,

aphids, grasshoppers, ﬂ ies, boil weevils, mites, termites, ants, leafminers, thrips,

armyworms, wireworms, stem borers (Phillips et al. 2005 ) and even in the form of

lotion and shampoo for topical treatment for head and body lice and scabies

(US-FDA 2009 ) .

Michael Faraday synthesized HCH for the very ﬁ rst time in 1825 (Li 1999 ) and

the insecticidal properties of the gamma isomer were discovered in 1942 (Metcalf

1955 ; Li 1999 ). HCH is commercially produced by photochemical chlorination of

benzene (Walker et al. 1999 ) . Technical mixtures contain 55–70% α -HCH, 5–14%

β -HCH, 10–15% γ -HCH, 2–10% δ -HCH and 1–4% ε -HCH (van Eekert et al.

1998 ) . Though HCH is now banned in many countries it has been applied in huge

quantities in the past. The total global technical HCH usage between 1948 and

1997 has been estimated to be 10 million tons (Li 1999 ) . Approximately 382,000

tons of technical HCH and 81,000 tons of lindane were used in Europe from 1970

to 1996 (Breivik et al. 1999 ) . Initially, HCH was applied as a mixture, but later on

during the late 70’s only γ -HCH was applied and the rest of the isomers were sepa-

rated and dumped.

There are many health related issues associated with HCH. Alpha, beta and

gamma isomers of HCH mainly act as depressant of the nervous system (Nagata

et al. 1996 ) . The isomers of HCH can cause cancer in mice (Sagelsdorff et al. 1983 ) .

The β -HCH may be the toxicologically most signi ﬁ cant due to the high persistence

497

20 Anaerobic Degradation of Lindane and Other HCH Isomers

in mammalian tissues and its estrogenic effects in mammalian cells and ﬁ sh

(Willett et al. 1998 ) . β -HCH is thought to be the representative of a new class of

xenobiotics that produce estrogen like effects through non-classical mechanisms

and, therefore, may be of concern with regard to breast and uterine cancer risk

(Steinmentz et al.

1996 ) . In human fat the bioconcentration factor of β -HCH is

nearly 30 times higher than that of γ -HCH (Geyer et al.

1987 ) . The median half-life

of β -HCH in the blood is 7.2 years (Jung et al. 1997 ) in comparison to only 1 day

for γ -HCH (Feldmann and Maibach 1974 ) .

HCH is volatile and its residues have been found in glaciers (Berg et al. 2004 ) . It

is fat soluble, which may result in bio-accumulation in fat tissue. The UNEP

Stockholm Convention ( 2008 ) has listed the alfa, beta and gamma isomers of HCH

as new Persistent Organic Pollutants (POPs).

2 Persistence

Lindane and the other HCH-isomers are recalcitrant and can persist for more than

11 years (Lichtenstein and Polivka 1959 ) . Mineralization of some HCH isomers has

been reported to occur in the presence of oxygen (Senoo and Wada 1989 ; Sahu et al.

1990, 1995 ; Nagasawa et al. 1993 ) . Generally, oxygenases are involved in aerobic

degradation of organic chlorine compounds. However, molecules that are substituted

with numerous electron withdrawing groups such as chlorine-, nitro- and azo- groups

are relatively resistant to aerobic biodegradation (Okey and Bogan 1965 ; Field et al.

1995 ) . Such molecules are more susceptible to an initial reductive attack, which is

common in anoxic environments (Field et al. 1995 ) .

The alfa and gamma isomers can be degraded by aerobic organisms but the beta

and delta isomers are thought to be more recalcitrant. In a long term ﬁ eld plot study,

the alpha isomer was the least persistent with only 4% remaining in the soil, while

the most persistent beta isomer still remained 44% in the soil after 15 years (Stewart

and Chisholm 1971 ) . The beta isomer is the most persistent of all the HCH isomers

(Bachmann et al. 1988a, b ; Doelman et al. 1988 ; Beurskens et al. 1991 ) . Generally,

the rate of dechlorination follows the order γ -HCH > α -HCH > δ -HCH > β -HCH

(Jagnow et al. 1977 ; Buser and Müller 1995 ; Quintero et al. 2005 ) . The persistence

of HCH isomers is due to their chemical structure and isomerization.

2.1 Chemical Structure

The structures of the most common HCH isomers are shown in Fig. 20.1 . The relative

persistence of each isomer is generally attributed to the orientation of the chlorine atoms

on the molecule (Beurskens et al. 1991 ; Phillips et al. 2005 ) . A lower number of equato-

rial chlorine atoms or a higher number of axial chlorine atoms renders persistence to the

compound. The axial chlorine atoms are thought to provide the speci ﬁ c sites for

498

F. Mehboob et al.

enzymatic attack. So γ - and α -HCH, having three and two axial chlorine atom, are

degraded faster than the one axial chlorine containing δ -HCH and β -HCH (Buser and

Müller 1995 ) . β -HCH, which has six equatorially oriented chlorine atoms is the most

stable compound (Jagnow et al. 1977 ; Buser and Müller 1995 ; Phillips et al. 2005 ) .

2.2 Isomerization

HCH isomers are interconvertible to each other. Photo-isomerization and bio-

isomerization can change their relative proportions, and this may explain the higher

concentrations of α -HCH relative to γ -HCH in speci ﬁ c environments. γ -HCH

isomerizes into α -HCH in aqueous solutions placed in UV light (Malaiyandi et al.

1982 ) . Similarly, γ -HCH bio-isomerizes to α -HCH by Pseudomonas putida under

anoxic conditions (Benezet and Matsumura 1973 ) and by P. aeruginosa in the

presence of oxygen (Lodha et al. 2007 ) . However, during anoxic conditions

Escherichia coli has been found to catalyze the isomerization of α -HCH to γ -HCH

(Vonk and Quirijns 1979 ) . Based on thermodynamic stabilities, a complete transfor-

mation of γ -HCH ﬁ rst to α -HCH, then to δ -HCH and ﬁ nally to β -HCH could be

expected. This isomerization may stop at the alpha isomer in case of volatilization

to the atmosphere. However, under anoxic conditions where isomerization of γ -HCH

was occurring rapidly, the accumulation of δ -HCH was observed. It was suggested

that the isomerization results in a continuous detoxi ﬁ cation of a compound (Newland

et al. 1969 ) . A very small percentage of γ -HCH was converted into α - and δ -HCH

Fig. 20.1 The structures of the most common HCH isomers showing the position of axial and

equatorial chlorine atoms. ( a ) Represents the α -HCH with 2 axial and 4 equatorial chlorine atoms;

( b ) represents the β -HCH with all equatorial chlorine atoms; ( c ) represents the γ -HCH with the 3

axial and 3 equatorial chlorine atoms and ( d ) represents δ -HCH with one axial and 5 equatorial

chlorine atoms

499

20 Anaerobic Degradation of Lindane and Other HCH Isomers

in the activated sludge. The isomerization of γ -HCH into α -HCH was nearly 240

times slower than the overall degradation rate (Buser and Müller 1995 ) . Such stud-

ies indicate the insigni ﬁ cant role of isomerization in the overall persistence of HCH.

Yet, in an extensive study Wu et al. (

1997 ) demonstrated that α -HCH isomerizes

predominantly into the β -HCH along with small quantities of gamma and delta

isomers in both oxic and anoxic environments. The authors suggested that this bulk

isomerization, besides its chemical stability, is a reason for β -HCH persistence.

3 Aerobic Biodegradation of Lindane and Other HCH Isomers

Organic molecules with a large number of electron withdrawing groups are relatively

resistant to oxidative attack by oxygenases and thus resistant to aerobic degradation

(Field et al. 1995 ) . For a long time it was assumed that HCH is best degraded under

anoxic conditions (MacRae et al. 1967 ; Bachmann et al. 1988b ) . However, there are

a number of reports on the aerobic degradation of lindane and other HCH isomers.

More than 30 aerobic HCH degrading Sphingomonads have been described (Lal

et al. 2010 ) . Apart from Sphingomonas spp., Sphingobium and Pseudomonas are

other two dominant genera involved in the aerobic degradation HCH (Lal et al. 2010 ) .

Mainly due to ease in handling and faster growth of aerobic microorganisms, a lot

of work on the biochemistry and genetics of the aerobic HCH degradation has been

done. The genes and enzymes involved in the aerobic HCH degradation pathway

have been characterized. The enzymes involved in the initial aerobic degradation of

HCH include LinA i.e. a 16.5 kDa homotetrameric protein and dehydrochlorinase

in function (Nagata et al. 1993 ; Suar et al. 2005 ; Wu et al. 2007 ) , LinB i.e. a 32 kDa

monomeric enzyme having an haloalkane dehalogenase function (Nagata et al.

2005 ; Sharma et al. 2006 ; Wu et al. 2007 ) and LinC that has a dehydrogenase activity

(Nagata et al. 1994 ; Dogra et al. 2004 ) . Other enzymes that catalyze the downstream

process of the aerobic HCH degradation include LinD, LinE, LinF, LinGH and LinJ,

which have reductive dechlorinase, ring cleaving dioxygenase, maleyl acetate

reductase, acyl-CoA transferase and thiolase activity, respectively (Miyauchi et al.

1999 ; Nagata et al. 1999 ; Dogra et al. 2004 ) . The initial enzymes together with the

downstream enzymes lead to the aerobic degradation of HCH (reviewed by Lal

et al. 2010 ; Camacho-Pérez et al. 2012 ) .

4 Anaerobic Biodegradation of Lindane and Other

HCH Isomers

Anaerobic degradation of lindane and other HCH isomers is known for about

50 years. Table 20.1 lists various studies in which biodegradation of lindane and

other HCH isomers have been reported. Lindane was rapidly degraded in non-sterile

Table 20.1 Summary of HCH degradation studies, with known microorganisms

Microorganism involved Compound

External source of C or

energy or supplement Metabolite formed End product Reference

Clostridium sphenoides

UQM 780 and its

washed cell suspensions

γ -HCH

α -HCH

PCCHa

γ -PeCCH

PCCOL

β -TeCCH

δ -TeCCH

γ -TeCCH

0.5% YE α -HCH via δ -3,4,5,6-tetrachloro-

1-cyclohexene

and

γ -HCH via γ -3,4,5,6-tetrachloro-

1-cyclohexene

Approx. 75% of

the theoretical

amount of the

chlorine of

lindane was

released as

chloride

MacRae et al.

(

1969 ),

Heritage and

MacRae

(

1977a ),

Heritage and

MacRae (

1979 )

Clostridium butyricum

C. pasteurianum,

Citrobacter freundii,

B. polymyxa,

E. coli,

Enterobacter aerogenes,

Enterobacter cloacae,

B. macerans,

B. laterosporus,

B. alvei,

B. circulans,

Serratia marcescens,

Proteus mirabilis,

P. vulgaris

γ -HCH

α -HCH

β -HCH

δ -HCH

γ -HCH

Glucose, pyruvate,

formate, soluble

starch, yeast extract

γ -tetrachlorocyclohexene

( γ -TeCCH) as main

intermediate & small amount

of tri-chlorobenzene and

tetra-chlorobenzene found too

but not con ﬁ rmed

Chloride Haider and Jagnow

1975 , Jagnow

et al. (

1977 ),

Haider (

1979 )

Microorganism involved Compound

External source of C or

energy or supplement Metabolite formed End product Reference

Clostridium rectum strain

S-17 and its washed cell

suspensions

γ -HCH

α -HCH

γ -1,2,3,4,5,6-

hexachlorocyclohexene

and

γ -l,3,4,5,6-

pentachlorocyclohexene

1% peptone and 0.1%

yeast extract.

leucine, alanine,

pyruvate, leucine,

proline, hydrogen

γ -3,4,5,6-tetrachlorocyclohexene

(TeCCH)

γ -1,2,3,4,5,6-

hexachlorocyclohexene is

converted into

1,2,4-trichlorobenzene

and

γ -l,3,4,5,6-pentachlorocyclohexene

is converted to and

1,4-dichlorobenzene

Chlorobenzene Ohisa and

Yamaguchi

(

1978b ), Ohisa

et al. (

1980 )

Ohisa et al. (

1982 )

Various Clostridia

designated as O-1, O-2,

H-1, H-2, H-6, H-7, H-8,

H-9, H-13, S-1, S-5, S-6,

S-7, S-8, S-13

O-4, H-3, H-4, H-10, S-3,

S-10, S-11, S-12, S-14,

S-15, S-17

γ -HCH

γ -HCH and α -HCH

0.2% peptone – – Ohisa and

Yamaguchi

(

1978a )

Clostridium rectum strain

S-17,

C. bifermentans,

C. sporogenes ,

C. putrefaciens,

C. lentoputrescens,

C. butyricum,

C. acetobutylicum,

C. histolyticum

γ -HCH

α -HCH

γ -HCH

1% peptone, 0.1%

YE, whenever

needed glucose

added

– – Ohisa and

Yamaguchi

(

1979 )

Mixed anaerobic microbial

populations containing

Clostridium bifermentans,

Clostridium glycolium,

Clostridium sp.

γ -HCH and dieldrin Acetate, formate,

yeast extract and

peptone

Tetrachlocyclohexene (TeCCH) – Maule et al. (

1987 )

(continued)

Microorganism involved Compound

External source of C or

energy or supplement Metabolite formed End product Reference

Desulfovibrio gigas ATCC

19364

Desulfovibrio africanus

ATCC 19997

Desulfobacter curvatus

ATCC 43919

Desulfococcus multivorans

ATCC 33890

γ -HCH Acetate, citrate, lactate,

yeast extract and

sulfate

Also benzoate for D.

multivorans

γ -3,4,5,6-tetrachlorocyclohexene

( γ - TeCCH)

Chlorobenzene and

benzene

Boyle et al. (

1999 ),

Badea et al.

(

2009 )

Gram positive organisms

( Desufomicrobium sp .

& several uncultured

bacteria)

γ -HCH Lactate, methanol & H

– Benzene and

chlorobenzene

Elango et al. ( 2011 )

Dehalobacter species β -HCH

α -HCH

γ -HCH

, lactate, pyruvate,

acetate, (0.005%)

peptone

– Benzene, chlo-

robenzene

and chloride

Van Doesburg et al.

(

2005 )

–: not described/not detected; YE: yeast extract; tetrachlorocyclohexene (TeCCH); pentachlorocyclohexane (PCCHa); γ -2,3,4,5,6-pentachloro-1-cyclohexene

( γ -PeCCH); 2,3,4,5,6-pentachloro-2-cyclohexane-l-ol (PCCOL)

Table 20.1 (continued)

503

20 Anaerobic Degradation of Lindane and Other HCH Isomers

soils but not in sterile soils (autoclaved or azide treated) showing the biological

nature of the degradation (Lichtenstein et al. 1966 ; Raghu and MacRae 1966 ) . The

half life of lindane in an active culture was in the order of 1 day, while in a sterile

culture it was nearly 170 days (Hill and McCarty

1967 ) . Rapid degradation after a

second addition of lindane was observed, suggesting that lindane degrading anaero-

bic microorganisms had been enriched (Raghu and MacRae 1966 ) . All four isomers

(alpha, beta, gamma and delta) of HCH were degraded faster in ﬂ ooded soil than in

sterilized soil and C

labeled CO

was evolved from non-sterile ﬂ ooded soils treated

with C

labeled γ -HCH (MacRae et al. 1967 ) . Similarly, it has been observed that

degradation of lindane occurs faster in ﬂ ooded soil than in un ﬂ ooded soils (Yoshida

and Castro 1970 ) , because of anoxic conditions (Panda et al. 1988 ) . A slightly

higher anaerobic degradation rate of lindane was observed than the aerobic degrada-

tion rate (Hill and McCarty 1967 ) and it was suggested that anaerobic microorganisms

were more active in the degradation of lindane than their aerobic counterparts

(MacRae et al. 1967 ) .

In a waste dump site polluted with HCH isomers, 35% of α -HCH was degraded

in 20 weeks (Doelman et al. 1985 ) . The (+)-enantiomer of α -HCH was degraded

faster than the (−)-enantiomer when incubated with the sludge indicating the high

enantioselectivity of degradation. This shows the biotic nature of the process. Nearly

80–95% of the degradation was attributed to microbes present inside the sludge.

The calculated half lives were 35, 99, 20, 178, 126 h for (+)- α -HCH, (−)- α -HCH,

γ -HCH, β -HCH and δ -HCH showing that γ -HCH is degraded the fastest and

β -HCH the slowest. The degradation rates were in the following order

γ -HCH > α -HCH > δ -HCH > β -HCH (Buser and Müller 1995 ) . In another study it

was found that in 34 groundwater samples, collected from beneath a pesticide refor-

mulating and packaging facility, the (−)-enantiomer of α -HCH was degraded faster

than the (+)-enantiomer of α -HCH (Law et al. 2004 ) . Under methanogenic condi-

tions, after a lag phase of about 30 days, α -HCH was (bio)converted at a rate of

13 mg kg

−1

of soil per day. Denitrifying and sulfate-reducing conditions did not

result in any biotransformation (Bachmann et al. 1988b ) .

Signi ﬁ cant reductive dechlorination of β -HCH was demonstrated by Middeldorp

et al. ( 1996 ) under methanogenic condition. The enrichments also dechlorinated the

other three isomers of HCH. A long lag phase (60 days) was observed for δ - HCH.

γ -HCH was degraded without any lag phase but at a slower rate. α -HCH was dechlo-

rinated at a rate comparable to that of β -HCH. In a ﬂ owthrough column experiment an

increasing breakthrough of β -HCH was observed in the ﬁ rst 20 days. When 0.1 mM

lactate was added as electron donor on day 21, a complete disappearance of β -HCH

was observed. Since no dechlorination occurred in pasteurized batches and dechlori-

nation was not inhibited after addition of 2-bromoethansulfonic acid (BrES), it was

concluded that neither spore-forming bacteria nor methanogens were involved in the

dechlorination of HCH (Middeldorp et al. 1996 ) . Benzene and chlorobenzene were

detected as end product, which are quite recalcitrant in anoxic environments. There is

not a single bacterial isolate that can degrade chlorobenzene anaerobically and there

are only ﬁ ve bacterial isolates that can degrade benzene anaerobically (Mehboob et al.

2010 ) . So a sequential anaerobic-aerobic strategy has been suggested for the mineral-

ization of HCH in polluted soils and aquifers (Middeldorp et al. 1996 ) .

504

F. Mehboob et al.

Bacteria that have the ability to reductively dechlorinate the β -HCH are present

in different anoxic environments. Anaerobic degradation of β -HCH was observed

by methanogenic granular sludge grown on methanol, volatile fatty acids or sucrose.

Contaminated soil samples were also capable of reductive dechlorination of β - and

α -HCH (van Eekert et al.

1998 ) . Anaerobic reduction was also demonstrated in

batches with material from an HCH-contaminated site, where 8 uM of HCH was

degraded within 4 months, without the addition of an external carbon source to

prove the intrinsic bioremediation occurring at the site (Langenhoff et al.

2002 ) .

Soil from a heavy polluted site rapidly dechlorinated β -HCH upon addition of

lactate as electron donor while slightly polluted soil did not show degradation within

4 months. All the four isomers, α -, β -, γ - and δ -HCH added separately or together,

were reductively dechlorinated by the soil sample. Acetate, propionate, lactate,

methanol, H

, yeast extract and land ﬁ ll leachate were used as electron donors. The

lag phase for β -HCH degradation was 20 days and less than 10 days for the degrada-

tion of the others HCH isomers. However, the degradation rate for β -HCH was

higher than rest of the isomers (Middeldorp et al. 2005 ) .

The four isomers of HCH were found to be degraded in the liquid and soil

slurry system. The degradation rates were found in the following order

γ -HCH > α -HCH > β -HCH > δ -HCH. α - and γ -HCH were dechlorinated in 20–40 days

while it took 102 days for the dechlorination of β - and δ -HCH. In liquid medium the

degradation rates were found to be higher (Quintero et al. 2005 ) due to mass transfer

limitations associated to the soils (Rijnaarts et al. 1990 ) . In soil assays only partial

degradation of HCH isomers was observed. Quintero et al. ( 2005 ) suggested that

slurry systems with anaerobic sludge could be an alternative in stimulating the

bioremediation of HCH polluted soils.

Almost 78% of the γ -HCH was found to be co-metabolically degraded by a bacterial

culture enriched from a pesticide contaminated soil. A comparable lindane degradation

occurred with cultures enriched on lindane or on endosulfan or on mixed pesticides.

However, cultures enriched on methyl parathion and carbofuran were not effective in

degrading lindane. It was suggested that lindane and endosulfan might share a common

dechlorinating enzyme for their degradation (Krishna and Philip 2008 ) .

4.1 Reactor Studies

There are only a few studies where the dechlorination of lindane or other HCH

isomers was studied in the reactors. A complete removal of α - and γ -HCH within

10 days and 90% removal of β - and δ -HCH was observed in anaerobic slurry reactor

when it was operated under optimal conditions with a sludge concentration of 8 g

VSS l

−1

, a starch concentration of 2 g COD l

−1

and soil replacements of 10–20%

(Quintero et al. 2006 ) .

Most of the studies on lindane and other HCH isomers were conducted at low

concentrations of HCH. Bhat et al. ( 2006 ) demonstrated the reductive dechlorina-

tion of HCH at a much higher concentration of 100–200 mg l

−1

. A 85% removal of

505

20 Anaerobic Degradation of Lindane and Other HCH Isomers

technical HCH (175 mg l

−1

) and a complete removal of β -HCH was observed in an

up- ﬂ ow anaerobic sludge blanket reactor (UASB) under continuous mode of operation

at a constant HRT of 48 h. Methanol was used as co-substrate and electron donor.

The degradation rate was found to be 6.66 mg g

−1

day

−1

(Bhat et al. 2006 ) .

Sequential methanogenic-sulfate reducing slurry bioreactors showed 98% lindane

removal ef ﬁ ciency against 41 and 82% lindane removal ef ﬁ ciency of only methano-

genic and sulphate reducing slurry bioreactors, respectively. The sulfate-reducing stage

of operation contributed the most to lindane reduction (Camacho-Pérez et al.

2010 ) .

4.2 Field Study

Langenhoff et al. ( 2002 ) conducted a ﬁ eld study for in situ intrinsic and stimulated

biodegradation of HCH. At an industrial site, intermediates of HCH degradation,

i.e. benzene, chlorobenzene and chlorophenol were detected in the groundwater, indi-

cating that intrinsic bioremediation was occurring. The aquifer showed an average

dissolved organic carbon concentration of 27 mg l

−1

, demonstrating that electron

donor capacity for reductive dechlorination was present. In laboratory experiments,

these intermediates were shown to be degraded by adding a small amount of oxygen

or nitrate. The addition of either compost percolate or land ﬁ ll leachate led to a rapid

degradation of HCH. Hence, the anaerobic degradation of HCH can be stimulated via

the addition of an electron donor, followed by aerobic degradation of the formed inter-

mediates (Langenhoff et al. 2002 ) . This was tested at the site, to increase the intrinsic

degradation capacity. In ﬁ ltration was performed with methanol, and as a result, the

amount of HCH in the groundwater decreased to zero. The produced monochlo-

robenzene and benzene could be degraded in an on-site reactor (Langenhoff 2009 ) .

Many studies have shown that 80–90% degradation of lindane and other HCH

isomers can be attributed to the microbiota present in diverse type of inocula ranging

from contaminated soils to anaerobic sludges. A more rapid degradation was found

for the ﬂ ooded soils than the non- ﬂ ooded soils due to anoxic conditions. A longer lag

phase and slower dechlorination of β - and δ -HCH was observed compared to the

smaller or no lag phase and rapid dechlorination of γ - and α -HCH. Generally, the rate

of dechlorination follows the following order γ -HCH > α -HCH > δ -HCH > β -HCH

(Jagnow et al. 1977 ; Buser and Müller 1995 ; Quintero et al. 2005 ) .

5 Diversity of Microorganisms Involved in the Anaerobic

Dechlorination of Lindane and Other HCH Isomers

Microorganisms involved in the anaerobic dechlorination of lindane and other HCH

isomers are quite diverse and are present under diverse anoxic conditions. Many

species of Clostridium, Bacillus , Enterobacter, Desulfovibrio, Desulfococcu s,

Desulfobacter, Citrobacter , Escherichia coli and Dehalobacter have been found to

506

F. Mehboob et al.

metabolize lindane and other HCH isomers. Initially, only co-metabolic degradation

of lindane and other HCH isomers was observed (MacRae et al. 1969 ; Jagnow et al.

1977 ; Boyle et al. 1999 ) . Later on dehalorespiration by specialized genera like

Dehalobacter was demonstrated (van Doesburg et al.

2005 ) .

Clostridium sphenoides UQM 780 is a gram negative, spore-forming, non-motile

organism that was isolated from a ﬂ ooded soil in medium containing 3–4 ppm of

lindane and 0.5% yeast extract as carbon source (MacRae et al. 1969 ) . C. sphenoides

reduced lindane in concentrations from 3.70 to 0.03 ppm in 11 days. A washed cell

suspension degraded lindane within 27 h. Nearly 75% of the theoretical amount of

lindane was recovered as chloride (MacRae et al. 1969 ) . This bacterium was also capa-

ble of degradation of α -HCH via the formation of δ -3,4,5,6-tetrachloro-1-cyclohexene

( δ -TeCCH). Lindane was degraded via γ -3,4,5,6-tetrachloro-1-cyclohexene

( γ -TeCCH) (Heritage and MacRae 1977b ) . Optimal conditions for metabolism

were 40°C and a pH of 8. Lindane adapted cells were also capable of metabolizing the

beta, gamma and delta isomers of 3,4,5,6-tetrachloro-l-cyclohexene ( β -, γ -, δ -TeCCH),

2,3,4,5,6-pentachloro-2-cyclohexen-l-ol (PCCOL), γ -l,2,3,4,5,6-pentachlorocyclohex-

l-ene (PeCCH) and 1,2,3,4,5-pentachlorocyclohexane (PCCHa) (Heritage and MacRae

1979 ) . Cell free extracts (CFE) of C. sphenoides were also capable of converting

lindane into γ -TeCCH. The CFE activity was associated with membranes and gluta-

thionine was required suggesting the involvement of glutathionine conjugation in

the process. Membrane fractions showed a faster conversion of lindane into

γ -TeCCH and subsequently γ -TeCCH into another unknown product than cell free

extract (Heritage and MacRae 1977a ) .

An anaerobic mixed bacterial culture consisting of Bacilli and Clostridia

degraded 90% of the applied lindane within 4–5 days. α -HCH was degraded slower

than the γ -HCH (Haider and Jagnow 1975 ) . In this study many strict and facultative

anaerobes were screened and it was found that many Clostridia, Bacilli, Enterobacter

species are involved in anaerobic degradation of lindane. C. butyricum, C. pasteur-

ianum and Citrobacter freundii showed good degradation of lindane . B. polymyxa,

E. coli, Enterobacter aerogenes, Enterobacter cloacae, B. macerans moderately

degraded lindane. However, poor degradation of lindane was observed with

B. laterosporus, B. alvei, B. circulans, Serratia marcescens, Proteus mirabilis, and

P. vulgaris (Jagnow et al. 1977 ) . Aerobically grown cultures that were subse-

quently incubated anaerobically with different electron donors also degraded

lindane. Mixed anaerobic cultures, C. butyricum, C. pasteurianum and Citrobacter

freundii were also shown to degrade the alpha, beta and delta isomers of

HCH. Degradation rates of different isomers were in the following order

γ -HCH > α -HCH > β -HCH = δ -HCH (Jagnow et al. 1977 ) . It was suggested that

organisms which evolve H

during fermentation are involved in the dechlorination

process. Similarly, Clostridia are known to produce vitamin B

(Neujahr and

Rossi-Ricci 1960 ; Sugita et al. 1991 ) and reductive dechlorination of lindane and

other HCH isomers can also occur with the corrins, porphrins (Marks et al. 1989 )

and hydroxocobalamin (vitamin B

12a

) (Rodriguez-Garrido et al. 2010 ) . Reductive

dehalogenation of lindane and other HCH isomers could be due to the vitamin B

produced by the Clostridia (Jagnow et al. 1977 ) .

507

20 Anaerobic Degradation of Lindane and Other HCH Isomers

Clostridium rectum strain S-17 was isolated from a paddy ﬁ eld soil on medium

containing 1 ppm of lindane, 1% peptone and 0.1% yeast extract. Rapid degradation

was observed during the growth phase as compared with resting states (Ohisa and

Yamaguchi

1978b ) . Degradation of lindane requires the addition of electron donors

like leucine, alanine, pyruvate, a leucine-proline mixture, and molecular hydrogen.

Since almost all the Clostridium sp. which carry out a Stickland reaction were able

to degrade lindane and the process was accompanied with concomitant formation of

isovaleric acid so the authors suggested a close relation between the Stickland reac-

tion and lindane degradation (Ohisa et al. 1980 ; Ohisa and Yamaguchi 1979 ) .

Though at ﬁ rst the process was thought to be co-metabolic, later on ATP synthesis

in C. rectum was found to be associated with the metabolism of lindane, showing

the metabolic nature of the process. Hence it was concluded that HCH can act as

electron acceptor for the Stickland reaction (Ohisa et al. 1982 ) . However, this was

demonstrated with cells pre-grown on a rich medium without γ -HCH and use of

γ -HCH as the sole terminal electron acceptor in successive transfers of the culture

was not evaluated (Elango et al. 2011 ) . CFE of C. rectum S-17 dechlorinated lindane,

hexachlorocyclohexenes (HeCCH), pentachlorocyclohexenes (PeCCH), and tetra-

chlorocyclohexenes (TeCCH) in the presence of dithiothreitol (DTT) (Kurihara

et al. 1981 ; Ohisa et al. 1982 ) .

Sixteen strains capable of γ -HCH degradation and 11 strains capable of both

γ - and α -HCH degradation were enriched in peptone containing medium. Due to

common properties of being rod shaped, spore forming, strict anaerobes which are

catalase negative, isolates were tentatively identi ﬁ ed as belonging to the genus

Clostridium . The optimum temperature for their metabolism was found to be 40°C.

Since addition of lindane did not increase their number, it was thought that these

strains did not use the lindane as a source of carbon and energy and instead fortu-

itously degraded lindane. Since many species of Clostridium use amino acids in

their metabolism via the Stickland reaction, the peptone might have been a good

source for their growth (Ohisa and Yamaguchi 1978a ) .

C. rectum S-17, C. sporogenes , C. putrefaciens, C. bifermentans, C. lentoputrescens,

C. butyricum, C. acetobutylicum and C. histolyticum were all capable of γ -HCH degra-

dation, but none of them could decompose β - and δ -HCH. C. rectum S-17 and C. bifer-

mentans were also able to degrade α -HCH. It seems that the activity of degradation of

lindane and other HCH isomers is widespread among Clostridia and they are the most

dominant HCH co-metabolizing organisms in soils (Ohisa and Yamaguchi

1979 ) . It can

also be concluded that the large numbers of Clostridia could be the reason for the rapid

decomposition of lindane in submerged soils (Ohisa and Yamaguchi

1978a ) .

Mixed anaerobic microbial populations were enriched from soil, freshwater mud,

sheep rumen, and chicken litter in medium reduced with cysteine and sodium

sul ﬁ de. The bacteria were originally enriched in a medium containing 10 ug ml

−1

dieldrin which were later screened for lindane degradation. 100% removal of lin-

dane was observed from the enrichment within 6 h. The mixed anaerobic popula-

tion contained ten different obligate anaerobic bacteria including C. bifermentans,

C. glycolium, and Clostridium sp. The parent culture was more ef ﬁ cient in lindane

degradation than the isolates (Maule et al. 1987 ) .

508

F. Mehboob et al.

Marine sediments around the dwellings of a tribromopyrrole-producing marine

hemichordate, were used to enrich cultures capable of lindane degradation

co-metabolically. Citrate, lactate, yeast extract and sulfate containing enrichments

dehalogenated lindane. Lindane degradation was inhibited with molybdate, which

is the speci ﬁ c inhibitor for sulfate reduction indicating the involvement of sulfate

reducers. Elimination of sulfate from the medium reduced lindane degradation by

only 5% showing the involvement of non-sulfate reducers in the process. More than

90% of the added lindane was dechlorinated within 20 days by the enrichments.

In subsequent experiments, pure cultures of Desulfovibrio gigas ATCC 19364,

Desulfovibrio africanus ATCC 19997, Desulfococcus multivorans ATCC 33890

and Desulfobacter curvatus ATCC 43919 were found to dechlorinate more than

50% of lindane within 4 h of incubation. Autoclaved cultures of Desulfovibrio gigas

were also able to dechlorinate lindane indicating that it is a co-factor rather than an

enzyme mediated process (Boyle et al.

1999 ) .

The ﬁ rst de ﬁ ned anaerobic bacterial culture that is able to dehalorespire with

β -HCH was reported by van Doesburg et al. ( 2005 ) . The culture was enriched from

HCH polluted soil using lactate as electron donor, which was later replaced by the

, and with β -HCH as electron acceptor. The co-culture was maintained for over

3 years with hydrogen as the electron donor and β -HCH as the only terminal electron

acceptor through successive transfers. The co-culture consisted of a Dehalobacter

sp. and a Sedimentibacter sp. The Dehalobacter sp. is the dehalorespiring bacterium

which grows with β -HCH and a suitable electron donor, but only in the presence of

the Sedimentibacter sp. (van Doesburg et al. 2005 ) . Formerly the genus

Sedimentibacter was classi ﬁ ed inside the genus Clostridium (Breitenstein et al.

2002 ) . We have observed that the Sedimentibacter sp., which we found in co-culture

with Dehalobacter , can also carry out the Stickland reaction. This reaction was

originally thought to be the electron donating process for the γ -HCH dechlorination

in various Clostridium spp. , but our Sedimentibacter sp. was unable to grow with

β -HCH. This may suggest that Stickland reactions are not necessary for electron

donation and instead it can be that only the presence of peptone and/or yeast extract

in the medium is important. It has been suggested that Sedimentibacter stimulates

the dechlorination of β -HCH by providing some kind of growth factors like vitamins,

amino acids or other compounds. H

, lactate, pyruvate and acetate were the electron

donors required for the dechlorination (van Doesburg et al. 2005 ) . When the bicar-

bonate buffer was replaced by phosphate and the CO

from headspace was replaced

by H

only, the co-culture still grew and dechlorinated the β -HCH suggesting that

instead of bicarbonate, either HCH itself or peptone is used as carbon source.

α -HCH was dechlorinated at the rates comparable with β -HCH degradation, while

it took 130 days for dechlorination of the γ -HCH. It was also shown that the benzene:

chlorobenzene ratio decreased with increasing number of axial chlorine atoms in

the HCH molecule. β -HCH, which does not contain an axial chlorine has a ratio of

0.7, while α -HCH (containing 2 axial Cl atoms) has 0.3 and γ -HCH (containing 3

axial Cl atoms) has a ratio of 0.2 (van Doesburg et al.

2005 ) .

Based upon the fraction of electron equivalents from the electron donor to be

used for reductive dechlorination, Elango et al. ( 2011 ) demonstrated that γ -HCH

509

20 Anaerobic Degradation of Lindane and Other HCH Isomers

acts as a terminal electron acceptor for an enrichment culture in HEPES-buffered

anaerobic mineral salt medium. 79–90% of the electron equivalents from hydrogen

(electron donor) were used by the enrichment culture for reductive dechlorination of

the γ -HCH. The rate of dechlorination of lindane was found to be 1.0–1.5 mg l

−1

day

−1

. An enrichment culture with hydrogen as electron donor was successfully

maintained for 1 year through three transfers (1% v/v), suggesting that γ -HCH

dechlorination is linked to the growth of microbes performing this reaction. Benzene

and chlorobenzene were the only volatile transformation products detected, account-

ing for 25 and 75% of the γ -HCH degradation. Addition of vancomycin signi ﬁ cantly

decreased the rate of γ -HCH dechlorination, showing that Gram-positive organisms

are responsible. A denaturing gradient gel electrophoresis (DGGE) of the enrich-

ment culture did not show any known chlororespiring genera, including Dehlaobacter .

However, a Desulfomicrobium sp. and several uncultured bacteria were found to be

present (Elango et al.

2011 ) .

6 Detection of Metabolites and Mechanism

of Anaerobic Dechlorination

The mechanism of anaerobic degradation of lindane and other HCH isomers is

explained on the basis of detection of intermediates of the presumed pathway.

However, expected intermediates of HCH degradation such as tetrachlorocyclohex-

enes (TeCCHs), pentachlorocyclohexenes (PeCCHs) and pentachlorocyclohexanes

(PCCHa) have not always been detected presumably because of different conver-

sion rates for the individual transformation steps (Buser and Müller 1995 ) . van

Eekert et al. ( 1998 ) suggested that since the ﬁ rst step in the transformation of HCH

in their study was the rate-limiting step, so intermediates were not observed.

Tables 20.1 and 20.2 list a number of intermediates formed during HCH degrada-

tion by various pure cultures and enrichments.

Intermediates were used as indicator for the occurrence of lindane biodegrada-

tion in many studies. The formation of TeCCH was observed in active ﬂ ooded soil

treated with lindane while TeCCH was not found in soils without lindane treatment

or soils treated with sodium azide (Tsukano and Kobayashi 1972 ) .

Rapid formation of γ -TeCCH was observed as the main intermediate (Jagnow

et al. 1977 ) and was suggested as the reason for the faster degradation under

anoxic conditions, compared with the slower aerobic degradation where PeCCH

was detected as intermediate. Small amounts of tri- and tetra-chlorobenzene have

also been found, but they were not con ﬁ rmed as intermediates. A dichloro elimi-

nation reaction has been proposed as a ﬁ rst step in the degradation of lindane

(Jagnow et al.

1977 ) .

Formation of a pentachloro compound (PeCCHs and PCCHa) was ruled out during

HCH dechlorination with C. sphenoides. Neither these pentachloro compounds were

detected during lindane degradation nor TeCCH formation was observed during the

dechlorination of these two pentachloro compounds, while TeCCH is already a known

510

F. Mehboob et al.

Table 20.2 Summary of biodegradation studies of the HCH isomers, by unknown microorganisms

Compound

External source of C or energy or

supplement Metabolite formed End product Reference

γ -HCH Organic matter – – Raghu and MacRae (

1966 )

Organic matter – – Lichtenstein et al. (

1966 )

Organic matter – – Hill and McCarty (

1967 )

Organic matter – – Yoshida and Castro (

1970 )

1.95% total carbon content – – Tsukano and Kobayashi (

1972 )

Organic matter γ -TeCCH (>5%), γ -PeCCH

(<2%) and small amounts of

1,2,4-TCB, 1,2,3,5 and/or

1,2,4,5 tetrachlorobenzene

and 1,2,3,4-

tetrachlorobenzene

– Mathur and Saha (

1975 )

Citrate, lactate, yeast extract and

sulfate containing media

– Benzene and CB Boyle et al. (

1999 )

Dextrose unknown Chloride released Krishna and Philip (

2008 )

Lactate – – Baczynski et al. (

2010 )

Organic matter, silicone oil added

in selected units

PeCCH and 1,2,4-TCB – Comacho-Perez et al. (

2010 )

β -HCH Methanol, VFAs (acetate,

propionate, Butyrate) or

sucrose

– Benzene and CB Van Eekert et al. (

1998 )

α -HCH

α -HCH Organic matter, glucose, glutamic

acid, peptone

– – Doelman et al. (

1985 )

Glucose, acetate 3,5-dichlorophenol, and a

trichlorophenol (possibly

2,4,5-trichlorophenol)

CB Bachmann et al. (

1988b )

HCH Lactate, land ﬁ ll leachate, compost

leachate

– Benzene and CB and

chlorophenol

Langenhoff et al. (

2002 )

511

20 Anaerobic Degradation of Lindane and Other HCH Isomers

Compound

External source of C or energy or

supplement Metabolite formed End product Reference

Tech. HCH Methanol – Methane and CO

Bhat et al. ( 2006 )

Acetate, butyrate, formate,

ethanol and methanol

– – Bhatt et al. (

2008 )

γ -HCH Organic matter – C

MacRae et al. ( 1967 )

δ -HCH

Soil with 3.98% carbon contents

and amended with urea,

inositol, YE, a mixture of

glutamine, serine, proline,

leucine

– – MacRae et al. (

1984 )

β -HCH

α -HCH

Soluble starch and bakers’ yeast

as additional nutrients

– – Buser and Müller ( 1995 )

Lactate TeCCH Benzene and CB Middeldorp et al. (

1996 )

Acetate, propionate, lactate,

methanol, H2, yeast extract

and land ﬁ ll leachate

– Benzene and CB Middeldrop et al. (

2005 )

The columns were fed with lactate

Potato starch in liquid medium α - and γ -HCH via PCCHa,

from which the 1,2-DCB

and 1,3-DCB isomers and

ﬁ nally CB are formed

CB Quintero et al. (

2005 )

In slurry acetic-propionic-butyric

acid (4:1:1)

In β - and δ -HCH via PCCHa,

TeCCH, 1,2,3-TCB,

1,4-DCB and ﬁ nally CB

Glucose + methanol, glucose only,

methanol only, acetate, and

ethanol

– CB Cui et al.

2012

– not described/not detected, 1,2,3-TCB 1,2,3-trichlorobenzene, 1,2,4-TCB 1,2,4-trichlorobenzene, I,2-DCB 1,2-dichlorobenzene, 1,4-DCB 1,4-dichlorobenzene,

CB chlorobenzene, PCCHa pentachlorocyclohexane, TeCCH tetrachlorocyclohexene, g -PeCCH γ -2,3,-4,5,6-pentachloro-1-cyclohexene

Mainly a mix of different fatty acids

512

F. Mehboob et al.

intermediate in the lindane degradation (Heritage and MacRae 1977b, 1979 ) . Due to

the formation of TeCCH (Heritage and MacRae 1977b ) and ruling out a pentachloro

intermediate, it was indicated that two chlorine atoms are removed in the ﬁ rst step

of degradation of lindane (Heritage and MacRae

1979 ) as was also proposed by

Jagnow et al. ( 1977 ) .

Clostridium rectum S-17 metabolizes lindane to chlorobenzene via the formation

of γ -TeCCH (Ohisa and Yamaguchi 1978b ; Ohisa et al. 1980 ) . This strain can also

metabolize the γ -1,2,3,4,5,6-hexachlorocyclohexene and γ -l,3,4,5,6-pentachloro-

cyclohexene via 1,2,4-trichlorobenzene and 1,4-dichlorobenzene, respectively

(Ohisa et al. 1982 ) . TeCCH was also detected in mixed anaerobic microbial popula-

tions metabolizing lindane (Maule et al. 1987 ) .

A complete mechanism of β -HCH degradation was proposed by Middeldorp

et al. ( 1996 ) . 3,4,5,6-tetrachlorocyclohexane (TeCCH) was detected as intermediate

and benzene and chlorobenzene as the end products of the degradation. It was

proposed that β -HCH was converted into TeCCH via the dichloro-elimination.

Another dichloro-elimination reaction yielded a dichlorocyclohexadiene, which

was either converted to chlorobenzene via an abiotic dehydrohalogenation reaction

or biotically to benzene via another dichloro-elimination reaction (Baker et al. 1985 ;

Middeldorp et al. 1996 ) . After 49 days the chlorobenzene formed corresponded to

about 67% and benzene corresponds to 19% of initial amount of β -HCH added. The

remaining fraction (15%) was attributed to loss of volatile products in sampling and

to analysis variance (Middeldorp et al. 1996 ) .

Mass balance calculations indicated that nearly 85% of the initial α -HCH was

metabolized to chlorobenzene (CB), 3,5-dichlorophenol, and a trichlorophenol

isomer, possibly 2,4,5-trichlorophenol (Bachmann et al. 1988b ) . Equal amounts

of benzene and chlorobenzene were formed by the soil microbiota during the

reductive dechlorination of β -HCH (van Eekert et al. 1998 ) . However, a higher

ratio of benzene to chlorobenzene was observed in granular sludge as compared

with the crushed granules. This was attributed to the syntrophic interaction

between the microorganisms (van Eekert et al. 1998 ) . During the lindane degrada-

tion by sulfate reducing enrichments a 3:1 ratio of chlorobenzene and benzene

was formed and in total it represented nearly 60% of the added lindane. The incom-

plete mass balance was attributed to the loss of benzene and chlorobenzene to the

headspace (Boyle et al. 1999 ) .

Based upon the intermediates detection Quintero et al. ( 2005 ) suggested two

different pathways for anaerobic degradation of HCH isomers. The degradation

of α - and γ -HCH is initiated with a dechlorination to form PCCHa, from which

the 1,2-DCB (1,2-dichlorobenzene) and 1,3-DCB (1,2-dichlorobenzene) and

ﬁ nally CB is formed. In contrast, for β - and δ -HCH the biodegradation pathway

is initiated with PCCHa, followed by one sequential chlorine removal at each step

forming TeCCH, 1,2,3-TCB (1,2,3-trichlorobenzene), 1,2-DCB, 1,4-dichlorobenzene

(1,4-DCB) and ﬁ nally CB (Quintero et al. 2005 ) .

Based upon the intermediates formed by the pure cultures (Table 20.1 ) and the

conclusions of Jagnow et al. (

1977 ) and Heritage and MacRae ( 1979 ) , a pathway for

the reductive dehalogenation of HCH is presented in Fig. 20.2 .

513

20 Anaerobic Degradation of Lindane and Other HCH Isomers

Fig. 20.2 Proposed pathway for the reductive dehalogenation of HCH (re-drawn from van

Doesburg et al.

2005 ) . Biotic transformation takes place via three successive dihaloelimination

reactions forming tetrachlorocyclohexene ( TeCCH ), dichlorocyclohexadiene ( DCCH ) and ﬁ nally

benzene. Chlorobenzene ( CB ) is formed abiotically via a dehydrohalogenation reaction

7 Factors Affecting the Microbial Dechlorination

of Lindane and Other HCH Isomers

Factors such as type of electron donor or substrate, electron acceptor, redox condition

and temperature etc. can affect the dechlorination of lindane and other HCH isomers.

7.1 Effect of Electron Donor or Substrate

The type of electron donor or substrate affected the dechlorination of the lindane

and other HCH isomers in different studies. Rice straw was found to be the best

followed by cellulose and then glucose during degradation of the four isomers of

HCH in submerged soils. The positive effect of rice straw may be due to the high

content of available carbon and nitrogen (Castro and Yoshida 1974 ) . During the

dechlorination of lindane by Citrobacter freundii , glucose was found to be the best

substrate followed by pyruvate, formate and, to a little extent, succinate (Jagnow

et al. 1977 ) . Similarly, addition of glucose also slightly stimulated the lindane

degradation in ﬂ ooded soils (Ohisa and Yamaguchi 1978a ) . However, in contrast to

this, glucose inhibited the dechlorination of lindane in an anaerobic mixed popula-

tion (Maule et al. 1987 ) . Here, formate was found to be the best substrate for

dechlorination followed by Stickland type amino acids and then acetate, pyruvate,

and mannitol (Maule et al. 1987 ) .

Peptone and yeast extract had a positive effect on HCH degradation. Peptone

might also have helped to lower the redox potential. A mixture of amino acids, yeast

extract and inositol were found to stimulate the degradation of α -, β -, γ - and δ -HCH.

Amino acids and inositol can be fermented by Clostridia and yeast extract has a

growth stimulating effect on microbes thus increasing the degradation rate of the

four isomers of HCH (MacRae et al. 1984 ) .

514

F. Mehboob et al.

A shorter lag phase of 20 days was observed with lactate, yeast extract, and

fermented land ﬁ ll leachate for dechlorination of β -HCH while a longer lag phase

of >20 days was found with methanol, hydrogen, acetate and propionate. The

ratio of benzene and chlorobenzene produced with different electron donors was

stable during the dechlorination and was between 0.2 and 0.5 for all electron

donors tested, except in fermented land ﬁ ll leachate (0.8) and acetate (1.3)

(Middeldorp et al.

2005 ) .

In an experiment with a β -HCH dechlorinating enrichment, a shorter lag phase

of 11 days was observed with acetate and lactate while with propionate and metha-

nol it was found to be 19 and 28 days, respectively. Only the lactate enrichment

continued reductive dechlorination on further transfer. It took 2 weeks for complete

dechlorination of β -HCH with lactate or acetate as the electron donor, while it

took 3–4 weeks when propionate and methanol were used as electron donor

(van Doesburg et al. 2005 ) .

The order of technical HCH degradation in a UASB reactor for different electron

donors was found to be methanol > ethanol > acetate > butyrate > formate (Bhatt et al.

2008 ) . The addition of electron donors signi ﬁ cantly enhanced the dechlorination of

α -, β -, γ - and δ -HCH by an enrichment culture. α - and γ -HCH in methanol and ethanol

fed cultures were completely dechlorinated in 8 and 12 days while δ - and β -HCH

with the same electron donors were dechlorinated in 28 days. Dechlorination with

glucose and acetate was found to be slower (Cui et al. 2012 ) .

The organic matter level is directly related to the rate of decomposition and a

more pronounced effect of organic matter addition was observed with soils having

a lower level of organic matter (Castro and Yoshida 1974 ) . Organic matter helps in

lowering the redox potential of the soil (Yoshida and Castro 1970 ) and may provide

the electrons for lindane degradation.

Siddaramappa and Sethunathan ( 1975 ) found that the transformation of β -HCH

in soil required a redox potential lower than −40 mV. The low redox potential caused

by methanogenic conditions, and/or the presence of sul ﬁ de in the incubations was

helpful for a complete biotransformation of β -HCH to benzene and chlorobenzene

(van Eekert et al. 1998 ) .

7.2 Effect of Temperature

Anaerobic lindane degradation increases with an increase in temperature (Hill and

McCarty

1967 ; Yoshida and Castro 1970 ) . The rate of lindane degradation was

0.3 ug ml

−1

day

−1

at 35°C and 0.1 ug ml

−1

day

−1

at 20°C (Hill and McCarty 1967 ) .

In an anaerobic β -HCH dechlorinating mixed culture, no measurable β -HCH

dechlorination occurred at 4 and 10°C over a period of 100 days. After 248 days

β -HCH was completely dechlorinated in the incubations at 10°C but not at 4°C.

An optimum temperature of 30°C was found for this mixed culture (Middeldorp

et al. 2005 ) . A 95% loss of lindane was observed at 30°C within 2 weeks as com-

pared to only 63% at 12°C (Baczynski et al. 2010 ) .

515

20 Anaerobic Degradation of Lindane and Other HCH Isomers

7.3 Effect of Electron Acceptor

Molecular oxygen, nitrate, and manganese oxide retarded the rate of γ -HCH

degradation in rice soils. The probable reasons are that these compounds inhibit the

lowering of the redox potential of the soil and that they can act as electron acceptor

(Yoshida and Castro

1970 ) .

A decrease in degradation of lindane was observed in an anaerobic mixed

bacterial culture when oxygen contents were increased (Haider and Jagnow 1975 ) .

Anoxic conditions were found to be the most suitable for the dechlorination of

lindane among the oxic (shake cultures under air), semi-oxic (stationary cultures

under air) and anoxic (stationary cultures under N

) conditions (Jagnow et al. 1977 ) .

Lindane degradation by C. rectum S-17 was immediately inhibited when anaerobi-

cally growing cultures were exposed to oxygen (Ohisa and Yamaguchi 1979 ) .

The addition of sulfate had no effect on β -HCH dechlorination and led to a

simultaneous reduction of β -HCH and sulfate, while the addition of nitrate stopped

the β -HCH degradation. When nitrate was omitted, it took 1 month to restore the

dechlorination activity in a soil percolation column (Middeldorp et al. 2005 ) .

By contrast, nitrate was used to stimulate the degradation of intermediates of HCH

degradation (Langenhoff et al. 2002 ) . So nitrate inhibits the HCH degradation in the

reaction mixture as the competing electron acceptor, but when used sequentially it can

stimulate the degradation by metabolizing the intermediates in the HCH degrada-

tion pathway.

8 Metagenomics of Anaerobic HCH Dechlorination

Molecular studies for the anaerobic dechlorination of lindane and other HCH

isomers are totally absent. It is pertinent to mention here that even most of the isolates

capable of reductive dechlorination of HCH have not been identi ﬁ ed by the most

widely used 16S rRNA gene marker. No information is available on the genes and

enzymes responsible for reductive dechlorination of HCH. The reason could be that

since the bacteria which can dehalorespire with chlorinated compounds are dif ﬁ cult

to grow and are very sensitive to oxygen. Also due to their small genome size, they

are mostly dependent on another syntrophic partner and are dif ﬁ cult to isolate. Only

very recently, Maphosa ( 2010 ) adopted a metagenomic approach to gain insight in

the genomes of Dehalobacter sp. E1 and Sedimentibacter sp. B4 in a co-culture

capable of β -HCH dechlorination, which was originally isolated by van Doesburg

et al. ( 2005 ) . This is the only co-culture available which can dehalorespire with

β -HCH. The draft genome of Dehalobacter is approximately 2.6 Mbp in size and

contains ten putative reductive dehalogenase-encoding gene clusters. No reductive

dehalogenase (Rdh) genes were found on the Sedimentibacter genome con ﬁ rming

the previous results that Dehalobacter is responsible for reductive dehlaogenation

of β -HCH. Phylogenetic analysis revealed that seven out of ten putative reductive

516

F. Mehboob et al.

dehalogenases (Rdh) are closely related to chlorophenol Rdh genes and three to

tetrachloroethene Rdh genes. This indicates that Dehalobacter sp. E1 has a higher

dehalogenation potential than previously thought. This has been con ﬁ rmed in

degradation experiments where the dechlorination of trichloroethene could be

coupled to growth by this co-culture (Maphosa

2010 ) . Previously, this culture was

unable to dechlorinate tetrachloroethene (PCE) within 5 months (van Doesburg

et al.

2005 ) . A transcription analysis revealed that after 11 days of growth on β -HCH,

eight out of ten Rdh genes were induced. However, after 30 days of incubation,

three of the Rdhs having the highest expression during the ﬁ rst 11 days were not

transcribed leading to the suggestion that those three Rdhs are only involved in the

initial dechlorination of β -HCH. However, four other Rdhs, which are supposed to

be involved in the subsequent chloro-elimination reactions, were up-regulated after

30 days. The 4.2 Mbp genome of Sedimentibacter contains genes for carbohydrates

catabolism, for biosynthesis of amino acids, and for the production of several vitamins.

Genes for the fermentative conversion of acetyl-CoA to butyrate and lactate and

genes for cobalamin (vitamin B12) biosynthesis on the Sedimentibacter sp. genome

could be the reason for dependence of Dehalobacter on Sedimentibacter (Maphosa

2010 ) .

9 Conclusions and Future Recommendations

Since lindane and other HCH isomers are persistent, toxic, bio-accumulating,

carcinogenic substances and are included in the new POPs list, studies for the

enrichment and isolation of HCH dechlorinating microorganisms are essential.

Studying the physiology of HCH-degrading microorganisms will help to have a

better understanding of the HCH dehalogenation mechanism. This will help to

develop an effective strategy for biological removal of lindane and other HCH isomers

from the environment. Most of the studies have focused on the dechlorination of

HCH via co-metabolic reactions that are often slow and may result in incomplete

degradation of the HCH isomers. The need is to focus more on the enrichment and

isolation of more specialized, dehalorespiring microorganisms like Dehalobacter.

One such enrichment was obtained and studied by Elango et al. ( 2011 ) , but the

responsible microorganisms are not yet known. Not one single isolate is known,

which can couple the dechlorination of all isomers of HCH to growth. The lack of

such an organism is a bottleneck in studying the genetics and biochemistry of the

anoxic microbial HCH dechlorination process. An increase in the number of these

HCH dechlorinating enrichments and ultimately pure bacterial cultures will help to

understand the process and will open more options for bioremediation

Metagenomic and metatranscriptomic approaches such as adopted by Maphosa

(

2010 ) could in the meantime help to better understand the mechanism of anaerobic

dechlorination of HCH. Additional metaproteomic and metabolomic studies with

this co-culture might help better understand the mechanism. More ﬁ eld studies like

the one conducted by Langenhoff et al. ( 2002 ) are needed to monitor and if required

517

20 Anaerobic Degradation of Lindane and Other HCH Isomers

stimulate the in situ bioremediation of lindane and other HCH isomers. A sequential

anaerobic-aerobic treatment strategy is suggested for the complete mineralization

of lindane and other HCH isomers (Langenhoff 2009 ) .

Acknowledgements We would like to thank Wim van Doesburg (WUR) and Dr. Sher (AIOU)

for help in making ﬁ gures. We also thank the Dutch Center for Soil Quality Management and

Knowledge Transfer, (SKB;

www.skbodem.nl ) The Netherlands, and the Wageningen Institute

for Environment and Climate Research (WIMEK), The Netherlands for providing funds for the

present study.

References

Bachmann A, de Bruin W, Jumelet JC, Rijnaarts HHM, Zehnder AJB (1988a) Aerobic biominer-

alization of alphahexachlorocyclohexane in contaminated soil. Appl Environ Microbiol

54:548–554

Bachmann A, Wijnen P, de Bruin W, Huntjens JLM, Roelofsen W, Zehnder AJB (1988b)

Biodegradation of alpha- and beta-hexachlorocyclohexane in a soil slurry under different redox

conditions. Appl Environ Microbiol 54:143–149

Baczynski TP, Pleissner D, Grotenhuis T (2010) Anaerobic biodegradation of organochlorine

pesticides in contaminated soil-signi ﬁ cance of temperature and availability. Chemosphere

78:22–28

Badea S-L, Vogt C, Weber S, Danet A-F, Richnow H-H (2009) Stable isotope fractionation of

g -hexachlorocyclohexane (lindane) during reductive dechlorination by two strains of sulfate-

reducing bacteria. Environ Sci Technol 43:3155–3161

Baker MT, Nelson RM, van Dijke RA (1985) The formation of chlorobenzene and benzene by the

reductive metabolism of lindane in rat liver microsomes. Arch Biochem Biophys 236:506–514

Benezet HJ, Matsumura F (1973) Isomerization of γ -BHC to α -BHC in the environment. Nature

243:480–481

Berg T, Kallenborn R, Manø S (2004) Challenges in arctic-alpine environmental research. Arct

Antarct Alp Res 36:284–291

Beurskens JEM, Stams AJM, Zehnder AJB, Bachmann A (1991) Relative biochemical reactivity

of three hexachlorocyclohexane isomers. Ecotoxicol Environ Safety 21:128–136

Bhat P, Kumar MS, Mudliar SN, Chakrabarti T (2006) Biodegradation of tech-hexachlorocyclo-

hexane in a up ﬂ ow anaerobic sludge blanket (UASB) reactor. Bioresour Technol 97:824–830

Bhatt P, Kumar MS, Mudliar SN, Chakrabarti T (2008) Enhanced biodegradation of hexachloro-

cyclohexane in up ﬂ ow anaerobic sludge blanket reactor using methanol as an electron donor.

Bioresour Technol 99:2594–2602

Boyle AW, Haggblom MM, Young LY (1999) Dehalogenation of lindane ( γ -hexachlorocyclo-

hexane) by anaerobic bacteria from marine sediments and by sulfate-reducing bacteria. FEMS

Microbiol Ecol 29:379–387

Breitenstein A, Wiegel J, Haertig C, Weiss N, Andreesen JR, Lechner U (2002) Reclassi ﬁ cation of

Clostridium hydroxybenzoicum as Sedimentibacter hydroxybenzoicus gen. nov., comb. nov.,

and description of Sedimentibacter saalensis sp. nov. Int J Sys Evol Microbiol 52:801–807

Breivik K, Pacyna JM, Munch J (1999) Use of α , β and γ -hexachlorocyclohexane in Europe,

1970–1996. Sci Total Environ 239:151–163

Buser H-R, Müller MD (1995) Isomer and enantioselective degradation of hexachlorocyclohexane

isomers in sewage sludge under anaerobic conditions. Environ Sci Technol 29:664–672

Camacho-Pérez B, Ríos-Leal E, Esparza-García F, Cortes JB, Fava F, Poggi-Varaldo HM (2010)

Bioremediation of an agricultural soil polluted with lindane in triphasic, sequential methano-

genic-sulfate reducing slurry bioreactors. J Biotechnol 150:S561–S562

518

F. Mehboob et al.

Camacho-Pérez B, Ríos-Leal E, Rinderknecht-Seijas N, Poggi-Varaldo HM (2012) Enzymes

involved in the biodegradation of hexachlorocyclohexane: a mini review. J Environ Manag

95:S306–S318

Castro TF, Yoshida T (1974) Effect of organic matter on the biodegradation of some organochlorine

insecticides in submerged soils. Soil Sci Plant Nutr 20:363–370

Cui Z, Meng F, Hong J, Li X, Ren X (2012) Effects of electron donors on the microbial reductive

dechlorination of hexachlorocyclohexane and on the environment. J Biosci Bioeng 113:765–770

Deo PG, Karanth NG, Karanth NGK (1994) Biodegradation of hexachlorocyclohexane isomers in

soil and food environment. CRC Crit Rev Microbiol 20:57–78

Doelman P, Haanstra L, deRuiter E, Slange J (1985) Rate of microbial degradation of high concen-

trations of a-hexachlorocyclohexane in soil under aerobic and anaerobic conditions. Chemosphere

14:565–570

Doelman P, Haanstra L, Vos A (1988) Microbial degradation by the autochthonous soil population

of alpha and beta HCH under anaerobic ﬁ eld conditions in temperate regions. Chemosphere

17:481–487

Dogra C, Raina V, Pal R, Suar M, Lal S, Gartemann KH, van der Meer JR, Holliger C, Lal R

(2004) Organization of lin genes and IS6100 among different strains of hexachlorocyclohexane

degrading Sphingomonas paucimobilis : evidence for natural horizontal transfer. J Bacteriol

186:2225–2235

Elango V, Kurtz HD, Anderson C, Freedman DL (2011) Use of γ -hexachlorocyclohexane as a

terminal electron acceptor by an anaerobic enrichment culture. J Hazard Mater 197:204–210

Feldmann RJ, Maibach HI (1974) Percutaneous penetration of some pesticides and herbicides in man.

Toxicol Appl Pharmacol 28:126–132

Field JA, Stams AJM, Kato M, Schraa G (1995) Enhanced biodegradation of aromatic pollutants in

cocultures of anaerobic and aerobic bacterial consortia. Antonie Van Leeuwenhoek 67:47–77

Geyer HJ, Scheunert I, Korte F (1987) Correlation between the bioconcentration potential of

organic environmental chemicals in humans and their n-octanol/water partition coef ﬁ cients.

Chemosphere 16:239–252

Haider K (1979) Degradation and metabolization of lindane and other hexachlorocyclohexane

isomers by anaerobic and aerobic soil microorganisms. Z Naturforsch 34c:1066–1069

Haider K, Jagnow G (1975) Abbau von

C-,

H- und

Cl-markierten γ -Hexachlorcyclohexan

durch anaerobe Bodenmikroorganismen. Arch Microbiol 104:113–121

Heritage AD, MacRae IC (1977a) Degradation of lindane by cell-free preparations of Clostridium

sphenoides . Appl Environ Microbiol 34:222–224

Heritage AD, MacRae IC (1977b) Identi ﬁ cation of intermediates formed during the degradation of

hexachlorocyclohexanes by Clostridium sphenoides . Appl Environ Microbiol 33:1295–1297

Heritage AD, MacRae IC (1979) Degradation of hexachlorocyclohexanes and structurally related

substance by Clostridium sphenoides . Appl Environ Microbiol 33:1295–1297

Hill DW, McCarty PL (1967) Anaerobic degradation of selected chlorinated hydrocarbon pesticides.

JWPCF 39:1259–1277

Jagnow G, Haider K, Ellwardt P (1977) Anaerobic dechlorination and degradation of hexachlorocy-

clohexane isomers by anaerobic and faculative anaerobic bacteria. Arch Microbiol 115:285–292

Jung D, Becher H, Edler L, Flesch-Janys D, Gurn P, Konietzko J, Manz A, Papke O (1997)

Elimination of beta-hexachlorocyclohexane in occupationally exposed persons. J Toxicol

Environ Health 51:23–34

Krishna KR, Philip L (2008) Biodegradation of lindane, methyl parathion and carbofuran by

various enriched bacterial isolates. J Environ Sci Health B 43:157–171

Kurihara N, Ohisa N, Nakajima M, Kakutani T, Senda M (1981) Relation between microbial

degradation and polarographic half-wave potential of polychlorocyclohexenes and BHC

isomers. Agric Biol Chem 45:1229–1235

Lal R, Pandey G, Sharma P et al (2010) Biochemistry of microbial degradation of hexachlorocy-

clohexane and prospects for bioremediation. Microbiol Mol Bio Rev 74:58–80

Langenhoff AAM (2009) Bioremediation of areas polluted with chlorinated and non-chlorinated

hydrocarbons. Land Contam Recl 17:295–302

519

20 Anaerobic Degradation of Lindane and Other HCH Isomers

Langenhoff AAM, Staps JJM, Pijls C, Alphenaar A, Zwiep G, Rijnaarts HHM (2002) Intrinsic and

stimulated in situ biodegradation of hexachlorocyclohexane (HCH). Water, Air, Soil Poll Focus

2:171–181

Law SA, Bidleman TF, Martin MJ, Ruby MV (2004) Evidence of enantioselective degradation of

α -hexachlorocyclohexane in groundwater. Environ Sci Technol 38:1633–1638

Li YF (1999) Global technical hexachlorocyclohexane usage and its contamination consequences

in the environment: from 1948 to 1997. Sci Total Environ 232:121–158

Lichtenstein EP, Polivka JB (1959) Persistence of some chlorinated hydrocarbon insecticides in

turf soils. J Econ Ent 52:289–293

Lichtenstein EP, Schulz KR, Skrentny RF, Tsukano Y (1966) Toxicity and fate of insecticide

residues in water. Arch Environ Health 12:199–212

Lodha B, Bhat P, Kumar SM, Vaidya AN, Mudliar S, Killedar DJ, Chakrabarti T (2007)

Bioisomerization kinetics of γ -HCH and biokinetics of Pseudomonas aeruginosa degrading

technical HCH. Biochem Eng J 35:12–19

MacRae IC, Raghu K, Castro TF (1967) Persistence and biodegradation of four common isomers

of benzene hexachloride in submerged soils. J Agric Food Chem 15:911–914

MacRae IC, Raghu K, Bautista EM (1969) Anaerobic degradation of the insecticide lindane by

Clostridium sp. Nature 221:859–860

MacRae IC, Yamaya Y, Yoshida T (1984) Persistence of hexachlorocyclohexane isomers in soil

suspensions. Soil Biol Biochem 16:285–286

Malaiyandi M, Shah SM, Lee P (1982) Fate of alpha- and gamma-hexachlorocyclohexane isomers

under simulated environmental conditions. J Environ Sci Health A A17:283–297

Maphosa F (2010) Chasing organohalide respirers: ecogenomics approaches to assess the biore-

mediation capacity of soils. PhD dissertation, Wageningen University, The Netherlands

Marks TS, Allpress JD, Maule A (1989) Dehalogenation of lindane by a variety of porphyrins and

corrins. Appl Environ Microbiol 55:1258–1261

Mathur SP, Saha JG (1975) Microbial degradation of lindane-C

in a ﬂ ooded sandy loam soil. Soil

Sci 120:301–307

Maule A, Plyte S, Quirk AV (1987) Dehalogenation of organochlorine insecticides by mixed

anaerobic microbial populations. Pestic Biochem Physiol 27:229–236

Mehboob F, Weelink S, Saia FT, Junca H, Stams AJM, Schraa G (2010) Microbial degradation of

aliphatic and aromatic hydrocarbons with (per)chlorate as electron acceptor. In: Timmis KN (ed)

Handbook of hydrocarbon and lipid microbiology. Springer, Berlin/Heidelberg

Metcalf RL (1955) Organic insecticides, their chemistry and mode of action. Interscience, New York

Middeldorp PJ, Jaspers M, Zehnder AJB, Schraa G (1996) Biotransformation of α -, β -, γ -,

δ -hexachlorocyclohexane under methaonogenic conditions. Environ Sci Technol 30:2345–2349

Middeldorp PJ, van Doesburg W, Schraa G, Stams AJ (2005) Reductive dechlorination of hexachlo-

rocyclohexane (HCH) isomers in soil under anaerobic conditions. Biodegradation

16:283–290

Miyauchi K, Adachi Y, Nagata Y, Takagi M (1999) Cloning and sequencing of a novel meta -

cleavage dioxygenase gene whose product is involved in degradation of γ -hexachlorocyclo-

hexane in Sphingomonas paucimobilis . J Bacteriol 181:6712–6719

Nagasawa S, Kikuchi R, Nagata Y, Takagi M, Matsuo M (1993) Aerobic mineralization of gamma-

HCH by Pseudomonas paucimobilis UT26. Chemosphere 26:1719–1728

Nagata YT, Hatta IR, Kimbara K, Fukuda M, Yano K, Takagi M (1993) Puri ﬁ cation and character-

ization of γ -hexachlorocyclohexane ( γ -HCH) dehydrochlorinase (LinA) from Pseudomonas

paucimobilis . Biosci Biotechnol Biochem 59:1582–1583

Nagata YT, Ohtomo R, Miyauchi K, Fukuda M, Yano K, Takagi M (1994) Cloning and sequencing

of a 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase gene involved in the degradation

of γ -hexachlorocyclohexane in Pseudomonas paucimobilis . J Bacteriol 176:3117–3125

Nagata K, Huang CS, Hamilton BJ, Carter DB, Narahashi T (1996) Differential effects of hexachlo-

rocyclohexane on the GABA receptor subunits expressed in human embryonic kidney-cell line.

Brain Res 738:131–137

520

F. Mehboob et al.

Nagata YT, Miyauchi K, Takagi M (1999) Complete analysis of genes and enzymes for γ -hexachlo-

rocyclohexane degradation in Sphingomonas paucimobilis UT26. J Ind Microbiol Biotechnol

23:380–390

Nagata YT, Prokop Z, Sato Y, Jerabek P, Kumar A, Ohtsubo Y, Tsuda M, Damborsky J (2005)

Degradation of γ -hexachlorocyclohexane by haloalkane dehalogenase LinB from Sphingomonas

paucimobilis UT26. Appl Environ Microbiol 71:2183–2185

Neujahr HY, Rossi-Ricci G (1960) On vitamins in sewage sludge XII. Production of vitamin B

by certain Clostridia . Acta Chem Scand 14:43–47

Newland LW, Chesters G, Lee GB (1969) Degradation of γ -BHC in simulated lake impoundments

as affected by aeration. JWPCF 41:R174–R188

Ohisa N, Yamaguchi M (1978a) Degradation of gamma-BHC in ﬂ ooded soils enriched with

peptone. Agric Biol Chem 42:1983–1987

Ohisa N, Yamaguchi M (1978b) Gamma-BHC degradation accompanied by the growth of

Clostridium rectum isolated from paddy ﬁ eld soil. Agric Biol Chem 42:1819–1823

Ohisa N, Yamaguchi M (1979) Clostridium species and γ -BHC degradation in paddy soil. Soil

Biol Biochem 11:645–649

Ohisa N, Yamaguchi M, Kurihara N (1980) Lindane degradation by cell-free extracts of Clostridium

rectum . Arch Microbiol 125:221–225

Ohisa N, Kurihara N, Yamaguchi M (1982) ATP synthesis associated with the conversion of

hexachlorocyclohexane related compounds. Arch Microbiol 131:330–333

Okey RW, Bogan RH (1965) Apparent involvement of electron mechanism in limiting metabolism

of pesticides. JWPCF 37:692–712

Panda S, Sharmila M, Ramanand K, Panda D, Sethunathan N (1988) Persistence of hexachlorocy-

clohexane isomers and carbofuran applied to surface and sub-surface layers of a ﬂ ooded soil.

Pestic Sci 23:199–207

Phillips TM, Seech AG, Lee H, Trevors JT (2005) Biodegradation of hexachlorocyclohexane

(HCH) by microorganisms. Biodegradation 16:363–392

Quintero JC, Moreira MT, Feijoo G, Lema JM (2005) Anaerobic degradation of hexachlorocyclo-

hexane isomers in liquid and soil slurry systems. Chemosphere 61:528–536

Quintero JC, Moreira MT, Lema JM, Feijoo G (2006) An anaerobic bioreactor allows the ef ﬁ cient

degradation of HCH isomers in soil slurry. Chemosphere 63:1005–1013

Raghu K, MacRae IC (1966) Biodegradation of the gamma isomer of benzene hexachloride in

submerged soils. Science 154:263–264

Rijnaarts HHM, Bachmann A, Jumelet JC, Zehnder AJB (1990) Effect of desorption and intrapar-

ticle mass transfer on the aerobic biomineralization of α -hexachlorocyclohexane in a contami-

nated calcareous soil. Environ Sci Technol 24:1349–1354

Rodriguez-Garrido B, Lu-Chau TA, Feijoo G, Macias F, Monterrroso MC (2010) Reductive

dechlorination of α , β -, γ -, δ -hexachlorocyclohexane isomers with hydroxocobalamin, in soil

slurry systems. Environ Sci Technol 44:7063–7069

Sagelsdorff P, Lutz WK, Schlatter S (1983) The relevance of covalent binding to mouse liver DNA

to the carcinogenic action of hexachlorocyclohexane isomers. Carcinogenesis 4:1267–1273

Sahu SK, Patnaik KK, Sharmila M, Sethunathan N (1990) Degradation of alpha-, beta-, and

gamma-hexachlorocyclohexane by a soil bacterium under aerobic conditions. Appl Environ

Microbiol 56:3620–3622

Sahu SK, Patnaik KK, Bhuyan S, Sreedharan B, Kurihara N, Adhya TK, Sethunathan N (1995)

Mineralization of α -, γ -, and β -isomers of hexachlorocyclohexane by a soil bacterium under

aerobic conditions. J Agric Food Chem 43:833–837

Senoo K, Wada H (1989) Isolation and identi ﬁ cation of an aerobic gamma-HCH-decomposing

bacterium from soil. Soil Sci Plant Nutr 35:79–87

Sharma P, Raina V, Kumari R, Malhotra S, Dogra C, Kumari H, Kohler H-PE, Buser H-R,

Holliger C, Lal R (2006) Haloalkane dehalogenase LinB is responsible for beta- and

delta-hexachlorocyclohexane transformation in Sphingobium indicum B90A. Appl Environ

Microbiol 72:5720–5727

521

20 Anaerobic Degradation of Lindane and Other HCH Isomers

Siddaramappa R, Sethunathan N (1975) Persistence of gamma-BHC and beta-BHC in Indian rice

soils under ﬂ ooded conditions. Pestic Sci 6:395–403

Steinmentz R, Young PCM, Caperellgrant A, Gize EA, Madhukar BV, Benjonathan N, Bigsby RM

(1996) Novel estrogenic action of the pesticide residue beta-hexachlorocyclohexane in human

breast cancer cells. Cancer Res 56:5403–5409

Stewart DKR, Chisholm D (1971) Long-term persistence of BHC, DDT and Chlordane in a sandy

loam soil. Can J Soil Sci 51:379–383

UNEP Stockholm Convention (2008) The new POPs under the Stockholm Convention.

http://chm.

pops.int

. Cited 18 May 2012

Suar M, Hauser A, Poiger T, Buser H-R, Muller MD, Dogra C, Raina V, Holliger C, van der Meer

JR, Lal R, Kohler H-PE (2005) Enantioselective transformation of chiral alpha HCH by HCH

dehydrochlorinases (LinA1 and LinA2) from Sphingomonas paucimobilis B90A. Appl Environ

Microbiol 71:8514–8518

Sugita H, Miyajima C, Deguchi Y (1991) The vitamin B

-producing ability of the intestinal

micro ﬂ ora of freshwater ﬁ sh. Aquaculture 92:267–276

Tsukano Y, Kobayashi A (1972) Formation of γ -BTC in ﬂ ooded rice ﬁ eld soils treated with

γ -BHC. Agric Biol Chem 36:166–167

United States Food and Drug Administration (2009) Lindane shampoo and lindane lotion.

http://www.fda.gov . Cited 18 May 2012

van Doesburg W, van Eekert MH, Middeldorp PJ, Balk M, Schraa G, Stams AJ (2005) Reductive

dechlorination of β -hexachlorocyclohexane ( β -HCH) by a Dehalobacter species in coculture

with a Sedimentibacter sp. FEMS Microbiol Ecol 54:87–95

van Eekert MHA, van Ras NJP, Mentink GH, Rijnaarts HHM, Stams AJM, Field JA, Schraa G

(1998) Anaerobic transformation of β -hexachlorocyclohexane by methanogenic granular

sludge and soil micro ﬂ ora. Environ Sci Technol 32:3299–3304

Vonk JW, Quirijns JK (1979) Anaerobic formation of α -hexachlorocyclohexane from γ - hexachlo-

rocyclohexane in soil and by Escherichia coli . Pest Biochem Physiol 12:68–74

Walker K, Vallero DA, Lewis RG (1999) Factors in ﬂ uencing the distribution of lindane and other

hexachlorocyclohexanes in the environment. Environ Sci Technol 33:4373–4378

Willett KL, Ulrich EM, Hites RA (1998) Differential toxicity and environmental fates of hexachlo-

rocyclohexane isomers. Environ Sci Technol 32:2197–2207

Wu WZ, Xu Y, Schramm KW, Kettrup A (1997) Study of sorption, biodegradation and isomeriza-

tion of HCH in stimulated sediment/water system. Chemosphere 35:1887–1894

Wu J, Hong Q, Sun Y, Hong Y, Yan Q, Li S (2007) Analysis of the role of LinA and LinB in

biodegradation of δ -hexachlorocyclohexane. Environ Microbiol 9:2331–2340

Yoshida T, Castro TE (1970) Degradation of γ -BHC in rice soils. Soil Sci Soc Am Proc

34:440–448

523

Index

ABA. See Abscisic acid (ABA)

Abamectin , 269, 273

Abscisic acid (ABA) , 365

Acaricide , 273, 274

Acetate , 321, 395, 439, 451–453, 457,

458, 461, 462, 499, 501, 502, 504,

508, 510, 511, 513, 514

Acetogenesis , 320, 321, 324, 334, 455

Acetyl-coenzyme A (Acetyl-CoA) , 439, 451,

455, 456, 499, 516

Achromobacter piechaudii , 256, 364, 365

Acidogenesis , 320, 324

Acirovorax , 197

Acrylic acid , 9

Adhesions , 144, 146, 155, 160, 432, 434,

435, 440

ADRA. See Ampli ﬁ ed DNA restriction

analysis (ADRA)

A ﬂ atoxins , 100

AFLP. See Ampli ﬁ ed fragment-length

polymorphism (AFLP)

AFPs. See Auto ﬂ uorescent proteins (AFPs)

Agriculture , 7, 9, 12, 19, 20, 32, 56, 59, 66, 70,

73, 84, 94, 95, 123, 125, 148, 225, 229,

249–279, 290, 314–317, 327, 331, 342,

345, 346, 353, 356, 361–377, 390, 446

Alternaria alternate , 74–75

Altruism , 220, 222–223

American Type Culture Collection (ATCC) ,

53, 79, 82, 95, 110, 183, 502, 508

AMF. See Arbuscular mycorrhizal fungi

(AMF)

1-Aminocyclopropane-1-carboxylate (ACC)

deaminase , 254, 262, 263, 363–366, 377

Amoxicillin , 227, 228

Ampelomyces , 75, 259

Ampelomyces quisqualis , 71, 73, 74, 82

Amphotericin B , 440, 441

Amplicons , 24, 35, 230, 234, 237, 238

Ampli ﬁ ed DNA restriction analysis (ADRA) ,

29–30

Ampli ﬁ ed fragment-length polymorphism

(AFLP) , 27, 28, 96

Anaerobic digestion , 6, 8, 313–337

Anodophiles , 460

Antibiosis , 71, 77–79, 276, 389

Arbuscular mycorrhizal fungi (AMF) , 92, 253,

261–265, 365, 368

Archaea , 32, 57, 110, 120, 126, 129,

130, 132, 135, 153, 389, 400–404,

445–463

Archaeoglobus , 450

Archaeoglobus fulgidus , 457, 458

ARISA. See Automated ribosomal intergenic

spacer analysis (ARISA)

Ascomycetes , 70, 71, 93, 94, 431

Ascoviruses , 346, 348

Asexual , 351, 352, 431

ATCC. See American Type Culture Collection

(ATCC)

Atrazine , 170, 183, 192, 193, 225

Auto ﬂ uorescent proteins (AFPs) , 39–40

Automated ribosomal intergenic spacer

analysis (ARISA) , 28

Azoles , 440, 441

Azospirillum , 159, 253, 254, 256, 260–263,

362, 368, 369, 371, 372

Azotobacter , 145, 146, 253, 254, 256, 258,

261, 263, 362, 369, 372

A. Malik et al. (eds.), Management of Microbial Resources in the Environment,

524

Bacillus idriensis , 302

Bacillus thuringiensis , 236, 260, 265, 276,

342, 343, 345, 350, 356, 374, 473

Bacteremia , 344

Bacteriocins , 217, 219, 224, 471–486

Bacteriolysins , 475

Bacteriophages , 135, 190, 216

Baculoviruses , 346, 349–350

Banana bunchy top virus (BBTV) , 260, 374

Barotolerant , 448

Basic Local Alignment Search Tool (BLAST) ,

126–128, 134–136, 400, 404

Basidiomycetes , 70, 94

Basidiomycota , 92

Bavistin , 231

BBTV. See Banana bunchy top virus (BBTV)

BCAs. See Biocontrol agents (BCAs)

Beauveria , 276, 351–354

Beauveria bassiana , 276, 352–355

Bilanafos , 269, 272

Biobutanol , 446

Biocontrol agents (BCAs) , 72–77, 79, 82–85,

251, 258–260, 275–277, 343

Biodiesel , 9, 446

Bioethanol , 446

Biofertilization , 258, 373

Biofertilizers , 52, 251, 255–258, 278, 362,

367–373, 377

Biofox C , 82

Biofuels , 446, 455, 456

Biofungus , 82

Biogas , 9, 315, 317, 319, 320, 322–334, 336,

337, 446

Biohydrogen , 446

Bioinformatics , 3–5, 12, 41, 64, 66, 104, 112,

118–137, 157, 251, 303–304, 446, 451

BIOLOG , 20, 21

Biological resource centers (BRCs) , 64, 66,

107, 111–113

Biomineralization , 297, 299–300, 303

Biopesticides , 52, 85, 265–274, 355, 356

Biophotolysis , 451

Bioreactors , 328, 333–335, 397, 457, 505

Biore ﬁ nery , 9

Bioremediation , 2, 3, 7, 66, 155, 156, 217,

225, 227, 251, 257, 289–304, 394, 446,

504, 505, 516, 517

Biosorption , 297

Biotrophic mycoparasites , 74

BLAST. See Basic Local Alignment Search

Tool (BLAST)

Blastoconidium , 431

Bradyrhizobium japonicum , 369

Bradyrhzobium , 253

BRCs. See Biological resource centers (BRCs)

Brevundimonas diminuta , 181, 189

Broad-host-range plasmids , 169, 218, 227,

229, 232–234, 236, 239, 393

Bromoviruses , 421

Burkholderia , 170, 171, 181, 197, 199, 226,

231, 254, 256, 262, 362, 366, 368

1,4-Butanediol , 9

Butyrate , 321, 453, 510, 511, 514, 516

Butyric acid , 9

Caesium chloride , 232

Calcium oxalate , 300

Camphor , 171, 393

Candida , 259, 276, 430, 431, 433, 435, 436,

440, 441

Candida albicans , 429–441

Candidal onchomychosis , 433

Candidiasis , 431, 433, 437, 440–441

ε -Caprolactam , 173

Carbamazepine , 228

Carbazole , 169, 171, 178, 188, 193–196

Carbofuran , 179, 504

Carbon dioxide , 275, 295, 318, 321, 436, 438,

449, 460

Carboxydotrophic , 457

Catabolic plasmids , 168–191, 196, 198, 199,

239, 396–398

Catecholates , 296

Catechol 2,3-dioxygenase , 395

Cell wall , 32, 37, 39, 73, 76–80, 92, 260, 272,

297, 352, 375, 392, 432, 438, 441, 473

Chaetomium , 71, 73, 74, 78, 79

Chickpea , 70, 351, 369, 372, 375, 376

Chitinases , 77, 80, 81, 256, 259, 260, 344,

352, 375

Chlorobenzenes , 192, 195, 500, 501, 503, 505,

508, 509, 511–514

3-Chlorobenzoate , 170, 175, 192

Chloro ﬂ exi , 147, 150, 151, 450

Chlorophenols , 179, 188, 505, 510, 516

Chromosome , 104, 189, 190, 196, 198, 217,

219, 221, 238, 292, 293, 394, 395, 397,

398, 414, 416, 434

Chronosequence , 149, 228

Chytridiomycetes , 70, 71

Chytridiomycota , 92

Cipro ﬂ oxacin , 228

Cisplatin , 419

Citrobacter , 505

Citrobacter freundii , 500, 506, 513

CMR. See Comprehensive microbial resource

(CMR)

Index

525

CO dehydrogenase (CODH) , 455–457

Co-digestion , 325, 330–332, 337

Commensal , 392, 430, 431, 433, 434, 436

Comprehensive microbial resource (CMR) , 126

Coniothyrium , 71, 79, 81, 259

Conjugation , 168, 190, 217, 218, 221, 393,

397, 401, 506

Conjugative plasmids , 215–239, 393

Conjugative transfer , 187, 189, 196, 216–218,

226, 229, 236, 396

Continuously stirred tank rectors (CSTR) ,

334, 335

Convention on biological diversity (CBD) , 64,

107, 110

Crenarchaeota , 450

Cronartium ribicola , 74

Cry genes , 343, 345

CSTR. See Continuously stirred tank rectors

(CSTR)

Cyanobacteria , 57, 150, 263, 293, 297, 403

Cystibiotics , 474

Cytokinin , 365, 371–373

Cytoplasmic polyhedrosis viruses , 346–348

Damping-off , 76, 78, 375, 376

Dehydroalanine , 473

Dehalorespiration , 506, 508, 515, 516

Dehydrochlorinase , 499

Deltaproteobacteria , 461, 462

Denaturing gradient gel electrophoresis

(DGGE) , 5–7, 21, 24, 29, 30, 37, 146,

460–462, 509

Derxia , 254

Desulfobacter , 502, 505, 508

Desulfococcus , 23, 502, 505, 508

Desulfotomaculum reducens , 298

DGGE. See Denaturing gradient gel

electrophoresis (DGGE)

2,4-Diacetyl phloroglucinol , 375

Dibenzofuran , 180, 184, 186, 188, 190

Dibenzothiophene , 175

2,4-Dichlorophenoxyacetic acid (2,4-D) , 169,

170, 175–177, 182, 193, 195, 198, 225,

226, 237, 395, 398

2,3-Dihydroxybiphenyl 1,2-dioxygenase ,

397–398

Diploid , 431, 434

Direct viable count , 36, 37

Dithiothreitol (DTT) , 507

2,4-D, malonate , 170

DNA Chips , 125

Drosophila , 418

DTT. See Dithiothreitol (DTT)

Echinocandins , 441

eDNA. See Extracellular DNA (eDNA)

Endosulfan , 504

Endosymbionts , 34, 218, 221

δ –Endotoxin , 343, 344

Enterobacter , 254, 256, 257, 262, 362, 368,

369, 500, 505, 506

Enterobacteriaceae , 168

Entomopoxviruses (EPVs) , 346, 348

EPS. See Extracellular polymeric substances

(EPS)

Epsilonproteobacteria , 450

EPVs. See Entomopoxviruses (EPVs)

Erwinia Flavobacterium , 256, 368

Escherichia coli (E.coli) , 11, 24, 34, 36,

38, 39, 101, 120, 135, 216, 218–220,

225–227, 229, 235, 236, 266, 293,

302, 396, 403, 475, 479–482, 498,

500, 505, 506

Esterases , 99, 352

Ethanol , 101, 321, 439, 452, 455, 456, 461,

462, 511, 514

Ethidium bromide , 232

Ethylene , 9, 262–263, 363–366, 377

Exochitinase , 81

Exoelectrogens , 460

Exotoxins , 74

Extracellular DNA (eDNA) , 142–147,

158–160

Extracellular polymeric substances (EPS) ,

216, 300, 331

FACS. See Fluorescence-activated cell sorting

(FACS)

FASTA , 127–128, 135, 136

Fatty acid methyl esters (FAMEs) , 6, 9, 20, 22

Ferritin , 439, 440

Fibrobacteres , 150

Firmicutes , 150, 151, 153, 158, 161, 403,

455, 463

Fluorescence-activated cell sorting (FACS) ,

34, 36–38, 40, 156, 199, 236, 239

Fluorescent in situ hybridization (FISH) ,

31–32, 38, 39, 157

Fluorquinolones , 228

Fo. See Functional organization (Fo)

Formate , 297, 500, 501, 511, 513, 514

Fosmid , 238

Fumonisins , 100

Functional organization (Fo) , 5–7

Fungicides , 70, 72, 75, 217, 259, 265–272,

274, 375–377, 388

Index

526

Gasteromycetes , 70, 71

GBRCN. See Global Biological Resource

Centre Network (GBRCN)

Geminiviruses , 422

Gemmatimonadetes , 150, 151

Gene-bioaugmentation , 198, 225–226, 301

Gene duplication , 133, 395, 400, 404

Genetic engineering , 11, 83, 251, 301–302,

304, 349

Gene transfer , 18, 19, 146, 220, 231, 275, 277,

301–302, 389, 392–394, 396–398,

400–403, 455

Geobacillus , 184, 191

Geopsychrobacter electrodiphilus ,

461, 462

Germplasms , 3–4, 278

GFP. See Green ﬂ uorescent protein (GFP)

Gibberellins , 371, 372

Gliovirin , 78, 79

Global Biological Resource Centre Network

(GBRCN) , 64, 111, 112

Glomeromycota , 92

Glomus intraradices , 261

β -(1,3)-Glucanase , 77

Gluconacetobacter , 254

Gluconeogenesis , 439

β -Glucosidase , 76

Glutathionine , 301, 476, 506

Glyoxylate cycle , 439

Gordonia , 184, 191, 225

Granulosis virus (GV) , 349, 350

Greenbeard , 223, 224

Green ﬂ uorescent protein (GFP) , 39, 40

Green genes , 130, 131, 136

Griseofulvin , 440, 441

GV. See Granulosis virus (GV)

Haemophilus in ﬂ uenzae , 120

Halophilic , 449

Halotolerant , 449

Harpin , 266, 267, 271

HCH. See Hexachlorocyclohexane (HCH)

Heat shock proteins , 437

Heavy metals , 198, 217, 221, 226, 227, 232,

239, 260–262, 274, 290–292, 294, 298,

301, 302, 304, 329

HeCCH. See Hexachlorocyclohexenes

(HeCCH)

Hemicellulose , 324

Herbicides , 217, 225, 259, 269, 272–274, 388,

394, 398

Heterobasidion annosum , 79, 80, 276

Heterotrimeric G-proteins , 73, 80

Heterozygosity , 28, 431

α -Hexachlorocyclohexane ( α -HCH) , 496–508,

510–514

β -Hexachlorocyclohexane ( β -HCH) , 496–500,

502–506, 508, 510–516

δ -Hexachlorocyclohexane ( δ -HCH) , 496–500,

503–507, 511–514

γ -Hexachlorocyclohexane ( γ -HCH) , 178–180,

188, 189, 191, 194, 496–515

Hexachlorocyclohexane (HCH) , 495–517

Hexachlorocyclohexenes (HeCCH) , 507

Hirsutella , 352

Histidine kinase , 400

Histidine protein kinases (HPKs) , 399, 400

Horizontal gene transfer (HGT) , 26, 40, 120,

133, 143, 145, 154, 158–160, 168, 191,

199, 216–224, 230, 231, 278, 389, 391,

393, 394, 397, 400–405

Human papillomavirus (HPV) , 422

Hybridization , 22, 25–27, 31–32, 36, 38–39,

131, 132, 227, 230, 234, 236, 238, 399

Hydrogenotrophic methanogenesis , 448

Hydrogen partial pressure ( P H

) , 452, 453

Hydroxamates , 262, 296

3-Hydroxy-propionic acid , 9

Hyperparasitism , 71

Hyperthermophiles , 320, 455

Hyperthermophilic , 448, 453, 457

Hyphal wall protein , 434

Hypocreales , 71, 274, 352

Imidazoles , 441

Immobilization , 25, 252–253, 256, 294,

296–298, 300, 485

Indole acetamide (IAM) , 371

Indole acetic acid (IAA) , 254, 267, 371–374

Insecticides , 259, 273, 274, 341–357, 388

Integrons , 229, 391

Internal transcribed spacer (ITS) , 28, 29, 94,

104, 105, 122, 131

International Union of Microbiological

Societies (IUMS) , 54, 65

Intertrigo , 433

Iridoviruses , 346, 347

Kasugamycin , 267, 271

Kinado , 231

Kinetochore , 416

Index

527

Klebsiella , 182, 254, 257, 362, 391

Klebsiella pneumoniae , 391

Labyrinthine , 473

Lactoferrin , 439

Land ﬁ lling , 8, 313, 317, 318, 333, 336,

337, 504, 505, 510, 511, 514

Lantibiotics , 472, 473, 484

Lichens , 57, 71, 148

Lignocellulose , 324, 327, 446, 455

Lindane , 495–517

Lipases , 80–81, 99, 256, 259, 352

Lipopolysaccharides (LPSs) , 226, 227, 297

Listeria monocytogenes , 475–479

Lyophilisation , 60

Macroaggregates , 147

Magnetic nanoparticles , 35

Mannan , 432

Mating pair formation (MPF) , 169–171, 173,

174, 177–180, 182, 186

MEC. See Microbial electrolysis cell (MEC)

Mesoaggregates , 147

Mesophiles , 319–320

Metabolomics , 12, 516

Metagenomic library , 11, 13, 154, 155

Metagenomics , 10–11, 13, 126, 141–161,

199–200, 230, 237, 239, 263, 279, 390,

446, 449–451, 515–516

Metarhizium , 276, 351, 352, 354

Metaryhizium anisopliae , 276, 353, 354

Methane (CH

) , 9, 37, 264, 275, 318, 321–325,

327, 330–334, 336, 446, 449, 455, 457,

458, 460, 511

Methanocaldococcus , 457

Methanococcales , 450

Methanococcus , 457

Methanoculleus , 457

Methanogenesis , 313, 320–326, 331, 334, 335,

457, 503–505, 514

Methanogenium , 457

Methanol , 9, 321, 502, 504, 505, 510, 511, 514

Methanolacinia , 457

Methanopyrus , 457

β -Methyllanthionine (meLan) , 472, 473

Methylobacterium fujisawaense , 262

Methyl parathion , 177, 194, 504

MGEs. See Mobile genetic elements (MGEs)

MGMs. See Mixed-genome microarrays

(MGMs)

Microaggregates , 147, 150

Microarray , 40, 121–123, 126, 131, 133,

237, 263

Microbial electrolysis cell (MEC) , 460

Microbial resource centers (MRCs) , 3, 5,

51–66, 111

Microbial resource management (MRM) , 5–7

Microbial resources , 1–13, 51–66, 111

Microbiome , 148, 156

Micro ﬂ uidics , 34–35, 38, 39

Micropores , 216

Microsporidia , 92, 356

Milbemycin , 269, 273

Mildiomycin , 267, 271

Mitoxantrone , 419

Mixed-genome microarrays (MGMs) , 122

MLVA. See Multiple locus variable-number

tandem repeat analysis (MLVA)

Mobile genetic elements (MGEs) , 167–200,

216, 217, 219–224, 227, 228, 230, 237,

239, 389, 393, 394, 397–398, 404–405

Mobilizable plasmids , 216, 217, 224, 239

Mobilization (MOB) , 80, 168–186, 188, 199,

216, 217, 219, 224, 227, 235, 236, 239,

264, 294–297, 391–392, 396

Molecular beacons , 39

Molecular clocks , 120

Monocrotophos , 231

Multiple locus variable-number tandem repeat

analysis (MLVA) , 121

Multiple sequence alignment (MSA) , 128, 137

Multiwalled carbon nanotubes (MWCNTs) , 303

Municipal solid waste (MSW) , 313–337, 446

Mutation , 12, 30, 78, 120, 128, 129, 132, 133,

388, 389, 391–392, 394, 395, 397–399,

404, 415–419, 437

Mutational drift , 395–396

Mutualism , 220, 221

MWCNTs. See Multiwalled carbon nanotubes

(MWCNTs)

Mycobacterium fortuitum , 191

Mycobacterium marinum , 302

Mycotoxins , 99, 100

Myxococcus xanthus , 399

Myxomycetes , 70, 71

N-acetylglucosamine , 432

Nanotechnology , 303

Naphthalene (nah) , 169, 171–175, 178, 179,

182, 184, 186, 190, 195–198, 225, 237,

397, 399

Natamycin , 271

Index

528

n-Butanol , 9, 456

Necrotrophic parasites , 74

Nematode , 267, 269, 270, 273, 278, 373,

375, 376

Neocallimastigomycota , 92

Neotype , 59

Nephrotoxicity , 441

Nisin , 473, 475–477, 479–481, 483–486

Nitri ﬁ cation , 8, 150, 159, 256, 263, 319

Nitrogenases , 254, 260

Nomuraea , 352, 353

Non mobilizable plasmids , 216

Nosema locustae , 355

Nostoc spongiaeforme , 297

Nuclear Polyhedrosis virus (NPV) , 347,

349–351

Nucleic acid , 22–32, 34, 38, 97, 120, 121, 123,

126, 129, 135, 293, 399

Nystatin , 440, 441

Obligate aerobes , 264, 319

Ochratoxin A (OTA) , 100

Ochrobactrum , 254

Octane , 393

OECD. See Organisation for Economic

Cooperation and Development (OECD)

Oncogenes , 418

Open reading frames (ORFs) , 121, 189

Organisation for Economic Cooperation and

Development (OECD) , 65, 111, 112

Organomercurials , 293

Orthologs , 125–126, 137, 402, 414, 421

OTA. See Ochratoxin A (OTA)

Oxygenases , 185, 440, 497, 499

Paecilomyces , 352, 353

PAHs. See Polycyclic aromatic hydrocarbons

(PAHs)

PCBs. See Polychlorinated biphenyls (PCBs)

PCR. See Polymerase chain reaction (PCR)

Pediocin , 472, 474–476, 478, 479, 481,

482, 486

Pentachlorocyclohexenes (PeCCH) , 500–502,

506, 507, 509–511

Pesticide , 7, 217, 226, 231, 250–251, 255,

259, 265, 267, 271, 276–278, 290,

342, 345, 356–357, 368, 388, 496,

503, 504

PFGE. See Pulse- ﬁ eld gel electrophoresis

(PFGE)

PGPR. See Plant growth promoting

rhizobacteria (PGPR)

Phosphate solubilizing bacteria (PSB) , 234,

258, 261, 262, 362, 370, 372–373

Phosphobacterin , 258

Phospholipid fatty acid (PLFA) , 20, 22–23

Phosphorus , 256, 258, 261, 263–265, 300,

325, 369

Phosphorylation , 390, 436–437

Photofermentation , 451

Phyllosphere , 77, 78, 80, 372

Phytohormone , 251, 256, 259, 262, 362,

366–368, 371–373

Phytophthora blight , 376–377

Phytoremediation , 251, 261–262, 304

Phytosiderophores , 370

Pigeonpea , 70

Pisum sativum , 365

Plant growth promoting rhizobacteria (PGPR) ,

83–84, 253–263, 275, 278, 361–377

Plasmids , 3, 26, 57, 110, 120, 168, 215–239,

292, 391, 420–421

PLFA. See Phospholipid fatty acid (PLFA)

Polaromonas naphthalenivorans , 182, 189, 197

Polychlorinated biphenyls (PCBs) , 184–186,

190, 398

Polycyclic aromatic hydrocarbons (PAHs) ,

178–180, 188, 198, 399

Polymerase chain reaction (PCR) , 21, 24–31,

35, 37, 38, 96, 104, 121, 151, 195, 199,

225, 227, 229, 230, 234–238, 390

Polynactins , 270, 273

Polyoxins , 268, 272

Prebiotics , 6

Prestop , 82

Prirnastop , 82

Prolixibacter bellariivorans , 461–463

Propionate , 182, 321, 504, 510, 511, 514

Proteases , 256, 259, 344, 352, 376–377, 435,

438, 477

Proteinases , 80–81, 344, 349, 435

β -Proteobacteria , 169, 199, 225, 461

Proteome , 123, 125, 137

Proteomics , 12, 112, 123–125, 263, 279, 301,

303, 422, 423

Proteus mirabilis , 500, 506

Protoxin , 344

Protozoa , 3, 34, 52, 57, 70, 110–111, 253, 265,

342, 355–356, 375

PSB. See Phosphate solubilizing bacteria

(PSB)

Pseudohyphal , 432, 435

Pseudomonas aeruginosa , 155, 174, 227, 231,

296, 375, 376, 395, 498

Index

529

Pseudomonas mendocina , 256, 365

Pseudomonas putida , 40, 155, 170–177, 192,

195, 197, 199, 225–226, 262, 301–302,

366, 369, 372, 375, 376, 394, 498

Psychrophiles , 319–320

Puccinia , 80

Pulse- ﬁ eld gel electrophoresis (PFGE) ,

121, 133

Pyrococcus , 453, 454

Pyrosequencing , 6–7, 147, 152, 238, 239

Ralstonia , 170, 193, 197–199, 262,

301–302

Random ampli ﬁ ed polymorphic DNA

(RAPD) , 27, 28, 96

RDP. See Ribosomal database project (RDP)

Response regulators (RRs) , 399, 400

Restriction fragment length polymorphism

(RFLP) , 26–28, 96, 121

Rhizobacteria , 259–261, 368, 373

Rhizobiales , 152–153

Rhizoctonia bataticola , 375, 376

Rhizoplane , 254

Rhizosphere , 29, 31–32, 40, 77, 78, 80, 82,

146, 149, 234, 239, 252–255, 262–264,

298, 361–362, 368–376

Rhodoferax ferrireducens , 461–463

Rhodospirillales , 152, 153

Ribosomal database project (RDP) , 126,

130–132

Ribosomal intergenic spacer analysis (RISA) ,

6, 28

Ribulose bisphosphate (RuBP)

carboxylase , 272

RNA interference (RNAi) , 417–419

RNA polymerase , 137

RRs. See Response regulators (RRs)

Rubrobacteriales , 147, 148

Sactibiotics , 473

Salicylate , 175, 197, 393, 398

Salmonella Typhimurium , 480, 482

Schizosaccharomyces pombe , 414, 421, 422

Sedimentibacter , 508, 515, 516

Selenoproteins , 298

Septicemia , 344, 356

Sesbania sesban , 372

Shewanella oneidensis , 462

Siderophores , 254, 259, 262, 295, 296, 369,

370, 373, 374, 440

Silica , 106, 108, 146

Single-strand conformational polymorphism

(SSCP) , 28–29

SIP. See Stable isotope probing (SIP)

Sphaerotheca fuliginea , 74–75

Sphingobium , 178–180, 188–189, 193,

194, 499

Sphingomonas , 153, 168–169, 178–180, 188,

191, 371, 499

Sphingomonas desiccabilis , 301–302

Spinosad , 270, 273

Spirochaetes , 150, 151

Spodoptera exigua , 345, 348

SSCP. See Single-strand conformational

polymorphism (SSCP)

Stable isotope probing (SIP) , 7, 199, 237

Sulfadiazine , 228, 229

Sulfamethoxazole , 228

Symbiosis , 159, 253, 263

Synthetic genetic array (SGA) , 415–417

Synthetic lethality , 413–423

Teleomorph , 92, 352, 353

Temperature gradient gel electrophoresis

(TGGE) , 5, 6, 24, 29–30

Terrabacter , 186, 190

Tetrachlorocyclohexenes (TeCCH) , 500–502,

506, 507, 509–513

Tetracycline , 227, 390

Thermococcales , 450, 453

Thermophilin , 484

Tilletiopsis , 74–76

Toluene , 169, 172, 174–177, 181, 186,

188–189, 192, 195, 196, 199,

393, 398

Tombusviruses , 421–422

Torulopsis bombicola , 296

Toxemia , 344

Transconjugants , 199, 226–228, 236,

396, 478

Transcriptomics , 12, 123, 237, 301, 303

Transduction , 273, 396, 399–401, 437

Transformation , 8, 9, 40, 65, 142–143, 145,

146, 158, 160, 225–226, 253, 257,

295–300, 302, 304, 320, 326–327, 393,

396, 397, 416, 509, 513, 514

Transposons , 168, 169, 191–196, 199, 216,

219, 225, 231, 391, 394–395, 397, 398,

404–405, 417

Triazoles , 441

2,4,5-Trichlorophenoxyacetate , 398

Trichoderma harzianum , 71, 73–83

Index

530

Trichothecenes , 100

Tuberculina maxima , 74

Up ﬂ ow anaerobic sludge blanket (UASB) ,

334, 335, 504–505, 514

Vairimorpha necatrix , 355

Vectors , 24, 57, 228, 230, 345, 346

Venturia inaequalis , 78

Versicolores , 98

Verticillium lecanii , 74, 75

Verucomicrobia , 147

Vibrio aerogens , 452

Volatile fatty acid (VFA) , 313, 321, 324, 328,

456, 504, 510

World Data Center for Microorganisms

(WDCM) , 54, 55, 57, 58, 61–62,

65, 95

World Federation for Culture Collections

(WFCC) , 53–54, 61, 65, 95, 110–112

Xanthomonas maltophilia , 370

Xenobiotic , 168, 169, 188, 190, 191, 196, 198,

199, 217, 224, 225, 387–405, 497

Xerophilous , 99

Xylene ( xyl ) , 169, 172, 174, 178, 188, 192,

195, 196, 393, 398

Zearalenones , 100

Index

Bacteria in biofloc technology aquaculture systems: roles and mediating factors

Article

Jan 2022

The abundance of nitrogen compounds, phosphorous compounds and organic matter in biofloc technology (BFT) aquaculture systems creates an ideal medium for increasing microbial communities and load. The abundance of microbial DNA found in BFT aquaculture systems is hypothesised to be among the greatest in current aquaculture systems. Several factors mediate the bacterial diversity, relative abundance and dynamics in BFT systems. This review focusses on the bacteria in BFT aquaculture systems, their role as food for animals present in the culture and their various relationships with major nutrients. The analytical techniques available for determining bacterial integrity and function are reviewed along with the factors that affect microbial community structure, water quality and production performance. Future investigations to characterise bacteria in BFT aquaculture systems and their roles and mediating factors are suggested.

Effectiveness of Plant Beneficial Microbes: Overview of the Methodological Approaches for the Assessment of Root Colonization and Persistence

Article

Full-text available

Jan 2020

Issues concerning the use of harmful chemical fertilizers and pesticides that have large negative impacts on environmental and human health have generated increasing interest in the use of beneficial microorganisms for the development of sustainable agri-food systems. A successful microbial inoculant has to colonize the root system, establish a positive interaction and persist in the environment in competition with native microorganisms living in the soil through rhizocompetence traits. Currently, several approaches based on culture-dependent, microscopic and molecular methods have been developed to follow bioinoculants in the soil and plant surface over time. Although culture-dependent methods are commonly used to estimate the persistence of bioinoculants, it is difficult to differentiate inoculated organisms from native populations based on morphological characteristics. Therefore, these methods should be used complementary to culture-independent approaches. Microscopy-based techniques (bright-field, electron and fluorescence microscopy) allow to obtain a picture of microbial colonization outside and inside plant tissues also at high resolution, but it is not possible to always distinguish living cells from dead cells by direct observation as well as distinguish bioinoculants from indigenous microbial populations living in soils. In addition, the development of metagenomic techniques, including the use of DNA probes, PCR-based methods, next-generation sequencing, whole-genome sequencing and pangenome methods, provides a complementary approach useful to understand plant–soil–microbe interactions. However, to ensure good results in microbiological analysis, the first fundamental prerequisite is correct soil sampling and sample preparation for the different methodological approaches that will be assayed. Here, we provide an overview of the advantages and limitations of the currently used methods and new methodological approaches that could be developed to assess the presence, plant colonization and soil persistence of bioinoculants in the rhizosphere. We further discuss the possibility of integrating multidisciplinary approaches to examine the variations in microbial communities after inoculation and to track the inoculated microbial strains.

Conference Paper Agrotechnology for Snapshots Soil Health with Bacteria

Conference Paper

Full-text available

Jan 2020

Taxonomic structure of bacterial microbiome of sod-podzolic soil (Gatchina district of Leningrad region, Russia) with varying degrees of moisture were studied using pyrosequencing of 16sRNA gene. Proteobacteria were revealed mostly in drought conditions and may be used as indicator microorganisms. The fractal analysis of the data showed that the index of the biosystem determinism of the frequencies of soil microbial communities decreased with drought (from 0.73 to 0.65), since decreases the number of variations of taxonomic units, due to which a smaller number of biosystem groups were formed.

Effects of different fertilizer systems and hydrothermal factors on microbial activity in the chernozem in Ukraine

Article

Full-text available

Nov 2018

Groups of microorganisms in soils perform the role of global biogeochemical membrane which provides metabolism of substances and energy between the pedosphere, lithosphere, hydrosphere and living organisms. Сlimate change has resulted in a complex combination of unpredictable changeability of the environment, which is a serious test for the stability and productivity for the natural and anthropogenically transformed ecosystems. Changeability of the hydrothermal factors causes serious changes in the structure and metabolic activity of soil microorganisms, the quality and properties of soil. We studied the impact of hydrothermal factors on the content of carbon, microbial biomass and organic substance in deep chernozem of a natural ecosystem (fallow) and an agroecosystem under different systems of fertilization of winter wheat. A close relationship (r = 0.69–0.79) was determined between the content of microbial biomass in soil and hydrothermal factors (air temperature and moisture). Excessive drought and high parameters of air temperature led to decrease in the content of microbial biomass by 1.5–2.8 times compared to the years with optimum parameters of hydrothermal regime (HTC = 1.0). Leveling out the impact of high temperatures on the productivity of the soil microbiota occurs at a sufficient amount of moisture, and also available nutrients. Drought (HTC = 0.4) and excessive moisture (HTC = 2.0) following heightened air temperatures reduce the release of СО2 from soil. Fallow soil usually has a high content of microbial carbon in the organic compounds of soil (Сmic/Сorg was 2%). In the agroecosystem, there was recorded a decrease by 26–32% of the Сmic specific share in the content of the organic compound of the soil compared to the natural analogue. With organic and organic-mineral systems of fertilization, an increase in Сmic/Сorg parameter occurs and the soil parameters become close to the soil of a natural ecosystem. The calculated ecological coefficients of the orientation of microbial processes in soil indicate a possibility of a balanced functioning of the microbial group and introducing organic and organic-mineral fertilizers, creating optimum conditions for the productivity of winter wheat.

Ascochyta blight resistance in cool season food legumes. Legume Perspectives 8: 35-36.

Article

Full-text available

Jul 2015

Diego Rubiales

Методология микробиологических исследований почвы в рамках проекта “Микробиом России”

Article

Full-text available

May 2017

Рассматриваются методологические направления развития отечественной почвенной биологии при изучении микробиома почв. Приоритетными являются междисциплинарные исследования растительно-микробных взаимодействий, роли микробиома в формировании почвенного плодородия и круговороте углерода. Для наиболее полного раскрытия экологических и сервисных функций почвенного микробиома предлагается сочетать методы метагеномики (для оценки филогенетического разнообразия микроорганизмов), анализа биомаркеров (для определения функционального разнообразия) и измерения ферментативной активности (для оценки актуальной функциональности почв). Исследование связи структурной иерархии почв (от агрегатов и микролокусов до почвенных ареалов) с уровнями организации микробных сообществ (от непосредственно микробных популяций до биогеографических закономерностей) позволит лучше понять пространственное распределение и общие основы взаимодействия системы почва-микроорганизмы. Помимо пространственной организации предлагается изучать динамику почвенных микробиомов на разных временных отрезках: краткосрочные изменения (на полевых мониторинговых площадках), трансформация в процессе почвообразования (на “хронорядах” почв разного возраста) и в геологическом масштабе времени (на примерах погребенных почв). Рассматривается важность изучения разнообразия почвенных микроорганизмов как источника супрессирующей активности почв, крупнейшего депозитария генетической информации, важного агента эмиссии и фиксации атмосферного углерода. Сравнительный анализ микробного разнообразия целинных и нарушенных почв и оценка различных внешних воздействий на почвенный микробиом представляются необходимыми для сохранения биоразнообразия почв как ценного экологического и биотехнологического ресурса.

Combined pre-seed treatment with microbial inoculants and Mo nanoparticles changes composition of root exudates and rhizosphere microbiome structure of chickpea (Cicer arietinum L.) plants

Article

Full-text available

Sep 2017

Chickpea (Cicer arietinum L.), a valuable legume crop, is an essential component of diet in many Asian, African, European and American countries. A major role in increasing its adaptive potential, quality and quantity of the yield is played by symbiotic and associative bacteria. The main aim of this research was to study the effect of combined pre-seed treatment with microbial inoculants and Mo nanoparticles on the composition of root exudates and the taxonomic diversity of microorganisms in the chickpea plants rhizosphere. We studied seed germination, the activity of enzymes involved in antioxidant protection system and the formation of plant-microbial system under the influence of nodule and rhizosphere bacteria and molybdenum (Mo) nanoparticles introduced into seeds before sowing. Rhizosphere microbiome was studied with the help of pyrosequencing method. Maximum numbers of introduced bacteria were observed in variants with Mo nanoparticles. The symbiotic effectiveness of Mesorhizobium ciceri strain ST282 was further improved by co-inoculation with “helper bacteria” Bacillus subtilis and Mo nanoparticles. Effective symbiosis was shown to be an important factor determining the formation of the rhizosphere microbiome by the representatives of the order Rhizobiales and influencing the numbers and the composition of the rhizosphere microbial community. A self-sufficient legume-rhizobium symbiosis improved the physiological status of the plant, increasing structural diversity of the microbial community of the rhizosphere through changes in the activity of root exudates, and paved the way for the development of the most effective associative bacteria.

Prospects for the use of multi-component symbiotic systems of the Legumes

Article

Full-text available

Mar 2015

Legume-Rhizobial Symbiosis (LRS), Arbuscular Mycorrhiza (AM) and associations with Plant Growth-Promoting Bacteria (PGPB) implement nutritional and defensive functions in plant, improve soil fertility, and thus are appropriate to be used for sustainable crop production and soil restoration. Based on synergism and evolutional commonality of the symbioses, we propose a multi-component plant-microbe system with legume plant as a main component. Advances obtained from simultaneous inoculation of legumes with various beneficial microbes are summarized. Basic principles of legume breeding to improve effectiveness of interaction with a complex of the microbes along with problems and prospects for development of multi-microbial inoculants for legumes (and non-legumes) are stated.

A metagenomic analysis of soil samples to find the distribution of microflora in different soil types

Article

Full-text available

Feb 2016

The soil is one of the major components of Earth's ecosystem. The soil is rich in minerals, salts, water, sand, dissolved gases and organic matter. The composition of soil makes it a nurturing ground for many microorganisms. The soil microflora is widely variable and mainly depends on the composition of soil components and nature of the soil. The microorganisms that can adapt better are found in a wide variety of soil types. This study is aimed at the visualization of microflora distribution by creating abundance heat maps and phylogenetic profiling to uncover evolutionary relations among the microorganisms present in a range of soil samples.

Supraspecies genetic systems

Article

May 2015

The genetic integration of diverse organisms results in the generation of three types of supraspecies systems of heredity: the metagenome (the set of genetic factors of a microbial community that occupies a certain ecological niche), the symbiogenome (the functionally integrated system of the partners’ symbiotic genes) and the hologenome (the unitary hereditary system of an organism of symbiotic origin). The integrity of a metagenome is based on the cross-regulation and horizontal transfer of genes in the coevolving organisms. In the soil microbial communities, this is accompanied by maintenance of a stable extracellular DNA pool. The formation of a symbiogenome is defined by highly specific signaling interactions between the partners; these interactions are responsible for the development of common metabolic pathways based on specialized cellular and tissue structures. The transition of a symbiogenome into a hologenome is often accompanied by endosymbiotic gene transfer from microsymbionts to their hosts. In symbiotic bacteria, this transition is coupled with the establishment of multicomponent and reducted types of genomes that are characteristic for ecologically obligatory symbionts and genetically obligatory symbionts, as well as rudimentary genomes characteristic for cellular organelles. In addition, the evolution of symbiotic genomes towards a higher stringency of microsymbiont transmission in the host generations proceeded from pseudo-vertical (via the environment) to transembryonic (via host embryos and surrounding tissues) and transovarian (via host germ cells), with the latter culminating in the establishment of cytoplasmic inheritance of cellular organelles. Based on our analysis, we propose a hypothesis for the origins of an endophytic plant symbiogenome on the basis of host intervention in the metagenome of soil bacteria, which is mediated by host involvement in the quorum-sensing auto-regulation in the microbial community.

STUDYING THE STRUCTURE OF SOIL MICROBIAL COMMUNITY IN SALINE SOILS BY HIGH-THROUGHPUT PYROSEQUENCING

Article

Full-text available

Jun 2012

The taxonomic structure of soil microbial community was studied in six samples taken from a salt marsh along the salinity gradient and in two samples of non-saline soils using pyrosequencing method (454 Roche). The analysis allowed to identify three main ecological groups of microorganisms depending on the degree of the soil salinity. Halophylic microorganisms were mainly represented by bacteria of three phyla Firmicutes, Proteobacteria and Bacteroidetes and included much less of archaea (the Halobacteriaceae family). Within the distance of 150–200 m from the point with the highest levels of salinity, the microbial community tends to have a considerable similarity with control samples of non-saline soils.

Spatial distribution of bacterial communities and their relationship with the micro-architecture of soil

Article

Full-text available

Jun 2003
FEMS MICROBIOL ECOL

Biological soil thin-sections and a combination of image analysis and geostatistical tools were used to conduct a detailed investigation into the distribution of bacteria in soil and their relationship with pores. The presence of spatial patterns in the distribution of bacteria was demonstrated at the microscale, with ranges of spatial autocorrelation of 1 mm and below. Bacterial density gradients were found within bacterial patches in topsoil samples and also in one subsoil sample. Bacterial density patches displayed a mosaic of high and low values in the remaining subsoil samples. Anisotropy was detected in the spatial structure of pores, but was not detected in relation to the distribution of bacteria. No marked trend as a function of distance to the nearest pore was observed in bacterial density values in the topsoil, but in the subsoil bacterial density was greatest close to pores and decreased thereafter. Bacterial aggregation was greatest in the cropped topsoil, though no consistent trends were found in the degree of bacterial aggregation as a function of distance to the nearest pore. The implications of the results presented for modelling and predicting bacterial activity in soil are discussed.

Adsorptions of DNA molecules by soils and variable-charged soil constituents

Article

Full-text available

Jan 2010

Understanding the adsorption of extracellular DNA on soil particles is essential to assess the risk of release of genetically modified organisms and to develop efficient methods of DNA extraction from soils in the analysis of soil microbial communities using culture-independent methods. Much research has used 2:1 type layer phyllosilicates (e.g., montmorillonite) as adsorptive particles to understand DNA adsorption by soils. However, the results of DNA adsorption by phyllosilicates were not enough to study DNA molecule behaviors in variable-charge soils such as andosol. Therefore, this mini-review summarized the adsorption of DNA molecules by natural soils and variable-charged soil constituents such as goethite, allophane, and humic acids.

Stabilization of Extracellular DNA and Proteins by Transient Binding to Various Soil Components

Article

Jan 2006

The soil habitat

Article

Dec 2006

Paul Voroney

At first sight nothing seems more obvious than that everything has a beginning and an end and that everything can be subdivided into smaller parts. Nevertheless, for entirely speculative reasons the philosophers of Antiquity, especially the Stoics, concluded this concept to be quite unnecessary. The prodigious development of physics has now reached the same conclusion as those philosophers, Empedocles and Democritus in particular, who lived around 500 BCE and for whom even ancient man had a lively admiration. (Svante Arrhenius, Nobel Lecture, 1903).

The diversity and biogeography of soil bacterial communities

Article

Jan 2006

Culture-independent molecular techniques for soil microbial ecology

Article

Jan 2010
SOIL BIOL BIOCHEM

Soil bacterial community composition across different topographic sites characterized by 16S rRNA gene clones in the Fushan Forest of Taiwan

Article

Jan 2009
BOT STUD

Bacterial communities present in soils from the valley, middle-slope, and ridge sites of the Fushan forest in Taiwan were characterized using 16S rDNA analysis of genomic DNA after polymerase chain reaction amplification, cloning, and denaturing gradient gel electrophoresis analysis. Phylogenetic analysis revealed that the clones from nine clone libraries included members of the phyla Proteobacteria, Acidobacteria, Actinobacteria, Bacteroidetes, Cyanobacteria, Firmicutes, Gemmatimonadetes, Nitrospirae, Planctomycetes, candidate division TM7, and Verrucomicrobia. Members of Proteobacteria, Acidobacteria, and Actinobacteria constituted 49.1%, 32.3%, and 6.3% of the clone libraries, respectively, while the remaining bacterial divisions each comprised less than 6%. The ridge site exhibited the most bacterial species number, indicating the influence of topography. Bacterial composition was more diverse in the organic layer than in the deeper horizons. In addition, bacterial species numbers varied across the gradient horizons.

Soil bacterial community composition across different topographic sites characterized by 16S rRNA gene clones in the Fushan Forest of Taiwan

Article

Jan 2009
BOT STUD

S-H. Tsai

Molecular microbial ecology: land of the one-eyed king

Article

May 2004
CURR OPIN MICROBIOL

Larry Forney

Studies of microbial biodiversity have made astounding discoveries of late due to the use of methodologies based on phylogenetic analyses of small subunit ribosomal RNA sequences. Although there are limitations to these methods, they can nonetheless be very useful if these limitations are kept in mind. These limitations range from technical problems such as obtaining representative genomic DNA and suitable primers, to conceptual problems such as defining and using meaningful taxonomic units of diversity (species). Here we discuss several of the limitations inherent in studies of microbial diversity that must be considered when interpreting the results obtained using these approaches.

Recent Advances and Perspectives in Metagenomic Studies of Soil Microbial Communities

Abstract

Recommended publications

Metagenomic-based approach to a comprehensive understanding of cave microbial diversity

THE CONCEPT OF TAXONOMIC SPACE AND INTEGRAL ESTIMATES OF SHIFT IN THE STRUCTURE OF MICROBIAL COMMUNI...

Investigation of the core microbiome in main soil types from the East European plain

Dispersing misconceptions and identifying opportunities for the use of 'omics' in soil microbial eco...

The structure of microbial community in aggregates of a typical chernozem aggregates under contrasti...