Content uploaded by Daiqing Liao
Author content
All content in this area was uploaded by Daiqing Liao on Feb 14, 2014
Content may be subject to copyright.
2006;66:9445-9452. Cancer Res
Lisa Y. Zhao, Yuxin Niu, Aleixo Santiago, et al.
Cell Cycle Arrest and Apoptosis
An EBF3-Mediated Transcriptional Program That Induces
Updated version
http://cancerres.aacrjournals.org/content/66/19/9445
Access the most recent version of this article at:
Material
Supplementary
http://cancerres.aacrjournals.org/content/suppl/2006/09/29/66.19.9445.DC1.html
Access the most recent supplemental material at:
Cited Articles
http://cancerres.aacrjournals.org/content/66/19/9445.full.html#ref-list-1
This article cites by 23 articles, 11 of which you can access for free at:
Citing articles
http://cancerres.aacrjournals.org/content/66/19/9445.full.html#related-urls
This article has been cited by 8 HighWire-hosted articles. Access the articles at:
E-mail alerts
related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
.permissions@aacr.orgDepartment at
To request permission to re-use all or part of this article, contact the AACR Publications
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
An EBF3-Mediated Transcriptional Program That Induces
Cell Cycle Arrest and Apoptosis
Lisa Y. Zhao,
1
Yuxin Niu,
1
Aleixo Santiago,
1
Jilin Liu,
1
Sara H. Albert,
1
Keith D. Robertson,
2,3
and Daiqing Liao
1,3,4
Departments of
1
Anatomy and Cell Biology and
2
Biochemistry and Molecular Biology,
3
Program in Cancer Genetics,
Epigenetics and Tumor Virology, and
4
Program in Signaling, Apoptosis and Cancer, Shands Cancer Center,
University of Florida College of Medicine, Gainesville, Florida
Abstract
In a genome-wide screen for putative tumor suppressor genes,
the EBF3 locus on the human chromosome 10q26.3 was found
to be deleted or methylated in 73% of the examined cases of
brain tumors. EBF3 is expressed in normal brain but is
silenced in brain tumors. Therefore, it is suggested that EBF3
is a tumor suppressor. However, it remains unknown whether
inactivation of EBF3 locus also occurs in other types of tumors
and what functions of EBF3 underlie EBF3-mediated tumor
suppression. We show here that expression of EBF3 resulted in
cell cycle arrest and apoptosis. The expression of cyclin-
dependent kinase inhibitors was profoundly affected with
early activation and then repression of p21
cip1/waf1
and
persistent activation of both p27
kip1
and p57
kip2
, whereas
genes involved in cell survival and proliferation were sup-
pressed. EBF3 bound directly to p21
cip1/waf1
promoter and
regulated transcription from both p21
cip1/waf1
and p27
kip1
promoters in reporter assays. Apoptosis occurred 48 hours
after EBF3 expression with caspase-3 activation. Silencing of
the EBF3 locus was observed in brain, colorectal, breast, liver,
and bone tumor cell lines and its reactivation was achieved on
treatment with 5-aza-2¶-deoxycytidine and trichostatin A in a
significant portion of these tumor cells. Therefore, EBF3
regulates a transcriptional program underlying a putative
tumor suppression pathway. (Cancer Res 2006; 66(19): 9445-52)
Introduction
The early B-cell factors (EBF; also known as Olf, COE, or O/E;
this family of proteins is hereafter called EBF) are a group of DNA-
binding transcription factors with the basic helix-loop-helix
(bHLH) domain. These factors were discovered in 1993 indepen-
dently as proteins that are involved in regulating expression of
genes in two specific cell types: B lymphocyte (1) and olfactory cell
(2). Later studies revealed that these factors are expressed in B
lymphocytes, adipocytes, neuronal cells, and several other cell types
and that they have specific roles in regulating differentiation in
cells originating from all three embryonic germ layers (3). The
human and mouse genomes each carry four genes of EBF family
(EBF1-EBF4) and multiple alternatively spliced transcripts from
each gene exist (3). These factors have well-recognized bHLH
domains. The two amphipathic helices of 15 amino acids,
separated by a loop of 7 amino acids, are strikingly similar, which
distinguishes the EBF family from other known bHLH families of
proteins that usually contain two dissimilar helices (4). This family
of proteins bind directly to DNA sequences with a consensus of
5¶-CCCNNGGG-3¶ as homodimers or heterodimers (5, 6). Within the
highly conserved DNA-binding domain, there is a sequence motif
that defines the signature of the EBF family (termed as COE). This
signature sequence is an atypical Zn
2+
finger (H-X
3
-C-X
2
-C-X
5
-C)
and is absolutely required for DNA binding (7). The COOH-terminal
serine/threonine-rich sequence is the transactivation domain,
although other sequences also contribute to transactivation (7).
These proteins exist only in the animal kingdom from Caeno-
rhabditis elegans to the humans. The EBF orthologues in Drosophila
melanogaster (Collier) and C. elegans (Unc-3) are involved in
neurogenesis, which might be regulated through genetic interac-
tions between EBF and the hedgehog or notch pathway (8). In the
mouse, all four members of the EBF family are expressed in olfactory
receptor neurons, where they regulate the expression of olfactory
genes (5, 9). During mouse embryogenesis, EBF members are
expressed in early postmitotic neurons from the midbrain to the
spinal cord and at specific sites in the embryonic forebrain,
suggesting that they may regulate neuronal maturation in the
central nervous system (CNS; refs. 8, 10, 11). EBF2 is expressed in the
embryonic CNS (12) and targeted inactivation of EBF2 has revealed
roles for EBF2 in peripheral nerve morphogenesis, migration of
hormone-producing neurons, and projection of olfactory neurons
(9, 13). During neuronal differentiation, the members in the EBF
family might have distinct roles. For example, the mouse EBF2 seems
to act earlier than EBF1 or EBF3. In Xenopus, EBF3 is implicated
in promoting differentiation of specific neuronal subtypes (3, 8).
In addition to roles in neuronal differentiation, the EBF family of
transcription factors are also implicated in other developmental
pathways. It has been extensively documented that EBF1 is
essential for B-cell development (14, 15). EBF1-deficient mice
produce only B-biased progenitor cells but not mature B cells (16).
EBF2 is a regulator of osteoblast-dependent differentiation of
osteoclasts and targeted disruption of EBF2 resulted in reduced
bone mass (17). Although mice deficient for EBF1 and EBF2 are
viable (9, 13, 16, 17), homozygous EBF3 knockout mice exhibited
neonatal lethality before postnatal day 2, suggesting that EBF
family members are not functionally redundant (9).
A genome-wide screen using integrated genomic and epigenetic
analyses revealed that the EBF3 locus at the human chromosome
10q26.3 is biallelically altered by methylation and/or deletion in
most high-grade brain tumor cases (18). Whereas EBF3 was found
to be inactivated in 50% of grade II tumors, 83% of grade III and
90% of grade IV brain tumors have mutated (deleted) or silenced
Note: Current address for J. Liu: Applied Genetic Technologies Corp., 11801
Research Drive, Suite D, Alachua, FL 32615. Current address for S.H. Albert:
Department of Biology, University of Louisiana at Lafayette, P.O. Box 42451,
Lafayette, LA 70504-2451.
Requests for reprints: Daiqing Liao, Department of Anatomy and Cell Biology,
Shands Cancer Center, University of Florida College of Medicine, P.O. Box 103633, 1376
Mowry Road, Gainesville, FL 32611-3633. Phone: 352-273-8188; Fax: 352-273-8285;
E-mail: dliao@ufl.edu.
I2006 American Association for Cancer Research.
doi:10.1158/0008-5472.CAN-06-1713
www.aacrjournals.org
9445
Cancer Res 2006; 66: (19). October 1, 2006
Research Article
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
EBF3 locus (18). Consistently, EBF3 is expressed in normal brain
cells but is silenced in brain tumor cells (18). These data suggest
that EBF3 is a potential tumor suppressor in brain tumors,
although what functions of EBF3 at biochemical or cellular levels
are implicated in tumor suppression remain unknown. Further-
more, whether EBF3 inactivation is involved in the development of
tumors of other tissue origins has not been examined. In this study,
we show that inactivation of the EBF3 locus occurs not only in
brain tumors but also in breast, colorectal, liver, and bone tumor
cells. Strikingly, expression of EBF3 in tumor cells resulted in
growth suppression and apoptosis. In cells with EBF3 expression,
genes involved in growth suppression were activated, whereas
those involved in cell growth and proliferation were suppressed.
Therefore, EBF3 regulates a transcriptional program that may
underpin its tumor suppression function.
Materials and Methods
Antibodies. Antibodies to Bax, caspase-3, CDC2, cyclin-dependent
kinase (CDK) 2, cyclin A, Daxx, EBF, p16 (CDKN2A), p21
cip1/waf1
(hereafter
called p21), p27
kip1
(hereafter called p27), p57
kip2
(hereafter called p57), p107
(Rbl1), and poly(ADP-ribose) polymerase (PARP) were from Santa Cruz
Biotechnology (Santa Cruz, CA); those to AKT, Bcl-xL, and myeloid cell
leukemia-1 (Mcl-1) were from Cell Signaling (Danvers, MA); and antibodies
to extracellular signal-regulated kinase 1/2 (ERK1/2), FLAG, and a-tubulin
were from Sigma (St. Louis, MO). The anti–Janus kinase 1 (JAK1) antibody
was from BD Biosciences (San Jose, CA).
Recombinant adenoviruses. A mouse EBF3 cDNA clone was provided
by Dr. Randall Reed (Johns Hopkins University). The EBF3 open reading
frame encoding 596 amino acids was preceded by codons for FLAG epitope
and cloned into pShuttle-CMV. The EBF3 H157A mutant was generated
using QuickChange protocol (Stratagene, La Jolla, CA). Recombinant
adenoviruses for EBF3 and its mutant were generated with the AdEasy
system (Stratagene). Near confluent cell culture was infected with viruses
with a multiplicity of infection of f10. Infected cells were harvested at 24,
48, 72, and 96 hours postinfection. The infected cells were processed either
for Western blot analysis or flow cytometry as described (19).
Electrophoresis mobility shift assays. Synthetic oligonucleotides were
annealed to form dsDNA and their 5¶ ends were labeled with [g-
32
P]ATP using
T4 polynucleotide kinase. FLAG-EBF3 and FLAG-EBF3 H157A were purified
from Saos2 cells transfected with a relevant expression plasmid using affinity
gel in which monoclonal anti-FLAG M2 is conjugated to agarose beads
(Sigma) according to the manufacturer’s protocol. Purified FLAG-EBF3 or the
H157A mutant was preincubated in a reaction volume of 20 AL containing
10 mmol/L HEPES (pH 7.5), 70 mmol/L KCl, 1 mmol/L EDTA, 2.5 mmol/L
MgCl
2
,1mmol/LZnCl
2
,5%glycerol,0.1Ag/AL poly(deoxyinosinic-
deoxycytidylic acid), 5 Ag/AL bovine serum albumin, 0.05% NP40, and
1 mmol/L DTT on ice for 20 minutes. The labeled oligonucleotides (0.066
pmol) was then added to the reaction mix and further incubated at 30jC for
20 minutes. For antibody-mediated supershift, 0.5 Ag anti-FLAG antibody was
added to the reaction and incubated further for 10 minutes at 30jC. For
competition using nonradioactive DNA, 0.5 pmol nonradioactive DNA was
added in the binding reaction. The reaction mix was separated on a 6% native
polyacrylamide gel with 0.5
Tris-borate-EDTA (45 mmol/L Tris-borate,
2 mmol/L EDTA). The gel was dried and subjected to autoradiography.
Figure 1. EBF3 suppresses tumor cell growth. A, Saos2 cells were grown in six-well plates and were either untreated (Mock ; a, d, g , and j ) or infected with
recombinant adenoviruses for EBF3 (Ad-EBF3 ; b, e, h, and k) or EBF3 H157A (Ad-EBF3 H157A ; c, f, i, and l). Cells were photographed at 24, 48, 72, and 96 hours
after infection. B, HCT116 cells were cotransfected with a vector for puromycin-resistant gene along with the empty vector, EBF3, or EBF3 H157A expression vector.
Cells were selected in medium containing puromycin and grown until visible colonies appeared. The colonies were stained and counted and relative numbers are
plotted.
Cancer Research
Cancer Res 2006; 66: (19). October 1, 2006
9446
www.aacrjournals.org
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
Chromatin immunoprecipitation. Saos2 cells grown on 10-cm dishes
were infected with recombinant adenovirus encoding EBF3, and 24 hours
after infection, the cells were fixed with 1% formaldehyde for 10 minutes at
room temperature. The rest of steps in chromatin immunoprecipitation
were done according to a typical protocol using 2 Ag anti-EBF (Santa Cruz
Biotechnology). PCR on immunoprecipitated templates was done with one
step at 95j C for 5 minutes and 35 cycles of 95jC, 55jC, and 72jC each for
95 seconds and a final step at 72jC for 2 minutes. The PCR primers used
were ( from 5¶ to 3¶) p21 promoter forward GGTAAATCCTTGCCTGCCA-
GAG and reverse ACTTCCCTCCTCCCCCAGTC and h-actin promoter
forward ACGCCAAAACTCTCCCTCCTCCTC and reverse CATAAAAGG-
CAACTTTCGGAACGGC.
Luciferase promoter reporter assays. The 2.4 kb p21 promoter was
progressively deleted from the 5¶ end and all promoter fragments were
cloned into pGL3-Basic (Promega, Madison, WI). The set of p27 promoter
reporter constructs was obtained from Dr. Toshiyuki Sakai (Kyoto
Prefectural University of Medicine, Kyoto, Japan; ref. 20). Saos2 cells were
seeded in 48-well plates and were transfected with the indicated expression
plasmid, promoter reporter construct, and SV40-Renilla control reporter
vector. Lysates were assayed at 24 hours after transfection using the Dual
Luciferase Reporter System (Promega).
Assessing EBF3 expression in tumor cells and its reactivation.
Reverse transcription-PCR (RT-PCR) was carried out according to standard
protocols. Briefly, untreated and treated cells were homogenized in Trizol and
the RNA was purified according to the manufacturer’s instructions
(Invitrogen, Carlsbad, CA). First-strand cDNA synthesis was carried out
using SuperScript III RT (Invitrogen). Subsequently, the cDNA was used in
semiquantitative PCR using the following primers (sequences from 5¶ to 3¶):
EBF1 forward CAACTTCTTCCACTTCGTCCTGG and reverse CACATTTCT-
GGGTTCTTGTCTTGG, EBF3 forward CGAGAAAACCAACAACGGCATC and
reverse ATGATTACAGGGTCTGAGGGCG, and EBF4 forward CCAACTT-
CTTCCACTTCGTGCTG and reverse CTTGTCCTGCCCCTCATAGATG. Am-
plification of glyceraldehyde-3-phosphate dehydrogenase was used as a
control for RNA integrity for all samples. Following PCR, reaction products
were resolved on 2% agarose gels and photographed using a Bio-Rad
(Hercules, CA) gel documentation system.
For reactivation experiments, cell lines were treated with 5 Amol/L 5-aza-
2¶-deoxycytidine for 4 days (fresh drug was added every 24 hours) followed
by a 24-hour treatment with 100 nmol/L trichostatin A. All chemicals were
purchased from Sigma.
Results
Expression of EBF3 in tumor cells results in growth arrest
and apoptosis. To assess the effect of EBF3 expression on the
growth and proliferation of tumor cells, we have transduced several
tumor cell lines with recombinant adenovirus for wild-type EBF3
(Ad-EBF3) or the DNA-binding mutant H157A (Ad-EBF3 H157A).
We found that EBF3 expression profoundly restricted the growth of
several tumor cell lines, including glioblastoma U87 MG, osteosar-
coma Saos2, and colon carcinoma HCT116. The growth of these
tumor cells was almost completely suppressed within 4 days of
infection with Ad-EBF3 but not with Ad-EBF3 H157A (see Fig. 1;
data not shown). Saos2 cells continued to grow in mock and Ad-
EBF3 H157A-treated cells. By contrast, the Ad-EBF3-infected cells
started to detach from the culture plate by 48 hours postinfection,
and most of the cells were detached with very few attached cells by
96 hours postinfection (Fig. 1A). Interestingly, EBF3-mediated
killing of tumor cells seems to be selective, as several prostate
cancer cell lines were completely resistant to Ad-EBF3 infection
(data not shown).
EBF3-mediated killing of Saos2 cells and inactivation of EBF3 in
brain tumors (18) suggest that EBF3 might have broad tumor
suppression functions in diverse tumor cells. To further substan-
tiate this possibility, we assayed effects of EBF3 expression on the
growth of colon carcinoma cell HCT116. Empty vector, or that
carrying cDNA for EBF3 or H157A mutant, was cotransfected with
a plasmid carrying the puromycin-resistant gene. As shown in
Fig. 1B, transfection of wild-type EBF3, but not the H157A mutant
cDNA, drastically reduced the number of puromycin-resistant
colonies. Thus, EBF3 suppresses the growth of colon cancer cells.
Flow cytometry analysis of Ad-EBF3-transduced Saos2 cells
revealed that G
1
arrest was evident within 24 hours and peaked
48 hours postinfection with 90% of cells in the G
1
phase of the cell
cycle (Fig. 2). EBF3 expression also resulted in inhibition of DNA
replication, as the percentage of cells in the S phase was markedly
reduced in cells with EBF3 expression as opposed to mock-infected
or Ad-EBF3 H157A-infected cells. At a late time after infection with
Figure 2. EBF3 promotes cell cycle arrest and apoptosis.
Saos2 cells were either not treated (Mock ) or infected
with Ad-EBF3 or Ad-EBF3 H157A mutant. Cells were
harvested for flow cytometry analyses at different time
points. Percentage of cells in each phase of the cell
cycle as well as that of apoptotic cells with sub-G
1
DNA
content under different treatments is separately plotted.
hpi, hours postinfection. Points, results of two independent
experiments; bars, SD. Dark gray line, mock; black line,
EBF3; thick light gray line, EBF3 H157A.
Transcriptional Regulation by EBF3
www.aacrjournals.org
9447
Cancer Res 2006; 66: (19). October 1, 2006
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
Ad-EBF3 (72 and 96 hours postinfection), cell cycle arrest at the
G
2
-M phase was also evident (Fig. 2). Finally, Saos2 cells underwent
apoptosis on EBF3 expression as cells with sub-G
1
DNA content
were accumulating starting at 48 hours after Ad-EBF3 infection
(Fig. 2). Importantly, the DNA-binding mutant H157A had no
obvious effects on cell cycle progression and apoptosis (Fig. 2).
Therefore, it is likely that EBF3 suppresses tumor cell growth and
proliferation through cell cycle arrest and apoptosis.
EBF3 activates genes involved in growth inhibition but
represses genes required for cell growth and survival. To
understand the molecular mechanisms underlying EBF3-imposed
restriction on cell proliferation, we analyzed the expression of some
important players involved in the regulation of cell cycle
progression and apoptosis. Strikingly, the expression of CDK
inhibitors (CDKI) p21, p27, and p57 was markedly elevated
24 hours after Ad-EBF3 infection (Fig. 3A). The increased
Figure 3. Gene expression of the EBF3-mediated transcriptional program. Saos2 cells were either not treated (Mock ) or infected with Ad-EBF3 or Ad-EBF3 H157A
mutant. Cells were harvested for Western blot analyses at different time points. Antibodies for each blot are denoted. Protein concentration of cell extracts was
measured with the Bradford method. Equal amount of total cellular proteins was loaded in each lane as shown in the a-tubulin (Tub ) blot. Arrows, intact and cleaved
proteins in caspase-3 and PARP blots. A, EBF3 regulates the expression of genes for CDKIs. B, EBF3 represses the genes involved in cell proliferation and survival.
C, EBF3 inhibits the expression of antiapoptotic genes.
Cancer Research
Cancer Res 2006; 66: (19). October 1, 2006
9448
www.aacrjournals.org
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
expression of p27 and p57 persisted throughout the course of
infection with peak expression at 48 and 72 hours postinfection for
p27. The expression pattern of p27 correlated strictly with the G
1
arrest induced by EBF3. Thus, at 48 hours postinfection, 90% of the
cells were arrested at the G
1
phase (Fig. 2), when the expression of
p27 was also highest (Fig. 3A). Interestingly, p21 expression peaked
at 24 hours postinfection but was then repressed at later times
after Ad-EBF3 infection. By contrast, EBF3 did not influence the
expression of p16
INK4A
, an inhibitor of cyclin D-CDK4/6 holoen-
zymes (Fig. 3A). Collectively, our findings suggest that EBF3
specifically activates the expression of p21, p27, and p57, all of
which belong to the Cip/Kip family of CDKIs and specifically
inhibit cyclin A-CDK2 or cyclin E-CDK2 holoenzymes. Of note, the
levels of the wild-type EBF3 protein seemed to be higher than that
of the H157A mutant (Fig. 3A). Nonetheless, differential expression
of the two constructs did not influence these observations, as EBF3
were able to induce specific gene expression at a much lower dose
(10-fold lower than that used for Fig. 3), whereas the H157A mutant
did not affect gene expression and cell growth at any dose tested
(data not shown). EBF3-mediated activation of p21 and p27 is likely
direct, as EBF3 can stimulate the promoters of both p21 and p27 in
reporter gene assays (see below) and EBF3 binds to p21 promoter
in gel electrophoresis mobility shift assay (EMSA) and chromatin
immunoprecipitation experiments (see below).
We then analyzed the expression patterns of genes involved in
cell growth and proliferation. As shown in Fig. 3B, EBF3 inhibited
the expression of several key proteins involved in cell cycle
progression, including cyclin A, CDC2, and CDK2 (Fig. 3B) as well
as cyclin B (data not shown). Down-regulation of CDC2 and CDK2
was observed as early as 24 hours after Ad-EBF3 infection, and at
later time points, the levels of these proteins were drastically
reduced. In contrast, cyclin D1 expression was not affected (data
not shown).
Saos2 cells do not contain functional retinoblastoma protein
(Rb). Because Rb family proteins can inhibit both proliferation and
apoptosis (21), we wondered whether EBF3 could regulate the
Figure 4. EBF3 binds to and activates
the p21 promoter. A, EBF3 activates the
proximal p21 promoter. Top, schematic
representation of the human p21 promoter.
Some known cis -elements along with their
positions are indicated. p53 BS, p53
binding site. The p21 promoter was deleted
progressively from the distal 5¶ end and
the 5¶ position of each deletion mutant is
indicated. A putative EBF-binding site was
mutated in p21-162m-Luc. The mutations
were the same as in p21#1m1 in (C).
The luciferase reporter with the specified
fragment of the p21 promoter was
transfected alone or together with a mouse
EBF3 expression plasmid into Saos2 cells.
Dual luciferase assays were done with
the extracts of transfected cells 24 hours
after transfection. B, effects of coexpression
of p53 and EBF3 on the p21 promoter.
The firefly luciferase reporter driven by
the 2.4-kb p21 promoter (p21-Luc) was
transfected into Saos2 cells alone or
together with p53, EBF3 expression vector,
or both. Dual luciferase reporter assays were
done 24 hours after transfection. C, EBF3
binds to the p21 promoter. Top, DNA
probe for each protein-DNA interaction
assay. In some reactions, anti-FLAG
antibody was included. M, 1-kb DNA size
markers. Arrows, positions of free DNA
probes. The DNA sequences of the
used probes for EMSA are shown. The
EBF3-binding site is indicated in white with
gray background; mutated nucleotides are
denoted with lowercase letter. D, purified
FLAG-EBF3. The protein was purified using
anti-FLAG affinity gel and eluted with FLAG
peptide. The eluate was examined using
Western blotting with anti-FLAG antibody.
E, chromatin immunoprecipitation analysis
of EBF3-p21 promoter interaction.
Saos2 cells infected with Ad-EBF3 were
subjected to chromatin immunoprecipitation
with anti-EBF antibody and the
immunoprecipitates were PCR amplified
using primers specific to the proximal region
of the p21 promoter or to the h-actin
promoter. The amplified PCR fragment from
the p21 promoter lies 95 bp 5¶ to the putative
EBF-binding site.
Transcriptional Regulation by EBF3
www.aacrjournals.org
9449
Cancer Res 2006; 66: (19). October 1, 2006
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
expression of Rb family proteins. Interestingly, EBF3 expression
resulted in specific repression of p107, a member of Rb family
(Fig. 3B). Down-regulation of p107 was seen as early as 24 hours
postinfection with Ad-EBF3, and more profound repression was
evident at later times during EBF3 expression (Fig. 3B). AKT
expression was moderately down-regulated at 72 and 96 hours after
Ad-EBF3 infection and the expression of mitogen-activated kinase
p38 (MAPK14), ERK1/2, and JAK1 was not at all affected (data not
shown).
If EBF3 expression indeed triggers apoptosis, we would expect
the appearance of apoptotic markers. We thus have examined the
expression of various proapoptotic and antiapoptotic proteins.
Whereas EBF3 did not affect the expression of either antiapoptotic
Bcl-2 family protein Bcl-xL or the proapoptotic Bax (data not
shown), it markedly repressed the expression of Mcl-1, an
antiapoptotic Bcl-2 family protein (Fig. 3C). Interestingly, strong
repression of Daxx expression by EBF3 was also observed,
consistent with an antiapoptotic role for Daxx in this situation as
we reported previously (19). Strikingly, activation of caspase-3 and
cleavage of PARP, two hallmark events during apoptosis, occurred
48 hours postinfection of Ad-EBF3 (Fig. 3C). Thus, EBF3 expression
resulted in apoptotic cell death.
EBF3 regulates p21 and p27 promoters. The results described
above indicate that EBF3 regulates the expression of inhibitors of
CDKs p21 and p27 (Fig. 3). To assess whether EBF3 directly
mediates the transcription of both genes, we first did luciferase
reporter gene assays. Data presented in Fig. 4A revealed that EBF3
expression markedly elevated the reporter activities driven by a set
of constructs of the p21 promoter. The data also indicated that
only the proximal region of the p21 promoter is required.
Inspection of the DNA sequence of this region allowed us to
identify a single putative EBF-binding site (121 to 128) that
resembles the consensus EBF-binding sequence (see Fig. 3C). We
mutated this site in the p21 reporter and found that this mutated
reporter (p21-162m-Luc) was no longer responsive to EBF3
expression (Fig. 4A).
Whereas p21 is a prototypical p53 target gene, our data indicated
that p53 probably does not influence EBF3-mediated regulation of
p21. First, EBF3 could activate p21 expression in Saos2 cells that
are deficient of p53 (Figs. 3 and 4A). Second, the p21 promoter
constructs lacking the p53-binding sites (p21-769-Luc, p21-419-Luc,
and p21-162-Luc in Fig. 4A) could still be activated by EBF3.
Furthermore, we coexpressed p53 and EBF3 in reporter assays.
Data presented in Fig. 4B indicate that these two factors showed no
synergy in regulating the p21 promoter.
To verify whether EBF3 indeed binds to the putative EBF-binding
site in the p21 promoter, we have done EMSA. Purified FLAG-
tagged EBF3 from transfected Saos2 cells was incubated with a
radioactive double-stranded oligonucleotide containing the EBF-
binding site (p21#1, Fig. 4C). The mobility of this DNA probe was
retarded (Fig. 4C, lane 5) and addition of anti-FLAG antibody
resulted in supershift of the retarded band (Fig. 4C, lane 6).
Mutations within the EBF-binding site abolished EBF3-binding to
the DNA (p21#1m1 and p21#1m2, Fig. 4C, lanes 7-9; note that two
shifted bands in lanes 7 and 8 were nonspecific because addition of
anti-FLAG antibody did not result in supershift). We have also
tested the interaction between EBF3 and several other oligonucle-
otide probes that together span the entire proximal region of the
p21 promoter from 162 to +10. EBF3 did not bind to any DNA
probe without the putative EBF-binding site (data not shown). As a
positive control, we assayed the interaction of the purified FLAG-
EBF3 with human Mb-1 promoter, a known target gene of EBF1 (1).
FLAG-EBF3 could bind to the DNA probe containing the wild-type
but not the mutated EBF-binding site from the human Mb-1
promoter (compare lanes 2 and 4 in Fig. 4C). Furthermore,
addition of anti-FLAG antibody also resulted in supershift of the
Figure 5. EBF activates the p27 promoter.
A schematic representation of the human
p27 promoter. The transcription start site
is designated as +1. The position of the
translational initiation codon (ATG ) is also
indicated. The p27 promoter was deleted
progressively from the distal 5¶ end and the
5¶ position of each deletion construct is
indicated relatively to the +1 site. Each
reporter construct is specifically named as
described by Inoue et al. (20). Base
substitutions were made at two putative
Sp1 sites and a CTF (NF-Y) site. The
luciferase reporter with a specified fragment
of the p27 promoter was transfected alone
or together with either vector for mouse
EBF3 or the H157A mutant into Saos2 cells.
Dual luciferase assays were done with
the extracts of transfected cells 24 hours
after transfection.
Cancer Research
Cancer Res 2006; 66: (19). October 1, 2006
9450
www.aacrjournals.org
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
EBF3-DNA complex (Fig. 4C, lane 3). Therefore, EBF3 specifically
binds to the p21 promoter.
To further assess the interaction of EBF3 with the p21 promoter,
we have carried out chromatin immunoprecipitation assay. We
found that in Saos2 cells infected by Ad-EBF3, the proximal region
of the p21 promoter near the EBF-binding site was significantly
enriched by the anti-EBF antibody, whereas h-actin promoter
was not (Fig. 4E). Similar results were obtained from glioblastoma
LN-229 cells that express endogenous EBF3 (data not shown).
Therefore, EBF3 associates with the p21 promoter at the chromatin
levels.
We also assayed whether EBF3 could activate the p27 promoter.
Data shown in Fig. 5 indicate that EBF3, but not EBF3 H157A
mutant, activated the p27 promoter using luciferase reporter gene
assay. Interestingly, EBF3 had very little effects on constructs
p27AflIII and p27No.2, but luciferase activity was restored or even
increased on further deletion from the 5¶ end of the p27 promoter.
A simple explanation for these observations is that one or more
cis-acting elements locating around 107 to 84 might confer
inhibition to EBF3-mediated transcription from the p27 promoter.
This inhibition can be overcome in the presence of upstream DNA
sequence. Consistent with this interpretation, mutation of a
putative Sp1 site at 78 (p27mSp1-1) or a putative CTF (p27mCTF)
at 58 resulted in increased reporter activities (Fig. 5). Collectively,
our results suggest that EBF3 directly activates the expression of
the p27 gene.
Epigenetic inactivation of EBF3 in tumors. We have examined
a panel of brain tumor cell lines for the expression of EBF family of
transcription factors using RT-PCR. Consistent with previous
findings regarding inactivation of EBF3 in brain tumors (18),
EBF3 expression was undetectable or very low in four of six brain
tumor cell lines, whereas the levels of EBF1 expression were
markedly higher and detectable in all six lines (see Fig. 6A; data not
shown). In glioblastoma cell line T98G, treatment with inhibitors of
DNA methyltransferase (5-aza-2¶-deoxycytidine) and histone deace-
tylases (trichostatin A) resulted in strong reactivation of EBF3. By
contrast, the same treatment did not cause increased expression of
EBF1 or EBF4 (Fig. 6A). Thus, our data suggest that EBF3 is
selectively silenced in brain tumors and its expression could be
reactivated with 5-aza-2¶-deoxycytidine and trichostatin A.
We have also examined EBF3 expression in tumor cell lines of
various tissue origins and found that EBF3 is silenced in 5 of 8 (63%)
colorectal tumor cell lines and 7 of 7 (100%) breast tumor cell lines
and 1 of 2 bone tumor cell lines (Fig. 6B; data not shown) as well as
6 of 8 liver cancer lines (data not shown). With the exception of
bone tumors, EBF3 can be reactivated with 5-aza-2¶-deoxycytidine
and trichostatin A in most of these examined tumor cells (Fig. 6B;
data not shown). Taken together, our findings indicate that
epigenetic silencing of EBF3 is a widely occurring phenomenon
in human cancers; remarkably, EBF3 silencing can be reversed after
treatment with anticancer drugs.
Discussion
A previous study showed that EBF3 locus is inactivated in brain
tumors (18). Here, we found that EBF3 gene is silenced in tumor
cell lines of diverse tissue origins, such as breast, bone, and
colorectal cancers. Importantly, our results provided a plausible
explanation for EBF3-mediated tumor suppression. EBF3 expres-
sion in tumor cells results in growth suppression and apoptosis. It
regulates a gene expression program in which genes involved in cell
cycle arrest, such as the Cip/Kip family of CDKIs are selectively up-
regulated, and in the same time, genes involved in cell proliferation
(e.g., cyclins and CDKs) and survival (Daxx and Mcl-1) are
repressed. Apoptosis was induced on EBF3 expression as
caspase-3 activation and cleavage of PARP were observed.
For many of the genes whose expression was affected on EBF3
expression, EBF3 may directly mediate their transcriptional
activation or repression through interacting with specific binding
sites in the promoters of these genes. Indeed, EBF3 binds to the
p21 promoter and regulates the expression of p21 and p27 in
reporter gene assays. In support of this interpretation, the EBF3
H157A, a DNA-binding mutant, failed to elicit specific gene
expression and killing of tumor cells. Notably, EBF3 constitutively
activated the expression of p27 and p57 (Fig. 3A). Therefore, EBF3
regulates the expression of all three members of Cip/Kip family of
CDKIs, which specifically inhibit cyclin A-CDK2 or cyclin E-CDK2
holoenzymes. Additionally, EBF3 also represses the expression of
CDK2 and cyclin A (Fig. 3B). In conjunction with our finding that it
does not affect the expression of p16
INK4A
, our data suggest that
EBF3 specifically and profoundly suppresses the cyclin A-CDK2
activities at multiple levels, which may account for EBF3-mediated
cell cycle arrest.
Interestingly, for the p21 gene, we have observed a striking
switch from activation at early time point of EBF3 expression to
repression at a later time point (see Fig. 3A). This switch seems to
Figure 6. Epigenetic silencing of EBF3 locus in tumor cells. A, expression of
EBF family of transcription factors in brain tumor. Glioblastoma T98G cells
were either untreated () or treated (+) with 5-aza-2¶-deoxycytidine (5-azadC ;
5 Amol/L) + trichostatin A (TSA ;0.1Amol/L). RT-PCR was done using RNA
extracted from the cells and specific primers to EBF1, EBF3, or EBF4.
B, epigenetic silencing of EBF3 locus in colon, breast, and bone tumors.
Tumor cell lines were either untreated or treated with 5-aza-2¶-deoxycytidine
(5 Amol/L) + trichostatin A (0.1 Amol/L). RT-PCR was done using RNA extracted
from the cells and specific primers to EBF3.
Transcriptional Regulation by EBF3
www.aacrjournals.org
9451
Cancer Res 2006; 66: (19). October 1, 2006
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
coincide with the onset of apoptosis as activation of caspase-3 and
cleavage of PARP started around 48 hours after EBF3 expression.
This observation suggests that down-regulation of p21 may be
necessary for the activation of apoptosis. It has been documented
that cytoplasmic localization of overexpressed p21 correlates with
inhibition of apoptosis, cancer cell survival, and poor prognosis of
cancer patients (22). How this activation-repression switch of p21
expression is achieved is unknown. One scenario could be an
ordered exchange of activators and repressors on the p21 promoter
in a situation similar to signal-dependent activation of c-Jun
transcription factor although in a reversed order of events (23).
Further studies on the mechanisms underlying EBF3-regulated p21
expression might shed important insight into how cells coordinate
transcription and apoptosis.
We were able to detect EBF3 expression in several tumor cell lines,
such as colon tumor lines SW48 and LoVo and glioblastoma cell line
LN-229 (data not shown) as well as osteosarcoma U2-OS (Fig. 6B).
Thus, EBF3 is not universally silenced. In conjunction with the
findings that EBF3 is expressed in normal brain cells (18), our data
suggest that EBF3 is probably expressed in differentiated cells of
different organs and epigenetic silencing of EBF3 occurs specifically
in tumor cells. On treatment of tumor cells with 5-aza-2¶-deoxy-
cytidine and trichostatin A, EBF3 was reactivated in most of the
studied cell lines. However, in a small portion of these cell lines, such
as colon cancer cell lines HT29 and T84, breast tumor cell line SKBR3
(data not shown) and bone tumor Saos2 (Fig. 6B), the same drug
treatment was unable to promote EBF3 expression. Although it is
unknown what the cause for the failure to reactivate EBF3 in these
tumor cells was, one possibility is that the EBF3 locus is completely
deleted in these tumor cell lines, as deletion of EBF3 locus has been
found in glioblastoma (18). Additionally, small-scale inactivating
mutations of the EBF3 coding sequence, such as point mutations,
small insertions, and deletions, could also occur in tumors, especially
in tumor cells with detectable expression of EBF3. Further studies
will be required to determine whether genetic mutations occur
within the coding sequence of the EBF3 gene.
Acknowledgments
Received 5/11/2006; revised 6/27/2006; accepted 7/27/2006.
Grant support: NIH grants RO1 CA92236 (D. Liao) and 5T32 CA09126-29
(S.H. Albert) and American Lung Association Florida, Inc. Career Investigator Award
(D. Liao).
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank James Hagman, Tom Kadesch, Randall Reed, Toshiyuki Sakai, and Bert
Vogelstein for DNA constructs.
References
1. Hagman J, Belanger C, Travis A, Turck CW, Grosschedl
R. Cloning and functional characterization of early
B-cell factor, a regulator of lymphocyte-specific gene
expression. Genes Dev 1993;7:760–73.
2. Wang MM, Reed RR. Molecular cloning of the
olfactory neuronal transcription factor Olf-1 by genetic
selection in yeast. Nature 1993;364:121–6.
3. Liberg D, Sigvardsson M, Akerblad P. The EBF/
Olf/Collier family of transcription factors: regula-
tors of differentiation in cells originating from all
three embryonal germ layers. Mol Cell Biol 2002;22:
8389–97.
4. Maier H, Hagman J. Roles of EBF and Pax-5 in B
lineage commitment and development. Semin Immunol
2002;14:415–22.
5. Wang SS, Tsai RY, Reed RR. The characterization of the
Olf-1/EBF-like HLH transcription factor family: impli-
cations in olfactory gene regulation and neuronal
development. J Neurosci 1997;17:4149–58.
6. Wang SS, Betz AG, Reed RR. Cloning of a novel Olf-1/
EBF-like gene, O/E-4, by degenerate oligo-based direct
selection. Mol Cell Neurosci 2002;20:404–14.
7. Hagman J, Gutch MJ, Lin H, Grosschedl R. EBF
contains a novel zinc coordination motif and multiple
dimerization and transcriptional activation domains.
EMBO J 1995;14:2907–16.
8. Dubois L, Vincent A. The COE-Collier/Olf1/EBF-
transcription factors: structural conservation and
diversity of developmental functions. Mech Dev 2001;
108:3–12.
9. Wang SS, Lewcock JW, Feinstein P, Mombaerts P, Reed
RR. Genetic disruptions of O/E2 and O/E3 genes reveal
involvement in olfactory receptor neuron projection.
Development 2004;131:1377–88.
10. Garel S, Marin F, Mattei MG, Vesque C, Vincent A,
Charnay P. Family of Ebf/Olf-1-related genes potentially
involved in neuronal differentiation and regional
specification in the central nervous system. Dev Dyn
1997;210:191–205.
11. Garel S, Marin F, Grosschedl R, Charnay P. Ebf1
controls early cell differentiation in the embryonic
striatum. Development 1999;126:5285–94.
12. Malgaretti N, Pozzoli O, Bosetti A, et al. Mmot1, a
new helix-loop-helix transcription factor gene displaying
a sharp expression boundary in the embryonic mouse
brain. J Biol Chem 1997;272:17632–9.
13. Corradi A, Croci L, Broccoli V, et al. Hypogonado-
tropic hypogonadism and peripheral neuropathy in
Ebf2-null mice. Development 2003;130:401–10.
14. Medina KL, Pongubala JM, Reddy KL, et al.
Assembling a gene regulatory network for specification
of the B cell fate. Dev Cell 2004;7:607–17.
15. Hagman J, Lukin K. Transcription factors drive B cell
development. Curr Opin Immunol 2006;18:127–34.
16. Lin H, Grosschedl R. Failure of B-cell differentiation
in mice lacking the transcription factor EBF. Nature
1995;376:263–7.
17. Kieslinger M, Folberth S, Dobreva G, et al. EBF2
regulates osteoblast-dependent differentiation of osteo-
clasts. Dev Cell 2005;9:757–67.
18. Zardo G, Tiirikainen MI, Hong C, et al. Integrated
genomic and epigenomic analyses pinpoint biallelic
gene inactivation in tumors. Nat Genet 2002;32:453–8.
19. Zhao LY, Liu J, Sidhu GS, et al. Negative regulation of
p53 functions by Daxx and the involvement of MDM2.
J Biol Chem 2004;279:50566–79.
20. Inoue T, Kamiyama J, Sakai T. Sp1 and NF-Y
synergistically mediate the effect of vitamin D(3) in
the p27(Kip1) gene promoter that lacks vitamin D
response elements. J Biol Chem 1999;274:32309–17.
21. Chau BN, Wang JY. Coordinated regulation of life and
death by RB. Nat Rev Cancer 2003;3:130–8.
22. Xia W, Chen JS, Zhou X, et al. Phosphorylation/
cytoplasmic localization of p21
Cip1/WAF1
is associated
with HER2/neu overexpression and provides a novel
combination predictor for poor prognosis in breast
cancer patients. Clin Cancer Res 2004;10:3815–24.
23. Ogawa S, Lozach J, Jepsen K, et al. A nuclear receptor
corepressor transcriptional checkpoint controlling acti-
vator protein 1-dependent gene networks required for
macrophage activation. Proc Natl Acad Sci U S A 2004;
101:14461–6.
Cancer Research
Cancer Res 2006; 66: (19). October 1, 2006
9452
www.aacrjournals.org
Research.
on June 3, 2013. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from
