Low Intensity Exercise Training Improves Skeletal Muscle Regeneration Potential

Abstract

Purpose: The aim of this study was to determine whether 12 days of low-to-moderate exercise training at low altitude (598 m a.s.l.) improves skeletal muscle regeneration in sedentary adult women.
Methods: Satellite cells were obtained from the vastus lateralis skeletal muscle of seven women before and after this exercise training at low altitude. They were investigated for differentiation aspects, superoxide anion production, antioxidant enzymes, mitochondrial potential variation after a depolarizing insult, intracellular Ca²⁺ concentrations, and micro (mi)RNA expression (miR-1, miR-133, miR-206).
Results: In these myogenic populations of adult stem cells, those obtained after exercise training, showed increased Fusion Index and intracellular Ca²⁺ concentrations. This exercise training also generally reduced superoxide anion production in cells (by 12–67%), although not in two women, where there was an increase of ~15% along with a reduced superoxide dismutase activity. miRNA expression showed an exercise-induced epigenetic transcription profile that was specific according to the reduced or increased superoxide anion production of the cells.
Conclusions: The present study shows that low-to-moderate exercise training at low altitude improves the regenerative capacity of skeletal muscle in adult women. The differentiation of cells was favored by increased intracellular calcium concentration and increased the fusion index. This low-to-moderate training at low altitude also depicted the epigenetic signature of cells.

Full text

ORIGINAL RESEARCH
published: 24 December 2015
doi: 10.3389/fphys.2015.00399
Frontiers in Physiology | www.frontiersin.org 1December 2015 | Volume 6 | Article 399
Edited by:
Barbara Morgan,
University of Wisconsin-Madison, USA
Reviewed by:
Naoto Fujii,
University of Ottawa, Canada
Shane A. Phillips,
University of Illinois at Chicago, USA
*Correspondence:
Rosa Mancinelli
r.mancinelli@unich.it
Specialty section:
This article was submitted to
Exercise Physiology,
a section of the journal
Frontiers in Physiology
Received: 23 September 2015
Accepted: 07 December 2015
Published: 24 December 2015
Citation:
Pietrangelo T, Di Filippo ES,
Mancinelli R, Doria C, Rotini A,
Fanò-Illic G and Fulle S (2015) Low
Intensity Exercise Training Improves
Skeletal Muscle Regeneration
Potential. Front. Physiol. 6:399.
doi: 10.3389/fphys.2015.00399
Low Intensity Exercise Training
Improves Skeletal Muscle
Regeneration Potential
Tiziana Pietrangelo 1, 2, 3, 4, Ester S. Di Filippo 1,3, 4 , Rosa Mancinelli 1, 3, 4*, Christian Doria 1, 2, 4,
Alessio Rotini 1, 4 , Giorgio Fanò-Illic 2, 3, 4 and Stefania Fulle 1,2, 3, 4
1Department of Neuroscience, Imaging and Clinical Sciences, University “G. d’Annunzio” Chieti-Pescara, Chieti, Italy,
2Laboratory of Functional Evaluation, “G. d’Annunzio” University of Chieti-Pescara, Chieti, Italy, 3Centre for Aging Sciences,
d’Annunzio Foundation, Chieti, Italy, 4Department of Neuroscience, Imaging and Clinical Sciences, Interuniversity Institute of
Myology, Chieti, Italy
Purpose: The aim of this study was to determine whether 12 days of low-to-moderate
exercise training at low altitude (598 m a.s.l.) improves skeletal muscle regeneration in
sedentary adult women.
Methods: Satellite cells were obtained from the vastus lateralis skeletal muscle of seven
women before and after this exercise training at low altitude. They were investigated for
differentiation aspects, superoxide anion production, antioxidant enzymes, mitochondrial
potential variation after a depolarizing insult, intracellular Ca2+concentrations, and micro
(mi)RNA expression (miR-1, miR-133, miR-206).
Results: In these myogenic populations of adult stem cells, those obtained after
exercise training, showed increased Fusion Index and intracellular Ca2+concentrations.
This exercise training also generally reduced superoxide anion production in cells
(by 12–67%), although not in two women, where there was an increase of ∼15%
along with a reduced superoxide dismutase activity. miRNA expression showed an
exercise-induced epigenetic transcription profile that was specific according to the
reduced or increased superoxide anion production of the cells.
Conclusions: The present study shows that low-to-moderate exercise training at low
altitude improves the regenerative capacity of skeletal muscle in adult women. The
differentiation of cells was favored by increased intracellular calcium concentration and
increased the fusion index. This low-to-moderate training at low altitude also depicted
the epigenetic signature of cells.
Keywords: low-to-moderate intensity exercise training, satellite cells, superoxide anion, oxidative status, miRNA,
women
INTRODUCTION
Satellite cells are myogenic cells that are responsible for postnatal skeletal muscle growth. In normal
adult muscle, satellite cells account for differently activated peripheral sub-sarcolemmal nuclei,
which depend on the metabolic properties of the muscle fiber and the age of the person (Verdijk
et al., 2014). In response to various stimuli, satellite cells can enter the mitotic cycle, proliferate,
and fuse, thereby contributing to muscle regeneration for repair or hypertrophy of postnatal

Pietrangelo et al. Training and Muscle Regeneration in Women
skeletal muscle (Lorenzon et al., 2004; Snijders et al., 2012;
Ceafalan et al., 2014). Satellite cells are specifically involved
in skeletal muscle adaptation to different types of exercise,
such as with strength (Kvorning et al., 2014; Verdijk et al.,
2014) and endurance (Kadi et al., 2004) training, whereby the
intensity and duration of muscle stimulation is crucial for satellite
cell activation. Indeed, although it has been demonstrated that
satellite cells are not activated in response to a single bout of
exercise (Kadi et al., 2004), they can modulate specific factor
content after 9 h of combined resistance–endurance exercise
(Verdijk, 2014). Furthermore, even if it is currently accepted
that exercise has positive effects on skeletal muscle regeneration,
the fitness level of subjects and the type and intensity of
exercise protocols have crucial roles in satellite cell activation.
In fact, a number of study demonstrated that both resistance
and endurance training increased satellite cells content (Kadi
et al., 2005). At the ultrastructural level, it has been observed
that the endurance-training programme induced the formation
of new myotubes (Appell et al., 1988). However, there are many
points to be addressed at molecular level. The [Ca2+]i increase
is a prerequisite for fusion process due to specific signaling it
activates (Millay et al., 2013; Hindi et al., 2013). In fact, many
studies have shown that myoblast fusion is regulated by [Ca2+]i
increase (Constantin et al., 1996) that may depend on cholinergic
(Bernareggi et al., 2012), stretch-activated and KCa channels
activation (Pietrangelo et al., 2006; Shin et al., 1996).
Another molecular messenger influenced by exercise is
reactive oxygen species (ROS) production (Abruzzo et al., 2013).
The ROS include: superoxide anions, hydroxyl radicals, oxide
anions, hydrogen peroxide, nitric oxide, peroxynitrite, lipid
peroxyls, and lipid alkoxyls. ROS production is related to with
the term oxidative stress, which was originally defined as “a
disturbance in the pro-oxidant/anti-oxidant balance in favor of
the former” (Siens and Cadenas, 1985). However, due to the
complexity of the cellular redox balance, this was refined to “an
imbalance between oxidants and anti-oxidants in favor of the
oxidants, leading to a disruption of redox signaling and control
and/or molecular damage” (Siens and Jones, 2007; Powers et al.,
2011).
The cellular antioxidant system consists on the activity of
scavengers as vitamin C and E, for instance, and enzymes
as glutathione peroxidase, superoxide dismutase (SOD),
catalase (Cat). In particular, the SOD reduces the superoxide
anion to hydrogen peroxide and in turn the Cat reduces
this to water. There are several studies accounting for the
involvement of antioxidant enzymes in exercise-induced
muscle plasticity and also in vitamin supplementation
(Cumming et al., 2014; Nikolaidis et al., 2015). However, it
is not well understood the role of antioxidants in human
myogenesis.
Abbreviations: a.s.l., altitude sea level; [Ca2+]i,intracellular calcium
concentration; Cat, catalase; DCF-DA, 2′,7′Dichlorodihydrofluorescein diacetate;
JC-1,5,5′,6,6′-Tetrachloro-1,1′,3,3′tetraethylbenzimidazolylcarbocyanine; H2O2,
hydrogen peroxide; iodide/chloride; MHC, Myosin Heavy Chain; miRNA, micro
ribonucleic acid; O•−
2, superoxide anion; PBS, Dulbecco’s phosphate-buffered
saline; ROS, Reactive oxygen species; SOD, superoxide dismutase.
In mitochondria the cellular aerobic metabolism reduces
around 1–2% of oxygen to superoxide anions, which represent
the most abundant free radicals produced. The superoxide
reactivity could last for days in absence of enzymatic removal
and it can spread out into also outside the cell, and undergo
reactions far from its site of production, thus provoking cellular
and general oxidative stress. However, a gender distinguish has
to be considered, as female subjects are more protected than
men against oxidative stress thanks to their estrogen hormone.
The estrogen level in young woman exerts an antioxidant effect,
as demonstrated by four-fold less DNA and lipid oxidation in
female with respect to male subjects (Mecocci et al., 1999; Green
and Simpkins, 2000).
Skeletal muscle contraction during exercise produces variable
amounts of ROS, which depend on exercise intensity and
duration (Fisher-Wellman and Bloomer, 2009; Powers et al.,
2011). ROS can activate specific signaling pathways at the plasma
membrane and/or stimulate gene transcription (Gundersen,
2011; Baar, 2014). In particular, recent literature suggests that
both exercise and ROS can activate muscle-specific microRNAs
(myo-miRs; small post-transcriptional RNAs), and regulate the
differentiation levels of satellite cells (Eisenberg et al., 2009;
Crippa et al., 2012; Huang et al., 2012). Among the myo-miRs
of value for satellite cells, there are miR-1, miR-133, and miR-206
(Kwon et al., 2005; McCarthy and Esser, 2007; La Rovere et al.,
2014).
The aim of this study was to determine whether 12-day
exercise training at low altitude (598 m a.s.l.) can improve
skeletal muscle regeneration in adult women. In particular, we
investigated whether this kind of exercise could affect some
molecular actor of the differentiation process as the fusion
index, the intracellular calcium level, the redox balance, the
mitochondrial activation, and the miRNA expression.
METHODS
Subjects
Seven healthy women of childbearing age (mean age, 36.3 ±
7.1 years old) who were generally used to a sedentary life-
style (at 110 m altitude sea level, a.s.l.) were enrolled to serve
as subjects to the study known as GOKYO KHUMBU/AMA
DABLAM TREK 2012. None of these women suffered from
any metabolic or skeletal muscle diseases. The women were not
engaged in any specific trekking or exercise training protocols
within a few months of their enrolment, except two of them who
occasionally went trekking. All of the subjects provided written,
informed consent before participating in the study. The study
was conducted according to the Helsinki Declaration, and it was
approved by Ethic Committee of “G. d’Annunzio” University of
Chieti-Pescara, Italy (protocol no. 773 COET).
Experimental Design and Training
Trekking consisted of a 12- day walking at low-altitude on
mountain paths in central Italy (L’Aquila, Abruzzo, Italy). The
average altitude was 598 m ±561 and a range of difference in
elevation between consecutive days was 250–1000 m. The total
covered distance was 139600 m. The total ascent and descent
Frontiers in Physiology | www.frontiersin.org 2December 2015 | Volume 6 | Article 399

Pietrangelo et al. Training and Muscle Regeneration in Women
were 5500 m (458 m d−1; range: 0–1000 m d−1) and 5350 m
(445 m d−1; range: 0–1000 m d−1), respectively. The total walking
time was 149580 s ±27.06, on average 3 h and 28 min per day,
and the average speed was 0.93 m s−1. The total number of steps
was 182372 ±77.43. The volunteers freely choose their intensity
of exercise also considering the general recommendations to
approach physical exercise with a load adapted to personal
capacity (guidelines of American College Sport Medicine, Garber
et al., 2011). The exercise intensity of the training was monitored
with a heart rate monitor for each subject (POLAR R
, Kempele,
Finland). The average heart rate of the seven subjects in the
12 day of exercise training period was 111 ±10 bpm, which
was classified as light-to-moderate intensity (Tam et al., 2015).
The subjects did not perform other exercise outside the trekking
protocol.
Skeletal Muscle Needle Biopsy
Tiny percutaneous needle biopsies from the vastus lateralis
muscle were performed at the Laboratory of Functional
Evaluation, “G. d’Annunzio” University of Chieti-Pescara, as
described by Pietrangelo et al. (2011), a week before initiating the
exercise training (PRE-Ex), and 9 days after the specific planned
light-to-moderate exercise training at low altitude (POST-Ex).
Specifically, after the training period, the subjects stayed at rest
for a couple of days, then they were engaged in functional
evaluations described in (Tam et al., 2015), that lasted 5 days, and
after a couple of days of recovering, they had the needle biopsies.
Satellite Cell Population and Myogenicity
The satellite cells were obtained, expanded as myoblasts in
growth medium, and differentiated as previously described (Fulle
et al., 2005; Mancinelli et al., 2011). Briefly, the percentages
of myogenicity of the cell cultures were obtained using an
immunocytochemistry assay, with the marker desmin (Kaufman
and Foster, 1988; Behr et al., 1994), and with biotinylated
streptavidin-AP kits (LSAB +System-AP Universal kits; Cat.
No. K0678; DAKO, Dakocytomation, Glostrup, Denmark).
Differentiation of the cell populations was determined by
counting the numbers of nuclei in the myotubes after 7 days of
differentiation, as percentages with respect to the total number
of nuclei, with the ratio between these two values (nuclei in
myotubes/total nuclei ×100%) giving the Fusion Index. We
only considered myotubes that were positive to the primary
antibody against myosin heavy chain (MHC), using the MF20
anti-MHC monoclonal antibody (diluted 1:50; Developmental
Studies Hybridoma Bank, University of Iowa, Iowa City, IA,
USA), and that contained three or more nuclei (Pietrangelo et al.,
2009).
Intracellular Calcium Concentration
Measurement
The cells were loaded with Fura2-AM at the final concentration
of 5 µM for 30 min, which was then de-esterificated for
20 min at 37◦C. The experiments were performed and images
were acquired using the procedures and set-up described by
Pietrangelo et al. (2002).
Reactive Oxygen Species
The general analysis of ROS, specifically the cellular
peroxidation end products, was conducted using the dye
2,7-dichlorofluorescein diacetate (DCF; Cat.No. D6883; Sigma).
The cells were plated and grown in 96-well microplates (1000
cells 0.32 cm−1), and incubated with 10 µM DCF for 30 min
at 37◦C in sterile normal extracellular solution (140 mM NaCl,
2.8 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 10 mM glucose, 10 mM
Hepes, pH 7.3). The fluorescence of the dye accumulated in
the cytoplasm (i.e., 2,7-dichlorofluorescein) was determined at
530 nm (excitation, 490 nm) using a fluorometer (SPECTRAmax
Gemini XS; Molecular Devices Toronto, ON, Canada). The
analysis was conducted using the SOFTmax Pro software. The
cells were stimulated with 100 nM hydrogen peroxide (H2O2)
to evaluate their response to an oxidant (Menghini et al.,
2011).
To determine the superoxide anion (O•−
2), we used an assay
based on the dye nitroblue tetrazolium chloride (NBT; Cat. No.
N6639; Sigma-Aldrich) and its reduction into formazan O•−
2
(Sozio et al., 2013). The absorbance at 550 nm was determined
using a spectrophotometer (SPECTRAmax 190 microplate 257;
Molecular Devices, Sunnyvale, CA, USA), such that the greater
the O•−
2level, the greater the absorbance. The cells (1 ×106cells)
were detached, centrifuged at 170 ×gfor 5 min, resuspended in
1 ml NBT at 1 mg ml−1in 0.9% aqueous NaCl, and incubated for
3 h at 37◦C. Then, the cells were centrifuged at 100 ×gfor 10 min,
resuspended in 1 ml DMSO, and left for 20 min at 37◦C. Finally,
the NBT absorbance was determined.
Transmembrane Mitochondrial Potential
The mitochondrial membrane potential was determined
using the JC-1 dye (5,5′,6, 6′-tetracloro-1,1′,3,3′-
tetraethylbenzimidazolylcarbocianine iodide/chloride;
Molecular Probes). JC-1 is a cationic dye that accumulates
in the mitochondria. When the mitochondrial potential is
high, as in normal cells, JC-1 aggregates into dimers that
emit red fluorescence (aggregated J: excitation/ emission,
560/595 nm). When the membrane potential is low, as in
the presence of oxidative stress, JC-1 forms monomers that
emit green fluorescence (excitation/emission, 488/522 nm),
with concomitant decreased red fluorescence. The ratio
of the red/green fluorescence depends exclusively on the
mitochondrial potential, with no effects of other factors (such
as mitochondrial dimension, volume, shape, or density). The
cells were plated into 96-well plates, incubated with 10 µg
ml−1JC-1 for 15 min at 37◦C, and assayed using a fluorometer
(SPECTRAmax Gemini XS; Molecular Devices Toronto, ON,
Canada) equipped with the SoftMax Pro software (Gemini
XS, Molecular Devices Toronto, ON, Canada) (Nuydens
et al., 1999). The fluorescence is reported as means ±SEM of
the red/green fluorescence ratios of samples with respect to
control, as f(r/g)/f(r/g)c(Morabito et al., 2010), and is here
given as 19mit . The dye ratio for JC-1 between the inner and
outer mitochondrial membrane potentials was related to the
mitochondrial depolarization after an oxidant insult, such as
with (H2O2).
Frontiers in Physiology | www.frontiersin.org 3December 2015 | Volume 6 | Article 399

Pietrangelo et al. Training and Muscle Regeneration in Women
Antioxidant Enzyme Activity
The antioxidant enzymes analyzed were superoxide dismutase
and catalase, The assays were performed using the cells cytosolic
fraction.
Superoxide Dismutase
The activity of superoxide dismutase (SOD) is direct against
O•−
2. SOD catalyzes a disproportionation reaction where a first
O•−
2is oxidized and the second molecule is reduced, turning
two molecules of superoxide into O2and H2O2.The enzymatic
activity was determined according to Fulle et al. (2000) The final
assay volume was 1 ml and contained 20 mM Na2CO3buffer pH
10, 10 mM Cytochrome c, 1 mM Xanthine and Xanthine Oxidase.
Xanthine-xanthine oxidase is the O•−
2generation system. As
the xanthine oxidase activity varies, the amount used for the
assay was such that produced a rate of cytochrome c reduction,
at 550 nm, of 0.025 per minute without SOD addiction. The
assay was performed at 550 nm for 10 min. The SOD units
were calculated considering that 1 SOD unit is defined as
the quantity that inhibits the rate of cytochrome c reduction
by 50%.
Catalase
The reaction for which catalase (Cat) is best known is the
“catalatic” reaction, in which H2O2oxidizes the heme iron
of the resting enzyme to form an oxyferryl group with a
π-cationic porphyrin radical (Kirkman and Gaetani, 2006).
This step is followed by oxidation of a second molecule
of H2O2. Catalase forms two molecules of H2O and O2,
starting from two molecules of H2O2. Catalase activity was
determined, according to Greenwald (1985), by the decrease in
absorbance due to H2O2consumption (ε= −0.04 mM−1cm−1)
measured at 240 nm. The final reaction volume was 1 ml and
contained 100 mM Na-phosphate buffer pH 7.0, 12 µM H2O2
and 70 µg of sample proteins. The reaction was followed for
1 min and the Cat activity was expressed in µmol/minute/mg
proteins.
miRNA Expression
PureLink miRNA Isolation kits were used for the miRNA
extractions (Cat. No. K1570-01, Invitrogen, Life Technologies,
Molecular Devices, Sunnyvale, USA). About 800,000 cells were
resuspended in 300 µl binding buffer (from the PureLink
miRNA kits), and 300 µl 70% alcohol was added to the lysate.
This was forced into the spin cartridges of the PureLink
miRNA Isolation kits, which were then centrifuged at 12000
×gfor 1 min. After washing with 100% alcohol, these were
centrifuged again, as before. Then 500 µl wash buffer was
added to the spin cartridges, which were centrifuged again
at 12000 ×gfor 1 min. This procedure was performed
twice, and then the spin cartridges were centrifuged at
12000 ×gfor 3 min, to remove residual buffer. Finally,
they were eluted with 50 µl RNase-free sterile water. The
RNA concentrations were determined using a NanoDrop™
spectrophotometer.
Retro-transcription and real-time PCR were carried out
according to the Applied Biosystems TaqMan miRNA assay
kit protocols. Briefly, the retro-transcription involved 20 ng
of a “small” RNA, as the “stem loop” primer that was
specific for each miRNA, dNTPs, and inverse transcriptase
RNAse inhibitors (according to the Applied Biosystems high
capacity cDNA reverse transcription kit, part N◦4368814),
using a thermocycler (30 min at 16◦C, 30 min at 42◦C, 5 min
at 85◦C, then at 4◦C). Then, the real-time PCR for the miRNA
expression levels was performed using TaqMan probes and
specific TaqMan R
Universal Master Mix II, without UNG, in
96-well plates (Part No.: 4440040, Applied Biosystems) with a
sequence detection system (Applied Biosystems PRISM 7900
HT), in triplicate. MiR-16 was used as the endogenous control.
The specific miRNA sequence probes used were (Applied
Biosystems):
(i) has-miR-1 (UGGAAUGUAAAGAAGUAUGUAU; #0022
22);
(ii) has-miR-206 (UGGAAUGUAAGGAAGUGUGUGG; #00
0510);
(iii) has-miR-133b (UUUGGUCCCCUUCAACCAGCUA; #00
2247);
(iv) has-miR-16-5p (UAGCAGCACGUAAAUAUUGGCG; #00
0391).
The relative quantification of the miRNA targets was carried out
using the 1Ct formula, according to the Ct method.
Statistical Analysis
The statistical analysis was carried out using GraphPad Prism
Software, version 5 (GraphPad Software, La Jolla, CA, USA). The
data are reported as means ±standard error (SE). Unpaired
and paired t-tests (for different group of cells and for the same
cells with specific treatment, respectively) were used to reveal the
statistical differences.
RESULTS
Subjects
Seven healthy women of childbearing age who were generally
used to a sedentary life-style were enrolled to study the skeletal
muscle regeneration potential after low to moderate intensity
training as trekking at low altitude. Table 1 summarize their
anthopometric and physiological features.
TABLE 1 | Anthropometric and physiological characteristics of the
subjects before (PRE-Exercise) and after (POST-Exercise) 12-days training
period.
PRE-exercise POST-exercise
BW (Kg) 65.7 ±4.4 65.1 ±4.0
BMI (Kg m−2) 24.3 ±1.5 24.1 ±1.4
BF (%) 27.2 ±2.6 25.9 ±2.7
VO2max(L min−1) 2.13 ±0.13 2.16 ±0.12
BW, body weight; BMI, body mass index; BF (%), body fat percentage; VO2max, maximum
oxygen consumption.
Frontiers in Physiology | www.frontiersin.org 4December 2015 | Volume 6 | Article 399

Pietrangelo et al. Training and Muscle Regeneration in Women
TABLE 2 | Characteristics of myogenicity and differentiation of the satellite cell populations isolated from the seven women after trekking in the Abruzzo
hills (central Italy).
Subject PRE-exercise POST-exercise
code %Desmin+Fusion Index (%) %Desmin+unfused %Desmin+Fusion Index (%) %Desmin+unfused
#1 68.5 38.0 75.0 70.5 33.3 75.8
#2 66.0 23.3 73.9 77.3 60.2 22.4
#3 76.2 28.2 91.3 87.0 30.0 87.0
#4 90.4 14.6 82.1 88.8 67.9 28.5
#5 70.0 19.8 71.8 46.7 44.5 37.2
#6 67.0 23.5 58.4 34.5 42.6 25.7
#7 48.1 18.0 49.2 – – –
POST-Exercise Fusion Index differs significantly from the PRE-Exercise Fusion Index (p <0.05, one tailed); POST-Exercise %Desmin+unfused differs significantly from the PRE-Exercise
%Desmin+unfused (p <0.05, one tailed).
FIGURE 1 | Intracellular Ca2+concentrations as basal levels for
undifferentiated and differentiated (as indicated) cells obtained from
skeletal muscle of female subjects for PRE-Ex and POST-Ex (as
indicated). ** p<0.01 vs. undifferentiated PRE-Ex cells; §§p<0.01 vs.
undifferentiated PRE-Ex cells. The total analyzed cells were 90 myoblasts and
70 myotubes.
Myogenic Characteristics and Analysis of Cell
Differentiation After Exercise Training
We obtained myogenic populations of adult stem cells,
myoblasts, from percutaneous needle biopsies from the vastus
lateralis muscle of female volunteers before (PRE-Ex) and
after (POST-Ex) low altitude exercise training in the Abruzzo
mountains. The characteristics of the cell differentiation are
reported in Table 2.
The analysis of desmin-positive undifferentiated cells
suggested that there were no significant difference in the
myogenicity between the PRE-Ex and POST-Ex conditions.
Of note, the Fusion Index, which represents the percentage of
myoblasts that can fuse over 7 days of differentiation forming
myotubes, was significantly increased at POST-Ex (p<0.05).
The percentage of desmin-positive cells in the differentiation
media (after 7 days of differentiation) significantly decreased
(p<0.05).
Intracellular Ca2+Concentrations of Cells
Figure 1 shows the basal levels of the intracellular Ca2+
concentrations ([Ca2+]i) of the undifferentiated and
differentiated cells. The undifferentiated POST-Ex myoblasts had
[Ca2+]ithat were significantly higher than PRE-Ex myoblasts
(p≤0.01). In the comparison of the differentiated PRE-Ex
cells with respect to the undifferentiated PRE-Ex cells, these also
showed an increase in [Ca2+]i(p≤0.01). There were, however,
no differences for the [Ca2+]ibetween the differentiated and
undifferentiated POST-Ex cells and among the differentiated
ones.
Superoxide Production and General Oxidation State
The myoblasts showed different level of superoxide production
(Table 3). While the myoblasts from subject #1 maintained
the same O•−
2levels, those from subjects #2, #3, and #4
showed significant decreases (p≤0.0001); conversely, those
from subjects #5 and #6 showed significant increases in O•−
2
production (p≤0.0001) after the exercise training. The increases
in O•−
2production here were about 15% with respect to the
control production, while the decreases ranged from 12 to 67%
(Table 3).
The analysis of general oxidation state was conducted
using DCF fluorescence. The addition of 100 nM H2O2to
the myoblasts loaded with DCF resulted in rapid increases in
fluorescence that returned to basal level within 5 min, in the
samples with both decreased and increased O•−
2production
(Figure 2). Of note, the POST-Ex cell populations showing
reduced superoxide anion production showed also a less amount
of ROS at basal level, as revealed by 10% less DCF fluorescence
with respect to that measured at PRE-Ex, even if not significant.
In fact, the DCF fluorescence of POST-Ex vs. PRE-Ex at 0 min
was 5.4 ±0.7 vs. 6.0 ±0.9 (Figure 2, confront Figure 2B
vs. Figure 2A). The POST-Ex myoblasts showing increased
superoxide anion production showed similar amounts of DCF
fluorescent dye with respect to the PRE-Ex (4.6 ±0.6 vs. 4.3 ±
0.7, not significant, Figures 2C,D).
Antioxidant Enzyme Activity
The activity of antioxidant enzymes Superoxide dismutase and
Catalase were determined on cytosolic fractions of PRE-Ex and
POST-Ex undifferentiated cells both in population with reduced
and increased superoxide anion production (Figure 3). The
myoblasts with increased O•−
2production (empty bars) showed
no variation of both enzyme activity while those with decreased
Frontiers in Physiology | www.frontiersin.org 5December 2015 | Volume 6 | Article 399

Pietrangelo et al. Training and Muscle Regeneration in Women
FIGURE 2 | Kinetics of DCF fluorescence in the control (PRE-Ex; A, C) and POST-Ex (B, D) myoblasts obtained from the skeletal muscle of the women
that saw both decreased (A, B) and increased (C, D) O•−
2production, without and with addition of 100 nM H2O2(as indicated). The H2O2was added at
0 min in dedicated samples (+100 nM H2O2). Data came from three independent experiments. All of the ±H2O2data points were significantly different (p≤0.0001),
except after 5 min ns, not significant.
TABLE 3 | Superoxide anion detection in the control (PRE-exercise) and
after the low-moderate exercise conditioned (POST-exercise) satellite
cells, as revealed by NBT dye fluorescence.
Subject NBT dye fluorescence (mean ±SD) Variationa(%)
PRE-exercise POST-exercise
#1 0.170 ±0.030 0.180 ±0.011 0
#2 0.132 ±0.012 0.114 ±0.006 §§ −14
#3 0.139 ±0.004 0.045 ±0.001 §§ −67
#4 0.080 ±0.004 0.070 ±0.002 §§ −12.5
#5 0.060 ±0.002 0.070 ±0.003 §§ +16
#6 0.106 ±0.003 0.125 ±0.004 §§ +18
apercentage of variation with respect to PRE-Ex data (assumed as 100%), §significantly
decreased or increased O•−
2radical level for POST-Ex vs. PRE-Ex (p <0.001).
O•−
2production (dotted bars) showed a significant reduction
of Superoxide dismutase activity (p≤0.05) and no significant
change of Catalase activity.
Transmembrane Mitochondrial Potential
The undifferentiated and differentiated PRE-Ex and POST-Ex
cells showed stable transmembrane mitochondrial potentials
(measured as the f[r/g]/f[r/g]cratio for JC-1; 19mit ), which
was reversibly depolarized (in a range of 10–20%) under
the oxidative stimulus of 100 nM H2O2(data not shown).
Acute stimulation with the H2O2induced less mitochondrial
depolarization of the POST-Ex myotubes than was seen PRE-
Ex, even if the depolarization levels were not significantly
different (data not shown). The transmembrane mitochondrial
potential of the myoblasts producing more superoxide anion
provided an exception here: the PRE-Ex 19mit showed H2O2-
dependent depolarization, as previously described, while the
POST-Ex 19mit was stable with this addition of H2O2
(Figure 4).
Epigenetic Profile Induced by Exercise
Training
The analysis of the expression of miRNAs in the POST-
Ex myoblasts showed an up-regulation of miR-1, miR133b,
and miR206 respect to PRE-Ex in samples with decreased
O•−
2production conversely we found a down-regulation of
all miRNAs tested in samples with increased O•−
2production
(Figure 5).
DISCUSSION
We have analyzed here skeletal muscle regeneration in adult
women after low-to-moderate exercise training with specific
attention paid to oxidative status. Recently, molecular studies
in humans, highlighted that fusion of myogenic cells is
triggered by endurance exercise-induced muscle plasticity
(Frese et al., 2015)
Frontiers in Physiology | www.frontiersin.org 6December 2015 | Volume 6 | Article 399

Pietrangelo et al. Training and Muscle Regeneration in Women
FIGURE 3 | Superoxide dismutase and Catalase activity. In the Figure is shown a representative example of enzyme activities. The activity of Superoxide
dismutase showed similar level on myoblasts with decreased O•−
2production (empty bars) while it was reduced in myoblasts showing increased O•−
2production
(dotted bars) with respect to PRE-Ex (*p≤0.05). The Catalase activity was similar among the PRE-Ex and POST-Ex cells, despite the O•−
2production.
FIGURE 4 | Kinetics of the JC1 red/green fluorescence ratio variations
as indirect measures of the transmembrane mitochondrial potential
(19) of myotubes obtained from skeletal muscle of female subjects for
PRE-Ex and POST-Ex, without and with addition of 100 nM H2O2(as
indicated). Data came from three independent experiments. The treatment
with H2O2produced significant 19 variation only in PRE-Ex cells (*p≤0.05).
The condition PRE-Ex vs. POST-Ex resulted significant only in untreated cells
(§§§, p≤0.0001).
At the cellular level, the fusion process is characterized
by the alignment/fusion of myoblast membranes and
cytoskeleton/cytoplasm rearrangements which results in
the formation of nascent myotubes. Many studies of in vitro
skeletal myogenesis have shown that myoblast fusion is regulated
by calcium-increase in myoblasts before myotube formation
(Constantin et al., 1996). We recorded an increased [Ca2+]iin
the POST-Ex myoblats that could be at the base of their increased
ability to fuse to each other to form myotubes (Antigny et al.,
2014). In fact, the fusion index significantly increased after the
exercise training (POST-Ex) despite the O•−
2production, along
with a trend to a reduction in the levels of desmin-positive cells
that did not fuse in the differentiation media.
The data from the literature are consistent with the
observation that intracellular ROS generation by contracting
skeletal muscle increases by two-four–fold during contraction
(Jackson et al., 2007). These ROS are derived through different
biochemical pathways, and in particular by mitochondrial
activity.
In fact, during aerobic training, the enzymatic activity of this
electron transfer shifts from complex IV to complex III (maximal
ADP-stimulated respiration), which improves the efficiency of
the mitochondria for the production of ATP and the reduction
of O•−
2(Di Meo and Venditti, 2001; Muller et al., 2004; Kozlov
et al., 2005; Quinlan et al., 2013).
The results here for the satellite cell populations obtained
after this low altitude exercise training suggested that the
exercise linked to training provoked redox imbalance in some
manner, mainly reducing O•−
2production. These data thus
showed that in the satellite cell populations of three of the
six subjects there was significantly reduced O•−
2production,
for one of the six there was no change, and for two of the
six there was about a 15% increase in the O•−
2production,
as a relatively small amount. Albeit the myoblasts from two
subjects increased cellular O•−
2production, this was linked to
reduced superoxide dismutase activity. This reduction could be
due to both the involvement of the enzyme in the oxidant
reduction activity or in the partial inhibition of the dismutase
enzyme.
The ROS species produced physiologically during exercise
can stimulate important physiological mechanisms. For
instance, there can be reversible oxidation of exposed protein
thiols of the amino-acid cysteine in the ryanodine receptor,
which governs correct excitation-contraction coupling
(Fulle et al., 2007). Other examples include stimulation
of mitochondrial biogenesis (Powers et al., 2011), up-
regulation of antioxidant defenses (Gomez-Cabrera et al., 2008),
expression of several genes for muscle hypertrophy (Powers
et al., 2010), management of optimum muscle contractility
(Reid et al., 1985), and muscle fatigue (Morillas-Ruiz et al.,
2005).
Moreover, the data on general cellular peroxidation performed
using DCF fluorescence, revealed that the presence of increased
O•−
2production did not match with an establishment of
oxidative stress. In fact, the POST-Ex cell populations showing
increased O•−
2production, showed similar amount of DCF
fluorescence with respect to PRE-Ex while those with reduced
O•−
2production showed about 10% less amounts of the
fluorescent dye DCF with respect to the PRE-Ex, albeit
Frontiers in Physiology | www.frontiersin.org 7December 2015 | Volume 6 | Article 399

Pietrangelo et al. Training and Muscle Regeneration in Women
FIGURE 5 | Epigenetic signatures of miRNA expression. Relative expression of miR-1, miR-133b, and miR-206 (as indicated) in undifferentiated cells obtained
from skeletal muscle of female subjects that saw both decreased (A) and increased (B) O•−
2production before (empty bars) and after (dotted bars) exercise training.
Data came from three independent experiments, each performed in triplicate. *,p<0.05;**,p<0.01;***,p<0.0001.
it not reached significant statistical differences. After the
addition of H2O2as external oxidant to mimic acute oxidative
stress, all the cells completely reduced the ROS at the
control levels in 5 min, as shown by the kinetics of DCF
fluorescence.
The O•−
2radical is rapidly converted into the cell by the
superoxide dismutases, to the more stable H2O2(Abele et al.,
2002). This H2O2then undergoes specific degradation by catalase
(Sullivan-Gunn and Lewandowski, 2013). The measurement of
Catalase activity showed no significant differences among cell
populations despite the level of O•−
2production, suggesting
that probably the cells did not undergo the oxidative stress.
The mitochondria are the main source of O•−
2production;
in addition there are other intracellular sources, such as
the sarcoplasmic reticulum-associated and plasma-membrane-
associated NAD(P)H oxidases, whereby the latter release
O•−
2mainly into the extracellular space, so they would be
less important for intracellular O•−
2production. Although
we cannot exactly distinguish the sources of increased O•−
2
in our samples, we think that it could depend on the
decreased superoxide dismutase activity and not on the impaired
electron transfer shifts from mitochondrial complexes. In fact,
the analysis of the mitochondrial transmembrane potential,
19mit , suggested that the cell populations with decreased
superoxide production after the exercise training showed
the same levels of 19mit under the PRE-Ex and POST-Ex
conditions. Acute stimulation with the H2O2induced less
mitochondrial depolarization of the POST-Ex myotubes than
was seen PRE-Ex, which demonstrates potentially more efficient
mitochondrial regulation. The investigation of 19mit in the
cell populations with increased superoxide production showed
that albeit some POST-Ex myotubes were more depolarized
than their PRE-Ex controls, the depolarizing insult with H2O2
did not provoke further variations. It could be that these
mitochondrial potential were fixed as in a protective asset
(Starkov, 1997). This might be linked to the effectiveness
of the exercise training, which would adapt the myotubes
to counteract oxidation-dependent depolarization and thus
avoid its eventual negative consequences. In this manner, the
mitochondrial functionality and the ATP production would
remain optimal.
The miRNA analysis of myoblasts revealed a particular
signature of this low-to-moderate training at low altitude in
relation to the oxidant production. In fact, the increased
accumulation of O•−
2in myoblasts occurred along with
down-regulation of miR-1, miR-133b, and miR-206 expression
while these miRNAs were up-regulated in samples with increased
O•−
2production. miR-1 pushes cells toward apoptosis by
inhibiting the heat shock proteins 60 and 70 which inhibit the
mitochondrial apoptosis pathway, miR-133 acts in an opposite
way through the repression of caspase nine. Interestingly, the
coherent up- or down-regulation of miR-1 and miR-133b,
as found in all our samples despite the O•−
2production,
suggested that apoptosis was switched off (Xu et al., 2007).
Moreover, we noted that when miRNA-1, miRNA-133b and
miRNA-206 were up-regulated the cells showed decreased level
of O•−
2production, on the contrary when down-regulated,
increased level of O•−
2production. It could be possible that
in female human myoblasts these miRNAs are specifically
sensible to O•−
2presence. Moreover, the down-regulation of
miRNA-1, miRNA-133b, and miRNA-206 has been correlated
with skeletal muscle inflammatory (Georgantas et al., 2014).
We think that in this muscle condition among oxidant
species it could be present increased O•−
2production that
could be responsible for these miRNA regulation and this
scenario could be managed during female low training intensity
session.
CONCLUSIONS
The low to moderate intensity training has been able to
stimulate the regeneration of female skeletal muscle. It induced
mainly a decrease of O•−
2production, an increase of human
myoblasts fusion index along with [Ca2+]iincrease. The
O•−
2production could regulate the miRNA-1, miRNA 133b,
and miRNA-206 expression without affecting the myoblast
differentiation.
AUTHOR CONTRIBUTIONS
TP designed the project, realised calcium imaging experiments,
wrote the manuscript, analyzed and discussed the data.
Frontiers in Physiology | www.frontiersin.org 8December 2015 | Volume 6 | Article 399

Pietrangelo et al. Training and Muscle Regeneration in Women
ED performed experiments on oxidative status and
miRNA regulation. RM managed cell cultures, performed
experiments on oxidative status, analyzed and discussed
the data. CD trained the volunteers and discussed the
data. AR performed experiments on oxidative status.
GF discussed the data. SF analyzed and discussed the
data.
ACKNOWLEDGMENTS
The authors would like to thank all of the volunteers
for their collaboration. This study was funded by a “G.
d’Annunzio” University grant, the 2012N8YJC3_003 and
the 2010R8JK2X_007 PRIN national grants to PT and SF,
respectively; the RBFR12BUMH_005 FIRB national grant to MR.
REFERENCES
Abele, D., Heise, K., Pörtner, H. O., and Puntarulo, S. (2002). Temperature
dependence of mitochondrial function and production of reactive oxygen
species in the intertidal mud clam Mya arenaria.J. Exp. Biol. 205, 1831–1841.
Abruzzo, P. M., Esposito, F., Marchionni, C., di Tullio, S., Belia, S., Fulle, S., et al.
(2013). Moderate exercise training induces ROS-related adaptations to skeletal
muscles. Int. J. Sports Med. 34, 676–687. doi: 10.1055/s-0032-1323782
Antigny, F., Konig, S., Bernheim, L., and Frieden, M. (2014). Inositol 1,4,5
trisphosphate receptor 1 is a key player of human myoblast differentiation. Cell
Calcium 56, 513–521. doi: 10.1016/j.ceca.2014.10.014
Appell, H. J., Forsberg, S., and Hollmann, W. (1988). Satellite cell activation in
human skeletal muscle after training: evidence for muscle fiber neoformation.
Int. J. Sports Med. 9, 297–299. doi: 10.1055/s-2007-1025026
Baar, K. (2014). Nutrition and the adaptation to endurance training. Sports Med.
44(Suppl. 1), S5–S12. doi: 10.1007/s40279-014-0146-1
Behr, T., Fischer, P., Müller-Felber, W., Schmidt-Achert, M., and Pongratz, D.
(1994). Myofibrillogenesis in primary tissue cultures of adult human skeletal
muscle: expression of desmin, titin, and nebulin. Clin. Investig. 72, 150–155.
doi: 10.1007/BF00184594
Bernareggi, A., Luin, E., Formaggio, E., Fumagalli, G., and Lorenzon, P.
(2012). Novel role for prepatterned nicotinic acetylcholine receptors during
myogenesis. Muscle Nerve 46, 112–121. doi: 10.1002/mus.23284
Ceafalan, L. C., Popescu, B. O., and Hinescu, M. E. (2014). Cellular
players in skeletal muscle regeneration. BioMed Res. Int. 2014:957014. doi:
10.1155/2014/957014
Constantin, B., Cognard, C., and Raymond, G. (1996). Myoblast fusion requires
cytosolic calcium elevation but not activation of voltage-dependent calcium
channels. Cell Calcium 19, 365–374. doi: 10.1016/S0143-4160(96)90109-8
Crippa, S., Cassano, M., and Sampaolesi, M. (2012). Role of miRNAs in muscle
stem cell biology: proliferation differentiation and death. Curr. Pharm. Des. 18,
1718–1729. doi: 10.2174/138161212799859620
Cumming, K. T., Raastad, T., Holden, G., Bastani, N. E., Schneeberger, D.,
Paronetto, M. P., et al. (2014). Effects of vitamin C and E supplementation
on endogenous antioxidant systems and heat shock proteins in response to
endurance training. Physiol. Rep. 2:e12142 doi: 10.14814/phy2.12142
Di Meo, S., and Venditti, P. (2001). Mitochondria in exercise-induced oxidative
stress. Biol. Signals Recept. 10, 125–140. doi: 10.1159/000046880
Eisenberg, I., Alexander, M. S., and Kunkel, L. M. (2009). miRNAS in normal
and diseased skeletal muscle. J. Cell. Mol. Med. 13, 2–11. doi: 10.1111/j.1582-
4934.2008.00524.x
Fisher-Wellman, K., and Bloomer, J. (2009). Acute exercise and oxidative stress: a
30 year history. Dyn. Med. 8:1. doi: 10.1186/1476-5918-8-1
Frese, S., Ruebner, M., Suhr, F., Konou, T. M., Tappe, K. A., Toigo, M., et al.
(2015). Long-term endurance exercise in humans stimulates cell fusion of
myoblasts along with fusogenic endogenous retroviral genes in vivo.PLoS ONE
10:e0132099. doi: 10.1371/journal.pone.0132099
Fulle, S., Di Donna, S., Puglielli, C., Pietrangelo, T., Beccafico, S., Bellomo, R., et al.
(2005). Age-dependent imbalance of the antioxidative system in human satellite
cells. Exp. Gerontol. 40, 189–197. doi: 10.1016/j.exger.2004.11.006
Fulle, S., Mecocci, P., Fanó, G., Vecchiet, I., Vecchini, A., Racciotti, D., et al. (2000).
Specific oxidative alterations in vastus lateralis muscle of patients with the
diagnosis of chronic fatigue syndrome. Free Radic. Biol. Med. 29, 1252–1259.
doi: 10.1016/S0891-5849(00)00419-6
Fulle, S., Pietrangelo, T., Mancinelli, R., Saggini, R., and Fanò, G. (2007). Specific
correlations between muscle oxidative stress and chronic fatigue syndrome: a
working hypothesis. J. Muscle Res. Cell Motil. 28, 355–362. doi: 10.1007/s10974-
008-9128-y
Garber, C. E., Blissmer, B., Deschenes, M. R., Franklin, B. A., Lamonte, M.
J., Lee, I. M., et al. (2011). American college of sports medicine position
stand. Quantity and quality of exercise for developing and maintaining
cardiorespiratory, musculoskeletal, and neuromotor fitness in apparently
healthy adults: guidance for prescribing exercise. Med. Sci. Sports Exerc. 43,
1334–1359. doi: 10.1249/MSS.0b013e318213fefb
Georgantas, R. W., Streicher, K., Greenberg, S. A., Greenlees, L. M., Zhu, W.,
Brohawn, P. Z., et al. (2014). Inhibition of myogenic microRNAs 1, 133, and
206 by inflammatory cytokines links inflammation and muscle degeneration
in adult inflammatory myopathies. Arthritis Rheumatol. 66, 1022–1033. doi:
10.1002/art.38292
Gomez-Cabrera, M. C., Domenech, E., and Viña, J. (2008). Moderate exercise is
an antioxidant: upregulation of antioxidant genes by training. Free Radic. Biol.
Med. 44, 126–131. doi: 10.1016/j.freeradbiomed.2007.02.001
Green, P. S., and Simpkins, J. W. (2000). Neuroprotective effects of estrogens:
potential mechanisms of action. Int. J. Dev. Neurosci. 18, 347–358. doi:
10.1016/S0736-5748(00)00017-4
Greenwald, R. A. (1985). Therapeutic benefits of oxygen radical scavenger
treatments remain unproven. J. Free Radic. Biol. Med. 1, 173–177.
Gundersen, K. (2011). Excitation-transcription coupling in skeletal muscle: the
molecular pathways of exercise. Biol. Rev. Camb. Philos. Soc. 86, 564–600. doi:
10.1111/j.1469-185X.2010.00161.x
Hindi, S. M., Tajrishi, M. M., and Kumar, A. (2013). Signaling mechanisms in
mammalian myoblast fusion. Sci. Signal. 6:re2. doi: 10.1126/scisignal.2003832
Huang, Z.-P., Espinoza-Lewis, R., and Wang, D.-Z. (2012). Determination of
miRNA targets in skeletal muscle cells. Methods Mol. Biol. Clifton N.J. 798,
475–490. doi: 10.1007/978-1-61779-343-1_28
Jackson, M. J., Pye, D., and Palomero, J. (2007). The production of reactive oxygen
and nitrogen species by skeletal muscle. J. Appl. Physiol. 102, 1664–1670. doi:
10.1152/japplphysiol.01102.2006
Kadi, F., Charifi, N., Denis, C., Lexell, J., Andersen, J. L., Schjerling, P., et al.
(2005). The behaviour of satellite cells in response to exercise: what have we
learned from human studies? Pflugers Arch Eur. J. Physiol. 451, 319–327. doi:
10.1007/s00424-005-1406-6
Kadi, F., Johansson, F., Johansson, R., Sjöström, M., and Henriksson, J. (2004).
Effects of one bout of endurance exercise on the expression of myogenin
in human quadriceps muscle. J. Histochem. Cell Biol. 121, 329–334. doi:
10.1007/s00418-004-0630-z
Kaufman, S. J., and Foster, R. F. (1988). Replicating myoblasts express a muscle-
specific phenotype. Proc. Natl. Acad. Sci. U.S.A. 85, 9606–9610.
Kirkman, H. N., and Gaetani, G. F. (2006). Mammalian catalase: a venerable
enzyme with new mysteries. Trends Biochem. Sci. 32, 44–50. doi:
10.1016/j.tibs.2006.11.003
Kozlov, A. V., Szalay, L., Umar, F., Koprik, K., Staniek, K., Niedermuller,
H., et al. (2005). Skeletal muscles, heart, and lung are the main sources
of oxygen radicals in old rats. Biochim. Biophys. Acta 1740, 382–389. doi:
10.1016/j.bbadis.2004.11.004
Kvorning, T., Kadi, F., Schjerling, P., Andersen, M., Brixen, K., Suetta, C., et al.
(2014). The activity of satellite cells and myonuclei following 8 weeks of
strength training in young men with suppressed testosterone levels. Acta
Physiol. (Oxf). 213, 676–687. doi: 10.1111/apha.12404
Kwon, C., Han, Z., Olson, E. N., and Srivastava, D. (2005). MicroRNA1 influences
cardiac differentiation in Drosophila and regulates Notch signaling. Proc. Natl.
Acad. Sci. U.S.A. 102, 18986–18991. doi: 10.1073/pnas.0509535102
Frontiers in Physiology | www.frontiersin.org 9December 2015 | Volume 6 | Article 399

Pietrangelo et al. Training and Muscle Regeneration in Women
La Rovere, R. M., Quattrocelli, M., Pietrangelo, T., Di Filippo, E. S., Maccatrozzo,
L., Cassano, M., et al. (2014). Myogenic potential of canine craniofacial satellite
cells. Front. Aging Neurosci. 6:90. doi: 10.3389/fnagi.2014.00090
Lorenzon, P., Bandi, E., de Guarrini, F., Pietrangelo, T., Schäfer, R., Zweyer, M.,
et al. (2004). Ageing affects the differentiation potential of human myoblasts.
Exp. Gerontol. 39, 1545–1554. doi: 10.1016/j.exger.2004.07.008
Mancinelli, R., Pietrangelo, T., La Rovere, R., Toniolo, L., Fanò, G., Reggiani,
C., et al. (2011). Cellular and molecular responses of human skeletal
muscle exposed to hypoxic environment. J. Biol. Regul. Homeost. Agents 25,
635–645.
McCarthy, J. J., and Esser, K. A. (2007). MicroRNA-1 and microRNA-133a
expression are decreased during skeletal muscle hypertrophy. J. Appl. Physiol.
102, 306–313. doi: 10.1152/japplphysiol.00932.2006
Mecocci, P., Fanó, G., Fulle, S., MacGarvey, U., Shinobu, L., Polidori, M. C.,
et al. (1999). Age-dependent increases in oxidative damage to DNA, lipids and
proteins in human skeletal muscle. Free Radic. Biol. Med. 26, 303–308. doi:
10.1016/s0891-5849(98)00208-1
Menghini, L., Leporini, L., Scanu, N., Pintore, G., La Rovere, R., Di Filippo, E. S.,
et al. (2011). Effect of phytochemical concentrations on biological activities of
cranberry extracts. J. Biol. Regul. Homeost. Agents 25, 27–35.
Millay, D. P., O’Rourke, J. R., Sutherland, L. B., Bezprozvannaya, S., Shelton, J. M.,
Bassel-Duby, R., et al. (2013). Myomaker is a membrane activator of myoblast
fusion and muscle formation. Nature 499, 301–305. doi: 10.1038/nature12343
Morabito, C., Rovetta, F., Bizzarri, M., Mazzoleni, G., Fanò, G., and Mariggiò,
M. A. (2010). Modulation of redox status and calcium handling by
extremely low frequency electromagnetic fields in C2C12 muscle cells: a
real-time, single-cell approach. Free Radic. Biol Med. 48, 579–589. doi:
10.1016/j.freeradbiomed.2009.12.005
Morillas-Ruiz, J., Zafrilla, P., Almar, M., Cuevas, M. J., Lopez, F. J., bellan, P.,
et al. (2005). The effects of an anti-oxidant-supplemented beverage on exercise-
induced oxidative stress: results from a placebo-controlled double-blind study
in cyclists. Eur. J. Appl. Physiol. 95, 543–549. doi: 10.1007/s00421-005-0017-4
Muller, F. L., Liu, Y., and Van Remmen, H. (2004). Complex III releases
superoxide to both sides of inner mitochondrial membrane. J. Biol. Chem. 279,
49064–49073. doi: 10.1074/jbc.M407715200
Nikolaidis, M. G., Margaritelis, N. V., Paschalis, V., Theodorou, A. A., Kyparos,
A., and Vrabas, I. S. (2015). “Common questions and tentative answers on
how to assess oxidative stress after antioxidant supplementation and exercise,”
in Antioxidants in Sport Nutrition, ed M. Lamprecht (Boca Raton, FL: CRC
Press).
Nuydens, R., Novalbos, J., Dispersyn, G., Weber, C., Borgers, M., and Geerts, H.
(1999). A rapid method for the evaluation of compounds with mitochondria-
protective properties. J. Neurosci. Methods 92, 153–159. doi: 10.1016/S0165-
0270(99)00107-7
Pietrangelo, T., D’Amelio, L., Doria, C., Mancinelli, R., Fulle, S., and Fanò, G.
(2011). Tiny percutaneous needle biopsy: an efficient method for studying
cellular and molecular aspects of skeletal muscle in humans. Int. J. Mol. Med.
27, 361–367. doi: 10.3892/ijmm.2010.582
Pietrangelo, T., Fioretti, B., Mancinelli, R., Catacuzzeno, L., Franciolini, F., Fanò,
G., et al. (2006). Extracellular guanosine-5′-triphosphate modulates myogenesis
via intermediate Ca(2+)-activated K+ currents in C2C12 mouse cells. J. Physiol.
572, 721–733. doi: 10.1113/jphysiol.2005.102194
Pietrangelo, T., Mariggiò, M. A., Lorenzon, P., Fulle, S., Protasi, F., Rathbone,
M., et al. (2002). Characterization of specific GTP binding sites in C2C12
mouse skeletal muscle cells. J. Muscle Res. Cell Motil. 23, 107–118. doi:
10.1023/A:1020288117082
Pietrangelo, T., Puglielli, C., Mancinelli, R., Beccafico, S., Fanò, G., and Fulle,
S. (2009). Molecular basis of the Myogenic profile of aged human skeletal
muscle satellite cells during differentiation. Exp. Geront. 44, 523–531. doi:
10.1016/j.exger.2009.05.002
Powers, S. K., Duarte, J., Kavazis, A. N., and Talbert, E. E. (2010). Reactive oxygen
species are signaling molecules for skeletal muscle adaptation. Exp. Physiol. 95,
1–9. doi: 10.1113/expphysiol.2009.050526
Powers, S. K., Nelson, W. B., and Hudson, M. B. (2011). Exercise-induced oxidative
stress in humans: cause and consequences. Free Radic. Biol. Med. 51, 942–950.
doi: 10.1016/j.freeradbiomed.2010.12.009
Quinlan, C. L., Perevoshchikova, I. V., Hey-Mogensen, M., Orr, A. L., and
Brand, M. D. (2013). Sites of reactive oxygen species generation by
mitochondria oxidizing different substrates. Redox Biol. 1, 304–312. doi:
10.1016/j.redox.2013.04.005
Reid, M. B., Khawli, F. A., and Moody, M. R. (1985). Reactive oxygen in skeletal
muscle. III. Contractility of unfatigued muscle. J. Appl. Physiol. 75, 1081–1087.
Shin, K. S., Park, J. Y., Ha, D. B., Chung, C. H., and Kang, M.-S. (1996).
Involvement of KCa channels and stretch-activated channels in calcium influx,
triggering membrane fusion of chick embryonic myoblasts. Dev. Biol. 175,
14–23. doi: 10.1006/dbio.1996.0091
Siens, H., and Cadenas, E. (1985). Oxidative stress: damage to intact cells and
organs. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 311, 617–631. doi:
10.1098/rstb.1985.0168
Siens, H., and Jones, D. P. (2007). “Oxidative stress,” in Encyclopedia of Stress, ed
G. Fink (Victoria: Elsevier), 45–48.
Snijders, T., Verdijk, L. B., Beelen, M., McKay, B. R., Parise, G., Kadi, F.,
et al. (2012). A single bout of exercise activates skeletal muscle satellite
cells during subsequent overnight recovery. Exp. Physiol. 97, 762–773. doi:
10.1113/expphysiol.2011.063313
Sozio, P., Cerasa, L. S., Laserra, S., Cacciatore, I., Cornacchia, C., Di Filippo, E. S.,
et al. (2013). Memantine-sulfur containing antioxidant conjugates as potential
prodrugs to improve the treatment of Alzheimer’s disease. Eur. J. Pharm. Sci.
49, 187–198. doi: 10.1016/j.ejps.2013.02.013
Starkov, A. A. (1997). “Mild”uncoupling of mitochondria. Biosci. Rep. 17, 273–279.
doi: 10.1023/A:1027380527769
Sullivan-Gunn, M. J., and Lewandowski, P. A. (2013). Elevated hydrogen peroxide
and decreased catalase and glutathione peroxidase protection are associated
with aging sarcopenia. BMC Geriatr. 13:104. doi: 10.1186/1471-2318-13-104
Tam, E., Bruseghini, P., Calabria, E., Sacco, L. D., Doria, C., Grassi, B., et al.
(2015). Gokyo Khumbu/Ama Dablam Trek 2012: effects of physical training
and high-altitude exposure on oxidative metabolism, muscle composition, and
metabolic cost of walking in women. Eur. J. Appl. Physiol. doi: 10.1007/s00421-
015-3256-z. [Epub ahead of print].
Verdijk, L. B. (2014). Satellite cells activation as a critical step in skeletal muscle
plasticity. Exp. Physiol. 99, 1449–1450. doi: 10.1113/expphysiol.2014.081273
Verdijk, L. B., Snijders, T., Drost, M., Delhaas, T., Kadi, F., and van Loon, L. J.
(2014). Satellite cells in human skeletal muscle; from birth to old age. Age 36,
545–547. doi: 10.1007/s11357-013-9583-2
Xu, C., Lu, Y., Pan, Z., Chu, W., Luo, X., Lin, H., et al. (2007). The muscle-
specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis
by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes. J. Cell Sci. 120(Pt
17), 3045–3052. doi: 10.1242/jcs.010728
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
Copyright © 2015 Pietrangelo, Di Filippo, Mancinelli, Doria, Rotini, Fanò-Illic and
Fulle. This is an open-access article distributed under the terms of the Creative
Commons Attribution License (CC BY). The use, distribution or reproduction in
other forums is permitted, provided the original author(s) or licensor are credited
and that the original publication in this journal is cited, in accordance with accepted
academic practice. No use, distribution or reproduction is permitted which does not
comply with these terms.
Frontiers in Physiology | www.frontiersin.org 10 December 2015 | Volume 6 | Article 399