Severe cognitive impairment in DMD: Obvious clinical indication for Dp71 isoform point mutation screening

Abstract

Duchenne muscular dystrophy is associated with variable degrees of selective cognitive defect with lower scores for verbal intelligence and reading abilities. A number of findings have shown that rearrangements located in the second part of the gene seem to be preferentially associated with cognitive impairment. Several dystrophin transcripts are expressed in the brain. The more distal of them, Dp71, is predominant. We have carried out a mutational analysis of Dp71 transcript in 12 DMD patients severely, mildly or not retarded, all without detectable deletion or duplication. We have detected five point mutations causing Dp71 premature translation termination. All were found among the more severely mentally retarded patients of this group (VIQ < 50 and/or no reading acquisition).

Full text

SHORT REPORT
Severe cognitive impairment in DMD: obvious clinical
indication for Dp71 isoform point mutation screening
Marie-Pierre Moizard
1
, Annick Toutain
1
, Delphine Fournier
1
, Fran¸coise Berret
1
,
Martine Raynaud
1
, Catherine Billard
2
, Christian Andres
3
and Claude Moraine
1
1
Unit´e de G´en´etique, Hˆopital Bretonneau;
2
Unit´e de Neurochirurgie-Neurologie, Hˆopital Clocheville;
3
Laboratoire de
Biochimie et Biologie Mol´eculaire, INSERM unit´e316, Facult´e de M´edecine, Tours, France
Duchenne muscular dystrophy is associated with variable degrees of selective cognitive defect with lower
scores for verbal intelligence and reading abilities. A number of findings have shown that rearrangements
located in the second part of the gene seem to be preferentially associated with cognitive impairment.
Several dystrophin transcripts are expressed in the brain. The more distal of them, Dp71, is predominant.
We have carried out a mutational analysis of Dp71 transcript in 12 DMD patients severely, mildly or not
retarded, all without detectable deletion or duplication. We have detected five point mutations causing
Dp71 premature translation termination. All were found among the more severely mentally retarded
patients of this group (VIQ < 50 and/or no reading acquisition). European Journal of Human Genetics (2000)
8, 552–556.
Keywords: Duchenne muscular dystrophy; Dp71; cognitive impairment; point mutations; dystrophin isoforms
Introduction
Duchenne muscular dystrophy (DMD) is a progressive
X-linked muscle degenerative disorder, caused in most cases
by large out-of-frame deletions or duplications in the dystro-
phin gene.
1
The remaining patients have more subtle
mutations such as small insertions/deletions or nucleotide
substitutions.
2
In both cases, mutations cause premature
translation termination leading to an absence of dystrophin,
a 427kDa protein that is localised in the plasma membrane
of muscle cells. Apart from the muscles, the brain is the major
site of dystrophin expression. Two 427kDa dystrophins, one
active in neuronal cells of the cerebral cortex and the other
expressed in cerebellar Purkinje neurons, originate from two
distinct proximal promoters located in the vicinity of the
muscle promoter.
3,4
Two smaller alternative C-terminal prod-
ucts expressed in the brain, Dp140 and Dp71, have also been
described. Dp140 is initiated upstream from exon45
5
and
Dp71, between exons 62 and 63.
6,7
These four DMD tran-
scripts expressed in the brain retain the cysteine-rich and
carboxyterminal domains of dystrophin which bind to a
complex of sarcolemmal proteins known as the dystrophin
associated proteins (DAPs).
8
In most patients, the muscle disease is associated with
variable degrees of cognitive impairment, corresponding to
significantly lower scores for verbal skills and delay in
reading learning.
9
Several investigations have shown that
rearrangements located in the second part of the gene tend to
be more commonly associated with cognitive impairment
than mutations located in the proximal part.
10–12
Recently
Bardoni et al
13
found a statistically significant correlation
between the absence of Dp140 promoter and the presence of
mental retardation in patients suffering from Becker mus-
cular dystrophy (BMD), the allelic milder form of DMD.
Moreover, many point mutations have been described in
mentally retarded patients in the distal part of the gene
corresponding to the Dp71 coding region.
14,15
In a recent
investigation, we found two promoter deleted Dp140 tran-
scripts and two altered Dp71 transcripts (total absence of
Dp71 transcript for one patient and a nonsense mutation for
the other) respectively in four patients with severe cerebral
dysfunction.
16
Both patients with Dp140 deletion had a QIV
<70 and bad or no reading acquisition, whereas both
patients with altered Dp71 transcripts were psychologically
untestable because of severe mental deficiency. Taken
Correspondence: Marie-Pierre Moizard, Unit´e de G´en´etique, Hˆopital
Bretonneau, 2boulevard Tonnell´e, 37044Tours Cedex, France. Tel:
+33 2 4747 4799; Fax: +33247 61 8256; E-mail: moizard —m@lemel.fr
Received 23 July 1999; revised 25 February 2000; accepted
1 March 2000
European Journal of Human Genetics (2000) 8, 552–556
y
© 2000 Macmillan Publishers Ltd All rights reserved 1018–4813/00 $15.00
www.nature.com/ejhg

together, these findings suggest that: (i) the cognitive impair-
ment in some DMD patients may be related to dysfunction of
certain brain DMD isoforms, and (ii) the degree of mental
retardation might be related to the location of the mutation
in the gene. It seems that the degree of cognitive impairment
is more severe when the mutation is more distal.
To support this last hypothesis, we screened for point
mutations in the Dp71 coding sequence in a group of
12DMD patients without detectable deletion or duplication
in the whole dystrophin cDNA sequence. Seven of the
12patients were included in our previous study
16
but were
not screened for Dp71 point mutations (patients 7, 11, 13, 22,
43, 44, 48) (Table1). We report here four nonsense mutations
and one splice mutation that were all detected in five severely
neuropsychologically impaired patients. Results of semi-
quantitative analysis performed to compare Dp71 transcript
amount in mentally retarded patients, some with nonsense
mutations and other with no Dp71 mutation, are also
reported.
Materials and methods
Patients
After informed consent, all 12patients were diagnosed on
clinical features, progression of the disease, family history,
markedly raised serum creatine kinase level and, when
performed, absence of dystrophin on muscle biopsy.
When patients could be tested, evaluation of cognitive
abilities included verbal (VIQ) and visuospatial (PIQ) intelli-
gence assessment (WISC-R scale) and/or reading skills assess-
ment (Alouette test), as previously described.
16
Deletion and duplications screening had been performed
both by multiplex PCR assays and Southern blotting covering
the whole cDNA dystrophin sequence.
16
Dp71 transcript analysis
Dp71 transcript analysis was performed on total RNA isolated
from lymphoblastoid cells. In brief, 5µg of total RNA were
reverse transcribed into cDNA using 100pmol of random
hexamers and 200U of Superscript reverse transcriptase (Life
Technologies, Inchinnan, UK) in 200µl of buffer containing
1m
M
of each dNTP and 20U of RNAsin (Promega, Madison,
WI, USA). An exogenous sample of reference RNA (50ng of
total rat liver RNA) was added as a source of internal standard
for semi-quantitative Dp71 analysis.
The Dp71 transcript was analysed qualitatively by PCR
amplification on 20µl of the cDNA sample, as previously
described.
16
PCR-amplified Dp71 cDNA was electrophoresed
through 2% agarose gel and showed two bands of 2.1kb and
1.8kb, respectively. The latter band results from alternative
splicing of exons71 to 74. For each patient, the full-length
top band was extracted from the gel and purified using the
gel Extraction kit (Qiagen, Hilden, Germany). Direct
sequencing was performed using the ABI PRISM dye termi-
nator cycle sequencing system (Perkin Elmer, Warrington,
UK) (primers used for sequencing are available on request).
The product from the sequencing reaction was analysed
using a 4.25% denaturing polyacrylamide gel with a fluores-
cent DNA sequencer (ABI PRISM377 DNA Sequencer, Perkin
Elmer). Data were analysed automatically. RT-PCR was per-
formed twice when a mutation was found.
For semi-quantitative Dp71 analysis, PCR was performed
on 10µl of the cDNA sample with 50 pmol of a forward
primer identical to a sequence of the specific exon of Dp71
(as above), and 50pmol of a reverse primer spanning
nucleotides 9461–9482 in dystrophin cDNA, and on 50pmol
of two primers specific for rat liver L-type pyruvate kinase
transcript (LPK1: AAGCAACGTAGCAGCATGGAA and LPK2:
GGGTCAGTTGAGCCACACTCG). The cycling conditions
used were 94°C (1min), 58°C (1 min), and 72°C (1min) for
17cycles. The final PCR products were Southern blotted and
hybridised using an internal 5' labelled oligonucleotide probe
(CTTGCAGCCATGAGGGAACA) for Dp71 transcript and 5'
labelled primer LPK1 for rat liver pyruvate kinase
transcript.
Table 1 Summary of data on the 12 patients
Cognitive phenotype
Patients Age at studyaDystrophin analysis VIQ PIQ Reading Agea
7 14.6 –b50 58 no
11 11.1 – 110 110 12.5
13 13.3 negative 69 99 7.8
22 14 – 92 92 7
43 14.1 negative 74 80 7.11
44 13.9 negative 82 72 10.7
48 12 – untestable
53 15 – – – no
69 17.9 negative 46 59 no
70 16 – 45 – –
74 9.5 negative untestable
367 17.6 negativec––no
aAge in years, months; bData not available; cWeak signal has been detected by western blot.
Dp71 DMD isoform and cognitive impairment
M-P Moizard et al
y
553
European Journal of Human Genetics

Exon66 analysis
Exon66 and its intronic boundaries were amplified and
sequenced with specific primers (Leiden Muscular Dystrophy
pages, web information) from 200ng of patient 69 genomic
DNA.
Results and discussion
Table2 summarizes the five sequence changes observed in
the Dp71 coding sequence. All are translation termination
mutations. Four of them are mutations of an arginine CGA
codon corresponding to mutations at CpG sites, which are
preferential sites for nonsense mutations
17
and have already
been described
18,19
(Leiden Muscular Dystrophy pages, web
information). The fifth is a mutation in the splice donor site
of intron66. Analysis of Dp71 mRNA from patient 69 by
RT-PCR showed an abnormal pattern of migration (Figure1).
Two slightly smaller products than the predicted bands were
detected. Sequence analysis of the top band revealed a 85bp
deletion corresponding to absence of exon66 in the cDNA.
This data was suggestive of an mRNA splicing defect. Exon 66
and its intronic boundaries were amplified from genomic
DNA of patient69 and controls. Direct sequencing showed a
G to A substitution at position + 1 of the 5' donor site in
intron66. This mutation affects pre-mRNA maturation, lead-
ing to exon66 skipping. The loss of exon 66 shifts the open
reading frame, and thus introduces a termination codon at
nucleotide position9895 in exon 67. To the best of our
knowledge this is a newly reported mutation.
These five chain terminating mutations are predicted to
affect full-length muscle and brain type 427 kDa dystrophins,
either by truncation or by reduction of mRNA, or both, and
should be considered causative of muscular disease.
2
In
addition, Dp71 might also be affected by truncation, proba-
bly leading to disruption of its function.
No mutation in Dp71 transcript was found in the five
mildly or not retarded patients of this group (VIQ ≥70, with
delayed or correct reading acquisition). The five patients with
a mutation were among the seven severely mentally retarded
patients (VIQ ≤50 and/or no reading acquisition or global
mental deficiency). No mutation was found in Dp71 coding
region in two patients (7 and 48) with severe cerebral
dysfunction. Semi-quantitative analysis of Dp71 transcript
by RT-PCR was performed to compare Dp71 transcript
amount in these two patients with respect to patients with
nonsense mutations and control (Figure2). As usually
observed,
20
a noticeable reduction in the level of Dp71
mRNA was observed in patients with a stop codon
(patients70 and 74). A similar reduction, indicative of an
unstable mRNA and potentially in accordance with the
psychometric phenotype, was observed for patient7. It is
possible that a mutation, located either in Dp71 regulatory
sequences or in the polyadenylation region of the transcript
and which could explain the low level of mRNA, has not
been detected in this patient. For patient48, we found no
Table 2 Mutations detected
Patient Exon Nucleotide change Amino acid change
74 66 C 9776->T Arg 3190->Stop
367 66 C 9776->T Arg 3190->Stop
69 66 9857+1G->A Thr 3188->fs
53 69 C 10241->T Arg 3345->Stop
70 70 C 10379->T Arg 3391->Stop
fs: frameshift.
Figure1 Characterisation of the 9857 + 1G -> A mutation: aautoradiograph of Southern blot of the cDNA amplified products
from a control and from patient69. Dp 71 specific primer and a primer located in the 3' untranslated region of the dystrophin mRNA
(nucleotides11519–11541) were used for amplification. Hybridisation was performed with a
32
P dCTP-labelled dystrophin cDNA
probe covering exons53 to 65; bSplicing pattern in patient 69. Exons are shown as boxes. Partial sequence of exon66 (capitals)
and its intronic 5' boundaries (lower case) amplified from the genomic DNA of patient69 reveals a G -> A substitution at the junction
exon66–intron 66.
Dp71 DMD isoform and cognitive impairment
y
M-P Moizard et al
554
European Journal of Human Genetics

evidence of unstable Dp71 transcript which could explain his
intellectual disabilities. A Dp71 mutation, located outside the
region pinpointed by the PCR primers and without any effect
on Dp71 expression, could have been missed. However, a
mutation outside the Dp 71 region cannot be excluded in this
case.
Finally, these results tend to confirm that mutations
leading to premature translation termination in the Dp71
coding sequence are preferentially associated with severe
mental retardation. Mutations in the distal part of the gene
are likely to be associated with a loss of all isoforms expressed
in the brain (including 427kDa brain isoforms) and that
could explain why these patients have a particularly severe
cognitive phenotype. Therefore, distal mutations seem to be
more deleterious for brain function than proximal mutations
which lead only to a loss of cerebral and cerebellar dystro-
phins. Among 19point mutations reported to date in the
Dp71 region in DMD patients with a known cognitive
phenotype, 16 were indeed found in mentally retarded
patients.
14,15,18,19,21–28
Only three mutations were found in
patients of normal intelligence.
14,27,29
Two were located in
exon74 which is alternatively spliced in brain dystrophin
isoforms,
30
and one in exon79 which corresponds to the 3'
untranslated region.
Although some of the mutations described here have
already been reported, their associated cognitive phenotype
has not been described. This study in fact adds five point
mutations in exons62–79 associated with mental
retardation.
Why the loss or alteration of Dp71 protein should be
deleterious for cognitive function is unknown. Transgenic
mice experiments have shown that Dp71 cannot replace the
function of full-length dystrophin and correct the muscle
defect, although it does restore the DAP complex.
31
These
results suggest that although Dp71 and dystrophin may
interact with the same proteins they have distinct functions.
Greenberg et al
32
also demonstrated that mutant Dp71
deficient mice have a reduced level of DAP and conclude that
Dp71 plays a role in the function or organisation of the DAP
complex in the brain. It has been demonstrated that
dystroglycan (a member of the DAP complex) and Dp71
mRNAs, are co-located in some regions of the brain involved
in certain cognitive processes.
33,34
The early and gradually
increased levels of Dp71 in the normal embryonic forebrain
persisting to adulthood suggest its fundamental role during
the development of the nervous system,
35
indicating that
lack of Dp71 could impair cognitive function.
In conclusion, this study is consistent with previous
findings concerning the association between cognitive disa-
bilities and the presence of mutation in the specific Dp71
region in DMD patients. The systematic screening of point
mutations in the gene is hindered by the size and complexity
of the dystrophin gene. However, direct detection of the
mutation in probands provides the basis of accurate genetic
counselling of DMD families. This study indeed demon-
strates that severe cognitive impairment is good clinical
evidence to suggest searching for point mutations in the
Dp71 region in DMD patients with no detectable deletion or
duplication.
Acknowledgements
The authors are grateful to the patients for their collaboration and to
the physicians of medical centres for providing blood samples and
clinical data from patients. We thank N Ronce and C Antar for their
contribution to this work. S Briault and B Jauffrion for the
lymphoblastoid cell lines and D Raine for her help in translation of the
manuscript. This study was supported by grants from the Association
Fran¸caise contre les Myopathies (AFM).
Figure2 Expression of Dp71 transcript in DMD patients: autoradiograph of a Southern blot of the amplified cDNA products
obtained after 17cycles. The arrows indicate the size of the specific amplified fragments: 130 bp for Dp71 transcript, 67bp for
internal standard rat liver pyruvate–kinase transcript. Hybridisation was performed with an internal 5' radio-labelled oligonucleotide
probe for Dp71 transcript and 5' radio-labelled LPK1 primer for rat liver pyruvate–kinase transcript.
Dp71 DMD isoform and cognitive impairment
M-P Moizard et al
y
555
European Journal of Human Genetics

References
1 Koenig M, Hoffman EP, Bertelson CJ, Monaco AP, Feener C,
Kunkel LM: Complete cloning of the Duchenne Muscular dys-
trophy (DMD) cDNA and preliminary genomic organization of
the DMD gene in normal and affected individuals. Cell 1987; 50:
509–517.
2 Roberts RG, Gardner R, Bobrow M: Searching for the 1 in
2,400,000: a review of dystrophin gene point mutations. Hum Mut
1994; 4: 1–11.
3 Lidov HGW, Byers J, Watkins SC, Kunkel LM: Localization of
dystrophin to postsynaptic regions of central nervous system
cortical neurons. Nature 1990; 348: 725–727.
4 Gorecki DC, Monaco AP, Derry JMJ, Walker AP, Barnard EA,
Barnard PJ: Expression of four alternative dystrophin transcripts
in brain regions regulated by different promoters. Hum Mol Genet
1992; 1: 505–510.
5 Lidov HGW, Selig S, Kunkel LM: Dp140: a novel 140kDa CNS
transcript from the dystrophin locus. Hum Mol Genet 1995; 4:
329–335.
6 Bar S, Barnea E, Levy Z, Neuman S, Yaffe D, Nudel U: A novel
product of the Duchenne muscular dystrophy gene which greatly
differs from the known isoforms in its structure and tissue
distribution. Biochem J 1990; 272: 557–560.
7 Hugnot JP, Gilgenkrantz H, Vincent N et al: Distal transcript of the
dystrophin gene initiated from an alternative first exon and
encoding a 75-kDa protein widely distributed in non muscle
tissues. Proc Natl Acad Sci USA 1992; 89: 7506–7510.
8 Ervasti JM, Campbell KP: Membrane organization of the dystro-
phin–glycoprotein complex. Cell 1991; 66: 1121–1131.
9 Billard C, Gillet P, Signoret JL et al: Cognitive functions in
Duchenne muscular dystrophy: a reappraisal and comparison
with spinal muscular atrophy. Neuromusc Disord 1992; 2:
371–378.
10 Rapaport D, Passos-Bueno MR, Brandao L, Love D, Vainzof M,
Zatz M: Apparent association of mental retardation and specific
patterns of deletions screened with probes cf56a and cf23a in
Duchenne muscular dystrophy. Am J Med Genet 1991; 39:
437–441.
11 Hodgson SV, Abbs S, Clark S et al: Correlation of clinical and
deletion data in Duchenne and Becker muscular dystrophy, with
special reference to mental ability. Neuromusc Disord 1992; 2:
269–276.
12 Bushby K, Appleton R, Anderson LVB, Welch JL, Kelly P, Gardner-
Medwin D: Deletion status and intellectual impairment in
Duchenne muscular dystrophy. Dev Med Child Neurol 1995; 37:
260–269.
13 Bardoni A, Sironi M, Felisari G, Comi G, Bresolin N: Absence of
brain Dp140 isoform and cognitive impairment in Becker mus-
cular dystrophy. Lancet 1999; 353: 897–898.
14 Lenk U, Hanke R, Thiele H, Speer A: Point mutations at the
carboxy terminus of the human dystrophin gene: Implications for
an association with mental retardation in DMD patients. Hum Mol
Genet 1993; 2: 1877–1881.
15 Tuffery S, Lenk U, Roberts RG, Coubes C, Demaille J, Claustres M:
Protein truncation test: Analysis of two novel point mutations at
the carboxy-terminus of the human dystrophin gene associated
with mental retardation. Hum Mut 1995; 6: 126–135.
16 Moizard MP, Billard C, Toutain A, Berret F, Marmin N, Moraine C:
Are Dp71 and Dp140 brain dystrophin isoforms related to
cognitive impairment in Duchenne muscular dystrophy? Am J
Med Genet 1998; 80: 32–41.
17 Akalin N, Zietkiewicz E, Makalowski W, Labuda D: Are CpG sites
mutation hot spots in the dystrophin gene? Hum Mol Genet 1994;
3: 1425–1426.
18 Barbieri AM, Soriani N, Ferlini A, Michelato A, Ferrari M, Carrera
P: Seven novel additional small mutations and a new alternative
splicing in the human dystrophin gene detected by heteroduplex
analysis and restricted RT-PCR heteroduplex analysis of illegit-
imate transcripts. Eur J Hum Genet 1996; 4: 183–187.
19 Tuffery S, Chambert S, Bareil C et al: Mutation analysis of the
dystrophin gene in Southern French DMD or BMD families: from
Southern blot to protein truncation test. Hum Genet 1998; 102:
334–342.
20 McIntosh I, Hamosh A, Dietz H: Nonsense mutations and
diminished mRNA levels. Nat Genet 1993; 4: 219.
21 Roberts RG, Bobrow M, Bentley DR: Point mutations in the
dystrophin gene. Proc Natl Acad Sci USA 1992; 89: 2331–2335.
22 Lenk U, Oexle K, Voit T et al: A cystein3340 substitution in the
dystroglycan-binding domain of dystrophin associated with
Duchenne muscular dystrophy, mental retardation and absence
of the ERG b-wave. Hum Mol Genet 1996; 5: 973–975.
23 Tsukamoto H, Inui K, Matsuoka T, Yanagihara I, Fukushima H,
Okada S: One base deletion in the cysteine-rich domain of the
dystrophin gene in Duchenne muscular dystrophy patients. Hum
Mol Genet 1994; 3: 995–996.
24 Comi GP, Ciafaloni E, Rohan de Silva HA et al: A G
+1
->A
transversion at the 5' splice site of intron 69 of the dytrophin gene
causing the absence of peripheral nerve Dp116 and severe clinical
involvement in a DMD patient. Hum Mol Genet 1995; 4:
2171–2174.
25 Gardner RJ, Bobrow M, Roberts RG: The identification of point
mutations in Duchenne muscular dystrophy patients by using
reverse-transcription PCR and the protein truncation test. Am J
Hum Genet 1995; 57: 311–320.
26 Roest PAM, Bout M, van der Tuijen AC et al: Splicing mutations in
DMD/BMD detected by RT-PCR/PTT: detection of a 19aa insertion
in the cysteine rich domain of dystrophin compatible with BMD.
J Med Genet 1996; 33: 935–939.
27 Lasa A, Gallano P, Baiget M: Three novel point mutations in the
dystrophin gene in DMD patients. Hum Mut 1997; 9: 473–474.
28 Cau M, Cao A, Loi D et al: Two novel mutations (10410 T- > G;
10296delC) at carboxy-terminus of the dystrophin gene asso-
ciated with mental retardation. Hum Mut 1998; 12: 70–73.
29 Nigro V, Nigro G, Esposito MG et al: Novel small mutations along
the DMD/BMD gene associated with different phenotypes. Hum
Mol Genet 1994; 3: 1907–1908.
30 Bies RD, Phelps SF, Cortez MD, Roberts R, Caskey CT, Chamber-
lain JS: Human and murine dystrophin mRNA transcripts are
differentially expressed during skeletal muscle, heart, and brain
development. Nucleic Acids Res 1992; 20: 1725–1731.
31 Greenberg DS, Sunada Y, Campbell KP, Yaffe D, Nudel U:
Exogenous Dp71 restores the levels of dystrophin associated
proteins but does not alleviate muscle damage in mdx mice. Nat
Genet 1994; 8: 340–344.
32 Greenberg DS, Schatz Y, Levy Z, Pizzo P, Yaffe D, Nudel U: Reduced
levels of dystrophin associated proteins in the brains of mice
deficient for Dp71. Hum Mol Genet 1996; 5: 1299–1303.
33 Gorecki DC, Derry JMJ, Barnard EA: Dystroglycan: brain local-
isation and chromosome mapping in the mouse. Hum Mol Genet
1994; 3: 1589–1597.
34 Gorecki DC, Barnard E: Specific expression of G-dystrophin
(Dp71) in the brain. NeuroReport 1995; 6: 893–896.
35 Sarig R, Mezger-Lallemand V, Gitelman I et al: Targeted inactiva-
tion of Dp71, the major non-muscle product of the DMD gene:
differential activity of the Dp71 promoter during development.
Hum Mol Genet 1999; 8: 1–10.
Dp71 DMD isoform and cognitive impairment
y
M-P Moizard et al
556
European Journal of Human Genetics