Effect of bovine oviductal fluid on development and quality of bovine embryos produced in vitro

Abstract

To evaluate the effect of bovine oviductal fluid (OF) supplementation during in vitro culture of bovine embryos on their development and quality, in vitro-produced zygotes were cultured in synthetic oviductal fluid (SOF; negative control; C-) supplemented with OF or 5% fetal calf serum (positive control; C+). Embryo development was recorded on Days 7-9 after insemination and blastocyst quality was assessed through cryotolerance, differential cell counting of the inner cell mass and trophectoderm, and gene expression. OF was added to the culture medium at concentrations ranging from 0.625% to 25%. The higher OF concentrations (5%, 10% and 25%) had a detrimental effect on embryo development. Lower OF concentrations (1.25% and 0.625%) supported embryo development until Day 9 (27.5%) and produced higher-quality blastocysts, as reflected by their cryotolerance (53.6% and 57.7% survival at 72 h, respectively, vs 25.9% in C+) and total cell number (mean (± s.e.m.) 165.1 ± 4.7 and 156.2 ± 4.2, respectively, vs 127.7 ± 4.9 in C- and 143.1 ± 4.9 in C+). Consistent with these data, upregulation of the water channel aquaporin 3 (AQP3) mRNA was observed in blastocysts supplemented with 1.25% OF compared with C- and C+. Serum supplementation resulted in a reduction in the expression of glucose and lipid metabolism-related genes and downregulation of the epigenetic-related genes DNA methyltransferase 3A (DNMT3A) and insulin-like growth factor 2 receptor (IGF2R). In conclusion, in vitro culture with low concentrations of OF has a positive effect on the development and quality of bovine embryos.

Full text

Effect of bovine oviductal fluid on development and quality
of bovine embryos produced in vitro
Ricaurte Lopera-Vasquez
A
,Meriem Hamdi
A
,Veronica Maillo
A
,
Valeriano Lloreda
A
,Pilar Coy
B
,Alfonso Gutierrez-Adan
A
,
Pablo Bermejo-Alvarez
A
and Dimitrios Rizos
A
,
C
A
Departamento de Reproduccio
´n Animal, Instituto Nacional de Investigacio
´n y Tecnologı´a
Agraria y Alimentaria (INIA), Ctra. de la Coruna Km 5.9, Madrid, 28040, Spain.
B
Departamento de Fisiologı´a, Facultad de Veterinaria, Universidad de Murcia, Murcia,
30071, Spain.
C
Corresponding author. Email: drizos@inia.es
Abstract. To evaluate the effect of bovine oviductal fluid (OF) supplementation during in vitro culture of bovine
embryos on their development and quality, in vitro-produced zygotes were cultured in synthetic oviductal fluid (SOF;
negative control; C

) supplemented with OF or 5% fetal calf serum (positive control; C
þ
). Embryo development was
recorded on Days 7–9 after insemination and blastocyst quality was assessed through cryotolerance, differential cell
counting of the inner cell mass and trophectoderm, and gene expression. OF was added to the culture medium
at concentrations ranging from 0.625% to 25%. The higher OF concentrations (5%, 10% and 25%) had a detrimental
effect on embryo development. Lower OF concentrations (1.25% and 0.625%) supported embryo development until
Day 9 (27.5%) and produced higher-quality blastocysts, as reflected by their cryotolerance (53.6% and 57.7% survival
at 72 h, respectively, vs 25.9% in C
þ
) and total cell number (mean (s.e.m.) 165.1 4.7 and 156.2 4.2,
respectively, vs 127.7 4.9 in C

and 143.1 4.9 in C
þ
). Consistent with these data, upregulation of the water channel
aquaporin 3 (AQP3) mRNA was observed in blastocysts supplemented with 1.25% OF compared with C

and C
þ
. Serum
supplementation resulted in a reduction in the expression of glucose and lipid metabolism-related genes and down-
regulation of the epigenetic-related genes DNA methyltransferase 3A (DNMT3A) and insulin-like growth factor 2 receptor
(IGF2R). In conclusion, in vitro culture with low concentrations of OF has a positive effect on the development and quality
of bovine embryos.
Additional keywords: embryo culture, gene expression.
Received 12 June 2015, accepted 2 September 2015, published online 14 October 2015
Introduction
According to the annual statistics collated by the International
Embryo Transfer Society, approximately 390 000 in vitro-
produced bovine embryos were transferred worldwide in 2013
(Perry 2014). Of these embryos, .90% were transferred fresh,
reflecting the fact that in vitro-produced (IVP) embryos have
lower cryotolerance than those derived in vivo.
It has been well demonstrated that the post-fertilisation
culture environment determines embryo quality and different
strategies have been developed to improve culture conditions.
Biological supplements, such as serum or bovine serum albumin
(BSA), are commonly used in culture media to improve the
suboptimal conditions. However, a paradoxical effect is evident,
with serum increasing the number of blastocysts developing
but reducing their quality (Rizos et al. 2003) and being associ-
ated with long-term effects, such as large offspring syndrome
(Lazzari et al. 2002).
When IVP bovine zygotes are cultured in vivo, for example in
the ewe oviduct, blastocysts can be produced of a quality similar
to those derived in vivo in terms of cryotolerance and gene
expression (Rizos et al. 2008). Furthermore, the significant
effect of culture conditions, in vitro or in vivo in the homologous
bovine oviduct, on the transcriptome of the embryos in relation
to embryonic genome activation has been well demonstrated
(Gad et al. 2012).
The oviduct is a dynamic organ in which fertilisation
and early embryo development occur. Studying the oviductal
environment is crucial to further our understanding of the
underlying regulatory mechanisms controlling embryo devel-
opment (Aviles et al. 2015). The advantages of the oviductal
environment have been demonstrated in different models,
through the substances isolated and the effect of environment
per se. Many physiological aspects have been clarified; however,
many others remain unknown (Hunter 2012).
CSIRO PUBLISHING
Reproduction, Fertility and Development, 2017, 29, 621–629
http://dx.doi.org/10.1071/RD15238
Journal compilation ÓCSIRO 2017 www.publish.csiro.au/journals/rfd

The oviductal environment is primarily composed of secre-
tions of oviduct epithelial cells and plasma components (Leese
et al. 2001). The use of bovine oviduct epithelial cells (BOEC)
was a major breakthrough in the in vitro culture (IVC) of bovine
embryos (Gandolfi and Moor 1987), with positive effects
on embryo development and quality (Cordova et al. 2014).
Recently, Schmaltz-Panneau et al. (2014) demonstrated that
oviductal cells modify their transcription in the presence of
developing embryos, concluding that BOEC coculture may be a
suitable model for studying the complex embryo–maternal
cross-talk in bovine species.
The composition of oviductal fluid (OF) is very complex,
containing simple and complex carbohydrates, ions, lipids,
phospholipids and proteins (Avile´s et al. 2010). Some of these
components are metabolic substrates, such as lactate, pyru-
vate, amino acids and glucose, the concentrations of which
differ from those present in the uterine fluid and serum (Leese
1988;Hugentobler et al. 2007;Leese et al. 2008). Individual
oviductal secretions have an effect on oocyte and sperm
function (Killian 2011;Monde´jar et al. 2013) and the possible
role of oviductins, osteopontin, glycodelins and lactoferrin on
gamete interaction has been described (Coy and Yanagimachi
2015;Ghersevich et al. 2015). Coy et al. (2008,2012)
demonstrated that oviduct-specific glycoprotein (OVGP) 1
and heparin-like glycosaminoglycans (GAGs) from the OF of
sows and cows participate in the functional modification of the
zona pellucida (ZP), affecting sperm–oocyte interaction and
contributing to the control of polyspermy. In addition, a
significant increase in cleavage rate and blastocyst yield has
been reported from OF-treated porcine oocytes compared with
untreated oocytes, suggesting OF protection of the embryo
against adverse effects on mitochondrial (mt) DNA transcrip-
tion or replication and apoptosis (Lloyd et al. 2009). In
contrast, in cattle, oocyte exposure to OF before fertilisation
had no effect on embryo development and morphological
characteristics of the resulting blastocysts (Cebrian-Serrano
et al. 2013). However, differences appear in the transcriptome
of the embryos produced from oocytes previouslytreated with
OF compared with controls (Cebrian-Serrano et al. 2013).
It is clear then that there is a need to improve IVC conditions
and adapt strategies based on conditions in vivo to enhance
embryo development. In addition, in vitro techniques permit
the study of physiological processes under specific conditions,
which are difficult to assess in vivo. To our knowledge, no
evidence of any developmental consequences of bovine OF
supplementation during post-fertilisation embryo culture in vitro
exists. Thus, the aim of the present study was to evaluate the
effect of OF supplementation during IVC on bovine embryo
development and embryo quality.
Materials and methods
Unless stated otherwise, all chemicals were purchased from
Sigma Aldrich Quı´mica (Madrid, Spain).
Oocyte collection and IVM
Immature cumulus–oocyte complexes (COCs) were obtained
by aspirating follicles (2–8 mm diameter) from the ovaries of
mature heifers and cows collected at slaughter. COCs were
matured for 24 h in 500 mL maturation medium (TCM 199–
M4530 supplemented with 10% (v/v) fetal calf serum (FCS)
and 10 ng mL
1
epidermal growth factor (E4127)) in a four-well
dish, in groups of 50 COCs per well at 38.58C under an atmo-
sphere of 5% CO
2
in air, with maximum humidity.
Sperm preparation and IVF
Frozen semen straws (0.25 mL) from a single Asturian Valley
bull were thawed at 378C in a water bath for 1 min and cen-
trifuged for 5 min at 280gthrough a gradient of 1 mL of 40%
Bovipure (Nidacon Laboratories AB, Go¨thenborg, Sweden)
and 1 mL of 80% Bovipure according to the manufacturer’s
instructions. The sperm pellet was isolated and washed in 3 mL
Boviwash (Nidacon Laboratories AB) by centrifugation at 280g
for 5 min. The pellet was resuspended in the remaining 300 mL
Boviwash. Sperm concentration was determined and adjusted to
a final concentration of 1 10
6
sperm mL
1
for IVF. Gametes
were coincubated for 18–22 h in 500 mL fertilisation medium
(Tyrode’s medium with 25 mM bicarbonate, 22 mM Na-lactate,
1 mM Na-pyruvate and 6 mg mL
1
fatty acid-free BSA sup-
plemented with 10 mg mL
1
heparin sodium salt; Calbiochem,
San Diego, CA, USA) in a four-well dish, in groups of 50 COCs
per well under an atmosphere of 5% CO
2
in air, with maximum
humidity at 38.58C.
Collection of OF
OF samples (NaturArts BOF-EL) were purchased from
Embryocloud, Murcia, Spain (http://www.embryocloud.com).
Specifically, NaturArts BOF-EL was used in the experiments.
As described on the company website, oviducts ipsilateral to
the corpus luteum were collected from ovaries of slaughtered
heifers at the early luteal phase of the oestrous cycle (Ireland
et al. 1980). Oviducts were transported on ice, washed twice in
cold phosphate-buffered saline (PBS) and then transferred to a
stainless steel tray on a bed of ice and straightened by trimming
accessory ligaments. OF was collected according to the protocol
of Carrasco et al. (2008). Each oviduct was squeezed gently
from the uterotubal junction towards the ampulla and the con-
tents were collected by aspiration from the infundibulum using a
200-mL automatic pipette. A mean volume of approximately
10–30 mL per oviduct was collected and a pool of OF from five
oviducts was centrifuged at 7000gfor 10 min at 48C to remove
cellular debris. The supernatant was aliquoted and stored at
808C until use.
IVC of presumptive zygotes
At approximately 20 h post insemination (h.p.i.), presumptive
zygotes were denuded of cumulus cells by vortexing for 3 min
and then cultured in groups of 25 in 25-mL droplets of culture
medium (synthetic oviductal fluid (SOF); negative control
(C

); Holm et al. 1999) with 4.2 mM sodium lactate (L4263),
0.73 mM sodium pyruvate (P4562), 30 mLmL
1
BME amino
acids (B6766), 10 mLmL
1
minimum essential medium (MEM)
amino acids (M7145) and 1 mgmL
1
phenol red (P0290) under
mineral oil at 38.58C under an atmosphere of 5% CO
2
,5%O
2
622 Reproduction, Fertility and Development R. Lopera-Vasquez et al.

and 90% N
2
. Depending on the experiment (see below), SOF
was supplemented with 5% FCS (positive control; C
þ
) or with
different concentrations of bovine OF.
Assessment of embryo development and quality
Embryo development
Cleavage rate was recorded at Day 2 (48 h.p.i.) and cumula-
tive blastocyst yield was recorded at Days 7, 8, and 9 after
insemination.
Embryo quality: blastocyst vitrification
The ability of the blastocyst to withstand cryopreservation
was used as a quality indicator. Day 7 and 8 blastocysts and
expanding blastocysts were vitrified in holding medium (HM;
TCM 199 supplemented with 20% (v/v) FCS) and cryoprotec-
tants, following the procedures of Rizos et al. (2002b),ina
two-step protocol using the Cryoloop device (Hampton
Research, Aliso Viejo, CA, USA). The first step consisted of
HM with 7.5% ethylene glycol and 7.5% dimethyl sulfoxide
(DMSO), whereas the second step (final solution) was consisted
of HM with 16.5% ethylene glycol, 16.5% DMSO and 0.5 M
sucrose. The blastocysts were warmed in two steps in HM with
0.25 and 0.15 M sucrose and then cultured in 25-mL droplets of
SOF with 5% FCS. Survival was defined as re-expansion of the
blastocoel and its maintenance for 24, 48 and 72 h.
Differential staining of blastocysts
Differential staining of inner cell mass (ICM) and trophec-
toderm (TE) cells was performed according to the procedures of
Thouas et al. (2001). Day 8 expanded blastocysts were permea-
bilised and TE cells were stained by incubation in 500 mL PBS
with 0.2% Triton X-100 and 100 mgmL
1
propidium iodide (PI)
in the dark for 60 s at 378C. For fixation and ICM staining,
blastocysts were transferred to 500 mL absolute ethanol with
25 mgmL
1
bisbenzimide (Hoechst 33342) for 3 min. Fixed and
stained blastocysts were transferred to glycerol and mounted on
glass microscope slides, gently flattened with a coverslip and
visualised for cell counting under a fluorescent microscope.
Gene expression analysis
Gene expression analysis was performed using four groups
of 10 Day 8 expanding blastocysts per treatment group, namely
C

(SOF), OF (SOF supplemented with 1.25% oviductal fluid;
selected based on developmental and cryotolerance data)
and C
þ
(SOF supplemented with 5% FCS). Poly(A) RNA was
extracted using the Dynabeads mRNA Direct Extraction
Kit (Dynal Biotech, Oslo, Norway) with minor modifications
(Bermejo-A
´lvarez et al. 2008). Immediately after extraction, the
reverse transcription (RT) reaction was performed according to
the manufacturer’s instructions (Bioline, Ecogen, Madrid,
Spain) using poly(T) primer, random primers and Moloney
Murine Leukemia Virus (MMLV) reverse transcriptase. Tubes
were heated to 708C for 5 min to denature the secondary RNA
structure and then the RT mix was completed with the addition
of 50 units reverse transcriptase. Samples were incubated at
428C for 60 min to allow the RT of RNA, followed by incubation
at 708C for 10 min to denature the RT enzyme. All mRNA
transcripts were quantified using quantitative polymerase chain
reaction (qPCR) with two replicates for all genes of interest.
The qPCR was performed by adding a 2-mL aliquot of
each cDNA sample to the PCR mix containing the specific
primers to amplify transcripts for histone H2A histone family,
member Z (H2AFZ), solute carrier family 2 (facilitated glucose
transporter) member 1 (SCL2A1; previously known as GLUT1),
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), lactate
dehydrogenase A (LDHA), low-density lipoprotein receptor
(LDLR), cytochrome P450 family 51 (CYP51), fatty acid desa-
turase 1 (FADS1), DNA methyltransferase 3A (DNMT3A),
insulin-like growth factor 2 receptor (IGF2R), ubiquitin-
conjugating enzyme E2A (UBE2A) and aquaporin 3 (AQP3).
Primer sequences and the approximate sizes of the amplified
fragments of all transcripts are given in Table 1. For quantifica-
tion, qPCR was performed as described previously (Bermejo-
Alvarez et al. 2010a). The PCR conditions were tested to
achieve efficiencies close to 1. The comparative cycle threshold
(CT) method was used to quantify expression levels. Values
were normalised against the endogenous control H2AFZ. Fluo-
rescence was acquired in each cycle to determine the threshold
cycle or the cycle during the log-linear phase of the reaction at
which fluorescence increased above background for each sam-
ple. Within this region of the amplification curve, a difference of
one cycle is equivalent to a doubling of the amplified PCR
product. According to the comparative CT method, the DCT
value was determined by subtracting the H2AFZ CT value for
each sample from each gene CT value of the sample. The
calculation of DDCT involved using the highest treatment
DCT value (i.e. the treatment with the lowest target expression)
as an arbitrary constant to subtract from all other DCT sample
values. Fold changes in the relative gene expression of the target
were determined using the formula 2
DDCT
.
Experimental design
The developmental capacity and quality of bovine zygotes
cultured in vitro with SOF without FCS supplemented with
different concentrations of OF was assessed. In a preliminary
experiment, embryo culture with concentrations of 5%, 10%
and 25% OF was found to be detrimental for embryo develop-
ment, with blastocysts yields of 11%, 10% and 1% on Day 9,
respectively. Therefore, these concentrations were not used in
subsequent experiments. Thus, at 20 h.p.i., presumptive zygotes
were cultured in SOF with (C
þ
;n¼872) or without (C

;
n¼927) 5% FCS or in SOF without FCS supplemented with
2.5% (n¼855), 1.25% (n¼964) or 0.625% OF (n¼1011).
Overall cleavage rate was recorded at 48 h.p.i. and blastocyst
development was recorded on Days 7, 8 and 9 after insemina-
tion. To assess blastocyst quality, a representative number of
Day 7–8 blastocysts from each group were either: (1) vitrified–
warmed (n¼78–91 per group), with survival rate recorded
every 24 h up to 72 h after warming, and fixed for differential
cell counts (n¼40 per group); or (2) frozen in liquid nitrogen
(LN
2
;n¼40 per group) in groups of 10 and stored at 808C for
gene expression analysis. Eleven replicates were performed.
Bovine oviductal fluid in in vitro embryo culture Reproduction, Fertility and Development 623

Statistical analysis
Data relating to cleavage rate, blastocyst yield and survival
after vitrification–warming and relative mRNA abundance were
analysed using one-way analysis of variance (ANOVA), with
two-sided P,0.05 considered significant. Embryo cell number
(ICM, TE and the ICM : TE ratio) was analysed by multiple pair-
wise comparisons using t-tests. All analyses were performed
using SigmaStat (Jandel Scientific, San Rafael, CA, USA).
Results
As noted above, supplementation of the culture medium with
5%, 10% and 25% OF was detrimental for embryo development,
with blastocyst yields of 11%, 10% and 1% on Day 9, respec-
tively, all of which were significantly lower than in the control
groups. Therefore, these concentrations of OF were not used in
subsequent experiments.
No differences were observed in cleavage rate between both
control groups and the OF groups (range 86.7%–89.1%). Blas-
tocyst yield on Day 7 was higher for the C
þ
group compared
with all other groups, whereas that in the 1.25% and 0.625% OF
groups was significantly higher than in the C

group (Table 2).
On Day 8, no differences were observed in blastocyst yield
between the C
þ
and 1.25% OF groups. However, culture with
1.25% or 0.625% OF resulted in more blastocysts than in the
C

group (Table 2). On Day 9, the blastocyst yield for the 1.25%
Table 2. Effect of in vitro embryo culture with low concentrations of bovine oviductal fluid (OF) on development in vitro
Within columns, values with different superscript letters differ significantly (P,0.05). No. PZ, total number of presumptive zygotes placed in culture;
C

, negative control, cultured in the presence of synthetic oviductal fluid (SOF); C
þ
, positive control, cultured in the presence of SOF þ5% fetal calf serum
No. PZ Cleavage Blastocyst yield
nMean s.e.m. (%) Day 7 Day 8 Day 9
nMean s.e.m. (%) nMean s.e.m. (%) nMean s.e.m. (%)
C
þ
872 747 86.7 1.5 198 22.9 1.2
a
226 26.6 1.2
a
236 27.7 1.9
a
C

927 823 88.8 1.2 96 12.0 1.7
c
164 18.3 1.2
c
195 21.5 1.4
b
OF
2.5% 855 748 87.3 1.1 110 13.9 1.4
bc
180 21.2 1.4
bc
192 22.7 1.5
b
1.25% 964 855 89.1 1.5 163 17.4 1.5
b
236 24.4 1.7
ab
266 27.5 1.7
a
0.625% 1011 898 89.1 1.3 160 16.0 1.2
b
230 22.3 1.0
b
279 27.5 1.2
a
Table 1. Primers used for reverse transcription–quantitative polymerase chain reaction
H2AFZ, H2A histone family, member Z; SCL2A1, solute carrier family 2 (facilitated glucose transporter) member 1; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; LDHA, lactate dehydrogenase A; LDLR, low-density lipoproteinreceptor; CYP51, cytochrome P450 family 51; FADS1, fatty acid desaturase 1;
DNMT3A, DNA methyltransferase 3A; IGF2R, insulin-like growth factor 2 receptor; UBE2A, ubiquitin-conjugating enzyme E2A; AQP3, aquaporin 3
Gene Primer sequence (50–30) Fragment size (bp) GenBank Accession no.
H2A.Z Forward: AGGACGACTAGCCATGGACGTGTG 212 NM_016750
Reverse: CCACCACCAGCAATTGTAGCCTTG
SCL2A1 Forward: CTGATCCTGGGTCGCTTCAT 68 NM_174602.2
Reverse: ACGTACATGGGCACAAAACCA
GAPDH Forward: ACCCAGAAGACTGTGGATGG 247 BC102589
Reverse: ATGCCTGCTTCACCACCTTC
LDHA Forward: TTCTTAAGGAAGAACATGTC 310 NM_174099.2
Reverse: TTCACGTTACGCTGGACCAA
LDLR Forward: CAAAACCCCGATCATCCCCA 194 NM_001166530
Reverse: TCGACCCTGAACTGGAAACG
CYP51 Forward: GGCCCAADDTDATTTCCATTTC 167 BC149346.1
Reverse: CTCCCAAGAAACCCTGCACTGG
FADS1 Forward: GCTGCCCAATCTGAGCAAAGC 208 Bt.4959.1.A1_at
Reverse: TCCTGTCATGGTGTGGGTCCTG
DNMT3A Forward: CTGGTGCTGAAGGACTTGGGC 318 AY271299
Reverse: CAGAAGAAGGGGCGGTCATC
IGF2R Forward: GCTGCGGTGTGCCAAGTGAAAAAG 201 NM_174352.2
Reverse: AGCCCCTCTGCCGTTGTTACCT
UBE2A Forward: GGGCTCCGTCTGAGAACAACATC 336 XM_864331
Reverse: CATACTCCCGCTTGTTCTCCTGG
AQP3 Forward: CGGTGGTTTCCTCACCATCA 299 NM_001079794.1
Reverse: CAGAGGGGTAGGTGGCAAAG
624 Reproduction, Fertility and Development R. Lopera-Vasquez et al.

and 0.625% OF groups was similar to that in the C
þ
group, but
significantly higher than in the C

and 2.5% OF groups, as
indicated in Table 2.
The survival rate of vitrified–warmed blastocysts produced
in the C

and 0.625% OF groups was significantly higher than in
the 2.5% OF and C
þ
groups at 24 h (Table 3), but was not
different from that in the 1.25% OF group. At 48 and 72 h, the
survival rate of blastocysts cultured in 1.25% and 0.625% OF
and in the C

group was higher than that of blastocysts in the
2.5% OF and C
þ
groups (Table 3).
Total cell number in the C

group was significantly lower
than in all other groups (Table 4), whereas for total cell number
in the 1.25% and 0.625% OF groups was significantly higher
than in the C
þ
and C

groups (Table 4). The number of TE cells
in embryos cultured with 1.25% and 0.625% OF was signifi-
cantly higher than in the C
þ
and C

groups (Table 4). Blas-
tocysts from the C

group had a significantly lower number of
cells in the ICM compared with all other groups (Table 4).
The expression of three genes related to glucose metabolism
(SCL2A1,GAPDH and LDHA), three genes related to lipid
metabolism (LDLR,CYP51 and FADS1), three genes related
to epigenetics (DNMT3A,IGF2R and UBE2A) and AQP3 was
determined in blastocysts cultured in C
þ
,C

or C

þ1.25% OF
(Fig. 1). Overall, the C

and OF groups showed no differences in
the expression levels of the 10 genes analysed, except for AQP3
expression, which was significantly upregulated (P,0.05) in
the OF compared with the other two groups. Expression of
SCL2A1 was significantly upregulated (P,0.05) in both groups
cultured without serum, whereas GAPDH expression levels
were significantly higher (P,0.05) in the C

than C
þ
group,
with no differences observed for LDHA. Of the genes related
to lipid metabolism, LDLR was significantly upregulated
(P,0.05) in the OF compared with C
þ
group, and the expres-
sion of CYP51 and FADS1 was significantly higher (P,0.05)
in both groups cultured without serum (C

and OF). Finally,
both DNMT3A and IGF2R were significantly upregulated
(P,0.05) in both groups cultured without serum compared
with the C
þ
group, whereas the expression of UBE2A did not
differ among groups.
Discussion
Over the past two decades, a considerable amount of research
has focused on the quality improvement of IVP blastocysts,
which lags behind that of their in vivo counterparts. Studies
using the ‘oviduct’ as an intermediate host for embryo culture
highlighted that the fundamental part of the process responsible
for suboptimal embryo quality is the period after fertilisation
(Rizos et al. 2010). Moreover, any modification of the IVC
conditions can have a significant effect on the normality of
the embryo. Thus, in an attempt to mimic conditions in vivo,we
studied the effect of the presence of bovine OF during in vitro
embryo culture on the developmental competence and quality
of the blastocysts produced. Our findings indicate a positive
effect of OF supplementation at low concentrations (1.25% and
0.625%) as a replacement for serum during embryo culture, with
Table 3. Survival rates after vitrification and warming of Day 7–8 blastocysts cultured with low concentrations of bovine oviductal fluid (OF)
Within columns, values with different superscript letters differ significantly (P,0.05). C

, negative control, cultured in the presence of synthetic oviductal
fluid (SOF); C
þ
, positive control, cultured in the presence of SOF þ5% fetal calf serum
No. blastocysts vitrified Blastocyst survival after vitrification–warming
4 h 24 h 48 h 72 h
nMean s.e.m. (%) nMean s.e.m. (%) nMean s.e.m. (%) nMean s.e.m. (%)
C
þ
91 75 84.6 2.6
a
35 41.3 4.5
a
26 30.3 2.5
a
22 25.9 2.3
a
C

84 80 95.8 1.8
c
63 74.1 4.1
c
51 59.3 3.2
b
48 56.1 2.9
b
OF
2.5% 85 75 88.4 3.7
abc
49 58.7 4.9
b
32 39.2 4.9
a
30 36.1 4.7
a
1.25% 78 68 86.9 2.0
ab
50 63.1 3.8
bc
47 61.3 2.1
b
41 53.6 1.7
b
0.625% 82 79 95.5 2.4
c
62 71.7 6.4
c
51 61.6 4.1
b
48 57.7 3.8
b
Table 4. Effect of in vitro embryo culture with low concentrations of bovine oviductal fluid (OF) on blastocyst cell number
Data are the mean s.e.m. Within columns, values with different superscript letters differ significantly (P,0.05). C

, negative control, cultured in the
presence of synthetic oviductal fluid (SOF); C
þ
, positive control, cultured in the presence of SOF þ5% fetal calf serum; ICM, inner cell mass;
TE, trophectoderm
No. blastocysts processed Total nuclei No. ICM nuclei ICM (%) No. TE nuclei TE (%) Ratio ICM : TE
C
þ
40 143.1 4.9
a
36.0 1.4
a
25.6 0.9 107.1 4.3
a
74.4 0.9 0.35 0.02
C

40 127.7 4.9
b
31.1 1.4
b
24.9 1.1 96.6 4.6
a
75.1 1.1 0.34 0.02
OF
2.5% 40 150.2 7.1
ac
37.1 1.6
a
25.8 1.1 113.1 6.8
ab
74.2 1.1 0.36 0.02
1.25% 40 165.1 4.7
d
38.0 1.5
a
23.5 0.9 127.1 4.5
c
76.5 0.9 0.31 0.02
0.625% 40 156.2 4.2
cd
36.2 1.3
a
23.4 0.8 119.9 3.7
bc
76.6 0.8 0.31 0.01
Bovine oviductal fluid in in vitro embryo culture Reproduction, Fertility and Development 625

an increase in developmental rates and better quality embryos in
terms of survival after vitrification and warming, cell number
and gene expression patterns.
The oviduct is the anatomical part of the reproductive tract
where fertilisation and early embryo development take place,
and it provides an optimal environment for gametes and early
embryos to develop (Hunter 2012). Critical events, such as
sperm storage, capacitation, sperm release and transport, final
oocyte maturation, fertilisation, early embryo development
and embryo transport to the uterus, occur in the oviduct. These
sequential events require a dynamic and synchronised support
system by the oviduct in order to occur successfully (Aguilar and
Reyley 2005). In the oviductal milieu, molecular mechanisms
and pathways represent the first signal exchange between the
maternal environment and the embryo (Besenfelder et al. 2012).
This milieu is comprised of the secretions of oviduct epithelial
cells and from blood plasma, and is represented in the OF
(Ellington 1991).
Most media used for in vitro embryo culture (e.g. SOF;
Holm et al. 1999) have been designed based on the ion, energy
substrate and amino acid composition of OF (Leese et al. 2008).
However, the optimisation of an IVC environment that contains
all the substances present in the oviduct regions may resolve part
of the major limitations present during embryo culture, allowing
the production of embryos at comparable rates and of compara-
ble quality to those that occur in vivo. Thus, by mimicking in
vivo conditions using animal models, we could improve ARTs
applied to both domestic species and humans.
Exposure of mature pig and cow oocytes to pure OF for a
short period of time (30 min) before fertilisation has been used
to improve zona hardening, reduce polyspermy and improve
embryo quality (Coy et al. 2008;Cebrian-Serrano et al. 2013).
To our knowledge, the present study is the first to assess the
effect of OF during the embryo culture period in a medium
without serum on embryo development and embryo quality.
When the medium was supplemented with a high concentration
of OF, a negative effect on blastocyst development was evident
(7% at Day 7). This may reflect the continuous renewal of OF in
the oviduct in vivo as the reproductive tract modifies its activity
in order to provide the optimal environment for the development
of the embryo (Buhi 2002), whereas in vitro it degraded with
a negative effect on the embryo. Gradual decreases in OF con-
centration (2.5%, 1.25% and 0.625%) diminish the detrimental
effects and improve embryo development rates.
Consistent with our previous reports (Rizos et al. 2003), we
observed that the presence of serum had a stimulatory effect on
the speed of embryo development and on blastocyst yield.
However, the effect of serum is detrimental to embryo cryo-
tolerance and gene expression (Rizos et al. 2008) and has been
linked to postnatal consequences for the offspring, such as large
offspring syndrome (Lazzari et al. 2002). Replacement of serum
with OF in the culture medium had a stimulatory effect on
blastocyst yield, as observed with serum, but had the added
benefit of improving embryo quality.
As mentioned before, the culture environment during
embryo development has an effect on embryo quality in terms
of cryotolerance (Rizos et al. 2002b,2008), ultrastructural
morphology (Fair et al. 2001), embryo cell number (Trigal
et al. 2011) and gene expression (Rizos et al. 2002a;Wrenzycki
et al. 2007). In the present study, we found that replacing serum
with 1.25% or 0.625% OF doubled embryo cryotolerance
compared with culture with serum. Conversely, embryos
2.0
aa
a
ab
ab
a
a
b
bbbb
bb
a
a
b
a
a
a
a
a
a
a
1.8
1.6
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0
SCL2A1 GAPDH LDHA LDLR CYP51 FADS1 DNMT3A IGF2R UBE2A AQP3
C⫺
OF
C⫹
Fig. 1. Relative mRNA abundance (normalised against that of the housekeeping gene H2A histone family,
member Z (H2AFZ)) of genes related with glucose metabolism (SCL2A1, solute carrier family 2 (facilitated
glucose transporter) member 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LDHA, lactate dehy-
drogenase A), lipid metabolism (LDLR, low-density lipoprotein receptor; CYP51, cytochrome P450 family 51;
FADS1, fatty acid desaturase 1), epigenetics (DNMT3A, DNA methyltransferase 3A; IGF2R, insulin-like
growth factor 2 receptor; UBE2A, ubiquitin-conjugating enzyme E2A) and water channels (AQP3, aquaporin 3)
in bovine in vitro blastocysts (Day 7) cultured with a low concentration (1.25%) of bovine oviductal fluid (OF).
C

, negative control, cultured in the presence of synthetic oviducal fluid (SOF); C
þ
, positive control, cultured in
the presence of SOF þ5% fetal calf serum. Data are the mean s.e.m. Columns with different letters differ
significantly within each gene group (P,0.05).
626 Reproduction, Fertility and Development R. Lopera-Vasquez et al.

cultured with 1.25% OF had a higher number of total cells and
TE cells compared with embryos cultured with serum and the
no-serum control group. ICM cell number did not differ between
OF groups and serum control, but was higher than in the no-
serum control. It has been shown that embryo quality deter-
mined by blastocyst total cell number, ICM and the ICM : TE
ratio is an important index of embryo survival and pregnancy
rate after embryo transfer (Fleming et al. 2004). Moreover, the
trophoblast cells play a crucial role in pregnancy establishment
when intense trophoblast proliferation begins together with
increased trophoblast secretion of the pregnancy recognition
factor interferon-t(Ealy and Yang 2009). Therefore, tropho-
blast cells have an essential role in implantation and placenta-
tion. The increased proliferation of these cells is likely to have a
positive effect on pregnancy rate. The positive effect of OF on
embryo development and quality could be attributed to the
oviductal embryotrophic secretions that are absent in defined
and serum-supplemented media. Ballester et al. (2014) pro-
posed OF and/or uterine fluid supplementation as a challenge
for improving the IVC environment. However, it is important
to note that many aspects of the oviductal environment remain
unclear.
Of the OF fluid components that may play a beneficial role in
embryo development, oviduct-specific glycoproteins, specifi-
cally OVGP1, have been shown to play a critical role during
porcine fertilisation in sperm–ZP binding (Coy et al. 2008) and
ZP hardening (Monde´jar et al. 2013). Martus et al. (1997) also
demonstrated a positive effect on fertilisation rates when
OVGP1 was used before or during the fertilisation process.
Thus, OVGPs may have a specific function on early embryo
developmental events.
Recently, Cebrian-Serrano et al. (2013) evaluated the effect
of a short incubation of mature oocytes with OF before fertilisa-
tion on early embryo development and quality. No effect on
embryo development was found; however, embryos derived
from OF preincubation showed modification of glucose-
6-phosphate dehydrogenase (G6PD) and superoxide dismutase
32 (SOD32) transcripts. Similarly, IVM porcine oocytes exposed
to bovine OF for 30 min before fertilisation had increased blasto-
cyst rates and embryo cell numbers, and the gene expression
patterns of apoptotic and developmentally related genes were
modified (Lloyd et al. 2009).
Gene expression analysis in the present study suggested
that glucose and lipid metabolism is affected by the addition
of serum to the culture medium. In particular, expression of the
glucose transporter SCL2A1 and the enzyme GAPDH, whose
expression levels are related to anaerobic glycolysis during
preimplantation development (Bermejo-A
´lvarez et al. 2010b),
was lower in the C
þ
compared with C

group, suggesting
reduced glucose metabolism in embryos cultured in the presence
of serum. LDLR, downregulated in the C
þ
compared with
OF group, has been reported to be downregulated in embryos
derived from obese mice, where it may act as a regulator of lipid
uptake (Bermejo-Alvarez et al. 2012). Thus, the downregulation
of LDLR in the C
þ
group may be a response to an excessive
amount of lipids in the C
þ
medium. Another two genes related
to lipid metabolism (CYP51 and FADS1) were upregulated in
the C

and OF groups compared with the C
þ
group. Both genes
were reported to be upregulated in in vitro-derived blastocysts
compared with their in vivo counterparts (Clemente et al. 2011),
which may indicate that C
þ
conditions are closer to the in vivo
situation than C

or OF, and therefore of better quality.
However, the differences in metabolite use between in vivo
and in vitro embryos should preclude direct extrapolation from
the comparison of in vivo versus in vitro to good- versus poor-
quality embryos (Sturmey et al. 2010). Both CYP51 and FADS1
are involved in the synthesis of molecules required for mem-
brane formation: CYP51 is required for sterol biosynthesis
(Lepesheva and Waterman 2004), whereas FADS1 is involved
in the unsaturation of fatty acids (de Antueno et al. 2001), key
molecules in the regulation of membrane fluidity and thereby
related to survival after vitrification, which was higher in the C

and OF groups than in the C
þ
group. Similarly, AQP3 expres-
sion was higher in the presence of OF compared with the C
þ
and
C

groups. The AQPs are water channel proteins that have been
suggested to play an important role in cryopreservation. The
artificial expression of AQP3 in mouse oocytes (Edashige et al.
2003) improved survival after cryopreservation and AQP3 has
been proposed as a major water and cryoprotectant transporter
in bovine morulae (Jin et al. 2011). Finally, the de novo DNA
methyltransferase DNMT3A and the imprinted gene IGF2R
were downregulated in the C
þ
group compared with the other
two groups. These transcriptional changes are compatible with
previous molecular observations of the large offspring syn-
drome caused by suboptimal IVC conditions. In particular, loss
of methylation in the differentially methylated region 2 of
IGF2R was associated with an increase in IGF2R transcription
and fetal overgrowth (Young et al. 2001).
In conclusion, the results of the present study indicate that
the presence of low concentrations of OF in serum-free culture
medium of bovine embryos has a positive effect on embryo
development and the quality of the resulting blastocysts,
increasing their cryotolerance and the number of TE cells and
modifying the relative abundance of developmentally important
gene transcripts, including imprinted genes.
Acknowledgements
This study was supported by the grants from the Spanish Ministry of
Economy and Competitiveness (DR: AGL2012-37510; AGA: AGL2012-
39652-C02–01), Ramon y Cajal (RYC-2012-10193 to PBA) and an FPI
scholarship (BES-2010-031873 to RLV). The authors thank Carolina Nun
˜ez
and Paula Beltra´ n for their excellent laboratory assistance and the Spanish
Association of Breeders of Selected Cattle of the Asturian Valley Breed
(ASEAVA) for providing the semen used in this study. The authors thank Pat
Lonergan for his comments on and English revision of this article.
References
Aguilar, J., and Reyley, M. (2005). The uterine tubal fluid: secretion,
composition and biological effects. Anim. Reprod. 2, 91–105.
Avile´s, M., Gutie´rrez-Ada´n, A., and Coy, P. (2010). Oviductal secretions:
will they be key factors for the future ARTs? Mol. Hum. Reprod. 16,
896–906. doi:10.1093/MOLEHR/GAQ056
Aviles, M., Coy, P., and Rizos, D. (2015). The oviduct: a key organ for
the success of early reproductive events. Anim. Front. 5, 25–31.
doi:10.2527/AF.2015-0005
Ballester, L., Romero-Aguirregomezcorta, J., Soriano-U
´beda, C., Mata´s, C.,
Romar, R., and Coy, P. (2014). Timing of oviductal fluid collection,
Bovine oviductal fluid in in vitro embryo culture Reproduction, Fertility and Development 627

steroid concentrations, and sperm preservation method affect porcine
in vitro fertilization efficiency. Fertil. Steril. 102, 1762–1768.e1.
doi:10.1016/J.FERTNSTERT.2014.08.009
Bermejo-A
´lvarez, P., Rizos, D., Rath, D., Lonergan, P., and Gutierrez-Adan,
A. (2008). Epigenetic differences between male and female bovine
blastocysts produced in vitro.Physiol. Genomics 32, 264–272.
doi:10.1152/PHYSIOLGENOMICS.00234.2007
Bermejo-Alvarez, P., Rizos, D.,Rath, D., Lonergan, P.,and Gutierrez-Adan,A.
(2010a). Sex determines the expression level of one third of the actively
expressed genes in bovine blastocysts. Proc. Natl Acad. Sci. USA 107,
3394–3399. doi:10.1073/PNAS.0913843107
Bermejo-A
´lvarez, P., Lonergan, P., Rizos, D., and Gutie´ rrez-Adan, A.
(2010b). Low oxygen tension during IVM improves bovine oocyte
competence and enhances anaerobic glycolysis. Reprod. Biomed. Online
20, 341–349. doi:10.1016/J.RBMO.2009.12.006
Bermejo-Alvarez, P., Rosenfeld, C. S., and Roberts, R. M. (2012). Effect of
maternal obesity on estrous cyclicity, embryo development and blasto-
cyst gene expression in a mouse model. Hum. Reprod. 27, 3513–3522.
doi:10.1093/HUMREP/DES327
Besenfelder, U., Havlicek, V., and Brem, G. (2012). Role of the oviduct
in early embryo development. Reprod. Domest. Anim. 47, 156–163.
doi:10.1111/J.1439-0531.2012.02070.X
Buhi, W. C. (2002). Characterization and biological roles of oviduct-
specific, oestrogen-dependent glycoprotein. Reproduction 123, 355–362.
doi:10.1530/REP.0.1230355
Carrasco, L. C., Coy, P., Avile´s, M., Gadea, J., and Romar, R. (2008).
Glycosidase determination in bovine oviducal fluid at the follicular and
luteal phases of the oestrous cycle. Reprod. Fertil. Dev. 20, 808–817.
doi:10.1071/RD08113
Cebrian-Serrano, A., Salvador, I., Garcı´a-Rosello´ , E., Pericuesta, E., Pe´rez-
Cerezales, S., Gutierrez-Ada´n, A., Coy, P., and Silvestre, M. (2013).
Effect of the bovine oviductal fluid on in vitro fertilization, development
and gene expression of in vitro-produced bovine blastocysts. Reprod.
Domest. Anim. 48, 331–338. doi:10.1111/J.1439-0531.2012.02157.X
Clemente, M., Lopez-Vidriero, I., O’Gaora, P., Mehta, J. P., Forde, N.,
Gutierrez-Adan, A., Lonergan, P., and Rizos, D. (2011). Transcriptome
changes at the initiation of elongation in the bovine conceptus. Biol.
Reprod. 85, 285–295. doi:10.1095/BIOLREPROD.111.091587
Cordova, A., Perreau, C., Uzbekova, S., Ponsart, C., Locatelli, Y., and
Mermillod, P. (2014). Development rate and gene expression of IVP
bovine embryos cocultured with bovine oviduct epithelial cells at
early or late stage of preimplantation development. Theriogenology
81, 1163–1173. doi:10.1016/J.THERIOGENOLOGY.2014.01.012
Coy, P., and Yanagimachi, R. (2015). Common and species-specific roles of
oviductal proteins in mammalian fertilization and embryo development.
Bioscience. doi:10.1093/BIOSCI/BIV119
Coy, P., Ca´novas, S., Monde´jar, I., Saavedra, M. D., Romar, R., Grullo´ n, L.,
Mata´s, C., and Avile´s, M. (2008). Oviduct-specific glycoprotein and
heparin modulate sperm–zona pellucida interaction during fertilization
and contribute to the control of polyspermy. Proc. Natl Acad. Sci. USA
105, 15 809–15 814. doi:10.1073/PNAS.0804422105
Coy, P., Garcı´a-Va´zquez, F. A., Visconti, P. E., and Avile´s, M. (2012). Roles
of the oviduct in mammalian fertilization. Reproduction 144, 649–660.
doi:10.1530/REP-12-0279
de Antueno, R. J., Knickle, L. C., Smith, H., Elliot, M. L., Allen, S. J.,
Nwaka, S., and Winther, M. D. (2001). Activity of human D5 and D6
desaturases on multiple n-3 and n-6 polyunsaturated fatty acids. FEBS
Lett. 509, 77–80. doi:10.1016/S0014-5793(01)03135-0
Ealy, A. D., and Yang, Q. E. (2009). Review article: control of interferon-tau
expression during early pregnancy in ruminants. Am. J. Reprod. Immu-
nol. 61, 95–106. doi:10.1111/J.1600-0897.2008.00673.X
Edashige, K., Yamaji, Y., Kleinhans, F. W., and Kasai, M. (2003). Artificial
expression of aquaporin-3 improves the survival of mouse oocytes after
cryopreservation. Biol. Reprod. 68, 87–94. doi:10.1095/BIOLREPROD.
101.002394
Ellington, J. E. (1991). The bovine oviduct and its role in reproduction:
a review of the literature. Cornell Vet. 81, 313–328.
Fair, T., Lonergan, P., Dinnyes, A., Cottell, D. c., Hyttel, P., Ward, F. a., and
Boland, M. p. (2001). Ultrastructure of bovine blastocysts following
cryopreservation: effect of method of blastocyst production. Mol. Reprod.
Dev. 58, 186–195. doi:10.1002/1098-2795(200102)58:2,186::AID-
MRD8.3.0.CO;2-N
Fleming, T. P., Kwong, W. Y., Porter, R., Ursell, E., Fesenko, I., Wilkins, A.,
Miller, D. J., Watkins, A. J., and Eckert, J. J. (2004). The embryo and its
future. Biol. Reprod. 71, 1046–1054. doi:10.1095/BIOLREPROD.104.
030957
Gad, A., Hoelker, M., Besenfelder, U., Havlicek, V., Cinar, U., Rings, F.,
Held, E., Dufort, I., Sirard, M.-A., Schellander, K., and Tesfaye, D.
(2012). Molecular mechanisms and pathways involved in bovine embry-
onic genome activation and their regulation by alternative in vivo and
in vitro culture conditions. Biol. Reprod. 87, 100. doi:10.1095/BIOL
REPROD.112.099697
Gandolfi, F., and Moor, R. M. (1987). Stimulation of early embryonic
development in the sheep by co-culture with oviduct epithelial cells.
J. Reprod. Fertil. 81, 23–28. doi:10.1530/JRF.0.0810023
Ghersevich, S., Massa, E., and Zumoffen, C. (2015). Oviductal secretion
and gamete interaction. Reproduction 149, R1–R14. doi:10.1530/
REP-14-0145
Holm, P., Booth, P. J., Schmidt, M. H., Greve, T., and Callesen, H. (1999).
High bovine blastocyst development in a static in vitro production
system using SOFaa medium supplemented with sodium citrate
and myo-inositol with or without serum-proteins. Theriogenology 52,
683–700. doi:10.1016/S0093-691X(99)00162-4
Hugentobler, S. A., Diskin, M. G., Leese, H. J., Humpherson, P. G., Watson,
T., Sreenan, J. M., and Morris, D. G. (2007). Amino acids in oviduct and
uterine fluid and blood plasma during the estrous cycle in the bovine.
Mol. Reprod. Dev. 74, 445–454. doi:10.1002/MRD.20607
Hunter, R. H. F. (2012). Components of oviduct physiology in eutherian
mammals. Biol. Rev. Camb. Philos. Soc. 87, 244–255. doi:10.1111/
J.1469-185X.2011.00196.X
Ireland, J. J., Murphee, R. L., and Coulson, P. B. (1980). Accuracy of predic ting
stages of bovine estrous cycle by gross appearance of the corpus luteum.
J. Dairy Sci. 63, 155–160. doi:10.3168/JDS.S0022-0302(80)82901-8
Jin, B., Kawai, Y., Hara, T., Takeda, S., Seki, S., Nakata, Y.-i., Matsukawa,
K., Koshimoto, C., Kasai, M., and Edashige, K. (2011). Pathway for the
movement of water and cryoprotectants in bovine oocytes and embryos.
Biol. Reprod. 85, 834–847. doi:10.1095/BIOLREPROD.110.088641
Killian, G. (2011). Physiology and Endocrinology Symposium: evidence
that oviduct secretions influence sperm function: a retrospective view for
livestock. J. Anim. Sci. 89, 1315–1322. doi:10.2527/JAS.2010-3349
Lazzari, G., Wrenzycki, C., Herrmann, D., Duchi, R., Kruip, T., Niemann,
H., and Galli, C. (2002). Cellular and molecular deviations in bovine
in vitro-produced embryos are related to the large offspring syndrome.
Biol. Reprod. 67, 767–775. doi:10.1095/BIOLREPROD.102.004481
Leese, H. J. (1988). The formation and function of oviduct fluid. J. Reprod.
Fertil. 82, 843–856. doi:10.1530/JRF.0.0820843
Leese, H. J., Tay, J. I., Reischl, J., and Downing, S. J. (2001). Formation
of fallopian tubal fluid: role of a neglected epithelium. Reproduction
121, 339–346. doi:10.1530/REP.0.1210339
Leese, H. J., Hugentobler, S. A., Gray, S. M., Morris, D. G., Sturmey, R. G.,
Whitear, S., and Sreenan, J. M. (2008). Female reproductive tract fluids:
composition, mechanism of formation and potential role in the develop-
mental origins of health and disease. Reprod. Fertil. Dev. 20, 1–8.
Lepesheva, G. I., and Waterman, M. R. (2004). CYP51: the omnipotent
P450. Mol. Cell. Endocrinol. 215, 165–170. doi:10.1016/J.MCE.2003.
11.016
628 Reproduction, Fertility and Development R. Lopera-Vasquez et al.

Lloyd, R. E., Romar, R., Mata´s, C., Gutie´rrez-Ada´n, A., Holt, W. V., and
Coy, P. (2009). Effects of oviductal fluid on the development, quality,
and gene expression of porcine blastocysts produced in vitro.Reproduc-
tion 137, 679–687. doi:10.1530/REP-08-0405
Martus, N. S., Verhage, H. G., Mavrogianis, P. A., and Thibodeaux, J. K.
(1997). Enhanced in vitro development of bovine embryos in the
presence of a bovine oviductal specific glycoprotein. Theriogenology
47, 334. doi:10.1016/S0093-691X(97)82461-2
Monde´ jar, I., Martı´nez-Martı´nez, I., Avile´s, M., and Coy, P. (2013).
Identification of potential oviductal factors responsible for zona pellu-
cida hardening and monospermy during fertilization in mammals.
Biol. Reprod. 89, 67. doi:10.1095/BIOLREPROD.113.111385
Perry, G. (2014). 2013 statistics of embryo collection and transfer in
domestic farm animals. Embryo Transfer Newsl. 32, 14–26.
Rizos, D., Lonergan, P., Boland, M. P., Arroyo-Garcı´a, R., Pintado, B.,
Fuente, J. l., and Gutie´ rrez-Ada´n, A. (2002a). Analysis of differential
messenger RNA expression between bovine blastocysts produced in
different culture systems: implications for blastocyst quality. Biol.
Reprod. 66, 589–595. doi:10.1095/BIOLREPROD66.3.589
Rizos, D., Ward, F., Duffy, P., Boland, M. P., and Lonergan, P. (2002b).
Consequences of bovine oocyte maturation, fertilization or early embryo
development in vitro versus in vivo: implications for blastocyst yield
and blastocyst quality. Mol. Reprod. Dev. 61, 234–248. doi:10.1002/
MRD.1153
Rizos, D., Gutie´rrez-Ada´n, A., Pe´rez-Garnelo, S., Fuente, J. l., Boland,
M. P., and Lonergan, P. (2003). Bovine embryo culture in the presence or
absence of serum: implications for blastocyst development, cryotoler-
ance, and messenger RNA expression. Biol. Reprod. 68, 236–243.
doi:10.1095/BIOLREPROD.102.007799
Rizos, D., Clemente, M., Bermejo-Alvarez, P., De La Fuente, J., Lonergan, P.,
and Gutie´rrez-Ada´n, A. (2008). Consequences of in vitro culture
conditions on embryo development and quality. Reprod. Domest. Anim.
43, 44–50. doi:10.1111/J.1439-0531.2008.01230.X
Rizos, D., Ramirez, M. A., Pintado, B., Lonergan, P., and Gutierrez-Adan,
A. (2010). Culture of bovine embryos in intermediate host oviducts with
emphasis on the isolated mouse oviduct. Theriogenology 73, 777–785.
doi:10.1016/J.THERIOGENOLOGY.2009.10.001
Schmaltz-Panneau, B., Cordova, A., Dhorne-Pollet, S., Hennequet-Antier,
C., Uzbekova, S., Martinot, E., Doret, S., Martin, P., Mermillod, P., and
Locatelli, Y. (2014). Early bovine embryos regulate oviduct epithelial
cell gene expression during in vitro co-culture. Anim. Reprod. Sci. 149,
103–116. doi:10.1016/J.ANIREPROSCI.2014.06.022
Sturmey,R. G., Bermejo-Alvarez, P., Gutierrez-Adan,A., Rizos, D., Leese,H.
j., and Lonergan, P. (2010).Amino acid metabolismof bovine blastocysts:
a biomarker of sex and viability. Mol. Reprod. Dev. 77, 285–296.
Thouas, G. A., Korfiatis, N. A., French, A. J., Jones, G. M., and Trounson, A. O.
(2001). Simplified technique for differential staining of inner cell mass
and trophectoderm cells of mouse and bovine blastocysts. Reprod.
Biomed. Online 3, 25–29. doi:10.1016/S1472-6483(10)61960-8
Trigal, B., Go´ mez, E., Dı´ez, C., Caaman
˜o, J. N., Martı´n, D., Carrocera, S.,
and Mun
˜oz, M. (2011). In vitro development of bovine embryos cultured
with activin A. Theriogenology 75, 584–588. doi:10.1016/J.THERIO
GENOLOGY.2010.09.010
Wrenzycki, C., Herrmann, D., and Niemann, H. (2007). Messenger RNA
in oocytes and embryos in relation to embryo viability. Theriogenology
68(Suppl. 1), S77–S83. doi:10.1016/J.THERIOGENOLOGY.2007.
04.028
Young, L. E., Fernandes, K., McEvoy, T. G., Butterwith, S. C., Gutierrez, C.
G., Carolan, C., Broadbent, P. J., Robinson, J. J., Wilmut, I., and Sinclair,
K. D. (2001). Epigenetic change in IGF2R is associated with fetal
overgrowth after sheep embryo culture. Nat. Genet. 27, 153–154.
doi:10.1038/84769
www.publish.csiro.au/journals/rfd
Bovine oviductal fluid in in vitro embryo culture Reproduction, Fertility and Development 629