Content uploaded by Deepak Kumar
Author content
All content in this area was uploaded by Deepak Kumar on Sep 01, 2016
Content may be subject to copyright.
Cross-species transferability of microsatellite markers
from Fusarium oxysporum for the assessment of genetic
diversity in Fusarium udum
Sudheer Kumar &Shalini Rai &Deepak Kumar Maurya &
Prem Lal Kashyap &Alok K. Srivastava &M. Anandaraj
Received: 24 July 2012 /Accepted: 3 July 2013 / Published online: 11 July 2013
#Springer Science+Business Media Dordrecht 2013
Abstract Expressed sequence tags (ESTs) are the
source of simple sequence repeats (SSRs) that can be
used to develop molecular markers for the study of
polymorphism and genetic diversity. In the present
investigation, 30 EST simple sequence repeats (SSR)
primer sets derived from three formae speciales of
Fusarium oxysporum:melonis (Fom), cucumerium
(Foc), and lycopersici (Fol)–were tested for transfer-
ability to Fusarium udum. The majority of SSR loci
contain trinucleotide (63.70%) while fewer contain di-
(27.41%), tetra- (5.64%) and penta-nucleotide (3.22%)
repeats. The number of alleles at these SSR loci ranged
from one to three, with an average of 1.4 alleles per
locus. CAG (24.19%) and AC (16.93%) were the most
abundant motifs identified. Three markers (FomSSR-
8, FolSSR-2 and FolSSR-4) were found highly infor-
mative for genetic characterization of F.udum and very
useful in distinguishing the polymorphism rate of the
markers at specific locus; however, polymorphic infor-
mation content (PIC) was maximum (0.597) in
FocSSR-7. In terms of cross species transferability,
70% of the primer sets of Fom-SSR and Fol-SSR and
30% of the Foc-SSR produced an amplicon in F.udum
isolates. To the best of our knowledge, this is the first
set of EST SSR markers developed and assessed for the
variability, genetic analysis and evolutionary relation-
ships of the F.udum population.
Keywords Co-dominant marker .Fusarium
oxysporum f.sp. melonis .Fusarium oxysporum f.sp.
cucumerium .Fusarium oxysporum f.sp.
lycopersici .Polymorphism
Introduction
Vascular wilt caused by Fusarium udum is an impor-
tant biotic constraint for sustainable crop production of
pigeon pea (Cajanus cajan), which has been reported
to cause 16-47% crop yield losses (Raju et al.2010). In
India alone, the losses due to this disease are estimated
to be US $71 million and disease incidence varies from
5.3% to 22.6% (Kannaiyan et al.1984). Use of resis-
tant cultivars is the most effective and economic meth-
od to manage the disease. However, a high level of
genetic variability among the F.udum population and
resistant cultivars’selective pressure has led to wide
variation in virulence and aggressiveness of the F.
udum population in the field (Kiprop et al.2005).
Pathogenic variability in F.udum has been assessed
traditionally through virulence tests using a set of host
differentials containing different resistance genes. This
Phytoparasitica (2013) 41:615–622
DOI 10.1007/s12600-013-0324-y
S. Kumar (*):S. Rai :D. K. Maurya :P. L. Kashyap :
A. K. Srivastava
National Bureau of Agriculturally Important
Microorganisms (NBAIM),
Mau, Uttar Pradesh 275101, India
e-mail: sudheer.nbaim@gmail.com
M. Anandaraj
Indian Institute of Spices Research (IISR),
Marikunnu, Calicut, Kerala 673012, India
is a time-consuming procedure requiring at least 40
days for the analysis, and reactions can be influenced
by environmental parameters (Haware & Nene 1982).
Therefore, more effective genetic markers are needed
to understand genetic variation in F.udum.
Molecular markers have become important tools to
study and detect genetic variation in a plant pathogen
population. Several DNA-based molecular markers
such as rDNA-ITS, RFLP, and RAPD have been suc-
cessfully used for identifying and studying genetic
variation and diversity of numerous plant pathogenic
fungi (Bogale et al.2006;Mesapoguet al.2012).
Simple sequence repeats (SSRs), a more efficient mark-
er system than RFLPs and RAPDs, have been widely
developed for genetic analysis of fungi (Barbará et al.
2007;Kumaret al.2012;Rouxelet al.2012). SSRs or
microsatellites are tandemly repeated DNA sequence
units of 1–6 bp. They have abundant and random distri-
bution throughout eukaryotic genomes. Variation in
SSR length occurs primarily due to slipped-strand
mispairing during replication (Levinson & Gutman
1987) and mutations, which can be detected by PCR
with primers designed from the conserved flanking re-
gion. Because they are highly polymorphic, multi-
allelic, co-dominant, PCR-based, and highly reproduc-
ible, SSRs provide an ideal molecular marker system for
a variety of purposes. A key advantage of EST-SSRs is
that they are often more transferable across species as
compared with SSRs from non-coding sequences
(Pashley et al.2006), thereby facilitating comparative
genetic analyses. However, the development of SSR
markers from genomic libraries is efficient and relative-
ly inexpensive. With the availability of large numbers of
expressed sequence tags (ESTs) and other DNA se-
quence data through data mining, development of SSRs
has become fast, efficient, and cheaper. Recently, EST-
SSR markers for three formae speciales of F.oxysporum:
melonis (Fom), lycopersici (Fol), and cucumeris (Foc)–
have been developed and utilized for polymorphism
studies (Mahfooz et al.2012), but no formal analysis of
these microsatellite markers in F.udum has been
reported.
In view of the above facts, the present study was
undertaken to determine cross-transferability of EST-
SSRs derived from formae speciales of F.oxysporum
for the assessment of genetic diversity and phylogenet-
ic analysis among F.udum isolates.
Materials and methods
Fungal isolates Twenty-eight virulent isolates of
Fusaria including 20 of F.udum, three of Fom, three
of Foc and two of Fol obtained from National Agri-
culturally Important Microbial Culture Collection
(NAIMCC), National Bureau of Agriculturally Impor-
tant Microorganisms (NBAIM), Mau, Uttar Pradesh,
India, were used in the present study. The isolates were
selected on the basis of host specificity, geographic
origin and pathogenicity (Table 1).
Microsatellite markers and PCR amplification Thirty
randomly selected EST-SSR primer sets including ten
primer pairs each from Fom,Foc and Fol EST se-
quence and transcripts (Mahfooz et al.2012) were used
for the study of polymorphism and genetic diversity in
F.udum. Total genomic DNA was extracted using
CTAB method (Kumar et al.2013). The PCR was
performed in a 10 μl reaction volume containing 1×
PCR buffer (10 mM Tris HCl pH 9.0, 1.5 μM MgCl
2
,
50 mM KCl, 0.01% gelatin), 0.4 mM each of dNTP
(Bangalore Genei, Chennai, India), 0.2 U of Ta q DNA
polymerase (Bangalore Genei), 10 pM each of forward
and reverse primers and 25 ng of genomic DNA were
used as a template. The PCR program was initial de-
naturation at 95°C for 3 min, and subsequently five
touch-down PCR cycles comprising 94°C for 20 s,
60/55°C (depending on the marker as given in Table 3)
for 20 s, and 72°C for 30 s. These cycles were followed
by 40 cycles of denaturation at 94°C for 20 s with a
constant annealing temperature of 56/51°C (depending
on marker) for 20 s, and extension at 72°C for 20 s, and
a final extension at 72°C for 20 min. PCR amplicons
were examined on 3% agarose gel using ethidium
bromide staining. 100 bp DNA ladder (MBI
Fermentas, Amherst, NY, USA) was used to estimate
the allele size.
Diversity and cluster analysis The amplification data
generated by SSR markers were analyzed using
SIMQUAL route to generate Jaccard’s similarity coef-
ficient (Jaccard 1908) using NTSYS-PC, software ver-
sion 2.1 (Rohlf 1998). These similarity coefficients
were used to construct a dendrogram depicting genetic
relationships among the isolates by employing the
Unweighted Paired Group Method of Arithmetic
616 Phytoparasitica (2013) 41:615–622
Averages (UPGMA) algorithm and SAHN clustering.
The robustness of the dendrogram was evaluated with a
bootstrap analysis performed on the binary dataset using
WINBOOT software (version 2.0). The allelic diversity or
polymorphism information content (PIC) was measured
as described by Botstein et al.(1980). PIC is defined as
the probability that two randomly chosen copies of gene
will be different alleles within a population. The PIC
value was calculated with the formula as follows:
PICi¼1−X
j¼1n
Pij2
where Pij represents the frequency of the j
th
allele for
marker i, and summation extends over n alleles.
Results
Transferability of SSR markers Thirty primer sets were
tested on different isolates of F.udum, using Foc,Fol
and Fom as control isolates (Table 1). Twenty-one
(70%) of them successfully produced at least one
bright and distinct amplicon in F.udum isolates rang-
ing from 180–700 bp, whereas nine SSR markers
Table 1 Details of the isolates of Fusarium species used in the study
Code no. Accession No. Culture Biological Origin Geographical Region Virulence*
Fu1 NAIMCC-F-02854 F.udum Cajanus cajan Hyderabad, Andhra Pradesh +++
Fu2 NAIMCC-F-02853 F.udum C.cajan Faridkot, Punjab +
Fu3 NAIMCC-F-02852 F.udum C.cajan Hissar, Haryana +
Fu4 NAIMCC-F-02860 F.udum C.cajan Latur, Maharashtra +++
Fu5 NAIMCC-F-02850 F.udum C.cajan Ranchi, Jharkhand ++
Fu6 NAIMCC-F-02849 F.udum C.cajan Mujaffarpur, Bihar +++
Fu7 NAIMCC-F-02851 F.udum C.cajan Berhampur, West Bengal ++
Fu8 NAIMCC-F-02844 F.udum C.cajan Aligarh, Uttar Pradesh +++
Fu9 NAIMCC-F-02847 F.udum C.cajan Jabalpur, Madhya Pradesh +
Fu10 NAIMCC-F-02842 F.udum C.cajan IIPR Kanpur, Uttar Pradesh +++
Fu11 NAIMCC-F-02855 F.udum C.cajan Guntur, Andhra Pradesh +
Fu12 NAIMCC-F-02848 F.udum C.cajan Sagar, Madhya Pradesh ++
Fu13 NAIMCC-F-02845 F.udum C.cajan Bahraich, Uttar Pradesh +++
Fu14 NAIMCC-F-02843 F.udum C.cajan Varanasi, Uttar Pradesh +++
Fu15 NAIMCC -F-02861 F.udum C.cajan Badnapur, Maharashtra +++
Fu16 NAIMCC -F-02857 F.udum C.cajan Bangalore, Karnataka +
Fu17 NAIMCC -F-02858 F.udum C.cajan Gulberga, Karnataka ++
Fu18 NAIMCC -F-02859 F.udum C.cajan Aloka, Maharashtra +++
Fu19 NAIMCC -F-02856 F.udum C.cajan Krishnagiri, Tamil Nadu +
Fu20 NAIMCC -F-02846 F.udum C.cajan Allahabad, Uttar Pradesh +++
Fom1 NAIMCC -F-00915 F.oxysporum f. sp. meloni Cucumis sativus Kotputli, Rajasthan +++
Fom2 NAIMCC -F-00916 F.oxysporum f. sp. meloni C.sativus Tonk, Rajasthan +++
Fom3 NAIMCC -F-00922 F.oxysporum f. sp. meloni C.sativus Bagpat, Uttar Pradesh +++
Foc1 NAIMCC -F-00861 F.oxysporum f. sp. cucumerium C.sativus Alipur, Uttar Pradesh +++
Foc2 NAIMCC -F-00863 F.oxysporum f. sp. cucumerium C.sativus Tonk, Rajasthan +++
Foc3 NAIMCC -F-00869 F.oxysporum f. sp. cucumerium C.sativus Sikar, Rajasthan ++
Fol1 NAIMCC -F-02785 F.oxysporum f. sp. lycopersici Solanum lycopersicum Varanasi, Uttar Pradesh +++
Fol2 NAIMCC -F-02792 F.oxysporum f. sp. lycopersici S.lycopersicum Coimbatore, Tamil Nadu +++
*+ = less virulent, ++ = moderately virulent, +++ = highly virulent
Phytoparasitica (2013) 41:615–622 617
showed no amplification. The highest rate of success-
ful amplification (80%) was achieved from Fom primer
sets. Transferability of F.oxysporum EST primers
ranged from 60% (in the case of Foc primers) to 70%
(in the case of Fol SSR primers) in F.udum (Table 2).
The functional SSR markers, their repeat motif and
repeat numbers, primer sequences, PCR annealing
temperature, and expected fragment length are de-
scribed in Table 3. The majority of SSR loci contain
trinucleotide (63.70%) or dinucleotide (27.41%) re-
peats, while fewer contain tetranucleotide (5.64%)
and pentanucleotide (3.22%) repeats. Among 21
markers, eight (38.09%) were polymorphic and the
remaining 13 (61.9%) were monomorphic. A total of
31 alleles were amplified by 21 markers (Table 2). The
number of alleles at each polymorphic SSR locus
ranged from one to three, with an average of 1.4 alleles
per locus. The number of alleles detected by Fom,Foc
and Fol primers was 12, 11 and eight, with an average
of 1.5, 1.6 and 1.3 alleles per locus, respectively. Out
of 31 alleles, only 18 (58.1%) were polymorphic. The
highest number of alleles (3) was detected by Fom4
and Foc7 markers, whereas 13 markers (Fom1, Fom2,
Fom5, Fom6, Fom9, Foc3, Foc5, Foc6, Foc9, Foc10,
Fol1, Fol3, and Fol10) were able to detect one allele
per locus. Three SSR markers (Fom8,Fol2andFol8)
showed 100% polymorphism and minimum level of
polymorphism (50%) was revealed by Fom3and
Fol5 markers. Four Fol (Fol2, Fol4, Fol5and
Fol9), three Fom (Fom3, Fom4andFom8) and
one Foc (Foc7) markers were highly polymorphic,
with a PIC value ranging from 0.133 to 0.594.
Fom8, Foc7andFol4withPICvalues≥0.4 were
identified as the most informative SSR markers
(Table 3).
Diversity and cluster analysis The similarity coeffi-
cient values between isolates ranged from 0.30 to
0.97 with a mean of 0.64 for all 406 isolates/SSRs
combination used in the present investigation. For
microsatellite markers developed from Fom, the simi-
larity coefficient between isolates ranged from 0.22 to
1, with 33.1% genetic diversity. Similarly, with Foc-
SSR markers, the similarity coefficients between iso-
lates ranged from 0.25 to 1, with 42.7% genetic diver-
sity. For Fol markers, a similarity coefficient value
ranged from 0.44 to 1.0 with the average diversity
being 34.5% (Table 3). The highest similarity value
was observed between F.udum isolates, F.udum 17–
20 (0.97) followed by F.udum 12–13 (0.94). The
dendrogram (Fig. 1) constructed on the basis of simi-
larity index resulted in two major clusters. The first
cluster is composed exclusively of F.udum isolates,
and is further divided into many sub-clades. The sec-
ond cluster is further grouped in two distinct sub-
clades, where one clade includes the rest of the F.udum
isolates, and the second clade includes formae
speciales of F.oxysporum isolates taken into this study.
Discussion
Expressed sequence tags (ESTs) are the source of sim-
ple sequence repeats (SSRs) that can be used to devel-
op molecular markers for the study of polymorphism
and genetic diversity of the F.udum population and
related species. Generally, the success rate of EST-SSR
primers (percentage of SSR primers producing discrete
amplification products) ranged from 50% to 100%
between species within genera in plants (Peakall et al.
Table 2 Comparison between Fom,Foc and Fol markers in order to estimate the level of transferability and polymorphism among
Fusarium udum
Fom SSR Foc SSR Fol SSR Cumulative Results
Number of SSR primers used 10 10 10 30
Marker amplified (Transferability) 8 (80%) 6 (60%) 7 (70%) 21 (70%)
Number of monomorphic markers 5 (62.5%) 5 (83.3%) 3 (42.8%) 13 (61.9%)
Number of polymorphic markers 3 (37.5%) 1 (16.7%) 4 (57.2%) 8 (38.1%)
Average PIC value 0.363 0.617 0.334 0.438
Number of alleles amplified 12 8 11 31
Average similarity coefficient value 0.61 0.46 0.76 0.61
618 Phytoparasitica (2013) 41:615–622
1998; Varshney et al.2005), and 34% in cross species
transfer of SSRs within genera in fungi (Dutech et al.
2007). The 70% amplification of EST-SSRs in the F.
udum population obtained in the present investigation
corroborates the findings of Goodwin (2007), who
tested 99 primer pairs designed from the
Mycosphaerella graminicola EST database on the
closely related species Septoria passerinii and found
that 66% of them amplified. Eight of 12 primer pairs
tested also amplified on the more distantly related
species Mycosphaerella fijiensis (Goodwin 2007).
Similarly, Dracatos et al.(2006) used 55 primer pairs
for EST-SSR loci of Puccinia coronata f.sp. lolii to
amplify the DNA from various fungal species
(Puccinia coronata f.sp. avenae,Puccinia striiformis
f.sp. tritici,Neotyphodium lolii,Blumeria graminis,
Table 3 Amplification patterns and polymorphic information content (PIC) of Fusarium oxysporum EST-SSR primers in Fusarium
udum
Primer
Name
Primer sequence Motifs Temp
(°C)
No. of
alleles
Expected
size (bp)
Observed
size (bp)
Polymorphism
(%)
PIC
Fom1 CTCATCGTCATCGCTATTGCT
GAAGAATGGGAACTTAAATGCG
(CAA)4 55.2 1 186 200 - -
Fom2 TCATTCTCCATGTCCTCATCAC
TCGTTCCGATAGTAATTCGTCA
(AC)15 55.45 1 179 180 - -
Fom3 ATGCGAAAGAAGGTCTGGATTA
GAGAAGCCATTATCAACAACGC
(TC)6 54.5 2 393 400-500 50 0.277
Fom4 CTTCGGTTGCTCGACTTTCT
ATCCATGATCCCCTAAGATCG
(CTT)4 55.6 3 390 400-700 66.7 0.398
Fom5 CGTATCACAGCTACAGCCACTC
ATCTCAGTCACCCACTCAACCT
(ACA)4 59.2 1 223 250 - -
Fom6 ACACTCCAAGAACTCAGCATCA
GACAAAACTCGCTATTCGTTCC
(AC)6 56.4 1 214 200 - -
Fom8 CAACACACGTCACAATTCTTCC
CTTTGGCGACGACCTCCT
(TCG)4 56.2 2 377 500- 600 100 0.476
Fom 9 GCACACAATTCTATCCTCCTCC
CTGAAAGTGCTGTTGATACGCT
(CCT)4 57.4 1 200 280 - -
Foc3 CGAAACAATGCGTACATCCAT
AAGACTCCATACTCCCGAAACA
(CATT)4 55.2 1 216 220 - -
Foc5 CCCAAAGCAACTACAACGCT
ATATCCAAGGAAGTGCAAATGG
(CAG)4 54.9 1 308 380 - -
Foc6 CTGTTTTCTCAAAGACCATGTCC
TACACCGATCTCATCAACAAGC
(CGT)4 56.7 1 360 400 - -
Foc7 CAAGTCAGCAACCAACACAACT
GTCCTCCCATTCTTCTACCACC
(CGG)4 58.25 3 318 180-300 66.7 0.594
Foc9 GTTCGGATCATACAGCACATTT
TGGGGAATTAGTACGGAAAAGA
(CT)7 55.5 1 142 200 - -
Foc10 GGCAGGTTTCAATTCTTTGAGT
ATCGAACAACGATGGGAGAC
(CAACT)4 56.7 1 158 200 - -
Fol1 GGAGGCCGAGGTAATGGATAC
CTGAGACTGAATGGCAGTAGGG
(CGG)7 60.0 1 384 400 - -
Fol2 CTCGCATACTACTACCGCACAG
GCAGATAAGGGAGATGCAAAAC
(CAG)10 58.3 2 312 200-300 100 0.42
Fol3 AGCAACTGGAGAAAGAATACGC
TGATTGGGGTTAGTGAAGGTCT
(GAG)8 56.4 1 325 300 - -
Fol4 CCAGTCAATCCAACCCTTACTT
AGGCTTATCTGCGTCAGTTTCT
(ACCA)3 56.4 2 348 200-300 100 0.495
Fol5 ACCTAACTCTTGGGAGGACGAT
CTGCATAGCCTTGGTTGTTGTA
(CAG)7 57.4 2 308 190- 320 50 0.133
Fol9 CATTGGGAGATACGAACACTGA
ATTGCGGACTTGAGAACAAAG
(GAC)6 57.15 2 305 200-310 66.7 0.375
Fol10 AACAACAGCAACAGCAACAGAT
CTTCCAGTAGTGCCAGTGTGAG
(CAG)9 56.2 1 180 200 - -
Phytoparasitica (2013) 41:615–622 619
Aspergillus nidulans, and Penicillium marneffei) and
had a success rate of amplification ranging from 22%
to 53%. This suggests that SSR primers developed
from EST sequences are highly transferable to other
related species. The more closely related the organ-
isms, the higher the rate of the transferability due to
more closely related species sharing more homology in
SSR-containing genes. Another possibility for the high
rate of success in the amplification of EST-SSRs may
be the result of several factors, such as the sequences
from which the primers were derived, the adequate
criteria used for primer design and the use of the
species of same genus for the design and amplification
of the primer set.
Patterns of cross-species SSR amplification in fungi
are beginning to emerge, although there are still few
studies that systematically explore SSR transferability
beyond closely related genera (Dutech et al.2007;
Mahfooz et al.2012). In the present study, the EST-
SSR markers developed from formae speciales of F.
oxysporum, amplified F.udum isolates and exhibited
high levels of polymorphism. It is worth mentioning
here that a small number of markers (four out of 25)
have also been described as transferable from related
Uredinales species to Hemileia vastatrix (Cristancho &
Escobar 2008). The preliminary results obtained in the
present study agree with previous reports that describe
a smaller fraction of cross species transfer of
microsatellites within fungal genera (Baird et al.
2010). However, there might be a higher probability
of transferability of Fom-derived markers than Foc-
and Fol-EST derived markers in F.udum, which needs
further investigation and statistical validation using a
large set of EST-derived SSRs. The results also con-
firmed wide species transferability of developed EST
primers and demonstrated that they may represent a set
of well-conserved loci across the species. This may be
due to the transfer of lineage-specific genomic regions
in F.oxysporum (Ma et al.2010).
It has been observed in the study that the distribu-
tion of microsatellites in the F.udum genome is not
random. Tri-nucleotide repeats (CAG and CAA) have
been found to be a common feature in EST-derived
SSRs. A high frequency of these repeats in coding
regions could be due to mutation and selection pressure
for specific amino acids. The abundance of tri-
nucleotide repeats EST-SSR is likely due to suppres-
sion of other kinds of repeats in the coding region,
Coefficient
0.00 0.25 0.50 0.75 1.00
Fu1
Fu5
Fu4
Fu6
Fu7
Fu2
Fu3
Fu8
Fu9
Fu14
Fu17
Fu20
Fu10
Fu12
Fu13
Fu11
Fu16
Fu15
Fu18
Fu19
Fom1
Fom3
Fom2
Fol3
Fol2
Foc1
Foc2
Foc3
Fig. 1 Dendrogram showing genetic relationship among the Fusarium udum and related isolates based on 21 microsatellite markers. Scale
indicates Jaccard’s coefficient of similarity
620 Phytoparasitica (2013) 41:615–622
which reduces the frame-shift mutations in the coding
regions (Garnica et al.2006). Additionally, there is a
possibility that these tri-nucleotides in the coding re-
gion are translated into amino acid repeats (glutamine,
proline, arginine, aspartic acid, glutamic acid and ser-
ine, etc.), which possibly contribute to the biological
function of protein (Kim et al.2008). Di-nucleotide
SSRs are often found in the exonic region of F.udum,
however (AC)
n
, (CT)
n
and (TC)
n
repeats are common
in all the isolates taken under study. Based on the
present status of our knowledge, it is uncertain whether
they are merely structural moieties or have some func-
tional significance too.
To analyze the polymorphism pattern in the F.udum
population, average PIC values were compared and
recorded significant distinction in the polymorphism
rate of the markers at a specific locus. In this study,
70% of functional SSRs showed polymorphisms in the
F.udum population, indicating a relatively high level
of polymorphism. These markers clustered the F.udum
population and the other three formae speciales of F.
oxysporum in two distinct major clusters in basal to-
pology. Similar levels of polymorphism have been
reported by Mahfooz et al.(2012)informae speciales
of F.oxysporum. Markers with PIC values of ≥0.40,
viz., Fom8, Foc7 and Fol2, were found to be highly
informative for genetic characterization and very use-
ful in distinguishing the polymorphism rate of the
markers at a specific locus. The high level of polymor-
phism associated with SSR is to be expected, because
of the unique mechanism responsible for generating
SSR allelic diversity by replication slippage (Varshney
et al.2005). The average PIC value was relatively low
for SSR markers compared with previous studies in
Fusarium spp. Bogale et al.(2005) developed nine
functional SSR markers from F.oxysporum having an
average PIC of 0.594 and utilized them to discriminate
21 formae speciales of F.oxysproum. Similarly,
Gauthier et al.(2007) reported an average PIC value
of 0.756 with 15 markers developed from F.
graminearium. Recently, Mahfooz et al.(2012) dem-
onstrated the utility of 30 SSR markers from three
formae speciales of F.oxysporum having average
PIC values of 0.53. The lower value of average PIC
obtained in the present study may provide an indication
that functional SSRs represent the coding region of
genome which is generally highly conserved.
In summary, three effective functional SSR markers
for the study of polymorphism and genetic diversity in
F.udum were obtained. These markers have shown a
high success rate in PCR amplification and detected a
high level of molecular polymorphism in F.udum iso-
lates. Additionally, their ease of scoring may facilitate
larger studies to compare the evolution of different
populations throughout their geographical distribution.
In particular, comparison of genetic structure from
different F.udum populations will be helpful in the
understanding of evolutionary dynamics of F.udum.
Thus, these SSR markers may provide a powerful tool
for Fusarium udum discrimination, genetic diversity
assessment, and genetic relationship studies.
Acknowledgment The authors gratefully acknowledge the fi-
nancial assistance under project ‘Outreach project on
Phytophthora,Fusarium and Ralstonia Disease in Horticulture
and Field Crops’from the Indian Council of Agricultural Re-
search (ICAR), India.
References
Baird, R. E., Wadl, P. A., Allen, T., McNeill, D., Wang, X.,
Moulton, J. K., et al. (2010). Variability of United States
isolates of Macrophomina phaseolina based on simple se-
quence repeats and cross genus transferability to related
genera within botryosphaeriaceae. Mycopathologia, 170,
169–180.
Barbará, T., Martinelli, G., Fay, M. F., Mayo, S. J., & Lexer, C.
(2007). Population differentiation and species cohesion in
two closely related plants adapted to neotropical high-
altitude ‘inselbergs’,Alcantarea imperialis and A.
geniculata.Molecular Ecology, 16, 1981–1992.
Bogale, M., Wingfield, B. D., Wingfield, M. J., & Steenkamp, E.
T. (2005). Simple sequence repeat markers for species in the
Fusarium oxysporum complex. Molecular Ecology Notes,
5, 622–624.
Bogale, M., Wingfield, B. D., Wingfield, M. J., & Steenkamp, E.
T. (2006). Characterization of Fusarium oxysporum isolates
from Ethiopia using AFLP, SSR and DNA sequence anal-
yses. Fungal Diversity, 23,51–66.
Botstein, D., White, K. L., Skolnick, M., & Davis, R. W. (1980).
Construction of a genetic linkage map in man using restric-
tion fragment length polymorphisms. American Journal of
Human Genetics, 32, 314–33l.
Cristancho, M., & Escobar, C. (2008). Transferability of SSR
markers from related Uredinales species to the coffee rust
Hemileia vastatrix.Genetics and Molecular Research, 7,
1186–1192.
Dracatos, P. M., Dumsday, J. L., Olle, R. S., Cogan, N. O. I.,
Dobrowolski, M. P., Fugimori, M., et al. (2006). Additions
and corrections: Development and characterization of EST-
SSR markers from the crown rust pathogen of ryegrass
(Puccinia coronata Corda f. sp. lolii). Genome, 49, 1341.
Phytoparasitica (2013) 41:615–622 621
Dutech, C., Enjalbert, J., Fournier, E., Delmotte, F., Barrès, B.,
Carlier, J., et al. (2007). Challenges of microsatellite isola-
tion in fungi. Fungal Genetics Biology, 44, 933–949.
Garnica, D. P., Pinzón, A. M., Quesada-Ocampo, L. M., Bernal,
A. J., Barreto, E., Grünwald, N. J., et al. (2006). Survey and
analysis of microsatellites from transcript sequences in
Phytophthora species: frequency, distribution, and potential
as markers for the genus. BMC Genomics, 7, 245.
Gauthier, N., Clouet, C. D., Fargues, J., & Bon, M. C. (2007).
Microsatellite variability in the entomopathogenic fungus
Paecilomyces fumosoroseus: genetic diversity and popula-
tion structure. Mycologia, 99, 693–704.
Goodwin, S. B. (2007). Back to basics and beyond: increasing
the level of resistance to Septoria tritici blotch in wheat.
Australian Plant Pathology, 36, 532–538.
Haware, M. P., & Nene, Y. L. (1982). Races of Fusarium
oxysporum f. sp. ciceri.Plant Disease, 66, 809–810.
Jaccard, P. (1908). Nouvelle recherches sur la distribution
florale. Bulletin de la Société Vaudoise des Sciences
Naturelles, 44, 223–270.
Kannaiyan, J., Nene, Y. L., Reddy, M. V., Ryan, J. G., & Raju, T.
N. (1984). Prevalence of pigeonpea diseases and associated
crop losses in Asia, Africa and the Americas. Tropical Pest
Management, 30,62–71.
Kim, T. S., Booth, J. G., Gauch, H. G., Jr., Sun, Q., Park, J., Lee,
Y. H., et al. (2008). Simple sequence repeats in Neurospora
crassa: distribution, polymorphism and evolutionary infer-
ence. BMC Genomics, 9, 31.
Kiprop, E. K., Mwang’ombe, A. W., Baudoin, J.-P., Kimani, P.
M., & Mergeai, G. (2005). Genetic variability among Fu-
sarium udum isolates from pigeonpea. African Crop Sci-
ence Journal, 13, 163–172.
Kumar, S., Maurya, D., Kashyap, P. L., & Srivastava, A. K.
(2012). Computational mining and genome wide distribu-
tion of microsatellites in Fusarium oxysporum f. sp.
lycopersici.Notulae Scientia Biologicae, 4, 127–131.
Kumar, S., Singh, R., Kashyap, P. L., & Srivastava, A. K. (2013).
Rapid detection and quantification of Alternaria solani in
tomato. Scientia Horticulturae, 151, 184–189.
Levinson, G., & Gutman, G. A. (1987). Slipped-strand mispairing:
a major mechanism for DNA sequence evolution. Molecular
Biology and Evolution, 4,203–221.
Ma, L. J., van der Does, H. C., Borkovich, K. A., Colema, J. J.,
Daboussi, M. J., Di Pietro, A., et al. (2010). Comparative
genomics reveals mobile pathogenicity chromosomes in
Fusarium.Nature, 464, 367–373.
Mahfooz, S., Maurya, D. K., Srivastava, A. K., Kumar, S., &
Arora, D. K. (2012). A comparative in-silico analysis on
frequency and distribution of microsatellites in coding re-
gions of three formae speciales of Fusarium oxysporum and
development of EST-SSR markers for polymorphism stud-
ies. FEMS Microbiology Letters, 328,54–60.
Mesapogu, S., Bakshi, A., Kishore Babu, B., Reddy, S. S.,
Saxena, S., & Arora, D. K. (2012). Genetic diversity and
pathogenic variability among Indian isolates of Fusarium
udum infecting pigeonpea (Cajanus cajan (L.) Millsp.).
International Research Journal of Agricultural Science
and Soil Science, 2,51–57.
Pashley, C. H., Ellis, J. R., McCauley, D. E., & Burke, J.
M. (2006). EST databases as a source for molecular
markers: lessons from Helianthus.Journal of Heredity,
97,381–388.
Peakall, R., Gilmore, S., Keys, W., Morgante, M., & Rafalski, A.
(1998). Cross-species amplification of soybean (Glycine
max) simple sequence repeats (SSRs) within the genus
and other legume genera: implications for the transferability
of SSRs in plants. Molecular Biology and Evolution, 15,
1275–1287.
Raju, N. L., Gnanesh, B. N., Lekha, P., Jayashree, B., Pande, S.,
Hiremath, P. J., et al. (2010). The first set of EST resource
for gene discovery and marker development in pigeonpea
(Cajanus cajan L.). BMC Plant Biology, 10, 45.
Rohlf, J. F. (1998). NTSYS-PC: numerical taxonomy and multi-
variate analysis system Version 2.01. Setauket, NY, USA:
Exetersoftware.
Rouxel, M., Papura, D., Nogueira, M., Machefer, V., Dezette,
D., Richard-Cervera, S., et al. (2012). Microsatellite
markers for characterization of native and introduced pop-
ulations of Plasmopara viticola, the causal agent of grape-
vine downy mildew. Applied Environmental Microbiolo-
gy, 78, 6337.
Varshney, R. K., Graner, A., & Sorrells, M. E. (2005). Genic
microsatellite markers in plants: features and applications.
Trends in Biotechnology, 23,48–55.
622 Phytoparasitica (2013) 41:615–622
