Content uploaded by Dae-Hee Lee
Author content
All content in this area was uploaded by Dae-Hee Lee on Jun 05, 2022
Content may be subject to copyright.
Cloning, expression, and characterization of single-chain
variable fragment antibody against mycotoxin
deoxynivalenol in recombinant Escherichia coli
Gyu-Ho Choi,
a
Dae-Hee Lee,
a
Won-Ki Min,
a
Young-Jin Cho,
a
Dae-Hyuk Kweon,
b
Dong-Hwa Son,
c
Kyungmoon Park,
d
and Jin-Ho Seo
a,*
a
School of Agricultural Biotechnology, Seoul National University, Seoul 151-742, Republic of Korea
b
School of Bioresource Sciences, Andong National University, Andong, Kyungbuk 760-749, Republic of Korea
c
Korea Food Research Institute, Sungnam 463-746, Republic of Korea
d
Eugene Science Inc., Pucheon 421-150, Republic of Korea
Received 29 October 2003, and in revised form 11 December 2003
Abstract
Deoxynivalenol (DON), a mycotoxin produced by several Fusarium species, is a worldwide contaminant of food and feedstuffs.
The DON-specific single-chain variable fragment (scFv) antibody was produced in recombinant Escherichia coli. The variable re-
gions of the heavy chain (VH) and light chain (VL) cloned from the hybridoma 3G7 were connected with a flexible linker using an
overlap extension polymerase chain reaction. Nucleotide sequence analysis revealed that the anti-DON VHwas a member of the VH
III gene family IA subgroup and the VLgene belonged to the Vkgene family II subgroup. Extensive efforts to express the functional
scFv antibody in E. coli have been made by using gene fusion and chaperone coexpression. Coexpression of the molecular chap-
erones (DnaK-DnaJ-GrpE) allowed soluble expression of the scFv. The scFv antibody fused with hexahistidine residues at the
C-terminus was purified by immobilized metal affinity chromatography (IMAC). Soluble scFv antibody produced in this manner
was characterized for its antigen-binding characteristics. Its biological affinity as antibody was measured by surface plasmon
resonance (SPR) analysis and proved to be significant but weaker than that of the whole anti-DON mAb.
Ó2004 Elsevier Inc. All rights reserved.
Keywords: Deoxynivalenol; scFv; Molecular chaperone; Inclusion body; Escherichia coli
Many toxigenic species of Fusarium are common
pathogens of cereal plants, causing diseases such as head
blight that greatly reduces the yields of wheat, barley,
maize, and other grains [1]. Even more devastating
losses result from several mycotoxins produced by these
fungi. The most important toxin in terms of human
exposure is trichothecene deoxynivalenol (DON), which
was first identified in late 1979 in the United States and
has since been found worldwide [2]. DON, sometimes
called vomitoxin, is a low-molecular weight inhibitor of
protein synthesis of cell membrane and has hemolytic
activity. Ingestion of contaminated grain or byproducts
of exposed animals causes severe long-term illness,
including immunosuppression, neurotoxicity, and nu-
trient uptake alteration [3–5]. Because of known toxicity
of DON combined with its prevalence, several ap-
proaches to detect DON such as mass spectrometry and
enzyme-linked immunosorbent assay (ELISA) have
been reported [6,7].
Antibody fragments can be readily expressed in
Escherichia coli, allowing low-cost production and pu-
rification, important advantages for many applications
[8]. The scFv fragments are contiguous polypeptides
consisting of the variable heavy chain (VH) and the
variable light chain (VL) of an immunoglobulin linked
together by a 15- to 20-amino acid flexible linker. The
resulting small antibody fragment still retains the
binding specificity and affinity comparable to that of
its parent antibody [9]. ScFv has a wide range of
*
Corresponding author. Fax: +82-2-873-5095.
E-mail address: jhseo94@snu.ac.kr (J.-H. Seo).
1046-5928/$ - see front matter Ó2004 Elsevier Inc. All rights reserved.
doi:10.1016/j.pep.2003.12.008
Protein Expression and Purification 35 (2004) 84–92
www.elsevier.com/locate/yprep
therapeutic and diagnostic applications because of small
size and its retained antigen binding properties. Re-
cently, the scFv strategy has become one of the most
popular methods in antibody engineering, offering nu-
merous advantages over traditional methods. Most
single-chain antibodies, however, tend to form inclusion
bodies when expressed in bacteria, especially in E. coli
[10–12]. It is desirable to express them in soluble form in
vivo, so that they may directly be purified, characterized,
and employed without a tedious step of protein refold-
ing in vitro. Especially, available protein engineering
methodologies readily allow evolution and modification
of the recombinant antibody when scFv is expressed as
soluble form in E. coli.
Here, we cloned anti-DON scFv gene and expressed it
in recombinant E. coli. To the extent of our information,
this is the first report for the anti-DON scFv. The ex-
pressed scFv resulted in the formation of inclusion bo-
dies. Among several approaches performed to express
the scFv in soluble form, coexpression of molecular
chaperones to alleviate protein aggregation was most
effective. This strategy would be useful for the pre-
parative production of other recombinant antibodies.
Materials and methods
Bacterial strains and plasmids
Escherichia coli DH5awas used for plasmid DNA
preparation. E. coli BL21(DE3) and Orgami(DE3)
(gor,trxB) strains for expression of the anti-DON
scFv were purchased from Novagen (USA).
Plasmids pTscFvH6 and pTpelscFvH6 were con-
structed for expression of the scFv tagged with hexa-
histidine at the C-terminus. The former was constructed
from pET-29b(+) (Novagen) and the latter, fused with
the pelB leader sequence at the N-terminus of anti-DON
scFv, was constructed from pET-26b(+) (Novagen).
Plasmid pGSTscFv derived from pGEX-5X-3 (Amer-
sham Biosciences) was used to express the scFv fused
with the glutathione-S-transferase (GST) at the N-ter-
minus. Plasmids encoding the molecular chaperone,
pGro7, pKJE7, and pG-KJE3 in which the
LL
-arabinose-
inducible promoter (ara BAD) was used to express
GroEL-GroES, DnaK-DnaJ-GrpE, and GroEL-
GroES-DnaK-DnaJ-GrpE [13], respectively, were
kindly donated by Dr. Hideki Yanagi (HSP Research
Institute, Kyoto Research Park, Kyoto, Japan).
First strand cDNA synthesis
The mouse hybridoma cell line 3G7 against DON
was established and maintained in RPMI 1640 (Invit-
rogen) supplemented with antibiotics and 10% fetal
bovine serum (Invitrogen).
For total RNA isolation from the hybridoma cell line
3G7 producing anti-DON monoclonal antibody (mAb),
TRIzol Reagent (Invitrogen) was used according to
manufacturerÕs instructions. The cDNA coding for the
variable heavy and light chains was synthesized from the
total RNA template using Moloney Murine Leukemia
Virus Reverse Transcriptase (Promega) and random
primers (hexamer) of RPAS Mouse ScFv Module
(Amersham Biosciences).
Construction of scFv expression vector
All DNA manipulation and bacterial transformation
were based upon the methods described by Sambrook
et al. [14]. Genes encoding the variable heavy and light
chains of the anti-DON antibody were constructed using
the multiple overlap polymerase chain reaction (PCR)
method described by Stemmer et al. [15]. The variable
segments of the heavy and light chains were amplified
using the sense primers 50-GCAACTCATATGCAGG
TGAAGCTGCAGCAGTCT-30(VH), 50-TCCGGCGG
TGGTGGCAGCGGTGGCGGCGGTTCTCAGGCT
GTTGTGA CTCAGGAA-30(VL) and the antisense
primers 50-ACCGCTGCCACCACCGCCGGAGCCA
CCGCCACCTGAGGAGACGGTGACCGTGGT-30
(VH), 50-CATTCTCTCGAGACCTAGGACAGTGAC
CTTGGT-30(VL) to introduce NdeI and XhoI restric-
tion sites (underlined), respectively. The amplified VH
and VLgenes were assembled into the scFv gene using a
linker sequence. The scFv fragment has a (Gly4Ser)3
linker and also VH-(Gly4Ser)3-VLorientation. Condi-
tions for PCR amplification were as follows: six cycles of
denaturation at 94 °C for 1 min, annealing at 65 °C for
2 min, and extension at 72 °C for 3 min. After the reac-
tion, the overlapped scFv DNA fragments were amplified
using the VHsense and the VLantisense primer. PCR-
amplified products were purified, treated with NdeI/XhoI,
and then cloned into pET-29b(+), pET-26b(+), and
pGEX-5X-3 to construct pTscFvH6, pTpelscFvH6, and
pGSTscFv vectors, respectively. Clones with affinity were
subjected to DNA sequencing to verify the assembly of
the variable heavy and light chains.
Expression of scFv
Transformants were selected by growth on Luria–
Bertani (LB) agar plates supplemented with appropriate
antibiotics and cultured overnight in 5 ml LB medium at
37 °C. The overnight culture was used to inoculate
100 ml fresh LB medium. When the OD600 reached ap-
proximately 0.5, expression of the scFv was induced
with isopropyl-b-
DD
-thiogalactopyranoside (IPTG) at a
final concentration of 0.1 mM. The cultures were al-
lowed to produce scFv for 6 h at 30 °C before the cells
were harvested by centrifugation at 6000 rpm for 10 min
at 4 °C. The supernatant was decanted and the pellet
G.-H. Choi et al. / Protein Expression and Purification 35 (2004) 84–92 85
was stored at )20 °C. In the coexpression experiments,
expression of the scFv and molecular chaperone genes
was induced at the logarithmic phase of growth by
adding IPTG and
LL
-arabinose at a final concentration of
0.1 mM and 1.0 g/L, respectively.
Electron microscopy
IPTG-induced cells were harvested and prefixed in
2% glutaraldehyde and 2% paraformaldehyde in 50 mM
sodium cacodylate buffer, pH 7.2, for 2 h at 4 °C. The
primary fixed samples were washed three times with
50 mM sodium cacodylate buffer, pH 7.2, for 10 min at
4°C and then postfixed with 1% OsO4in sodium caco-
dylate buffer, pH 7.2, for 2 h at room temperature. After
washing two times briefly with distilled water, samples
were En bloc stained with 0.5% uranyl acetate at 4 °C for
30 min and then dehydrated through an ascending series
of ethanol and two changes of propylene oxide. Thin
sections in embedding medium made with an Ultrami-
crotome (RMC, Tucson, AZ) were recovered and
poststained with 2% uranyl acetate and ReynoldsÕlead
citrate. The stained samples were subjected to micro-
scopic observation using a JEM-1010 electron micro-
scope (JEOL, Akishima, Japan).
SDS–PAGE and Western blot analysis
SDS–PAGE analysis was performed according to the
method described by Laemmli [16] with 12.5% poly-
acrylamide gels to analyze the expressed scFv. The pellet
stored at )20 °C was resuspended in 50 mM Na–phos-
phate buffer, pH 6.0. All samples were normalized to the
same OD600 with 50 mM Na–phosphate buffer, pH 6.0,
and equal volumes of cell suspension were passed twice
through a French pressure cell (Thermo Spectronic,
Madison, WI). After cell disruption, the resulting
preparation was separated into soluble and insoluble
fractions by centrifugation at 12,000 rpm for 30 min at
4°C. Fractions obtained from extracts having equiva-
lent protein contents were analyzed by SDS–PAGE. For
Western blot analysis, the fractionated scFv was sub-
jected to 12.5% Tris–glycine gels and then transferred to
PVDF membrane (Roche). Blocked with 3% skim milk
(Difco), the transferred membrane was incubated with
0.4 lg/ml anti-His antibody (Qiagen) for 2 h at 37 °C.
The immunoreactive protein bands were detected with
mouse anti-hexahistidine IgG conjugated with horse-
radish peroxidase (HRP) (Qiagen).
Purification of scFv antibody
Samples for purification were prepared as follows:
chaperone-coexpressed cells were harvested by centri-
fugation at 6000 rpm for 10 min at 4 °C. The supernatant
was decanted and the pellet was resuspended in lysis
buffer (50 mM Na–phosphate, pH 8.0, and 500 mM
NaCl). After cell disruption by passing the cell suspen-
sion twice through a French pressure cell (Thermo
Spectronic, Madison, WI), the resulting preparation was
separated into soluble and insoluble fractions by cen-
trifugation at 12,000 rpm for 30 min at 4 °C. The soluble
fraction was subjected directly to column chromatog-
raphy purification.
Expressed scFv proteins were purified using the
€
AKTAprime system (Amersham Biosciences) equipped
with the HiTrap Chelating HP column (Amersham
Biosciences). The column was charged with 50 mM
NiSO4and washed with distilled water. After equili-
brating the column with binding buffer (50 mM
Na–phosphate, pH 8.0, 500 mM NaCl, and 40 mM im-
idazole), the soluble fraction produced in chaperone
coexpression was loaded. The column loaded with the
sample was washed with binding buffer and bound pro-
teins were eluted with elution buffer (50 mM Na–phos-
phate, pH 8.0, 500 mM NaCl, and 250 mM imidazole)
with linear gradient of imidazole concentration. Finally,
Fig. 1. Construction of the scFv expression vectors. (A) Amplifications
of VHand VLgene from hybridoma 3G7 cells. Lane M, 100 bp DNA
ladder; lane 1, amplified VH; lane 2, amplified VL; and lane 3, amplified
scFv. (B) Schematic diagram of plasmid coding regions. pTscFvH6
(5.9 kb) and pTpelscFvH6 (6.0 kb) utilize a T7lac promoter and encode
kanamycin resistance gene. pGSTscFv (5.6 kb) utilizes a tac promoter
to drive expression and encodes ampicillin resistance. pelB and GST
indicate the signal sequence from Erwinia chrysanthemi pectate lyase
gene and glutathione-S-transferase from Schistosoma japonicum,
respectively.
86 G.-H. Choi et al. / Protein Expression and Purification 35 (2004) 84–92
the purified scFv was analyzed by SDS–PAGE. Protein
concentration was determined using protein assay kit
(Bio-Rad). In all experiments, standard curves were
drawn using bovine serum albumin (BSA) as a standard.
Determination of affinity constant
Affinity of scFv antibodies was measured by the sur-
face plasmon resonance (SPR) method using BIAcore
3000 (BIAcore AB, Uppsala, Sweden) according to
manufacturerÕs instructions. DON–hemiglutarate
(HG)–horseradish peroxidase (HRP) was covalently im-
mobilized to the flow cells of a CM5 sensor chip using
amine-coupling at a level of 2450 resonance units (RU).
For assessment of affinity against DON, scFv antibodies
resuspended in phosphate-buffered saline (PBS) at pH 7.4
were injected at a flow rate of 30 ll/min. Anti-DON mAb
and anti-rabbit IgG were also injected at the same flow
Fig. 2. The nucleotide and amino acid sequences of the scFv fragment specific for DON. (A) The variable regions of heavy chain (VH). (B) The
variable regions of light chain (VL). Amino acid numbering and complementarity determining regions of the VHand VLdomains were determined
according to Kabat et al. [20]. The gene segment families of VHand VLwere identified by a search for similarities against ImMunoGeneTics (IMGT)
Database (http://www.ebi.ac.uk/imgt). FR indicated by dotted arrows means the frame region conserved in immunoglobulins.
G.-H. Choi et al. / Protein Expression and Purification 35 (2004) 84–92 87
rate for positive and negative controls, respectively.
Control curves were prepared from the cell without
DON–HG–HRP. BIAcore sensorgram curves were
evaluated by BIAevaluation software 3.1 (Pharmacia
Biosensor AB) installed in the equipment. The response
curves of various antibody concentrations were fitted to
several preinstalled models. The dissociation constant
(KD) was defined as the ratio of the dissociation rate
constant (kd) divided by the association rate constant (ka).
Results and discussion
Construction of scFv expression vector
The variable regions of the heavy and light chains (357
and 330 bp, respectively) amplified from the mouse
hybridoma cells 3G7 were assembled with the linker DNA
fragment (Fig. 1A) and cloned into pET-29b(+), pET-
26b(+), and pGEX-5X-3 to construct pTscFvH6 (5.9 kb),
pTpelscFvH6 (6.0 kb), and pGSTscFv (5.6 kb) vectors,
respectively. The coding regions of the vectors are shown
in Fig. 1B. The expression cassette for pTscFvH6 and
pTpelscFvH6 vectors is driven by a T7lac promoter and
borne on pBR322 origin-based plasmid encoding kana-
mycin resistance. In pTpelscFvH6, the scFv gene was
inserted in-frame between an N-terminal pelB leader
sequence and a C-terminal hexahistidine tag of plasmid
pET-26b(+). The pGSTscFv vector contains the GST
gene fused to the N-terminus of the scFv gene and tac
promoter.
Sequence of scFv gene
The variable region genes were cloned by RT-PCR
from total RNA isolated from the hybridoma cell 3G7
and sequenced. The RPAS mouse scFv module is de-
signed to generate antibody cDNA using mRNA from
mouse hybridoma or spleen cells, to amplify the VHand
VLgenes by PCR using primers specific for the variable
region of each chain and finally, to assemble them into a
single gene using a special linker fragment, which
maintains the correct reading frame [17]. However, the
VLof anti-DON mAb was not cloned because the light
chain primers supplied with the RPAS mouse scFv
module were only specific for the j-type. Therefore, we
redesigned the primers specific for the k-type based on
the previously reported sequences [18,19] and success-
fully cloned the VLgene of anti-DON mAb. The
nucleotide and amino acid sequences of the VHand VL
regions are shown in Fig. 2. The scFv has 750
Fig. 3. Expression of anti-DON scFv in E. coli. (A) SDS–PAGE analysis of the scFv expressed in E. coli BL21(DE3):pTscFvH6. I, the insoluble
fraction; S, the soluble fraction; T, total proteins; M, low molecular weight marker; and U, uninduced total cell extracts. (B) Transmission electron
microscopy of E. coli BL21(DE3) expressing the anti-DON scFv. Arrows indicate the inclusion bodies. (C) scFv expressed in the strain
Orgami(DE3):pTscFvH6. Lane symbols are same as denoted in (A).
Fig. 4. Expression of the fusion proteins in E. coli. (A) The scFv
expressed in E. coli BL21(DE3):pTpelscFvH6. (B) The scFv–GST
fusion protein expressed in E. coli BL21(DE3):pGSTscFv. Lane sym-
bols are same as denoted in Fig. 3A.
88 G.-H. Choi et al. / Protein Expression and Purification 35 (2004) 84–92
nucleotides encoding 250 amino acids including a flexi-
ble linker of (Gly4Ser)3and a hexahistidine tag. Amino
acid numbering and complementarity determining
regions (CDRs) of the VHand VLdomains were deter-
mined according to Kabat et al. [20]. The gene segment
families of VHand VLwere identified by a search for
similarities against ImMunoGeneTics (IMGT) Data-
base (http://www.ebi.ac.uk/imgt) and confirmed by the
alignments with sequences of GenBank/EMBL. The V-,
D-, and J-segments forming the variable regions of the
heavy chain were determined to be V1,D
SP2, and J2,
respectively. Consequently, the anti-DON VHis a
member of the VHIII gene family IA subgroup. For the
variable region of the light chain, the V- and J-segments
were determined as V2and J2, respectively. Accordingly,
the anti-DON VLgene belongs to the Vkgene family II
subgroup. The frame regions and CDR 1, 2, and 3 of VH
and VLalso were positioned as depicted in Fig. 2.
Soluble expression of scFv
The strain E. coli BL2l(DE3):pTscFvH6 was used for
the overexpression of the anti-DON scFv. After IPTG
induction for 6 h at 30 °C, a protein of an apparent
29 kDa molecular weight appeared in the total cellular
proteins as demonstrated by SDS–PAGE analysis
(Fig. 3A). Though overall expression level was quite
high, it was mostly produced as inclusion bodies as
confirmed by SDS–PAGE and electron microscopy
(Figs. 3A and B). Moreover, no affinity was detected in
vitro when assayed by enzyme-linked immunosorbent
assay (ELISA).
To increase the scFv solubility, Origami(DE3) was
employed as an expression host. Origami(DE3) is a
mutant strain of BL21(DE3) defective with both trxB
and gor genes, which are implicated in redox potential of
intracellular environment. Since the formation of di-
sulfide bond has been essential for many scFvs reported,
a scFv is usually targeted to periplasm where disulfide
bridge can be formed and maintained. It is well known
that the cytoplasm is too reducing for many disulfide
bonds to form and periplasm is spatially too small to
reserve the produced proteins. Generally, the lack of
disulfide bond in the cytoplasmic proteins of E. coli is
owing to two specialized systems keeping free thiol
groups in a reduced state: the thioredoxin and glutare-
doxin pathways. Initial attempts to express scFvs in the
cytoplasm of E. coli used the trxB mutant cells that were
reported to form disulfide bonds for some cytoplasmic
proteins [22]. It was also reported that disulfide bridges
could form in some eukaryotic proteins, such as tissue
plasminogen activator (tPA), expressed in the cytoplasm
of E. coli cells carrying mutations in the trxB and gor
genes [23]. Unexpectedly, however, experimental results
showed that the scFv antibodies were also expressed as
inclusion body in Origami(DE3) (Fig. 3C).
A fusion gene approach was attempted for the ex-
pression of soluble scFv. Glutathione-S-transferase
(GST) or pelB leader sequence was fused to N-terminus
of scFv. The pelB leader sequence was used to direct
secretion of the scFv to the periplasmic space of E. coli.
Fig. 5. Chaperone coexpression with scFv. Lane symbols, S and T, are
same as denoted in Fig. 3A. (A) SDS–PAGE analysis. S1, soluble
fraction induced by 0.1 mM IPTG; T1, total proteins induced at
0.1 mM IPTG; S2, soluble fraction induced by 1 mM IPTG; and T2,
total proteins induced at 1 mM IPTG. (B) Western blot analysis of the
scFv coexpressed with DnaK-DnaJ-GrpE. (C) Purification of scFv by
IMAC. Affinity-purified scFv expressed in soluble form in the coex-
pression of molecular chaperones was analyzed by SDS–PAGE
(12.5%) stained with Coomassie brilliant blue. Lane M, low molecular
weight marker; lane 1, purified scFv.
G.-H. Choi et al. / Protein Expression and Purification 35 (2004) 84–92 89
Periplasmic location of scFv was ensured by the reduced
size of scFv in SDS–PAGE gel, because pelB leader se-
quence is removed during the secretion across the peri-
plasmic membrane. However, the scFv antibodies were
deposited into the inclusion bodies (Fig. 4A) even in the
periplasmic space. GST is a naturally occurring 26 kDa
protein, which is often used for the soluble expression of
heterologous proteins [21]. GST fusion tag with inte-
grated protease sites has been used for convenient pu-
rification of the proteins. Additionally, the presence of a
soluble tag often leads to the soluble expression of ag-
gregation-prone proteins. Thus, GST fusion protein was
constructed to achieve soluble expression of the scFv.
However, the scFv fused to GST at its N-terminus also
resulted in the formation of inclusion bodies when ex-
pressed in E. coli (Fig. 4B). In both cases, the soluble
fraction generated no signal against DON when assayed
by ELISA (data not shown).
Finally, chaperone-coexpression was tested for the
soluble expression of scFv. We used plasmids pGro7,
pKJE7, and pG-KJE3 constructed by Nishihara et al.
[13] which allow coexpression of GroEL-GroES,
DnaK-DnaJ-GrpE, and GroEL-GroES-DnaK-DnaJ-
GrpE, respectively. Among the chaperone families co-
expressed, the DnaK-DnaJ-GrpE chaperone family
exerted the most positive effects on soluble expression
of the scFv antibodies as confirmed by SDS–PAGE
and Western blot analysis using the anti-His6 antibody
Fig. 6. Overlay of sensorgrams showing the binding of various concentrations of scFv to immobilized DON-HG-HRP. (A) Anti-DON mAb used as
positive control. (B) Anti-DON scFv. The scFv was injected at concentrations of 155, 310, 620, 1240, and 1280 nM.
90 G.-H. Choi et al. / Protein Expression and Purification 35 (2004) 84–92
conjugated HRP (Figs. 5A and B). Molecular chaper-
ones are known to play a role in protecting proteins
from aggregation of unfolded or partially folded
proteins in cells. It was also reported previously that
coexpression of the DnaK-DnaJ-GrpE and GroEL-
GroES molecular chaperone complexes improved
proper folding of product proteins such as tyrosine
kinases in E. coli [24]. In addition, expression of
GroEL-GroES may cooperate with DnaK-DnaJ-GrpE
in a synergistic way to increase soluble production of
some proteins, indicating that they play cooperative
roles in protein folding [13]. In this study, however,
coexpression of DnaK-DnaJ-GrpE was sufficient to
enhance soluble expression of the target scFv, i.e., co-
expression of GroEL-GroES-DnaK-DnaJ-GrpE was
not as effective as its corresponding single coexpression
system (data not shown).
Purification of scFv
The scFv proteins were purified by immobilized metal
affinity chromatography (IMAC) from the soluble
fraction of flask cultures using the hexahistidine tail
present at the C-terminus of the scFv. The purified
29 kDa scFv was confirmed by SDS–PAGE analysis
(Fig. 5C). The purified proteins were used for measuring
the affinity against an antigen, DON, in the subsequent
experiments.
Determination of affinity constant
The affinity of the purified scFv was measured under
mass transfer limitation conditions using surface plasmon
resonance (SPR) on the BIAcore. As the anti-DON scFv
in reaction buffer binds to the DON–HG–HRP as ligand,
the accumulation of protein on the surface results in an
increase in the refractive index. This change in refractive
index is transformed into the sensorgram plotted as res-
onance units (RUs) versus time, which is a continuous,
real-time monitoring of the association and dissociation
of the interacting molecules [25]. The sensorgram pro-
vides the information in real-time on specificity of bind-
ing, kinetics, and affinity. While anti-DON mAb used as a
positive control showed the dose-dependent binding to
DON as depicted in Fig. 6A, anti-rabbit IgG used as a
negative control hardly change (data not shown). When
the purified anti-DON scFv antibodies were injected in
the flow cell, the sensorgram revealed that the association
was very slow (ka¼9:1103s1M1) but dissociation
was relatively fast (kd¼3:4102s1M1). The disso-
ciation constant (KD) determined from the ratio of these
two kinetic constants (kd=ka) was 3.7 106M. For the
comparison, it is noted that constants for whole mono-
clonal antibody are 3.3 104s1M1, 2.9 103s1
M1, and 8.8 108M for ka,kd, and KD, respectively.
The anti-DON scFv retained less binding capacity com-
pared to anti-DON mAb that was purified from the spleen
of mouse. Thus, a protein engineering study to evolve
affinity warrants further investigation.
Biophysical characterization of many antibody frag-
ments still tends to be hampered by poor expression in a
soluble form. In this study, we tested several method-
ologies to express anti-DON scFv in soluble form.
Among them, chaperone coexpression was most effec-
tive. However, chaperone coexpression may not guar-
antee for other scFvs. Another method may be more
effective for other scFv. Thus, the shown time-consum-
ing efforts are probably inevitable to express soluble
scFv because the expression pattern is case by case de-
pending on the protein. In vitro refolding may be a more
straightforward strategy when efficient refolding scheme
exists.
The cloned recombinant scFv had lower affinity
constant than the parent 3G7 mAb. That might be due
to the structural difference between scFv and native
antibody, e.g., a different conformation at the antigen-
binding site. However, successful soluble expression of
the anti-DON scFv in E. coli enables us to carry out a
protein engineering study to improve affinity, which
might provide final advantages of recombinant antibody
system.
Acknowledgments
We are grateful to Dr. Yanagi (HSP Research Insti-
tute, Kyoto Research Park, Kyoto, Japan) for his kind
donation of the molecular chaperone plasmids. This
work was supported by Center for Advanced Biosepa-
ration Technology at Inha University, Ministry of
Commerce, Industry and Energy, and Ministry of Ed-
ucation through the BK21 program.
References
[1] M.E. diMenna, D.R. Lauren, A. Hardacre, Fusaria and Fusarium
toxins in New Zealand maize plants, Mycopathologia 139 (1997)
165–173.
[2] M.P. Lutz, G. Feichtinger, G. D
efago, B. Duffy, Mycotoxigenic
Fusarium and deoxynivalenol production repress chitinase gene
expression in the biocontrol agent Trichoderma atroviride P1,
Appl. Environ. Microbiol. 69 (2003) 3077–3084.
[3] J. Gilbert, A. Tekauz, Recent developments in research on
Fusarium head blight of wheat in Canada, Can. J. Plant Pathol.
22 (2000) 1–8.
[4] B.A. Rotter, D.B. Prelusky, Toxicology of deoxynivalenol (vomi-
toxin), J. Toxicol. Environ. Health 48 (1996) 1–34.
[5] S.L. Walker, S. Leath, W.M. Hagler, J.P. Murphy, Variation
among isolates of Fusarium graminearum associated with Fusa-
rium head blight in North Carolina, Plant Dis. 85 (2001) 404–410.
[6] R.D. Plattner, C.M. Maragos, Determination of deoxynivalenol
and nivalenol in corn and wheat by liquid chromatography with
electrospray mass spectrometry, J. AOAC Int. 86 (2003) 61–65.
G.-H. Choi et al. / Protein Expression and Purification 35 (2004) 84–92 91
[7] W.L. Casale, J.J. Pestka, L.P. Hart, Enzyme-linked immunosor-
bent assay employing monoclonal antibody specific for deoxyni-
valenol (vomitoxin) and several analogues, J. Agric. Food Chem.
36 (1988) 663–668.
[8] A. Hayhurst, G. Georgiou, High-throughput antibody isolation,
Curr. Opin. Chem. Biol. 5 (2001) 683–689.
[9] A. Hayhurst, Improved expression characteristics of single-chain
Fv fragments when fused downstream of the Escherichia coli
maltose-binding protein or upstream of a single immunoglobulin-
constant domain, Protein Expr. Purif. 18 (2000) 1–10.
[10] H. Field, G.T. Yarranton, A.R. Rees, Expression of mouse
immunoglobulin light and heavy chain variable regions in
Escherichia coli and reconstitution of antigen-binding activity,
Protein Eng. 3 (1990) 641–647.
[11] A. Pl€
uckthun, Mono- and bivalent antibody fragments produced
in Escherichia coli : engineering, folding and antigen binding,
Immunol. Rev. 130 (1992) 151–188.
[12] K. Tsumoto, K. Shinoki, H. Kondo, M. Uchikawa, T. Juji, I.
Kumagai, Highly efficient recovery of functional single-chain Fv
fragments from inclusion bodies overexpressed in Escherichia coli
controlled introduction of oxidizing reagent-application to a
human single-chain Fv fragment, J. Immunol. Methods 219
(1998) 119–129.
[13] K. Nishihara, M. Kanemori, M. Kitagawa, H. Yanagi, T. Yura,
Chaperone coexpression plasmids: differential and synergistic
roles of DnaK-DnaJ-GrpE and GroEL-GroES in assisting folding
of an allergen of Japanese cedar pollen Cryj2 in Escherichia coli,
Appl. Environ. Microbiol. 64 (1998) 1694–1699.
[14] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory
Manual, third ed., Cold Spring Harbor Laboratory Press, New
York, 2001.
[15] W.P. Stemmer, A. Crameri, K.D. Ha, T.M. Brennan, H.L.
Heyneker, Single-step assembly of a gene and entire plasmid from
large numbers of oligodeoxyribonucleotides, Gene 164 (1995)
49–53.
[16] U.K. Laemmli, Cleavage of structural proteins during assembly of
the head of bacteriophage T4, Nature 27 (1970) 680–685.
[17] P.J. Cummings, N.E. Hooper, S.S. Rowland, Generation of a
recombinant bacteriophage antibody library to Mycobacterium
tuberculosis, Hybridoma 17 (1998) 151–157.
[18] S. Weiss, G.E. Wu, Somatic point mutations in unrearranged
immunoglobulin gene segments encoding the variable region of k
light chains, EMBO J. 6 (1987) 927–932.
[19] E.B. Reilly, R.M. Reilly, R.M. Breyer, R.T. Sauer, H.N. Eisen,
Amino acid and nucleotide sequences of variable regions of mouse
immunoglobulin light chains of the k3-subtype, J. Immunol. 133
(1984) 471–475.
[20] E.A. Kabat, T.T. Wu, H.M. Peery, K.S. Gottesmann, C. Foeller,
Sequences of Proteins of Immunological Interest, fifth ed., US
Department of Health and Human Services, US Government
Printing Office, Washington, 1991.
[21] X. Wu, U. Oppermann, High-level expression and rapid puri-
fication of rare-codon genes from hyperthermophilic archaea by
the GST gene fusion system, J. Chromatogr. B 786 (2003) 177–
185.
[22] A.I. Derman, W.A. Prinz, D. Belin, J. Beckwith, Mutations that
allow disulfide bond formation in the cytoplasm of Escherichia
coli, Science 262 (1993) 1744–1747.
[23] P.H. Bessette, F.
Aslund, J. Beckwith, G. Georgiou, Efficient
folding of proteins with multiple disulfide bonds in the Escherichia
coli cytoplasm, Proc. Natl. Acad. Sci. USA 96 (1999) 13704–
13708.
[24] K.E. Amrein, B. Takacs, M. Steiger, J. Molnos, N.A. Flint, P.
Burn, Purification and characterization of recombinant human
p50csk protein-tyrosine kinase from and Escherichia coli expres-
sion system overproducing the bacterial chaperones GroES and
GroEL, Proc. Natl. Acad. Sci. USA 92 (1995) 1048–1052.
[25] S.E. Harding, B.Z. Chowdhry, Protein–Ligand Interactions:
Hydrodynamics and Calorimetry, Oxford University Press,
Oxford, 2001.
92 G.-H. Choi et al. / Protein Expression and Purification 35 (2004) 84–92
