Content uploaded by Dapeng Li
Author content
All content in this area was uploaded by Dapeng Li on Feb 18, 2019
Content may be subject to copyright.
RESEARCH ARTICLE
Synergistic anti‐inflammatory effects of quercetin and catechin
via inhibiting activation of TLR4–MyD88‐mediated NF‐κB and
MAPK signaling pathways
Ting Li
1
*|Feng Li
1
*|Xinying Liu
2
|Jianhua Liu
1
|Dapeng Li
1
1
Key Laboratory of Food Processing
Technology and Quality Control in Shandong
Province, College of Food Science and
Engineering, Shandong Agricultural University,
Tai'an, China
2
Center of Bee Industry on Seed‐Breeding
and Popularization in Shandong Province,
Tai'an, China
Correspondence
Dapeng Li, Key Laboratory of Food Processing
Technology and Quality Control in Shandong
Province, College of Food Science and
Engineering, Shandong Agricultural University,
Tai'an 271018, China.
Email: dpli73@sdau.edu.cn
Funding information
Shandong “Double Tops”Program, Grant/
Award Number: SYT2017XTTD04; Shandong
Agricultural Innovation Team, Grant/Award
Number: SDAIT‐24‐05; Shandong Provincial
Natural Science Foundation, Grant/Award
Number: ZR2018BC063; National Natural
Science Foundation of China, Grant/Award
Numbers: 31201417 and 31571836
The synergistic anti‐inflammatory effect of quercetin and catechin was investigated
using lipopolysaccharide (LPS)‐stimulated macrophage RAW 264.7 cells. Results
showed that the combined treatment of quercetin with catechin synergistically
attenuated LPS‐stimulated increase of some proinflammatory molecules, including
nitric oxide, tumor necrosis factor α, interleukin‐1β, nitric oxide synthase, and
cyclooxygenase‐2. Moreover, it exhibited significantly (p< 0.05) stronger inhibitory
effect on nuclear translocation of nuclear factor‐κB (NF‐κB) by suppressing the phos-
phorylation of NF‐κB p65 and p50 submits and on the phosphorylation of ETS
domain‐containing protein and c‐Jun N‐terminal kinase than any of quercetin or
catechin alone. Besides, the cotreatment of quercetin with catechin significantly
(p< 0.05) restored the impaired expression of toll‐like receptor 4, myeloid differen-
tiation primary response gene 88, and some downstream effectors (IRAK1, TRAF6,
and TAK1). These results suggest that quercetin and catechin possessed synergistic
anti‐inflammatory effects, which may be attributed to their roles in suppressing the
activation of TLR4–MyD88‐mediated NF‐κB and mitogen‐activated protein kinases
signaling pathways.
KEYWORDS
catechin, inflammation, lipopolysaccharide, quercetin, synergism
1|INTRODUCTION
Inflammation is classically known as an important pathological
response to pathogens and diverse external stimuli (Lin et al., 2008).
Moreover, inflammation reaction has been increasingly recognized as
a pivotal molecular basis in the pathogenesis of many chronic diseases,
such as inflammatory bowel diseases, cardiovascular, cancers,
atherosclerosis, neurodegenerative diseases, and rheumatoid arthritis
(Qureshi et al., 2011). Inflammatory stimuli such as lipopolysaccharide
(LPS) and interferon γactivate macrophages to produce a variety of
proinflammatory mediators such as nitric oxide (NO), prostaglandins
(PGs), and other proinflammatory cytokines such as tumor necrosis
factor (TNF) α, interleukin (IL)‐1, IL‐6, and IL‐8 (Christiansen, Nielsen,
& Kolte, 2006). Inhibition of these mediators by various anti‐
inflammatory drugs or chemicals is one common therapeutic approach
for inflammation‐related diseases (Ritchlin, Haas‐Smith, Li, Hicks, &
Schwarz, 2003). Among the drugs, nonsteroidal anti‐inflammatory
drugs and corticosteroids are widely used, but they are relatively old
and sometimes cause some undesired side effects, especially
gastrointestinal injures (Yuan et al., 2011). Thus, there is a continuous
demand for the development of new and more efficacious anti‐
inflammatory drugs.
A variety of phytochemicals have exhibited anti‐inflammatory
effects by inhibiting the production and release of proinflammatory
cytokines and mediators (Cho et al., 2016). Quercetin and catechin
are common bioflavonoids found abundantly in fruits and vegetables
such as apples, tea, onion, and berries, which are linked to diverse
medicinal effects, including anti‐inflammatory, antitumor, antioxidant,
*Ting Li and Feng Li contributed equally to this work.
Received: 17 June 2018 Revised: 31 October 2018 Accepted: 3 December 2018
DOI: 10.1002/ptr.6268
Phytotherapy Research. 2019;1–12. © 2019 John Wiley & Sons, Ltd.wileyonlinelibrary.com/journal/ptr 1
and anticarcinogenic activities (Formica & Regelson, 1995; Wang,
Sun‐Waterhouse, Li, Xin, & Li, 2018). Quercetin was able to inhibit
LPS‐stimulated NO increase via suppressing nitric oxide synthase
(iNOS) mRNA (Chen et al., 2005). Catechin could attenuate inflamma-
tory reaction by downregulating the phosphorylation of mitogen‐
activated protein kinases (MAPKs) and inactivating nuclear factor‐κB
(NF‐κB) in toll‐like receptor (TLR) 2 ligand‐stimulated dental pulp cells
(Hirao et al., 2010).
Drug combinations have been increasingly used as a promising
approach for the treatment of inflammation. Multiple beneficial
effects can be achieved by using these drug combinations, such as
enhancing the therapeutic effects (synergistic effect), reducing the
dosage without compromising the efficacy, and minimizing the side
effects of anti‐inflammatory agents (Chou, 2006). Therefore, it is of
significance to search for the drug combinations as anti‐inflammatory
agents. For instance, the combination of sodium ferulate with
oxymatrine showed a synergistic effect in inhibiting the production
of some inflammation‐associated mediators in LPS‐induced RAW
264.7 cells (Yuan et al., 2011). Ethanol suppressed iNOS activity when
used in combination with quercetin and resveratrol, which may have
potential clinical implications (Chan, Mattiacci, Hwang, Shah, & Fong,
2000). Saw, Huang, and Kong (2010) found that the anti‐inflammatory
activities of curcumin were enhanced when used with low doses of
polyunsaturated fatty acids. Recent studies revealed that catechin,
quercetin, and their combination had potential benefits in mitigating
the metabolic syndrome (MetS)‐associated adipose inflammation,
which could be in part attributed to their capacity of diminishing
c‐Jun N‐terminal kinase (JNK)/p38/activator protein 1 activation
(Vazquez Prieto et al., 2015).
Considering that both quercetin and catechin, due to structural
similarity, coexist prevalently in many plant‐based diets, this study
was initiated to investigate whether their combination might amplify
their anti‐inflammatory efficacy in LPS‐stimulated RAW 264.7 cells.
Furthermore, the possible mechanism underlying the anti‐inflammatory
actions of the combination was explored. The results obtained in this
study may provide some basis for the combined use of quercetin and
catechin as an effective anti‐inflammatory agent in the future.
2|MATERIAL AND METHODS
2.1 |Chemicals
Quercetin (purity ≥95%), catechin (purity ≥98%), LPS, and 3‐(4,5‐
dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) were
purchased from Sigma‐Aldrich Chemical Co. (Milwaukee, WI).
Dulbecco's modified Eagle's minimum essential medium (DMEM),
trypsin‐EDTA (0.25% trypsin with EDTA‐4Na), fetal bovine serum,
and penicillin–streptomycin were obtained from Gibco (Grand Island,
NY). Enzyme‐linked immunosorbent assay kits for TNF‐αand IL‐1β
were purchased from Langdun Biotechnology Inc. (Shanghai, China).
Inducible iNOS, cyclooxygenase‐2 (COX‐2), p50/phospho50,
p65/phosphor p65, ETS domain‐containing protein (ELK1)/phosphor
ELK1, JNK/phosphor JNK, p38/phosphor p38, extracellular signal‐
regulated kinase (ERK)/phosphor ERK, myeloid differentiation primary
response gene 88 (MyD88) primary antibodies, and horseradish
peroxidase‐conjugated secondary antibodies were purchased from
Abcam (Cambridge, UK).
2.2 |Cell culture
Murine macrophage RAW 264.7 cells were obtained from American
Type Culture Collection (Rockville, MD). Cells were grown at 37°C,
5% CO
2
atmosphere in the DMEM supplemented with 10% (v/v) fetal
bovine serum, 100 U/ml of penicillin, and 100 μg/ml of streptomycin.
2.3 |Cell viability assay
RAW 264.7 macrophages were seeded at 96‐well plates at a density
of5×10
4
cells per well. After 24 hr of preconditioning, the medium
was replaced with fresh DMEM containing either 1 μg/ml of LPS
alone or LPS with different concentrations of quercetin, catechin, or
their combination, and the cells were further incubated for 24 hr.
Thereafter, the medium was removed and 100 μl of MTT dye solution
(1 mg/ml in phosphate buffered saline) was added to each well, and
the cells were incubated for 2 hr at 37°C. After that, 100 μl of DMSO
was added to each well and the plate was incubated for 15 min under
gentle shaking at 37°C to dissolve/extract tetrazolium dye. Relative
cell viability was calculated by determining the absorbance at
570 nm, and untreated control cells were assigned a relative viability
of 100%.
2.4 |NO assay
RAW 264.7 macrophages were seeded in 96‐well plates at a density of
5×10
4
cells per well. After 24 hr of preconditioning, the medium was
replaced with fresh DMEM containing either 1 μg/ml of LPS alone or
LPS with different concentrations of quercetin, catechin, or their com-
bination, and the cells were further incubated for 24 hr. Afterwards,
100 μl of culture supernatant was mixed with equal volume of Griess
reagent (1% [w/v] sulfanilamide in 2.5% [w/v] phosphoric acid, and
0.1% [w/v] naphthylethylenediamine dihydrochloride). After 10 min,
the absorbance was recorded at 540 nm, and percent inhibition of
NO was calculated by comparison with a standard curve of sodium
nitrite prepared in DMEM.
2.5 |Western blot analysis
RAW 264.7 macrophages were seeded in six‐well plates at a density of
5×10
5
cells/ml. After 24 hr of preconditioning, the medium was
replaced with fresh DMEM containing either 1 μg/ml of LPS alone or
LPS with different concentrations of quercetin, catechin, or their com-
bination, and the cells were incubated for 24 hr. After removal of the
medium, the cells were washed twice with ice‐cold phosphate‐buffered
saline and then lysed in 100 μl of radioimmunoprecipitation assay
(RIPA) lysis buffer (50‐mM Tris base, 150‐mM NaCl, 0.1% Triton X‐
100, and 0.1% sodium dodecyl sulfate) with protease inhibitor (10×,
Calbiochem, San Diego, CA). Protein concentration of the whole cell
extract was determined by BCA assay kit (Beyotime, China). Equal
2LI ET AL.
amounts of protein extract (50 μg) were resolved by 10% sodium dode-
cyl sulfate polyacrylamide gel electrophoresis and transferred to a
polyvinylidene fluoride membrane. The membrane was blocked in
western blocking buffer (Beyotime) for 1 hr at room temperature and
then probed with the primary antibodies (1:2,000) in TBST buffer (20‐
mM Tris‐HCl [pH 7.6], 140‐mM NaCl, and 0.05% [v/v] Tween 20) over-
night at 4°C followed by incubation with the corresponding second
antibodies (1:5,000) for 2 hr. The blots were washed three times with
TBST, and the immunoreactivity analysis was then performed with an
ECL plus western blotting detection kit (Sagecreation, China).
2.6 |Enzyme‐linked immunosorbent assay
RAW 264.7 cells were seeded in 96‐well plates at a density of 5 × 10
4
cells per well. After 24 hr of preconditioning, the medium was
replaced with fresh DMEM containing either 1 μg/ml of LPS alone
or LPS with different concentrations of quercetin, catechin, or their
combination, and the cells were incubated for 24 hr. Cell supernatant
(100 μl) was collected, and the levels of TNF‐αand IL‐1βwere ana-
lyzed using enzyme‐linked immunosorbent assay kits (Langdun,
Shanghai, China).
2.7 |Real‐time quantitative reverse transcriptase
polymerase chain reaction
RAW 264.7 cells were seeded in six‐well plates at a density of 5 × 10
5
cells/ml. After 24 hr of preconditioning, the medium was replaced with
fresh DMEM containing either 1 μg/ml of LPS alone or LPS with
different concentrations of quercetin, catechin, or their combination,
and the cells were incubated for 6 hr. Total RNA from each treatment
was extracted using a TRIzol RNA extracting kit (Tiangen Biotech Co.,
Ltd., Beijing, China) according to the manufacturer's instructions. Total
RNA (2 μg) was reverse‐transcribed into cDNA using a PrimeScript™
RT Reagent Kit with gDNA Eraser (Takara Bio Inc., Kusatsu, Japan).
Quantitative reverse transcriptase polymerase chain reaction (qRT‐
PCR) reaction was conducted on a Bio‐Rad IQ5 Real‐time PCR System
(Bio‐Rad Laboratories Inc., Hercules, CA, USA) using SYBR
®
Premix Ex
Taq™(TaKaRa, Japan). The primer sequences designed for qRT‐PCR
analysis are listed in Table 1. The expression levels of genes were
determined by normalizing to GAPDH expression.
2.8 |Statistical analysis
All experiments were carried out in at least triplicate and data are
expressed as means ± standard deviations. A one‐way analysis of
variance followed by Dunnett's post hoc test was performed to calcu-
late statistical differences. A probability of <0.05 was considered sta-
tistically different.
3|RESULTS
Cytotoxic effects of quercetin and catechin, either alone or in combi-
nation, were first evaluated by MTT colorimetric assay. As shown in
Figure 1a–c, treatment with 1 μg/ml of LPS did not cause a remark-
able (p> 0.05) change in cell viability compared with the control. In
the presence of LPS, neither single compound, quercetin (4–20 μM),
or catechin (100–500 μM) nor their combinations significantly
affected the cell viability as compared with the control (p> 0.05).
The cell viabilities of all groups were maintained over 80%, suggesting
that single compound and their combinations are nontoxic towards
RAW 264.7 macrophages within the dose range used in this study.
NO is involved in all phases of the inflammatory immune response.
It served as an important mediator in the regulation of different
TABLE 1 Oligomeric nucleotide primer sequence of quantitative reverse transcriptase polymerase chain reaction
Gene Forward primer (5′‐3′) Reverse primer (5′‐3′)
iNOS TCCTACACCACACCAAAC TCCTACACCACACCAAAC
iNOS TCCTACACCACACCAAAC TCCTACACCACACCAAAC
COX‐2 CCTCTGCGATGCTCTTCC TCACACTTATACTGG TCAAATCC
TNF‐αAGGTTCTGTCCCTTTCACTCACTGG AGAGAACCT GGGAGTAGACAAGGTA
IL‐1βGAAGTCAAGAGCAAAGTGG ACAGTCCAGCCCATACTTT
NF‐kB p65 GCGTACACATTCTGGGGAGT CCGAAGCAGGAGCTATCAAC
NF‐kB p50 CCTACGGTGGGATTACATTC CTCCTCGTCATCACTCTTGG
ELK1 CATCATCTCCTGGACCTCACG ACCTCAGGCTGGGGTGGGCAGTCTT
JUN CGGACCGTTCTATGACTGC AGCGTGTTCTGGCTATGC
c‐FOS CGGGTTTCAACGCCGACTACG GCAACGCAGACTTCTCATC
p38 GGAGGTGCCCGAACGATA CAGCCCACGGACCAAATA
JNK CCAGCACCCATACATCAA TTCCTCCAAATCCATTACCT
ERK GGTTGTTCCCAAATGCTG CTCCTTAGGTAAGTCGTCCA
TLR4 TTCAGAGCCGTTGGTGTATC CTCCCATTCCAGGTAGGTGT
MyD88 AGGACAAACGCCGGAACTTTT GCCGATAGTCTGTCTGTTCTAGT
GAPDH TCAACGGCACAGTCAAGG ACTCCACGACATACTCAG
Note. iNOS: nitric oxide synthase; COX‐2: cyclooxygenase‐2; TNF‐α: tumor necrosis factor α;IL‐1β: interleukin‐1β;NF‐κB:
nuclear factor κB; ELK1: ETS domain‐containing protein; JNK: c‐Jun N‐terminal kinase; ERK: extracellular signal‐regulated
kinase; TLR4: toll‐like receptor 4; MyD88: myeloid differentiation primary response gene 88.
LI ET AL.3
physiological and pathophysiological mechanisms (Lyons, 1995). All the
test samples (single compound and their combinations) were able to
significantly (p< 0.05) alleviate LPS‐stimulated NO increase in macro-
phages in a dose‐dependent fashion (Figure 1d–f). The EC
50
values of
quercetin and catechin were 6 and 238 μM, respectively. To examine
whether the combinations of quercetin with catechin have synergistic
effects in inhibiting LPS‐stimulated NO production in RAW 264.7 cells,
serial concentrations of quercetin and catechin at a fixed ratio of 1:25
were tested. As shown in Figure 1f, all the combinations exhibited a
dose‐dependent NO inhibition in LPS‐stimulated macrophages. Treat-
ment of the cells with 7‐μM quercetin + 175‐μM catechin for 24 hr
caused a 92% NO inhibition. It is noteworthy that the combinations
of quercetin with catechin resulted in a significantly (p< 0.05) higher
NO inhibition compared with the theoretical sum of those from the
corresponding single compound. For example, treatment with 4‐μM
quercetin + 100‐μM catechin caused a 73% NO inhibition in LPS‐
stimulated macrophages. By contrast, the theoretical sum of percent
NO inhibition from the corresponding single compound (8‐μM
quercetin + 200‐μM catechin) was 45%, suggesting that there existed
a synergistic anti‐inflammatory action between quercetin and catechin.
To further analyze the possible interaction between quercetin and
catechin, an isobolographic analysis based on the median‐effect princi-
ple was performed (Rodea‐Palomares et al., 2010). The combination
index of the combinations of quercetin with catechin was 0.747 (<1),
indicating a synergism between quercetin and catechin in suppressing
NO production. Because the combination of 3‐μM quercetin + 75‐μM
catechin caused a nearly 50% NO inhibition in cells, it was used for the
subsequent experiments.
FIGURE 1 Effects and of quercetin, catechin, and their combinations on cell viability and nitric oxide (NO) production in lipopolysaccharide
(LPS)‐stimulated RAW 264.7 macrophages. RAW 264.7 cells (5 × 10
4
cells per well) were treated with either 1 μg/ml of LPS alone or LPS with
different concentrations of quercetin, catechin, or their combinations for 24 hr. Cell viability of RAW 264.7 cells was determined by the MTT
assay. Inhibition of NO production was measured based on the Griess reaction. (a–c) Cell viability of RAW 264.7 cells treated with quercetin,
catechin, and their combinations. (d–f) Percent NO inhibition in LPS‐stimulated RAW 264.7 cells treated with quercetin, catechin, and the
combination. Histograms marked with different letters are statistically different at p< 0.05
4LI ET AL.
The effects of quercetin and catechin, either alone or in combina-
tion, on protein expression of iNOS and COX‐2 were determined by
western blotting. As shown in Figure 2, stimulation of RAW 264.7
cells with LPS for 24 hr led to a dramatic increase of iNOS and
COX‐2 protein compared with non‐LPS‐treated cells (the control;
p< 0.05). However, addition of single compound or their combination
attenuated the LPS‐elicited increase in iNOS and COX‐2 levels in
RAW 264.7 cells. The combination of 3‐μM quercetin + 75‐μM cate-
chin caused a significant (p< 0.05) 87% and 65% decrease in iNOS and
COX‐2 proteins compared with the LPS‐treated alone. Incubation of
6‐μM quercetin or 150‐μM catechin alone showed inhibitory effects
on expression of two proteins, with the percent inhibition of iNOS
being 53% (quercetin) and 50% (catechin) and 29% and 35% in the
case of COX‐2, respectively. These results agree with the previous
reports that the suppression of iNOS and COX‐2 protein expression
was related to anti‐inflammatory actions of various phytonutrients.
For instance, Park, Jin, Lee, and Song (2011) revealed that luteolin
and chicoric acid cotreatment synergistically ameliorated LPS‐induced
inflammation response through the suppression of proinflammatory
proteins in RAW 264.7 cells. It is noteworthy that the combination
treatment presented stronger inhibitory activity compared with the
theoretical sum of those from the corresponding single compound,
suggesting that it was more effective in inhibiting expression of iNOS
and COX‐2 proteins in LPS‐stimulated macrophages.
The effects of quercetin and catechin, either alone or in combina-
tion, on proinflammatory cytokine genes and protein expressions in
LPS‐stimulated RAW 264.7 cells are illustrated in Figure 3. LPS activa-
tion of the macrophages led to significant (p< 0.05) increases of TNF‐α
and IL‐1βgenes and proteins compared with the non‐LPS‐treated con-
trol. Following the treatment with the single compound, the upregula-
tion of TNF‐αand IL‐1βwas significantly (p< 0.05) suppressed, with
the percent inhibition being 47% and 52% for quercetin (Figure 3a)
and 27% and 44% for catechin, respectively (Figure 3b). In the case of
the combination of quercetin with catechin, the levels of TNF‐αand
IL‐1βwere reduced by 78% and 75% compared with the LPS‐treated
control, respectively, suggest that it is more effective in inactivating
two proinflammatory cytokines than any of the single compounds.
The effects of quercetin and catechin, either alone or in combination,
on mRNA levels of TNF‐αand IL‐1βwere similar to that on these
proteins (Figure 3c,d). Moreover, quercetin and catechin exhibited a
significant (p< 0.05) synergistic effect in suppressing the LPS‐activated
upregulation of the TNF‐αand IL‐1βmRNA in RAW 264.7 cells.
As shown in Figure 4, LPS stimulation markedly (p< 0.05)
upregulated the mRNA levels of NF‐κB p65 and p50 compared with
the control. When RAW264.7 cells were treated with 6‐μM quercetin
or 150‐μM catechin alone for 24 hr, no significant (p> 0.05)
differences were observed for the NF‐κB p65 mRNA levels compared
with the LPS‐stimulated control. Following the treatment with the
combination of 3‐μM quercetin + 75‐μM catechin, LPS‐stimulated
upregulation of NF‐κB p65 mRNA was significantly (p< 0.05) inhibited
by 15%. In the case of NF‐κB p50, treatment with 6‐μM quercetin did
not cause significant (p> 0.05) differences compared with the LPS
alone, whereas 150‐μM catechin significantly (p< 0.05) inhibited the
upregulation of NF‐κB p50 mRNA by 30%. Moreover, the inhibition
of NF‐κB p50 was further enhanced when catechin was used in com-
bination with quercetin, with percent inhibition reaching 57%. Next,
the phosphorylation of NF‐κB p65 and p50 submits in the cells treated
with the compounds or their combination was examined by western
blotting. As shown in Figure 4c,d, LPS stimulation markedly
(p< 0.05) increased the phosphorylation of both NF‐κB p65 and
p50, which was consistent with their increased mRNA levels after
LPS treatment. Quercetin at 6 μM and catechin at 150 μM did not
reduce protein levels of phosphorylated NF‐κB p65 and p50 in macro-
phages exposed to LPS (p> 0.05). By contrast, the combination of
FIGURE 2 Effects of quercetin, catechin, and their combination on protein expression of nitric oxide synthase (iNOS) and cyclooxygenase‐2
(COX‐2) in lipopolysaccharide (LPS)‐stimulated RAW 264.7 macrophages. RAW 264.7 cells (5 × 10
5
cells/ml) were treated with either 1 μg/ml
of LPS alone or LPS with 6‐μM quercetin, 150‐μM catechin, or the combination of 3‐μM quercetin with 75‐μM catechin for 24 hr. The protein
levels of iNOS and COX‐2 were detected by western blot. (a) The protein levels of iNOS in RAW 264.7 cells. (b) The protein levels of COX‐2in
RAW 264.7 cells.
#
p< 0.05 versus control group.
*
p< 0.05 versus the LPS‐treated alone group
LI ET AL.5
3‐μM quercetin + 75‐μM catechin significantly (p< 0.05) inhibited the
upregulation of phosphorylated NF‐κB p65 and p50, suggesting a
synergistic effect between them. These results indicated that the
cotreatment of quercetin with catechin was effective in suppressing
LPS‐induced nuclear translocation of NF‐κB by inhibiting the phos-
phorylation of NF‐κB p65 and p50 submits in RAW264.7 cells.
We next examined the effects of quercetin and catechin, either
alone or in combination, on LPS‐induced activation of MAPKs. As
shown in Figure 5a–c, the mRNA levels of transcription factors
including JUN, c‐FOS, and ELK1 were significantly (p< 0.05) unregu-
lated in RAW 264.7 cells upon exposure to LPS. Catechin at 6 μM signif-
icantly (p< 0.05) inhibited the upregulation of LPS‐stimulated JUN and
c‐FOS mRNA, but no effects on ELK1 mRNA. Quercetin at 150 μM did
not have a significant influence on the JUN mRNA but markedly
(p< 0.05) inhibited the upregulation of c‐FOS and enhanced the
expression of ELK1 compared with the LPS alone. When RAW264.7
cells were treated with the combination of 3‐μM quercetin + 75‐μM
catechin, the upregulation of JUN and c‐FOS induced by LPS was
significantly (p< 0.05) inhibited in a similar way to that of catechin. It
is noteworthy that the combination showed an enhanced inhibitory
effect on the mRNA levels of ELK1 than any of the single compounds.
The effects of the combination of quercetin with catechin on the
phosphorylation of ELK1 are shown in Figure 5d. Upon LPS
stimulation, ELK1 was markedly (p< 0.05) phosphorylated compared
with the control. Quercetin and catechin, either alone or in combina-
tion, dramatically (p< 0.05) restrained the LPS‐induced upregulation
of phosphorylated ELK1 protein. In particular, the cotreatment of
quercetin with catechin led to a lower level of p‐ELK1 protein than
any of quercetin or catechin.
In addition, MAPKs family proteins (i.e., JNK, p38, and ERK) are
upstream of the above transcription factors. The activation of MAPK
family proteins is an important trigger for ELK1 phosphorylation
induction (Kasza, 2013). Therefore, the phosphorylation of JNK, p38,
and ERK was examined by western blotting. As shown in Figure 5e–g,
when RAW264.7 cells were treated with LPS alone, the phosphoryla-
tion of MAPKs family proteins was significantly (p< 0.05) increased.
However, the treatment of quercetin and catechin either alone or in
combination suppressed LPS‐induced phosphorylation of JNK, p38,
and ERK. Moreover, the combined treatment showed more potent
(p< 0.05) inhibitory effect on phosphorylation of JNK in LPS‐stimulated
RAW 264.7 cells.
The gene expressions of key targets involved in TLR4/MyD88
pathway were examined in LPS‐stimulated RAW 264.7 cells by qRT‐
PCR. As shown in Figure 6a–h, LPS treatment markedly (p< 0.05)
influenced the mRNA levels of TLR4, MyD88, IRAK4, IRAK1, TRAF6,
TAB1, TAB2, and TAK1 compared with the control. The combination
FIGURE 3 Effects of quercetin, catechin, or their combination on expression of tumor necrosis factor α(TNF‐α) and interleukin‐1β(IL‐1β)in
lipopolysaccharide (LPS)‐stimulated RAW 264.7 macrophages. The cells (5 × 10
4
cells per well) were treated with either 1 μg/ml of LPS alone
or LPS with 6‐μM quercetin, 150‐μM catechin, or the combination of 3‐μM quercetin with 75‐μM catechin for 24 hr. The production levels of
TNF‐αand IL‐1βin the culture media were determined by enzyme‐linked immunosorbent assay. The mRNA levels of TNF‐αand IL‐1βwere
analyzed by real‐time quantitative reverse transcriptase polymerase chain reaction. (a) The production levels of TNF‐α. (b) The production levels of
IL‐1β. (c) The mRNA levels of TNF‐α. (d) The mRNA levels of IL‐1β.
#
p< 0.05 versus control group.
*
p< 0.05 versus the LPS‐treated alone group
6LI ET AL.
of quercetin with catechin markedly (p< 0.05) restored LPS‐induced
the mRNA levels of TLR4, MyD88, IRAK1, TRAF6, and TAK1. How-
ever, neither quercetin nor catechin had significant influences on the
MyD88 genes compared with the LPS alone, whereas their combina-
tion led to a lower level of MyD88 mRNA than any of quercetin or
catechin alone. Similar effects were also observed for the MyD88
protein expression (Figure 6i). These findings suggested that
cotreatment of quercetin and catechin restored the impaired expres-
sion of TLR4 and MyD88, as well as some downstream effectors such
as IRAK1, TRAF6, and TAK1, which were involved in the activation of
NF‐κB and MAPK signaling pathways. Moreover, there exists a syner-
gistic inhibition of MyD88 at mRNA and protein levels when quercetin
and catechin were used in combination, suggesting that MyD88 might
be an important target of synergistic activities of the combination.
4|DISCUSSION
Quercetin and catechin are among the widely renowned bioflavonoids
found in fruits and vegetables. Previous studies have revealed that
flavonoids can interact together, leading to generation of several syn-
ergistic properties, such as antioxidative and antiplatelet aggregation
effect (Silberberg, Morand, Manach, Scalbert, & Remesy, 2005).
Although quercetin and catechin exhibited remarkable anti‐
inflammatory ability via different molecular mechanisms (Vazquez
Prieto et al., 2015), there appear to be few reports focusing on the
possible anti‐inflammatory synergism between them. Thus, this study
was initiated to investigate the possible anti‐inflammatory synergism
between quercetin and catechin using LPS‐stimulated RAW 264.7
macrophages bioassay.
Inflammation reaction is indeed innate immune defensive reac-
tions to eliminate infection from foreign pathogens or injury damaged
cells and to initiate tissue wound healing. In inflammation processes,
immune cells such as monocytes and mast cells are secreted with
increased production of proinflammatory cytokines, enzymes, and
inflammatory secondary mediators (Lee et al., 2015). In the present
study, we found that the quercetin and catechin either alone or in
combination were able to significantly attenuate the LPS‐stimulated
increase of some inflammatory mediators and cytokines in RAW
264.7 macrophages. Moreover, the cotreatments of both compounds
FIGURE 4 Effects of quercetin, catechin, or their combination on the nuclear factor κB (NF‐κB) pathway in lipopolysaccharide (LPS)‐stimulated
RAW 264.7 macrophages. The cells (5 × 10
4
cells per well) were treated with either 1 μg/ml of LPS alone or LPS with 6‐μM quercetin, 150‐μM
catechin, or the combination of 3‐μM quercetin with 75‐μM catechin for 24 hr. The mRNA levels of NF‐κB p65 and p50 were measured by real‐
time quantitative reverse transcriptase polymerase chain reaction. The protein levels of NF‐κB p65 and p50 were determined by western blot. (a)
The mRNA levels of NF‐κB p65. (b) The mRNA levels of NF‐κB p50. (c) The protein expression of NF‐κB p65. (d) The protein expression of NF‐κB
p50.
#
p< 0.05 versus control group.
*
p< 0.05 versus the LPS‐treated alone group
LI ET AL.7
were more effective than any of them in concentrations where cell
viability was maintained at >80%, suggesting that their anti‐
inflammatory effects were indeed attributed to synergistic actions
between them, rather than the disruption of normal cellular function.
The combination index values of the combinations of quercetin and
catechin further confirmed the synergistic anti‐inflammatory action.
It is known that some proinflammatory mediators/cytokines (i.e., NO
and PG E2) are generated through the activity of iNOS and COX‐2
(Ritchlin et al., 2003). iNOS and COX‐2 catalyze from L‐arginine into
L‐citrulline and synthesis of PGs from arachidonic acid, respectively.
These two enzymes are believed to be the most important inflamma-
tory mediators (Fujimura, Ohta, Oyama, Miyashita, & Miwa, 2007).
Thus, we investigated whether the combination treatment affected
their expression in LPS‐stimulated macrophages. Results showed that
the combination caused much higher inhibition of the LPS‐activated
upregulation of iNOS and COX‐2 compared with the summation of
FIGURE 5 Effects of quercetin, catechin, or their combination on expression of mitogen‐activated protein kinases family proteins in
lipopolysaccharide (LPS)‐stimulated RAW 264.7 macrophages. The cells (5 × 10
4
cells per well) were treated with either 1 μg/ml of LPS alone
or LPS with 6‐μM quercetin, 150‐μM catechin, or the combination of 3‐μM quercetin with 75‐μM catechin for 24 hr. The mRNA levels of JUN,
c‐FOS, and ETS domain‐containing protein (ELK1) were measured by real‐time quantitative reverse transcriptase polymerase chain reaction. The
protein levels of ELK1, c‐Jun N‐terminal kinase (JNK), p38, and extracellular signal‐regulated kinase (ERK) were determined by western blot. (a–c)
The mRNA levels of JUN, c‐FOS, and ELK1. (d) The protein levels of ELK1. (e) The protein levels of JNK. (f) The protein levels of p38. (g) The
protein levels of ERK.
#
p< 0.05 versus control group.
*
p< 0.05 versus the LPS‐treated alone group
8LI ET AL.
the effect of each in the combination. Our results agree with the pre-
vious report that the suppression of iNOS and COX‐2 protein was
related to anti‐inflammatory actions of various phytonutrients. For
instance, Park et al. (2011) revealed that luteolin and chicoric acid
cotreatment synergistically ameliorated LPS‐induced inflammation
responses through the suppression of proinflammatory proteins in
RAW 264.7 cells.
NF‐κB is a key transcription factor involved in the regulation of
proinflammatory cytokines and chemokines. In unstimulated cells, it
is present in cytosol as a homodimer or heterodimer and interacts with
IκB. However, upon LPS stimulation, IκB was phosphorylated by IKK
and followed by proteasome‐mediated degradation of IκB, leading to
the nuclear translocation of NF‐κB and subsequent activation of tar-
get genes (Oeckinghaus & Ghosh, 2009). It is evidenced that NF‐κB
pathway plays a central role in controlling chronic inflammatory dis-
eases (Tao et al., 2008), as well as in inducing the production of proin-
flammatory cytokines and inflammatory mediators, such as NO,
TNF‐α, and IL‐1β(Cho et al., 2016). There are many reports on the
inhibition of the NF‐κB signaling pathway by various flavonoids. For
examples, some researchers found that baicalein inhibits NF‐κB trans-
location, NF‐κB‐dependent transcriptional activity, and iNOS expres-
sion through the inhibition of IκB degradation in RAW264.7 cells
(Cheng et al., 2007). These findings prompted us to assess whether
NF‐κB pathway was also responsive to the inhibitory effect of the
combination of quercetin with catechin. Our results showed that nei-
ther quercetin nor catechin alone significantly affected the phosphor-
ylation of NF‐κB p65 and p50 submits at mRNA and protein levels in
LPS‐stimulated RAW264.7 cells, indicating that NF‐κB signaling path-
way might not be a major target of the anti‐inflammatory action of
quercetin and catechin when each was used individually. These find-
ings are inconsistent with those from other researchers. Min et al.
(2007) reported that quercetin inhibited the expression of inflamma-
tory cytokines through inhibiting the degradation of IκBαand nuclear
translocation of NF‐κB p65 submit. Babu, Si, and Liu (2012) revealed
that epigallocatechin gallate (EGCG) reduced vascular inflammation
through suppressing the nuclear translocation of NF‐κB p65 submit.
The reasons might be related to altered dosages of the compound
used in these studies. By contrast, the expression of NF‐κB p50 and
FIGURE 6 Effects of quercetin, catechin, or their combination on toll‐like receptor 4 (TLR4)‐mediated myeloid differentiation primary response
gene 88 (MyD88)‐dependent signaling pathway in lipopolysaccharide (LPS)‐stimulated RAW 264.7 cells. The cells (5 × 10
4
cells per well) were
treated with either 1 μg/ml of LPS alone or LPS with 6‐μM quercetin, 150‐μM catechin, or the combination of 3‐μM quercetin with 75‐μM
catechin for 24 hr. The mRNA levels of TLR4, MyD88, IRAK4, IRAK1, TRAF6, TAB1, TAB2, and TAK1 were measured by real‐time quantitative
reverse transcriptase polymerase chain reaction. The protein levels of MyD88 were determined by western blot. (a–h) The mRNA levels of TLR4,
MyD88, IRAK4, IRAK1, TRAF6, TAB1, TAB2, and TAK1, respectively. (i) The protein levels of MyD88.
#
p< 0.05 versus control group.
*
p< 0.05
versus the LPS‐treated alone group [Colour figure can be viewed at wileyonlinelibrary.com]
LI ET AL.9
p65 was markedly decreased at mRNA and protein levels when quer-
cetin and catechin were used in combination, suggesting that the syn-
ergistic effect of both compounds in downregulating inflammatory
mediators might be through suppressing p50 and p65 expression at
mRNA and protein levels in LPS‐stimulated RAW 246.7 cells.
Besides NF‐κB signaling pathway, LPS stimulation of macro-
phages usually activates other intracellular signaling pathways, such
as three classical MAPKs pathways: ERK1/2, p38 MAPK, and JNK.
Moreover, once activated, MAPKs pathways in turn activate a variety
of transcription factors including NF‐κB (p50/p65) and activator pro-
tein 1 (c‐FOS/c‐JUN; Tak & Firestein, 2001). Recent studies reported
that the protective role of quercetin or catechin against inflammatory
reactions was related to MAPKs pathways (Hirao et al., 2010). There-
fore, we next analyzed their effects on MAPKs pathway. Catechin
alone significantly inhibited the phosphorylation of three MAPK family
proteins (ERK, p38, and c‐JUN), whereas quercetin was effective for
ERK and p38 MAPK. By contrast, the combination exhibited the com-
parable potency to the catechin in suppressing the phosphorylation of
three MAPK family proteins but was higher for the inhibition of phos-
phorylated JNK. Meanwhile, the ELK1 was markedly decreased at
mRNA and protein levels when quercetin and catechin were used in
combination than when used individually. The transcription factor of
ELK1 is one of the important downstream targets of MEK–ERK1/2
pathway. Collectively, these data suggest that the synergic anti‐
inflammatory response of quercetin and catechin was related to the
MAPK pathway, and ELK1 and JNK might be the major potential
targets.
TLR4‐mediated MyD88‐dependent signaling pathway plays an
important role in the activation of NF‐κB and MAPK pathways (He
et al., 2013). It is evidenced that LPS‐stimulated inflammation
response is mediated by pattern recognition receptors including
TLR4 (Akira & Takeda, 2004; Kawai & Akira, 2010; Mogensen,
2009). The recognition of LPS by TLR4 triggers the initiation of a seri-
ous of cascades including MyD88 adaptor protein that recruits IRAK4,
thereby allowing the association and phosphorylation IRAK4 as well as
IRAK‐1 (Rock, Hardiman, Timans, Kastelein, & Bazan, 1998). After-
wards, IRAK1 and TRAF‐6 form a complex that can interact with
TAK1, TAB1, and TAB2, leading to the phosphorylation of TAB2 and
TAK1 (Lu, Yeh, & Ohashi, 2008). This process triggers the transloca-
tion of many transcription factors from the cytosol to the nucleus,
such as p50 and p65 (Brasier, 2010), and the activation of MAPK
signaling cascades (Adcock & Caramori, 2001). Recent studies showed
that the protective effect of quercetin on mouse liver against CCl
4
‐
induced inflammation was mediated by TLR2/TLR4 and
MAPK/NF‐κB signaling pathway (Ma, Li, Xie, Liu, & Liu, 2015). Tea
polyphenols also could prevent the ischemic/reperfusion injury
through the suppression extrinsic apoptotic signal pathway induced
by TLR4/NF‐κB p65 signal pathway (Li et al., 2014). Our results
showed that cotreatment of quercetin and catechin restored the
impaired expression of TLR4 and MyD88, as well as some down-
stream effectors such as IRAK1, TRAF6, and TAK1. Moreover, there
exists a synergistic inhibition of MyD88 at mRNA and protein levels
when quercetin and catechin were used in combination, suggesting
that MyD88 might be an important target of synergistic action of
quercetin and catechin.
Drug combinations have been widely used as a promising choice
for treating inflammation. There are multiple beneficial effects by
using these drug combinations, such as increasing the therapeutic effi-
ciency, decreasing the dosages, and achieving selective synergism
(Chou, 2006). Taken together, the results obtained in our study for
FIGURE 7 Schematic diagram of the
proposed synergistic anti‐inflammatory
mechanism of the combination of quercetin
with catechin in lipopolysaccharide (LPS)‐
stimulated RAW 264.7 cells. Quercetin and
catechin synergistically suppressed the
production of proinflammatory mediators and
cytokines at multiple targets: p50 and p65 at
transcription and phosphorylation levels in
nuclear factor κB (NF‐κB) signal pathway, ETS
domain‐containing protein (ELK1) at
transcription and phosphorylation levels, c‐
Jun N‐terminal kinase (JNK) at
phosphorylation level in mitogen‐activated
protein kinases, and myeloid differentiation
primary response gene 88 (MyD88) at
transcription and protein levels. Red area
denotes synergistic target [Colour figure can
be viewed at wileyonlinelibrary.com]
10 LI ET AL.
the first time showed that quercetin and catechin are able to synergis-
tically suppress the production of proinflammatory mediators and
cytokines in LPS‐stimulated RAW 264.7 macrophages via inhibiting
multiple targets involved in TLR4–MyD88‐mediated NF‐κB and MAPK
signaling pathways.
5|CONCLUSIONS
The results obtained in our study for the first time showed that quer-
cetin and catechin were able to synergistically suppress the produc-
tion of proinflammatory mediators and cytokines in LPS‐stimulated
RAW 264.7 macrophages via inhibiting multiple targets involved in
TLR4–MyD88‐mediated NF‐κB and MAPK signaling pathways
(Figure 7). These results may provide some basis for the combined
use of quercetin and catechin as an effective anti‐inflammatory agent
in the future. However, animal experiments are needed to elucidate
the molecular mechanism behind the synergistic anti‐inflammatory
actions of quercetin and catechin in the future.
ACKNOWLEDGEMENTS
This work was supported by the National Natural Science Foundation
of China (31571836 and 31201417), Shandong Provincial Natural
Science Foundation (ZR2018BC063), Shandong Agricultural Innova-
tion Team (SDAIT‐24‐05), and Shandong “Double Tops”Program
(SYT2017XTTD04).
CONFLICT OF INTEREST
The authors have declared that there is no conflict of interest.
ORCID
Dapeng Li https://orcid.org/0000-0002-1816-3217
REFERENCES
Adcock, I. M., & Caramori, G. (2001). Cross‐talk between pro‐inflammatory
transcription factors and glucocorticoids. Immunology and Cell Biology,
79, 376–384. https://doi.org/10.1046/j.1440‐1711.2001.01025.x
Akira, S., & Takeda, K. (2004). Toll‐like receptor signalling. Nature Reviews
Immunology,4, 499–499, 511. https://doi.org/10.1038/nri1391
Babu, P. V. A., Si, H., & Liu, D. (2012). Epigallocatechin gallate reduces vas-
cular inflammation in db/db mice possibly through an NF‐κB‐mediated
mechanism. Molecular Nutrition & Food Research,56, 1424–1432.
https://doi.org/10.1002/mnfr.201200040
Brasier, A. R. (2010). The nuclear factor‐κB–interleukin‐6 signalling path-
way mediating vascular inflammation. Cardiovascular Research,86,
211–218. https://doi.org/10.1093/cvr/cvq076
Chan, M. M. Y., Mattiacci, J. A., Hwang, H. S., Shah, A., & Fong, D. (2000).
Synergy between ethanol and grape polyphenols, quercetin, and res-
veratrol, in the inhibition of the inducible nitric oxide synthase
pathway. Biochemical Pharmacology,60, 1539–1548. https://doi.org/
10.1016/S0006‐2952(00)00471‐8
Chen, J. C., Ho, F. M., Chao, P. D. L., Chen, C. P., Jeng, K. C. G., Hsu, H. B., …
Lin, W. W. (2005). Inhibition of iNOS gene expression by quercetin is
mediated by the inhibition of IκB kinase, nuclear factor‐kappa B and
STAT1, and depends on heme oxygenase‐1 induction in mouse BV‐2
microglia. European Journal of Pharmacology,521,9–20. https://doi.
org/10.1016/j.ejphar.2005.08.005
Cheng, P. Y., Lee, Y. M., Wu, Y. S., Chang, T. W., Jin, J. S., & Yen, M. H.
(2007). Protective effect of baicalein against endotoxic shock in rats
in vivo and in vitro. Biochemical Pharmacology,73, 793–804. https://
doi.org/10.1016/j.bcp.2006.11.025
Cho, K. H., Kim, D. C., Yoon, C. S., Ko, W. M., Lee, S. J., Sohn, J. H., …Oh, H.
(2016). Anti‐neuroinflammatory effects of citreohybridonol involving
TLR4‐MyD88‐mediated inhibition of NF‐кB and MAPK signaling
pathways in lipopolysaccharide‐stimulated BV2 cells. Neurochemistry
International,95,55–62. https://doi.org/10.1016/j.neuint.2015.12.010
Chou, T. C. (2006). Theoretical basis, experimental design, and computer-
ized simulation of synergism and antagonism in drug combination
studies. Pharmacological Reviews,58, 621–681. https://doi.org/
10.1124/pr.58.3.10
Christiansen, O. B., Nielsen, H. S., & Kolte, A. M. (2006). Inflammation and
miscarriage. Seminars in Fetal and Neonatal Medicine,11, 302–308.
https://doi.org/10.1016/j.siny.2006.03.001
Formica, J. V., & Regelson, W. (1995). Review of the biology of quercetin
and related bioflavonoids. Food and Chemical Toxicology,33,
1061–1080. https://doi.org/10.1016/0278‐6915(95)00077‐1
Fujimura, T., Ohta, T., Oyama, K., Miyashita, T., & Miwa, K. (2007).
Cyclooxygenase‐2 (COX‐2) in carcinogenesis and selective COX‐2
inhibitors for chemoprevention in gastrointestinal cancers. Journal of
Gastrointestinal Cancer,38,78–82. https://doi.org/10.1007/s12029‐
008‐9035‐x
He, W., Qu, T., Yu, Q., Wang, Z., Lv, H., Zhang, J., …Wang, P. (2013).
LPS induces IL‐8 expression through TLR4, MyD88, NF‐κB and
MAPK pathways in human dental pulp stem cells. International
Endodontic Journal,46, 128–136. https://doi.org/10.1111/j.1365‐
2591.2012.02096.x
Hirao, K., Yumoto, H., Nakanishi, T., Mukai, K., Takahashi, K., Takegawa, D.,
…Matsuo, T. (2010). Tea catechins reduce inflammatory reactions via
mitogen‐activated protein kinase pathways in toll‐like receptor 2
ligand‐stimulated dental pulp cells. Life Sciences,86, 654–660.
https://doi.org/10.1016/j.lfs.2010.02.017
Kasza, A. (2013). Signal‐dependent Elk‐1 target genes involved in tran-
script processing and cell migration. Biochimica et Biophysica Acta,
1829, 1026–1033. https://doi.org/10.1016/j.bbagrm.2013.05.004
Kawai, T., & Akira, S. (2010). The role of pattern‐recognition receptors in
innate immunity: Update on Toll‐like receptors. Nature Immunology,
11, 373–384. https://doi.org/10.1038/ni.1863
Lee, S. H., Yang, H. W., Ding, Y., Wang, Y., Jeon, Y. J., Moon, S. H., …Sung,
S. H. (2015). Anti‐inflammatory effects of enzymatic hydrolysates of
velvet antler in RAW 264.7 cells in vitro and zebrafish model. EXCLI
Journal,14, 1122–1132. https://doi.org/10.17179/excli2015‐481
Li, Y. W., Zhang, Y., Zhang, L., Li, X., Yu, J. B., Zhang, H. T., …Liu, H. G.
(2014). Protective effect of tea polyphenols on renal
ischemia/reperfusion injury via suppressing the activation of
TLR4/NF‐κB p65 signal pathway. Gene,542,46–51. https://doi.org/
10.1016/j.gene.2014.03.021
Lin, W., Wu, R. T., Wu, T., Khor, T. O., Wang, H., & Kong, A. N. (2008). Sul-
foraphane suppressed LPS‐induced inflammation in mouse peritoneal
macrophages through Nrf2 dependent pathway. Biochemical Pharma-
cology,76, 967–973. https://doi.org/10.1016/j.bcp.2008.07.036
Lu, Y. C., Yeh, W. C., & Ohashi, P. S. (2008). LPS/TLR4 signal transduc-
tion pathway. Cytokine,42, 145–151. https://doi.org/10.1016/j.
cyto.2008.01.006
Lyons, C. R. (1995). The role of nitric oxide in inflammation. Advances in
Immunology,60, 323–371. https://doi.org/10.1016/S0065‐
2776(08)60589‐1
Ma, J. Q., Li, Z., Xie, W. R., Liu, C. M., & Liu, S. S. (2015). Quercetin protects
mouse liver against CCl
4
‐induced inflammation by the TLR2/4 and
MAPK/NF‐κB pathway. International Immunopharmacology,28,
531–539. https://doi.org/10.1016/j.intimp.2015.06.036
Min, Y. D., Choi, C. H., Bark, H., Son, H. Y., Park, H. H., Lee, S., …Kim, S. H.
(2007). Quercetin inhibits expression of inflammatory cytokines
through attenuation of NF‐κB and p38 MAPK in HMC‐1 human mast
cell line. Inflammation Research,56, 210–215. https://doi.org/
10.1007/s00011‐007‐6172‐9
LI ET AL.11
Mogensen, T. H. (2009). Pathogen recognition and inflammatory signaling
in innate immune defenses. Clinical Microbiology Reviews,22,
240–273. https://doi.org/10.1128/CMR.00046‐08
Oeckinghaus, A., & Ghosh, S. (2009). The NF‐κB family of transcription
factors and its regulation. Cold Spring Harbor Perspectives in Biology,1,
a000034.
Park, C. M., Jin, K. S., Lee, Y. W., & Song, Y. S. (2011). Luteolin and chicoric
acid synergistically inhibited inflammatory responses via inactivation of
PI3K‐Akt pathway and impairment of NF‐κB translocation in LPS
stimulated RAW 264.7 cells. European Journal of Pharmacology,660,
454–459. https://doi.org/10.1016/j.ejphar.2011.04.007
Qureshi, A. A., Tan, X., Reis, J. C., Badr, M. Z., Papasian, C. J., Morrison,
D. C., & Qureshi, N. (2011). Suppression of nitric oxide induction and
pro‐inflammatory cytokines by novel proteasome inhibitors in various
experimental models. Lipids in Health and Disease,10, 177–177.
https://doi.org/10.1186/1476‐511X‐10‐177
Ritchlin, C. T., Haas‐Smith, S. A., Li, P., Hicks, D. G., & Schwarz, E. M.
(2003). Mechanisms of TNF‐α–and RANKL‐mediated osteoclastogen-
esis and bone resorption in psoriatic arthritis. Journal of Clinical
Investigation,111, 821–831. https://doi.org/10.1172/JCI200316069
Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., & Bazan, J. F.
(1998). A family of human receptors structurally related to Drosophila
Toll. PNAS,95, 588–593. https://doi.org/10.1073/pnas.95.2.588
Rodea‐Palomares, I., Petre, A. L., Boltes, K., Leganes, F., Perdigon‐Melon,
J. A., Rosal, R., & Fernández‐Piñas, F. (2010). Application of the combi-
nation index (CI)‐isobologram equation to study the toxicological
interactions of lipid regulators in two aquatic bioluminescent organ-
isms. Water Research,44, 427–438. https://doi.org/10.1016/j.
watres.2009.07.026
Saw, C. L., Huang, Y., & Kong, A. N. (2010). Synergistic anti‐inflammatory
effects of low doses of curcumin in combination with polyunsaturated
fatty acids: Docosahexaenoic acid or eicosapentaenoic acid.
Biochemical Pharmacology,79, 421–430. https://doi.org/10.1016/j.
bcp.2009.08.030
Silberberg, M., Morand, C., Manach, C., Scalbert, A., & Remesy, C. (2005).
Co‐administration of quercetin and catechin in rats alters their
absorption but not their metabolism. Life Sciences,77, 3156–3167.
https://doi.org/10.1016/j.lfs.2005.03.033
Tak, P. P., & Firestein, G. S. (2001). NF‐κB: A key role in inflammatory
diseases. Journal of Clinical Investigation,107,7–11. https://doi.org/
10.1172/JCI11830
Tao, J. Y., Zhao, L., Huang, Z. J., Zhang, X. Y., Zhang, S. L., Zhang, Q. G., …
Zheng, J. H. (2008). Anti‐inflammatory effects of ethanol extract from
Kummerowia striata (Thunb.) Schindl on LPS‐stimulated RAW 264.7
cell. Inflammation,31, 154–166. https://doi.org/10.1007/s10753‐
008‐9061‐7
Vazquez Prieto, M. A., Bettaieb, A., Rodriguez Lanzi, C., Soto, V. C.,
Perdicaro, D. J., Galmarini, C. R., …Oteiza, P. I. (2015). Catechin and
quercetin attenuate adipose inflammation in fructose‐fed rats and
3T3‐L1 adipocytes. Molecular Nutrition & Food Research,59, 622–633.
https://doi.org/10.1002/mnfr.201400631
Wang, D., Sun‐Waterhouse, D., Li, F., Xin, L., & Li, D. (2018).
MicroRNAs as molecular targets of quercetin and its derivatives
underlying their biological effects: A preclinical strategy. Critical
Reviews in Food Science and Nutrition,1–13. https://doi.org/
10.1080/10408398.2018.1441123
Yuan, X., Sun, Y., Miao, N., Sun, S., Wang, Y., Hu, Z., …Liu, Z. (2011). The
synergistic anti‐inflammatory effect of the combination of sodium
ferulate and oxymatrine and its modulation on inflammation‐
associated mediators in RAW 264.7 cells. Journal of
Ethnopharmacology,137, 1477–1485. https://doi.org/10.1016/j.
jep.2011.08.031
How to cite this article: Li T, Li F, Liu X, Liu J, Li D. Synergistic
anti‐inflammatory effects of quercetin and catechin via
inhibiting activation of TLR4–MyD88‐mediated NF‐κB and
MAPK signaling pathways. Phytotherapy Research.
2019;1–12. https://doi.org/10.1002/ptr.6268
12 LI ET AL.
