Content uploaded by D.T.J. Littlewood
Author content
All content in this area was uploaded by D.T.J. Littlewood
Content may be subject to copyright.
The phylogeny of the Schistosomatidae based on
three genes with emphasis on the interrelationships of
Schistosoma Weinland, 1858
A. E. LOCKYER
1
,P.D.OLSON
1
,P.ØSTERGAARD
1
,D.ROLLINSON
1
, D. A. JOHNSTON
1
,
S. W. ATT WOO D
1
, V. R. SOUTHGATE
1
,P.HORAK
2
, S. D. SNYDER
3
,
T. H. LE
4
,T.AGATSUMA
5
,D.P.MCMANUS
6
, A. C. CARMICHAEL
7
,
S. NA EM
8
and D. T. J. LITT LEW OOD
1
*
1
Department of Zoology,The Natural History Museum,Cromwell Road,London SW7 5BD,UK
2
Department of Parasitology and Hydrobiology,Charles University,Vinicna 7,CZ-128 44 Prague 2,Czech Republic
3
Department of Biology,University of Nebraska at Omaha,6001 Dodge Street,Omaha,NE 68182-0040,USA
4
Immunology Department,Institute of Biotechnology of Vietnam,18. Hoang Quoc Viet Road,Cau Giay District,
Hanoi,Vietnam
5
Department of Environmental Health Science,Faculty of Medicine,Kochi Medical School,Oko,Nankoku City,
Kochi 783-8505,Japan
6
Molecular Parasitology Laboratory,The Queensland Institute of Medical Research,300 Herston Road,Brisbane,Q4029,
Australia
7
University of California Botanical Garden,University of California,200 Centennial Drive,Berkeley,CA 94720,USA
8
Nazloo Campus,Department of Pathobiology,Faculty of Veterinary Medicine,Urmia,Iran
(Received 12 September 2002; revised 26 October 2002; accepted 26 October 2002)
SUMMARY
Schistosomes are digenean flukes, parasitic of birds, mammals and crocodiles. The family Schistosomatidae contains species
of considerable medical and veterinary importance, which cause the disease schistosomiasis. Previous studies, both mor-
phological and molecular, which have provided a good deal of information on the phylogenetics of this group, have been
limited in the number of species investigated or the type or extent of molecular data used. This paper presents the most
comprehensive phylogeny to date, based on the sequences of 3 genes, complete ribosomal small subunit rRNA and large
ribosomal subunit rRNA, and mitochondrial cytochrome oxidase 1, sequenced from 30 taxa including at least 1 rep-
resentative from 10 of the 13 known genera of the Schistosomatidae and 17 of the 20 recognized Schistosoma species. The
phylogeny is examined using morphological characters, intermediate and definitive host associations and biogeography.
Theories as to the origins and spread of Schistosoma are also explored. The principal findings are that Ornithobilharzia and
Austrobilharzia form a sister group to the Schistosoma; mammalian schistosomes appear paraphyletic and 2 Trichobilharzia
species, T. ocellata and T. szidati, seem to be synonymous. The position of Orientobilharzia within the Schistosoma is
confirmed, as is an Asian origin for the Schistosoma, followed by subsequent dispersal through India and Africa.
Key words: interrelationships, character analysis, biogeography, host–parasite associations, Digenea.
INTRODUCTION
The Schistosomatidae are digenean flukes that para-
sitize birds, mammals and crocodiles and use gas-
tropod intermediate hosts. Schistosomatids are
primarily associated with freshwater habitats and
are found in all temperate and tropical regions of
the world. There are 14 recognized genera and
approximately 100 species of schistosomes (Khalil,
2002) including a number of species of medical and
veterinary importance. As the causative agents of
schistosomiasis, human schistosomes rank amongst
the most important of all metazoan parasites, affect-
ing over 220 million people (WHO, 2001). Other
schistosomatids, such as the avian flukes Tricho-
bilharzia, also have implications for human health, as
the release of their cercariae can cause severe cercarial
dermatitis (e.g. Horak & Kolarova, 2001 ; Horak,
Kolarova & Adema, 2002). A sound framework for
the taxonomy of schistosomes may provide a better
understanding of the origins, radiation and evolution
of schistosomes. The elucidation of the history,
present distribution, and the possible future spread of
schistosomes, had implications for controlling the
diseases they cause. General descriptions of the
family and taxonomic histories can be found in Farley
(1971) and Gibson, Jones & Bray (2002).
Within the Schistosomatidae, it is the genus
Schistosoma that contains species that parasitize man.
Traditional groupings of Schistosoma species, based
primarily on egg morphology, intermediate host
specificity and biogeography, divided the genus into
* Corresponding author : Department of Zoology, The
Natural History Museum, Cromwell Road, London SW7
5BD, UK. Tel: +44 20 7942 5742. Fax : +44 20 7942
5151. E-mail: T.Littlewood@nhm.ac.uk
203
Parasitology (2003), 126, 203–224. f2003 Cambridge University Press
DOI: 10.1017/S0031182002002792 Printed in the United Kingdom
4 groups, represented by the species S. mansoni,S.
haematobium,S. indicum and S. japonicum (Rollinson
& Southgate, 1987). S. mansoni, which causes human
intestinal schistosomiasis, has lateral spined eggs
and uses Biomphalaria snails as intermediate hosts.
S. mansoni is widespread in Africa and is also present
in South America and the Caribbean. Other members
of this group include S. rodhaini, a rodent parasite and
also 2 parasites of the hippopotamus, S. edwardiense
and S. hippopotami.S. haematobium causes urinary
schistosomiasis in man and uses snails of the genus
Bulinus as its intermediate hosts. This species has ter-
minal spined eggs. Most of the other African species
fall into this group, such as S. intercalatum, which
also infects man and several species that infect mainly
cattle and sheep, including S. bovis,S. mattheei and
S. curassoni. It has been estimated that at least 165
million cattle worldwide are infected with schisto-
somiasis (de Bont & Vercruysse, 1997). The third
group includes S. japonicum, which has a rounded,
minutely spined egg. S. japonicum is widespread
throughout East Asia, although eradicated from
Japan by extensive control programmes. Other Asian
species in this group are S. sinensium,S. mekongi,
S. malayensis and a fourth, recently described, species
S. ovuncatum (Attwood et al. 2002 a). Both S. mekongi
and S. japonicum are human pathogens. The S. indi-
cum group contains the Indian species S. incognitum,
S. spindale and S. nasale, in addition to S. indicum.
None of these infect man, and they have a variety of
egg morphologies. These species have been grouped
together for convenience, as much on the basis that
they do not fit with the S. mansoni,S. haematobium
and S. japonicum groups, as that they are all found in
India and parts of S. E. Asia (Rollinson & Southgate,
1987). Indeed, Agatsuma et al. (2002) suggested the
group may not be monophyletic. Those species which
infect man do not fall into a single species group,
indicating that they are not closely related and do not
share the same morphological features, intermediate
host or geographical ranges. Rather, they individ-
ually share features with other species that are not
infective to man, and this indicates that there have
been independent lateral transfers into man from
other hosts (Combes, 1990).
Taxonomy and systematics
Carmichael (1984) carried out a cladistic analysis of
the Schistosomatidae and produced a comprehensive
review with a phylogeny based on 24 morphological
characters scored for 14 genera. Morand & Mu
¨ller-
Graf (2000) re-analysed these data using modern
computational methods, recoded as 37 characters
(Carmichael’s thesis included a number of multi-
state characters). The preferred tree presented by
Carmichael was not the most parsimonious as found
by a cladistic analysis performed by Morand &
Mu
¨ller-Graf (2000) using the same characters which
provided a more resolved solution (Fig. 1A). There
have been a number of molecular attempts to infer
schistosomatid phylogenies, with particular empha-
sis on resolving the interrelationships of species of the
medically important genus Schistosoma. Rollinson
et al. (1997) reviewed some of the earliest studies
based on mitochondrial and nuclear ribosomal gene
sequences (Despre
´set al. 1992; Johnston, Kane &
Rollinson, 1993 ; Littlewood & Johnston, 1995),
RAPDs (Barral et al. 1993 ; Kaukas et al. 1994) and
RFLPs of mitochondrial DNA (Despre
´s, Imbert-
Establet & Monnerot, 1993). The majority of these
studies involved only a few exemplar taxa and con-
centrated on Schistosoma. Snyder & Loker (2000)
broadened the approach to the Schistosomatidae and
used large subunit ribosomal DNA (lsrDNA). Using
12 ingroup taxa (representing 10 genera) and 2 out-
groups, and sequencing about a kilobase of lsrDNA
encompassing variable domains D1–D2, their sol-
ution differed fundamentally from analyses based on
morphology by Morand & Mu
¨ller-Graf (2000) (Fig.
1). With lsrDNA sequence data, Orientobilharzia and
Schistosoma formed a monophyletic (mammalian)
clade and the other schistosomatid taxa formed a
primarily avian clade, not seen in the morphology
tree. The interrelationships of the remaining bird and
mammal schistosomes are the same in both analyses,
recognizing 3 clades comprising : Schistosomatium
and Heterobilharzia ;Dendritobilharzia,Giganto-
bilharzia,Trichobilharzia and Bilharziella ;Ornitho-
bilharzia and Austrobilharzia (called ‘ Sinobilharzia ’
in the tree based on morphology). However, as
a result of topological differences, the interpretation
of the evolution of the family, including the adoption
of intermediate and definitive hosts, also changes. Of
particular interest is whether the move from avian to
mammalian definitive hosts was a single event. For
this to be resolved, the true identity of the sister group
to Schistosoma must be identified.
While Schistosoma has long been a subject of study,
a clear phylogeny for the genus has remained elusive.
There are discrepancies in our understanding of the
radiation of Schistosoma, but this stems largely from
later efforts building on earlier, relatively poorly
sampled attempts, in a fragmented manner. There
has rarely been full complementarity between the
various studies undertaken, such that some genes are
sampled for some taxa but not for all. Johnston et al.
(1993) and Littlewood & Johnston (1995) used almost
complete ssrDNA and partial lsrDNA respectively to
estimate the interrelationships of exemplar taxa from
the main Schistosoma species groups. Barker & Blair
(1996) incorporated more species, but used shorter
ssrDNA and lsrDNA fragments. Shorter, more
variable regions of DNA from nuclear ribosomal
internal transcribed spacer region 2 (ITS2) and mito-
chondrial cytochrome oxidase I (COI), were also used
to confirm species groups (Bowles, Blair & McManus,
1995), although again, only a limited number of
A. E. Lockyer and others 204
exemplar taxa were included. Most recent studies
have added gene fragments or additional taxa to
particular clades within Schistosoma to test the pos-
ition of individual taxa (e.g. Agatsuma et al. 2001,
2002; Blair et al. 1997), or to examine some of the
biogeographic hypotheses suggested by Snyder &
Loker’s (2000) scheme, e.g. Zhang et al. (2001) and
Attwood et al. (2002 b). Few molecular studies have
focused on the non-Schistosoma groups, although
molecular methods to differentiate Trichobilharzia
species are being developed (Dvorak et al. 2002).
Snyder & Loker (2000) found Orientobilharzia
among the Schistosoma lineages, suggesting that
Schistosoma is paraphyletic. Blair, Davis & Wu (2001)
using the same data with the addition of more Schisto-
soma species, showed a single mammalian/avian split
but without strong nodal support. A recent summary
(Morgan et al. 2001) indicated that the Schistosoma
phylogeny is not resolved leaving many questions
unanswered, such as the position of S. incognitum.
Also, while it now seems likely that the East Asian
species are the earliest derived species in the Schisto-
soma clade, the position of Orientobilharzia, either
within the East Asian clade or basal to the African and
Indian species, remains problematic (Attwood et al.
2002a; Snyder & Loker, 2000 ; Zhang et al. 2001).
Additional evidence for the phylogeny within
Schistosoma has been gleaned from investigating
complete mitochondrial genomes, and a remarkable
split in the genus has been revealed (Le et al. 2000).
The gene order of S. mansoni is quite different to that
found in S. japonicum and S. mekongi and these 2
Asian schistosomes share the same gene order as that
found in other trematodes and in cestodes, suggesting
that they possess the plesiomorphic pattern. S.
mansoni not only has a translocation of atp6 and nad2
when compared to S. japonicum, but also the gene
order for nad3 and nad1 is reversed, and thus these
data confirm the basal status of the East Asian Schisto-
soma. The position of the East Asian species is sig-
nificant in distinguishing between different theories
for the origin and subsequent radiation and dispersal
of the schistosomes.
Biogeography
Two theories of Schistosoma origin have been pro-
posed. A Gondwanan-origin (vicariance) hypothesis,
based on snail host phylogeny and palaeontology,
suggests members of the genus originated in Gond-
wanaland, with an ancestor rafting on the Indian
plate to Asia 70–150 MYA and that Schistosoma
AB
Fig. 1. Previously published phylogenies based on a cladistic analysis of morphology (recoding characters used by
Carmichael, 1984 ; Morand & Mu
¨ller-Graf, 2000) and a molecular phylogenetic analysis of partial lsrDNA (Snyder & Loker,
2000).
Note: Sinobilharzia refers to Austrobilharzia odhneri – One anomaly not explained by Morand & Mu
¨ller-Graf (2000)
concerns this species. In Carmichael’s analysis (Carmichael, 1984) Sinobilharzia represents a single species that was
originally named Ornithobilharzia odhneri Faust, 1924, but subsequently reclassified as Sinobilharzia odhneri by
Dutt & Srivastava (1961). Farley (1971) then placed this species in Austrobilharzia, but Carmichael chose to analyse
the species separately under the genus Sinobilharzia. In their analysis, Morand & Mu
¨ller-Graf (2000) used Carmichael’s
morphological matrix to produce a tree, but mapped specific morphological data from another species that they called
Sinobilharzia crecci – we can find no reference for this species and suggest that they may have mistakenly used Jilinobilharzia
crecci Liu & Bai (1976) in their analysis. Although this has no effect on their analysis of Carmichael’s matrix, it should
be borne in mind that Sinobilharzia in the tree of Morand & Mu
¨ller-Graf (2000) ; shown in Fig. 1A refers to Austrobilharzia
odhneri. Khalil (2002) synonymizes Sinobilharzia as Austrobilharzia. Indeed, Sinobilharzia, which has also been used for
Schistosoma japonicum by Le Roux (1958), is no longer recognized.
Phylogenetics of the Schistosomatidae 205
transferred to South America 80–120 MYA before
continental drift split Gondwanaland (Davis, 1980).
The molecular evidence so far refutes this scenario.
Firstly, Despre
´set al. (1993) using restriction
fragment length polymorphisms (RFLPs) of mito-
chondrial DNA fragments found that the genetic
differentiation between African and American popu-
lations of S. mansoni was no greater than within
African populations, suggesting a recent transfer of
the parasite to S. America, associated with the slave
trade. Secondly, Snyder & Loker (2000) found
S. japonicum and Orientobilharzia at the base of the
Schistosoma phylogeny and proposed an alternative,
Asian, hypothesis. They proposed (and subsequently
suggested dates by referring to the historical record
of the vertebrate hosts (Morgan et al. 2001)), that
an ancestral schistosome dispersed to Africa 12–19
MYA via widespread mammal migration from Asia.
The Schistosoma ancestor remaining in Asia radiated
as the S. japonicum species group. In Africa the lin-
eage diverged into the S. mansoni and S. haematobium
groups and an S. indicum ancestor migrated back to
India, possibly with early humans and their animals.
S. mansoni dispersed to South America about 500 YA
via the transport of African slaves (Despre
´set al.
1993). Dating such events is highly problematic.
Barker & Blair (1996) rejected the use of a molecular
clock based on partial lsrDNA, and Snyder & Loker
(2000) recognized the whole exercise as highly specu-
lative. Other dates have been proposed for these
various splits, but all depend on the acceptance of
molecular clocks (Despre
´set al. 1992; Morgan et al.
2001) that are at best highly erratic and that have been
employed without estimating confidence intervals
(e.g. Cutler, 2000 ; Rambaut, 2000). Attwood (2001),
Attwood & Johnston (2001) and Attwood et al.
(2002b) also discussed biogeographical predictions
for Schistosoma which are concordant with an Asian
origin, based on intermediate host phylogeography
and the late Caenozoic evolution of the main rivers
in Asia. Attwood (2002 b) used partial 18S, 28S and
mitochondrial 16S rRNA gene sequences to estimate
a phylogeny for the East Asian species which was
independent of a molecular clock hypothesis but does
rely on, as yet, incomplete palaeogeographical data.
This study
A robust and comprehensive phylogeny is required to
enable us to stabilize the taxonomy, to identify tax-
onomically useful characters, to investigate the bio-
geography and the origin of the schistosomes, and to
reveal other unique features of this important group,
including host-specificity, host-switching, and the
evolution of sexual dimorphism. Many of these
questions have recently been subjects of investigation
and there have been attempts to construct ‘ super-
trees’ based on various previous phylogenetic esti-
mates from smaller trees with fewer taxa (Morand
&Mu
¨ller-Graf, 2000). However, an estimate of the
phylogeny based on a fully complementary multi-
gene dataset is required. This paper extends on pre-
vious studies by using 2 nuclear and 1 mitochondrial
gene. Although previous work has resolved some
schistosomatid relationships with lsrDNA and
ssrDNA sequences treated individually, it is clear
that a combination of these data works well among
platyhelminth groups in general, and particularly
amongst neodermatan flatworms (e.g. Olson et al.
2001; Olson & Littlewood, 2002 ; Olson et al.
manuscript submitted). However, rather than relying
on partial lsrDNA alone, there is growing evidence
that combining the complete sequences of both
genes adds stability and resolution at a number of
levels within and between metazoan taxa (Mallatt
& Winchell, 2002 ; Medina et al. 2001), including
platyhelminths (Lockyer, Olson & Littlewood,
2003). Additionally, almost complete mitochondrial
COI was sequenced in order to provide greater res-
olution among more closely related taxa. These 3
genes were sequenced from 30 taxa, including at least
1 representative from 10 of the 13 known genera of
the Schistosomatidae and 17 of the 20 recognized
Schistosoma species.
MATERIALS AND METHODS
Taxa sampled and choice of outgroup
Twenty-nine schistosomatid species and one san-
guinicolid for outgroup rooting were sampled. Pre-
vious morphological and molecular phylogenetic
estimates of digenean interrelationships have indi-
cated strongly that the Sanguinicolidae are the sister
group to the Schistosomatidae within the superfamily
Schistosomatoidea (see Cribb et al. 2001). Recent
work (D.T.J.L. & P.D.O., unpublished results)
has indicated that sanguinicolids are quite divergent
from the schistosomatids, exhibiting relatively long
branches for both ssrDNA and lsrDNA. Never-
theless, each selected gene partition was sequenced
from the basal sanguinicolid Chimaerohemecus trond-
heimensis, its position based on analyses of digenean
interrelationships using full ssrDNA and partial
lsrDNA (D.T.J.L., P.D.O., unpublished results).
An, as yet undescribed, sanguinicolid, used elsewhere
for ssrDNA and lsrDNA analyses of platyhelminth
relationships (Lockyer, Olson & Littlewood, 2003),
added additional information for outgroup rooting.
Although the COI fragment could not be amplified
from this second outgroup taxon, all ingroup top-
ologies of ssrDNA and lsrDNA trees were identical
with one or two outgroups, so the analyses were re-
stricted to rooting against C. trondheimensis alone. If
suggestions that the Spirorchidae are in fact the sister
group to the Schistosomatidae (Platt & Brooks, 1997)
can be confirmed, additional molecular sampling
from this family may be worthwhile. No spirorchids
were available for the present analysis.
A. E. Lockyer and others 206
All major schistosomatid genera were sampled
except Macrobilharzia,Bivitellobilharzia,Jilinobil-
harzia and Griphobilharzia. These taxa are parasites
of protected or rare vertebrate hosts and one, Gripho-
bilharzia, has remained elusive since its original
description from the freshwater crocodile (Platt et al.
1991). Among the genus Schistosoma, every species
was sampled except S. hippopotami and S. edwar-
diense, both parasites of Hippopotamus amphibious L.,
another protected species. Unfortunately, there were
insufficient female (most readily identifiable) speci-
mens of S. ovuncatum (Attwood et al. 2002 a) avail-
able for the present study. The full classification of
the Schistosomatidae according to the latest keys
(Khalil, 2002) is replicated in Table 1. The same table
gives full details of the taxa sampled here, including
authorities and sources.
DNA extraction and gene sequencing
Total genomic DNA was extracted from liquid nitro-
gen-frozen or ethanol-preserved specimens using
standard proteinase K, phenol-chloroform extraction
techniques (Sambrook, Fritsch & Maniatis, 1989) or
DNeasy
TM
Tissue kit (Qiagen) according to the
manufacturer’s protocol. The 25 ml amplifications
were performed with 3–5 ml of genomic extract
(y10 ng) using Ready-To-Go PCR beads (Amer-
sham Pharmacia Biotech) each containing 1.5UTaq
Polymerase, 10 mMTris–HCl (pH 9.0), 50 mMKCl,
1.5m
MMgCl
2
, 200 mMeach dNTP and stabilisers
including BSA ; and 0.4mMof each PCR primer. The
complete lsrDNA was amplified in 3 overlapping
sections using the primer combinations U178+
L1642, U1148+L2450 and U1846+L3449 (see
Table 2). PCR conditions used were : 2 min de-
naturation at 94 xC ; 40 cycles of 30 sec at 94 xC,
30 sec at 52 xC and 2 min at 72 xC ; followed by a final
7 min extension at 72 xC. Where necessary to obtain
a product, the stringency was reduced by adding
MgCl
2
to a final concentration of 2.5mMor by re-
ducing the annealing temperature to 50 xC. Ampli-
fication of mitochondrial cytochrome oxidase subunit
1 (CO1) was performed using the primers Cox1_-
Schist_5kand Cox1_Schist_3k(see Table 2) with the
same PCR conditions as above. Complete sequencing
of ssrDNA was performed as described previously
(Littlewood et al. 1999).
PCR products were purified with Qiagen Qiaquick
columns, cycle-sequenced directly using ABI Big-
Dye chemistry, ethanol-precipitated and run on an
ABI prism 377 automated sequencer. A variety of
internal primers were used to obtain the full sequence
of each fragment from both strands (see Table 2).
Sequences were assembled and edited using Se-
quencher ver 3.1.1 (GeneCodes Corp.) and submit-
ted to EMBL/GenBank (see Table 1 for accession
numbers). In all cases complete lsrDNA, ssrDNA
and CO1 were sequenced, except for conserved
regions at both 5kand 3kends that were targeted for
primer design.
Sequence alignment and phylogenetic analyses
ssrDNA and lsrDNA sequences were each aligned
initially with the aid of ClustalX using default para-
meters (Jeanmougin et al. 1998), and alignments then
refined by eye with MacClade ver. 4.03 (Maddison
& Maddison, 2000). CO1 sequences were aligned with
reference to the open-reading frame and the inferred
amino acid sequences. Individual gene alignments
were concatenated in MacClade, ambiguously aligned
positions excluded and data partitions defined.
Maximum parsimony (MP) and maximum likeli-
hood (ML) analyses were performed using PAUP*
ver. 4.0b10 (Swofford, 2002) and the resulting net-
works rooted with the outgroup taxon. Each gene was
analysed both independently and combined using
MP, ML and also Bayesian inference (BI) using the
program MrBayes (Huelsenbeck, 2000). Mitochon-
drial COI sequences were analysed only as nucleo-
tides but were investigated to see whether trees dif-
fered in topology when using only first and second
codon positions or all 3 positions, in order to best
reflect the signal at nonsynonymous sites. Analyses
by MP were performed using a heuristic search
strategy (1000 search replicates), random-addition of
sequences and tree-bisection-reconnection (TBR)
branch-swapping options. All characters were run
unordered and equally weighted. Gaps were treated
as missing data. Nodal support was assessed by boot-
strap resampling in MP (1000 replicates) and ML
(100 replicates). Nodal support from majority-rule
consensus trees found with BI were also utilized. In
order to test whether there was significant conflict
between the data partitions prior to combining them
the criteria of conditional combination of indepen-
dent data sets (Huelsenbeck, Bull & Cunningham,
1996; Cunningham, 1997) were examined using the
incongruence length-difference (Farris et al. 1995)
test as implemented in PAUP*. The test was per-
formed with maximum parsimony, 10 heuristic
searches (random sequence addition, TBR branch-
swapping) each for 100 homogeneity-replicates on
informative sites only (Lee, 2001).
A suitable nucleotide substitution model was es-
timated using Modeltest (Posada & Crandall, 1998),
which showed a general time reversible (GTR) model
including estimates of invariant sites (I) and among-
site rate heterogeneity (G) for each individual and
combined data set. In calculating maximum likeli-
hood trees, values of Iand Gwere set to those esti-
mated by Modeltest but substitution rate parameters
were free to vary and nucleotide frequencies used
were empirical.
Bayesian inference (BI) of phylogeny was esti-
mated using the following nucleotide substitution
Phylogenetics of the Schistosomatidae 207
Table 1. List of taxa and sequences used in this study and their geographical origin
(Avian (A) or mammalian (M) vertebrate host indicated. See Fig. 5 for list of mollusc hosts. Previously unreported sequences are marked ·.)
Classification Source
Vertebrate host GenBANK Accession No.
A M COI ssrDNA lsrDNA
Schistosomatidae Stiles & Hassall, 1898
Schistosomatinae Stiles & Hassall, 1898
Austrobilharzia Johnston, 1917
Austrobilharzia terrigalensis Johnson, 1916 ex Batillaria australis ; Rodd Point, Iron Cove,
Sydney Harbour, NSW, Australia.
[AY157195·AY157223·AY157249·
Austrobilharzia variglandis (Miller & Northup, 1926) ex Larus delawarensis; Delaware, USA. [AY157196·AY157224·AY157250·
Bivitellobilharzia Vogel & Minning, 1940 No species sampled [
Heterobilharzia Price, 1929
Heterobilharzia americana Price, 1929 ex Mesocricetus auratus; (experimental infection)
NHM-409 original isolate from Louisiana, USA.
[AY157192·AY157220·AY157246·
Macrobilharzia Travassos, 1922 No species sampled. [
Orientobilharzia Dutt & Srivastava, 1955
Orientobilharzia turkestanicum (Skrjabin, 1913) ex Ovis aries; Iran. [AY157200·AF442499 AY157254·
Ornithobilharzia Odhner, 1912
Ornithobilharzia canaliculata (Rudolphi, 1819) ex Larus delawarensis; Donley County, Texas, USA. [AY157194·AY157222·AY157248·
Schistosomatium Tanabe, 1923
Schistosomatium douthitti (Cort, 1915) ex Mesocricetus auratus; (experimental infection)
Indiana, USA.
[AY157193·AY157221·AY157247·
Schistosoma Weinland, 1858
Schistosoma bovis (Sonsoni, 1876) ex Mus musculus; (experimental infection) original
isolate from Iranga, Tanzania.
[AY157212·AY157238·AY157266·
Schistosoma curassoni Brumpt, 1931 ex Mesocricetus auratus; (experimental infection)
original isolate from Dakar, Senegal.
[AY157210·AY157236·AY157264·
Schistosoma haematobium (Bilharz, 1852) ex Mesocricetus auratus; (laboratory infection)
NHM-3390, Village 10, Nigel delta, Mali.
[AY157209·Z11976 AY157263·
Schistosoma incognitum Chandler, 1926 ex Bandicota indica; Phitsanulok, Thailand. [AY157201·AY157229·AY157255·
Schistosoma indicum Montgomery, 1906 ex Bos taurus; Mymensingh, Bangladesh. [AY157204·AY157231·AY157258·
Schistosoma intercalatum Fisher, 1934 ex Mus musculus ; (laboratory infection)
NHM-3188, San Antonio, Sa
˜o Tome
´.
[AY157208·AY157235·AY157262·
Schistosoma japonicum Katsurada, 1904 ex Mus musculus; (experimental infection)
isolate S15/90–19. Original isolate from the Philippines.
[AF215860 AY157226·AY157607·
Schistosoma leiperi Le Roux, 1955 ex Mesocricetus auratus; (experimental infection)
original isolate from South Africa.
[AY157207·AY157234·AY157261·
Schistosoma malayensis Greer et al. 1988 ex Mus musculus; (experimental infection)
original isolate from Baling, Kedah, Malaysia
[AY157198·AY157227·AY157252·
Schistosoma mansoni Sambon, 1907 ex Mus musculus ; (experimental infection)
isolate NHM-3454/5/6.
[AF216698 M62652 AY157173·
Schistosoma margrebowiei Le Roux, 1933 ex Mus musculus; (experimental infection)
lab strain isolate NHM-3295. Original
isolate from Lochinvar, Zambia.
[AY157206·AY157233·AY157260·
A. E. Lockyer and others 208
Schistosoma mattheei Veglia & Le Roux, 1929 ex Mus musculus; (experimental infection)
original isolate from Denwood Farm,
Nr Lusaka, Zambia.
[AY157211·AY157237·AY157265·
Schistosoma mekongi Voge, Buckner & Bruce, 1978 ex Mus musculus; (experimental infection)
originally isolated from Neotricula
aperta, Khong Island, Laos.
[AY157199·AY157228·AY157253·
Schistosoma nasale Rao, 1933 ex Capra hircus; Sri Lanka. [AY157205·AY157232·AY157259·
Schistosoma rodhaini Brumpt, 1931 ex Mus musculus; (experimental infection)
lab strain (NHM).
[AY157202·AY157230·AY157256·
Schistosoma sinensium Bao, 1958 ex Mus musculus; (experimental infection)
originally isolated from Tricula sp.,
Mianzhu, Sichuan, China.
[AY157197·AY157225·AY157251·
Schistosoma spindale Montgomery, 1906 ex Mus musculus ; (experimental infection) NMH 1630
original isolate from Indoplanorbis
exustus from Sri Lanka.
[AY157203·Z11979 AY157257·
Griphobilharziinae Platt, Blair, Purdie & Melville,
1991
Griphobilharzia Platt, Blair, Purdie & Melville, 1991 No species sampled.
Bilharziellinae Price, 1929
Bilharziella, Looss, 1899
Bilharziella polonica (Kowalewski, 1895) ex Anas platyrhynchus; Kherson Oblast, Ukraine. [AY157186·AY157214·AY157240·
Jilinobilharzia Liu & Bai, 1976 No species sampled. [
Trichobilharzia, Skrjabin & Zakharow, 1920
Trichobilharzia ocellata (La Valette, 1855) ex Lymnaea stagnalis ; Germany. [AY157189·AY157217·AY157243·
Trichobilharzia regenti Horak, Kolarova &
Dvorak, 1998
ex Radix peregra; (experimental infection);
Horak Lab., Prague, Czech Rep.
[AY157190·AY157218·AY157244·
Trichobilharzia szidati Neuhaus, 1952 ex Lymnaea stagnalis; (experimental infection);
Horak Lab., Prague, Czech Rep.
[AY157191·AY157219·AY157245·
Gigantobilharziinae Mehra, 1940
Dendritobilharzia Skrjabin & Zakharow, 1920
Dendritobilharzia pulverulenta (Braun, 1901) ex Gallus gallus; (experimental infection),
Bernallio County, New Mexico, USA.
[AY157187·AY157215·AY157241·
Gigantobilharzia Odhner, 1910
Gigantobilharzia huronensis Najim, 1950 ex Agelaius phoeniceus; Winnebago County,
Wisconsin, USA.
[AY157188·AY157216·AY157242·
Sanguinicolidae
Chimaerohemecus trondheimensis van der Land, 1967 ex Chimaera monstrosa ; Korsfiorden, near
Bergen, Norway.
AY157185·AY157213·AY157239·
Phylogenetics of the Schistosomatidae 209
parameters : lset nst=6, rates=invgamma, ncat=4,
shape=estimate, inferrates=yes and basefreq=
empirical, that approximates to a GTR+I+Gmodel
as above. Posterior probabilities were approximated
over 200 000 generations, log-likelihood scores plot-
ted and only the final 85% of trees where the log-
likelihood had reached a plateau were used to produce
the consensus tree.
In order to include more sites and test further the
interrelationships of the Schistosoma species, a subset
of the entire dataset comprising only the Schistosoma
(but including Orientobilharzia) was analysed rooting
against the most basal, East Asian clade, as deter-
mined in the full analyses.
Final tree topologies were tested against previous
hypotheses of interrelationships by using ML alone
on the combined data set to find the best constrained
trees, and then applying the Shimodaira-Hasegawa
test (Shimodaira & Hasegawa, 1999) as implemented
in PAUP* with full optimization and 1000 bootstrap
replicates, testing within and between the con-
strained and unconstrained topologies.
Character mapping and interpretation
The morphological character matrix of Carmichael
(1984) (based on personal observations of many
schistosomatid species, as well as on an extensive
review of literature including Farley (1971)) was
adapted, in order to interpret our molecular estimate
of phylogeny in the context of morphology. Carmi-
chael’s matrix of 24 characters was taken in its en-
tirety, but taxa not sampled in this study, namely
Old and New World Macrobilharzia and Bivitello-
bilharzia and ‘ Sinobilharzia’, w ere omitted (see Fig. 1
legend). Characters that changed unambiguously
were mapped on our phylogeny using MacClade
Table 2. Primers used for PCR amplification and sequencing of complete
lsrDNA and CO1
(See Littlewood et al. (1999) for ssrDNA amplification and sequencing primers.)
Amplification
and sequencing Primer sequence (5k–3k)
lsrDNA
U178 GCACCCGCTGAAYTTAAG
L1642 CCAGCGCCATCCATTTTCA
U1148 GACCCGAAAGATGGTGAA
L2450 GCTTTGTTTTAATTAGACAGTCGGA
U1846 AGGCCGAAGTGGAGAAGG
L3449 ATTCTGACTTAGAGGCGTTCA
COI
Cox1_schist_5kTCTTTRGATCATAAGCG
Cox1_schist_3kTAATGCATMGGAAAAAAACA
Additional sequencing primers
lsrDNA
300F CAAGTACCGTGAGGGAAAGTTG
300R CAACTTTCCCTCACGGTACTTG
EDC2 CCTTGGTCCGTGTTTCAAGACGGG
900F CCGTCTTGAAACACGGACCAAG
1200F CCCGAAAGATGGTGAACTATGC
1200R GCATAGTTCACCATCTTTCGG
1600F AGCAGGACGGTGGCCATGGAAG
U2229 TACCCATATCCGCAGCAGGTCT
L2230 AGACCTGCTGCGGATATGGGT
U2562 AAACGGCGGGAGTAACTATGA
L2630 GGGAATCTCGTTAATCCATTCA
U2771 AGAGGTGTAGGATARGTGGGA
L2984 CTGAGCTCGCCTTAGGACACCT
U3119 TTAAGCAAGAGGTGTCAGAAAAGT
U3139 AAGTTACCACAGGGATAACTGGCT
LSU3_4160 GGTCTAAACCCAGCTCACGTTCCC
L3358 AACCTGCGGTTCCTCTCGTACT
COI
CO1560Fa TTTGATCGTAAATTTGGTAC
CO1560Fb TTTGATCGGAATTTTGGTAC
CO1560R GCAGTACCAAATTTACGATC
CO1800F CATCATATGTTTATGGTTGG
CO1800Ra CCAACCATAAACATATGATG
CO1800Rb CCAACCATAAACATGTGATG
A. E. Lockyer and others 210
(Maddison & Maddison, 2000) and treated as un-
weighted and unordered but were not recoded.
To further interpret the phylogeny, the Host–
Parasite Database (H–PD) of The Natural History
Museum (Gibson & Bray, 1994), see www.nhm.a-
c.uk/zoology/hp-dat.htm, was used to code the snail
genera used as intermediate hosts by the taxa studied
here as well as those snail genera used by the other
schistosomatid species not available in our molecular
study. Using a variety of literature, including Car-
michael (1984), Farley (1971) and the H-PD, the
biogeographical distribution of species and genera
included in our phylogenetic estimates was also
examined. It should be noted that relying on the
literature may incorporate certain errors, particularly
where authors have misidentified parasite or host
taxa. The best test for host associations is full, ex-
perimentally determined, life-cycle information but
this is unavailable for most taxa. Finally, mitochon-
drial gene arrangements, based on published and
unpublished observations of taxa used in this study
were coded or inferred according to phylogenetic
position and mapped on the phylogeny.
RESULTS
Accession numbers for each gene sequenced are
shown in Table 1. Only ML solutions are presented
for each gene, as BI methods yielded identical
tree topologies throughout and MP produced only
minor deviations in some cases. The full GTR+I+G
model parameters for each data partition are shown
in Table 3. Major associations for each individual
gene are presented below, but the full detail of species
interrelationships is restricted to the combined evi-
dence solution (Fig. 5 below).
Cytochrome oxidase I
A total of 1139 sites were available for alignment, of
which 1122 were unambiguously aligned. Of the
aligned positions 524 were constant and 498 parsi-
mony informative. Removing third codon positions
resulted in 748 included positions, of which 496 were
constant and 180 parsimony informative. Phylo-
genetic estimates using the first 2 and all 3 codon
positions are shown in Fig. 2A and B, respectively.
The trees are almost identical in topology, suggesting
none or insignificant levels of bases saturation, but
with longer branch lengths for all taxa and greater
resolution among the more derived Schistosoma taxa
when all 3 positions were included (Fig. 2B). Dendri-
tobilharzia falls as the most basal taxon with other bird
schistosomes radiating first with a (Bilharziella+
Gigantobilharzia+Trichobilharzia) clade and then
the (Ornithobilharzia+Austrobilharzia) clade. The
mammalian schistosomes are split into 2 major
clades, namely (Heterobilharzia+Schistosomatium)
and (Schistosoma+Orientobilharzia).
Where multiple exemplars of genera were sampled,
only Schistosoma appears non-monophyletic, due to
the placement of Orientobilharzia. All schistosome
species appear to be well differentiated from one
another, in terms of molecular distance, except Tri-
chobilharzia szidati and T. ocellata, which are almost
identical. For COI these taxa differ in 9 bases out of
1125 bp (0.008) and all differences are at synonymous
sites. Poorly resolved nodes, as judged by relatively
low Bayesian support, include the relative placement
of the bird schistosome genera, the (Ornitho-
bilharzia+Austrobilharzia) clade, and the most de-
rived members of the African Schistosoma. Otherwise
the gene provides a high proportion of informative
positions, at least as judged by parsimony, for its
relatively short length.
ssrDNA
A total of 1937 sites were available for alignment, of
which 1831 were unambiguously aligned. Of the
aligned positions 1526 were constant and 145 par-
simony informative. The phylogenetic estimate
Table 3. Maximum likelihood parameter estimates
(All estimates are based on a general time reversible model of nucleotide substitution incorporating estimates of among-site
rate variation (ASRV), estimated proportion of invariant sites (Inv-E), transition rates (Ts), transversion rates (Tv) and
alpha shape parameter estimate of the gamma distribution (a). CO1
12
and CO1
123
indicate analyses using only the first two
codon positions for cytochrome oxidase 1, and that using all 3 positions, respectively.)
ASRV Ts Tv
Data partition aInv-E AG CT AC AT GC GT
All taxa
ssrDNA 0.652 0.539 5.021 7.039 0.901 1.842 0.660 1.000
lsrDNA 0.639 0.494 4.260 5.755 0.508 1.955 0.342 1.000
CO1
12
0.421 0.453 8.798 8.779 0.639 1.980 2.441 1.000
CO1
123
0.449 0.370 18.815 25.656 1.723 2.421 8.636 1.000
ssrDNA+lsrDNA+CO1
123
0.351 0.589 5.929 2.879 0.276 2.401 0.339 1.000
Schistosoma only
ssrDNA+lsrDNA+CO1
123
0.438 0.743 7.101 2.648 0.133 2.762 0.263 1.000
Phylogenetics of the Schistosomatidae 211
A B
CD
Fig. 2. Maximum likelihood estimates of the interrelationships of the Schistosomatidae from individual gene fragments. (A) Mitochondrial CO1 using only the first 2 codon positions.
(B) Mitochondrial CO1 using all 3 codon positions. (C) Nuclear small subunit rDNA. (D) Nuclear large subunit rDNA. Nodal support values are posterior probabilities (expressed as
percentages) from Bayesian analyses for each of the same data partitions.
A. E. Lockyer and others 212
afforded by this gene is shown in Fig. 2C. In contrast
to COI, Dendritobilharzia did not appear as the
most basal taxon. Instead, a larger clade including
(Dendritobilharzia +Bilharziella +Gigantobilharzia
+Trichobilharzia) occupies this position. Also in
contrast to COI, the next clade is (Heterobilharzia+
Schistosomatium) making the mammal schisto-
somes paraphyletic and giving (Ornithobilharzia+
Austrobilharzia) as the sister group to (Schistosoma+
Orientobilharzia). It is noteworthy that the inter-
relationships within Schistosoma are almost identical
to COI although Orientobilharzia falls in the same
clade as the East Asian Schistosoma (S. sinensium,S.
japonicum,S. malayensis and S. mekongi), rather than
basal to the African and Indian species. In the case of
Trichobilharzia,T. szidati and T. ocellata differ by
just 1 base change in 1868 bp (0.0005).
lsrDNA
A total of 3950 sites were available for alignment, of
which 3765 were unambiguously aligned. Of the
aligned positions 2900 were constant and 470 parsi-
mony informative. The tree is shown in Fig. 2D and is
almost identical in topology to that of ssrDNA except
in one important aspect. As with COI, Oriento-
bilharzia groups with S. incognitum, although with
poor nodal support. Poor nodal support also charac-
terizes the relative position of the (Heterobilharzia
+Schistosomatium) clade and the interrelationships
of the most derived African Schistosoma. In the case
of Trichobilharzia,T. szidati and T. ocellata differ by
7 base changes in 3856 bp (0.0018).
Combined COI, ssrDNA and lsrDNA
The partition homogeneity test (ILD ; incongruence
length difference test), using 100 test replicates in-
cluding parsimony informative sites only, indicated
no significant difference in signal between the 3 genes
for the ingroup (P=0.09), and therefore passed a test
for conditional combination of independent datasets.
Considering that this test has been demonstrated to
fail in detecting congruence when dealing with het-
erogeneous datasets, such as mitochondrial and nu-
clear gene sequences, the fact that no significant
difference was found, adds greater confidence in
combining our data (Dowton & Austin, 2002). The
combined data were analysed in full, and also for the
(Schistosoma+Orientobilharzia) clade alone (ILD ;
P=0.65). Results of the full analysis are shown in
Fig. 3. The avian clade is the same as with ssrDNA
and lsrDNA alone, and the interrelationships of these
schistosomes remains (Bilharziella (Trichobilharzia,
(Dendritobilharzia,Gigantobilharzia))). The next 2
major clades appear as with ssrDNA and lsrDNA
individually, but very poor nodal support means that
the true position of (Heterobilharzia+Schistosoma-
tium) may not be fully resolvable with these data
alone. However, even with this node unresolved, it
appears that mammalian schistosomes are para-
phyletic and, as with the individual rRNA genes, the
full analysis including COI resolves the bird schisto-
some clade (Ornithobilharzia+Austrobilharzia)as
the sister group to the (Schistosoma+Orientobil-
harzia) clade. It is clear that Orientobilharzia tur-
kestanicum is a member of the Schistosoma clade. The
Schistosoma split into 2 lineages, the East Asian
species and the rest. Within the East Asian clade,
S. sinensium was the first to diverge, followed by S.
japonicum.Orientobilharzia and S. incognitum sep-
arate the East Asian Schistosoma from the remaining
schistosomes, but the relatively poor nodal support
for S. incognitum suggests it may occupy a clade with
Orientobilharzia (as suggested, also weakly, by the
lsrDNA analysis). Of the remaining taxa, S. mansoni
and S. rodhaini form a well-supported clade as do
S. spindale and S. indicum.S. nasale is very weakly
supported (by bootstrap analysis) as the sister group
to S. spindale and S. indicum in the full analysis and its
position remains unresolved with these and the clade
of more derived taxa in the analysis of Schistosoma
taxa alone. Indeed, little resolution was gained in
analysing Schistosoma alone (results not shown).
Only an additional 127 sites were re-included in the
alignment (3 for CO1 ; 46 for ssrDNA ; 78 for
lsrDNA) and the topology within the (Schistosoma
+Orientobilharzia) clade remained essentially the
same as with the full analysis except that the re-
lationships between the 3 most derived taxa were
marginally better supported as (S. intercalatum (S.
curassoni,S. bovis)) by both bootstrap analysis using
maximum likelihood and the proportion of best
Bayesian trees supporting the nodes.
Constraint analyses
Constraint analyses were performed in order to test
whether the combined data set argued significantly
against specific topologies that were different from
the fully resolved, unconstrained solution provided
by ML, MP and BI (shown in Fig. 3). In particular to
test: (a) the avian schistosomes as a monophyletic
clade; (b) the mammalian schistosomes as mono-
phyletic; (c) the major avian clade including Bil-
harziella as the sister group to Schistosoma ; (d) the
(Heterobilharzia+Schistosomatium) clade as the sis-
ter group to Schistosoma (a slight variation on simply
holding mammalian schistosomes as monophyletic) ;
(e) Orientobilharzia and S. incognitum as a monophy-
letic group, as suggested by lsrDNA alone (Fig. 2D) ;
(f) Orientobilharzia belonging in a clade with the East
Asian Schistosoma as suggested by ssrDNA alone
(Fig. 2C) ; (g) the ‘ indicum ’ species group as mono-
phyletic. Results are shown in Table 4. Of all of these
permutations 2 hypotheses are clearly rejected by the
full implementation of the Shimodaira-Hasegawa
test. These were that Orientobilharzia falls in a clade
Phylogenetics of the Schistosomatidae 213
with the East Asian Schistosoma and that the
‘indicum ’ species group is monophyletic ; S. incog-
nitum does not cluster with the other ‘indicum ’ group
species, but lies basal to the schistosomes of Africa
and the Indian subcontinent.
Mapping morphological characters
Six morphological characters from Khalil (2002)
were taken as synapomorphies for the Schistosoma-
tidae and a seventh character inferred from our tree,
namely the presence of a gynaecophoric canal ;
Morand & Mu
¨ller-Graf (2000) also recognized this
character as plesiomorphic for the Schistosomatidae.
All other characters were taken directly from Car-
michael (1984) and mapped onto the combined evi-
dence topology shown in Fig. 3 (see Fig. 4 ; character
numbers corresponding to the codes used by Morand
&Mu
¨ller-Graf (2000) are also indicated). Carmi-
chael’s thesis deals only at the genus level and so the
combined evidence tree is reduced to reflect this. At
this level, all clades are supported by at least two syn-
apomorphies except the union of (Ornithobilharzia
+Austrobilharzia), which is strongly supported
by all molecular data but no obvious morphological
traits. Support for the sister group status between
(Ornithobilharzia+Austrobilharzia) and (Schisto-
soma+Orientobilharzia) emerges from 2 synapo-
morphies ; vitelline follicles paired along a common
caecum and the female common caecum being long
and straight. Four synapomorphies unite Schistosoma
and Orientobilharzia ; the absence of Laurer’s Canal
and a cirrus; weak coiling of the ovary and possession
of a small, globular seminal vesicle.
Fig. 3. Maximum likelihood estimate of the interrelationships of the Schistosomatidae from the combined analysis of
data partitions (ssrDNA, lsrDNA and CO1 employing all 3 codon positions). Nodal support values are bootstrap values
shown above (n=100), and Bayesian (posterior) probabilities expressed as percentages, shown below branches.
A. E. Lockyer and others 214
DISCUSSION
The combination of 3 genes has provided a phylogeny
of the Schistosomatidae that is reasonably well
resolved at all levels within the tree. The full data set
estimated a tree that is unique when compared to the
estimates from the individual nuclear ribosomal
DNA and mitochondrial cytochrome oxidase I gene
trees, but the same broad patterns emerge from each.
The main avian clade includes Bilharziella,Tricho-
bilharzia,Dendritobilharzia, and Gigantobilharzia ;
hereafter referred to as the BTDG clade. Its sister
clade includes the mammalian taxa, but also some
avian schistosomes. Within this clade, the next group
to diverge is less certain, based on nodal support
alone. The nuclear ribosomal genes both suggest the
mammalian clade (Heterobilharzia+Schistosoma-
tium) (the HS clade) but COI supports the remaining
avian genera (Ornithobilharzia+Austrobilharzia).
The full analysis reflects the individual ribosomal
solutions. Intuitively it might be expected that avian
clades gave rise to a monophyletic mammalian clade,
with the adoption of a mammalian vertebrate host as a
single evolutionary event. Constraint analyses failed
to reject either of these two clades as the true sister
group to Schistosoma and so phylogenetic analyses
were conducted without the use of an outgroup
(results not shown) since the poor support for these
internal deep nodes may be related to the long-
branching outgroup spuriously polarizing these basal
taxa (Felsenstein, 1978). However, the unrooted
phylograms from all analyses reflected the same
patterns in each rooted analysis and the final, full data
set indicated a very short branch length between
the BTDG and HS clades that, in turn, resulted in
relatively low bootstrap support at this critical node.
Although support for the relative positions of the
BTDG and HS clades remains problematic when
assessed in isolation, Bayesian inference strongly
recognized Ornithobilharzia+Austrobilharzia as the
sister group to the Schistosoma clade, and we consider
the full analysis to be the best available estimate.
Indeed, the clade is also well supported morpholo-
gically (see below). The topology from our combined
evidence solution provides the foundation for the
following discussion. Specific implications suggested
by this new topology are discussed below.
Systematics and taxonomy
The overall topology of the schistosomatid genera is
identical to that presented by Snyder & Loker (2000),
based on partial lsrDNA, except for the position of
the root. Snyder & Loker (2000) resolved Schisto-
soma+Orientobilharzia as a sister clade to the other
schistosomes, but all other relationships are the
same. Thus, this study confirms that at least one
higher taxonomic group is now clearly challenged.
The Schistosomatidae has been subdivided into 4
subfamilies. Leaving aside Griphobilharziinae, for
which no samples were obtained, of the others
Gigantobilharziinae (Mehra, 1940) as amended by
Farley (1971) comprises the genera Dendritobilharzia
and Gigantobilharzia and remains a valid taxon in
our scheme. Likewise, the Schistosomatinae Stiles &
Hassall, 1926, which includes all remaining taxa other
than Bilharziella and Trichobilharzia, also remains
monophyletic in this study. However, Bilharziella
and Trichobilharzia do not form a monophyletic
clade and therefore the subfamily Bilharziellinae
Price, 1929 can be rejected. Although Carmichael
(1984) listed 2 characters that appeared synapomor-
phic for the Bilharziellinae, namely the presence of
a gynaecophoric canal only surrounding the genital
pore (Carmichael’s character 4.2), and the male
genital pore well behind the acetabulum and caecal
reunion (Carmichael’s character 20.2), neither Car-
michael (1984) nor Morand & Mu
¨ller-Graf (2000)
favoured the relationship in their final trees. A fur-
ther consequence of rejecting the Bilharziellinae is
that it is not possible to speculate on the position of
Jilinobilharzia, within which there are only 2 species,
Table 4. Results of constraint analyses on the combined data set testing for the likelihood of accepting
alternative tree topologies
(See text for further details. Log likelihood values, their differences with respect to the unconstrained solution and the
significance of the constraints tested by the Shimodaira-Hasegawa test as implemented in PAUP* on ML trees are
indicated; P<0.05 indicates a significantly different topology (#).)
Constraint* xlnL diff.xlnL P
Unconstrained 34170.47
Avian schistosomes monophyletic 34180.50 10.03 0.522
Mammalian schistosomes monophyletic 34179.01 8.54 0.564
Bilharziella clade
1
as sister to Schistosoma 34180.50 10.03 0.522
Heterobilharzia clade
2
as sister to Schistosoma 34179.01 8.54 0.564
Orientobilharzia+S. incognitum monophyletic 34186.67 16.20 0.356
Orientobilharzia+E. Asian Schistosoma monophyletic
3
34212.00 41.53 0.035
#
‘indicum ’ species group monophyletic
4
34228.01 57.54 0.006
#
*
1
Bilharziella,Dendritobilharzia,Gigantobilharzia and Trichobilharzia ;
2
Heterobilharzia and Schistosomatium;
3
S. sinensium,S. japonicum,S. malayensis,S. mekongi ;
4
S. incognitum,S. spindale,S. nasale and S. indicum.
Phylogenetics of the Schistosomatidae 215
Fig. 4. For legend see facing page.
A. E. Lockyer and others 216
beyond suggesting that it will likely fall within the
(BTDG) clade.
In order to evaluate our combined evidence tree
in the light of morphology, Carmichael’s characters
(Carmichael, 1984) were mapped on to the tree ; the
codes used by Morand & Mu
¨ller-Graf (2000) are also
shown. Highlighting only those characters changing
unambiguously (i.e. with a consistency index of 1) the
character changes are indicated in Fig. 4. In spite of
short branch lengths and relatively poor nodal sup-
port at the deeper nodes within our tree, a satisfying
number of morphological synapomorphies exist at
critical nodes throughout the tree. The Schisto-
somatinae is supported by 3 characters (Carmichael’s
characters 18, 20.1, 21), and the sister group status of
(Ornithobilharzia+Austrobilharzia)toSchistosoma is
supported by 2 characters concerning the arrange-
ment of the vitelline follicles (8.2) and the length and
shape of the female common caecum (22.1). Four
characters (7.1, 14, 15.4, and 16) support the re-
inclusion of Orientobilharzia within Schistosoma,a
relationship originally proposed until revised by Dutt
& Srivastava (1961). More recently this relationship
was resurrected by Snyder & Loker (2000) using
partial lsrDNA ; supported by ITS2 (Zhang et al.
2001) and again partial lsrDNA (Attwood et al.
2002b); and is confirmed by the present study.
Orientobilharzia is traditionally distinguished from
Schistosoma by the large number of testes (usually
>50) present in Orientobilharzia (Farley, 1971 ;
Khalil, 2002). Morand & Mu
¨ller-Graf (2000) demon-
strated that testes number varied widely and not sys-
tematically throughout the family, suggesting this is
not a good character for phylogenetic purposes. The
only autapomorphy for the genus Orientobilharzia
(the absence of a seminal receptacle, character 17)
may be erroneous, as Carmichael (1984), based on
preliminary observations, reported that further
study may well reveal the presence of the structure
in the ‘genus’. It is clear, however, that the genus
Orientobilharzia is synonymous with Schistosoma.A
revision of the genus Orientobilharzia, ideally sup-
ported by molecular evidence, is required.
Within Schistosoma the traditional species groups,
based partly on egg morphology, are only marginally
compromised by our scheme. The ‘ japonicum ’,
‘mansoni’ and ‘haematobium ’ species groups remain
intact but the position of S. incognitum renders the
‘indicum ’ group either redundant, or restricted to
S. nasale,S. spindale and S. indicum. Egg morphology
within the group, with or without S. incognitum,is
still highly divergent. Of those Schistosoma species
not available to us, the position of S. hippopotami
and S. edwardiense remains problematic. Although
nominally included in the ‘ mansoni’ species group on
the basis of lateral-spined eggs, in the single mol-
ecular study that used ITS2 from S. hippopotami
(Despre
´set al. 1995), it failed to cluster with the
S. mansoni group. S. hippopotami does show mor-
phological similarities to S. incognitum at both egg
and adult stages (Thurston, 1963) although the in-
termediate snail host is not known. Since our results
remove S. incognitum from the ‘ indicum ’ group, it
seems likely that these two species could show a close
affiliation. No sequence data have ever been obtained
from S. edwardiense and its position is undetermined,
although this species is believed to use Biomphalaria
as a snail host (as do S. mansoni and S. rodhaini)
(Pitchford & Visser, 1981).
Attwood et al. (2002 a) described S. ovuncatum of
northern Thailand as a new species, distinct from
S. sinensium of Sichuan, China, on the basis of clear
morphological difference ; the eggs of S. ovuncatum
bear a small hook-like subterminal spine. Attwood
et al. (2002 b) provided partial lsrDNA and mitochon-
drial 12S rDNA sequences for specimens from the
type population of S. ovuncatum and these indicated
that this taxon is the sister species of S. sinensium
from China (0.8 % of sites were polymorphic at the
28S locus and 5.3% at the 12S). Denser sampling
within Schistosoma species may indicate high genetic
divergence, as found within S. sinensium sampled
between Thailand and China (Agatsuma et al. 2001)
and for S. intercalatum using RAPD data (Kaukas
et al. 1994). Divergence levels within S. sinensium ex-
ceed the divergence between S. malayensis and
S. mekongi and it seems likely that further species will
be described. In contrast, sampling of large frag-
ments of mitochondrial DNA within S. malayensis
and S. mekongi populations has shown limited vari-
ation (Le, Blair & McManus, 2002b).
Our tree suggests one other taxonomically im-
portant taxonomic feature. The very close relation-
ship, and almost identical nucleotide sequences
between Trichobilharzia ocellata and T. szidati,
suggests they may be synonymous. A wider study
including denser molecular sampling of populations
and a re-evaluation of purported morphological dif-
ferences will help to confirm this.
Host identity and host associations
Schistosomatids use snails from across a wide phylo-
genetic range within the Gastropoda and appear to
Fig. 4. Interpretation of the evolutionary radiation of the Schistosomatidae with the acquisition and loss of key features.
Numbers in rounded brackets are the characters from Carmichael (1984), while those in square brackets the numbers assigned
for the same characters by Morand & Mu
¨ller-Graf (2000). Character 17 of Carmichael (1984), is marked as ‘ ? ’; although
absence of a seminal receptacle is a characteristic of Orientobilharzia, Carmichael (1984), suggested that such a structure may
have been visible in one specimen he observed (USNHC #45820). * – Morand & Mu
¨ller-Graf (2000) coded the seminal
receptacle using two characters (26 and 27); for Orientobilharzia it was coded as ‘simple and sac-like’ rather than absent.
Phylogenetics of the Schistosomatidae 217
have switched intermediate host across considerable
phylogenetic distances (Blair et al. 2001). Our own
review of the literature, to assess mollusc families
indicated as intermediate hosts to schistosomatids in
the wild, is recorded in Fig. 5. Data for individual
species used in this study and the genera as a whole are
indicated. As a literature review, this figure reflects
the completeness and accuracy of the published data.
This is not without its difficulties due to the problems
in identifying mollusc species and emerging cercariae
and it is recognized that the list may include anom-
alous associations that require at least resampling
and at best experimental verification. Our review of
this literature suggested that the schistosomatids are
generalists in their use of intermediate snail hosts.
The same data are presented in Fig. 6 with phylo-
genies of the molluscs and parasites interlinked by
their recorded associations. The basic mollusc phylo-
geny is adapted from the tree presented by Blair et al.
(2001). The interrelationships of the cerithioidean
gastropods are adapted from the molecular system-
atic analysis of Lydeard et al. (2002). Snail host and
parasite phylogenies and associations were drawn
with the aid of TREEMAP (Page, 1995) in an attempt
to identify any patterns of cospeciation. A heuristic
search, superimposing the parasite tree on the host
tree resolved only 1 cospeciation event and 101
sorting events (see Page, 1994). Intermediate host
associations provide little evidence as to the inter-
relationships of the parasites at the generic level, and
it seems likely that there have been several host-
switching events into related taxa. However, the
‘tanglegram’ indicates the huge variety of snails used
by schistosomatids and also indicates how clades
within Schistosoma have radiated predominantly
within 3 families of snails. The East Asian clade is
restricted to the Pomatiopsidae (Gastropoda : Caeno-
gastropoda), while all other species are restricted to
the Planorbidae with the exception of S. incognitum
and Orientobilharzia. These species both use snails
of the Lymnaeidae. Only the other mammalian clade
(Heterobilharzia+Schistosomatium) shows a restric-
ted use of snail hosts (Lymnaeidae) whereas it is the
avian schistosomes that appear to be transmitted by
the greatest diversity of snails. Caenogastropod hosts
are only used by the East Asian Schistosoma clade, the
(Ornithobilharzia+Austrobilharzia) clade, Giganto-
bilharzia and 1 species of Trichobilharzia (T. corvi),
and again, it is the Schistosoma that are restricted
to a single snail family (Pomatiopsidae). Blair (2001)
considered pulmonates to be the ancestral hosts for
the schistosomatids, with individual host switching
events accounting for those using caenogastropod
hosts, but the basal position of Austrobilharzia and
Ornithobilharzia in their tree meant that they could
not be certain. Our tree, with Ornithobilharzia
+Austrobilharzia as sister group to the Schistosoma,
adds weight to his argument that association with
pulmonate host is the pleisiomorphic condition.
Finally, Fig. 5 highlights situations in which
schistosomes can become established in new regions.
A case in point is the occurrence of an S. haema-
tobium-like species infecting humans in India, which
may be transmitted by Ferrissia tenuis, an ancylid
snail (Southgate & Agrawal, 1990). Although this
parasite has never been formally identified and other,
perhaps more suitable, hosts are present in the re-
ported focus, this unusual occurrence readily demon-
strates the ease with which schistosomes can establish
themselves when suitable hosts are present.
Geographical distribution and historical biogeography
As with intermediate host identity, the geographical
distribution of taxa studied here, and other members
of the genera, is indicated in Fig. 5, again produced
from reviewing published work. Not surprisingly,
avian schistosomes have a very broad distribution.
The most basal avian clade has achieved an almost
global distribution with species found in all regions
except South America. The wide dispersal of bird
parasites is easy to envisage, but the avian schisto-
somatids’ success must also be due to their ability to
utilize a variety of molluscan hosts.
With respect to the possible origin and spread of
the mammalian genera, Schistosoma and Oriento-
bilharzia (assuming that current distribution is in-
dicative of past events) the Asian origin has been
confirmed, with the ‘ japonicum ’ group clearly basal
to the African and Indian schistosomes. Fig. 7A is
a synthesis of Snyder and Loker’s hypothesis as
reviewed by Morgan et al. (2001). Most interestingly
S. incognitum, found in India as well as Thailand and
Indonesia, diverges early in the phylogeny suggesting
that ancestors of the Schistosoma may have entered
the Indian subcontinent before Africa ; see Fig. 7B
for a diagram of our interpretation ; Attwood et al.
(2002b) provide finer-scale hypotheses on the move-
ment of Asian Schistosoma into and from the Indian
subcontinent. Our results suggest that there has been
movement east across Asia giving rise to Oriento-
bilharzia and S. incognitum followed by colonization
of Africa from India. There followed a reinvasion
of the Indian subcontinent by the ancestor to the
‘indicum ’ species group, which radiated to form S.
nasale,S. spindale and S. indicum, whilst members of
the ‘haematobium ’ group continued to radiate within
Africa. Such a scenario is dependent upon the pos-
ition of S. nasale within a monophyletic ‘ indicum ’
group suggested by the combined evidence. The most
recent and most easily dated dispersal (y500 YA)
was S. mansoni to S. America via the African slave
trade (Despre
´set al. 1993), where its subsequent
establishment was due to the presence of suitable
snail hosts (Campbell et al. 2000 ; DeJong et al. 2001).
The occurrence of 2 lineages within Africa has been
recognized for a long time and each lineage has in-
dependently given rise to schistosomes that infect
A. E. Lockyer and others 218
man, suggesting multiple lateral transfers between
hosts, in the case of S. mansoni from rodents and for
S. haematobium and S. intercalatum from ungulates
(Combes, 1990). A minimum of 3 independent ori-
gins of schistosomes in humans can be scored from
our phylogeny. To answer the question posed in the
title of Zhang et al.’s study (2001), there were at
least 1 Asian and 2 African evolutionary origins for
human schistosomes. Once associated with humans,
the dispersal of schistosomes may have occurred via
early humans and their domesticated animals. The
fact that schistosomes infecting man seem to be the
result of a number of lateral transfers in different
lineages indicates that schistosomes were already
widespread before the evolution and spread of Homo.
This suggests that non-human mammal migration is
most likely to be responsible for the continental dis-
persal of Schistosoma species. Attwood et al. (2002 a,b)
regarded climate driven dispersal of rodents and other
small mammals, rather than human involvement, as a
key factor in the early radiation of Schistosoma.
Mitochondrial genomes
Le et al. (2000) reported a remarkable difference
in mitochondrial gene order for S. mansoni when
compared to other parasitic platyhelminths, and
indeed other Schistosoma species. Comparing se-
quenced and characterized mitochondrial genomes
for 4 species of Schistosoma, 2 other digeneans and
4 cestodes, Le et al. (2001 ; Le, Blair & McManus,
2002a) revealed that S. mansoni exhibited a major
translocation involving the genes atp6,nad2 and
trnaA and a rearrangement of nad3 and nad1. All the
East Asian schistosomes (S. japonicum,S. mekongi
and S. malayensis) essentially exhibit the same gene
∞ ∞
∞
∞
∞∞
∞
∞
∞
∞
∞∞
∞ ∞
∞∞∞
∞∞
∞
Fig. 5. Intermediate host associations, geographical range and mitochondrial gene order for species studied here, and for all
members of each genera (not Schistosoma) as determined from the literature (predominantly the NHM’s Host–Parasite
Database) or, in the case of mtDNA, inferred from experimental data. Parasites that infect humans are indicated. Op,
Opisthobranchia. Snail host associations : (2) indicates that the named species uses that snail family as host ; (1) indicates
that other species within the genus associate with the host family. Geographical distribution : ($) indicates that the
named species occupies the specific geographic range indicated; (#) indicates that other species within the genus
occupy the range indicated.
Phylogenetics of the Schistosomatidae 219
order as other digeneans and cestodes examined to
date, suggesting that they have the plesiomorphic
condition for the Digenea. It can be inferred there-
fore, that taxa basal to the East Asian schistosomes
also have the plesiomorphic condition and it has
recently been confirmed that S. spindale and S.
haematobium have the same gene order as S. mansoni
(unpublished results). This same gene order is also
suggested for 6 other African schistosome species
(S.bovis,S.curassoni,S.intercalatum,S.margrebowiei,
S. mattheei and S. rodhaini), based on length and
preliminary sequencing of a 2.6 kb fragment of mito-
chondrial DNA amplified from all 6 species using
universal primers (unpublished results). It is there-
fore inferred that all taxa on our tree from S. mansoni
to the most derived African taxa have this same gene
order. However, the gene order of Orientobilharzia
and S. incognitum is unknown and since they are
likely to hold the key as to when and, based on bio-
geography, perhaps where the major rearrangement
and translocation events occurred, we are currently
characterizing these genomes.
The phylogeny presented here, based on 1 mito-
chondrial protein-coding and 2 nuclear ribosomal
RNA genes, provides a robust assessment of inter-
relationships within the Schistosomatidae and, in
particular, within 18 species of a revised genus Schisto-
soma that includes Orientobilharzia. Four major
clades radiated within the family, reflecting 2 radi-
ations within birds and 2 within mammals. Mam-
malian schistosomes are relatively restricted in their
biogeographical distribution and their use of snail
intermediate hosts. Avian schistosomes are more
widespread and use a far greater diversity of snail
families. There is little evidence for cospeciation be-
tween snail families and parasites, although finer scale
phylogenies within snail families hosting mammalian
schistosomes may subsequently reveal such patterns.
We resolved an avian clade, including Austrobil-
harzia and Ornithobilharzia as sister group to Schisto-
soma, showing that colonization of mammalian host
was not a single event. Within Schistosoma, the East
Asian taxa are most basal, confirming an Asian origin
for the genus. Subsequent movement of Schistosoma
eastwards across Asia resulted in an invasion of
Africa, suggested by the position of S. mansoni and
S. rodhaini, a re-invasion of central Asia and the
Indian subcontinent, suggested by the positions of
Fig. 6. TREEMAP (Page, 1995) plot of snail host and schistosome parasite associations in relation to their respective
phylogenies. Avian and mammalian schistosome lineages are indicated. Shaded areas represent snail family associations
with the mammalian schistosome clades.
A. E. Lockyer and others 220
S. nasale,S. spindale and S. indicum, and an addi-
tional radiation of species within Africa among the
‘haematobium ’ species group. Non-human mammal
migration is most likely to be responsible for the
earlier continental dispersal of Schistosoma species. A
suite of morphological characters supports the mol-
ecular tree and a number of morphological syna-
pomorphies are recognized for all but a few clades.
We reject the subfamily Bilharziellinae, suggest that
Trichobilharzia ocellata and T. szidati may be the
same species, and advise a revision and renaming of
Orientobilharzia to reflect its unquestioned position
within the genus Schistosoma. Our tree supports
a split in the pattern of mitochondrial genome
organization between the East Asian Schistosoma and
the more derived taxa, but it remains to be seen
whether S. incognitum and/or Orientobilharzia have
the plesiomorphic or derived unique patterns of
mitochondrial gene arrangement exhibited by S.
mansoni.
This work was funded by a Wellcome Trust Senior
Research Fellowship to D. T.J.L. (043965/Z/95/Z).
Additional funding was from the Czech Ministry of Edu-
cation (Grant No. J13/981131-4) for Petr Horak ; from the
National Science Foundation (USA) (BIR-9626072) for
Scott Snyder, and from Grant-in-Aid for International
Scientific Research from the Japanese Ministry of
Education (10041188, 13576008) for Takeshi Agatsuma.
We would like to thank all the many colleagues and field-
workers who have helped us collect specimens and maintain
schistosome life-cycles, especially Mike Anderson, NHM
and also M. M. H. Mondal and V. Kitikoon for collecting
S. indicum and S. incognitum respectively. We are grateful
to David Gibson, Rod Bray and Eileen Harris for access
to the NHM’s Host–Parasite Database and help with
the systematic literature. Julia Llewellyn-Hughes and
Claire Griffin provided expert technical assistance in the
operation of the automated DNA sequencers. Fred Naggs
and David Reid kindly advised on certain molluscan
queries.
REFERENCES
AGATSUMA,T., IWAGAMI,M., LIU,C.X., RAJAPAKSE,R.,
MONDAL,M.M.H., KITIKOON,V., AMBU,S., AGATSUMA,Y.,
BLAIR,D.& HIGUCHI,T. (2002). Affinities between Asian
non-human Schistosoma species, the S. indicum group,
and the African human schistosomes. Journal of
Helminthology 76, 7–19.
AGATSUMA,T., IWAGAMI,M., LIU,C.X., SAITOH,Y.,
KAWANAKA,M., UPATHAM,S., QUI,D.& HIGUCHI,T. (2001).
Molecular phylogenetic position of Schistosoma
sinensium in the genus Schistosoma.Journal of
Helminthology 75, 215–221.
ATTWOOD,S.W. (2001). Schistosomiasis in the Mekong
region: epidemiology and phylogeography. Advances in
Parasitology 50, 87–152.
ATTWOOD,S.W.& JOHNSTON,D.A. (2001). Nucleotide
sequence differences reveal genetic variation in
Neotricula aperta (Gastropoda : Pomatiopsidae), the snail
host of schistosomiasis in the lower Mekong
Basin. Biological Journal of the Linnean Society 73, 23–41.
ATTWOOD,S.W., PANASOPONKUL,C., UPATHAM,E.S., MENG,
X.H.& SOUTHGATE,V.R. (2002a). Schistosoma ovuncatum
n. sp. (Digenea: Schistosomatidae) from northwest
Thailand and the historical biogeography of Southeast
Asian Schistosoma Weinland, 1858. Systematic
Parasitology 51, 1–19.
ATTWOOD,S.W., UPATHAM,E.S., MENG,X.H., QIU,D.-C.
& SOUTHGATE,V.R. (2002b). The phylogeography of
Asian Schistosoma (Trematoda: Schistosomatidae).
Parasitology 125, 99–112.
BARKER,S.C.& BLAIR,D. (1996). Molecular phylogeny
of Schistosoma species supports traditional groupings
within the genus. Journal of Parasitology 82, 292–298.
BARRAL,V., THIS,P., IMBERT-ESTABLET,D., COMBES,C.&
DELSENY,M. (1993). Genetic variability and evolution of
the Schistosoma genome analysed by using random
Fig. 7. Hypotheses on the Asian origin and dispersal of
Schistosoma. (A) Asian origin (after Morgan et al. 2001 ;
Snyder & Loker, 2000). (1) The ancestral Asian Schistosoma
moves to Africa via widespread mammal migration.
(2) The Schistosoma ancestor remaining in Asia becomes
the S. japonicum species group. (3 and 4) The African
Schistosoma ancestor diverges to form the S. mansoni
and S. haematobium species groups. (5) An S. indicum
ancestor also diverges from the African ancestor and
migrates back to India, probably with early humans and
their animals. (6) Schistosoma mansoni disperses to South
America via the transport of African slaves. (B) Revised
Asian hypothesis (this study). (1) The ancestral Asian
Schistosoma radiates into the S. japonicum group.
(2) Meanwhile ancestral schistosomes disperse to Africa
via India and form the S. mansoni group. (3) A subsequent
split forms the S. haematobium group which radiates
through Africa, and (4) the S. indicum group which has
reinvaded the Indian subcontinent. (5) Schistosoma mansoni
disperses to South America via the transport of African
slaves.
Phylogenetics of the Schistosomatidae 221
amplified polymorphic DNA markers. Molecular and
Biochemical Parasitology 59, 211–222.
BLAIR,D., DAVIS,G.M.&WU,B. (2001). Evolutionary
relationships between trematodes and snails emphasizing
schistosomes and paragonimids. Parasitology 123,
S229–S243.
BLAIR,D., VAN HERWERDEN,L., HIRAI,H., TAGUCHI,T., HABE,
S., HIRATA,M., LAI,K., UPATHAM,S.& AGATSUMA,T.
(1997). Relationships between Schistosoma malayensis
and other Asian schistosomes reduced from DNA
sequences. Molecular and Biochemical Parasitology 85,
259–263.
BOWLES,J., BLAIR,D.&MCMANUS,D.P. (1995). A molecular
phylogeny of the human schistosomes. Molecular
phylogenetics and Evolution 4, 103–109.
CAMPBELL,G., JONES,C.S., LOCKYER,A.E., HUGHES,S.,
BROWN,D., NOBLE,L.R.& ROLLINSON,D. (2000).
Molecular evidence supports an African affinity of
the Neotropical freshwater gastropod, Biomphalaria
glabrata, Say 1818, an intermediate host for Schistosoma
mansoni.Proceedings of the Royal Society of London, B
267, 2351–2358.
CARMICHAEL,A.C. (1984). Phylogeny and historical
biogeography of the Schistosomatidae. Ph.D. thesis,
Michigan State University, Michigan.
COMBES,C. (1990). Where do human schistosomes come
from? An evolutionary approach. Trends in Ecology and
Evolution 5, 334–337.
CRIBB,T.H., BRAY,R.A., LITTLEWOOD,D.T.J., PICHELIN,S.P.
& HERNIOU,E.A. (2001). The Digenea. In
Interrelationships of the Platyhelminthes (ed. Littlewood,
D. T. J. & Bray, R. A.), pp. 168–185. Taylor & Francis,
London.
CUNNINGHAM,C.W. (1997). Can three incongruence tests
predict when data should be combined ? Molecular
Biology and Evolution 14, 733–740.
CUTLER,D.J. (2000). Estimating divergence times in the
presence of an overdispersed molecular clock. Molecular
Biology and Evolution 17, 1647–1660.
DAVIS,G.M. (1980). Snail hosts of Asian Schistosoma
infecting man: evolution and coevolution. In The
Mekong Schistosome (ed. Bruce, J. I., Sornmani, S.,
Asch, H. L. & Crawford, K. A.), pp. 195–238.
Malacological Review Suppl. 2, Whitmore Lake,
Michigan.
DE BONT,J.& VERCRUYSSE,J. (1997). The epidemiology and
control of cattle schistosomiasis. Parasitology Today 13,
255–262.
DEJONG,R.J., MORGAN,J.A.T., PARAENSE,W.L., POINTIER,
J.P., AMARISTA,M., AYEH-KUMI,P.F.K., BABIKER,A.,
BARBOSA,C.S., BREMOND,P., CANESE,A.P., DE SOUZA,C.P.,
DOMINGUEZ,C., FILE,S., GUTIERREZ,A., INCANI,R.N.,
KAWANO,T., KAZIBWE,F., KPIKPI,J., LWAMBO,N.J.S.,
MIMPFOUNDI,R., NJIOKOU,F., PODA,J.N., SENE,M.,
VELASQUEZ,L.E., YONG,M., ADEMA,C.M., HOFKIN,B.V.,
MKOJI,G.M.& LOKER,E.S. (2001). Evolutionary
relationships and biogeography of Biomphalaria
(Gastropoda: Planorbidae) with implications regarding
its role as host of the human bloodfluke, Schistosoma
mansoni.Molecular Biology and Evolution 18,
2225–2239.
DESPRE
´S,L., IMBERT-ESTABLET,D., COMBES,C.& BONHOMME,
F. (1992). Molecular evidence linking hominid evolution
to recent radiation of schistosomes (Platyhelminthes:
Trematoda). Molecular Phylogenetics and Evolution 1,
295–304.
DESPRE
´S,L., IMBERT-ESTABLET,D.& MONNEROT,M. (1993).
Molecular characterization of mitochondrial DNA
provides evidence for the recent introduction of
Schistosoma mansoni into America. Molecular and
Biochemical Parasitology 60, 221–230.
DESPRE
´S,L., KRUGER,F.J., IMBERT-ESTABLET,D.& ADAMSON,
M.L. (1995). ITS2 ribosomal RNA indicates Schistosoma
hippopotami is a distinct species. International Journal for
Parasitology 25, 1509–1514.
DOWTON,M.& AUSTIN,A.D. (2002). Increased congruence
does not necessarily indicate increased phylogenetic
accuracy – the behavior of the incongruence length
difference test in mixed-model analyses. Systematic
Biology 51, 19–31.
DUTT,S.C.& SRIVASTAVA,H.D. (1961). A revision of the
genus Ornithobilharzia Odhner (1912) with the creation
of two genera Orientobilharzia Dutt and Srivastava
(1955) and Sinobilharzia Dutt and Srivastava (1955)
(Trematoda: Schistosomatidae). Indian Journal of
Helminthology 13, 61–73.
DVORAK,J., VANACOVA,S., HAMPL,V., FLEGR,J.& HORAK,P.
(2002). Comparison of European Trichobilharzia species
based on ITS1 and ITS2 sequences. Parasitology 124,
307–313.
FARLEY,J. (1971). A review of the family Schistosomatidae :
excluding the genus Schistosoma from mammals. Journal
of Helminthology 45, 289–320.
FARRIS,J.S., KALLERSJO,M., KLUGE,A.G.& BULT,C. (1995).
Constructing a significance test for incongruence.
Systematic Biology 44, 570–572.
FELSENSTEIN,J. (1978). Cases in which parsimony or
compatibility methods will be positively misleading.
Systematic Zoology 27, 401– 410.
GIBSON,D.I.& BRAY,R.A. (1994). The evolutionary
expansion and host-parasite relationships of the Digenea.
International Journal for Parasitology 24, 1213–1226.
GIBSON,D.I., JONES,A.& BRAY,R.A. (2002). Keys to the
Trematoda. Vol. 1. CABI Publishing, Wallingford.
HORAK,P.& KOLAROVA,L. (2001). Bird schistosomes – do
they die in mammalian skin ? Trends in Parasitology 17,
66–69.
HORAK,P., KOLAROVA,L.& ADEMA,C.M. (2002). Biology of
the schistosome genus Trichobilharzia.Advances in
Parasitology 52, 155–233.
HUELSENBECK,J.P. (2000). MrBayes: Bayesian inference of
phylogeny. Department of Biology, University of
Rochester.
HUELSENBECK,J.P., BULL,J.J.& CUNNINGHAM,C.W. (1996).
Combining data in phylogenetic analysis. Trends in
Ecology and Evolution 11, 152–158.
JEANMOUGIN,F., THOMPSON,J.D., GOUY,M., HIGGINS,D.G.
& GIBSON,T.J. (1998). Multiple sequence alignment
with Clustal X. Trends in Biochemical Sciences 23,
403–405.
JOHNSTON,D.A., KANE,R.A.& ROLLINSON,D. (1993). Small
subunit (18S) ribosomal RNA gene divergence in the
genus Schistosoma.Parasitology 107, 147–156.
KAUKAS,A., DIAS NETO,E., SIMPSON,A.J.G., SOUTHGATE,
V.R.& ROLLINSON,D. (1994). A phylogenetic analysis of
Schistosoma haematobium group species based on
randomly amplified polymorphic DNA. International
Journal for Parasitology 24, 285–290.
A. E. Lockyer and others 222
KHALIL,L.F. (2002). Family Schistosomatidae Stiles
& Hassall, 1898. In Keys to the Trematoda (ed. Gibson,
D. I., Jones, A. & Bray, R. A.), pp. 419– 432. CABI
Publishing, Wallingford, UK.
LE ROUX,P.L. (1958). The validity of Schistosoma capense
(Harley, 1864) amended as a species. Transactions of the
Royal Society of Tropical Medicine and Hygiene 52,
12–14.
LE,T.H., BLAIR,D., AGATSUMA,T., HUMAIR,P.F., CAMPBELL,
N.J.H., IWAGAMI,M., LITTLEWOOD,D.T.J., PEACOCK,B.,
JOHNSTON,D.A., BARTLEY,J., ROLLINSON,D., HERNIOU,
E.A., ZARLENGA,D.S.&MCMANUS,D.P. (2000).
Phylogenies inferred from mitochondrial gene orders – a
cautionary tale from the parasitic flatworms. Molecular
Biology and Evolution 17, 1123–1125.
LE,T.H., BLAIR,D.&MCMANUS,D.P. (2001). Complete DNA
sequence and gene organization of the mitochondrial
genome of the liverfluke, Fasciola hepatica L.
(Platyhelminthes: Trematoda). Parasitology 123,
609–621.
LE,T.H., BLAIR,D.&MCMANUS,D.P. (2002a). Mitochondrial
genomes of parasitic flatworms. Trends in Parasitology
18, 206–213.
LE,T.H., BLAIR,D.&MCMANUS,D.P. (2002 b). Revisiting the
question of limited genetic variation within Schistosoma
japonicum. Annals of Tropical Medicine and Parasitology
96, 155–164.
LEE,M.S.Y. (2001). Uninformative characters and apparent
conflict between molecules and morphology. Molecular
Biology and Evolution 18, 676–680.
LITTLEWOOD,D.T.J.& JOHNSTON,D.A. (1995). Molecular
phylogenetics of the four Schistosoma species groups
determined with partial 28S ribosomal RNA gene
sequences. Parasitology 111, 167–175.
LITTLEWOOD,D.T.J., ROHDE,K., BRAY,R.A.& HERNIOU,E.A.
(1999). Phylogeny of the Platyhelminthes and the
evolution of parasitism. Biological Journal of the Linnean
Society 68, 257–287.
LOCKYER,A.E., OLSON,P.D.& LITTLEWOOD,D.T.J. (2003).
Utility of complete large and small subunit rRNA genes
in resolving the phylogeny of the Platyhelminthes :
implications and a review of the cercomer theory.
Biological Journal of the Linnean Society 78, 155–173.
LYDEARD,C., HOLZNAGEL,W.E., GLAUBRECHT,M.& PONDER,
W.F. (2002). Molecular phylogeny of a circum-global,
diverse gastropod superfamily (Carithioidea :
Mollusca: Caenogastropoda): pushing the deepest
phylogenetic limits of mitochondrial LSU rDNA
sequences. Molecular Phylogenetics and Evolution 22,
399–406.
MADDISON,W.P.& MADDISON,D.R. (2000). MacClade.
Version 4. Sinauer Associates, New York.
MALLATT,J.& WINCHELL,C.J. (2002). Testing the new
animal phylogeny : first use of combined large-subunit
and small-subunit rRNA gene sequences to classify
the Protostomes. Molecular Biology and Evolution 19,
289–301.
MEDINA,M., COLLINS,A.G., SILBERMAN,J.D.& SOGIN,M.L.
(2001). Evaluating hypotheses of basal animal phylogeny
using complete sequences of large and small subunit
rRNA. Proceedings of the National Academy of Sciences,
USA 98, 9707–9712.
MORAND,S.&MU
¨LLER-GRAF,C.D.M. (2000). Muscles or
testes? Comparative evidence for sexual competition
among dioecious blood parasites (Schistosomatidae) of
vertebrates. Parasitology 120, 45–56.
MORGAN,J.A.T., DE JONG,R.J., SNYDER,S.D., MKOJI,G.M.
& LOKER,E.S. (2001). Schistosoma mansoni and
Biomphalaria: past history and future trends.
Parasitology 123, S211–S228.
OLSON,P.D.& LITTLEWOOD,D.T.J. (2002). Phylogenetics
of the Monogenea – evidence from a medley of
molecules. International Journal for Parasitology 32,
233–244.
OLSON,P.D., LITTLEWOOD,D.T.J., BRAY,R.A.& MARIAUX,J.
(2001). Interrelationships and evolution of the
tapeworms (Platyhelminthes : Cestoda). Molecular
Phylogenetics and Evolution 19, 443–467.
PAGE,R.D.M. (1994). Maps between trees and
cladistic analysis of historical associations among
genes, organisms, and areas. Systematic Biology 43,
58–77.
PAGE,R.D.M. (1995). TreeMap. Ver. 1.0. Division of
Environmental and Evolutionary Biology, University
of Glasgow.
PITCHFORD,R.J.& VISSER,P.S. (1981). Schistosoma,
Weinland, 1858 from Hippopotamus amphibious,
Linnaeus 1758 in the Kruger National Park.
Onderstepoort Journal of Veterinary Research 49,
233–235.
PLATT,T.R., BLAIR,D., PURDIE,J.& MELVILLE,L. (1991).
Griphobilharzia amoena n. gen, n. sp. (Digenea,
Schistosomatidae), a parasite of the freshwater
crocodile Crocodylus johnstoni (Reptilia, Crocodylia)
from Australia, with the erection of a new
subfamily, Griphobilharziinae. Journal of Parasitology
77, 65–68.
PLATT,T.R.& BROOKS,D.R. (1997). Evolution of the
schistosomes (Digenea: Schistosomatoidea): the origin
of dioecy and colonization of the venous system. Journal
of Parasitology 83, 1035–1044.
POSADA,D.& CRANDALL,K.A. (1998). Modeltest: testing the
model of DNA substitution. Bioinformatics 14, 817–818.
RAMBAUT,A. (2000). Estimating the rate of molecular
evolution: incorporating non-contemporaneous
sequences into maximum likelihood phylogenies.
Bioinformatics 16, 395–399.
ROLLINSON,D., KAUKAS,A., JOHNSTON,D.A., SIMPSON,
A.J.G.& TANAKA,M. (1997). Some molecular insights into
schistosome evolution. International Journal for
Parasitology 27, 11–28.
ROLLINSON,D.& SOUTHGATE,V.R. (1987). The genus
Schistosoma: a taxonomic appraisal. In The Biology of
Schistosomes. From Genes to Latrines (ed. Rollinson, D.
& Simpson, A. J. G.), pp. 1–49. Academic Press,
London.
SAMBROOK,J., FRITSCH,E.F.& MANIATIS,T. (1989).
Molecular Cloning. A Laboratory Manual. Cold Spring
Harbour Laboratory Press, Cold Spring Harbour.
SHIMODAIRA,H.& HASEGAWA,M. (1999). Multiple
comparisons of log-likelihoods with applications to
phylogenetic inference. Molecular Biology and Evolution
16, 1114–1116.
SNYDER,S.D.& LOKER,E.S. (2000). Evolutionary
relationships among the Schistosomatidae
(Platyhelminthes: Digenea) and an Asian
origin for Schistosoma.Journal of Parasitology 86,
283–288.
Phylogenetics of the Schistosomatidae 223
SOUTHGATE,V.R.& AGRAWAL,M.C. (1990). Human
schistosomiasis in India? Parasitology Today 6,
166–168.
SWOFFORD,D.L. (2002). PAUP*. Phylogenetic Analysis
Using Parsimony *and Other Methods, Ver. 4. Sinauer
Associates, New York.
THURSTON,J.P. (1963). Schistosomes from Hippopotamus
amphibius L. I The morphology of Schistosoma
hippopotami sp. nov. Parasitology 53, 49–54.
WORLD HEALTH ORGANIZATION (2001). The World
Health Report 2001 : Mental Health: New
Understanding, New Hope. World Health Organization,
Geneva.
ZHANG,G.J., VERNEAU,O., QIU,C.P., JOURDANE,J.&XIA,
M.Y. (2001). An African or Asian evolutionary origin
for human schistosomes? Comptes Rendus de
l’Academie des Sciences Serie III. Sciences de la vie 324,
1001–1010.
A. E. Lockyer and others 224
